Glibenclamide Targets Sulfonylurea Receptor 1 to Inhibit P70s6k Activity and Upregulate KLF4

Author Manuscript Published OnlineFirst on July 24, 2019; DOI: 10.1158/1535-7163.MCT-18-1181 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Glibenclamide targets sulfonylurea receptor 1 to inhibit p70S6K activity and upregulate KLF4

expression to suppress non-small-cell lung carcinoma.

Kexin Xu1, Geng Sun1, Min Li1, Hongling Chen1, Zuhao Zhang1, Xixi Qian1, Ping Li1, Lin Xu3,

Wenbin Huang2, Xuerong Wang1*

Note: Kexin Xu, Geng Sun, and Min Li contribute equally to this work.

1Department of Pharmacology, Nanjing Medical University, Nanjing, Jiangsu Province, China.

210029

2Department of Pathology, Nanjing First Hospital, Nanjing Medical University, Nanjing, Jiangsu

Province, China. 210006

3Department of Thoracic Surgery, Jiangsu Cancer Hospital, Nanjing Medical University Affiliated

Cancer Hospital, Nanjing, Jiangsu Province, China. 210009

Corresponding Author:

Xuerong Wang, PhD, MD

Department of Pharmacology, Nanjing Medical University,

140 Hanzhong Road, Nanjing,

Jiangsu Province, China. 210029.

Email: [email protected]

Tel: 86-25-86862884

Fax: 86-25-86862884

Downloaded from mct.aacrjournals.org on September 29, 2021. © 2019 American Association for Cancer Research. Author Manuscript Published OnlineFirst on July 24, 2019; DOI: 10.1158/1535-7163.MCT-18-1181 Author manuscripts have been peer reviewed and accepted for publication but have not yet been edited.

Running title: Targeting SUR1 with glibenclamide in NSCLC

Key words: lung cancer; sulfonylureas; p70S6K; SUR1; KLF4

The authors declare no potential conflicts of interest.

Abstract

Sulfonylurea receptor 1 (SUR1) is the regulatory subunit of ATP-sensitive potassium channels

(KATP channels) and the receptor of antidiabetic drugs, such as glibenclamide, that induce insulin

secretion in pancreatic β cells. However, the expression and role of SUR1 in cancer are unknown. In

this study, we found that SUR1 expression was elevated in human non-small-cell lung carcinoma

(NSCLC) tissues and cell lines. SUR1 silencing suppressed the growth of NSCLC cells, while SUR1

overexpression promoted cell growth. Targeting SUR1 with glibenclamide suppressed cell growth,

cell cycle progression, the epithelial-mesenchymal transition, and cell migration. Moreover, SUR1

directly interacted with p70S6K and upregulated p70S6K phosphorylation and activity. Additionally,

glibenclamide inhibited p70S6K, and overexpression of p70S6K partially reversed the

growth-inhibiting effect of glibenclamide. Furthermore, glibenclamide upregulated the expression of

the tumor suppressor Krüppel-like factor 4 (KLF4), and silencing KLF4 partially reversed the

inhibitory effect of glibenlcamide on cell growth, the EMT, and migration. We found that SUR1 targeted p70S6K to downregulate KLF4 expression by enhancing DNA-methyltransferase 1

(DNMT1)-mediated methylation of the KLF4 promoter. Finally, in xenograft mouse models, SUR1 expression silencing or glibenclamide treatment inhibited the growth of A549 tumors, downregulated

p70S6K activity, and upregulated KLF4 expression. These findings suggested that SUR1 expression

was elevated in some NSCLC tissues and functioned as a tumor enhancer. Targeting SUR1 with

glibenclamide inhibited NSCLC through downregulation of p70S6K activity and subsequent

upregulationof the expression of the tumor suppressor gene KLF4. SUR1 can be developed as a new target for cancer therapy and glibenclamide has potential anticancer effects.

Introduction

Lung cancer is the most prevalent cancer and the leading cause of cancer-related deaths worldwide

(1). Approximately 83% of lung cancers are types of non-small-cell lung carcinoma (NSCLC), while the others are types of small-cell lung carcinoma (SCLC) (2). Therapeutic strategies for NSCLC have been widely developed, and although combinations of molecular-targeted drugs or immune checkpoint drugs with chemotherapy have been proven to be effective first-line treatments for select patients, the 5-year survival rate of patients in the middle or late stages is still very low, at approximately 21% (3). Therefore, identifying new therapeutic targets and agents is urgently needed.

Sulfonylurea receptor 1 (SUR1), also named ATP-binding cassette subfamily C, member 8

(ABCC8), is the regulatory subunit of the ATP-sensitive potassium channels (KATP channels) (4). The

KATP channels are metabolic sensors that couple energy status to ion channel activity (5). In pancreatic β cells, uptake of glucose induces an accumulation of cytoplasmic ATP, and then induces

KATP channel closing, cell membrane depolarization, voltage-dependent calcium channel (VDCC) opening, Ca2+ influx, and subsequent insulin secretion (6). SUR1 is well known as the receptor of sulfonylurea antidiabetic drugs, such as glibenclamide, which induce insulin secretion (7).

Glibenclamide has been reported to inhibit cell growth and invasion in several cancer cell lines, including gastric, breast, ovarian, liver, prostate, and bladder cancer (8-11). However, the expression and function of SUR1 in cancer are unknown.

The 70-kDa ribosomal S6 kinase (p70S6K) is a serine/threonine kinase (12). It is one of the major downstream effectors of the mammalian target of rapamycin complex 1 (mTORC1) signaling pathway and plays important roles in cell proliferation, metabolism, differentiation, and migration. p70S6K contributes to some diseases such as cancer, diabetes, and obesity (13,14). Its mechanism in

regulating protein translation, mRNA splicing, and cytoskeletal organization is well known, but its mechanism in regulating transcription is still unclear (15). Because mTORC1 signaling pathway is an important sensor of cellular energy and nutrient status, we hypothesize that there may be crosstalk between KATP channels and p70S6K.

Krüppel-like factor 4 (KLF4), a zinc finger-type transcription factor, positively or negatively

regulates gene expression in a context-dependent manner (16). It is famous for being one of the four

transcription factors that induces pluripotent stem cells from adult fibroblasts (17). It plays important

roles in many physiologic processes, including proliferation, differentiation, and apoptosis (18,19), and functions both as a tumor enhancer and suppressor in different types of cancers (20,21). In lung

cancer, KLF4 has been reported to inhibit cell growth, invasion, and metastasis, and its expression is

decreased in non-small-cell carcinoma but increased in small-cell carcinoma (16,22,23). Currently,

the regulatory context of KLF4 in lung cancer has not been elucidated.

In this study, we found that the expression of SUR1 was elevated in human lung cancer tissues.

SUR1 promoted cell growth in parallel with downregulation of the p-p70S6K signaling pathway

through a direct interaction with p70S6K in lung cancer cell lines. p70S6K downregulated KLF4

expression through DNMT1-mediated DNA methylation of the KLF4 promoter. Glibenclamide

targeted SUR1 to regulate the expression of p-p70S6K and KLF4 as well as growth, the EMT, and

migration both in NSCLC cells and in xenograft mouse models.

