bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
1 ADCK4 deficiency destabilizes the coenzyme Q complex, which is
2 rescued by 2,4-dihydroxybenzoic acid treatment
3
4 Eugen Widmeier,1,2† Seyoung Yu,3† Anish Nag,4 Youn Wook Chung,5 Makiko
5 Nakayama,1 Hannah Hugo,1 Florian Buerger,1 David Schapiro,1 Won-Il Choi,1 Jae-woo
6 Kim,6 Ji-Hwan Ryu,5,7 Min Goo Lee,3 Catherine F. Clarke,4 Friedhelm Hildebrandt,1‡ and
7 Heon Yung Gee3‡
8
1 9 Department of Medicine, Division of Nephrology, Boston Children’s Hospital, Harvard
10 Medical School, Boston, MA 02115, USA
2 11 Department of Medicine, Renal Division, Medical Center – University of Freiburg,
12 Faculty of Medicine, University of Freiburg, Freiburg, Germany
13 3Department of Pharmacology, Brain Korea 21 PLUS Project for Medical Sciences,
14 Yonsei University College of Medicine, Seoul 03722, Korea
4 15 Department of Chemistry and Biochemistry and Molecular Biology Institute, UCLA, Los
16 Angeles, CA, USA
17 5Severance Biomedical Science Institute, Yonsei University College of Medicine, Seoul
18 03722, Korea
19 6Department of Biochemistry and Molecular Biology, Brain Korea 21 PLUS Project for
20 Medical Sciences, Yonsei University College of Medicine, Seoul 03722, Korea
21 7Brain Korea 21 PLUS Project for Medical Science, Yonsei University College of
22 Medicine, Seoul 03722, Korea bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
23
24 †These authors contributed equally to this study.
25
26 ‡Correspondence should be addressed to
27 Name: Heon Yung Gee, MD, PhD
28 Address: Department of Pharmacology
29 Yonsei University College of Medicine
30 Avison BioMedical Research Center Rm#225
31 50-1 Yonsei-ro, Seodaemun-gu
32 Seoul 03722, Republic of Korea
33 Phone: +82 2 2228 0755
34 Fax: +82 2 313 1894
35 Email: [email protected]
36
37 or
38
39 Name: Friedhelm Hildebrandt, MD
40 Address: Boston Children’s Hospital, EN561
41 300 Longwood Avenue
42 Boston, MA 02115, USA
43 Phone: +1 (617) 355-6129
44 Fax.: +1 (617) 730-0569
45 Email: [email protected] bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
46 Abstract
47
48 ADCK4 mutations usually manifest as steroid-resistant nephrotic syndrome, and cause
49 coenzyme Q10 (CoQ10) deficiency. However, the function of ADCK4 remains obscure.
50 We investigated ADCK4 function using mouse and cell models. Podocyte-specific
51 Adck4 deletion in mice significantly reduced survival and caused severe focal
52 segmental glomerular sclerosis with extensive interstitial fibrosis and tubular atrophy,
53 which were prevented by treatment with 2,4-dihydroxybenzoic acid (2,4-diHB), an
54 analog of CoQ10 precursor molecule. ADCK4 knockout podocytes exhibited significantly
55 decreased CoQ10 level, respiratory chain activity, mitochondrial potential, and
56 dysmorphic mitochondria with loss of cristae formation, which were rescued by 2,4-diHB
57 treatment, thus attributing these phenotypes to decreased CoQ10 levels. ADCK4
58 interacted with mitochondrial proteins including COQ5, and also cytoplasmic proteins
59 including myosin and heat shock proteins. ADCK4 knockout decreased COQ complex
60 levels, and the COQ5 level was rescued by ADCK4 overexpression in ADCK4 knockout
61 podocytes. Overall, ADCK4 is required for CoQ10 biosynthesis and mitochondrial
62 function in podocytes.
63 bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
64 Introduction
65
66 Coenzyme Q (CoQ, ubiquinone), a lipophilic component located in the inner
67 mitochondrial membrane, Golgi apparatus, and cell membrane, plays a pivotal role in
68 oxidative phosphorylation (Stefely & Pagliarini, 2017). CoQ shuttles electrons from
69 complexes I and II to complex III in the mitochondrial respiratory chain (Mitchell, 1975).
70 It also has a critical function in antioxidant defense owing to its redox potential (Mugoni,
71 Postel et al., 2013). The CoQ biosynthesis pathway has been extensively studied in
72 Saccharomyces cerevisiae (Tran & Clarke, 2007). At least 12 proteins encoded by the
73 Coq genes form a complex, simultaneously stabilizing each other, and are involved in
74 coenzyme synthesis (Tran & Clarke, 2007). Based on protein homology, approximately
75 15 homologous genes have been identified in humans (Stefely & Pagliarini, 2017).
76 Primary CoQ deficiencies due to mutations in ubiquinone biosynthetic genes
77 (COQ2, COQ4, COQ6, COQ7, COQ9, PDSS1, PDSS2, ADCK3, and ADCK4) have
78 been identified (Ashraf, Gee et al., 2013, Diomedi-Camassei, Di Giandomenico et al.,
79 2007, Heeringa, Chernin et al., 2011, Lagier-Tourenne, Tazir et al., 2008, López,
80 Schuelke et al., 2006, Mollet, Giurgea et al., 2007, Quinzii, Kattah et al., 2005). Clinical
81 manifestations of CoQ10 deficiency vary depending on the genes involved, and
82 mutations in the same gene can result in diverse phenotypes depending on the mutated
83 allele (Acosta, Vazquez Fonseca et al., 2016). COQ2 (Diomedi-Camassei et al., 2007),
84 COQ6 (Heeringa et al., 2011), PDSS2 (López et al., 2006), and ADCK4 (Ashraf et al.,
85 2013) have also been implicated in steroid-resistant nephrotic syndrome (SRNS).
86 Although SRNS has no therapy, SRNS resulting from CoQ deficiency is unique because bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
87 supplementation of CoQ10 alleviates the associated clinical symptoms (Ashraf et al.,
88 2013, Heeringa et al., 2011, Korkmaz, Lipska-Zietkiewicz et al., 2016). This is partially
89 true for ADCK4-related glomerulopathy, and several cases have been reported
90 accordingly (Ashraf et al., 2013, Korkmaz et al., 2016). Recently, 2,4-dihydroxybenzoic
91 acid (2,4-diHB), a metabolic intermediate of CoQ10, which can be used to bypass a
92 defect in COQ7, has been shown to ameliorate disparate phenotypes in mouse models
93 caused by heterogeneous enzymatic defects in CoQ biosynthesis (Wang, Oxer et al.,
94 2015). Mutations in the ADCK4 (aarF domain containing kinase 4, also known as
95 COQ8B) gene generally manifest as adolescence-onset SRNS, sometimes
96 accompanied with medullary nephrocalcinosis or extrarenal symptoms, including
97 seizures (Ashraf et al., 2013, Park, Kang et al., 2017). The molecular mechanisms
98 underlying SRNS resulting from ADCK4 mutations are not well understood, largely
99 because the function of ADCK4 is unclear.
100 ADCK3 (also known as COQ8A) and ADCK4 are two mammalian orthologs of
101 yeast Coq8p/Abc1, which belongs to the microbial UbiB family; they appear to result
102 from gene duplication in vertebrates (Kannan, Taylor et al., 2007, Lagier-Tourenne et al.,
103 2008). UbiB and Coq8p are required for CoQ biosynthesis in prokaryotes and yeast,
104 respectively, and are speculated to activate an unknown mono-oxygenase in the CoQ
105 biosynthesis pathway (Kannan et al., 2007). Coq8p, ADCK3, and ADCK4 are present in
106 the matrix of the inner mitochondrial membrane (Pagliarini, Calvo et al., 2008, Tauche,
107 Krause-Buchholz et al., 2008, Vazquez Fonseca, Doimo et al., 2018). Coq8p is
108 essential for the organization of high molecular mass Coq polypeptide complex and for
109 phosphorylated forms of the Coq3, Coq5, and Coq7 polypeptides that are involved in bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
110 methylation and hydroxylation steps in CoQ biosynthesis (He, Xie et al., 2014, Tauche
111 et al., 2008). Similarly, it has been shown that ADCK3 interacts with CoQ biosynthesis
112 enzymes in a protein complex (complex Q) (Floyd, Wilkerson et al., 2016). ADCK3 lacks
113 protein kinase activity in the trans form and exhibits ATPase activity through its KxGQ
114 motif (Stefely, Licitra et al., 2016). It is not clear whether ADCK4 functions in a manner
115 similar to that of ADCK3. Therefore, in this study, we investigated the function of ADCK4
116 using mouse and cell models.
