DOCSLIB.ORG

Characterization of Microsatellite Loci in Festuca Gautieri

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Characterization of Microsatellite Loci in Festuca Gautieri American Journal of Botany: e360–e362. 2011. AJB Primer Notes & Protocols in the Plant Sciences C HARACTERIZATION OF MICROSATELLITE LOCI IN F ESTUCA GAUTIERI (POACEAE) AND TRANSFERABILITY TO F. ESKIA AND F. × PICOEUROPEANA 1 Jos é Gabriel Segarra-Moragues 2,4 and Pilar Catal á n 3 2 Centro de Investigaciones sobre Desertifi caci ó n (CIDE, CSIC-UV-GV), Carretera de Moncada-N á quera Km 4.5, E-46113 Moncada, Valencia, Spain; and 3 Departamento de Agricultura y Econom í a Agraria, Escuela Polit é cnica Superior de Huesca, Universidad de Zaragoza, C/ Carretera de Cuarte s/n, E-22071 Huesca, Spain • Premise of the study: Enriched genomic libraries were used to isolate and characterize microsatellite loci in Festuca gautieri , an important plant component of subalpine calcareous grasslands of the eastern Iberian Peninsula, the Pyrenees, and the Can- tabrian Mountains. Microsatellites were required to investigate landscape genetics across its distribution range and at a nar- rower geographical scale within the Ordesa y Monte Perdido , Aig ü estortes, and Picos de Europa Spanish national parks. • Methods and Results: Ten polymorphic microsatellite loci were characterized. They amplifi ed a total of 116 alleles in a sample of 30 individuals of F. gautieri , showing high levels of genetic diversity (expected heterozygosity = 0.821). Cross-species transferability to two other close congeners, F. eskia and F × picoeuropeana, increased the total number of alleles to 137. These taxa showed lower numbers of alleles but similar levels of genetic diversity to F. gautieri . • Conclusions: These microsatellite primers will be useful in population and landscape genetics and in establishing conservation strategies for these characteristic elements of subalpine pastures. Key words: conservation genetics; Festuca gautieri ; landscape genetics; Loliinae; Pooideae; SSR. Festuca L. (Poaceae), with more than 500 species, is the largest F. eskia Ramond ex DC. , an edaphic vicariant species occupying genus of the Loliinae. Species of Festuca are widespread in the similar habitats but on siliceous soils. In geographical areas where holarctic region but also inhabit cool and temperate areas in the both substrates come into contact, populations of F. gautieri and southern hemisphere. They grow in a large variety of different F. eskia naturally hybridize, producing the morphologically inter- habitats, from wetlands to xeric ecosystems, and are especially mediate taxon F. × picoeuropeana M. I. Gut. & Homet. well adapted to extreme conditions in mountains and in arctic and Such habitats have been subject to diverse human-induced subantarctic areas. Based on its wide taxonomic diversity and geo- degradations because of overexploitation of subalpine pastures graphical and ecological amplitude, different authors have specu- for cattle and sheep and the construction of touristic resources lated on the putative ancient origin of Festuca and postulated an such as ski resorts and have been identifi ed as potentially sensi- evolutionary trend from more basal broad-leaved lineages to more tive areas for loss of biodiversity under climatic change. recently evolved fi ne-leaved lineages, with some species with in- We have conducted a microsatellite characterization in F. termediate features forming an intermediate grade between these gautieri to investigate the genetic landscape and ecology of sub- two major clades ( Inda et al., 2008 and references therein). Festuca alpine grassland communities of F. gautieri , F. eskia , and their gautieri (Hack.) K. Richt. corresponds to a basal group of fi ne- hybrid F. × picoeuropeana in the Spanish Pyrenean-Cantabrian leaved Festuca taxa ( Festuca sect. Eskia Willk.) that are most di- national