Materials and Methods

Reagents

Glibenclamide (G2539-5G) and 5-Azacytidine (A2385) were purchased from Sigma, Inc.

Trichostain A (T6270) was purchased from Target Mol, Inc. Minoxidil (S24448) and nicorandil

(S67281) were obtained from Shanghai Yuanye Biotechnology Co., Ltd. 5-Azacytidine was

dissolved in PBS, and the other reagents were dissolved in DMSO. Lipofectamine 2000 transfection

reagent was purchased from Life Technologies Co., Invitrogen. The antibodies: anti-phospho-p70S6K (Thr389) (9205), anti-p70S6K (9202), anti-phospho-S6 (Ser235/236) (4858), anti-S6 (2217), anti-KLF4 (12173), anti-cyclin D1 (2922), and anti-Akt (9272) were obtained from

Cell Signaling Technology, Inc.; anti-SUR1 (ABCC8) (sc-25683) was obtained from Santa Cruz

Biotechnology Inc.; anti-β-actin (BS6007), anti-GAPDH (AP0063), anti-HA (AP0005M), anti-flag

(AP0007M), anti-E-cadherin (BS1098), and anti-N-cadherin (BS2224) were obtained from Bioworld

Technology Inc.; and anti-DNMT1 (A5495) was obtained from ABclonal Inc.

Cell lines

The NSCLC cell lines A549, H460, H157, H1299, and Calu-1 (ATCC) were cultured in

RPMI1640 medium (Gibco) supplemented with 5% fetal bovine serum (Gibco) at 37°C in a

humidified atmosphere consisting of 5% CO2. All cell lines were genetically confirmed by profiling

of 20 short tandem repeats (Shanghai Biowing Applied Biotechnology Co., Ltd.) and tested for mycoplasma contamination using Hoechst staining periodically.

Gene knockdown and overexpression

Small interfering RNA (siRNA) pools that targeted p70S6K

(5’-CCAAGGUCAUGUGAAACUA-3’, 5’-CAUGGAACAUUGUGAGAAA-3’, and

5’-GACGGGGUCCUCAAAUGUA-3’) (24), SUR1 (5’-GUGGUCUACUAUCACAACATT-3’,

5’-GAUCUACCGUCAAAGCUCUTT-3’, and 5’-GUCUAUGCCAUGGUGUUCATT-3’), KLF4

(5’-GGACUUUAUUCUCUCCAAUTT-3’, 5’-GGUCAUCAGCGUCAGCAAATT-3’, and

5’-GCCACCCACACUUGUGAUUTT-3’), and DNMT1 (5’-GGAUGAGUCCAUCAAGGAA-3’,

5’-CCAGAGCACUACCGGAAAU-3’, and 5’-GCAAGGACAUGGUUAAAUU-3’) and control siRNA were used as described previously (12) or were designed by us and synthesized by Shanghai

GenePharma. siRNAs were used at a concentration of 100 nmol/L.

SUR1 overexpression plasmids were constructed by inserting full-length SUR1 (NM_000352.4)

into pcDNA3.1 (pcDNA-SUR1). Full-length SUR1 was also inserted into the p3×flag-CMV-14

vector to generate plasmids expressing flag-tagged protein. The truncated C-terminus of SUR1 (from

amino acid 1187 to 1581) was amplified and cloned into the same vector by homologous

recombination using the ClonExpress II One Step Cloning Kit (C112-02, Vazyme Biotech Co., Ltd).

Constructs that expressed HA-tagged p70S6K (pRK7-S6K-HA) and control vector (pRK7) were

gifted by Dr. John Blenis (Harvard Medical School) (25).

A549 cells with stable SUR1 silencing were established by infection with lentivirus carrying

scramble shRNA or SUR1 shRNA (5’-GAUCUACCGUCAAAGCUCUTT-3’; Shanghai GeneChem

Co., Ltd). A549 cells stably overexpressing SUR1 were established by infection with lentivirus

carrying the full-length coding sequence of SUR1 or vector as previously described (26).

Cell growth and colony formation assays

Surviving cells were stained with sulforhodamine B (SRB) or crystal violet. The cell growth rate

and drug inhibition were calculated as previously described (26).

Cell cycle analysis

Cells were collected, and the DNA content was detected by flow cytometry (FACS; Cytomics FC

500, Beckman) as we previously described (26).

Transwell migration assay

A migration assay was performed using Matrigel Invasion Chambers with polyethylene terephthalate membranes on the bottoms of the chambers (8.0 μm pore size) from BD Transduction

Laboratories as we previously described (12).

RNA isolation and quantitative reverse transcription polymerase chain reaction (qRT-PCR)

Total RNA extraction, reverse transcription, quantitative PCR and data analysis were conducted as

we previously described (12). The primers for amplification of KLF4 were

5’-GAAATTCGCCCGCTCAGATGAACT-3’ (forward) and

5'-TTCTCTTCTGGCAGTGTGGGTCAT-3 (reverse), and those for the internal control GAPDH were 5’- ATGGGGAAGGTGAAGGTCG -3’ (forward) and 5'- GGGGTCATTGATGGCAACAATA

-3 (reverse). The primers were purchased from Invitrogen.

Western blot analysis and immunoprecipitation

Whole-cell proteins were extracted using 1% Triton X-100 lysis buffer as we previously described

(12). For immunoprecipitation, 1% Triton X-100 in the lysis buffer was substituted with 0.7%

CHAPs (C5070, Sigma Inc.). In brief, 0.5-1 mg of cell lysates was subjected to immunoprecipitation and 30-50 μg of cell lysates served as input. HA and flag antibodies, secondary antibodies and

Protein A/G PLUS-Agarose Immunoprecipitation Reagent (sc-2003, Santa Cruz Biotechnology, Inc.) were used for pull-down assays as we described previously (26).

Quantitative analysis of Western blot bands was performed as we previously described using

ImageJ (27). In brief, the chemiluminescent signal was collected by ImageJ (integrated optical density (IOD) of each band = density × area). The value of IOD ratio (IOD ratio = IOD of SUR1,

p-p70S6K, or KLF4 / IOD of housekeeping gene) was calculated. The fold change (fold change =

IOD ratio of treatment / IOD ratio of control) is presented under each blot band.

Luciferase reporter assay

We constructed the KLF4 promoter (from -1500 to -137) into the pGL3-Basic vector (Promega)

using a ClonExpress II One Step Cloning Kit (C112-02, Vazyme Biotech Co., Ltd) through

homologous recombination following the manufacturer’s instructions. The primers for amplification

of the KLF4 promoter were 5’-GGTACCGAGCTCTTACGCGTCGAAGGAACGAGTTGTC-3’

(forward) and 5’-CTTAGATCGCAGATCTCGAGTTCCTTACTTATAACTTCCT-3’ (reverse).

Cells were transfected with pGL3-KLF4-promoter (or pGL3 vector) plasmids, and a Dual-Luciferase

Reporter Assay System (E1910, Promega Co.) was used to detect fluorescence intensity as we

previously described (27).