117 118 Results
119
120 Podocyte-specific Adck4 knockout mice developed progressive proteinuria and
121 severe focal segmental glomerular sclerosis, and presented increased mortality
122 in adulthood
123 To evaluate the role of Adck4 in kidney function, we generated a transgenic Adck4
124 (Adck4tm1a) mouse line, using embryonic stem cells obtained from EUCOMM (Appendix
125 Fig S1A). Efficient targeting of the Adck4 gene was confirmed by genotyping
126 (Appendix Fig S1B and C). Whole body loss of Adck4 in Adck4tm1a mouse was found
127 to be lethal, which is consistent with the report of the International Mouse Phenotyping
128 Consortium (IPMC; www.mousephenotype.org). To circumvent Adck4tm1a embryonic
129 lethality, we generated podocyte-specific Adck4 knockout (KO) mice Adck4tm1d or
130 Nphs2.Cre+;Adck4flox/flox (hereafter referred to as Adck4ΔPodocyte), by crossing Nphs2-Cre+
131 mouse with Adck4flox/flox mouse in which two loxP sites surround exons 5 and 6 in the
132 Adck4 gene. While young Adck4ΔPodocyte mice appeared grossly normal, increased bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
133 morbidity (hunched posture and seedy fur) (Appendix Fig S1D) and a significantly
134 increased mortality (Fig 1A) were observed in older (> 9 months old) Adck4ΔPodocyte mice
135 compared with those in littermate controls. Necropsy of 10-month-old Adck4ΔPodocyte
136 mice revealed pale and significantly small kidneys compared with those in littermate
137 controls (Appendix Fig S1E and F), indicating that podocyte-specific deletion of Adck4
138 causes structural and functional kidney defects in Adck4ΔPodocyte mice. To examine the
139 renal function of Adck4ΔPodocyte mice, we performed serial urine and plasma analyses for
140 18 consecutive months. Adck4ΔPodocyte mice displayed the first significant decrease in
141 plasma albumin level at 5 months of age (Appendix Fig S1G) and the first significant
142 increase in albumin/creatinine ratio (18.81 fold, p = 0.0005) remained significant
143 throughout the study period compared with those in littermate controls (Fig 1B). The
144 increase over time in albuminuria was the maximum, up to 31.2-fold, in Adck4ΔPodocyte
145 mice compared with that in littermate controls (Fig 1B). The onset of kidney function
146 decline in Adck4ΔPodocyte mice was associated with a significant increase in plasma
147 creatinine and plasma BUN levels at 7 months of age, progressing to chronic kidney
148 disease, followed by renal failure and consequently death (Appendix Fig S1H-J and
149 Fig 1A). Histological analysis of kidneys from Adck4ΔPodocyte mice at 10 months of age
150 demonstrated severe global and focal segmental glomerular sclerosis (FSGS) with
151 extensive interstitial fibrosis and tubular atrophy (Fig 1C and Appendix Fig S1K). To
152 characterize the glomerular phenotype of Adck4ΔPodocyte mice, we quantified the number
153 of sclerotic glomeruli in the non-treated mutant mice at 10 months of age and found that
154 non-treated Adck4ΔPodocyte mice had significantly increased number of sclerotic glomeruli
155 (mean 96.03%) compared with that in non-treated littermate controls (Appendix Fig bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
156 S2C). In addition, we compared the number of filtration slit units per micrometer of
157 basement membrane in the glomeruli of Adck4ΔPodocyte and wild type mice. The filtration
158 slit frequency was significantly reduced in Adck4ΔPodocyte mice compared with that in wild
159 type mice (Appendix Fig S2E). To characterize the molecular abnormalities in the
160 glomeruli of Adck4ΔPodocyte mice, we analyzed the expression pattern of the slit
161 diaphragm proteins podocin (Fig 1D) and nephrin (Appendix Fig S3A), basement
162 membrane marker nidogen, and primary process marker synaptopodin (Appendix Fig
163 S4A) by confocal microscopy in the kidneys of 10-month-old mice. Staining of various
164 podocyte markers was significantly reduced in the glomeruli of Adck4ΔPodocyte mice
165 compared with that of the control glomeruli (Appendix Fig S3C, S4B, and S5A and B),
166 while the basement membrane marker nidogen showed a higher expression in these
167 mice than in normal mice (Fig 1D and Appendix Fig S4A), demonstrating that Adck4
168 function is required for podocyte maintenance and homeostasis. As glomerular sclerosis
169 is associated with increased expression of fibrotic markers, we analyzed the expression
170 of the fibrotic markers, collagen IV (Appendix Fig S3A), and αSMA (Appendix Fig S6A)
171 in the kidneys of Adck4ΔPodocyte mice by confocal microscopy. Indeed, the kidneys of
172 Adck4ΔPodocyte mice presented significantly increased expression of collagen IV
173 (Appendix Fig S3E) and αSMA (Appendix Fig S6B) in the glomeruli, characteristic of
174 glomerular fibrosis. To study the structural changes in the glomeruli of Adck4ΔPodocyte
175 mice at the ultrastructural level, we performed transmission electron microscopy (TEM)
176 using the kidney of 10-month-old Adck4ΔPodocyte mice. Consistent with its localization and
177 function in the mitochondria, the podocytes in the glomeruli of Adck4ΔPodocyte mice
178 appeared to contain abnormal, functionally impaired mitochondria characterized by bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
179 hyperproliferation and increased size (Fig 1E), presumably to compensate for their
180 defective energy metabolism. The results revealed the abnormal structure of glomeruli,
181 severe foot process effacement, and disturbed podocyte morphology in Adck4ΔPodocyte
182 mice (Fig 1E). Overall, the glomerular phenotype of podocyte-specific Adck4 KO mice
183 recapitulates the pathology of FSGS in humans resulting from ADCK4 mutations.
184
185 Treatment with 2,4-dihydroxybenzoic acid prevented the development of renal
186 pathology in podocyte-specific Adck4 knockout mice
187 Given that albuminuria started at around 4 months of age and renal structural
188 abnormalities and functional decline manifested relatively late in Adck4ΔPodocyte mice, we
189 decided to initiate the treatment with 2,4-diHB at 25 mM concentration in drinking water
190 when the mice were 3 months old, in order to prevent the disease onset and to mitigate
191 disease progression. Supplementation of 2,4-diHB did not have any effect on the
192 survival rate, albumin/creatinine ratio, and kidney function and histology of the control
193 mice (Fig 2 A and B, and Appendix Fig S2, A and G-J). Adck4ΔPodocyte mice treated
194 with 2,4-diHB showed a normal survival rate despite maintaining proteinuria (Fig 2B)
195 compared with that of healthy treated littermate controls (Fig 2A) and a significantly
196 improved survival rate (p = 0.0078) compared with that of non-treated Adck4ΔPodocyte
197 mice, which displayed an increased mortality rate progressing to end-stage renal
198 disease (ESRD) with a median survival period of 316 days and hazard ratio of 9.36
199 (Appendix Fig S2A). The mortality rate reduction in Adck4ΔPodocyte mice treated with
200 2,4-diHB was associated with significantly improved plasma albumin level and renal
201 function (Appendix Fig S2, G to J). This revealed normal glomerular histology (Fig 2C bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
202 and Appendix Fig S2B) and a significantly reduced rate of sclerotic glomeruli (mean
203 14.76%) in 18-month-old treated Adck4ΔPodocyte mice (Appendix Fig S2D). The
204 improvement in functional, histological, and ultrastructural findings in Adck4ΔPodocyte mice
205 treated with 2,4-diHB was also associated with significantly improved expression of the
206 slit diaphragm proteins podocin (Fig 2D, and Appendix Fig S5C and D) and nephrin
207 (Appendix Fig S3B and D), although the expression of the primary process marker
208 synaptopodin remained reduced (Appendix Fig S4C and D). Moreover, 18-month-old
209 Adck4ΔPodocyte mice treated with 2,4-diHB showed significantly reduced expression of the
210 fibrotic markers, collagen IV (Appendix Fig S3B and F) and SMA (Appendix Fig S6C
211 and D). Treatment with 2,4-diHB helped maintain the normal podocyte morphology and
212 configuration at the ultrastructural level in the glomeruli of Adck4ΔPodocyte mice (Fig 2E)
213 by preserving normal slit morphology, but the filtration slit frequency was decreased
214 compared to that of littermate controls (Appendix Fig S2F). In summary, the treatment
215 of Adck4ΔPodocyte mice with 2,4-diHB significantly prevented the development of FSGS
216 and foot process effacement, maintaining normal renal function in treated mice at 18
217 months of age. Therefore, our findings demonstrate that 2,4-diHB is effective in
218 protecting against renal disease progression and in improving survival in Adck4ΔPodocyte
219 mice.
220
221 Loss of ADCK4 caused mitochondrial defects in podocytes
222 To investigate the function of ADCK4 at the cellular level, we generated ADCK4
223 knockout (KO) cells of human podocytes and HK2 cells, which were originated from
224 human proximal tubule epithelial cells. Each cell line was subjected to deletion of exon 6 bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
225 of the ADCK4 gene using the CRISPR/Cas9 system, and the absence of ADCK4
226 expression was confirmed by immunoblotting (Appendix Fig S7A-E). Knockout of
227 ADCK4 did not affect the viability of both cell lines (Appendix Fig S7F and G). We have
228 previously shown that the level of CoQ10 decreased in fibroblasts and lymphoblasts
229 derived from patients with ADCK4 mutations (Ashraf et al., 2013), but not in podocytes.
230 Therefore, in the present study, we verified this finding using the established KO cells
231 and found that ADCK4 KO resulted in decreased CoQ9 in both cultured podocytes and
232 HK-2 cells compared to that in control cells (Fig 3A). However, CoQ10 was reduced only
233 in cultured podocytes, but not in HK-2 cells (Fig 3B). The basal CoQ10 level in
234 podocytes was three-fold higher than that in HK-2 cells (Fig 3B). As CoQ shuttles
235 electrons from complexes I and II to complex III in the mitochondrial respiratory chain
236 (Mitchell, 1975), the activity of complex II-III is dependent on the CoQ10 level in the
237 mitochondria. Therefore, we measured the activity of complexes II and II-III and found
238 that the activity of both was significantly reduced in ADCK4 KO podocytes (Fig 3C)
239 compared to that in control cells, but not in ADCK4 KO HK-2 cells (Fig 3D). Decreased
240 complex II-III activity observed in ADCK4 podocytes was partially rescued by the
241 addition of 2,4-diHB to culture media (Fig 3E). The reduced form of CoQ (QH2) plays a
242 role as a potent lipid-soluble antioxidant, scavenging free radicals and preventing lipid
243 peroxidative damage (Stefely & Pagliarini, 2017). Although ADCK4 KO in itself did not
244 affect the viability of cultured podocytes (Appendix Fig S7F and G), we examined cell
245 viability upon arachidonic acid (AA) treatment because CoQ-deficient yeast mutants
246 were found to be more sensitive to polyunsaturated fatty acids such as AA, which are
247 prone to autoxidation and breakdown into toxic products (Do, Schultz et al., 1996). AA bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
248 treatment reduced cell viability in both the control and ADCK4 KO podocytes, and
249 ADCK4 KO podocytes were relatively more affected (Fig 3F). Decreased cell viability by
250 AA treatment was rescued by supplementation of 2,4-diHB (Fig 3F). Overall, these
251 findings suggested that the loss of ADCK4 caused CoQ deficiency and that podocytes
252 were more susceptible than HK-2 cells were.
