Arrestin Interactions with Rhodopsin in the Squid Visual System by Kelly

Arrestin Interactions with Rhodopsin in the Squid Visual System

Kelly Ann Robinson

A thesis submitted in conformity with the requirements for the degree of M.Sc.

Graduate Department of Pharmacology and Toxicology

University of Toronto

Arrestin Interactions with Rhodopsin in the Squid Visual System

Kelly Ann Robinson

A thesis submitted in conformity with the requirements for the degree of M.Sc. Graduate Department of Pharmacology and Toxicology, University of Toronto, 2015

Abstract

Light activation of squid rhodopsin results in stimulation of the Gq signalling cascade. Activated rhodopsin (metarhodopsin) is a target for squid arrestin and squid rhodopsin kinase which are involved in the inactivation of metarhodopsin. The aim of this project is to characterize the interaction between squid rhodopsin and arrestin, and the role of phosphorylation on their interactions. We determined the affinity of arrestin for metarhodopsin to be 32nM. Two mutations to the polar core did not decrease the affinity of arrestin for metarhodopsin, suggesting a difference in basal structure of squid arrestin compared to other arrestins. Serine392 and

Serine397 in the C-terminus of squid arrestin were phosphorylated by squid rhodopsin kinase.

Arrestin phosphorylation decreased the affinity of arrestin binding to metarhodopsin, while metarhodopsin phosphorylation increased the dissociation of the two proteins. Further studies are required to identify mechanisms of metarhodopsin and arrestin dephosphorylation in the squid visual system.

Acknowledgements I am extremely grateful for the opportunity that Dr. Jane Mitchell provided me by taking me on as a Master’s student. I pursued my Master’s in hopes of getting hands on experience and learning something new, and I can say that I have definitely accomplished both of these over the past two years. I am extremely grateful for the guidance and support that Dr. Mitchell provided as my supervisor; under her guidance I’ve discovered an entirely new area of pharmacology, that if you told me 10 years ago I would be studying the squid visual system—I wouldn’t have believed it. I would also like to thank Dr. Kim Sugamori, who has taught me many of the methods that I have used in this project. I’ve learned so much having you as a mentor and I greatly appreciate all of your help and all of your support! Dr. Abhishek Bandyopadhyay has also greatly contributed to the methods and knowledge that I will be taking with me from this project. Your passion for this project, and the squid visual system was very motivational. I am also thankful to Dr. Oliver Ernst for his collaboration with this project and for allowing me to produce and purify my recombinant proteins in his laboratory. I am also thankful for the continued help and support of my fellow lab members, Ariana Dela Cruz, Lucia Zhang, and

Seanna Yoon, as well as the members of Dr. Ernst’s laboratory. Lastly, I am grateful to the

Department of Pharmacology and Toxicology and NSERC for the funding which allowed me to perform this project.

iii

Table of Contents

Abstract ...... ii Acknowledgements ...... iii Table of Contents ...... iv List of Tables ...... vii List of Figures ...... viii List of Abbreviations: ...... xi 1. Introduction ...... 1 1.1. Structure of Squid Eyes ...... 1 1.2. Activation Pathway of the Visual System ...... 2 1.2.1. Rhodopsin...... 5 1.2.2. G proteins ...... 8 1.2.3. Phospholipase C (PLC) ...... 12 1.3. Inactivation Pathway of the Visual System ...... 14 1.3.1. Squid Rhodopsin Kinase (SQRK) ...... 16 1.4. Arrestin ...... 18 1.4.1. Arrestin Structure ...... 19 1.5. Key Binding Elements in Arrestin ...... 20 1.5.1. Polar Core Residues ...... 21 1.5.2. 3- Element Interaction ...... 22 1.5.3. N- and C- Domain Residues...... 23 1.6. Models of Arrestin Binding ...... 25 1.6.1. Clam-Shell Model ...... 25 1.6.2. Multi-Site Interaction Model ...... 26 1.6.3. One Arrestin to Two Rhodopsin Binding Model ...... 29 1.7. Invertebrate Arrestin ...... 31 1.8. Arrestin Phosphorylation ...... 33 1.8.1. Role of Arrestin Phosphorylation ...... 35 1.9. Rationale ...... 37 1.10. Research Goals ...... 37 1.11. Hypotheses ...... 38