Bisulfite sequencing PCR (BSP) for DNA methylation assay

Genomic DNA was extracted from A549 cells and subjected to bisulfite conversion using the

TIANamp Genomic DNA Kit and the DNA Bisulfite Conversion Kit (Tiangen Biotech (Beijing) CO.,

Ltd), respectively. Selected DNA regions of KLF4 promoter (from -1302 to +1041 bp, transcription

start site (TSS) was defined as +1 bp) were amplified by PCR using primers as follows: 5'-

CACGCCTGTAATCCCAGCACTTC -3' (forward) and 5'- GACAGAGTCTCGCTGTGTCGCCC

-3' (reverse). The products were purified by Thermo Scientific GeneJet PCR Purification Kit

(Thermo Fisher Scientific Inc.), and then cloned into pCE2 TA / Blunt-Zero vector (Vazyme Biotech

Co., Ltd). 10 clones of each sample were selected and sequenced by Tsingke Biological Technology

Co. The percentage of methylation was the ratio of methylated CpG sites to total CpG sites.

Microarray analysis

A549 cells were treated with 50 μmol/L glibenclamide or DMSO for 24 h in triplicate. Total RNA

was extracted using TRIzol, and quality control was performed using an Agilent RNA 6000 Nano Kit.

A GeneChip PrimeView Human Gene Expression Array (901838, Affymetrix) was used. RNA was

processed using a GeneChip Hybridization Wash and Stain Kit. The data were analyzed by

GeneChem Co., Ltd. (Shanghai, China). A fold change of more than 1.5 was used as the cut-off

threshold for Gene Ontology (GO) analysis.

Lung cancer xenografts in nude mice

Animal experiments followed the institutional guidelines and were approved by the Institutional

Animal Care and Use Committee of Nanjing Medical University. Four- to six-week-old female

athymic (nu/nu) mice were purchased from the Model Animal Research Center of Nanjing

University and housed under standard conditions at the Animal Core Facility of Nanjing Medical

University. A549 cells (5×106 cells / mouse) were injected subcutaneously into the right flank regions of nude mice, which were treated with 200 mg/kg glibenclamide by oral gavage for 14 days.

A549-scramble_shRNA and A549-SUR1_shRNA cells were also injected into mice that were then

monitored for 14 days. Tumor measurement and sample collection were performed as we previously

described (26).

Human tissue samples

Paired cancer tissues and peripheral normal tissues were collected from lung cancer patients at the

Affiliated Hospital of Nanjing Medical University from 2010-2015. Among 16 patients, 8 had adenocarcinoma and 8 had squamous cell carcinoma. Tissue samples were stored at -80°C. Total

proteins were prepared and subjected to Western blot analysis. The study was approved by the Ethics

Committee of Nanjing Medical University in accordance with the Declaration of Helsinki and

informed written consent was obtained from all participating subjects (Approval No. 2014161). All

experiments were performed in accordance with the approval guidelines of Nanjing Medical

University.

Statistical analysis

The data are presented as the mean ± SD from triplicate or quadruplicate samples. The results are

representative of at least three independent experiments. Statistical significance between two groups

was analyzed using two-tailed unpaired Student's t tests. When multiple groups were compared,

one-way ANOVA was used. GraphPad software was used for data analysis. The results were

considered to be statistically significant at P < 0.05.

Results

SUR1 expression is elevated in NSCLC tissues and SUR1 promotes the growth of NSCLC cells.

Currently, the expression of SUR1 in cancer is unknown. We first analyzed SUR1 expression in

human tissue samples based on online databases. According to the Oncomine database, SUR1

(ABCC8) mRNA expression was higher in lung cancer tissues than in normal lung tissues (Fig. 1A).

We also analyzed the expression of the pore-forming protein of the KATP channels Kir6.1 and Kir6.2,

and the results showed that Kir6.1 (KCNJ8) was decreased but that Kir6.2 (KCNJ11) was increased

in cancer tissues (Supplementary Fig. S1A).

Then we analyzed the correlation between SUR1 expression and patient survival. A Kaplan-Meier

plotter of data from the website www.kmplot.com showed that high expression levels of SUR1 were

correlated with poor survival (Fig. 1B). However, Kir6.2 expression did not show any correlation

with patient survival (P=0.8). Increased Kir6.1 was correlated with good survival (P=0.02), which

was consistent with the low expression of Kir6.1 in NSCLC. These results indicate that SUR1 may have additional functions in NSCLC (Supplementary Fig. S1B).

We then examined SUR1 protein expression in 16 samples of cancer tissues with paired surrounding normal tissues from NSCLC patients, including 8 adenocarcinoma samples and 8

squamous cell carcinoma samples. The results showed that SUR1 expression was higher in lung

cancer tissue than in paired normal tissue for both adenocarcinoma (6/8) and squamous cell

carcinoma (5/8) patients. However, there were equal amounts of SUR1 expression in 3 patients (#4,

#8, #12). In 2 patients (#14 and #15), SUR1 expression was lower in cancer tissues than in normal

tissues (Fig. 1C). The clinicopathological characteristics of the patients are presented in

Supplementary Table 1. We also detected increased SUR1 protein expression in NSCLC cells (A549,

H157, and H1299) compared to normal HBE (human bronchial epithelial) cells and Beas 2B cells

(Fig. 1D). These findings indicate that SUR1 expression is increased in NSCLC and indicates poor

patient survival.

Next we examined the role of SUR1 in NSCLC cells. We found that silencing of SUR1 expression

in cells transiently transfected with SUR1 siRNAs (a pool of 3 sets of siRNAs) or in stable cell lines

(A549-SUR1_shRNA vs. A549-scramble_shRNA), inhibited the growth of A549 and H460 cells, as

determined by SRB assay. Western blot analysis confirmed the successful silencing of SUR1

expression and the decreased expression of cyclin D1, which is a cell cycle checkpoint protein whose

expression often decreases when cell growth is inhibited (Fig. 1E and Supplementary Fig. S2A). In

addition, overexpression of SUR1 in cells transfected with SUR1 plasmids or in stable cell lines

(A549-SUR1 OE/A549-vector) promoted cell growth. SUR1 and cyclin D1 expression increased in

parallel (Fig. 1E and Supplementary Fig. S2B). These results suggest that SUR1 promoted cell

growth in NSCLCs.

Glibenclamide targets SUR1 to inhibit the growth, cell cycle progression,

epithelial-mesenchymal transition, and migration of NSCLC cells.

SUR1 is the receptor of glibenclamide in pancreatic β cells. Glibenclamide has been reported to inhibit the growth of several types of cancer cells; however, its effect on lung cancer is unknown. We found that glibenclamide inhibited the growth of the NSCLC cell lines A549, H1299, Calu-1, H157, and H460 with IC50 values of 95.56, 188.3, 71.89, 113.3, and 143.43 μmol/L, respectively, by SRB assay (Fig. 2A). The colony formation assay showed the same dose-dependent inhibitory effect (Fig.

2B). We also observed cell cycle arrest at G1 phase (Fig. 2C) and decreased cyclin D1 expression

(Supplementary Fig. S3). SUR1 total protein was not altered (Supplementary Fig. S3).

Glibenclamide inhibited the EMT (as evidenced by increases in the expression of the epithelial cell

marker E-cadherin and decreases in the expression of the mesenchymal cell marker N-cadherin) (Fig.

2D) and cell migration (Fig. 2E).

