American Journal of Botany: e360–e362. 2011. AJB Primer Notes & Protocols in the Plant Sciences C HARACTERIZATION OF MICROSATELLITE LOCI IN F ESTUCA GAUTIERI (POACEAE) AND TRANSFERABILITY TO F. ESKIA AND F. × PICOEUROPEANA 1 Jos é Gabriel Segarra-Moragues 2,4 and Pilar Catal á n 3 2 Centro de Investigaciones sobre Desertifi caci ó n (CIDE, CSIC-UV-GV), Carretera de Moncada-N á quera Km 4.5, E-46113 Moncada, Valencia, Spain; and 3 Departamento de Agricultura y Econom í a Agraria, Escuela Polit é cnica Superior de Huesca, Universidad de Zaragoza, C/ Carretera de Cuarte s/n, E-22071 Huesca, Spain • Premise of the study: Enriched genomic libraries were used to isolate and characterize microsatellite loci in Festuca gautieri , an important plant component of subalpine calcareous grasslands of the eastern Iberian Peninsula, the Pyrenees, and the Can- tabrian Mountains. Microsatellites were required to investigate landscape genetics across its distribution range and at a nar- rower geographical scale within the Ordesa y Monte Perdido , Aig ü estortes, and Picos de Europa Spanish national parks. • Methods and Results: Ten polymorphic microsatellite loci were characterized. They amplifi ed a total of 116 alleles in a sample of 30 individuals of F. gautieri , showing high levels of genetic diversity (expected heterozygosity = 0.821). Cross-species transferability to two other close congeners, F. eskia and F × picoeuropeana, increased the total number of alleles to 137. These taxa showed lower numbers of alleles but similar levels of genetic diversity to F. gautieri . • Conclusions: These microsatellite primers will be useful in population and landscape genetics and in establishing conservation strategies for these characteristic elements of subalpine pastures. Key words: conservation genetics; Festuca gautieri ; landscape genetics; Loliinae; Pooideae; SSR. Festuca L. (Poaceae), with more than 500 species, is the largest F. eskia Ramond ex DC. , an edaphic vicariant species occupying genus of the Loliinae. Species of Festuca are widespread in the similar habitats but on siliceous soils. In geographical areas where holarctic region but also inhabit cool and temperate areas in the both substrates come into contact, populations of F. gautieri and southern hemisphere. They grow in a large variety of different F. eskia naturally hybridize, producing the morphologically inter- habitats, from wetlands to xeric ecosystems, and are especially mediate taxon F. × picoeuropeana M. I. Gut. & Homet. well adapted to extreme conditions in mountains and in arctic and Such habitats have been subject to diverse human-induced subantarctic areas. Based on its wide taxonomic diversity and geo- degradations because of overexploitation of subalpine pastures graphical and ecological amplitude, different authors have specu- for cattle and sheep and the construction of touristic resources lated on the putative ancient origin of Festuca and postulated an such as ski resorts and have been identifi ed as potentially sensi- evolutionary trend from more basal broad-leaved lineages to more tive areas for loss of biodiversity under climatic change. recently evolved fi ne-leaved lineages, with some species with in- We have conducted a microsatellite characterization in F. termediate features forming an intermediate grade between these gautieri to investigate the genetic landscape and ecology of sub- two major clades ( Inda et al., 2008 and references therein). Festuca alpine grassland communities of F. gautieri , F. eskia , and their gautieri (Hack.) K. Richt. corresponds to a basal group of fi ne- hybrid F. × picoeuropeana in the Spanish Pyrenean-Cantabrian leaved Festuca taxa ( Festuca sect. Eskia Willk.) that are most di- national parks of Ordesa y Monte Perdido, Aig ü estortes i Estany versifi ed in Mediterranean subalpine mountains and a major de Sant Maurici, and Picos de Europa. In these areas, these taxa constitutive element of subalpine pastures. This calcareous species act as a shelter to numerous herbaceous plants and animals and, is diploid with 2 n = 14 chromosomes and is capable of both sexual thus, play a key role in the subalpine plant community structure reproduction and vegetative spread through rhizomatous tillering. and in the maintenance of its global biodiversity ( Gonzalo-Turpin This species is morphologically and phylogenetically close to and Hazard, 2009 ; Gonzalo-Turpin et al., 2010 ). Our study is aimed at addressing conservation strategies for their biodiversity 1 Manuscript received 2 June 2011; revision accepted 15 July 2011. and at promoting ecological restoration of altered areas with The authors thank Antonio D í az-P é rez for his help with fi eld sampling, local genotypes. We will perform genotypic analysis of individu- and G. Sadowski and F. Fernando for information on the enrichment als based on this set of nuclear simple sequence repeat (SSR) process of the Festuca gautieri SSR library. Financial support was provided markers to describe the landscape genetics of each species. This by the Spanish projects UZ2008-TEC-14 from the University of Zaragoza, will enable us (1) to detect hybrids and introgression zones, (2) PI097/08 from the Arag ó n Government, GA-LC-012/2008 from the Arag ó n to interpret historical and ecological processes affecting the sub- Government – La Caixa, and 059/2009 from the Ministry of Environment (National Parks division). J.G.S.