Comprehensive Hematology Panel
Test code: HE0101
Is a 253 gene panel that includes assessment of non-coding variants.
Offers comprehensive genetic diagnostics for a broad range of hematological disorders varying from bone marrow failure to specific disorders affecting different cell populations or factors involved in hemostasis.
Is not recommended for patients suspected to have anemia due to alpha-thalassemia (HBA1 or HBA2). These genes are highly homologous reducing mutation detection rate due to challenges in variant call and difficult to detect mutation profile (deletions and gene-fusions within the homologous genes tandem in the human genome).
Is not recommended for patients with a suspicion of severe Hemophilia A if the common inversions are not excluded by previous testing. An intron 22 inversion of the F8 gene is identified in 43%-45% individuals with severe hemophilia A and intron 1 inversion in 2%-5% (GeneReviews NBK1404; PMID:8275087, 8490618, 29296726, 27292088, 22282501, 11756167). This test does not detect reliably these inversions.
About inherited hematological diseases
Inherited hematological diseases are a group of blood disorders with variable clinical presentation. Depending on the underlying defect and the affected hematological cell population, the symptoms can vary from bleeding disorders to severe anemia or may cause significant immunosuppression. Furthermore, the inherited defects in coagulopathy may also cause thrombophilia increasing the risk of thrombosis even in childhood. All genetic defects presenting with bone marrow failure lead to severe immunosuppression possibly necessitating stem cell transplantation. Patients with inherited bone marrow failure syndromes have a high risk of developing cancer, either leukemia or solid tumors. The role of genetic diagnostics in inherited hematological diseases is essential. Currently, accurate genetic diagnosis is necessary to confirm the diagnosis of certain hematological diseases and guide their optimal treatment.
Availability
4 weeks
Gene Set Description
Genes in the Comprehensive Hematology Panel and their clinical significance Gene Associated phenotypes Inheritance ClinVar HGMD
ABCA3 Interstitial lung disease, Surfactant metabolism dysfunction, AR 11 287 pulmonary
ABCB7 Anemia, sideroblastic, and spinocerebellar ataxia XL 8 9
ABCG5 Sitosterolemia AR 13 42
ABCG8 Sitosterolemia AR 18 44
ACD Dyskeratosis congenita, autosomal dominant 6, Dyskeratosis AD/AR 2 8 congenita, autosomal recessive 7
ACTB* Baraitser-Winter syndrome AD 55 60
ACTN1 Bleeding disorder, platelet- AD 7 25
https://blueprintgenetics.com/ ADAMTS13 Schulman-Upshaw syndrome, Thrombotic thrombocytopenic purpura, AR 30 183 familial
AK1 Adenylate kinase deficiency, hemolytic anemia due to AR 8 10
AK2 Reticular dysgenesis AR 14 17
ALAS2 Anemia, sideroblastic, Protoporphyria, erythropoietic XL 27 103
AMN Megaloblastic anemia-1, Norwegian AR 29 34
ANK1 Spherocytosis AD/AR 20 105
ANKRD26 Thrombocytopenia AD 6 21
AP3B1 Hermansky-Pudlak syndrome AR 14 34
AP3D1 Hermansky-Pudlak syndrome 10 AR 1 4
ARPC1B Platelet abnormalities with eosinophilia and immune-mediated AR 2 4 inflammatory disease
ATM Breast cancer, Ataxia-Telangiectasia AD/AR 1047 1109
ATR Cutaneous telangiectasia and cancer syndrome, Seckel syndrome AD/AR 10 33
ATRX Carpenter-Waziri syndrome, Alpha-thalassemia/mental retardation XL 65 165 syndrome, Holmes-Gang syndrome, Juberg-Marsidi syndrome, Smith- Fineman-Myers syndrome, Mental retardation-hypotonic facies syndrome
BLM Bloom syndrome AR 152 119
BLOC1S3 Hermansky-Pudlak syndrome AR 2 4
BLOC1S6 Hermansky-Pudlak syndrome AR 1 2
BRAF* LEOPARD syndrome, Noonan syndrome, Cardiofaciocutaneous AD 134 65 syndrome
BRCA1* Pancreatic cancer, Breast-ovarian cancer, familial AD 2997 2631
BRCA2 Fanconi anemia, Medulloblastoma, Glioma susceptibility, Pancreatic AD/AR 3369 2659 cancer, Wilms tumor, Breast-ovarian cancer, familial
BRIP1 Fanconi anemia, Breast cancer AD/AR 238 189
C15ORF41 Congenital dyserythropoietic anemia AR 3 3
CBL Noonan syndrome-like disorder with or without juvenile AD 24 43 myelomonocytic leukemia
CDAN1 Anemia, dyserythropoietic congenital AR 12 61
CDC42 Takenouchi-Kosaki syndrome, Noonan-syndrome like phenotype AD 11 9
CDKN2A Melanoma, familial, Melanoma-pancreatic cancer syndrome AD 87 232
CEBPA Acute myeloid leukemia, familial AD 15 13
CLCN7 Osteopetrosis AD/AR 15 98
https://blueprintgenetics.com/ CLPB 3-methylglutaconic aciduria with cataracts, neurologic involvement, AR 26 25 and neutropenia (MEGCANN)
CSF2RA* Surfactant metabolism dysfunction, pulmonary XL 2 17
CSF3R Neutrophilia, hereditary AD 13 13
CTC1 Cerebroretinal microangiopathy with calcifications and cysts AR 21 33
CTSC Periodontitis, juvenile, Haim-Munk syndrome, Papillon-Lefevre AR 19 92 syndrome
CUBN* Megaloblastic anemia-1, Finnish AR 42 53
CXCR4 Warts, hypogammaglobulinemia, infections, and myelokathexis AD 5 15 (WHIM) syndrome
CYB5R3 Methemoglobinemia due to methemoglobin reductase deficiency AR 21 71
CYCS* Thrombocytopenia AD 2 3
DDX41 Familial myeloproliferative/lymphoproliferative neoplasms, multiple AD 9 21 types, susceptibility to
DHFR* Megaloblastic anemia due to dihydrofolate reductase deficiency AR 2 5
DKC1 Hoyeraal-Hreidarsson syndrome, Dyskeratosis congenita XL 48 74
DNAJC21 Bone marrow failure syndrome 3 AR 5 11
DNASE2 Primary immunodeficiency 2
DTNBP1 Hermansky-Pudlak syndrome AR 2 3
EFL1 Shwachman-Diamond syndrome 3 2
EGLN1* Hemoglobin, high altitude adapation AD 3 64
ELANE Neutropenia AD 43 217
EPAS1 Erthyrocytosis, familial 4 AD 3 30
EPB41 Ellipsocytosis 1 AR 6 12
EPB42 Spherocytosis AR 8 17
EPCAM Diarrhea 5, with tufting enteropathy, congenital, Colorectal cancer, AD/AR 38 80 hereditary nonpolyposis
EPOR Erythrocytosis, familial, 1 AD 4 32
ERCC4 Fanconi anemia, Xeroderma pigmentosum, XFE progeroid syndrome AR 13 70
ERCC6L2 Bone marrow failure syndrome 2 AR 4 9
ETV6 Thrombocytopenia 5 AD 10 38
F10 Factor X deficiency AR 15 155
F11 Factor XI deficiency AD/AR 77 271
https://blueprintgenetics.com/ F12 Angioedema, Factor XII deficiency AD/AR 7 53
F13A1 Factor XIIIA deficiency AR 20 180
F13B Factor XIIIB deficiency AR 4 18
F2 Thrombophilia due to thrombin defect, Prothrombin deficiency, AD/AR 14 66 congenital
F5 Factor V deficiency, Thrombophilia due to activated protein C AD/AR 19 157 resistance
F7 Factor VII deficiency AR 27 322
F8* Hemophilia A XL 296 3205
F9 Hemophilia B, Warfarin sensitivity, Thrombophilia, due to factor IX XL 117 1281 defect
FADD Infections, recurrent, with encephalopathy, hepatic dysfunction, and AR 2 1 cardiovascular malformations
FANCA Fanconi anemia AR 191 677
FANCB Fanconi anemia XL 11 21
FANCC Fanconi anemia AR 94 64
FANCD2* Fanconi anemia AR 21 61
FANCE Fanconi anemia AR 4 17
FANCF Fanconia anemia AR 7 16
FANCG Fanconi anemia AR 16 92
FANCI Fanconi anemia AR 13 45
FANCL Fanconi anemia AR 13 24
FANCM Fanconi anemia AR 6 50
FAS Autoimmune lymphoproliferative syndrome AD/AR 31 133
FASLG Autoimmune lymphoproliferative syndrome, type IB AD 2 10