parks of Ordesa y Monte Perdido, Aig ü estortes i Estany versifi ed in Mediterranean subalpine mountains and a major de Sant Maurici, and Picos de Europa. In these areas, these taxa constitutive element of subalpine pastures. This calcareous species act as a shelter to numerous herbaceous plants and animals and, is diploid with 2 n = 14 chromosomes and is capable of both sexual thus, play a key role in the subalpine plant community structure reproduction and vegetative spread through rhizomatous tillering. and in the maintenance of its global biodiversity ( Gonzalo-Turpin This species is morphologically and phylogenetically close to and Hazard, 2009 ; Gonzalo-Turpin et al., 2010 ). Our study is aimed at addressing conservation strategies for their biodiversity 1 Manuscript received 2 June 2011; revision accepted 15 July 2011. and at promoting ecological restoration of altered areas with The authors thank Antonio D í az-P é rez for his help with fi eld sampling, local genotypes. We will perform genotypic analysis of individu- and G. Sadowski and F. Fernando for information on the enrichment als based on this set of nuclear simple sequence repeat (SSR) process of the Festuca gautieri SSR library. Financial support was provided markers to describe the landscape genetics of each species. This by the Spanish projects UZ2008-TEC-14 from the University of Zaragoza, will enable us (1) to detect hybrids and introgression zones, (2) PI097/08 from the Arag ó n Government, GA-LC-012/2008 from the Arag ó n to interpret historical and ecological processes affecting the sub- Government – La Caixa, and 059/2009 from the Ministry of Environment (National Parks division). J.G.S.-M. was supported by a Spanish Ministry alpine landscapes, (3) to propose relevant genetic and ecological of Science and Innovation “ Ram ó n y Cajal ” postdoctoral contract. units for the conservation of each species, (4) to select local gen- 4 Author for correspondence: [email protected] otypes for conservation and ecological restoration, and (5) to build predictive models of distribution of these species regarding doi:10.3732/ajb.1100267 different scenarios of global climate change. American Journal of Botany: e360–e362, 2011; http://www.amjbot.org/ © 2011 Botanical Society of America e360 December 2011] AJB Primer Notes & Protocols — FESTUCA GAUTIERI microsatellites e361 Table 1. Characteristics of 18 microsatellite loci developed in Festuca gautieri . For each locus, the primer pair sequences, repeat motif, size of the original fragment (bp), annealing temperature, and GenBank accession numbers are shown. a ′ ′ b ° Locus Primer sequence (5 – 3 ) Repeat motifSize Ta ( C) GenBank Accession No. FgauA02* F: 6FAM-CGTTTCAGTGTCGTTGATGTC (CA)13 176 56 JN040543 R: TTCTCTGCGTGGTCTGTATTG FgauA04* F: VIC-AAGGAAGCACACTACCTACACG (CA)10 294 56 JN040544 R: ATCCCAATCTGAACCCAATC FgauA101 F: NED-CACGAAGAACGAACAAGAAC (CA)13 280 51 JN040553 R: ATTCAAGGCAACCCTCTCTA FgauA104 F: VIC-ACCACGGTCTCTCACATAGG (GT)13 226 56 JN040555 R: CCGATGTTCACGAATTGAC FgauA111* F: VIC-TGACCTAAACTGTTCCCAAATG (GT)23 209 51 JN040545 R: CATGCAAGGTTGTATCTCACG FgauA115 F: VIC-TCCGATTTGTGGTCAATCTC (GT)13 206 56 JN040557 R: CATGCAATCTTCACGAATTG FgauA117 F: NED-TCAAACCTTTGTGAACAACAG (CA)9 298 56 JN040558 R: GGGATGGTGTGGTTAGTAAAT FgauA119 F: NED-CGGTCTCTCCTTGGATGA (GT)21 149 56 JN040559 R: GGGAACACGAAGAACGAA FgauA121* F: VIC-TGGAGAGGAACTTAGTTGAAAG (CA)13 119 56 JN040546 R: TGTACGACATGCTGATCTACA FgauB07* F: PET-TCATCGCTGACAAACTCTTC (CT)16 275 56 JN040547 R: CTGACGGGTATTACTTCCAAC FgauB101 F: VIC-GGAAGAGCCAAGATCCAATCT (GA)11 262 51 JN040560 R: CGTGCTGATTTAGATCCCATC FgauB103* F: VIC-CCACCTGTCATAAGCCTTTC (GA)6 G(GA)11 138 51 JN040548 R: GCTGATGTCCTCTTCTCGTC FgauB104 F: NED-AGTGTTCAGCGTTTGTCAGTG (GA)11 172 56 JN040561 R: CCCAGCAATCTTTATCGTGAG FgauB109* F: PET-CATGGCTTGACACTCTATGAG (GA)13 217 51 JN040549 R: TTTCAGTAAAGGGAACATCTTG FgauB119* F: 6FAM-GGGACACAAGCACTAAAGTTG (GA)15 146 51 JN040550 R: CCAAAAACAAAATAGGACGAAG FgauB125* F: NED-AAAGCACCCAGAATATAATGAG (CT)15 211 56 JN040551 R: ACTTGCTGTTACCATGTCAAC FgauB130* F: PET-GGAAAAGCCTAGAGAGAGGTG (GA)3 GG(GA)8 176 56 JN040552 R: CAAAGGGCACATCAGTTAAAG FgauC105 F: NED-TACCTTTGTAGGGACGATACG (CAA)13 294 56 JN040565 R: GGTCATTTTGATGGGAGATAC a Polymorphic loci are denoted with an asterisk (*). b 6FAM, NED, PET, and VIC are fl uorescent dyes from Applied Biosystems. METHODS AND RESULTS (Biotools, Madrid, Spain), 2 mM MgCl2 , 0.4 mM of each dNTP, 5 pmol each of the labeled (forward) and unlabeled (reverse) primers, 1 U Taq polymerase (Bio- tools), and 20 ng of template DNA. The PCR program consisted of one step of 4 One hundred micrograms of total DNA was extracted from silica gel – dried ° ° young leaves of an individual pool using the DNeasy Plant Minikit (QIAGEN, min at 94 C; followed by 35 cycles each of 1 min at 94 C, 1 min at annealing temperature ( Table 1 ) , and 45 s at 72 ° C; and a fi nal extension step of 7 min at Barcelona, Spain) following the manufacturer ’ s instructions. This DNA served as a ° template for enriched microsatellite library construction for CT, GT, CTT, and GTT 72 C. The products were run on an ABI 3730 automated sequencer (Applied motifs developed by Genetic Identifi cation Services (Chatsworth, California, USA ; Biosystems) using LIZ500 as the internal lane size standard and the amplifi ed http://www.genetic-id-services.com) following Jones et al. (2002) . Genomic DNA fragment lengths assigned to allelic sizes with GENEMARKER version 1.85 was partially restricted with a cocktail of seven blunt-end cutting enzymes ( Rsa I, software (SoftGenetics, State College, Pennsylvania, USA). After an initial Hae III, Bsr B1, Pvu II, Stu I, Sca I, and Eco RV). Fragments in the size range of 300 screening of individuals, 10 out of 24 loci (JN040543, JN040544, JN040545, to 750 bp were
Load more

Recommended publications
  • Conserving Europe's Threatened Plants
    Conserving Europe’s threatened plants Progress towards Target 8 of the Global Strategy for Plant Conservation Conserving Europe’s threatened plants Progress towards Target 8 of the Global Strategy for Plant Conservation By Suzanne Sharrock and Meirion Jones May 2009 Recommended citation: Sharrock, S. and Jones, M., 2009. Conserving Europe’s threatened plants: Progress towards Target 8 of the Global Strategy for Plant Conservation Botanic Gardens Conservation International, Richmond, UK ISBN 978-1-905164-30-1 Published by Botanic Gardens Conservation International Descanso House, 199 Kew Road, Richmond, Surrey, TW9 3BW, UK Design: John Morgan, [email protected] Acknowledgements The work of establishing a consolidated list of threatened Photo credits European plants was first initiated by Hugh Synge who developed the original database on which this report is based. All images are credited to BGCI with the exceptions of: We are most grateful to Hugh for providing this database to page 5, Nikos Krigas; page 8. Christophe Libert; page 10, BGCI and advising on further development of the list. The Pawel Kos; page 12 (upper), Nikos Krigas; page 14: James exacting task of inputting data from national Red Lists was Hitchmough; page 16 (lower), Jože Bavcon; page 17 (upper), carried out by Chris Cockel and without his dedicated work, the Nkos Krigas; page 20 (upper), Anca Sarbu; page 21, Nikos list would not have been completed. Thank you for your efforts Krigas; page 22 (upper) Simon Williams; page 22 (lower), RBG Chris. We are grateful to all the members of the European Kew; page 23 (upper), Jo Packet; page 23 (lower), Sandrine Botanic Gardens Consortium and other colleagues from Europe Godefroid; page 24 (upper) Jože Bavcon; page 24 (lower), Frank who provided essential advice, guidance and supplementary Scumacher; page 25 (upper) Michael Burkart; page 25, (lower) information on the species included in the database.