2. Materials and Methods ...... 39 2.1. Materials ...... 39 2.2. Purification of native squid visual proteins ...... 39 2.2.1. Rhodopsin...... 40 2.2.2. Arrestin, SQRK and PLC ...... 40 2.3. cDNA Preparation ...... 41 2.3.1. Preparation of XL1 Competent Cells ...... 42 2.4. Mutagenesis of the Phosphorylation Sites and of the Polar Core of Squid Arrestin ...... 43 2.5. Production and Preparation of Recombinant Squid Arrestin ...... 45 2.6. Arrestin Binding Assays ...... 46 2.7. Phosphorylation Assays ...... 47 2.8. Dissociation Assays ...... 48 2.9. Additional Methods ...... 48 2.10. Data Analysis ...... 49 3. Results ...... 49 3.1. Purification of Native Proteins of the Squid Visual System ...... 49 3.2. Purification of Recombinant, Strep-Tagged Squid Arrestin Proteins ...... 55 3.3. Rhodopsin-Arrestin Association Assays ...... 58 3.4. Effect of Mutations to the Polar Core on Arrestin-Rhodopsin Binding ...... 62 3.5. Determination of Phosphorylation Sites of Squid Arrestin ...... 66 3.6. Role of Phosphorylation of Arrestin and Rhodopsin on Association ...... 71 3.7. Role of Phosphorylation of Arrestin and Rhodopsin on Dissociation ...... 76 4. Discussion ...... 83 4.1. Summary of Results ...... 83 4.2. Purification of Recombinant Arrestin ...... 84 4.3. Arrestin-Rhodopsin Association Assays ...... 86 4.4. Determination of the Phosphorylation Sites of Arrestin ...... 91 4.5. Role of Phosphorylation on Arrestin and Rhodopsin Association ...... 95 4.6. Role of Phosphorylation on Arrestin and Rhodopsin Dissociation ...... 98 4.7. Clathrin-Binding Motif in Arrestins ...... 99 4.8. Summary and Modelling of the Inactivation Pathway of the Squid Visual System ...... 100 Appendices ...... 103

Appendix A-Protocol for Annealing Oligonucleotides as per Sigma-Aldrich ...... 103

Appendix B- Tni cell expressed SQRK-H6 Purification ...... 104 Appendix C- Purification of Native SQRK and Comparison of Enzyme Function between Native and Recombinant SQRK ...... 106 References ...... 108

List of Tables

Table 1: The forward and reverse primers for creating the arrestin phosphorylation mutants...... 44 Table 2: The forward and reverse primers designed for creating the arrestin polar core mutants...... 44 Table 3: The total protein recovered throughout the purification of squid rhodopsin from 50 squid eyes as determined by the Amido Black protein assay...... 51

Table 4: The Kd and Bmax values for the interactions of WTsArr and the polar core mutants (N293D & N293R) with metarhodopsin...... 65

Table 5: The Kd and Bmax values for the interaction of WTsArr with metarhodopsin (Rh*) and phosphorylated-metarhodopsin (P-Rh*)...... 73 Table 6: The Kd and Bmax values for WTsArr and phosphorylated arrestin (P-Arr) with metarhodopsin (Rh*) and phosphorylated metarhodopsin (P-Rh*)...... 76

Table 7: The IC50 values (mM salt) of the dissociation experiments investigating the effect of arrestin and rhodopsin phosphorylation...... 82 Table 8: Results of the two-way ANOVA test with Bonferroni post-hoc test comparing the various conditions in which the dissociation experiments were performed...... 82

vii

List of Figures

Figure 1: Structure of the squid eye and the bilobular photoreceptor neurons within the retina. ....2 Figure 2: Activation of the squid (invertebrate) visual system...... 4 Figure 3: Activation of the mammalian visual system...... 4 Figure 4: An overlay of the squid and bovine rhodopsin crystal structures...... 8

Figure 5: Co-crystal structure of the β2-adrenergic receptor and Gs protein from three separate angles...... 12 Figure 6: Crystal structures of Loligo pealei, Sepia officinalis and human PLC complexed with

Gqα...... 14 Figure 7: Inactivation pathway of the invertebrate visual system (A) and the mammalian visual system (B)...... 16 Figure 8: Crystal structures of mammalian arrestins (A) and enlargements of the two stabilizing structural features, the 3-element interaction (B) and the polar core (C)...... 20 Figure 9: The multi-site interaction model of arrestin binding to phosphorylated- metarhodopsin...... 28 Figure 10: One arrestin to two rhodopsin binding model...... 30 Figure 11: Modelled crystal structure of squid arrestin...... 32 Figure 12: Sequence alignment comparing the polar core residues of invertebrate and mammalian arrestins...... 33 Figure 13: Sequence alignment of the phosphorylation sites of arrestins...... 35 Figure 14: SDS-polyacrylamide gel of each stage in the purification of squid rhodopsin...... 50 Figure 15: Western blot probing for the presence of arrestin and SQRK after purifying rhodopsin...... 51 Figure 16: Purification of native squid arrestin over a DEAE ion exchange column using a linear salt gradient of 75mM to 350mM...... 53 Figure 17: Purification of native squid arrestin over a Heparin-Sepharose column using a linear

IP6 gradient of 0mM to 8mM...... 54 Figure 18: Purification of recombinant Strep-tagged WT squid arrestin by ammonium sulfate precipitation followed by affinity chromatography...... 57 Figure 19: Purified squid arrestin proteins resolved on an 11% polyacrylamide gel and stained with Coomassie Blue...... 58