FGA Afibrinogenemia, congenital, Dysfibrinogenemia, congenital, AD/AR 10 144 Hypodysfibrinogenemia, congenital, Familial visceral amyloidosis
FGB Afibrinogenemia, congenital, Dysfibrinogenemia, congenital, AD/AR 6 92 Hypodysfibrinogenemia, congenital
FGG Afibrinogenemia, congenital, Hypodysfibrinogenemia, AD/AR 7 127 Dysfibrinogenemia, congenital, Hypodysfibrinogenemia, congenital
FLI1 Thrombocytopenia, Paris-Trousseau type, Bleeding disorder, platelet AD 7 7 type 21
FLNA Frontometaphyseal dysplasia, Osteodysplasty Melnick-Needles, XL 133 257 Otopalatodigital syndrome type 1, Otopalatodigital syndrome type 2, Terminal osseous dysplasia with pigmentary defects
https://blueprintgenetics.com/ FYB Thrombocytopenia 3 AR 2 2
G6PC3 Neutropenia, severe congenital, Dursun syndrome AR 11 37
G6PD Glucose-6-phosphate dehydrogenase deficiency XL 45 226
GATA1 Anemia, without thrombocytopenia, Thrombocytopenia with beta- XL 21 15 thalessemia,, Dyserythropoietic anemia with thrombocytopenia
GATA2 Myelodysplastic syndrome, Chronic neutropenia associated with AD 30 142 monocytopenia, evolving to myelodysplasia and acute myeloid leukemia, Acute myeloid leukemia, Emberger syndrome, Immunodeficiency
GBA* Gaucher disease AR 84 488
GCLC Gamma-glutamylcysteine synthetase deficiency AR 2 7
GFI1 Neutropenia, severe congenital, 2 autosomal dominant, Neutropenia, AD 2 6 nonimmune chronic idiopathic, of adults
GFI1B Bleeding disorder, platelet-type, 17 AD 6 9
GGCX Pseudoxanthoma elasticum-like disorder with multiple coagulation AD/AR/Digenic 13 42 factor deficiency, Vitamin K-dependent clotting factors, combined deficiency
GINS1 Immunodeficiency AR 4 4
GP1BA Pseudo-von Willebrand disease, Bernard-Soulier syndrome AD/AR 9 73
GP1BB Giant platelet disorder, isolated, Bernard-Soulier syndrome AD/AR 5 53
GP9 Bernard-Soulier syndrome AR 6 42
GPI Hemolytic anemia, nonspherocytic due to glucose phosphate AR 11 41 isomerase deficiency
GPR143 Nystagmus, congenital, Ocular albinism XL 22 181
GSS Glutathione synthetase deficiency AR 8 38
HAX1 Neutropenia, severe congenital AR 11 21
HBA1* Alpha-thalassemia (Hemoglobin Bart syndrome), Alpha-thalassemia AR/Digenic 27 214 (Hemoglobin H disease)
HBA2*,# Alpha-thalassemia (Hemoglobin Bart syndrome), Alpha-thalassemia AR/Digenic 44 290 (Hemoglobin H disease)
HBB Sickle cell disease, Thalassemia-beta, dominant inclusion body, Other AD/AR/Digenic 242 865 Thalassemias/Hemoglobinopathies, Beta-thalassemia, Hereditary persistence of fetal hemogoblin
HFE Hemochromatosis AR/Digenic 11 56
HOXA11 Radioulnar synostosis with amegakaryocytic thrombocytopenia AD 1 1
HPS1* Hermansky-Pudlak syndrome AR 28 55
HPS3* Hermansky-Pudlak syndrome AR 10 17
https://blueprintgenetics.com/ HPS4 Hermansky-Pudlak syndrome AR 16 22
HPS5 Hermansky-Pudlak syndrome AR 20 31
HPS6 Hermansky-Pudlak syndrome AR 13 37
HRAS Costello syndrome, Congenital myopathy with excess of muscle AD 43 31 spindles
IFNGR2 Immunodeficiency AR 4 18
IKZF1# Immunodeficiency, common variable, 13 AD 10 35
ITGA2 Fetal and neonatal alloimmune thrombocytopenia AD/AR 5
ITGA2B Glanzmann thrombasthenia AD/AR 22 234
ITGB3 Bleeding disorder, platelet-, Thrombocytopenia, neonatal alloimmune, AD/AR 18 165 Glanzmann thrombasthenia
ITK Lymphoproliferative syndrome AR 4 11
JAGN1 Neutropenia, severe congenital AR 8 8
JAK2 Thrombocythemia 3 AD 12 22
KIF23 Anemia, dyserythropoietic congenital AD 1 3
KLF1 Anemia, dyserythropoietic congenital, Blood group, Lutheran AD/BG 16 45 inhibitor, Hereditary persistence of fetal hemoglobin
KRAS* Noonan syndrome, Cardiofaciocutaneous syndrome AD 63 35
LAMTOR2 Immunodeficiency due to defect in MAPBP-interacting protein AR 1 1
LMAN1 Combined factor V and VIII deficiency AR 5 37
LPIN2 Majeed syndrome AR 12 14
LYST* Chediak-Higashi syndrome AR 50 97
MAGT1 Immunodeficiency, with magnesium defect, Epstein-Barr virus XL 8 14 infection and neoplasia, Mental retardation, X-linked 95
MAP2K1 Cardiofaciocutaneous syndrome AD 45 23
MAP2K2 Cardiofaciocutaneous syndrome AD 21 35
MASTL Thrombocytopenia AD 5
MCFD2 Factor V & Factor VIII, combined deficiency of AR 8 20
MECOM Radioulnar synostosis with amegakaryocytic thrombocytopenia 2 AD 3 27
MKL1 Primary immunodeficiency AR 4
MLH1 Muir-Torre syndrome, Endometrial cancer, Mismatch repair cancer AD/AR 873 1191 syndrome, Colorectal cancer, hereditary nonpolyposis
MPL Thrombocythemia, Amegakaryocytic thrombocytopenia AD/AR 23 55
https://blueprintgenetics.com/ MSH2 Muir-Torre syndrome, Endometrial cancer, Colorectal cancer, AD/AR 933 1249 hereditary nonpolyposis,, Mismatch repair cancer syndrome
MSH6 Endometrial cancer, Mismatch repair cancer syndrome, Colorectal AD/AR 672 586 cancer, hereditary nonpolyposis
MTHFD1 Severe combined immunodeficiency AR 9 11
MTR Methylmalonic acidemia AR 13 43
MYH9 Sebastian syndrome, May-Hegglin anomaly, Epstein syndrome, AD 25 117 Fechtner syndrome, Macrothrombocytopenia and progressive sensorineural deafness, Deafness, autosomal dominant 17
MYO5A Griscelli syndrome AR 7 9
NBEAL2 Gray platelet syndrome AR 10 51
NBN Breast cancer, Nijmegen breakage syndrome AD/AR 188 97
NF1* Watson syndrome, Neurofibromatosis, Neurofibromatosis-Noonan AD 1157 2901 syndrome
NHP2 Dyskeratosis congenita AR 5 3
NOP10 Dyskeratosis congenita AR 1 1
NRAS Noonan syndrome AD 31 14
NT5C3A Uridine 5-prime monophosphate hydrolase deficiency, hemolytic AR 10 28 anemia due to
OCA2 Albinism, brown oculocutaneous, Albinism, oculocutaneous, AR 43 310 Skin/hair/eye pigmentation
P2RY12 Bleeding disorder, platelet- AD/AR 4 13
PALB2 Fanconi anemia, Pancreatic cancer, Breast cancer AD/AR 495 406
PARN* Pulmonary fibrosis and/or bone marrow failure, Dyskeratosis AD/AR 15 29 congenita
PAX5 Pre-B cell acute lymphoblastic leukemia AD 7
PC Pyruvate carboxylase deficiency AR 32 41
PDHA1 Leigh syndrome, Pyruvate dehydrogenase E1-alpha deficiency XL 66 192
PDHX Pyruvate dehydrogenase E3-binding protein deficiency AR 14 22
PGM3 Immunodeficiency 23 AR 14 15
PIEZO1 Dehydrated hereditary stomatocytosis, Lympehedema, hereditary III AD/AR 23 60
PKLR Pyruvate kinase deficiency, Elevation of red blood cell ATP levels, AD/AR 17 277 familial
PMS2* Mismatch repair cancer syndrome, Colorectal cancer, hereditary AD/AR 319 342 nonpolyposis
https://blueprintgenetics.com/ PRF1 Lymphoma, non-Hodgkin, Aplastic anemia, adult-onset, AR 24 183 Hemophagocytic lymphohistiocytosis
PRKACG Bleeding disorder, platelet-type, 19 AR 1 1
PROC Thrombophilia, hereditary AD/AR 36 387
PROS1* Thrombophilia, hereditary AD/AR 23 416
PTPN11 Noonan syndrome, Metachondromatosis AD 135 140
PUS1 Mitochondrial myopathy and sideroblastic anemia AR 7 9
RAB27A Griscelli syndrome, Elejalde syndrome AR 18 54
RAC2 Neutrophil immunodeficiency syndrome AD 2 3
RAD51C Fanconi anemia, Breast-ovarian cancer, familial AD/AR 107 125
RASGRP2 Bleeding disorder, platelet-type, 18 AR 3 20
RBM8A*,# Thrombocytopenia - absent radius AD/AR 5 12
RECQL4 Baller-Gerold syndrome, RAPADILINO syndrome, Rothmund- AR 82 114 Thomson syndrome