If the inhibitory effect of glibenclamide was mediated by blockade of KATP channels, we

speculated that KATP channel openers would promote cell growth. However, to our surprise,

minoxidil and nicorandil inhibited cell growth in a dose-dependent manner with the greastest

inhibitory effect of less than 30% of control (Supplementary Fig. S4). These results suggest that the

inhibitory effect of glibenclamide did not depend on KATP channels and that other mechanisms may

exist.

We further determined whether the effect of glibenclamide was mediated by SUR1 in NSCLC. We

found that overexpression of SUR1 reduced the inhibitory effect of glibenclamide, increasing the

IC50 from 92.72 to 127.9 μmol/L, while silencing of SUR1 enhanced the effect of glibenclamide,

decreasing the IC50 from 100.3 to 69.21 μmol/L (Fig. 2F).

These findings suggest that glibenclamide targeted SUR1 to inhibit cell growth, the EMT and

migration in NSCLCs.

p70S6K plays a critical role in mediating the effects of glibenclamide in NSCLC cells.

In our previous study which aimed to identify the proteins that interact with p70S6K, we identified

physical binding between SUR1 and p70S6K. In this experiment, we designed an immunoprecipitation assay to pull down p70S6K and examined its binding proteins by mass

spectrometry analysis. Following this strategy, HEK293T cells were transfected with pRK7-S6K-HA

plasmid to overexpress p70S6K and immunoprecipitated with anti-p70S6K antibody. Then the

precipitates were separated by SDS-PAGE and silver stained. We noted a new band located at ~45 kDa in p70S6K overexpression samples that was not present in control samples, suggesting the presence of some proteins that may physically bind to p70S6K (Supplementary Fig. S5A). We then

excised the band and conducted mass spectrometry analysis. The results showed that it was a fragment of SUR1 (GI: 784882) (Supplementary Fig. S5B). It should be noted that the immunoprecipitation was performed using 0.7% CHAPs lysis buffer, because when 1% Triton X-100

lysis buffer was used, we did not detect any new bands in the immunoprecipitates. These results

indicate that the binding of p70S6K with SUR1 was a type of protein-protein interaction rather than

chemical bond.

To confirm this finding, we examined the physical binding of p70S6K and SUR1 by

immunoprecipitation. First, we cotransfected HEK293T cells with HA-tagged p70S6K and

flag-tagged SUR1 constructs, and then pulled down one tag to immunoblot the other (Fig. 3A). The results showed that exogenous SUR1 and p70S6K bound to each other. Second, we overexpressed

HA-tagged p70S6K in A549 cells and pulled down HA to immunoblot SUR1. Exogenous p70S6K

bound to endogenous SUR1 in cancer cells (Fig. 3B). Third, we overexpressed the C-terminal

fragment of SUR1 (amino acid 1187 to 1581) (SUR1 CT-flag) and HA-tagged p70S6K, and then

pulled down flag to immunoblot HA. The C-terminal truncate specifically bound to p70S6K (Fig.

3C). These results suggest that SUR1 interacted with p70S6K through its C-terminus in NSCLCs.

We then examined the effect of SUR1 on p70S6K activity, which was indicated by T389

phosphorylation of p70S6K. In the aforementioned SUR1 transient or stable knockdown cells, we

found that phosphorylation of p70S6K (p-p70S6K T389) was decreased, and in SUR1

overexpression cells p-p70S6K levels were increased (Fig. 3D and Supplementary Fig. S2); these

results occurred without changes in total p70S6K levels, suggesting that SUR1 activated p70S6K.

We also detected the effect of glibenclamide on p70S6K activity. Glibenclamide pretreatment dramatically decreased the levels of p-p70S6K and its downstream target p-S6 after only 5 min when

cells were stimulated with serum for 30 min, suggesting that glibenclamide inhibited serum-induced

p70S6K activation (Fig. 3E). Moreover, p-p70S6K decreased in a dose-dependent manner under glibenclamide treatment for 24 h (Supplementary Fig. S3).

To identify the role of p70S6K in glibenclamide induced growth inhibition, we conducted a rescue

experiment. Through SRB assay we observed that overexpression of p70S6K by transfection of the

pRK7-S6K-HA plasmid promoted cell growth and almost completely attenuated the growth-inhibiting effect of glibenclamide (Fig. 3F). In contrast, knockdown of p70S6K expression

by transfection with siRNAs (a pool of 3 sets) enhanced glibenclamide-induced growth inhibition

(Fig. 3G). Western blotting was used to confirm the successful overexpression or silencing of

p70S6K. These findings suggest that p70S6K plays a critical role in mediating the effect of

glibenclamide in NSCLC cells.

KLF4 is the downstream effector of glibenclamide.

To reveal the downstream molecules that mediated the growth-inhibiting effect of SUR1, we conducted a microarray analysis of A549 cells treated with glibenclamide for 24 h using a human gene chip from Affymetrix (Fig. 4A). We identified 57 downregulated genes and 62 upregulated

genes. Gene Ontology (GO) biological process analysis suggested that the downregulated genes were

involved in cell migration, adhension, apoptosis, and death. The upregulated genes were involved in

amine, amino acid, small molecule, and nitrogen biosynthesis and metabolism (Supplementary Table

2). Among these genes, KLF4 was the most markedly regulated gene, with 14-fold greater

expression in treated cells than in control cells. We first verified that KLF4 mRNA and protein levels

were increased significantly in four NSCLC cell lines (Fig. 4B and C). We found that knockdown of

KLF4 expression using siRNAs promoted cell growth, the EMT, and migration (Supplementary Fig.

S4), suggesting that KLF4 is a tumor suppressor, which is consistent with other reports (20).

Moreover, silencing KLF4 expression partially reversed the glibenclamide-induced inhibition of cell

growth, the EMT, and migration (Fig. 4D, E, and F). These findings suggest that KLF4 plays an important role in mediating the effects of glibenclamide.

SUR1 activates p70S6K to reduce KLF4 expression by enhancing DNMT1-mediated

methylation of the KLF4 promoter.

We then examined the effect of SUR1 and p70S6K on KLF4 expression in the aforementioned

protein samples (in Fig. 1, 3, and Supplementary Fig. S2). First, we found that silencing SUR1

expression transiently or stably upregulated KLF4 protein levels, but overexpression of SUR1

downregulated KLF4 protein levels (Fig. 5A and Supplementary Fig. S2). Consistently, p70S6K knockdown increased KLF4 expression, and p70S6K overexpression decreased KLF4 expression

(Fig. 5B).

Next, we examined how KLF4 was regulated by p70S6K. DNA methylation and histone

acetylation have been reported to inhibit KLF4 promoter activity in NSCLC. Using 5-Azacytidine and Trichostatin A to inhibit global DNA methylation and histone acetylation, respectively, we found that KLF4 mRNA expression that had been downregulated by p70S6K was rescued by 5-Azacytidine

(Fig. 5C), but not Trichostatin A (Supplementary Fig. S7), suggesting that DNA methylation was

involved in KLF4 expression. The rescue effect of 5-Azacytidine was also confirmed on the protein levels of KLF4 in A549 cells (Fig. 5C). Moreover, a dual-luciferase reporter assay showed that p70S6K decreased and that 5-Azacytidine increased KLF4 promoter (from -1500 to -137) activity. In the combination group, 5-Azacytidine partially reversed the effect of p70S6K on KLF4 promoter activity (Fig. 5D). Furthermore, BSP analysis showed that p70S6K significantly increased the methylation levels of KLF4 promoter (Fig. 5E). Finally, we examined whether

DNA-methyltransferase 1 (DNMT1) mediated the effect of p70S6K, since DNMT1 has been reported to maintain the methylation of the KLF4 promoter and to suppress the expression of KLF4 in several types of cancers (28). We found that silencing DNMT1 using siRNAs partially reversed the p70S6K-induced downregulation of KLF4 (Fig. 5F). These findings suggest that SUR1 activated p70S6K and that p70S6K downregulated KLF4 expression by enhancing DNMT1-mediated methylation of the KLF4 promoter.