253 To comprehensively understand the molecular changes induced by the KO of
254 ADCK4, we performed proteomic analysis and quantified protein abundance changes
255 by MS-based proteomics using isobaric tag for relative and absolute quantification
256 (iTRAQ) (Chung, Lagranha et al., 2015) in podocytes with and without AA treatment.
257 Proteomic characterization of the control and ADCK4 KO podocytes revealed more than
258 2,500 proteins, and 421 (16%) proteins were mitochondrial proteins. By Gene Ontology
259 (GO) analysis, using DAVID functional annotation tool (david.abcc.ncifcrf.gov),
260 differentially expressed proteins in the control and ADCK4 KO cells were divided into
261 the following three categories of GO annotations: biological process, cellular component,
262 and molecular function. The results indicated that proteins related to cellular defense
263 response were upregulated and those associated with cytokine production pathway
264 were downregulated in ADCK4 KO podocytes compared with those in the control cells
265 (Appendix Fig S7H). In an injury situation, with the use of AA treatment, coenzyme
266 metabolism-related proteins and intermediate filament related proteins were
267 downregulated, whereas DNA regulation proteins were up-regulated in ADCK4 KO
268 podocytes (Appendix Fig S7I).
269
270 Disrupted mitochondrial morphology and mitochondrial membrane potential were bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
271 observed in ADCK4 knockout podocytes
272 Abnormal proliferation of polymorphous mitochondria in the cytoplasm of podocytes is
273 one of the characteristic ultrastructural findings of CoQ10-related diseases (Diomedi-
274 Camassei et al., 2007). Similarly, patients with ADCK4 mutations showed mitochondrial
275 abnormalities in podocytes and proximal tubules (Park et al., 2017). We examined the
276 ultrastructure of mitochondria in control and ADCK4 KO cells by TEM. The formation of
277 cristae was disrupted and the shape of mitochondria was disintegrated in ADCK4 KO
278 podocytes (Fig 4A-H), whereas ADCK4 KO HK-2 cells showed normal features of the
279 mitochondria (Appendix Fig S8A-H). We also observed the effect of AA treatment on
280 the ultrastructure of mitochondria by TEM. While the mitochondria of control podocytes
281 were less affected by AA (Fig 4I), AA-treated ADCK4 KO podocytes showed more
282 severe mitochondrial defects such as swollen and shortened cristae, and fewer inner
283 membranes (Fig 4J). These results indicate that ADCK4 KO confers susceptibility to
284 cellular stress, such as autoxidation of polyunsaturated fatty acids. To examine
285 functional defects of mitochondria in ADCK4 KO cells, we measured the mitochondrial
286 membrane potential using the JC-10 dye, which is concentrated in the mitochondrial
287 matrix based on membrane polarization (Li, Yu et al., 2013). The results revealed the
288 presence of inactive mitochondria in ADCK4 KO podocytes (Fig 4K). This finding was
289 confirmed by another mitochondrial membrane potential assay using the potentiometric
290 probe tetramethylrhodamine methyl ester (TMRM)-based fluorimetric assay. TMRM
291 fluorescence intensity was significantly reduced in ADCK4 KO cells; however,
292 supplementation of 2,4-diHB partially restored the lowered mitochondrial membrane
293 potential (Fig 4L). In contrast, mitochondrial membrane potential was not different bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
294 between the control and KO in HK-2 cells (Appendix Fig S8I and J). Therefore, the
295 loss of ADCK4 caused morphological and functional defects of mitochondria in cultured
296 podocytes by disrupting CoQ10 biosynthesis.
297 As we previously reported that ADCK4 knockdown reduced podocyte migration
298 (Ashraf et al., 2013), in the present study, we examined the cytoskeleton of ADCK4 KO
299 cells. Actin phalloidin staining revealed shrunk cellular area in ADCK4 KO podocytes
300 (Fig 4M), whereas ADCK4 KO HK-2 showed surface area similar to that of control HK-2
301 cells (Appendix Fig S8K and L). Interestingly, shrunk cellular area in ADCK4 KO
302 podocytes was not restored by 2,4-diHB supplementation, suggesting that this cellular
303 phenotype is not related to decreased CoQ10 level and that ADCK4 might have other
304 cellular functions in addition to its role in the CoQ biosynthesis pathway. AA treatment
305 significantly reduced cellular area in both the control and ADCK4 KO podocytes (Fig
306 4M). Shrunk cellular area by AA treatment was not rescued by 2,4-diHB, further
307 confirming that this phenotype is not related to CoQ10 deficiency (Fig 4M and N).
308
309 ADCK4 interacted with and stabilized COQ proteins
310 We performed proteomic analysis to understand the function of ADCK4 via the
311 identification of its interactome. We generated HEK293 cells that stably overexpressed
312 C-terminal FLAG-tagged bacterial alkaline phosphatase (BAP; BAP-3xFLAG) and
313 ADCK4 (ADCK4-3xFLAG) (Appendix Fig S9A). We confirmed that ADCK4-3xFLAG
314 mostly localized to the mitochondria (Appendix Fig S9B). Following affinity purification
315 using anti-FLAG beads (Appendix Fig S9C and D), protein eluates were analyzed
316 using a liquid chromatograph coupled to a high-resolution mass spectrometer (LC- bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
317 MS/MS). In total, 612 proteins were identified as interactors of ADCK4. Among them,
318 the cytoplasmic proteins, including myosin (MYH10, MYH11, MYO1B, and MYO1C),
319 filamin (FLNC), and kinase proteins (STK24, STK25, STK38 and ROCK1) were
320 detected. In addition, the mitochondrial proteins, including ATP synthase subunit
321 (ATP5L), cytochrome c oxidase subunit (COX6A1 and UQCRQ), and COQ5, were also
322 identified as interactors (Fig 5A). GO analysis of mitochondrial interactors showed that
323 these proteins are involved in transferase activity, oxidoreductase activity, nucleotide
324 binding, and ATPase activity (Fig 5B). As COQ5, which functions as a C-
325 methyltransferase in the CoQ biosynthesis pathway (Nguyen, Casarin et al., 2014), was
326 identified as an interactor of ADCK4, we examined the COQ proteins in ADCK4 KO
327 podocytes. Compared with that in the control podocytes, the expression of COQ3,
328 COQ5, and COQ9 was significantly decreased in ADCK4 KO podocytes, indicating that
329 these proteins in complex Q are destabilized in the absence of ADCK4 (Fig 5C and D).
330 Decreased COQ5 was restored not only by transfection of wild type ADCK4, but also by
331 2,4-diHB (Fig 5E). In addition, we examined the effect of ADCK4 mutations, which were
332 previously identified in individuals with nephrotic syndrome (Ashraf et al., 2013). COQ5
333 was also rescued by ADCK4 mutant proteins; however, the extent of the rescue was
334 less than that by wild type ADCK4 (Fig 5F). In addition, as STK38 is a negative
335 regulator of MAPKKK1/2 kinase signaling (Enomoto, Kido et al., 2008), we examined
336 the MAPK pathway by western blotting and found that phosphorylated ERK1/2 was
337 significantly increased in ADCK4 KO podocytes (Fig 5G). Moreover, we observed
338 considerably enhanced MAPK signaling including p-p38, p-ERK1/2, and p-JNK under
339 lipid peroxidation injury induced by AA (Fig 5G). As Coq2 silencing resulted in increased bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
340 autophagy and mitophagy in Drosophila nephrocytes (Zhu, Fu et al., 2017), we
341 examined mTOR and LC3 in ADCK4 KO podocytes; however, we could not observe
342 increased LC3-II expression (Appendix Fig S10). Taken together, ADCK4 contributes to
343 stabilizing the Q complex, elucidating CoQ deficiency in the absence of ADCK4, and
344 other signaling pathways were also affected upon ADCK4 KO in podocytes.
345
346 Discussion
347 In this study, we demonstrated that podocyte-specific deletion of Adck4 in mice resulted
348 in proteinuria and foot process effacement, recapitulating the features of nephrotic
349 syndrome caused by ADCK4 mutations. These defects were efficiently ameliorated by
350 2,4-diHB, an unnatural precursor analog of the CoQ biosynthesis pathway. ADCK4 KO
351 podocytes exhibited reduced activity under complex II+III, mitochondrial defects, and
352 sensitivity to AA, which resulted from CoQ deficiency. ADCK4 mutations cause
353 adolescence-onset nephrotic syndrome, which mostly progresses to ESRD in the
354 second decade of life (Korkmaz et al., 2016). The late onset of renal disease is
355 differentiated from nephropathy resulting from mutations in WT1, NPHS1, or NPHS2,
356 which usually manifests in the first year of life. Similarly, in the present study,
357 Adck4ΔPodocyte mice exhibited renal disease, which started around 4 months and
358 progressed to ESRD by 12 months. ADCK4-associated glomerulopathy can be partially
359 treated by CoQ10 supplementation, but it is not always successful (Ashraf et al., 2013,
360 Feng, Wang et al., 2017, Korkmaz et al., 2016). Failure to respond to CoQ
361 supplementation can be attributed to several possible causes, and one of the causes
362 might be the progression of renal disease to the irreversible stage. Therefore, early bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
363 genetic diagnosis is necessary to recognize ADCK4 mutations. In this regard, as the
364 onset of ADCK4-associated glomerulopathy is relatively late, if properly diagnosed, its
365 therapy can be initiated before the disease becomes fulminant. Another reason for the
366 failure of CoQ supplementation might be the poor oral availability of CoQ, which makes
367 its therapeutic efficacy variable and limited. In the present study, we demonstrated that
368 2,4-diHB efficiently ameliorated proteinuria and prevented FSGS in Adck4ΔPodocyte mice.