REN Hyperuricemic nephropathy, Hyperproreninemia, familial, Renal AD/AR 9 18 tubular dysgenesis
RHAG Overhydrated hereditary stomatocytosis, Anemia, hemolytic, Rh-null, AD/AR/BG 13 28 regulator type, Anemia, hemolytic,Rh-Mod type, RHAG blood group
RIT1 Noonan syndrome AD 23 26
RNF168 RIDDLE syndrome AR 4 5
RPL11 Diamond-Blackfan anemia AD 12 45
RPL15* Diamond-Blackfan anemia AD 2 2
RPL27 Diamond-Blackfan anemia 16 1 1
RPL31 Diamond-Blackfan anemia AD 2
RPL35A Diamond-Blackfan anemia AD 7 14
RPL5 Diamond-Blackfan anemia AD 19 77
RPS10 Diamond-Blackfan anemia AD 3 5
RPS19 Diamond-Blackfan anemia AD 23 172
RPS24 Diamond-Blackfan anemia AD 6 10
RPS26 Diamond-Blackfan anemia AD 10 33
RPS28 Diamond-Blackfan anemia 15 with mandibulofacial dysostosis AD 1 1
RPS29 Diamond-Blackfan anemia AD 4 4
RPS7 Diamond-Blackfan anemia AD 2 10
https://blueprintgenetics.com/ RTEL1 Pulmonary fibrosis and/or bone marrow failure, Dyskeratosis AD/AR 58 51 congenita
RUNX1 Platelet disorder, familial, with associated myeloid malignancy AD 47 101
SAMD9 Mirage syndrome, Tumoral calcinosis, normophosphatemic AD/AR 10 27
SAMD9L Ataxia-pancytopenia syndrome AD 4 16
SBDS* Aplastic anemia, Shwachman-Diamond syndrome, Severe AR 19 90 spondylometaphyseal dysplasia
SEC23B Anemia, dyserythropoietic congenital AR 18 121
SERPINC1 Antithrombin III deficiency AD/AR 44 412
SERPINF2 Alpha-2-plasmin inhibitor deficiency AD/AR 4 8
SFTPB Surfactant metabolism dysfunction, pulmonary AR 5 28
SFTPC Surfactant metabolism dysfunction, pulmonary AD 8 82
SH2D1A Lymphoproliferative syndrome XL 21 129
SLC11A2 Anemia, hypochromic microcytic, with iron overload AR 5 10
SLC19A2 Thiamine-responsive megaloblastic anemia syndrome AR 14 51
SLC25A38 Anemia, sideroblastic 2, pyridoxine-refractory AR 7 27
SLC37A4 Glycogen storage disease AR 49 113
SLC45A2 Skin/hair/eye pigmentation, Oculocutaneous albinism AD/AR 16 156
SLC46A1 Folate malabsorption AR 17 23
SLC4A1 Spherocytosis, Ovalcytosis, Renal tubular acidosis, distal, with AD/AR/BG 38 122 hemolytic anemia, Cryohydrocytosis, Acanthocytosis, Band 3 Memphis
SLFN14 Thrombocytopenia AD/AR 4 4
SLX4 Fanconi anemia AR 18 72
SMARCD2 Specific granule defiency 2 AR 3 1
SOS1 Noonan syndrome AD 44 71
SPTA1 Spherocytosis, Ellipsocytosis, Pyropoikilocytosis AD/AR 29 51
SPTB Spherocytosis, Anemia, neonatal hemolytic, Ellipsocytosis AD/AR 24 99
SRC Thrombocytopenia, autosomal dominant, 6 AD 2 1
SRP54 Shwachman-Diamond syndrome AD 3
SRP72* Bone marrow failure syndrome 1 AD 2 5
STX11 Hemophagocytic lymphohistiocytosis, familial AR 8 22
STXBP2 Hemophagocytic lymphohistiocytosis, familial AR 12 77
https://blueprintgenetics.com/ TBXA2R Bleeding disorder, platelet- AD 1 6
TCN2 Transcobalamin II deficiency AR 9 35
TERC Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, AD 42 73 telomere-related, Dyskeratosis congenita
TERT Aplastic anemia, Pulmonary fibrosis and/or bone marrow failure, AD/AR 48 156 telomere-related, Dyskeratosis congenita
TF Atransferrinemia AR 8 17
THBD Thrombophilia due to thrombomodulin defect, Hemolytic uremic AD 5 28 syndrome, atypical
THPO Thrombocythemia 1 AD 5 10
TINF2 Revesz syndrome, Dyskeratosis congenita AD 25 42
TMPRSS6 Iron-refractory iron deficiency anemia AR 13 102
TP53 Colorectal cancer, Li-Fraumeni syndrome, Ependymoma, intracranial, AD 393 505 Choroid plexus papilloma, Breast cancer, familial, Adrenocortical carcinoma, Osteogenic sarcoma, Hepatoblastoma, Non-Hodgkin lymphoma
TPI1 Triosephosphate isomerase deficiency AR 8 19
TRNT1 Retinitis pigmentosa and erythrocytic microcytosis, Sideroblastic AR 13 26 anemia with B-cell immunodeficiency, periodic fevers, and developmental delay
TUBB1 Macrothrombocytopenia AD 2 7
TYR* Albinism, oculocutaneous AR 77 441
TYRP1 Albinism, oculocutaneous AR 10 55
UBE2T Fanconi anemia, complementation group T AR 2 7
UNC13D Hemophagocytic lymphohistiocytosis, familial AR 22 192
USB1 Poikiloderma with neutropenia AR 24 22
VKORC1 Drug metabolism, VKORC1-related, Vitamin K-dependent clotting AD/AR 4 27 factors, combined deficiency
VPS13B Cohen syndrome AR 351 203
VPS45 Neutropenia, severe congenital, 5, autosomal recessive AR 3 4
VWF* Von Willebrand disease AD/AR 57 1009
WAS Neutropenia, severe congenital, Thrombocytopenia, Wiskott-Aldrich XL 57 439 syndrome
WDR1 AR 8
WIPF1 Wiskott-Aldrich syndrome 2 AR 2 3
WRAP53 Dyskeratosis congenita AR 7 6
https://blueprintgenetics.com/ XIAP* Lymphoproliferative syndrome XL 14 96
XRCC2 Hereditary breast cancer AD/AR 10 21
YARS2 Myopathy, lactic acidosis, and sideroblastic anemia AR 27 11
*Some regions of the gene are duplicated in the genome. Read more.
# The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads.
The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests.
Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases.
Non-coding disease causing variants covered by the panel
Gene Genomic HGVS RefSeq RS-number location HG19
ABCA3 Chr16:2333457 c.3863-98C>T NM_001089.2 rs189077405
ABCA3 Chr16:2358644 c.1112-20G>A NM_001089.2 rs746701685
ABCA3 Chr16:2376495 c.-26-2A>G NM_001089.2
ALAS2 ChrX:55054634 c.-15-2186C>G NM_000032.4
ALAS2 ChrX:55054635 c.-15-2187T>C NM_000032.4
ALAS2 ChrX:55054636 c.-15-2188A>G NM_000032.4
ALAS2 ChrX:55057393 c.-34C>T NM_000032.4 rs780642606
ALAS2 ChrX:55057617 c.-258C>G NM_000032.4 rs140772352
AMN Chr14:103395424 c.514-34G>A NM_030943.3 rs144077391
AMN Chr14:103396444 c.1007-31_1006+34delCCTCGCCCCGCCGCG NM_030943.3 rs386834161
AMN Chr14:103396458 c.1007-29_1006+36delTCGCCCCGCCGCGGG NM_030943.3 rs386834162
ANK1 Chr8:41566510 c.1900-17G>A NM_001142446.1 rs786205243
ANK1 Chr8:41566511 c.1900-18C>A NM_001142446.1
ANK1 Chr8:41655127 c.-73_-72delTG NM_020476.2 rs786205242
ANKRD26 Chr10:27389371 c.-116C>G NM_014915.2
ANKRD26 Chr10:27389373 c.-118C>A NM_014915.2
ANKRD26 Chr10:27389374 c.-119C>A NM_014915.2
ANKRD26 Chr10:27389374 c.-119C>A/G NM_014915.2
ANKRD26 Chr10:27389376 c.-121A>C NM_014915.2
ANKRD26 Chr10:27389380 c.-127_-126delAT NM_014915.2
ANKRD26 Chr10:27389381 c.-126T>C NM_014915.2
ANKRD26 Chr10:27389381 c.-126T>G NM_014915.2
https://blueprintgenetics.com/ ANKRD26 Chr10:27389382 c.-127A>G NM_014915.2
ANKRD26 Chr10:27389382 c.-127A>T NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>T NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>A NM_014915.2
ANKRD26 Chr10:27389383 c.-128G>C NM_014915.2
ANKRD26 Chr10:27389389 c.-134G>A NM_014915.2 rs863223318
ATM Chr11:108093770 c.-174A>G NM_000051.3
ATM Chr11:108094508 c.-31+595G>A NM_000051.3
ATM Chr11:108098321 c.-30-1G>T NM_000051.3 rs869312754
ATM Chr11:108138753 c.2639-384A>G NM_000051.3
ATM Chr11:108141209 c.2839-579_2839-576delAAGT NM_000051.3
ATM Chr11:108151710 c.3403-12T>A NM_000051.3 rs201370733
ATM Chr11:108158168 c.3994-159A>G NM_000051.3 rs864622543
ATM Chr11:108164028 c.4612-12A>G NM_000051.3
ATM Chr11:108179837 c.5763-1050A>G NM_000051.3 rs774925473
ATM Chr11:108214779 c.8418+681A>G NM_000051.3 rs748635985
BRCA1 Chr17:41196352 c.*1340_*1342delTGT NM_007294.3 rs1281551853
BRCA1 Chr17:41196424 c.*1271T>C NM_007294.3
BRCA1 Chr17:41197167 c.*528G>C NM_007294.3 rs1060504556