Glibenclamide treatment or SUR1 knockdown inhibits the growth of A549 tumors in xenograft mouse models.

We further confirmed the effects of SUR1 in vivo. SUR1 silenced A549 cells

(A549-SUR1_shRNA/A549-scramble_shRNA) were inoculated into nude mice. The tumor growth of the SUR1 silencing group was slower than that of the scramble group, the silencing group exhibited a significantly lower tumor size (Fig. 6A and Supplementary Fig. S8A) and weight (Fig.

6B) (P<0.05). At the end of the experiment, the tumors were collected and confirmed histologically by hematoxylin and eosin (H&E) staining (Supplementary Fig. S8B). Western blot analysis was used to examine p70S6K and KLF4 signals as mentioned previously. We found that the levels of

p-p70S6K were decreased and that KLF4 levels were increased, similar to what we observed in vitro

(Fig. 6C). These results suggested that SUR1 upregulated p-p70S6K and downregulated KLF4 to inhibit the growth of A549 xenografts in the nude mouse model.

We further confirmed the growth-inhibiting effects of glibenclamide in vivo. Nude mice were

inoculated with A549 cells and treated with 200 mg/kg glibenclamide by oral gavage for 14 days. As

expected, tumor size and weight were significantly lower in the glibenclamide-treated group than in

the control group (P<0.05) (Fig. 6D, E, and Supplementary Fig. S8A). Moreover, glibenclamide

treatment decreased p-p70S6K and increased KLF4 signals, consistent with the findings in vitro (Fig.

6F). Notably, the body weight of the mice showed no significant difference between the two groups, and no injury of livers was observed by pathological examination of liver tissues, suggesting no

obvious toxicity of glibenclamide (Supplementary Fig. S8C and S8D). These results suggested that glibenclamide inhibited the growth of NSCLC through p70S6K-mediated KLF4 upregulation in vivo.

Discussion

SUR1 is well known as the regulatory subunit of KATP channels, which are composed of

Kir6.2/SUR1 in pancreatic β cells. In this study, we focused on investigating the SUR1 in lung

cancer. First, we found that SUR1 expression was higher in lung cancer tissues than in normal lung

tissues based on the Oncomine database. High expression levels of SUR1 were correlated with short

patient survival times based on Kaplan-Meier plots for datasets from website www.kmplot.com.

Second, we observed increased SUR1 expression in cancer tissues of 11/16 lung cancer patients.

Third, SUR1 expression was also increased in NSCLC cell lines (including adenocarcinoma,

squamous cell carcinoma, and large cell carcinoma cell lines) compared to the normal lung cell lines

HBE and Beas 2B. Fourth, gain-of-function and loss-of-function studies in cell lines revealed that

SUR1 promoted growth in NSCLC cells. Fifth, in a nude mouse model, knockdown of SUR1 inhibited the growth of xenografts. Although 5/16 patients presented decreases or no changes in

SUR1 expression in cancer tissues, our results indicate that SUR1 may function as a tumor enhancer

in some lung cancer patients.

SUR1 is the receptor of sulfonylurea antidiabetic drugs, such as glibenclamide and gliclazide. We speculated that sulfonylureas may target SUR1 to suppress lung cancer. Thus far, preclinical and clinical studies on sulfonylureas in cancer have been very limited. Yang et al. reported that in type II

diabetes mellitus (T2MD), the use of glibenclamide and gliclazide was associated with reduced

cancer risk in a dose-dependent manner in a consecutive cohort study (29). Studies in cell lines have

shown that sulfonylureas inhibit cell growth, induce cell cycle arrest and apoptosis, and facilitate the

efficacy of other anticancer agents in gastric, breast, and ovarian and hepatoblastoma (8-11,30). In

this study, we found that glibenclamide targeted SUR1 to inhibit cell growth, cell cycle progression,

the EMT and migration and inhibited xenografts in a nude mouse model. The dose of glibenclamide

for diabetic patients is not more than 15 mg/day, which equals apporximately 2 mg/kg/day for mice.

The dose we used in the animal experiments was 200 mg/kg/day, which was selected according to

the dose of sulofenur, a diarysulfonylurea anticancer agent, used in Phase II clinical trials (31,32).

Although our dose was much higher than the clinical dose for diabetic patients, we did not observe any evidence of toxicity, for example, body weight loss, sickness, or liver injury in our experiments.

These findings suggest that glibenclamide targeted SUR1 to inhibit NSCLC both in vitro and in vivo.

To date, the mechanism of glibenclamide in cancer has not been elucidated. Qian et al. reported that in gastric cancer, glibenclamide regulates the ROS-JNK pathway to induce apoptosis (8). In

breast cancer, glibenclamide inhibits cell growth by inducing G0/G1 arrest (9). In ovarian cancer, it suppresses cell invasion through inhibition of PDGF (platelet-derived growth factor) secretion (10).

From the beginning of this study, we found that the expression and survival correlations for Kir6.1 and Kir6.2 in the online database were not consistent with that for SUR1. Moreover, KATP channel openers, minoxidil and nicorandil, did not promote cell growth but rather inhibited cell growth,

indicating that the effect of glibenclamidet may not depend on KATP channels. Therefore, we focused

our study on SUR1 but not on KATP channels. Though gain-of-function and loss-of-function study, we revealed that SUR1 phosphorylated and activated p70S6K. Additionally, glibenclamide inhibited

p70S6K after as little as 5 min, the effect was sustained for at least 24 h. Overexpression of p70S6K

almost completely attenuated the growth-inhibiting effect of glibenclamide, indicating that p70S6K

plays an important role in mediating the effects of glibenclamide.

SUR1 is the regulatory subunit that directly binds around the pore protein Kir6.xs to form the KATP

channel (33). Glibenclamide directly binds to SUR1 and induces a conformational change in SUR1

(4). Currently, the existence and functions of SUR1 alone or as a component of complexes other than

KATP channels are quite unknown. Seghers et al. reported the existence of KATP channel-independent

regulation of insulin secretion in a SUR1 knockout mouse model (34). Hambrock et al. observed that

in HEK293 cells exogenous overexpression of SUR1, but not SUR2B or SUR1 mutant (M1289T), enhanced glibenclamide-induced apoptosis (35). These findings suggest that SUR1 may have other functions in addition to regulation of KATP channels. In this study, we detected physical binding of

p70S6K and SUR1 through the C-terminus of SUR1. Although, no Kir6.1 or Kir6.2 was detected

when we pulled down SUR1, whether by proteomics analysis or immunoblotting, we cannot exclude

the function of SUR1 assembled in KATP channels in lung cancer due to the preliminary nature of the

data in this study. It is possible that some experimental conditions may miss some protein interactions or fail to detect SUR1-Kir6.x complexes at low abundance in lung cancer. We speculate

that SUR1 alone, SUR1-p70S6K complexes, SUR1-Kir6.x complexes and unknown SUR1 complexes all exist in lung cancer and respond to different cell contexts. This possibility is interesting and deserves further investigation. In this study, for the first time we found a new complex, SUR1/p70S6K, which may have new functions through regulation of the p70S6K signaling

pathway in NSCLC cells.