viii

Figure 20: Association of native arrestin to intact and cleaved rhodopsin in the presence and absence of salt, in dark (D) and light (L) conditions...... 60 Figure 21: Association of native arrestin to rhodopsin and metarhodopsin across a range of salt concentrations (0-1M)...... 61 Figure 22: Association of Strep-tagged WT squid arrestin to metarhodopsin in the presence of 500mM NaCl...... 62 Figure 23: Association of the polar core mutant N293D to metarhodopsin, as compared to WTsArr in the presence of 500mM NaCl...... 64 Figure 24: Association of the polar core mutant N293R to metarhodopsin, as compared to WTsArr in the presence of 500mM NaCl...... 65 Figure 25: Comparison of the association of native, WTsArr and the phosphorylation mutants to rhodopsin and metarhodopsin at 500mM NaCl...... 67 Figure 26: Phosphorylation of native arrestin and WTsArr in the presence and absence of rhodopsin by rSQRK as detected by autoradiography...... 68 Figure 27: Determination of the phosphorylation sites on arrestin by creating 4 arrestin mutants in which the potential phosphorylation sites are mutated to alanines...... 70 Figure 28: Association of WTsArr to metarhodopsin (Rh*) and phosphorylated metarhodopsin (P-Rh*) at 500mM NaCl...... 73 Figure 29: Association of phosphorylated arrestin (P-Arr) to metarhodopsin (Rh*) as compared to WTsArr, in 500mM NaCl...... 74 Figure 30: Association of phosphorylated arrestin (P-Arr) to phosphorylated-metarhodopsin (P- Rh*), as compared to WTsArr with metarhodopsin (Rh*), in 500mM NaCl...... 75 Figure 31: Dark dissociation of arrestin from metarhodopsin (Rh*) and phosphorylated- metarhodopsin (P-Rh*)...... 78 Figure 32: Light dissociation of arrestin from metarhodopsin (Rh*) and phosphorylated- metarhodopsin (P-Rh*)...... 79 Figure 33: Dark dissociation of phosphorylated arrestin (P-Arr) from metarhodopsin (Rh*) and phosphorylated-metarhodopsin (P-Rh*)...... 80 Figure 34: Light dissociation of phosphorylated arrestin (P-Arr) from metarhodopsin (Rh*) and phosphorylated-metarhodopsin (P-Rh*)...... 81 Figure A- 1: Purification of recombinant SQRK using affinity (A) and ion-exchange chromatography (B)...... 105

Figure A- 2: Purification of SQRK and PLC over DEAE and Heparin Sepharose Columns. ....106 Figure A- 3: Phosphorylation of urea washed bovine rhodopsin by native and recombinant SQRK...... 107

List of Abbreviations: GMP- Guanosine monophosphate

λmax- Maximum absorbance wavelength GPCR- G protein-coupled receptor AEBSF- 4-(2-Aminoethyl) benzenesulfonyl G protein- guanine nucleotide-binding fluoride hydrochloride proteins AMP- Ampicillin GRK- G protein-coupled receptor kinase ATP- Adenosine triphosphate Gt- Transducin ATR- All-trans-retinal GTP- Guanosine triphosphate

β2AR- β2- adrenergic receptor HED(S)- Hepes, EGTA, DTT, (Salt) Bmax- Maximum specific binding HDX- Hydrogen/deuterium exchange BSA- Bovine serum albumin IDT- Integrated DNA technologies C-terminal- Carboxyl terminal iGq- Invertebrate guanine nucleotide-binding CAM-PKII- Calcium/calmodulin-dependent protein of q class protein kinase II IP3- Inositol trisphosphate cGMP- Cyclic guanosine monophosphate IP6- Inositol hexaphosphate CW- Cholate wash IPTG- Isopropyl β-D-1- DAG- Diacylglyercol thiogalactopyranoside

DEAE- Diethylaminoethyl Kd- Dissociation constant

DEER- Double electron-electron resonance mGq- Mammalian guanine nucleotide- binding protein of q class dGPRK- Drosophila G protein-coupled receptor kinase N-terminal- Amino terminal

DTT- Dithiothreitol nArr- Native squid arrestin

ECL- Enhanced chemiluminescence norpA- No receptor potential A

EDTA- Ethylenediaminetetraacetic acid nSQRK- Native squid rhodopsin kinase

EGTA- Ethylene glycol tetraacetic acid OD600/OD280- Optical density at 600 or 280nm E. Coli- Escherichia Coli OS- Outer segment ERK- Extracellular-signal-regulated-kinases ORK- Octopus rhodopsin kinase GDP- Guanosine diphosphate xi p-44- Splice variant of arrestin-1 Rh*- Metarhodopsin

P-Arr- Phosphorylated squid arrestin sArr- Squid arrestin

PBST- Phosphate buffered saline with triton SQRK- Squid rhodopsin kinase

PDE- Phosphodiesterase rSQRK- Recombinant squid rhodopsin kinase PH- Pleckstrin homology SDS-PAGE- Sodium dodecyl sulfate- PIC- Protease inhibitor cocktail polyacrylamide gel electrophoresis

PIP2- Phosphatidylinositol-4,5- bisphosphate TCAG- Toronto Centre of Applied PLC- Phospholipase C Genomics

P-Rh*- Phosphorylated-metarhodopsin TM- Transmembrane

P-Rh- Phosphorylated rhodopsin TRP- Transient receptor potential

RGS- Regulator of G protein signalling WTsArr- Wild-type recombinant squid arrestin Rh- Rhodopsin

xii

1. Introduction

1.1. Structure of Squid Eyes

As with most invertebrates, squids have light-sensing organs. The eye of the squid is categorized as a camera-type eye, which is also the standard eye type of vertebrates. Light passes through a single lens and an image is formed on the retina within the anterior chamber of the eye. The retina consists of a single layer of bilobular photoreceptor neurons divided into rhabdomeral and arhabdomeral lobes (Mitchell & Swardfager, 2010). The rhabdomeral lobe, also called the outer segment (OS), contains the proteins involved in phototransduction that are embedded or associated with the membrane, and include the light-sensing pigment, rhodopsin (Figure 1).