    [Show full text]
  • Past Climate Changes Facilitated Homoploid Speciation in Three Mountain Spiny Fescues (Festuca, Poaceae)
    www.nature.com/scientificreports OPEN Past climate changes facilitated homoploid speciation in three mountain spiny fescues Received: 15 June 2016 Accepted: 03 October 2016 (Festuca, Poaceae) Published: 03 November 2016 I. Marques1, D. Draper2, M. L. López-Herranz1, T. Garnatje3, J. G. Segarra-Moragues4 & P. Catalán1,5 Apart from the overwhelming cases of allopolyploidization, the impact of speciation through homoploid hybridization is becoming more relevant than previously thought. Much less is known, however, about the impact of climate changes as a driven factor of speciation. To investigate these issues, we selected Festuca picoeuropeana, an hypothetical natural hybrid between the diploid species F. eskia and F. gautieri that occurs in two different mountain ranges (Cantabrian Mountains and Pyrenees) separated by more than 400 km. To unravel the outcomes of this mode of speciation and the impact of climate during speciation we used a multidisciplinary approach combining genome size and chromosome counts, data from an extensive nuclear genotypic analysis, plastid sequences and ecological niche models (ENM). Our results show that the same homoploid hybrid was originated independently in the two mountain ranges, being currently isolated from both parents and producing viable seeds. Parental species had the opportunity to contact as early as 21000 years ago although niche divergence occurs nowadays as result of a climate-driven shift. A high degree of niche divergence was observed between the hybrid and its parents and no recent introgression or backcrossed hybrids were detected, supporting the current presence of reproductive isolation barriers between these species. Homoploid hybrid speciation (HHS), where interspecific gene flow leads to the formation of a novel and stable lineage without a change in chromosome number1–3 has traditionally been defended as rare in relation to the more common allopolyploid hybrid speciation4,5.
    [Show full text]
  • Threats to Australia's Grazing Industries by Garden
    final report Project Code: NBP.357 Prepared by: Jenny Barker, Rod Randall,Tony Grice Co-operative Research Centre for Australian Weed Management Date published: May 2006 ISBN: 1 74036 781 2 PUBLISHED BY Meat and Livestock Australia Limited Locked Bag 991 NORTH SYDNEY NSW 2059 Weeds of the future? Threats to Australia’s grazing industries by garden plants Meat & Livestock Australia acknowledges the matching funds provided by the Australian Government to support the research and development detailed in this publication. This publication is published by Meat & Livestock Australia Limited ABN 39 081 678 364 (MLA). Care is taken to ensure the accuracy of the information contained in this publication. However MLA cannot accept responsibility for the accuracy or completeness of the information or opinions contained in the publication. You should make your own enquiries before making decisions concerning your interests. Reproduction in whole or in part of this publication is prohibited without prior written consent of MLA. Weeds of the future? Threats to Australia’s grazing industries by garden plants Abstract This report identifies 281 introduced garden plants and 800 lower priority species that present a significant risk to Australia’s grazing industries should they naturalise. Of the 281 species: • Nearly all have been recorded overseas as agricultural or environmental weeds (or both); • More than one tenth (11%) have been recorded as noxious weeds overseas; • At least one third (33%) are toxic and may harm or even kill livestock; • Almost all have been commercially available in Australia in the last 20 years; • Over two thirds (70%) were still available from Australian nurseries in 2004; • Over two thirds (72%) are not currently recognised as weeds under either State or Commonwealth legislation.