BRCA1 Chr17:41197588 c.*103_*106delTGTC NM_007294.3 rs431825382
BRCA1 Chr17:41197637 c.*58C>T NM_007294.3 rs137892861
BRCA1 Chr17:41197859 c.5468-40T>A NM_007294.3 rs80358151
BRCA1 Chr17:41199745 c.5407-25T>A NM_007294.3 rs758780152
BRCA1 Chr17:41201232 c.5333-36_5333-22delTACTGCAGTGATTTT NM_007294.3
BRCA1 Chr17:41206122 c.5277+2916_5277+2946delAAATTCTAGTGCTTTGGATTTTTTCCTCCATinsGG NM_007294.3
BRCA1 Chr17:41209164 c.5194-12G>A NM_007294.3 rs80358079
BRCA1 Chr17:41215994 c.5075-27delA NM_007294.3
BRCA1 Chr17:41251909 c.442-22_442-13delTGTTCTTTAC NM_007294.3 rs879254224
BRCA1 Chr17:41256984 c.213-11T>G NM_007294.3 rs80358061
BRCA1 Chr17:41256985 c.213-12A>G NM_007294.3 rs80358163
BRCA1 Chr17:41256988 c.213-15A>G NM_007294.3
BRCA1 Chr17:41276134 c.-19-2A>G NM_007294.3
BRCA2 Chr13:32889805 c.-40+1G>A NM_000059.3
BRCA2 Chr13:32890469 c.-39-89delC NM_000059.3
BRCA2 Chr13:32890556 c.-39-1_-39delGA NM_000059.3 rs758732038
BRCA2 Chr13:32890558 c.-39-1G>A NM_000059.3 rs1060499566
BRCA2 Chr13:32900222 c.426-12_426-8delGTTTT NM_000059.3 rs276174844
BRCA2 Chr13:32945079 c.8488-14A>G NM_000059.3
BRCA2 Chr13:32953872 c.8954-15T>G NM_000059.3
BRCA2 Chr13:32971007 c.9502-28A>G NM_000059.3 rs397508059
https://blueprintgenetics.com/ BRCA2 Chr13:32971023 c.9502-12T>G NM_000059.3 rs81002803
BRIP1 Chr17:59858864 c.1629-498A>T NM_032043.2
CDKN2A Chr9:21968346 c.458-105A>G NM_000077.4
CDKN2A Chr9:21972311 c.151-1104C>G NM_000077.4
CDKN2A Chr9:21973573 c.150+1104C>A NM_000077.4 rs756102261
CDKN2A Chr9:21974401 c.*73+2T>G NM_058197.4
CDKN2A Chr9:21974847 c.-21C>T NM_000077.4
CDKN2A Chr9:21974875 c.-49C>A NM_000077.4 rs1064797383
CDKN2A Chr9:21974882 c.-56G>T NM_000077.4
CDKN2A Chr9:21974916 c.-93_-91delAGG NM_000077.4
CLCN7 Chr16:1506057 c.916+57A>T NM_001287.5
CLCN7 Chr16:1507356 c.739-18G>A NM_001287.5 rs371893553
CTSC Chr11:88070895 c.-55C>A NM_001814.4 rs766114323
CUBN Chr10:17088532 c.3330-439C>G NM_001081.3 rs386833782
DKC1 ChrX:153991099 c.-142C>G NM_001363.3 rs199422241
DKC1 ChrX:153991100 c.-141C>G NM_001363.3
DKC1 ChrX:153993704 c.85-15T>C NM_001363.3
EPCAM Chr2:47606078 c.556-14A>G NM_002354.2 rs376155665
F11 Chr4:187186995 c.-456G>A NM_000128.3
F11 Chr4:187197061 c.595+11A>G NM_000128.3 rs534170853
F11 Chr4:187205426 c.1304+12G>A NM_000128.3 rs116667976
F12 Chr5:176836590 NM_000505.3 rs187018744
F13A1 Chr6:6320800 c.-19_-19+19delGGTAAGCCACCGACCCTGCA NM_000129.3
F2 Chr11:46742048 c.241-25C>G NM_000506.3
F2 Chr11:46761055 c.*97G>A NM_000506.4 rs1799963
F2 Chr11:46761064 c.*106T>A NM_000506.3
F2 Chr11:46761066 c.*108C>T NM_000506.3 rs562369397
F5 Chr1:169494158 c.5717-12T>A NM_000130.4
F5 Chr1:169521527 c.1296+268A>G NM_000130.4
F5 Chr1:169521984 c.1119-12C>G NM_000130.4
F7 Chr13:113760060 c.-96C>T NM_000131.4
F7 Chr13:113760062 c.-94C>G NM_000131.4
F7 Chr13:113760091 c.-65G>C NM_000131.4
F7 Chr13:113760094 NM_000131.4
F7 Chr13:113760094 c.-62C>T NM_000131.4
F7 Chr13:113760095 c.-61T>G NM_000131.4
F7 Chr13:113760096 NM_000131.4
F7 Chr13:113760096 NM_000131.4
F7 Chr13:113760097 c.-59T>G NM_000131.4
F7 Chr13:113760099 c.-57C>T NM_000131.4
https://blueprintgenetics.com/ F7 Chr13:113760101 NM_000131.4
F7 Chr13:113760101 NM_000131.4
F7 Chr13:113760112 c.-44T>C NM_000131.4 rs577393666
F7 Chr13:113760117 c.-39A>G NM_000131.4
F7 Chr13:113760124 c.-32A>C NM_000131.4 rs761212787
F7 Chr13:113760126 c.-30A>C NM_000131.4 rs539578931
F7 Chr13:113764993 c.131-11G>A NM_000131.4
F7 Chr13:113766228 c.291+1065delC NM_000131.4
F7 Chr13:113770192 c.571+78G>A NM_000131.4 rs764741909
F7 Chr13:113771068 c.572-12T>A NM_000131.4
F8 ChrX:154084603 c.6900+4104A>T NM_000132.3
F8 ChrX:154091516 c.6430-14A>G NM_000132.3
F8 ChrX:154130453 c.5999-11G>A NM_000132.3 rs782132907
F8 ChrX:154130463 c.5999-23_5999-22delCT NM_000132.3
F8 ChrX:154130464 c.5999-33_5999-22delGAAATAATTTCTinsATTC NM_000132.3
F8 ChrX:154130469 c.5999-33_5999-28delGAAATA NM_000132.3
F8 ChrX:154130719 c.5999-277G>A NM_000132.3
F8 ChrX:154131240 c.5999-798G>A NM_000132.3
F8 ChrX:154132376 c.5816-14_5816-13delGTinsTA NM_000132.3
F8 ChrX:154132397 c.5816-34A>T NM_000132.3 rs782301004
F8 ChrX:154132892 c.5587-93C>T NM_000132.3
F8 ChrX:154134863 c.5220-16_5220-15insA NM_000132.3
F8 ChrX:154174820 c.2113+1152delA NM_000132.3
F8 ChrX:154175961 c.2113+12T>A NM_000132.3
F8 ChrX:154176219 c.1904-37G>A NM_000132.3 rs367615232
F8 ChrX:154185464 c.1538-18G>A NM_000132.3
F8 ChrX:154189025 c.1537+325A>G NM_000132.3
F8 ChrX:154189458 c.1444-15C>A NM_000132.3
F8 ChrX:154197841 c.788-14T>G NM_000132.3
F8 ChrX:154213089 c.671-11T>C NM_000132.3
F8 ChrX:154215591 c.602-11T>G NM_000132.3
F8 ChrX:154215612 c.602-32A>G NM_000132.3
F8 ChrX:154219579 c.601+1632G>A NM_000132.3 rs387906429
F8 ChrX:154221439 c.389-16T>G NM_000132.3
F8 ChrX:154227886 c.144-11T>G NM_000132.3
F8 ChrX:154227901 c.144-26A>T NM_000132.3
F8 ChrX:154238632 c.144-10758_144-10757insTATA NM_000132.3
F8 ChrX:154249118 c.143+1567A>G NM_000132.3
F8 ChrX:154250939 c.-112G>A NM_000132.3 rs1317271565
F8 ChrX:154251045 c.-218T>C NM_000132.3
https://blueprintgenetics.com/ F8 ChrX:154251045 NM_000132.3
F8 ChrX:154251046 c.-219C>T NM_000132.3
F8 ChrX:154251048 c.-221T>A NM_000132.3
F8 ChrX:154251082 c.-255A>G NM_000132.3
F8 ChrX:154251084 c.-257T>C/G NM_000132.3
F8 ChrX:154251084 NM_000132.3
F8 ChrX:154251084 NM_000132.3
F8 ChrX:154251687 c.-860A>G NM_000132.3
F8 ChrX:154251793 c.-966G>T NM_000132.3
F9 ChrX:138612869 c.-55G>A/C/T NM_000133.3
F9 ChrX:138612869 NM_000133.3
F9 ChrX:138612869 NM_000133.3
F9 ChrX:138612869 NM_000133.3
F9 ChrX:138612871 c.-53A>G NM_000133.3
F9 ChrX:138612871 NM_000133.3
F9 ChrX:138612872 c.-52C>G/T NM_000133.3
F9 ChrX:138612872 NM_000133.3
F9 ChrX:138612872 NM_000133.3
F9 ChrX:138612874 c.-50T>C/G NM_000133.3
F9 ChrX:138612874 NM_000133.3
F9 ChrX:138612874 NM_000133.3
F9 ChrX:138612875 c.-49T>A/C NM_000133.3
F9 ChrX:138612875 NM_000133.3
F9 ChrX:138612875 NM_000133.3 rs1178811105
F9 ChrX:138612876 c.-48G>C NM_000133.3
F9 ChrX:138612886 c.-38A>G NM_000133.3
F9 ChrX:138612889 c.-35G>A/C NM_000133.3
F9 ChrX:138612889 NM_000133.3 rs1166164399
F9 ChrX:138612889 NM_000133.3
F9 ChrX:138612890 c.-34A>G/T NM_000133.3
F9 ChrX:138612890 NM_000133.3
F9 ChrX:138612890 NM_000133.3
F9 ChrX:138612899 c.-22delT NM_000133.3
F9 ChrX:138612900 c.-24T>A NM_000133.3
F9 ChrX:138612901 c.-23T>C NM_000133.3
F9 ChrX:138612902 c.-22T>C NM_000133.3
F9 ChrX:138612903 c.-21C>G NM_000133.3
F9 ChrX:138612905 c.-19C>G NM_000133.3
F9 ChrX:138612905 c.-17delA NM_000133.3
F9 ChrX:138612906 c.-18A>G/T NM_000133.3
https://blueprintgenetics.com/ F9 ChrX:138612906 c.-18A>T NM_000133.3
F9 ChrX:138612906 c.-18A>G NM_000133.3
F9 ChrX:138612907 c.-17A>C/G NM_000133.3
F9 ChrX:138612907 c.-17A>C NM_000133.3
F9 ChrX:138612907 c.-17A>G NM_000133.3
F9 ChrX:138619496 c.253-25A>G/T NM_000133.3
F9 ChrX:138619496 c.253-25A>T NM_000133.3
F9 ChrX:138619496 c.253-25A>G NM_000133.3 rs1201753038
F9 ChrX:138619501 c.253-19_253-16delCTTC NM_000133.3
F9 ChrX:138619502 c.253-16_253-12delCTTTT NM_000133.3
F9 ChrX:138623222 c.278-13A>G NM_000133.3