These membranes have microvillar projections which increase the surface area for capturing photons of light. The arhabdomeral lobe, also referred to as the inner segment, houses the cell nucleus and the organelles involved in protein synthesis (Calman & Chamberlain, 1982). From the inner segment extends the axon that comprises the optic nerve which projects directly to the squid brain (Young, 1974).

Figure 1: Structure of the squid eye and the bilobular photoreceptor neurons within the retina. Light enters the eye and passes through a single lens where an image is formed on the retina in the anterior chamber of the eye. The enlarged diagram shows the bilobular photoreceptor neurons of the retina, consisting of the outer segments (rhabdomeral) and the inner segments (arhabdomeral) which then extends into the axon which makes up the optic nerve which goes directly to the brain of the squid. The OS is where the proteins involved in phototransduction are located, whereas the inner segment houses the cell nucleus and organelles. This figure was reproduced with permissions from the Encyclopedia of the Eye, Mitchell & Swardfager, 2010.

1.2. Activation Pathway of the Visual System

Rhodopsin is a G protein-coupled receptor (GPCR) composed of opsin covalently linked to a light absorbing chromophore, retinal. When rhodopsin is in the inactive state, opsin is linked to an 11-cis-retinal. Upon absorption of a photon of light, the 11-cis-retinal is photoisomerized to all-trans-retinal (ATR), followed by a conformational change in the opsin, resulting in an active form of rhodopsin referred to as metarhodopsin (Hubbard & Kropf, 1957; Hubbard & St.

George, 1958). Upon activation invertebrate metarhodopsin stimulates an intracellular, heterotrimeric guanine nucleotide-binding protein (G protein) of the Gq class (iGq). Active iGq undergoes a guanine-nucleotide exchange releasing guanosine diphosphate (GDP) and taking up guanosine triphosphate (GTP). The Gqα subunit then interacts with and activates phospholipase

C (PLC). PLC hydrolyzes phosphatidylinositol-4,5-bisphosphate (PIP2) into two second messengers, inositol trisphosphate (IP3) and diacylglyercol (DAG) (Wood, Szuts, & Fein, 1989).

IP3 stimulates release of calcium from stores in the submicrovillar stores, and DAG acts on

2 membrane associated, transient-receptor potential (TRP)-like channels (Leung et al., 2008; Monk et al., 1996). The increase in intracellular calcium by second messenger activity, results in membrane depolarization, which then sends a signal to the brain of the invertebrate (Figure 2)

(Leung et al., 2008; Montell, 1999).

The invertebrate visual system differs from the mammalian visual system where rhodopsin activates transducin (Gt) which stimulates a phosphodiesterase (PDE) signalling pathway (Figure

3). When mammalian rhodopsin is in the inactive state, ion channels are open, and cyclic guanosine monophosphate (cGMP) is available. Upon activation of rhodopsin, Gt is stimulated which then activates its effector, phosphodiesterase (PDE). PDE then hydrolyzes the cGMP to

5'GMP, decreasing the available cGMP causing cation-selective-cGMP gated ion channels to close (Arshavsky, Lamb, & Pugh, 2002). This reduces the inward flow of cations resulting in membrane hyperpolarization. Membrane hyperpolarization then causes a decrease in the release of the synaptic transmitter glutamate, commencing a signalling pathway that will transmit this message through multiple layers of retinal cells through the optic nerve and onto the brain

(Arshavsky et al., 2002).

Figure 2: Activation of the squid (invertebrate) visual system. Rhodopsin in its inactive state is bound to an 11-cis-retinal. Upon absorption of photon of light, the 11-cis-retinal is photoisomerized into all-trans-retinal, and the iGqα has a guanine nucleotide exchange in which GDP is exchanged for GTP, resulting in the functional dissociation of the α- subunit from the βγ-subunits. iGqα then stimulates PLC which hydrolyzes PIP2 into DAG and IP3. DAG acts on TRPL channels and IP3 acts on the sarcoplasmic reticulum resulting in the release of intracellular calcium. This results in the depolarization of the membrane which then sends a signal to the brain of the invertebrate.

Figure 3: Activation of the mammalian visual system. In the inactive state, ion channels on the membrane are open and cGMP is available. When rhodopsin is activated in the mammalian visual system, it then activates its respective G protein, Gt, which then stimulates a PDE signalling pathway. PDE hydrolyzes cGMP to 5’GMP thereby decreasing the available cGMP causing the cation-selective-cGMP gated ion channels to close. The membrane becomes hyperpolarized which then results in a complex signalling pathway transmitting the signal from the eye to the brain.