    [Show full text]
  • Dated Historical Biogeography of the Temperate Lohinae (Poaceae, Pooideae) Grasses in the Northern and Southern Hemispheres
    -<'!'%, -^,â Availableonlineatwww.sciencedirect.com --~Î:Ùt>~h\ -'-'^ MOLECULAR s^"!! ••;' ScienceDirect PHJLOGENETICS .. ¿•_-;M^ EVOLUTION ELSEVIER Molecular Phylogenetics and Evolution 46 (2008) 932-957 ^^^^^^^ www.elsevier.com/locate/ympev Dated historical biogeography of the temperate LoHinae (Poaceae, Pooideae) grasses in the northern and southern hemispheres Luis A. Inda^, José Gabriel Segarra-Moragues^, Jochen Müller*^, Paul M. Peterson'^, Pilar Catalán^'* ^ High Polytechnic School of Huesca, University of Zaragoza, Ctra. Cuarte km 1, E-22071 Huesca, Spain Institute of Desertification Research, CSIC, Valencia, Spain '^ Friedrich-Schiller University, Jena, Germany Smithsonian Institution, Washington, DC, USA Received 25 May 2007; revised 4 October 2007; accepted 26 November 2007 Available online 5 December 2007 Abstract Divergence times and biogeographical analyses liave been conducted within the Loliinae, one of the largest subtribes of temperate grasses. New sequence data from representatives of the almost unexplored New World, New Zealand, and Eastern Asian centres were added to those of the panMediterranean region and used to reconstruct the phylogeny of the group and to calculate the times of lineage- splitting using Bayesian approaches. The traditional separation between broad-leaved and fine-leaved Festuca species was still main- tained, though several new broad-leaved lineages fell within the fine-leaved clade or were placed in an unsupported intermediate position. A strong biogeographical signal was detected for several Asian-American, American, Neozeylandic, and Macaronesian clades with dif- ferent aifinities to both the broad and the fine-leaved Festuca. Bayesian estimates of divergence and dispersal-vicariance analyses indicate that the broad-leaved and fine-leaved Loliinae likely originated in the Miocene (13 My) in the panMediterranean-SW Asian region and then expanded towards C and E Asia from where they colonized the New World.
    [Show full text]
  • Ornamental Grasses for Cold Climates North Central Regional Extension P Ublication 573
    \ Ornamental Grasses for Cold Climates North Central Regional Extension P ublication 573 ....._:; I • • I M. Hockenberry Meyer is an assistant professor and extension horticulturist who specializes in research on ornamental and native grasses. D. B. White is a professor of turfgrass science. H. Pellett is a professor who has done extensive research on cold hardiness. All authors are in the Department of Horticultural Science. UNIVERSITY OF MINNESOTA Extension SE R VICE The Minnesota Experiment Station provided financial support for this research under project number 21-55. Additional funding was provided by the College of Agricultural, Food, and Environmental Sciences. Editor/Product Manager: Richard Sherman Graphic Designer: Deb Thayer Photographers: Dave Hansen, Mary Meyer Illustrators: Kristine Kirkeby, John Molstad ~ CD< ~ ll> ~ ~ 3 ;;;· C') ll> :, ~ Cen ~ ~ CD s:: s· :, enCD 0 5j" r ll> :, a. en C') ll> -0 CD a-)> ro0 C: 3 Introduction Desirable Traits Culture and Maintenance 2 Research in Minnesota 2 USDA Hardiness Map 3 Research Results 4 Snow Cover and Minimum Temperatures for the Six-Year Trial 4 Group 1. Recommended for Cold Climates Including USDA Zone 4a 5 Group 2. Marginally Hardy in USDA Zone 4a 16 Group 3. Not Recommended as Perennials for USDA Zone 4a 19 Miscanthus for Cold Climates 20 What About Pampasgrass? 21 Grasses for Different Landscape Needs 22 22 Water Gardens and Standing Water Miscanthus sinensis 'Malepartus' Shady Locations 22 Erosion Control/Invasive Rhizomes 23 Perennial Grasses That Can Be Grown as Annuals 23 The ruler symbol appears Fall Color and Winter Interest 24 25 throughout this Alternative Lawns bulletin as a Native Ornamental Grasses 26 height reference for illustrations.