F9 ChrX:138623223 c.278-12C>G/T NM_000133.3
F9 ChrX:138623223 c.278-12C>G NM_000133.3
F9 ChrX:138623223 c.278-12C>T NM_000133.3 rs1475223858
F9 ChrX:138630499 c.392-22_392-21delCT NM_000133.3
F9 ChrX:138630663 c.520+13A>G NM_000133.3
F9 ChrX:138633441 c.723+18T>A NM_000133.3
F9 ChrX:138645387 c.*1157A>G NM_000133.3
F9 ChrX:138645598 c.*1368A>G NM_000133.3
FANCA Chr16:89805127 c.4261-19_4261-12delACCTGCTC NM_000135.3
FANCA Chr16:89816056 c.3239+82T>G NM_000135.2
FANCA Chr16:89818822 c.2982-192A>G NM_000135.2
FANCA Chr16:89831215 c.2778+83C>G NM_000135.2 rs750997715
FANCA Chr16:89836111 c.2504+134A>G NM_000135.2
FANCA Chr16:89836805 c.2223-138A>G NM_000135.2
FANCA Chr16:89849346 c.1567-20A>G NM_000135.2 rs775154397
FANCA Chr16:89864654 c.893+920C>A NM_000135.2
FANCC Chr9:98011653 c.-78-2A>G NM_000136.2 rs587779898
FANCC Chr9:98079807 c.-79+1G>A NM_000136.2
FANCD2 Chr3:10083186 c.696-121C>G NM_033084.3
FANCD2 Chr3:10102127 c.1766+40T>G NM_033084.3
FANCD2 Chr3:10106024 c.1948-16T>G NM_033084.3
FANCI Chr15:89825208 c.1583+142C>T NM_001113378.1
FANCL Chr2:58433394 c.375-2033C>G NM_001114636.1
FAS Chr10:90770494 c.506-16A>G NM_000043.4
FASLG Chr1:172628081 c.-261T>C NM_000639.1
FGB Chr4:155486360 c.115-600A>G NM_005141.4
FGB Chr4:155490472 c.958+13C>T NM_005141.4 rs606231223
FGG Chr4:155527225 c.1129+632A>G NM_021870.2 rs2066862
FGG Chr4:155527787 c.1129+66_1129+69delAATA NM_021870.2 rs139788771
https://blueprintgenetics.com/ FGG Chr4:155530122 c.667-320A>T NM_021870.2
FLNA ChrX:153581587 c.6023-27_6023-16delTGACTGACAGCC NM_001110556.1
GATA1 ChrX:48649496 c.-19-2A>G NM_002049.3
GATA2 Chr3:128202131 c.1017+572C>T NM_032638.4
GATA2 Chr3:128202162 c.1017+513_1017+540delGGAGTTTCCTATCCGGACATCTGCAGCC NM_032638.4
GATA2 Chr3:128202171 c.1017+532T>A NM_032638.4
GBA Chr1:155205646 c.1225-14_1225-11delTGTCinsAGT NM_000157.3
GBA Chr1:155208109 c.589-12C>G NM_000157.3
GBA Chr1:155211053 c.-150A>G NM_000157.3 rs1232943445
GINS1 Chr20:25388397 c.-60A>G NM_021067.3
GINS1 Chr20:25388409 c.-48C>G NM_021067.3
GP1BB Chr22:19710933 c.-160C>G NM_000407.4 rs730882059
GPR143 ChrX:9708630 c.885+748G>A NM_000273.2
GPR143 ChrX:9711844 c.659-131T>G NM_000273.2
GSS Chr20:33537864 c.129+1663A>G NM_000178.2
GSS Chr20:33543525 c.-9+5G>A NM_000178.2
HBA1 Chr16:227471 c.*63_*65delCCT NM_000558.3
HBA2 Chr16:223646 c.*47G>C NM_000517.4 rs4021971
HBA2 Chr16:223672 c.*74_*89delCCTTCCTGGTCTTTGA NM_000517.4 rs63750919
HBA2 Chr16:223690 c.*93_*94delAA NM_000517.4 rs63751268
HBA2 Chr16:223691 c.*92A>G NM_000517.4 rs63750067
HBA2 Chr16:223693 c.*94A>G NM_000517.4
HBA2 Chr16:223693 c.*94A>C NM_000517.4
HBA2 Chr16:223703 c.*104G>T NM_000517.4
HBB Chr11:5246696 c.*132C>A/T NM_000518.4
HBB Chr11:5246696 c.*132C>A NM_000518.4 rs1420779550
HBB Chr11:5246696 c.*132C>T NM_000518.4
HBB Chr11:5246699 c.*129T>C NM_000518.4
HBB Chr11:5246711 c.*115_*116delAA NM_000518.4 rs281864532
HBB Chr11:5246713 c.*110_*114delTAAAA NM_000518.4 rs606231219,rs35949130
HBB Chr11:5246715 c.*113A>G NM_000518.4 rs33985472
HBB Chr11:5246716 c.*112A>G/T NM_000518.4 rs63750954
HBB Chr11:5246716 c.*112A>T NM_000518.4
HBB Chr11:5246716 c.*112A>G NM_000518.4
HBB Chr11:5246716 c.*110_*111delTA NM_000518.4 rs63750205,rs281864905
HBB Chr11:5246717 c.*111A>G NM_000518.4 rs63751128
HBB Chr11:5246718 c.*110T>A/C NM_000518.4 rs33978907
HBB Chr11:5246718 c.*110T>G NM_000518.4
HBB Chr11:5246720 c.*108A>C/G NM_000518.4
HBB Chr11:5246720 c.*108A>C NM_000518.4
https://blueprintgenetics.com/ HBB Chr11:5246720 c.*108A>G NM_000518.4
HBB Chr11:5246722 c.*93_*105delATCTGGATTCTGC NM_000518.4 rs34171453
HBB Chr11:5246732 c.*96T>C NM_000518.4 rs34029390
HBB Chr11:5246754 c.*74A>G NM_000518.4 rs369101035
HBB Chr11:5246781 c.*47C>G NM_000518.4
HBB Chr11:5246796 c.*32A>C NM_000518.4
HBB Chr11:5246970 c.316-14T>G NM_000518.4 rs35703285
HBB Chr11:5247046 c.316-90A>G NM_000518.4 rs63750433
HBB Chr11:5247062 c.316-106C>G NM_000518.4 rs34690599
HBB Chr11:5247102 c.316-146T>G NM_000518.4 rs35328027
HBB Chr11:5247153 c.316-197C>T NM_000518.4 rs34451549
HBB Chr11:5247216 c.316-260T>C NM_000518.4
HBB Chr11:5247602 c.315+203_315+205delTCTinsCC NM_000518.4
HBB Chr11:5248044 c.93-15T>G NM_000518.4 rs35456885
HBB Chr11:5248050 c.93-21G>A NM_000518.4 rs35004220
HBB Chr11:5248050 c.93-22delT NM_000518.4
HBB Chr11:5248263 c.-12C>T NM_000518.4 rs113115948
HBB Chr11:5248269 c.-18C>G NM_000518.4 rs34135787
HBB Chr11:5248272 c.-21T>A NM_000518.4
HBB Chr11:5248280 c.-29G>A/T NM_000518.4 rs34704828
HBB Chr11:5248281 c.-31delC NM_000518.4
HBB Chr11:5248282 c.-31C>T NM_000518.4 rs63750628
HBB Chr11:5248291 c.-41delT NM_000518.4 rs35352549
HBB Chr11:5248294 c.-43C>T NM_000518.4
HBB Chr11:5248301 c.-50A>C NM_000518.4 rs34305195
HBB Chr11:5248301 c.-50A>G/T NM_000518.4
HBB Chr11:5248326 c.-75G>T NM_000518.4
HBB Chr11:5248326 c.-75G>C NM_000518.4 rs63750400
HBB Chr11:5248326 NM_000518.4 rs63750953
HBB Chr11:5248327 c.-76A>C NM_000518.4 rs281864525
HBB Chr11:5248328 c.-77A>G/T NM_000518.4
HBB Chr11:5248328 NM_000518.4
HBB Chr11:5248328 NM_000518.4
HBB Chr11:5248329 c.-78A>C/G NM_000518.4 rs33931746
HBB Chr11:5248329 NM_000518.4
HBB Chr11:5248329 NM_000518.4
HBB Chr11:5248330 c.-79A>G NM_000518.4 rs34598529
HBB Chr11:5248330 NM_000518.4 rs397509430
HBB Chr11:5248331 c.-80T>A/C NM_000518.4 rs33980857
HBB Chr11:5248331 NM_000518.4
https://blueprintgenetics.com/ HBB Chr11:5248331 NM_000518.4
HBB Chr11:5248332 c.-81A>C/G NM_000518.4 rs33981098
HBB Chr11:5248332 NM_000518.4
HBB Chr11:5248332 NM_000518.4
HBB Chr11:5248333 c.-82C>A/T NM_000518.4 rs34500389
HBB Chr11:5248333 NM_000518.4
HBB Chr11:5248333 NM_000518.4
HBB Chr11:5248342 c.-91A>C NM_000518.4
HBB Chr11:5248343 c.-92C>G NM_000518.4 rs397515291
HBB Chr11:5248351 c.-100G>A NM_000518.4 rs281864524
HBB Chr11:5248372 c.-121C>T NM_000518.4 rs281864518
HBB Chr11:5248373 NM_000518.4 rs1272414751
HBB Chr11:5248374 c.-123A>T NM_000518.4
HBB Chr11:5248377 c.-126C>A NM_000518.4
HBB Chr11:5248378 c.-127G>C NM_000518.4
HBB Chr11:5248384 NM_000518.4 rs72561473
HBB Chr11:5248387 c.-136C>A/G/T NM_000518.4 rs33994806
HBB Chr11:5248387 NM_000518.4
HBB Chr11:5248387 NM_000518.4
HBB Chr11:5248387 NM_000518.4
HBB Chr11:5248388 c.-137C>A/G/T NM_000518.4 rs33941377
HBB Chr11:5248388 NM_000518.4
HBB Chr11:5248388 NM_000518.4
HBB Chr11:5248388 NM_000518.4
HBB Chr11:5248389 c.-138C>A/T NM_000518.4 rs33944208
HBB Chr11:5248389 NM_000518.4
HBB Chr11:5248389 NM_000518.4
HBB Chr11:5248391 NM_000518.4 rs34999973
HBB Chr11:5248393 c.-142C>T NM_000518.4 rs34883338
HBB Chr11:5248394 c.-143C>G NM_000518.4 rs63751043
HBB Chr11:5248402 c.-151C>T NM_000518.4 rs63751208
HBB Chr11:5248402 NM_000518.4
HBB Chr11:5248403 c.-152C>A NM_000518.4
HBB Chr11:5248491 c.-240G>A NM_000518.4 rs753344875
HBB Chr11:5248524 c.-273T>C NM_000518.4 rs139703273
HFE Chr6:26087649 c.-20G>A NM_000410.3 rs138378000
HPS3 Chr3:148888270 c.2888-1612G>A NM_032383.3 rs281865096
ITGA2B Chr17:42449567 c.*165T>C NM_000419.3
ITGA2B Chr17:42455177 c.2095-19T>A NM_000419.3
ITGA2B Chr17:42458507 c.1211-78A>G NM_000419.3
https://blueprintgenetics.com/ ITGA2B Chr17:42463181 c.408+11C>A NM_000419.3