369 2,4-diHB has also been shown to be more effective in tamoxifen-inducible Mclk1/Coq7
370 KO mice than CoQ (Wang et al., 2015). It seems more readily absorbed than CoQ and
371 is safe, as it has been used as a food flavor modifier owing to its sweet taste. Therefore,
372 translational studies are required to investigate whether 2,4-diHB can be effective in
373 individuals with ADCK4 mutations.
374 2,4-diHB is expected to be beneficial for enzymatic deficiency in the CoQ
375 biosynthetic pathway as it bypasses the defect in COQ7 (Stefely & Pagliarini, 2017,
376 Wang et al., 2015). Therefore, it is actually interesting that 2,4-diHB rescued disease
377 phenotypes in Adck4ΔPodocyte mice as ADCK4, although an uncharacterized
378 mitochondrial protein, is not an enzyme directly involved in the CoQ biosynthetic
379 pathway. This finding suggests that ADCK4 supports an enzymatic component in CoQ
380 biosynthesis. We found that ADCK4 interacts with COQ5 by proteomic analysis and that
381 the expression of proteins in complex Q, COQ3, COQ5, and COQ9, was significantly
382 decreased in ADCK4 KO podocytes. It has been previously suggested that a physical
383 and functional interaction between ADCK3 and COQ5 is important (Floyd et al., 2016,
384 Stefely et al., 2016).
385 In the present study, phalloidin staining showed that the cytoskeleton of only bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
386 podocytes was defective, but not that of HK-2 cells. This observation suggests that
387 mitochondrial dynamics might also play important roles in maintaining the shape and
388 function of podocytes because podocytes, like neurons (Imasawa & Rossignol, 2013),
389 require a proper supply and high amount of energy to maintain their foot processes. In
390 addition, as the foot process has rich microfilaments, these interactions might also
391 participate in podocyte homeostasis (Greka & Mundel, 2012, Suleiman, Roth et al.,
392 2017). Moreover, these cytoskeletal defects in ADCK4 KO podocytes were also
393 consistent with the iTRAQ analysis data, which elucidated that cytoskeleton-related
394 proteins were down-regulated in ADCK4 KO podocytes compared to those in control
395 podocytes. In contrast to other cellular defects, the shrunk cytoskeleton of ADCK4 KO
396 podocytes was not rescued by 2,4-diHB, suggesting that this cellular phenotype might
397 not be related to CoQ10 deficiency. This also explains why CoQ
398 CoQ10 is well known for its antioxidant activity, protecting cells from oxidative
399 stress (Mugoni et al., 2013). In this study, we treated the cells with AA, one of the
400 polyunsaturated fatty acids, to induce lipid peroxidation stress and found that the MAPK
401 pathway signaling was activated in ADCK4 KO podocytes. The MAPK signaling
402 pathway is essential in regulating several cellular processes including inflammation, cell
403 stress response, and cell proliferation (Cowan & Storey, 2003). In addition, AA treatment
404 more significantly reduced cell viability in ADCK4 podocytes than in control podocytes,
405 and the reduced viability was rescued by the supplementation of 2,4-diHB. The reduced
406 form of CoQ10 might scavenge lipid peroxyl radicals and function as an antioxidant and
407 prevent the initiation of lipid peroxidation as it has been reported to eliminate perferryl
408 radicals (Ernster & Forsmark-Andree, 1993, Stefely & Pagliarini, 2017). In this regard, bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
409 ADCK4 KO might confer hypersensitivity to lipid peroxidation stress. This suggests that
410 cellular stress may be necessary to develop renal diseases in addition to loss of ADCK4,
411 partially explaining the relative late onset of nephrotic syndrome resulting from ADCK4
412 mutations.
413 Recent studies have revealed that ADCK3 lacks canonical protein kinase activity
414 in the trans form; instead, it binds to lipid CoQ10 intermediates and exhibits ATPase
415 activity(Reidenbach, Kemmerer et al., 2018, Stefely et al., 2016). In the present study,
416 GO analysis also revealed that interactors of ADCK4, especially in the mitochondria, are
417 significantly associated with oxidoreductase activity, which can be related to the
418 antioxidant property of CoQ10. Furthermore, proteomic analysis revealed the ATP
419 binding protein as an ADCK4 interactor, suggesting that ADCK4 has the ATPase activity,
420 like ADCK3. Yet, the precise role of ADCK4 is not clear, and further studies are required
421 to verify whether ADCK4 has ATPase or kinase activity towards an undiscovered
422 substrate.
423 In conclusion, our study results suggest that ADCK4 in podocytes stabilizes
424 proteins in complex Q in podocytes, and thereby contributes to CoQ synthesis and
425 plays a role in maintaining the cytoskeleton structure. Cellular defects and renal
426 phenotypes by ADCK4 deficiency were mostly rescued by 2,4-diHB supplementation,
427 an unnatural precursor analog of CoQ10, demonstrating the important role of ADCK4 in
428 the CoQ biosynthesis pathway. Our study provides insights into the functions of ADCK4
429 in CoQ biosynthesis and pathogenesis of nephrotic syndrome. bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
430 Materials and Methods
431
432 Mouse breeding and maintenance
433 The animal experimental protocols were reviewed and approved by the Institutional
434 Animal Care and Use Committee of University of Michigan (#08619), Boston Children's
435 Hospital (#13-01-2283), and Yonsei University College of Medicine (#2015-0179). All
436 mice were handled in accordance with the Guidelines for the Care and Use of
437 Laboratory Animals. Mice were housed under pathogen-free conditions with a light
438 period from 7:00 AM to 7:00 PM, and had ad libitum access to water and rodent chow.
439 The mice were randomly assigned to the different experimental groups. Targeted
440 Adck4tm1a(EUCOMM)Hmgu (Adck4tm1a) embryonic stem cells were obtained from EUCOMM
441 and injected into the blastocysts of mice. Chimeric mice were bred with C57BL/6J mice
442 to establish germline transmission. Nphs2.Cre+ (stock #008205) and Pgk1.Flpo+
443 (#011065) mice were obtained from Jackson Laboratory. Genotyping was performed by
444 standard PCR; the primer sequences are available upon request.
445
446 Supplementation of 2,4-diHB to the mice in drinking water
447 2,4-diHB at a concentration of 25 mM was administered to the mice via drinking water
448 and changed twice a week. The treatment was started at 3 months of age and
449 continued up to 18 months of age.
450
451 Urine analysis
452 Urine was collected by housing the mice overnight (12 h) in metabolic cages. All bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
453 samples were immediately frozen and stored at -80°C. The samples were thawed on ice
454 prior to urine albumin and creatinine measurements. Urinary albumin was measured
455 using the Albumin Blue Fluorescent Assay Kit (Active Motif), as per the manufacturer’s
456 instructions. Urine creatinine was measured using the LC-MS/MS method as described
457 previously (Young, Struys et al., 2007) Proteinuria was expressed as milligram of
458 albumin per milligram of creatinine.
459
460 Whole blood and plasma analysis
461 Blood from the mice was drawn using the facial vein bleeding method and collected in
462 citrate tubes. The whole blood sample was subsequently analyzed using the Vetscan®
463 VS2 Chemistry Analyzer, as per manufacturer’s instructions. Plasma samples obtained
464 by centrifugation of whole blood were immediately frozen at -80°C. Plasma creatinine
465 was measured using the LC-MS/MS method as described previously (Young et al.,
466 2007).
467
468 Immunoblotting and immunofluorescence staining
469 These experiments were performed as described previously (Hinkes, Wiggins et al.,
470 2006). Anti-Podocin, anti-FLAG M2 (Sigma-Aldrich), anti-Nidogen (Novus), anti-Nephrin
471 (Progen), anti-COQ3, anti-COQ5, anti-COQ9 (Proteintech), anti-p-mTOR, anti-mTOR,
472 anti-p-p38, anti-p-ERK, anti-pJNK, anti-p38, anti-LC3 (Cell Signaling), anti-COXIV, anti-
473 actin (Abcam), and ADCK4 (LSBio) were purchased from the indicated commercial
474 sources. Alexa Fluor 488 Phalloidin and secondary antibodies were purchased from
475 Invitrogen. Fluorescent images were obtained using an SP5X laser scanning bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
476 microscope (Leica) or LSM 700 microscope (Carl Zeiss). Images were processed and
477 analyzed using Leica AF, ImageJ, and Adobe Photoshop CS6 software.
478
479 Histological analysis
480 The kidney tissues were fixed in 4% paraformaldehyde (PFA), sectioned (5 µm
481 thickness), and stained with hematoxylin and eosin, periodic acid-Schiff, Masson’s
482 trichrome, and Jone’s silver following the standard protocols for histological examination.