    [Show full text]
  • (Castellon, NE Spain): Floods and People
    Historical palaeohydrology and landscape resilience of a Mediterranean rambla (Castellón, NE Spain): Floods and people a, * b a c d, e d a M.J. Machado , A. Medialdea , M. Calle , M.T. Rico , Y. Sánchez-Moya , A. Sopeña , Benito a Geology Department, National Museum of Natural Sciences -CSIC, Madrid, Spain b Department of Geography, University of Sheffield, Winter Street, S10 2TN, Sheffield, UK c Instituto Pirenaico de Ecología, CSIC, Zaragoza, Spain d Geosciences Institute, CSIC-University Complutense of Madrid, Spain e Department of Stratigraphy, University Complutense of Madrid, Spain A B S T R A C T This paper provides a new methodological approach to analyse secular patterns of flooding (magnitude and frequency) from sedimentary evidence (palaeofloods), taking into account changes in channel geometry, and their links to historical environmental changes and the inherent social and demographic evolution within the catchment. A case study analysis was focused in Rambla de la Viuda (drainage area of 1500 km2) whose stream flow is related to extreme rainfalls. A 500 years sedimentary archive was reconstructed from eight stratigraphic profiles comprising continuous sequences of slackwater flood deposits interbedded with episodic colluvial and edaphic horizons. Discharge estimates associated to sedimentary flood evidences were obtained from one-dimensional hydraulic modelling. The strati- graphic units were sampled to characterise their geochemical and paleobotanical (phytoliths) contents. Palaeoflood chronology was obtained from radiocarbon and luminescence (OSL) dating, supported by documentary data (written historical documents). A high frequency and high magnitude palaeoflood period took place during the 15th-middle 16th century, which seem to correlate in time with general wetter conditions.
    [Show full text]
  • Epidermis Foliares De Algunas Especies De" Festuca"," Poa" Y
    389 EPIDERMIS FOLIARES DE ALGUNAS ESPECIES DE FESTUCA, POA Y BELLARDIOCHLOA EN EL PIRINEO OCCIDENTAL* por RICARDO GARCÍA-GONZÁLEZ** Resumen GARCÍA GONZÁLEZ, R. (1983). Epidermis foliares de algunas especies de Festuca. Poa y Bellardiochloa en el Pirineo Occidental. Anales Jard. Bot. Madrid 39(2): 389-404. Se describe la estructura anatómica de las epidermis foliares en 12 gramíneas de alta montaña que abundan en los pastos suprafbrestales del Pirineo Occidental, y se proporciona una clave para su determinación. Las especies descritas son Bellardiochloa violacea, Festuca eskia, F. gautieri, F. glacialis, F. gr. ovina, F. paniculata, F. pyrenaica. F. gr. rubra, Poa alpina, P. minor, P. pratensis y P. supina. Se destaca el interés de los caracteres epidérmicos en la determinación taxonómica y en estudios sobre alimentación de herbívoros en régimen extensivo. Abstract GARCÍA GONZÁLEZ, R. (1983). Leaf epidermis of some species of Festuca, Poa and Bellardiochloa in the Western Pyrenees. Anales Jard. Bot. Madrid 39(2): 389-404 (In Spanish.) The anatomic structure of the leaf epidermis of twelve high mountain grasses from the alpine and subalpine pastures of the Western Pyrenees are reported. A key for their determination is also given. The species described are: Bellardiochloa violacea, Festuca eskia, F. gautieri, F. glacialis, F. gr. ovina, F. paniculata, F. pyrenaica, F. gr. rubra, Poa alpina, P. minor, P. pratensis and P. supina. The valué of epidermic features for taxonomic recognition and for studies on the feeding of grazing herbivores is emphasized. INTRODUCCIÓN La estructura microscópica de la hoja es un elemento a menudo indispen- sable en la taxonomía de gramíneas.