1.2.1. Rhodopsin

Opsin is a GPCR that when bound covalently to a light absorbing pigment, retinal, is called rhodopsin. Rhodopsin is a member of subfamily A of GPCRs sharing the main structural features associated with this superfamily. Squid rhodopsin shares several features of GPCRs with 7 transmembrane spanning helical domains and 3 cytoplasmic loops, with C-terminal sites of palmitoylation, N-terminal sites of glycosylation, and a disulfide bridge between two extracellular loops which are essential for proper folding of the protein and insertion into the membrane, creating a β-sheet as part of the retinal binding pocket (Mitchell & Swardfager, 2010;

Murakami & Kouyama, 2008; Palczewski et al., 2000). Squid rhodopsin also has the (D/E) R

(Y/W) sequence in the third intracellular loop, involved in G-protein interaction (Mitchell &

Swardfager, 2010). Bovine rhodopsin was the first GPCR to be crystallized by Palczewski

(2000). Shortly after, a C-terminally truncated squid rhodopsin was crystallized in low resolution

(Loligo opalescens) (Davies, Gowen, Krebs, Schertler, & Saibil, 2001). Murakami & Kouyama

(2008) reported the crystal structure of squid rhodopsin (Todarodes pacificus) at higher resolution, revealing the distinct features of this particular GPCR. Squid rhodopsin (~452 amino acids in length, ~50kDa) is approximately 100 residues larger than vertebrate rhodopsin (~348 amino acids, ~40kDa) due to 9-10 repeats of a pentapeptide motif, Pro-Pro-Gln-Gly-Tyr, in the

C-terminal tail (Mitchell & Swardfager, 2010; Murakami & Kouyama, 2008). This extended motif is unique to cephalopod rhodopsins and is thought to play a structural role in the outer segment (Venien-Bryan et al., 1995). Invertebrate and vertebrate rhodopsins are structurally homologous; however there are some important differences between squid rhodopsin and bovine rhodopsin which were revealed upon crystallization of squid rhodopsin at higher resolution

(Figure 4) (Murakami & Kouyama, 2008). Helices V and VI in the squid rhodopsin extend into

5 the cytoplasmic medium and helix VI is a rigid spiral, interacting with the cytoplasmic helix IX.

These cytoplasmic arrangements revealed by the squid rhodopsin crystal structure are not seen in the bovine rhodopsin structure. The amino acid sequence of these cytoplasmic extensions is well conserved across invertebrate rhodopsins and other Gq-coupled receptors. There is also a short

310 helix formed in an interhelical loop between helices VIII and IX that is unique to squid rhodopsin (Murakami & Kouyama, 2008). Another key structural difference between squid rhodopsin and vertebrate rhodopsin is the amino acid residues involved in the interaction of opsin and retinal (Murakami & Kouyama, 2008; Schertler, 2008; Shimamura et al., 2008). The retinal of both vertebrate and invertebrate rhodopsins is covalently linked to a lysine residue

(K296-bovine, K303-Loligo, K305-Todarodes) (Murakami & Kouyama, 2008; Sekharan, Altun,

& Morokuma, 2010). The squid rhodopsin crystal revealed that the residues in contact with retinal are different than those in bovine rhodopsin; resulting in a rigid hydrophobic pocket and a less distorted configuration of the retinal chain (Murakami & Kouyama, 2008). In bovine rhodopsin, the counterion for the positively charged nitrogen atom which provides the covalent bond for retinal, is glutamate 113. The only anionic counterion in squid rhodopsin is glutamate180 located between transmembrane domains III & IV, which is too far away to provide the direct counterionic action (Murakami & Kouyama, 2008; Sekharan et al., 2010;

Shimamura et al., 2008). Two residues, the hydroxyl group of tyrosine 111 or the carbonyl side chain of asparagine 87, could act as the hydrogen-bonding partner in the dark state, as these residues are conserved throughout invertebrate rhodopsins. These residues (Asn87& Tyr111) are replaced with glycine 87 and glutamate 113 in bovine rhodopsin.

Upon light activation, squid rhodopsin (λmax 493nm) is converted to metarhodopsin (500nm) which exists in two forms depending on the pH, acid metarhodopsin (500nm) and alkaline metarhodopsin (380nm) (Hubbard & Kropf, 1957; Hubbard & St. George, 1958). Acid

6 metarhodopsin is the form present in a slightly acidic to n eutral pH, and alkaline metarhodopsin is that in a basic solution. A key difference between the vertebrate and invertebrate rhodopsins is that upon irradiation, invertebrate rhodopsin is not bleached (Hubbard & St. George, 1958). This is due to the stability of squid metarhodopsin, which is comparable to that of the inactive, squid rhodopsin. Bovine rhodopsin on the other hand goes through several unstable intermediate states following light activation. Another difference between the two systems is the photoisomerization of 11-cis-retinal to all-trans retinal, which is accommodated by the squid opsin conformation, but the conformation of vertebrate opsin does not allow this transition and results in the release of all-trans retinene. In order for bovine rhodopsin to be regenerated, the opsin must rejoin with an

11-cis-retinal, thereby completing the rhodopsin cycle (Hubbard & St. George, 1958; Radding &

Wald, 1956).

Figure 4: An overlay of the squid and bovine rhodopsin crystal structures. The squid rhodopsin structure is displayed in brown and magenta and bovine rhodopsin is displayed in cyan and blue. This overlay reveals some of the key structural differences between the invertebrate and mammalian rhodopsins, with the exception of the proline-rich tail that is present in squid rhodopsin, as rhodopsin is C-terminally truncated in this crystal structure. This figure was reproduced with permissions from Murakami & Kouyama, 2008.