483
484 Ultrastructural analysis
485 The kidney tissues and cells were fixed in 2.5% glutaraldehyde, 1.25% PFA, and 0.03%
486 picric acid in 0.1 M sodium cacodylate buffer (pH 7.4) overnight at 4°C. They were
487 washed with 0.1 M phosphate buffer, post-fixed with 1% OsO4 dissolved in 0.1M
488 phosphate-buffered saline (PBS) for 2 h, dehydrated in ascending gradual series (50‒
489 100%) of ethanol, and infiltrated with propylene oxide. Samples were embedded using
490 the Poly/Bed 812 Kit (Polysciences). After pure fresh resin embedding and
491 polymerization in a 65°C oven (TD-700, DOSAKA, Japan) for 24 h, sections of
492 approximately 200–250 nm thickness were cut and stained with toluidine blue for light
493 microscopy. Sections of 70-nm thickness were double stained with 6% uranyl acetate
494 (EMS, 22400) for 20 min and lead citrate (Fisher) for 10 min for contrast staining. The
495 sections were cut using LEICA EM UC-7 (Leica) with a diamond knife (Diatome) and
496 transferred on to copper and nickel grids. All the sections were observed by
497 transmission electron microscopy (JEM-1011, JEOL) at an acceleration voltage of 80 kV.
498 bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
499 Plasmids, cell culture, transfection, and lentivirus transduction
500 sgRNAs targeting human ADCK4 (sgRNA1: GCTGCACAATCCGCTCGGCAT, sgRNA2:
501 GTAAGGTCTGCACAATCCGCT, and sgRNA3: GACCTTATGTACAGTTCGAG,) were
502 cloned into BsmBI-digested lentiCRISPR v2 (Addgene plasmid #52961). ADCK4 cDNA
503 was cloned into the p3xFLAG CMV26 (C-terminal) vector (Sigma-Aldrich). BAP cDNA
504 cloned into the p3xFLAG CMV7 vector was digested using Kpn1 and EcoR1 restriction
505 enzymes (New England BioLabs) and ligated into the p3xFLAG CMV24 vector.
506 Immortalized human podocytes (Saleem, O'Hare et al., 2002) were maintained in
507 RPMI + GlutaMAX™-I (Gibco) supplemented with 10% FBS, penicillin (50
508 IU/mL)/streptomycin (50 μg/mL), and insulin-transferrin-selenium-X. Human proximal
509 tubule cells (HK-2) and HEK293 were maintained in DMEM supplemented with 10%
510 FBS and 1% penicillin/streptomycin. Plasmids were transfected into podocytes or
511 HEK293 cells using Lipofectamine 2000 (Invitrogen). HEK293 cells stably expressing
512 p3xFLAG-ADCK4 or BAP were selected and maintained with 1 mg/mL G418.
513 To establish ADCK4 KO cells, lentiCRISPR v2, pMD2.G, and psPAX2 were
514 transfected into Lenti-X 298T cells (Clontech). Supernatant containing lentivirus was
515 collected 48 h after transfection and passed through a 0.2-M filter. Cultured podocytes
516 and HK-2 cells were transduced with lentivirus, selected, and maintained with 4 μg/mL
517 puromycin.
518
519 Cell viability assay
520 Cell viability assay was performed using the Cell Counting Kit-8 (Dong-in bio.). Cell
521 suspension (100 µL; 1 × 105/mL) with culture medium was added to a 96-well plate and bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
522 incubated for 24 h in a CO2 incubator. The medium was replaced with phenol-free fresh
523 medium with or without 30 µM AA and/or 500 µM 2,4-diHB for 15 h. Four wells were
524 included under the same conditions. CCK-8 reagent (10 µL) was added to each well
525 and the cells were incubated for 1 h; optical density of the sample at 450 nm was
526 measured.
527
528 Cellular lipid extraction and CoQ measurements via HPLC-MS/MS
529 Cells (approximately 0.1 g) were thawed on ice and resuspended in 1.5 mL of PBS
530 (0.14 M NaCl, 12.0 mM NaH2PO4, and 8.1 mM Na2HPO4; pH 7.4), followed by
531 homogenization using a polytron (Kinematica PT 2500E) for 1 min at 10 000 rpm on ice.
532 Lipid extracts were prepared as previously described with some minor
533 modifications(Fernández-Del-Río, Nag et al., 2017). Briefly, dipropoxy-CoQ10 was used
534 as the internal standard and was added at a constant volume to all the cell pellets and
535 to a set of five CoQ9 and CoQ10 standards of known concentrations ranging linearly
536 from 7.2 pmol to 400 pmol (to obtain a typical standard curve for CoQ quantification in
537 the cell pellets). The samples were vortexed in 2 mL of methanol for 30 s, followed by
538 addition of 2 mL petroleum ether. After vortexing for an additional 30 s, the organic
539 upper layer was transferred to a new tube. Another 2 mL of petroleum ether was added
540 to the original methanol layer, and samples were vortexed again for 30 s. The organic
541 phase was removed, and the combined organic phase was dried under a stream of
542 nitrogen gas. The samples were resuspended in 200 µL of ethanol containing 1 mg/mL
543 benzoquinone to oxidize all the lipids. Chromatographic separation was achieved
544 through a reverse phase Luna 5 µM PFP(2) column (Phenomenex) with a mobile phase bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
545 comprised of 90% solvent A (95:5 mixture of methanol:isopropanol containing 2.5 mM
546 ammonium formate) and 10% solvent B (isopropanol containing 2.5 mM ammonium
547 formate) at a constant flow rate of 1 mL/min. Transitions monitored were: m/z
548 795.6/197.08 (CoQ9), m/z 812.6/197.08 (CoQ9 with ammonium adduct), m/z
549 863.6/197.08 (CoQ10), m/z 880.6/197.08 (CoQ10 with ammonium adduct), m/z
550 919.7/253.1 (dipropoxy-CoQ10), and m/z 936.7/253.1 (dipropoxy-CoQ10 with ammonium
551 adduct).
552
553 Mitochondrial respiratory enzyme activity measurement
554 Cell lysate (15–50 µg) was diluted in phosphate buffer (50 mM KH2PO4; pH 7.5), and
555 then subjected to spectrophotometric analysis for isolated respiratory chain complex
556 activities at 37°C using a spectrophotometer (PerkinElmer). Complex II activity was
557 measured at 600 nm (ε = 19.1 mmol-1cm-1) after the addition of 20 mM succinate, 80 µM
558 dichlorophenolindophenol (DCPIP), 300 µM KCN, and 50 µM decylubiquinone.
559 Complex II activity was defined as the flux difference with or without 10 mM malonate.
560 Complex II+III activity was also determined at 550 nm (ε = 18.5 mmol-1cm-1) in the
561 presence of 10 mM succinate, 50 µM cytochrome c, and 300 µM KCN. Complex II-III
562 activity was defined as the flux difference before and after the addition of 10 mM
563 thenoyltrifluoroacetone (TTFA). All chemicals were obtained from Sigma-Aldrich.
564
565 Isobaric tag labeling for relative and absolute quantification
566 Isobaric tag labeling for relative and absolute quantification (iTRAQ) was performed by
567 Poochon Scientific as described previously (Chung et al., 2015). Proteins (100 µg) were bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
568 extracted from control and ADCK4 KO podocytes, digested with trypsin, and labeled
569 using the 8-plex iTRAQ Labeling Kit (AB Sciex). The fractionation of iTRAQ-multiplex
570 labeled peptide mixture was carried out using Agilent AdvanceBio Column (2.7 µm, 2.1
571 × 250 mm) and Agilent UHPLC 1290 system (Agilent, Santa Clara, CA). The LC/MS/MS
572 analysis was carried out using Thermo Scientific Q-Exactive hybrid Quadrupole-Orbitrap
573 Mass Spectrometer and Thermo Dionex UltiMate 3000 RSLCnano System (Thermo,
574 San Jose, CA). MS Raw data files were searched against the human protein sequence
575 databases obtained from the NCBI website using Proteome Discoverer 1.4 software
576 (Thermo) based on the SEQUEST and percolator algorithms.
577
578 Identification of ADCK4 interactors
579 Proteins (75 mg) from HEK293 cells stably expressing p3XFLAG-ADCK4 or -BAP were
580 incubated with 80 µL of FLAG M2 agarose beads (Sigma-Aldrich) for 48 h at 4°C in an
581 orbital shaker. The agarose beads were washed four times with lysis buffer to restrict
582 non-specific binding. Subsequently, 200 µL of elution buffer containing 150 ng/µL
583 3xFLAG peptide was added, and then the samples were incubated overnight. The
584 eluates were analyzed by immunoblotting, Coomassie blue staining, and silver staining.
585 The eluates were digested and subjected to NanoLC-MS/MS analysis. ProLuCID was
586 used to identify the peptides (Xu, Park et al., 2015).
587
588 Gene ontology analysis
589 ADCK4 interactors were analyzed using the Database for Annotation, Visualization and
590 Integrated Discovery (DAVID) for functional annotation. The Functional Annotation Tool bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
591 in the online version of DAVID (version 6.8) was run (http://david.abcc.ncifcrf.gov/) using
592 the default parameters and gene ontology categories representing molecular function,
593 cellular component, and biological process were separately analyzed for enrichment. p
594 value < 0.05 was considered significant.
595
596 Statistics
597 Statistical analyses were performed using Graph Pad Prism 7® software. The results are
598 presented as mean ± standard error or standard deviation for the indicated number of
599 experiments. Statistical analysis of continuous data was performed with two-tailed
600 Student’s t test or multiple comparison, as appropriate. Specific tests performed in the
601 experiments are indicated in the figure legends. The results with p < 0.05 were
602 considered statistically significant.