-M. was supported by a Spanish Ministry alpine landscapes, (3) to propose relevant genetic and ecological of Science and Innovation “ Ram ó n y Cajal ” postdoctoral contract. units for the conservation of each species, (4) to select local gen- 4 Author for correspondence: [email protected] otypes for conservation and ecological restoration, and (5) to build predictive models of distribution of these species regarding doi:10.3732/ajb.1100267 different scenarios of global climate change. American Journal of Botany: e360–e362, 2011; http://www.amjbot.org/ © 2011 Botanical Society of America e360 December 2011] AJB Primer Notes & Protocols — FESTUCA GAUTIERI microsatellites e361 Table 1. Characteristics of 18 microsatellite loci developed in Festuca gautieri . For each locus, the primer pair sequences, repeat motif, size of the original fragment (bp), annealing temperature, and GenBank accession numbers are shown. a ′ ′ b ° Locus Primer sequence (5 – 3 ) Repeat motifSize Ta ( C) GenBank Accession No. FgauA02* F: 6FAM-CGTTTCAGTGTCGTTGATGTC (CA)13 176 56 JN040543 R: TTCTCTGCGTGGTCTGTATTG FgauA04* F: VIC-AAGGAAGCACACTACCTACACG (CA)10 294 56 JN040544 R: ATCCCAATCTGAACCCAATC FgauA101 F: NED-CACGAAGAACGAACAAGAAC (CA)13 280 51 JN040553 R: ATTCAAGGCAACCCTCTCTA FgauA104 F: VIC-ACCACGGTCTCTCACATAGG (GT)13 226 56 JN040555 R: CCGATGTTCACGAATTGAC FgauA111* F: VIC-TGACCTAAACTGTTCCCAAATG (GT)23 209 51 JN040545 R: CATGCAAGGTTGTATCTCACG FgauA115 F: VIC-TCCGATTTGTGGTCAATCTC (GT)13 206 56 JN040557 R: CATGCAATCTTCACGAATTG FgauA117 F: NED-TCAAACCTTTGTGAACAACAG (CA)9 298 56 JN040558 R: GGGATGGTGTGGTTAGTAAAT FgauA119 F: NED-CGGTCTCTCCTTGGATGA (GT)21 149 56 JN040559 R: GGGAACACGAAGAACGAA FgauA121* F: VIC-TGGAGAGGAACTTAGTTGAAAG (CA)13 119 56 JN040546 R: TGTACGACATGCTGATCTACA FgauB07* F: PET-TCATCGCTGACAAACTCTTC (CT)16 275 56 JN040547 R: CTGACGGGTATTACTTCCAAC FgauB101 F: VIC-GGAAGAGCCAAGATCCAATCT (GA)11 262 51 JN040560 R: CGTGCTGATTTAGATCCCATC FgauB103* F: VIC-CCACCTGTCATAAGCCTTTC (GA)6 G(GA)11 138 51 JN040548 R: GCTGATGTCCTCTTCTCGTC FgauB104 F: NED-AGTGTTCAGCGTTTGTCAGTG (GA)11 172 56 JN040561 R: CCCAGCAATCTTTATCGTGAG FgauB109* F: PET-CATGGCTTGACACTCTATGAG (GA)13 217 51 JN040549 R: TTTCAGTAAAGGGAACATCTTG FgauB119* F: 6FAM-GGGACACAAGCACTAAAGTTG (GA)15 146 51 JN040550 R: CCAAAAACAAAATAGGACGAAG FgauB125* F: NED-AAAGCACCCAGAATATAATGAG (CT)15 211 56 JN040551 R: ACTTGCTGTTACCATGTCAAC FgauB130* F: PET-GGAAAAGCCTAGAGAGAGGTG (GA)3 GG(GA)8 176 56 JN040552 R: CAAAGGGCACATCAGTTAAAG FgauC105 F: NED-TACCTTTGTAGGGACGATACG (CAA)13 294 56 JN040565 R: GGTCATTTTGATGGGAGATAC a Polymorphic loci are denoted with an asterisk (*). b 6FAM, NED, PET, and VIC are fl uorescent dyes from Applied Biosystems. METHODS AND RESULTS (Biotools, Madrid, Spain), 2 mM MgCl2 , 0.4 mM of each dNTP, 5 pmol each of the labeled (forward) and unlabeled (reverse) primers, 1 U Taq polymerase (Bio- tools), and 20 ng of template DNA. The PCR program consisted of one step of 4 One hundred micrograms of total DNA was extracted from silica gel – dried ° ° young leaves of an individual pool using the DNeasy Plant Minikit (QIAGEN, min at 94 C; followed by 35 cycles each of 1 min at 94 C, 1 min at annealing temperature ( Table 1 ) , and 45 s at 72 ° C; and a fi nal extension step of 7 min at Barcelona, Spain) following the manufacturer ’ s instructions. This DNA served as a ° template for enriched microsatellite library construction for CT, GT, CTT, and GTT 72 C. The products were run on an ABI 3730 automated sequencer (Applied motifs developed by Genetic Identifi cation Services (Chatsworth, California, USA ; Biosystems) using LIZ500 as the internal lane size standard and the amplifi ed http://www.genetic-id-services.com) following Jones et al. (2002) . Genomic DNA fragment lengths assigned to allelic sizes with GENEMARKER version 1.85 was partially restricted with a cocktail of seven blunt-end cutting enzymes ( Rsa I, software (SoftGenetics, State College, Pennsylvania, USA). After an initial Hae III, Bsr B1, Pvu II, Stu I, Sca I, and Eco RV). Fragments in the size range of 300 screening of individuals, 10 out of 24 loci (JN040543, JN040544, JN040545, to 750 bp were