1.2.2. G proteins

G proteins which transduce signals from the GPCR to the downstream effector(s), are heterotrimeric consisting of 3 subunits; α, β and γ. The α-subunit has a guanine nucleotide binding region and is responsible for the major actions of the G protein on its effector. The β and

γ subunits act as supporters for the α-subunit with the plasma membrane and receptors but also may interact with downstream effectors. In the basal state, the trimer is bound together with a guanosine diphosphate (GDP) within the guanine nucleotide binding region of the α-subunit

(Rodbell, 1997). Upon activation of the GPCR by an agonist, there is a nucleotide exchange in the G protein, where the GDP is released by a change in the G protein, and the guanine nucleotide binding region is then occupied by guanosine triphosphate (GTP) (Rasmussen et al.,

2011; Rodbell, 1997). Once GTP is bound to the α-subunit, the α-subunit dissociates from the activated GPCR and from its βγ-subunits and binds to its respective effector. The βγ-subunits remain bound to each other at all times and are also free to associate with their respective effector(s) once G- has dissociated from them.

There are four subfamilies of G proteins, Gs, Gi, Gq and G12. The G protein, transducin, responsible for stimulation of PDE in the mammalian visual system, is a member of the Gi subfamily, and was the first G protein and its effector to be purified (Fung & Griswold-Prenner,

1989) and the first G protein to be crystallized (Gaudet, Bohm, & Sigler, 1996). In the invertebrate visual system, the G protein responsible for transducing the signal from metarhodopsin is the invertebrate Gq protein (iGq) which is a member of the Gq subfamily.

Visual iGqα has been isolated and cloned from several invertebrates including squid (Go &

Mitchell, 2003; Ryba, Findlay, & Reidt, 1993), octopus (Kikkawa, Tominaga, Nakagawa, Iwasa,

& Tsuda, 1996), Drosophila (Lee et al., 1994), Limulus (Dorlochter, Klemeit, & Stieve, 1997) and crayfish (Terakita, Hariyama, Tsukahara, Katsukura, & Tashiro, 1993), all of which share

75% sequence homology with the mammalian Gqα protein (mGq) (Go & Mitchell, 2007). One key difference between iGqα and mGqα proteins is the N-terminal extension, MTLESI, that is present in the mGqα and G11α protein but not in the iGqα protein. The last 31 residues of the C- terminus of squid iGqα are identical to those in the C-terminus of mGqα. Both iGqα and mGqα

9 interact solely with receptors known to couple Gq which may be controlled by residues in the C- terminus and linker sequences connecting the helical and ras-like domains (Go & Mitchell,

2007). The iGqα protein has a significantly improved efficacy upon activation by a Gq-coupled receptor than the mammalian Gqα protein; this efficacy is reduced upon addition of the N- terminal MTLESI extension present in the mGq protein (Go & Mitchell, 2007). The reverse was seen upon deletion of the MTLESI extension from mGq, where there was an increase in efficacy upon G protein activation by the GPCR, however not to the level that is observed with iGq. This inhibitory effect associated with the MTLESI extension is also observed downstream at the level of the activation of mitogen-activated protein kinase ERK1/2 (Go & Mitchell, 2007). The visual iGqαβγ subunits are mainly membrane associated proteins which is important for efficient interaction with rhodopsin, whereas Gtα is loosely associated with the membranes and does not efficiently interact with rhodopsin, unless the βγ-subunits are present (Bamsey, Mayeenuddin,

Cheung, & Mitchell, 2000). Soluble iGqα does exist in the squid visual system and is capable of activating PLC, which is unlike the mammalian Gq protein (Bamsey et al., 2000; Mitchell,

Gutierrez, & Northup, 1995). There appears to be an important mechanism present in the squid visual system where the N-terminal residues of only soluble Gqα are cleaved by calpain, which would prevent this soluble iGqα protein from activating PLCs in the absence of receptor- activation (Bamsey et al., 2000).

The co-crystal structure of the Gs protein interacting with the β2-adrenergic receptor (β2AR) was solved in 2011 (Figure 5) (Rasmussen et al., 2011). This structure revealed major conformational changes of the Gsα domain; where one of the two subdomains, Gsα-helical subdomain, had a significant displacement relative to the other domain, Gsα-Ras subdomain (Figure 5) (Rasmussen et al., 2011; Westfield et al., 2011). These two subdomains make up the nucleotide binding pocket, so this large conformational change exhibits the movement of these two domains upon

GDP-GTP exchange. The major conformational changes in the β2AR are the movement of the two transmembrane domains 5 and 6 (TM 5 & TM6); the cytoplasmic end of TM5 had 2 helical turns and TM6 had a large outward movement of 14Å. This opening between TM5 and TM6 allows for the docking of the α5-helix of the Gsα subunit which is rotated and displaced towards the receptor, into this transmembrane core. In addition to this, there are specific residues on the receptor which constitute a structural link of the receptor and G protein with the highly conserved DRY motif of the receptor (Rasmussen et al., 2011).

In the study by Rasmussen et al. (2011), they compared their co-crystal structure of β2AR-Gs protein to the co-crystal structure of metarhodopsin II and a peptide from the C-terminal sequence of Gt. In both structure complexes, there is movement of the TM5 and TM6 domains— to a lesser degree in the metarhodopsin II structure (Choe et al., 2011; Rasmussen et al., 2011).