KLF4 has been proven to be a tumor suppressor in lung cancer (16,36). In this study, we found that KLF4 played an important role in glibenclamide-induced inhibition of cell growth, the EMT, and

migration. We also verified that SUR1 and p70S6K downregulated KLF4 expression. We then

explored how KLF4 was downregulated by p70S6K. It has been reported that increased DNA

methylation of the KLF4 promoter is correlated with low KLF4 expression in chronic lymphocytic

leukemia (37). An HDAC (histone deacetylase) inhibitor has been reported to increase KLF4 expression in lung cancer (36). In this study, we found that p70S6K-induced downregulation of

KLF4 was reversed by 5-azacytidine, but not Trichostatin A, indicating that DNA methylation was

involved. Then, we showed that p70S6K-induced inactivation of the KLF4 promoter (from -1500 to

-137 bp) was attenuated by 5-azacytidine treatment using a luciferase assay. p70S6K significantly

increased the methylation levels of KLF4 promoter by BSP analysis. Furthermore, DNMT1

knockdown attenuated p70S6K-induced downregulation of KLF4 expression. These results suggested that p70S6K decreased KLF4 expression by enhancing DNMT1-mediated methylation of

the KLF4 promoter. In addition, we searched for transcription factors that possibly bound to the

KLF4 promoter (appoximately 1.0 kb upstream of the starting code) using Alibaba2.1 software, and

found that SP1, NF-kappaB, C/EBPalpha, and NF-1 binding sequences were present. p70S6K has been reported to activate NF-kappaB and regulate AP-1 transcription in breast cancer (38).

Furthermore, KLF4 is also downregulated by some miRNAs, such as miR-7, miR-10, miR-25, and

miR-3120-5p (39). Therefore, other mechanisms may exist as well. How SUR1 interacted with

p70S6K and downregulated KLF4 transcription deserves further investigation.

In summary, this study revealed that SUR1 was overexpressed in lung cancer. SUR1 promoted

NSCLC by interacting with p70S6K, increasing its activity, and subsequently downregulating KLF4

expression through a mechanism involving enhancement of DNMT1-mediated methylation of the

KLF4 promoter. Glibenclamide targeted SUR1 to exert anticancer effects both in vitro and in vivo.

These findings suggest SUR1 as a new target for cancer therapy and suggest the potential anticancer effects of glibenclamide in NSCLC.

Disclosure of Potential Conflicts of Interest

No conflicts of interest.

Authors’ Contributions

KX, GS, ML, HC, ZZ, and XQ conducted the experiments in cells. KX, GS, and PL conducted the

experiments in animal models. HC, WH, and LX conducted the experiments in human tissue samples.

KX, ML, WH, and LX were involved in study design and data analysis. XW were responsible for

study design, data analysis, and manuscript writing. All authors reviewed the manuscript.

Acknowledgements

This work is supported by the National Natural Science Foundation of China under Grant No.

81473241, 81172004, 81102458 for X, Wang; Key Laboratory of Human Functional Genomics of

Jiangsu Province, Nanjing Medical University, Nanjing, Jiangsu, China, 210029 (X, Wang); and the

“Six talent peaks project” in Jiangsu Province (W, Huang). We thank Dr. John Blenis (Harvard

Medical School) for providing us with the pRK7-S6K-HA plasmids and the control vector pRK7.

References 1. Siegel RL, Miller KD, Jemal A. Cancer statistics, 2018. CA: a cancer journal for clinicians 2018;68(1):7-30 doi 10.3322/caac.21442. 2. Torre LA, Siegel RL, Jemal A. Lung Cancer Statistics. Advances in experimental medicine and biology 2016;893:1-19 doi 10.1007/978-3-319-24223-1_1. 3. Miller KD, Siegel RL, Lin CC, Mariotto AB, Kramer JL, Rowland JH, et al. Cancer treatment and survivorship statistics, 2016. CA: a cancer journal for clinicians 2016;66(4):271-89 doi 10.3322/caac.21349. 4. Aguilar-Bryan L, Bryan J. Molecular biology of adenosine triphosphate-sensitive potassium channels. Endocr Rev 1999;20(2):101-35 doi 10.1210/edrv.20.2.0361. 5. Pasello G, Urso L, Conte P, Favaretto A. Effects of sulfonylureas on tumor growth: a review of the literature. The oncologist 2013;18(10):1118-25 doi 10.1634/theoncologist.2013-0177 theoncologist.2013-0177 [pii]. 6. Wu JX, Ding D, Wang M, Kang Y, Zeng X, Chen L. Ligand binding and conformational changes of SUR1 subunit in pancreatic ATP-sensitive potassium channels. Protein & cell 2018 doi 10.1007/s13238-018-0530-y. 7. Campbell JD, Sansom MS, Ashcroft FM. Potassium channel regulation. EMBO Rep 2003;4(11):1038-42 doi 10.1038/sj.embor.embor7400003 embor7400003 [pii]. 8. Qian X, Li J, Ding J, Wang Z, Duan L, Hu G. Glibenclamide exerts an antitumor activity through reactive oxygen species-c-jun NH2-terminal kinase pathway in human gastric cancer cell line MGC-803. Biochem Pharmacol 2008;76(12):1705-15 doi 10.1016/j.bcp.2008.09.009 S0006-2952(08)00636-9 [pii]. 9. Nunez M, Medina V, Cricco G, Croci M, Cocca C, Rivera E, et al. Glibenclamide inhibits cell growth by inducing G0/G1 arrest in the human breast cancer cell line MDA-MB-231. BMC Pharmacol Toxicol 2013;14:6 doi 10.1186/2050-6511-14-6 2050-6511-14-6 [pii]. 10. Yasukagawa T, Niwa Y, Simizu S, Umezawa K. Suppression of cellular invasion by glybenclamide through inhibited secretion of platelet-derived growth factor in ovarian clear cell carcinoma ES-2 cells. FEBS Lett 2012;586(10):1504-9 doi 10.1016/j.febslet.2012.04.007 S0014-5793(12)00285-2 [pii]. 11. Kim JA, Kang YS, Lee SH, Lee EH, Yoo BH, Lee YS. Glibenclamide induces apoptosis through inhibition of cystic fibrosis transmembrane conductance regulator (CFTR) Cl(-) channels and intracellular Ca(2+) release in HepG2 human hepatoblastoma cells. Biochemical and biophysical research communications 1999;261(3):682-8 doi 10.1006/bbrc.1999.1108