603 bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
604 Acknowledgments
605 We thank Dr. Jin Young Kim and Gina Yoon (Korea Basic Science Institute, Ochang,
606 Division of Biomedical Omics Research) for the NanoLC-MS/MS analysis. We
607 acknowledge the support of the UAB/UCSD O'Brien Core Center for Acute Kidney Injury
608 Research for the LC-MS/MS analysis in this study. We also thank Maria Ericsson, Louis
609 Trakimas, Elizabeth Benecchi, and Peg Coughlin from the Electron Microscope Core
610 Facility, Harvard Medical School, for excellent TEM services and Evelyn Flynn for her
611 outstanding technical assistance. We thank Yonsei Advanced Imaging Center for
612 assistance with the Carl Zeiss microscope. This study was supported by the National
613 Institutes of Health to FH (DK076683). F.H. is the William E. Harmon Professor. H.Y.G.
614 was supported by the Chung-Am (TJ Park) Science Fellowship and the Research
615 Program through the National Research Foundation of Korea (NRF) funded by the
616 Korea Government (MSIT, 2018R1A5A2025079). EW was supported by the Leopoldina
617 Fellowship Program, German National Academy of Sciences Leopoldina (LPDS 2015-
618 07).
619
620 Author contributions
621 E.W., S.Y., M.N., H.H., D.S., W.I.C., and M.G.L. carried out the animal experiments.
622 E.W., S.Y., A.N., Y.W.C., M.N., H.H., F.B, D.S., W.I.C., J.K., J.H.R., M.G.L., and C.F.C.
623 carried out the cell experiments. E.W., S.Y., F.H., and H.Y.G. conceived and directed
624 the study. E.W. and S.Y. wrote the paper with help from F.H. and H.Y.G. The
625 manuscript was critically reviewed by all the authors.
626 bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
627 Conflict of interest
628 F.H. is a cofounder of Goldfinch-Bio. The other authors have declared that no conflict of
629 interest exists. bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
630 REFERENCES
631
632 Acosta MJ, Vazquez Fonseca L, Desbats MA, Cerqua C, Zordan R, Trevisson E,
633 Salviati L (2016) Coenzyme Q biosynthesis in health and disease. Biochimica et
634 Biophysica Acta (BBA) - Bioenergetics 1857: 1079-1085
635 Ashraf S, Gee HY, Woerner S, Xie LX, Vega-Warner V, Lovric S, Fang H, Song X,
636 Cattran DC, Avila-Casado C, Paterson AD, Nitschke P, Bole-Feysot C, Cochat P,
637 Esteve-Rudd J, Haberberger B, Allen SJ, Zhou W, Airik R, Otto EA et al. (2013) ADCK4
638 mutations promote steroid-resistant nephrotic syndrome through CoQ10 biosynthesis
639 disruption. The Journal of clinical investigation 123: 5179-89
640 Chung YW, Lagranha C, Chen Y, Sun J, Tong G, Hockman SC, Ahmad F, Esfahani SG,
641 Bae DH, Polidovitch N, Wu J, Rhee DK, Lee BS, Gucek M, Daniels MP, Brantner CA,
642 Backx PH, Murphy E, Manganiello VC (2015) Targeted disruption of PDE3B, but not
643 PDE3A, protects murine heart from ischemia/reperfusion injury. 112: E2253-E2262
644 Cowan KJ, Storey KB (2003) Mitogen-activated protein kinases: new signaling
645 pathways functioning in cellular responses to environmental stress. 206: 1107-1115
646 Diomedi-Camassei F, Di Giandomenico S, Santorelli FM, Caridi G, Piemonte F, Montini
647 G, Ghiggeri GM, Murer L, Barisoni L, Pastore A, Muda AO, Valente ML, Bertini E, Emma
648 F (2007) COQ2 nephropathy: a newly described inherited mitochondriopathy with
649 primary renal involvement. Journal of the American Society of Nephrology : JASN 18:
650 2773-80
651 Do TQ, Schultz JR, Clarke CF (1996) Enhanced sensitivity of ubiquinone-deficient
652 mutants of Saccharomyces cerevisiae to products of autoxidized polyunsaturated fatty bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
653 acids. Proceedings of the National Academy of Sciences of the United States of
654 America 93: 7534-9
655 Enomoto A, Kido N, Ito M, Morita A, Matsumoto Y, Takamatsu N, Hosoi Y, Miyagawa K
656 (2008) Negative regulation of MEKK1/2 signaling by serine-threonine kinase 38
657 (STK38). Oncogene 27: 1930-8
658 Ernster L, Forsmark-Andree P (1993) Ubiquinol: an endogenous antioxidant in aerobic
659 organisms. The Clinical investigator 71: S60-5
660 Feng C, Wang Q, Wang J, Liu F, Shen H, Fu H, Mao J (2017) Coenzyme Q10
661 supplementation therapy for 2 children with proteinuria renal disease and ADCK4
662 mutation: Case reports and literature review. Medicine 96: e8880
663 Fernández-Del-Río L, Nag A, Gutiérrez Casado E, Ariza J, Awad AM, Joseph AI, Kwon
664 O, Verdin E, de Cabo R, Schneider C, Torres JZ, Burón MI, Clarke CF, Villalba JM (2017)
665 Kaempferol increases levels of coenzyme Q in kidney cells and serves as a biosynthetic
666 ring precursor. Free Radic Biol Med 110: 176-187
667 Floyd Brendan J, Wilkerson Emily M, Veling Mike T, Minogue Catie E, Xia C, Beebe
668 Emily T, Wrobel Russell L, Cho H, Kremer Laura S, Alston Charlotte L, Gromek
669 Katarzyna A, Dolan Brendan K, Ulbrich A, Stefely Jonathan A, Bohl Sarah L, Werner
670 Kelly M, Jochem A, Westphall Michael S, Rensvold Jarred W, Taylor Robert W et al.
671 (2016) Mitochondrial Protein Interaction Mapping Identifies Regulators of Respiratory
672 Chain Function. Molecular Cell 63: 621-632
673 Greka A, Mundel P (2012) Cell Biology and Pathology of Podocytes. Annual Review of
674 Physiology 74: 299-323
675 He CH, Xie LX, Allan CM, Tran UC, Clarke CF (2014) Coenzyme Q supplementation or bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
676 over-expression of the yeast Coq8 putative kinase stabilizes multi-subunit Coq
677 polypeptide complexes in yeast coq null mutants. Biochimica et Biophysica Acta (BBA) -
678 Molecular and Cell Biology of Lipids 1841: 630-644
679 Heeringa SF, Chernin G, Chaki M, Zhou W, Sloan AJ, Ji Z, Xie LX, Salviati L, Hurd TW,
680 Vega-Warner V, Killen PD, Raphael Y, Ashraf S, Ovunc B, Schoeb DS, McLaughlin HM,
681 Airik R, Vlangos CN, Gbadegesin R, Hinkes B et al. (2011) COQ6 mutations in human
682 patients produce nephrotic syndrome with sensorineural deafness. The Journal of