The C-terminus of the α-helix of the Gt peptide is tilted relative to the homologous region in the

Gs. These differences may be a result of different receptor-G protein interactions; however there is high conservation in the nucleotide binding pocket of the G proteins and these differences may be a result of more contact in the presence of an intact G protein (Rasmussen et al., 2011). It has been suggested that perhaps the metarhodopsin II-Gt peptide complex is revealing the initial binding contact of G protein to receptor, where the initial rotation of the α-helix of the G protein

(as seen with the Gt peptide) would be required to orient the G protein in the appropriate position for further interaction with its respective receptor (Choe et al., 2011; Rasmussen et al., 2011).

Figure 5: Co-crystal structure of the β2-adrenergic receptor and Gs protein from three separate angles. This co-crystal structure reveals the major conformational changes that take place in the α- subunit of Gs in which the α-helical subdomain was displaced from the α-Ras subdomain, as well as the movements of TM5 and TM6 of the β2AR which allows for the docking of the Gsα subunit. This figure was reproduced and modified with permissions from Rasmussen et al., 2011.

1.2.3. Phospholipase C (PLC)

PLC proteins are cytoplasmic proteins that upon activation hydrolyze membrane inositol phospholipids into IP3 and DAG. There are several sub-types of mammalian PLC proteins all classified based on their structure, including PLCδ, PLCβ, PLCγ, PLCε. PLC proteins have also been identified in invertebrates, including Loligo Pealei (Mitchell et al., 1995), Drosophila

(Bloomquist et al., 1988; Shortridge et al., 1991), and Limulus (Fein, 1986). While the PLC proteins differ based on structure, they all have two catalytic domains (X and Y) and a calcium binding domain. The 140-kDa PLC protein of the squid visual system that was previously identified in our lab has six domains; the two catalytic domains and Ca2+ binding domain previously mentioned, as well as pleckstrin homology domain (PH domain) which allows the

PLC to bind to the membrane and the C-terminally located P- and G-box motifs where the 12 activated iGq interacts (Mayeenuddin, Bamsey, & Mitchell, 2001; Mitchell et al., 1995; Mitchell

& Swardfager, 2010). There is also a PEST sequence where calpain cleavage can occur, and two

ATP/GTP binding sites (Mayeenuddin et al., 2001). Squid visual PLC shares a similar domain structure and has significant sequence homology to the mammalian PLC-β (36-40%). The squid visual PLC also has significant sequence homology with two Drosophila PLC proteins; the visual PLC, norpA (37%), and a neuronal PLC clone, PLC-21 (37%).

Squid PLC140 (Loligo pealei) and cuttlefish PLC21 (Sepia officinalis) were crystallized as fragmented proteins rather than full-length proteins (Figure 6) (Lyon et al., 2011). The catalytic core of these two cephalopod PLCs are essentially identical and compared to the human PLC analog only had subtle differences. There is also interactions of a helix within the proximal C- terminal region, Hα2’, with the catalytic core that is present in both cephalopod and human PLC; this helix is also involved in Gqα interactions (Lyon et al., 2011; Lyon, Dutta, Boguth, Skiniotis,

& Tesmer, 2013).

Squid PLC activity is stimulated by iGqα subunit and not by the Gβγ subunits. The PLC activity is also regulated by nucleotides, as is expected due to the presence of the ATP/GTP binding site present within the sequence; the activity is inhibited in a concentration-dependent manner

(Mayeenuddin et al., 2001). Squid PLC was also found to increase the GTPase activity of Gqα suggesting a negative feedback inhibition of invertebrate iGqα proteins, implicating the role of

PLC in both activation and inactivation of the squid visual system.

Figure 6: Crystal structures of Loligo pealei, Sepia officinalis and human PLC complexed with Gqα. Squid PLC (Loligo) (b) was crystallized as a dimer with all of the domains, PLC21 (Sepia) (c) was crystallized as a monomer and human PLC (d) complexed with Gqα (shown in grey). The colour scheme is the same for all of the PLC structures and labelled within the structures. This figure was reproduced and modified with permissions from Lyon et al., 2011.

1.3. Inactivation Pathway of the Visual System

In both vertebrate and invertebrate visual systems, metarhodopsin, is a target for two proteins, G protein-coupled receptor kinase (GRK) and arrestin (Figure 7 A, B) (Krupnick & Benovic,

1998). The GRK phosphorylates metarhodopsin and arrestin binds the intracellular surface of

14 metarhodopsin stopping further interaction with its respective G protein, ceasing downstream signalling (Figure 7B). In the mammalian visual system, GRKs bind with high affinity to metarhodopsin resulting in phosphorylation of up to 7 serine and threonine residues in the C- terminal tail of metarhodopsin (Kuhn, 1978; Palczewski et al., 1988). Once metarhodopsin is phosphorylated, visual arrestin binds with high affinity and visual arrestin has a low affinity for any other form of rhodopsin (inactive, inactive-phosphorylated, and active-unphosphorylated)

(Gurevich & Benovic, 1993, 1992). Rhodopsin must have a minimum of three sites phosphorylated in order for visual arrestin to bind with high affinity and with an additional phosphate maximal arrestin binding occurs (Vishnivetskiy et al., 2007). One phosphate is insufficient for arrestin binding, while two phosphates result in binding that is not a high affinity interaction.