ITGA2B Chr17:42470923 c.-4082G>A NM_000419.3
KLF1 Chr19:12998078 c.-124T>C NM_006563.3
KLF1 Chr19:12998102 NM_006563.3 rs552824864
KLF1 Chr19:12998108 c.-154C>T NM_006563.3 rs372651309
LAMTOR2 Chr1:156028185 c.*23C>A NM_014017.3
LMAN1 Chr18:57014710 c.822+34_822+35insGTTG NM_005570.3
MLH1 Chr3:37034619 c.-413_-411delGAG NM_000249.3 rs953169437
MLH1 Chr3:37034932 c.-107C>G NM_000249.3 rs587778886
MLH1 Chr3:37034976 c.-63_-58delGTGATTinsCACGAGGCACGAGCACGA NM_000249.3
MLH1 Chr3:37034997 c.-42C>T NM_000249.3 rs41285097
MLH1 Chr3:37035012 c.-27C>A NM_000249.3 rs587779001
MLH1 Chr3:37035260 c.116+106G>A NM_000249.3
MLH1 Chr3:37038099 c.117-11T>A NM_000249.3 rs267607711
MLH1 Chr3:37050292 c.454-13A>G NM_000249.3 rs267607749
MLH1 Chr3:37061788 c.885-9_887dupTCCTGACAGTTT NM_000249.3 rs63751620
MLH1 Chr3:37070436 c.1558+13T>A NM_000249.3 rs267607834
MSH2 Chr2:47630106 c.-225G>C NM_000251.2 rs138068023
MSH2 Chr2:47630150 c.-181G>A NM_000251.2 rs786201698
MSH2 Chr2:47630249 c.-81dupA NM_000251.2 rs560991330,rs587779187
MSH2 Chr2:47630251 c.-78_-77delTG NM_000251.2 rs587779182
MSH2 Chr2:47698086 c.1662-17dupG NM_000251.2 rs587779099
MSH6 Chr2:48018295 c.457+33_457+34insGTGT NM_000179.2
MSH6 Chr2:48030536 c.3173-16_3173-5delCCCTCTCTTTTA NM_000179.2
MSH6 Chr2:48034014 c.*15A>C NM_000179.2
MSH6 Chr2:48034047 c.*49_*68dupTTCAGACAACATTATGATCT NM_000179.2 rs777409019
MTR Chr1:236971838 c.340-166A>G NM_000254.2
MTR Chr1:236977232 c.609+1088G>A NM_000254.2 rs752526782
MTR Chr1:237057461 c.3205-196A>G NM_000254.2 rs544410324
NF1 Chr17:29422055 c.-273A>C NM_001042492.2
NF1 Chr17:29422056 c.-272G>A NM_001042492.2
NF1 Chr17:29431417 c.60+9031_60+9035delAAGTT NM_001042492.2
NF1 Chr17:29475515 c.61-7486G>T NM_001042492.2
NF1 Chr17:29488136 c.288+2025T>G NM_001042492.2
NF1 Chr17:29508426 c.587-14T>A NM_001042492.2
NF1 Chr17:29508428 c.587-12T>A NM_001042492.2
NF1 Chr17:29510334 c.888+651T>A NM_001042492.2
NF1 Chr17:29510427 c.888+744A>G NM_001042492.2
NF1 Chr17:29510472 c.888+789A>G NM_001042492.2
NF1 Chr17:29527428 c.889-12T>A NM_001042492.2
https://blueprintgenetics.com/ NF1 Chr17:29530107 c.1260+1604A>G NM_001042492.2
NF1 Chr17:29533239 c.1261-19G>A NM_001042492.2
NF1 Chr17:29534143 c.1392+754T>G NM_001042492.2
NF1 Chr17:29540877 c.1393-592A>G NM_001042492.2
NF1 Chr17:29542762 c.1527+1159C>T NM_001042492.2
NF1 Chr17:29548419 c.1642-449A>G NM_001042492.2 rs863224655
NF1 Chr17:29549489 c.*481A>G NM_001128147.2
NF1 Chr17:29553439 c.2002-14C>G NM_001042492.2
NF1 Chr17:29554225 c.2252-11T>G NM_001042492.2
NF1 Chr17:29556025 c.2410-18C>G NM_001042492.2
NF1 Chr17:29556027 c.2410-16A>G NM_001042492.2
NF1 Chr17:29556028 c.2410-15A>G NM_001042492.2
NF1 Chr17:29556031 c.2410-12T>G NM_001042492.2
NF1 Chr17:29556839 c.2851-14_2851-13insA NM_001042492.2
NF1 Chr17:29557267 c.2991-11T>G NM_001042492.2
NF1 Chr17:29558777 c.3198-314G>A NM_001042492.2
NF1 Chr17:29563299 c.3974+260T>G NM_001042492.2
NF1 Chr17:29577082 c.4110+945A>G NM_001042492.2
NF1 Chr17:29580296 c.4173+278A>G NM_001042492.2
NF1 Chr17:29588708 c.4578-20_4578-18delAAG NM_001042492.2
NF1 Chr17:29588715 c.4578-14T>G NM_001042492.2
NF1 Chr17:29654479 c.5269-38A>G NM_001042492.2
NF1 Chr17:29656858 c.5610-456G>T NM_001042492.2
NF1 Chr17:29657848 c.5812+332A>G NM_001042492.2 rs863224491
NF1 Chr17:29661577 c.5813-279A>G NM_001042492.2
NF1 Chr17:29664375 c.6428-11T>G NM_001042492.2
NF1 Chr17:29664618 c.6642+18A>G NM_001042492.2
NF1 Chr17:29676126 c.7190-12T>A NM_001042492.2
NF1 Chr17:29676127 c.7190-11_7190-10insGTTT NM_001042492.2
NF1 Chr17:29685177 c.7971-321C>G NM_001042492.2
NF1 Chr17:29685481 c.7971-17C>G NM_001042492.2
NF1 Chr17:29685665 c.8113+25A>T NM_001042492.2
OCA2 Chr15:28234823 c.1117-11T>A NM_000275.2
OCA2 Chr15:28234829 c.1117-17T>C NM_000275.2 rs200081580
OCA2 Chr15:28235808 c.1045-15T>G NM_000275.2 rs779461179
OCA2 Chr15:28267738 c.574-19A>G NM_000275.2 rs145242923
PALB2 Chr16:23649285 c.109-12T>A NM_024675.3 rs774949203
PARN Chr16:14724045 c.-165+2C>T NM_001134477.2
PC Chr11:66620883 c.1369-29A>G NM_000920.3
PDHA1 ChrX:19371182 c.533-17_533-14delTGTT NM_001173454.1
https://blueprintgenetics.com/ PDHA1 ChrX:19372579 c.625-30G>A NM_001173454.1
PDHA1 ChrX:19373648 c.873+26G>A NM_001173454.1
PDHA1 ChrX:19377849 c.*79_*90dupAGTCAATGAAAT NM_001173454.1 rs606231192
PDHA1 ChrX:19377861 c.*79_*90dupAGTCAATGAAAT NM_001173454.1
PDHX Chr11:34988372 c.816+11C>G NM_003477.2
PKLR Chr1:155263185 c.1269+44C>T NM_000298.5
PKLR Chr1:155265208 c.507+20C>A NM_000298.5
PKLR Chr1:155271258 c.-72A>G NM_000298.5
PKLR Chr1:155271259 c.-73G>C NM_000298.5
PKLR Chr1:155271269 c.-83G>C NM_000298.5
PKLR Chr1:155271269 NM_000298.5 rs1460844860
PMS2 Chr7:6027263 c.1145-31_1145-13delCTGACCCTCTTCTCCGTCC NM_000535.5 rs751973268
PMS2 Chr7:6048599 c.23+21_23+28delTCCGGTGT NM_000535.5
PROC Chr2:128175983 c.-107A>G NM_000312.3
PROC Chr2:128175984 c.-106A>G NM_000312.3
PROC Chr2:128175988 c.-102T>A NM_000312.3
PROC Chr2:128175991 NM_000312.3
PROC Chr2:128175994 c.-96T>G NM_000312.3
PROC Chr2:128176001 c.-89T>C NM_000312.3
PROC Chr2:128176005 c.-85C>T NM_000312.3
PROC Chr2:128176047 c.-43A>C NM_000312.3
PROC Chr2:128176058 c.-32G>A NM_000312.3 rs912629007
PROC Chr2:128179040 c.237+15G>A NM_000312.3 rs528055589
PROC Chr2:128180582 c.263-28T>G NM_000312.3
PROC Chr2:128180823 c.401-18_401-3delGCCCTCCCCTGCCCGC NM_000312.3
PROC Chr2:128183562 c.536-99C>G NM_000312.3
PROC Chr2:128186595 c.*73C>T NM_000312.3 rs199469473
PROS1 Chr3:93593261 c.1871-20_1871-13delCTAATATT NM_000313.3
PROS1 Chr3:93593263 c.1871-14T>G NM_000313.3 rs754929347
PROS1 Chr3:93598175 c.1493-17T>C NM_000313.3 rs199469501
PROS1 Chr3:93605147 c.1323+33A>G NM_000313.3
PROS1 Chr3:93611983 c.966-17C>G NM_000313.3 rs199469490
PROS1 Chr3:93692761 c.-168C>T NM_000313.3 rs199469484
PROS1 Chr3:93692783 c.-190C>G NM_000313.3 rs149028936
PTPN11 Chr12:112915602 c.934-59T>A NM_002834.3
RBM8A Chr1:145507646 c.-21G>A NM_005105.4
RBM8A Chr1:145507765 c.67+32G>C NM_005105.4 rs201779890
REN Chr1:204129817 c.374-12_374-11delTCinsAG NM_000537.3
RPL31 Chr2:101618778 c.-1+1G>A NM_001098577.2
RPL5 Chr1:93300322 c.190-12_191dupCTCTTACTATAGAT NM_000969.3
https://blueprintgenetics.com/ RPS19 Chr19:42364214 c.-144_-141delTTTC NM_001022.3
RPS26 Chr12:56436176 c.4-25_4-14delTAACAGTTTTCC NM_001029.3
RPS7 Chr2:3622941 c.-19+1G>T NM_001011.3
RPS7 Chr2:3622942 c.-19+2T>C NM_001011.3
SEC23B Chr20:18488060 c.-571A>G NM_006363.4 rs559854357
SEC23B Chr20:18488615 c.-16A>G NM_006363.4
SEC23B Chr20:18491731 c.221+31A>G NM_006363.4
SEC23B Chr20:18491863 c.221+163A>G NM_006363.4 rs573898514
SEC23B Chr20:18492791 c.222-78C>T NM_006363.4 rs150393520
SEC23B Chr20:18526845 c.1743+168A>G NM_006363.4 rs111951711
SERPINC1 Chr1:173876666 c.1154-14G>A NM_000488.3
SERPINC1 Chr1:173884075 c.42-18C>G NM_000488.3
SERPINC1 Chr1:173886568 c.-171C>G NM_000488.3
SH2D1A ChrX:123499593 c.138-17_138-11delAGTTTAT NM_002351.4
SLC45A2 Chr5:33985176 NM_016180.3 rs984225803
SLC45A2 Chr5:33985764 NM_016180.3 rs199972025
SLC4A1 Chr17:42340296 c.-62G>A NM_000342.3 rs387906565