683 clinical investigation 121: 2013-24
684 Hinkes B, Wiggins RC, Gbadegesin R, Vlangos CN, Seelow D, Nurnberg G, Garg P,
685 Verma R, Chaib H, Hoskins BE, Ashraf S, Becker C, Hennies HC, Goyal M, Wharram
686 BL, Schachter AD, Mudumana S, Drummond I, Kerjaschki D, Waldherr R et al. (2006)
687 Positional cloning uncovers mutations in PLCE1 responsible for a nephrotic syndrome
688 variant that may be reversible. Nature genetics 38: 1397-405
689 Imasawa T, Rossignol R (2013) Podocyte energy metabolism and glomerular diseases.
690 The international journal of biochemistry & cell biology 45: 2109-18
691 Kannan N, Taylor SS, Zhai Y, Venter JC, Manning G (2007) Structural and Functional
692 Diversity of the Microbial Kinome. PLOS Biology 5: e17
693 Korkmaz E, Lipska-Zietkiewicz BS, Boyer O, Gribouval O, Fourrage C, Tabatabaei M,
694 Schnaidt S, Gucer S, Kaymaz F, Arici M, Dinckan A, Mir S, Bayazit AK, Emre S, Balat A,
695 Rees L, Shroff R, Bergmann C, Mourani C, Antignac C et al. (2016) ADCK4-Associated
696 Glomerulopathy Causes Adolescence-Onset FSGS. Journal of the American Society of
697 Nephrology : JASN 27: 63-8
698 Lagier-Tourenne C, Tazir M, López LC, Quinzii CM, Assoum M, Drouot N, Busso C, bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
699 Makri S, Ali-Pacha L, Benhassine T, Anheim M, Lynch DR, Thibault C, Plewniak F,
700 Bianchetti L, Tranchant C, Poch O, DiMauro S, Mandel J-L, Barros MH et al. (2008)
701 ADCK3, an Ancestral Kinase, Is Mutated in a Form of Recessive Ataxia Associated with
702 Coenzyme Q10 Deficiency. The American Journal of Human Genetics 82: 661-672
703 Li J, Yu L, Gu X, Ma Y, Pasqualini R, Arap W, Snyder EY, Sidman RL (2013) Tissue
704 plasminogen activator regulates Purkinje neuron development and survival. 110: E2410-
705 E2419
706 López LC, Schuelke M, Quinzii CM, Kanki T, Rodenburg RJT, Naini A, DiMauro S,
707 Hirano M (2006) Leigh Syndrome with Nephropathy and CoQ10 Deficiency Due to
708 decaprenyl diphosphate synthase subunit 2 (PDSS2) Mutations. The American Journal
709 of Human Genetics 79: 1125-1129
710 Mitchell P (1975) Protonmotive redox mechanism of the cytochrome b-c1 complex in the
711 respiratory chain: protonmotive ubiquinone cycle. FEBS letters 56: 1-6
712 Mollet J, Giurgea I, Schlemmer D, Dallner G, Chretien D, Delahodde A, Bacq D, de
713 Lonlay P, Munnich A, Rotig A (2007) Prenyldiphosphate synthase, subunit 1 (PDSS1)
714 and OH-benzoate polyprenyltransferase (COQ2) mutations in ubiquinone deficiency
715 and oxidative phosphorylation disorders. The Journal of clinical investigation 117: 765-
716 72
717 Mugoni V, Postel R, Catanzaro V, De Luca E, Turco E, Digilio G, Silengo L, Murphy MP,
718 Medana C, Stainier DYR, Bakkers J, Santoro MM (2013) Ubiad1 is an antioxidant
719 enzyme that regulates eNOS activity by CoQ10 synthesis. Cell 152: 504-518
720 Nguyen TPT, Casarin A, Desbats MA, Doimo M, Trevisson E, Santos-Ocaña C, Navas P,
721 Clarke CF, Salviati L (2014) Molecular characterization of the human COQ5 C- bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
722 methyltransferase in coenzyme Q10 biosynthesis. Biochimica et Biophysica Acta (BBA)
723 - Molecular and Cell Biology of Lipids 1841: 1628-1638
724 Pagliarini DJ, Calvo SE, Chang B, Sheth SA, Vafai SB, Ong S-E, Walford GA, Sugiana
725 C, Boneh A, Chen WK, Hill DE, Vidal M, Evans JG, Thorburn DR, Carr SA, Mootha VK
726 (2008) A Mitochondrial Protein Compendium Elucidates Complex I Disease Biology. Cell
727 134: 112-123
728 Park E, Kang HG, Choi YH, Lee KB, Moon KC, Jeong HJ, Nagata M, Cheong HI (2017)
729 Focal segmental glomerulosclerosis and medullary nephrocalcinosis in children with
730 ADCK4 mutations. Pediatric nephrology (Berlin, Germany) 32: 1547-1554
731 Quinzii CM, Kattah AG, Naini A, Akman HO, Mootha VK, DiMauro S, Hirano M (2005)
732 Coenzyme Q deficiency and cerebellar ataxia associated with an aprataxin mutation.
733 Neurology 64: 539-541
734 Reidenbach AG, Kemmerer ZA, Aydin D, Jochem A, McDevitt MT, Hutchins PD, Stark
735 JL, Stefely JA, Reddy T, Hebert AS, Wilkerson EM, Johnson IE, Bingman CA, Markley
736 JL, Coon JJ, Dal Peraro M, Pagliarini DJ (2018) Conserved Lipid and Small-Molecule
737 Modulation of COQ8 Reveals Regulation of the Ancient Kinase-like UbiB Family. Cell
738 chemical biology 25: 154-165.e11
739 Saleem MA, O'Hare MJ, Reiser J, Coward RJ, Inward CD, Farren T, Xing CY, Ni L,
740 Mathieson PW, Mundel P (2002) A conditionally immortalized human podocyte cell line
741 demonstrating nephrin and podocin expression. Journal of the American Society of
742 Nephrology : JASN 13: 630-8
743 Stefely JA, Licitra F, Laredj L, Reidenbach AG, Kemmerer ZA, Grangeray A, Jaeg-Ehret
744 T, Minogue CE, Ulbrich A, Hutchins PD, Wilkerson EM, Ruan Z, Aydin D, Hebert AS, bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
745 Guo X, Freiberger EC, Reutenauer L, Jochem A, Chergova M, Johnson IE et al. (2016)
746 Cerebellar Ataxia and Coenzyme Q Deficiency through Loss of Unorthodox Kinase
747 Activity. Mol Cell 63: 608-620
748 Stefely JA, Pagliarini DJ (2017) Biochemistry of Mitochondrial Coenzyme Q
749 Biosynthesis. Trends in biochemical sciences 42: 824-843
750 Suleiman HY, Roth R, Jain S, Heuser JE, Shaw AS, Miner JH (2017) Injury-induced
751 actin cytoskeleton reorganization in podocytes revealed by super-resolution microscopy.
752 JCI insight 2
753 Tauche A, Krause-Buchholz U, Rödel G (2008) Ubiquinone biosynthesis in
754 Saccharomyces cerevisiae: the molecular organization of O-methylase Coq3p depends
755 on Abc1p/Coq8p. FEMS Yeast Research 8: 1263-1275
756 Tran UC, Clarke CF (2007) Endogenous synthesis of coenzyme Q in eukaryotes.
757 Mitochondrion 7: S62-S71
758 Vazquez Fonseca L, Doimo M, Calderan C, Desbats MA, Acosta MJ, Cerqua C,
759 Cassina M, Ashraf S, Hildebrandt F, Sartori G, Navas P, Trevisson E, Salviati L (2018)
760 Mutations in COQ8B (ADCK4) found in patients with steroid-resistant nephrotic
761 syndrome alter COQ8B function. Human mutation 39: 406-414
762 Wang Y, Oxer D, Hekimi S (2015) Mitochondrial function and lifespan of mice with
763 controlled ubiquinone biosynthesis. Nature communications 6: 6393
764 Xu T, Park SK, Venable JD, Wohlschlegel JA, Diedrich JK, Cociorva D, Lu B, Liao L,
765 Hewel J, Han X, Wong CCL, Fonslow B, Delahunty C, Gao Y, Shah H, Yates JR, 3rd
766 (2015) ProLuCID: An improved SEQUEST-like algorithm with enhanced sensitivity and
767 specificity. Journal of proteomics 129: 16-24 bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
768 Young S, Struys E, Wood T (2007) Quantification of creatine and guanidinoacetate
769 using GC-MS and LC-MS/MS for the detection of cerebral creatine deficiency
770 syndromes. Current protocols in human genetics Chapter 17: Unit 17.3
771 Zhu JY, Fu Y, Richman A, Zhao Z, Ray PE, Han Z (2017) A Personalized Model of
772 COQ2 Nephropathy Rescued by the Wild-Type COQ2 Allele or Dietary Coenzyme Q10
773 Supplementation. Journal of the American Society of Nephrology : JASN 28: 2607-2617
774 bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
775 Figure legends
776 Fig 1. Nphs2.Cre+;Adck4flox/flox mice developed focal segmental glomerular
777 sclerosis.
778 (A) Nphs2.Cre+;Adck4flox/flox mutant mice exhibited reduced life span with a median
779 survival period of 316 days and hazard ratio of 17.52 compared to that of littermate
780 controls (Log-rank [Mantel–Cox] test, p = 0.0001; hazard Ratio [logrank]).
781 (B) Urinary albumin/creatinine ratio serial analysis at indicated ages and genotypes
782 revealed progressive proteinuria in Nphs2.Cre+;Adck4flox/flox mutant mice (red hexagon),
783 but not in littermate controls (black diamond) (n = 15-17 animals per group). Dotted line
784 displays the onset of renal failure. Note that once chronic renal failure ensues, urinary
785 albumin excretion reduced as observed in SRNS (p-values were calculated using an
786 unpaired t-test; ns = not significant, *p < 0.05, **p < 0.01, ***p < 0.001, ****p < 0.0001;
787 each data point represents the mean value of technical duplicates; the error bars
788 represent SEM).
789 (C) Kidney serial sections and representative images of 10-month-old mice. The
790 Nphs2.Cre+;Adck4flox/flox mutant mice exhibited severe focal segmental glomerular
791 sclerosis (arrows) with severe interstitial fibrosis and tubular atrophy (arrow heads). In
792 contrast, wild type littermate control mice displayed normal histological kidney
793 morphology (Scale bars: upper row 500 μm, middle row 100 μm, and lower row 20
794 μm).
795 (D) Immunofluorescence staining for the slit diaphragm protein podocin (green) and the
796 basement membrane marker nidogen (red). A normal expression pattern of podocin was
797 observed in 10-month-old wild type littermate control mice. Nphs2.Cre+;Adck4flox/flox bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
798 mutant mice mostly showed reduced podocin staining (arrows), appearing only on a few
799 capillary loops (arrow head).
800 (E) Transmission electron microscopy representative images of mice at the age of 10
801 months. Nphs2.Cre+;Adck4flox/flox mutant mice revealed severe podocyte foot process
802 effacement (arrows) and an increased amount of dysmorphic mitochondria (asterisks).
803 Glomerular basement membrane is highlighted by a dotted line (Scale bars: 10 μm left
804 panel, and 2 μm middle and right panels).
805
806 Fig 2. Treatment of Nphs2.Cre+;Adck4flox/flox mutant mice with 2,4-diHB prevented
807 FSGS progression, resulting in normal survival rate.
808 (A) Nphs2.Cre+;Adck4flox/flox mutant mice treated with 2,4-diHB presented similar survival
809 rate as that of healthy treated littermate controls (Log-rank [Mantel–Cox] test, p = 0.797).
810 (B) Urinary albumin/creatinine ratio serial analysis at indicated ages and genotypes (n =
811 9–11 animals per group). Nphs2.Cre+;Adck4flox/flox mutant mice treated with 2,4-diHB
812 (green square) were protected from developing severe, progressive proteinuria,
813 although proteinuria was significantly increased, compared with that in healthy treated
814 littermate controls (black circle). Green arrow indicates the start of treatment (p-values
815 were calculated using an unpaired t-test; ns = not significant, *p < 0.05, **p < 0.01, ***p
816 < 0.001; each data point represents the mean value of technical duplicates; the error
817 bars represent SEM).