    [Show full text]
  • Willdenowia Annals of the Botanic Garden and Botanical Museum Berlin-Dahlem
    Willdenowia Annals of the Botanic Garden and Botanical Museum Berlin-Dahlem SAMUEL PYKE1*, LLORENÇ SÁEZ2,3, JULIÀ MOLERO4 & TERESA GARNATJE5 Festuca dertosensis (Poaceae), an overlooked fescue from the NE Iberian Peninsula Version of record first published online on November 2016 ahead of inclusion in December 2016 issue. Abstract: A new species of Festuca L. (Poaceae) is described from the southern mountains of Tarragona (Catalonia, Spain). The new taxon belongs to the F. rubra aggregate, and superficially resembles plants of the F. trichophylla group. Its leaf anatomy, however, suggests a closer relationship with F. rubra and, in particular, F. heterophylla. Although sharing some features with F. paucispicula, a sympatric taxon, there are sufcient diferences to warrant its separation from this local endemic. A comparative table and key are provided to assist in the identification of this overlooked fescue, and its relationship to other species present in the area is discussed, with special attention paid to species sharing a similar distribution. Mitosis studies have been carried out to determine the chromosome number, and the results suggest a decaploid, with a chromosome number of 2n = c. 70. Key words: chromosome count, endemism, Festuca, flow cytometry, Gramineae, Iberian Peninsula, mountain flora, Poaceae, Spain, taxonomy Article history: Received 8 March 2016; peer-review completed 30 June 2016; received in revised form 29 August 2016; accepted for publication 7 September 2016. Citation: Pyke S., Sáez L., Molero J. & Garnatje T. 2016: Festuca dertosensis (Poaceae), an overlooked fescue from the NE Iberian Peninsula. – Willdenowia 46: 367 – 377. doi: http://dx.doi.org/10.3372/wi.46.46305 Introduction across the temperate regions and mountain areas in the tropics (Clayton & Renvoize 1986; Watson & Dallwitz The genus Festuca L.
    [Show full text]
  • Download Alien Species in Norway
    Alien species in Norway – with the Norwegian Black List 2012 Alien species in Norway – with the Norwegian Black List 2012 presents an overview of ecological impact assessments of alien species which reproduce in Norwegian territories. The assessments are based upon a new and semi- quantitative set of criteria, where the species’ invasion potential and ecological effect are considered. The work has been carried out by 11 groups of experts who have treated ca. 2500 species. Impact assessments have been made for 1180 alien species which reproduce in Norwegian territories and for 134 species which might arrive in Norway with the aid of humans in the future – so called ‘door knockers’. A total of 106 species are categorised as having a severe impact, 111 species as having a high impact, 198 species as having a potentially high impact, 399 species as having a low impact, and 366 species as having no known impact in Norwegian nature. In addition, species inform- ation has been gathered for 1071 alien species which do not reproduce on the Norwegian mainland and territorial waters, and 69 non-reproducing alien species observed in Svalbard. Distribution: Norwegian Biodiversity Information Centre 7491 Trondheim Alien species in Norway Phone: +47 73592145 e-mail: [email protected] –with the Norwegian Black List www.biodiversity.no 2012 Alien species in Norway –with the Norwegian Black List 2012 Editors Lisbeth Gederaas, Toril Loennechen Moen, Sigrun Skjelseth, Line-Kristin Larsen Project management Lisbeth Gederaas Groups of experts See chapter “The work of the expert groups” Database development and management Stein Arild Hoem, Helge Sandmark Layout Skipnes Kommunikasjon AS, Åshild Viken (front cover) Cover Harmonia axyridis Cover photo Bjørn H.
    [Show full text]
  • Nuclear DNA Amounts in Angiosperms: Targets, Trends and Tomorrow
    Annals of Botany Page 1 of 124 doi:10.1093/aob/mcq258, available online at www.aob.oxfordjournals.org Nuclear DNA amounts in angiosperms: targets, trends and tomorrow M. D. Bennett* and I. J. Leitch Jodrell Laboratory, Royal Botanic Gardens, Kew, Richmond, Surrey TW9 3AB, UK * For correspondence. E-mail: [email protected] Received: 25 August 2010 Returned for revision: 18 October 2010 Accepted: 24 November 2010 CONTENTS INTRODUCTION 2 Extending the range of genome sizes encountered in angiosperms 3 The need for reference lists 4 TARGETS IN GENOME SIZE RESEARCH 4 Downloaded from Meeting targets for species representation 4 Progress towards targets for familial representation 5 Improved systematic representation for genera 6 Improved representation of other groups 6 TRENDS IN TECHNIQUES USED TO ESTIMATE GENOME SIZE 7 The rise in flow cytometry as the technique of choice for genome size estimations 7 http://aob.oxfordjournals.org/ Development of different isolation buffers for flow cytometry 7 The application of flow cytometry to plant systematics 8 Recent developments in the application of flow cytometry to genome size studies 8 (i) The use of seeds 8 (ii) Ease of access to methodological data 8 (iii) New equipment 8 Are there any new techniques for estimating genome size on the horizon? 9 (i) Can real time PCR be used for estimating plant genome sizes? 9 (ii) Will ‘complete’ genome sequencing give useable genome size estimates? 9 TOMORROW 13 at NIH Library on December 30, 2015 Uncovering and collating genome size data from diverse published sources 14 Screening ex situ and in situ collections as sources of target taxa 15 DEDICATION 15 LITERATURE CITED 16 APPENDIX 19 Notes to the Appendix 19 Original references for DNA values 121 † Background and Aims The amount of DNA in an unreplicated gametic chromosome complement is known as the C-value and is a key biodiversity character of fundamental significance with many practical and predictive uses.