SPTA1 Chr1:158613314 c.4339-99C>T NM_003126.2 rs200830867
SPTA1 Chr1:158626459 c.2806-13T>G NM_003126.2
STX11 Chr6:144508713 c.*85_*86insT NM_003764.3
STXBP2 Chr19:7705761 c.326-23_326-16delGCCCCACT NM_006949.3
TCN2 Chr22:31011112 c.581-176A>T NM_000355.3
TCN2 Chr22:31011112 c.581-176A>G NM_000355.3 rs372866837
TERC Chr3:169482870 n.-22C>T NR_001566.1
TERC Chr3:169482906 NR_001566.1
TERC Chr3:169482948 n.-100C>G NR_001566.1 rs199422256
TERC Chr3:169483086 NR_001566.1 rs199422255
TERT Chr5:1271334 c.2383-15C>T NM_198253.2 rs574645600
TERT Chr5:1295161 c.-57A>C NM_198253.2
THBD Chr20:23030319 NM_000361.2
THBD Chr20:23030443 c.-302C>A NM_000361.2
TP53 Chr17:7571520 NM_000546.5
TP53 Chr17:7577647 c.673-39G>A NM_000546.5
TP53 Chr17:7579601 c.97-11C>G NM_000546.5
TP53 Chr17:7590694 c.-29+1G>T NM_000546.5
TRNT1 Chr3:3188088 c.609-26T>C NM_182916.2
TYR Chr11:88960973 c.1037-18T>G NM_000372.4
UNC13D Chr17:73826245 c.2831-13G>A NM_199242.2
UNC13D Chr17:73827442 c.2448-13G>A NM_199242.2 rs753762300
UNC13D Chr17:73839907 c.118-307G>A NM_199242.2
https://blueprintgenetics.com/ UNC13D Chr17:73839908 c.118-308C>T NM_199242.2
VWF Chr12:6101204 c.6599-20A>T NM_000552.3 rs61750621
VWF Chr12:6125417 c.5312-19A>G NM_000552.3
VWF Chr12:6128923 c.3675-14G>A NM_000552.3
VWF Chr12:6233584 c.-1+3A>C NM_000552.3
VWF Chr12:6233714 c.-128G>A NM_000552.3 rs1300771136
VWF Chr12:6234258 c.-672C>T NM_000552.3 rs61750447
WAS ChrX:48547690 c.1339-19_1339-11delTGATCCCTGinsATCTGCAGACC NM_000377.2
Test Strengths
The strengths of this test include:
CAP accredited laboratory CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance Careful construction of clinically effective and scientifically justified gene panels Some of the panels include the whole mitochondrial genome (please see the Panel Content section) Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level Our publicly available analytic validation demonstrating complete details of test performance ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section) Our rigorous variant classification scheme Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data Our comprehensive clinical statements
Test Limitations
HBA1 and HBA2 genes have identical sequences at coding region and their mapping rely purely on differences at intronic/UTR regions. This reduces sensitivity for detecting variants in these region by using standard NGS diagnostics. However, Blueprint Genetics custom assay has good coverage (>20x) with improved mapping rates (mapping quality >40) within the target regions of these genes: HBA1 80.7% and HBA2 59.4%. Our validation showed high mean coverage of 604x for HBA1 gene and 463x for HBA2. We have been able to detect sequence variants and some of the known disease causing deletions using our assay but some limitations in sensitivity is expected to exist at the moment. This NGS-based analysis does not include analysis of the intron 1 and intron 22 inversions in F8-gene. The following exons are not included in the panel as they are not sufficiently covered with high quality sequence reads: CSF2RA (NM_001161530:9), VKORC1 (NM_001311311:3), VPS45 (NM_001279353:13). Genes with suboptimal coverage in our assay are marked with number sign (#) and genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. Gene is considered to have suboptimal coverage when >90% of the gene’s target nucleotides are not covered at >20x with mapping quality score (MQ>20) reads. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above).
This test does not d etect the following:
Complex inversions Gene conversions Balanced translocations Some of the panels include the whole mitochondrial genome (please see the Panel Content section) Repeat expansion disorders unless specifically mentioned Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see
https://blueprintgenetics.com/ above Panel Content / non-coding variants covered by the panel).
This test may not reliably detect the following:
Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability) Stretches of mononucleotide repeats Low level heteroplasmy in mtDNA (>90% are detected at 5% level) Indels larger than 50bp Single exon deletions or duplications Variants within pseudogene regions/duplicated segments Some disease causing variants present in mtDNA are not detectable from blood, thus post-mitotic tissue such as skeletal muscle may be required for establishing molecular diagnosis.
The sensitivity of this test may be reduced if DNA is extracted by a laboratory other than Blueprint Genetics.
For additional information, please refer to the Test performance section and see our Analytic Validation.
Test Performance
The genes on the panel have been carefully selected based on scientific literature, mutation databases and our experience.
Our panels are sectioned from our high-quality, clinical grade NGS assay. Please see our sequencing and detection performance table for details regarding our ability to detect different types of alterations (Table).
Assays have been validated for various sample types including EDTA-blood, isolated DNA (excluding from formalin fixed paraffin embedded tissue), saliva and dry blood spots (filter cards). These sample types were selected in order to maximize the likelihood for high-quality DNA yield. The diagnostic yield varies depending on the assay used, referring healthcare professional, hospital and country. Plus analysis increases the likelihood of finding a genetic diagnosis for your patient, as large deletions and duplications cannot be detected using sequence analysis alone. Blueprint Genetics’ Plus Analysis is a combination of both sequencing and deletion/duplication (copy number variant (CNV)) analysis.
The performance metrics listed below are from an initial validation performed at our main laboratory in Finland. The performance metrics of our laboratory in Seattle, WA, are equivalent.
Performance of Blueprint Genetics high-quality, clinical grade NGS sequencing assay for panels.
Sensitivity % (TP/(TP+FN) Specificity %
Single nucleotide variants 99.89% (99,153/99,266) >99.9999%
Insertions, deletions and indels by sequence analysis
1-10 bps 99.2% (7,745/7,806) >99.9999%
11-50 bps 99.13% (2,524/2,546) >99.9999%
Copy number variants (exon level dels/dups)
1 exon level deletion (heterozygous) 100% (20/20) NA
1 exon level deletion (homozygous) 100% (5/5) NA
1 exon level deletion (het or homo) 100% (25/25) NA
2-7 exon level deletion (het or homo) 100% (44/44) NA
1-9 exon level duplication (het or homo) 75% (6/8) NA
https://blueprintgenetics.com/ Simulated CNV detection
5 exons level deletion/duplication 98.7% 100.00%
Microdeletion/-duplication sdrs (large CNVs, n=37))
Size range (0.1-47 Mb) 100% (25/25)
The performance presented above reached by Blueprint Genetics high-quality, clinical grade NGS sequencing assay with the following coverage metrics
Mean sequencing depth 143X
Nucleotides with >20x sequencing coverage (%) 99.86%
Performance of Blueprint Genetics Mitochondrial Sequencing Assay.