818 (C) Kidney serial sections and representative images of 18-month-old mice. The wild
819 type littermate control mice and Nphs2.Cre+;Adck4flox/flox mutant mice treated with 2,4-
820 diHB displayed normal histological kidney morphology (Scale bars: upper row 500 μm, bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
821 middle row 100 μm, and lower row 20 μm).
822 (D) Immunofluorescence staining for the slit diaphragm protein podocin (green) and the
823 basement membrane marker nidogen (red). The representative images of 18-month-old
824 mice. A predominant expression of podocin was observed in Nphs2.Cre+;Adck4flox/flox
825 mutant mice treated with 2,4-diHB compared with that in healthy treated wild type
826 littermate control mice (Scale bars: 10 μm).
827 (E) Transmission electron microscopy representative images of mice at the age of 18
828 months. In contrast, Nphs2.Cre+;Adck4flox/flox mutant mice treated with 2,4-diHB
829 displayed mild foot process morphology changes with infrequent regions of effacement
830 (arrows). Mitochondrial morphology remained normal (Scale bars: 10 μm left panel, and
831 2 μm middle and right panels)
832
833 Fig 3. Coenzyme Q was deficient in ADCK4 knockout podocytes.
834 (A, B) Coenzyme Q contents of cultured podocytes and HK-2 cells. The CoQ9 level was
835 decreased in both cultured podocytes and HK-2 cells (A) and the CoQ10 level was
836 severely deficient in ADCK4 KO podocytes (B).
837 (C, D) Respiratory chain complex II and succinate-cytochrome c reductase (complex II-
838 III) enzyme activities were measured in podocytes (C) and HK-2 cells (D). Complex II-III
839 activities were decreased only in podocytes, whereas complex II activities were affected
840 in both cell lines.
841 (E) Succinate-cytochrome c reductase (complex II-III) enzyme activities were measured
842 in podocytes. Decreased activities in ADCK4 KO podocytes were partially restored by
843 the addition of 500 μM 2,4-dihydroxybenzoic acid (2,4-diHB). bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
844 (F) Cell viability was measured using the Cell Count Kit-8 assay. ADCK4 KO podocytes
845 exhibited susceptibility to 30 μM AA treatment. Decreased cell viability was reversed by
846 the addition of 500 μM 2,4-diHB (p-values were calculated using an unpaired t-test; ns =
847 not significant, *p < 0.05, **p < 0.005; error bars represent mean ± SD).
848
849 Fig 4. ADCK4 knockout podocytes showed mitochondrial defects.
850 (A-H) TEM of podocytes showing mitochondrial morphology. Black (A and B) and white-
851 boxed (D and E) areas are enlarged mitochondria in ADCK4 KO podocytes showing
852 abnormal fission and disrupted cristae (H) (black arrows).
853 (I-J) Mitochondria after AA treatment were severely disrupted in ADCK4 KO podocytes
854 (J). (Scale bars: 0.5 μm in (A-C), 0.1 μm in (D-F), and 0.05 μm in (G-J)).
855 (K-L) Mitochondrial membrane potential (ΔΨ) was measured using JC-10 (K) and
856 TMRM (L). ADCK4 KO podocytes showed reduced ΔΨ compared with that of control
857 podocytes. Reduced ΔΨ of ADCK4 KO podocytes was partially rescued by the addition
858 of 500 μM 2,4-dihydroxybenzoic acid (2,4-diHB) (p-values were calculated using an
859 unpaired t-test; ns = not significant, *p < 0.05, **p < 0.005; the error bars represent
860 mean ± SD).
861 (M) Immunofluorescence of COXIV and phalloidin staining in podocytes. Phalloidin-
862 stained area was shrunk in ADCK4 KO podocytes, and it became more prominent upon
863 arachidonic acid (AA) treatment. Decreased cellular area was not reversed by the
864 addition of 2,4-diHB. (Hundred cells from three independent experiments; p-values were
865 calculated using an unpaired t-test; ns = not significant, *p < 0.05, **p < 0.005; the error
866 bars represent mean ± SD). bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license.
867
868 Fig 5. ADCK4 interacted with COQ5 and stabilized complex Q in podocytes.
869 (A) ADCK4-interacting proteins isolated form HEK293 cells overexpressing ADCK4-
870 3XFLAG. Both cytoplasmic and mitochondrial proteins were detected as interactors by
871 NanoLC-MS/MS.
872 (B) Gene ontology analysis showed that ADCK4-interacting mitochondrial proteins are
873 associated with transferase activity, oxidoreductase activity, nucleotide binding, and
874 ATPase activity.
875 (C) Immunoblot showed that proteins in complex Q, COQ3, COQ5, and COQ9, were
876 significantly reduced in ADCK4 knockout (KO) podocytes.
877 (D) Densitometry analysis. Data are representative of at least three independent
878 experiments and band intensities were normalized to that of β-actin. *p < 0.05; t-test.
879 (E) Decreased COQ5 protein level was rescued by heterologous ADCK4 expression
880 and 2,4-diHB treatment in ADCK4 KO podocytes.
881 (F) Effect of ADCK4 mutations on COQ5 rescued in ADCK4 KO podocytes. COQ5 was
882 rescued to a lower extent by truncated ADCK4 mutant proteins, whereas ADCK4 mutant
883 proteins harboring missense variations were not different from wild type ADCK4.
884 (G) Immunoblot analysis of the MAPK pathway. p-p38 and p-pERK were increased in
885 ADCK4 KO podocytes and p-p38 was further induced by arachidonic acid (AA).
886 Unphosphorylated p38 was used as the loading control. 100
AC certified bypeerreview)istheauthor/funder,whohasgrantedbioRxivalicensetodisplaypreprintinperpetuity.Itmadeavailableunder
90 bioRxiv preprint 80 70 p = 0.0001 60 50
40 doi:
30 https://doi.org/10.1101/712323 20 Control (n=17) 10 Nphs2.Cre+;Adck4flox/flox (n=15) 0 8910 11 12 13 14 15 16 17 18 Month B a CC-BY-NC-ND 4.0Internationallicense ; this versionpostedJuly23,2019. Albumin/creatinin ratio (mg/dl) E The copyrightholderforthispreprint(whichwasnot
D .
Figure 1 AC certified bypeerreview)istheauthor/funder,whohasgrantedbioRxivalicensetodisplaypreprintinperpetuity.Itmadeavailableunder bioRxiv preprint doi: https://doi.org/10.1101/712323
80 ** * ns ****** ** ***ns * *** ** ** *** *** B 75 70 65 60 a
55 CC-BY-NC-ND 4.0Internationallicense ;
50 this versionpostedJuly23,2019. 45 40 35 30 25 20 15 10 5 Albumin/creatinine ratio (mg/dl) ratio Albumin/creatinine 0 E 3 4 5 6 7 8 9 101112131415161718 Month Control + 25 mM 2,4-diHB (n=11) Nphs2.Cre+;Adck4flox/flox + 25mM 2,4-diHB (n=9) The copyrightholderforthispreprint(whichwasnot D .
Figure 2 bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. Coenzyme Q9 Coenzyme Q10 AB60
40
20 pmol/mg protein
**10 * CoQ 0 1 2 1 2 1 2 # # # # # # O O O O O KO K K K K K Control 4 Control Control 4 Control 4 K4 KO#1 K4 K4 K4 C C C CK C CK D D ADCK ADCK4 KO#2 AD AD AD A AD A Podocytes HK-2 Podocytes HK-2 C D Cultured HK-2 podocytes Enzyme activity Enzyme Enzyme activity Enzyme (normalized to control) (normalized to control) (normalized
1 2 2 2 # A n A ol A ol # O i r r c TF nt O ontrol K TTF KO# KO#1 KO#2 T o KO#1 K C + Control my 4 K4 KO#K4 K4 KO#1K4 i Cont C C CK4 rol + DC ntrol DC Ant DCK4 A ADC AD A + ADCK AD nt A ADCK4 Co o rol C ont C Control + Antimycin A Complex II Complex ll-lll Complex II Complex ll-lll
EF Cultured podocytes 150 Cultured podocytes ** **
100 ** **
50 Complex II-III Enzyme activity Enzyme (normalized to control) to (normalized 0 Control ++ ++ - - Control ++- - ++- - ADCK4 KO#1 -- -- ++ADCK4 KO#1 --++ --++ ADCK4 KO#2 -- ++ ++ 30 MAA - - - - ++++ 500 M -+ -+ -+ 500 M -+-+ -+-+ 2,4-diHB 2,4-diHB Figure 3 bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-NDCultured 4.0 podocytes International license. 100 M AA A D G I Control
B E
H J ADCK4 KO#1 ADCK4
C F ADCK4 KO#2 ADCK4
K 150 JC-10 L TMRE
100 * *
50 Relative TMRM fluoroscence (%) fluoroscence
0 Control +- - Control ++ ++ - - ADCK4 KO#1 -+- ADCK4 KO#1 -- -- ++ ADCK4 KO#2 --+ ADCK4 KO#2 -- ++ ++ 500 M 2,4-diHB -+ -+ -+ M N Relative area (%)
HB AA HB HB HB di AAdi 4di 4- ,4di 4- 2, 2, 2 2, + + A A A A Control ADCK4 KO#1 Figure 4 bioRxiv preprint doi: https://doi.org/10.1101/712323; this version posted July 23, 2019. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under ABCytoplasmic MitochondrialaCC-BY-NC-ND 4.0 International license.
Log2(ADCK4/BAP) C D E Control ADCK4 KO#1 50 ADCK4 KO#2
40
30 * * * 20 *
10 * *
0 COQ3 COQ5 COQ9
F G
Figure 5