S0006-291X(99)91108-7 [pii]. 12. Wu D, Cheng J, Sun G, Wu S, Li M, Gao Z, et al. p70S6K promotes IL-6-induced epithelial-mesenchymal transition and metastasis of head and neck squamous cell carcinoma. Oncotarget 2016;7(24):36539-50 doi 10.18632/oncotarget.9282. 13. Zhou H, Huang S. Role of mTOR signaling in tumor cell motility, invasion and metastasis. Current protein & peptide science 2011;12(1):30-42. 14. Magnuson B, Ekim B, Fingar DC. Regulation and function of ribosomal protein S6 kinase (S6K) within mTOR signalling networks. The Biochemical journal 2012;441(1):1-21 doi 10.1042/BJ20110892 BJ20110892 [pii]. 15. Tavares MR, Pavan IC, Amaral CL, Meneguello L, Luchessi AD, Simabuco FM. The S6K protein family in health and disease. Life sciences 2015;131:1-10 doi 10.1016/j.lfs.2015.03.001. 16. Hu W, Hofstetter WL, Li H, Zhou Y, He Y, Pataer A, et al. Putative tumor-suppressive function of Kruppel-like factor 4 in primary lung carcinoma. Clinical cancer research : an official journal of the American Association for Cancer Research 2009;15(18):5688-95 doi 10.1158/1078-0432.CCR-09-0310. 17. Takahashi K, Tanabe K, Ohnuki M, Narita M, Ichisaka T, Tomoda K, et al. Induction of pluripotent stem cells from adult human fibroblasts by defined factors. Cell 2007;131(5):861-72 doi 10.1016/j.cell.2007.11.019. 18. Kaczynski J, Cook T, Urrutia R. Sp1- and Kruppel-like transcription factors. Genome biology 2003;4(2):206. 19. Cheng WL, She ZG, Qin JJ, Guo JH, Gong FH, Zhang P, et al. Interferon Regulatory Factor 4 Inhibits Neointima Formation by Engaging Kruppel-Like Factor 4 Signaling. Circulation 2017;136(15):1412-33 doi 10.1161/CIRCULATIONAHA.116.026046. 20. Maddipati R, Katz JP. KLF4 Initiates Acinar Cell Reprogramming and Is Essential for the Early Stages of Pancreatic Carcinogenesis. Cancer cell 2016;29(3):247-8 doi 10.1016/j.ccell.2016.02.019. 21. Wei D, Wang L, Yan Y, Jia Z, Gagea M, Li Z, et al. KLF4 Is Essential for Induction of Cellular Identity Change and Acinar-to-Ductal Reprogramming during Early Pancreatic Carcinogenesis. Cancer cell 2016;29(3):324-38 doi 10.1016/j.ccell.2016.02.005. 22. Fadous-Khalife MC, Aloulou N, Jalbout M, Hadchity J, Aftimos G, Paris F, et al. Kruppel-like factor 4: A new potential biomarker of lung cancer. Molecular and clinical oncology 2016;5(1):35-40 doi 10.3892/mco.2016.883. 23. Li S, Huang L, Gu J, Wu J, Ou W, Feng J, et al. Restoration of KLF4 Inhibits Invasion and Metastases of Lung Adenocarcinoma through Suppressing MMP2. Journal of Cancer 2017;8(17):3480-9 doi 10.7150/jca.21241. 24. Pon YL, Zhou HY, Cheung AN, Ngan HY, Wong AS. p70 S6 kinase promotes epithelial to mesenchymal transition through snail induction in ovarian cancer cells. Cancer research 2008;68(16):6524-32 doi 10.1158/0008-5472.CAN-07-6302. 25. Schalm SS, Blenis J. Identification of a conserved motif required for mTOR signaling. Current biology : CB 2002;12(8):632-9. 26. Wang X, Yue P, Kim YA, Fu H, Khuri FR, Sun SY. Enhancing mammalian target of rapamycin (mTOR)-targeted cancer therapy by preventing mTOR/raptor inhibition-initiated, mTOR/rictor-independent Akt activation. Cancer research 2008;68(18):7409-18 doi 10.1158/0008-5472.CAN-08-1522. 27. Chen X, Zhu L, Ma Z, Sun G, Luo X, Li M, et al. Oncogenic miR-9 is a target of erlotinib in NSCLCs. Scientific reports 2015;5:17031 doi 10.1038/srep17031. 28. Xie VK, Li Z, Yan Y, Jia Z, Zuo X, Ju Z, et al. DNA-Methyltransferase 1 Induces Dedifferentiation of Pancreatic Cancer Cells through Silencing of Kruppel-Like Factor 4 Expression. Clinical cancer research : an official journal of the American Association for Cancer Research 2017;23(18):5585-97 doi 10.1158/1078-0432.CCR-17-0387. 29. Yang X, So WY, Ma RC, Yu LW, Ko GT, Kong AP, et al. Use of sulphonylurea and cancer in type 2 diabetes-The

Hong Kong Diabetes Registry. Diabetes Res Clin Pract 2010;90(3):343-51 doi 10.1016/j.diabres.2010.08.022 S0168-8227(10)00442-0 [pii]. 30. Rong Z, Li L, Fei F, Luo L, Qu Y. Combined treatment of glibenclamide and CoCl2 decreases MMP9 expression and inhibits growth in highly metastatic breast cancer. J Exp Clin Cancer Res 2013;32:32 doi 10.1186/1756-9966-32-32 1756-9966-32-32 [pii]. 31. Taylor CW, Alberts DS, Peng YM, McCloskey TM, Matzner M, Roe DJ, et al. Antitumor activity and clinical pharmacology of sulofenur in ovarian cancer. Journal of the National Cancer Institute 1992;84(23):1798-802. 32. Forouzesh B, Takimoto CH, Goetz A, Diab S, Hammond LA, Smetzer L, et al. A phase I and pharmacokinetic study of ILX-295501, an oral diarylsulfonylurea, on a weekly for 3 weeks every 4-week schedule in patients with advanced solid malignancies. Clinical cancer research : an official journal of the American Association for Cancer Research 2003;9(15):5540-9. 33. Proks P, Lippiat JD. Membrane ion channels and diabetes. Current pharmaceutical design 2006;12(4):485-501. 34. Seghers V, Nakazaki M, DeMayo F, Aguilar-Bryan L, Bryan J. Sur1 knockout mice. A model for K(ATP) channel-independent regulation of insulin secretion. J Biol Chem 2000;275(13):9270-7. 35. Hambrock A, de Oliveira Franz CB, Hiller S, Osswald H. Glibenclamide-induced apoptosis is specifically enhanced by expression of the sulfonylurea receptor isoform SUR1 but not by expression of SUR2B or the mutant SUR1(M1289T). J Pharmacol Exp Ther 2006;316(3):1031-7 doi jpet.105.097501 [pii] 10.1124/jpet.105.097501. 36. Yu T, Chen X, Zhang W, Liu J, Avdiushko R, Napier DL, et al. KLF4 regulates adult lung tumor-initiating cells and represses K-Ras-mediated lung cancer. Cell death and differentiation 2016;23(2):207-15 doi 10.1038/cdd.2015.85. 37. Filarsky K, Garding A, Becker N, Wolf C, Zucknick M, Claus R, et al. Kruppel-like factor 4 (KLF4) inactivation in chronic lymphocytic leukemia correlates with promoter DNA-methylation and can be reversed by inhibition of NOTCH signaling. Haematologica 2016;101(6):e249-53 doi 10.3324/haematol.2015.138172. 38. Ahmed M, Kundu GC. Osteopontin selectively regulates p70S6K/mTOR phosphorylation leading to NF-kappaB dependent AP-1-mediated ICAM-1 expression in breast cancer cells. Molecular cancer 2010;9:101 doi 10.1186/1476-4598-9-101. 39. Ding X, Zhong T, Jiang L, Huang J, Xia Y, Hu R. miR-25 enhances cell migration and invasion in non-small-cell lung cancer cells via ERK signaling pathway by inhibiting KLF4. Molecular medicine reports 2018;17(5):7005-16 doi 10.3892/mmr.2018.8772.