Sensitivity % Specificity %
ANALYTIC VALIDATION (NA samples; n=4)
Single nucleotide variants
Heteroplasmic (45-100%) 100.0% (50/50) 100.0%
Heteroplasmic (35-45%) 100.0% (87/87) 100.0%
Heteroplasmic (25-35%) 100.0% (73/73) 100.0%
Heteroplasmic (15-25%) 100.0% (77/77) 100.0%
Heteroplasmic (10-15%) 100.0% (74/74) 100.0%
Heteroplasmic (5-10%) 100.0% (3/3) 100.0%
Heteroplasmic (<5%) 50.0% (2/4) 100.0%
CLINICAL VALIDATION (n=76 samples)
All types
Single nucleotide variants n=2026 SNVs
Heteroplasmic (45-100%) 100.0% (1940/1940) 100.0%
Heteroplasmic (35-45%) 100.0% (4/4) 100.0%
Heteroplasmic (25-35%) 100.0% (3/3) 100.0%
Heteroplasmic (15-25%) 100.0% (3/3) 100.0%
Heteroplasmic (10-15%) 100.0% (9/9) 100.0%
Heteroplasmic (5-10%) 92.3% (12/13) 99.98%
Heteroplasmic (<5%) 88.9% (48/54) 99.93%
https://blueprintgenetics.com/ Insertions and deletions by sequence analysis n=40 indels
Heteroplasmic (45-100%) 1-10bp 100.0% (32/32) 100.0%
Heteroplasmic (5-45%) 1-10bp 100.0% (3/3) 100.0%
Heteroplasmic (<5%) 1-10bp 100.0% (5/5) 99,997%
SIMULATION DATA /(mitomap mutations)
Insertions, and deletions 1-24 bps by sequence analysis; n=17
Homoplasmic (100%) 1-24bp 100.0% (17/17) 99.98%
Heteroplasmic (50%) 100.0% (17/17) 99.99%
Heteroplasmic (25%) 100.0% (17/17) 100.0%
Heteroplasmic (20%) 100.0% (17/17) 100.0%
Heteroplasmic (15%) 100.0% (17/17) 100.0%
Heteroplasmic (10%) 94.1% (16/17) 100.0%
Heteroplasmic (5%) 94.1% (16/17) 100.0%
Copy number variants (separate artifical mutations; n=1500)
Homoplasmic (100%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (50%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (30%) 500 bp, 1kb, 5 kb 100.0% 100.0%
Heteroplasmic (20%) 500 bp, 1kb, 5 kb 99.7% 100.0%
Heteroplasmic (10%) 500 bp, 1kb, 5 kb 99.0% 100.0%
The performance presented above reached by following coverage metrics at assay level (n=66)
Mean of medians Median of medians
Mean sequencing depth MQ0 (clinical) 18224X 17366X
Nucleotides with >1000x MQ0 sequencing coverage (%) (clinical) 100%
rho zero cell line (=no mtDNA), mean sequencing depth 12X
Bioinformatics
The target region for each gene includes coding exons and ±20 base pairs from the exon-intron boundary. In addition, the panel includes non-coding variants if listed above (Non-coding variants covered by the panel). Some regions of the gene(s) may be removed from the panel if specifically mentioned in the ‘Test limitations” section above. The sequencing data generated in our laboratory is analyzed with our proprietary data analysis and annotation pipeline, integrating state-of-the art algorithms and industry-standard software solutions. Incorporation of rigorous quality control steps throughout the workflow of the pipeline ensures the consistency, validity and accuracy of results. Our pipeline is streamlined to maximize sensitivity without sacrificing specificity. We have incorporated a number of reference population databases and mutation databases such as, but not limited, to 1000 Genomes Project, gnomAD, ClinVar and HGMD into our clinical interpretation software to
https://blueprintgenetics.com/ make the process effective and efficient. For missense variants, in silico variant prediction tools such as SIFT, PolyPhen, MutationTaster are used to assist with variant classification. Through our online ordering and statement reporting system, Nucleus, the customer has an access to details of the analysis, including patient specific sequencing metrics, a gene level coverage plot and a list of regions with inadequate coverage if present. This reflects our mission to build fully transparent diagnostics where customers have easy access to crucial details of the analysis process.
Clinical Interpretation
We provide customers with the most comprehensive clinical report available on the market. Clinical interpretation requires a fundamental understanding of clinical genetics and genetic principles. At Blueprint Genetics, our PhD molecular geneticists, medical geneticists and clinical consultants prepare the clinical statement together by evaluating the identified variants in the context of the phenotypic information provided in the requisition form. Our goal is to provide clinically meaningful statements that are understandable for all medical professionals regardless of whether they have formal training in genetics.
Variant classification is the corner stone of clinical interpretation and resulting patient management decisions. Our classifications follow the ACMG guideline 2015.
The final step in the analysis of sequence variants is confirmation of variants classified as pathogenic or likely pathogenic using bi-directional Sanger sequencing. Variant(s) fulfilling the following criteria are not Sanger confirmed: the variant quality score is above the internal threshold for a true positive call, and visual check-up of the variant at IGV is in-line with the variant call. Reported variants of uncertain significance are confirmed with bi-directional Sanger sequencing only if the quality score is below our internally defined quality score for true positive call. Reported copy number variations with a size <10 exons are confirmed by orthogonal methods such as qPCR if the specific CNV has been seen less than three times at Blueprint Genetics.
Our clinical statement includes tables for sequencing and copy number variants that include basic variant information (genomic coordinates, HGVS nomenclature, zygosity, allele frequencies, in silico predictions, OMIM phenotypes and classification of the variant). In addition, the statement includes detailed descriptions of the variant, gene and phenotype(s) including the role of the specific gene in human disease, the mutation profile, information about the gene’s variation in population cohorts and detailed information about related phenotypes. We also provide links to the references used, congress abstracts and mutation variant databases used to help our customers further evaluate the reported findings if desired. The conclusion summarizes all of the existing information and provides our rationale for the classification of the variant.
Identification of pathogenic or likely pathogenic variants in dominant disorders or their combinations in different alleles in recessive disorders are considered molecular confirmation of the clinical diagnosis. In these cases, family member testing can be used for risk stratification within the family. In the case of variants of uncertain significance (VUS), we do not recommend family member risk stratification based on the VUS result. Furthermore, in the case of VUS, we do not recommend the use of genetic information in patient management or genetic counseling.
Our interpretation team analyzes millions of variants from thousands of individuals with rare diseases. Thus, our database, and our understanding of variants and related phenotypes, is growing by leaps and bounds. Our laboratory is therefore well positioned to re-classify previously reported variants as new information becomes available. If a variant previously reported by Blueprint Genetics is re-classified, our laboratory will issue a follow-up statement to the original ordering health care provider at no additional cost.
Sample Requirements
Blood (min. 1ml) in an EDTA tube Extracted DNA, min. 2 μg in TE buffer or equivalent Saliva (Please see Sample Requirements for accepted saliva kits)
Label the sample tube with your patient's name, date of birth and the date of sample collection.
We do not accept DNA samples isolated from formalin-fixed paraffin-embedded (FFPE) tissue. In addition, if the patient is affected with a hematological malignancy, DNA extracted from a non-hematological source (e.g. skin fibroblasts) is strongly recommended.
Please note that, in rare cases, mitochondrial genome (mtDNA) variants may not be detectable in blood or saliva in which case
https://blueprintgenetics.com/ DNA extracted from post-mitotic tissue such as skeletal muscle may be a better option.
Read more about our sample requirements here.
For Patients
Other
American Sickle Cell Anemia Association Bernard Soulier Syndrome Organization Bloom’s Syndrome Association Bousfiha A et al. The 2017 IUIS Phenotypic Classification for Primary Immunodeficiencies. J Clin Immunol. 2018 38:129–143 Diamond Blackfan Anemia Foundation Fanconi Anemia Research Fund GeneReviews - Alpha-Thalassemia GeneReviews - Beta-Thalassemia GeneReviews - Bloom Syndrome GeneReviews - Chediak-Higashi Syndrome GeneReviews - Congenital Dyserythropoietic Anemia GeneReviews - Congenital Dyserythropoietic Anemia Type I GeneReviews - Diamond-Blackfan Anemia GeneReviews - Diamond-Blackfan anemia GeneReviews - EPB42-Related Hereditary Spherocytosis GeneReviews - Familial Hemophagocytic Lymphohistiocytosis GeneReviews - Fanconi Anemia GeneReviews - Hemophagocytic Lymphohistiocytosis, Familial GeneReviews - Hemophilia A GeneReviews - Hemophilia B GeneReviews - Hermansky-Pudlak Syndrome GeneReviews - Lymphoproliferative Disease, X-Linked GeneReviews - Lymphoproliferative Syndrome GeneReviews - Nijmegen Breakage Syndrome GeneReviews - Shwachman-Diamond Syndrome GeneReviews - Sickle Cell Disease GeneReviews - Von Willebrand Disease GeneReviews - WAS-Related Disorders GeneReviews - Wiskott Aldrich Syndrome GeneReviews - X-Linked Sideroblastic Anemia GeneReviews - X-Linked Sideroblastic Anemia and Ataxia Glanzmann’s Research Foundation Hemophilia & Rare Bleeding Disorders Hemophilia Federation of America Hermansky-Pudlak Syndrome Network Histiocytosis Association Immune Deficiency Foundation NORD - Bernard-Soulier Syndrome NORD - Beta-Thalassemia NORD - Bloom Syndrome NORD - Chediak-Higashi Syndrome NORD - Diamond-Blackfan anemia NORD - Fanconi Anemia NORD - Glanzmann Thrombasthenia NORD - Hemophilia A NORD - Hemophilia B NORD - Hereditary Spherocytosis
https://blueprintgenetics.com/ NORD - Hermansky-Pudlak Syndrome NORD - Lymphoproliferative Syndrome NORD - Shwachman-Diamond Syndrome NORD - Sickle Cell Disease NORD - Von Willebrand Disease NORD - Wiskott Aldrich Syndrome National Hemophilia Foundation National Organization for Albinism and Hypopigmentation Noris P et al. Hereditary thrombocytopenias: a growing list of disorders. Hematology Am Soc Hematol Educ Program. 2017 Dec 8; (1):385-399 Platelet Disorder Support Association Shwachman-Diamond Syndrome Foundation Thalassemia Support Foundation Wiskott-Aldrich Foundation World Federation of Hemophilia
https://blueprintgenetics.com/