    [Show full text]
  • Approved Conservation Advice (Incorporating Listing Advice) for the Illawarra and South Coast Lowland Forest and Woodland Ecological Community
    Environment Protection and Biodiversity Conservation Act 1999 (EPBC Act) (s266B) Approved conservation advice (incorporating listing advice) for the Illawarra and south coast lowland forest and woodland ecological community 1. The Threatened Species Scientific Committee (the Committee) was established under the EPBC Act and has obligations to present advice to the Minister for the Environment and Energy (the Minister) in relation to the listing and conservation of threatened ecological communities, including under sections 189, 194N and 266B of the EPBC Act. 2. The Committee provided its advice on the Illawarra and south coast lowland grassy forest and woodland ecological community to the Minister as a draft of this conservation advice. In 2016, the Minister accepted the Committee’s advice, and adopted this document as the approved conservation advice. 3. The Minister amended the list of threatened ecological communities under section 184 of the EPBC Act to include the Illawarra and south coast lowland forest and woodland ecological community in the critically endangered category. It is noted that a part of the ecological community is also listed as threatened in New South Wales (Threatened Species Conservation Act 1995). 4. The draft Conservation Advice for this ecological community was made available for expert and public comment for a minimum of 30 business days. The Committee and Minister had regard to all public and expert comment that was relevant to the consideration of the ecological community. 5. This approved conservation advice has been developed based on the best available information at the time it was approved; this includes scientific literature, advice from consultations, and existing plans, records or management prescriptions for this ecological community.
    [Show full text]
  • Testing Efficacy of Distance and Tree-Based Methods for DNA Barcoding of Grasses (Poaceae Tribe Poeae) in Australia
    RESEARCH ARTICLE Testing efficacy of distance and tree-based methods for DNA barcoding of grasses (Poaceae tribe Poeae) in Australia Joanne L. Birch¤*, Neville G. Walsh, David J. Cantrill, Gareth D. Holmes, Daniel J. Murphy Royal Botanic Gardens Victoria, Melbourne, Victoria, Australia ¤ Current address: School of BioSciences, The University of Melbourne, Parkville, Victoria, Australia * [email protected] a1111111111 a1111111111 a1111111111 a1111111111 Abstract a1111111111 In Australia, Poaceae tribe Poeae are represented by 19 genera and 99 species, including economically and environmentally important native and introduced pasture grasses [e.g. Poa (Tussock-grasses) and Lolium (Ryegrasses)]. We used this tribe, which are well char- acterised in regards to morphological diversity and evolutionary relationships, to test the effi- OPEN ACCESS cacy of DNA barcoding methods. A reference library was generated that included 93.9% of Citation: Birch JL, Walsh NG, Cantrill DJ, Holmes species in Australia (408 individuals, x = 3.7 individuals per species). Molecular data were GD, Murphy DJ (2017) Testing efficacy of distance and tree-based methods for DNA barcoding of generated for official plant barcoding markers (rbcL, matK) and the nuclear ribosomal inter- grasses (Poaceae tribe Poeae) in Australia. PLoS nal transcribed spacer (ITS) region. We investigated accuracy of specimen identifications ONE 12(10): e0186259. https://doi.org/10.1371/ using distance- (nearest neighbour, best-close match, and threshold identification) and tree- journal.pone.0186259 based (maximum likelihood, Bayesian inference) methods and applied species discovery Editor: Diego Breviario, Istituto di Biologia e methods (automatic barcode gap discovery, Poisson tree processes) based on molecular Biotecnologia Agraria Consiglio Nazionale delle data to assess congruence with recognised species.
    [Show full text]