Figure Legends

Figure 1. SUR1 is elevated in human NSCLC and promotes cell growth. A, ABCC8 (SUR1) mRNA

expression in different subtypes of NSCLC in the Oncomine database. B, Kaplan-Meier plots

showing the correlation between ABCC8 expression and patient survival from datasets at the website www.kmplot.com. C, SUR1 protein expression in human NSCLC tissues samples and paired

peripheral normal tissues (upper panel, 8 patients with adenocarcinoma; lower panel, 8 patients with squamous cell carcinoma) as revealed by Western blotting. D, SUR1 protein expression in NSCLC cells and normal cells as revealed by Western blotting. E and F, Effects of stable SUR1 silencing (E) or overexpression (F) on cell growth as determined by SRB assay and on SUR1 expression as determined by Western blot analysis. Bar, SD (n=4); *, P<0.05. The values under the blot bands are results of quantitative analysis of the bands. The results are representative of at least three independent experiments.

Figure 2. Glibenclamide inhibits the growth, cell cycle progression, the EMT and migration of

NSCLC cells. NSCLC cells were treated with different concentrations of glibenclamide (5-500

μmol/L) as indicated. A, Results of a 3-day SRB assay. B, Results of a 14-day colony formation

assay. C, Cell cycle analysis by flow cytometry for cells treated with 100 μmol/L glibenclamide for

24 h. D and E, Western blot analysis (D) and transwell assay for cell migration (E) in cells treated

with 75 μmol/L glibenclamide for 24 h. Scale bar, 30 μm. Magnification, 100×. F, Results of a 3-day

SRB assay for A549 cells with stable SUR1 overexpression or silencing treated with glibenclamide.

Bars, SD. The results are representative of at least three independent experiments.

Figure 3. p70S6K plays a critical role in mediating the effects of SUR1 and glibenclamide in

NSCLC cells. A-C, HEK293T cells were cotransfected with flag-tagged SUR1 and HA-tagged

p70S6K (A), A549 cells were transfected with HA-tagged p70S6K alone (B) or cotransfected with flag-tagged C-terminal SUR1 (C) constructs for 48 h as indicated. The cells were then subjected to

immunoprecipitation and Western blotting using the indicated antibodies. D, Cells with SUR1

silencing or overexpression (the same samples as in Fig. 1) were subjected to Western blot analysis.

The values under the blot bands are the results of quantitative analysis of the bands. E,

Serum-starved NSCLC cells were treated with 100 μmol/L glibenclamide for different times as indicated, and cotreated with 10% serum for 30 min, and then subjected to Western blot analysis. F and G, The indicated cells were transfected with p70S6K plasmid (F) or siRNA (G), treated with 100

μmol/L glibenclamide, and then subjected to SRB assays and Western blotting. Bars, SD; *, P<0.05

vs. control; #, P<0.05 vs. glibenclamide treatment. The results are representative of at least three

independent experiments.

Figure 4. KLF4 mediated the effects of glibenclamide. A, A549 cells treated with 50 μmol/L

glibenclamide for 24 h were subjected to microarray analysis. A heatmap of differential gene

expression (>1.5-fold change) is shown. B and C, Results of qRT-PCR analysis (B) and Western blot

analysis (C) of KLF4 expression in NSCLCs treated with 50 μmol/L glibenclamide for 24 h. D, E,

and F, Results of SRB assays (D), Western blot assays (E), and transwell assays (F) on cells with or

without KLF4 transient knockdown and with or without 75 μmol/L glibenclamide treatment for an

additional 24 h. Bars, SD; *, P<0.05 vs. control; #, P<0.05 vs. glibenclamide treatment. Scale bar, 30

µm. Magnification, 100×. The results are representative of three independent experiments.

Figure 5. SUR1 and p70S6K downregulated KLF4 expression by enhancing DNMT1-mediated

methylation of the KLF4 promoter. A, Western blot analysis for cells with SUR1 silencing or overexpression. The protein lysates are the same as those in Fig. 1. B, Western blot analysis for cells

with p70S6K silencing or overexpressions. The protein lysates are the same as those in Fig. 3F and G.

The values under the blot bands are the results of quantitative analysis of the bands. C, A549 cells

were transfected with p70S6K plasmids for 24 h, treated with or without 5-Azacytidine (4 μmol/L) for another 24 h, and then subjected to qRT-PCR assays and Western blotting. D, Cells were cotransfected with pGL3-KLF4-promoter plasmids (with the pGL3 vector as a control) and p70S6K

plasmids, treated with 5-Azacytidine 4 μmol/L for another 24 h as indicated, and then subjected to dual-luciferase reporter assays. E, BSP analysis of KLF4 promoter in A549 cells transfected with

p70S6K plasmids. A schematic illustration of the selected region of KLF4 promoter and the

methylation of CpG sites. Filled circle, methylated; open circle, unmethylated. Each column

represents one CpG site, and each row represents one clone of bacteria. F, Western blot analysis of

cells cotransfected with DNMT1 siRNA and p70S6K plasmids as indicated. Bars, SD; *, P<0.05 vs.

control; #, P<0.05 vs. p70S6K plasmid. The results are representative of three independent experiments.

Figure 6. SUR1 silencing or glibenclamide suppressed the growth of NSCLC tumors in nude mouse models. A, B, and C, Tumor sizes (A), Tumor weights (B), and Western blot analysis results (C) for

nude mice injected with control cells or cells with stable SUR1 knockdown (n=8). D, E, and F, Nude

mice burdened with A549 (n=6 for each group) xenografts were treated with glibenclamide (o.g. 200

mg/kg/d) or its vehicle for 14 days. Tumor size (D), tumor weight (E), and protein expression (F) were examined. In A and D: points, average tumor size; bars, SD; *, P<0.05. In B and E: points, individual tumor weight; horizontal line, mean tumor weight; bars, SD; *, P<0.05.

Glibenclamide targets sulfonylurea receptor 1 to inhibit p70S6K activity and upregulate KLF4 expression to suppress non-small-cell lung carcinoma

Kexin Xu, Geng Sun, Min Li, et al.

Mol Cancer Ther Published OnlineFirst July 24, 2019.

Updated version Access the most recent version of this article at: doi:10.1158/1535-7163.MCT-18-1181

Supplementary Access the most recent supplemental material at: Material http://mct.aacrjournals.org/content/suppl/2019/07/24/1535-7163.MCT-18-1181.DC1

Author Author manuscripts have been peer reviewed and accepted for publication but have not yet Manuscript been edited.

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://mct.aacrjournals.org/content/early/2019/07/24/1535-7163.MCT-18-1181. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.