In the invertebrate eye, arrestin binds metarhodopsin with high affinity, independently of receptor phosphorylation (Swardfager & Mitchell, 2007; Vinos, Jalink, Hardy, Britt, & Zuker,

1997). Even though arrestin binds independent of receptor phosphorylation, squid rhodopsin kinase (SQRK) phosphorylates metarhodopsin at two potential sites, serine 360 and threonine

364; it is not clear what role SQRK phosphorylation of metarhodopsin plays in this system, as it is not required for arrestin to bind, as seen in the mammalian visual system (Figure 7A,B).

Interestingly, SQRK also phosphorylates arrestin (Mayeenuddin & Mitchell, 2003), however the role of this phosphorylation is also unclear. In the squid, phosphorylated metarhodopsin, with arrestin bound, can be photoconverted back to the inactive state with a second light stimulus, isomerizing all-trans-retinal back to 11-cis-retinal. Once all-trans-retinal is photoisomerized back to 11-cis-retinal, it is thought that the arrestin phosphorylation facilitates the dissociation of the invertebrate rhodopsin-arrestin complex, as this has been shown in the Drosophila visual system

(Alloway & Dolph, 1999). This would allow for the dephosphorylation and regeneration of

15 rhodopsin, and presumably arrestin, for subsequent light-activation. This is unique to the inactivation pathway of the invertebrate visual system.

Figure 7: Inactivation pathway of the invertebrate visual system (A) and the mammalian visual system (B). A) Metarhodopsin is a target for both squid arrestin and SQRK. SQRK phosphorylates metarhodopsin and arrestin, while arrestin binds metarhodopsin and arrests the interactions between the Gq protein and the receptor. The all-trans retinal can be photoisomerized back into 11-cis-retinal upon absorption of a photon of light, bringing metarhodopsin back to the inactive state. Once the arrestin has bound and both arrestin and metarhodopsin are phosphorylated it is unknown how these two proteins dissociate or how they are dephosphorylated. B) Inactivation of the mammalian system begins when metarhodopsin is phosphorylated by GRK-1 (RK). Once the receptor is phosphorylated with a minimum of three phosphates, arrestin-1 binds with high affinity to the receptor and ceases the downstream signalling.

1.3.1. Squid Rhodopsin Kinase (SQRK)

The squid rhodopsin kinase cDNA was cloned by Mayeenuddin & Mitchell and encodes a

70kDa protein that is expressed primarily in the retina and to a lesser extent the optic ganglion

(2001). There are 7 mammalian GRKs which have been grouped into 3 subfamilies, GRK1,

GRK 2 and GRK4 (Gainetdinov et al., 2000; Mendez et al., 2000; Sterne-Marr, Dhami, Tesmer,

& Ferguson, 2004). The GRK1 subfamily consists of the two visual GRKs; GRK1, the rhodopsin kinase and GRK7, the cone opsin kinase. The GRK2 subfamily is made up of GRK2 and GRK3, the kinases responsible for β-adrenergic receptor phosphorylation. The final subfamily, GRK 4 consists of GRKs 4-6. Among the invertebrates, there is an octopus rhodopsin kinase (ORK)

(Kikkawa, Yoshida, Nakagawa, Iwasa, & Tsuda, 1998), Limulus kinase (Edwards, Wishart,

Wiebe, & Battelle, 1989) and two receptor kinases in Drosophila (dGPRK1 and dGPRK2)

(Cassill, Whitney, Joazeiro, Becker, & Zuker, 1991). SQRK shares high sequence similarity to octopus rhodopsin kinase, as well as significant sequence identity with GRK2, GRK 3 and dGPRK1. As observed with other invertebrate rhodopsin kinases, such as octopus and

Drosophila, SQRK has low sequence homology with the mammalian rhodopsin kinase, GRK1

(Mayeenuddin & Mitchell, 2001).

GRKs, structurally, have three domains, a centrally located catalytic kinase domain with an amino-terminal RGS (regulator of G-protein signalling) domain and a variable carboxyl- terminal domain on each side. The C-terminal domain is variable both in size and structure between GRKs and is involved in post-translational modifications and membrane localization

(Pitcher, Freedman, & Lefkowitz, 1998). SQRK is structurally homologous to the GRK2 family, consisting of the N-terminal RGS domain, the pleckstrin homology (PH) domain in the C- terminus, and the serine/threonine kinase catalytic domain with a kinase active site and an ATP- binding site (Mayeenuddin & Mitchell, 2001). SQRK also has two potential Ca2+/calmodulin- binding sites. GRKs phosphorylate receptors in their activated state, likewise SQRK phosphorylates both squid rhodopsin and bovine rhodopsin in a light-dependent manner

(Mayeenuddin & Mitchell, 2001). SQRK also phosphorylates squid arrestin which is unique to

17 the squid visual system as no other arrestins are phosphorylated by the receptor kinase

(Mayeenuddin & Mitchell, 2001, 2003; Swardfager & Mitchell, 2007).

Similar to GRK1, SQRK is autophosphorylated. GRK1 autophosphorylation does not have an effect on its ability to phosphorylate rhodopsin (Pitcher et al., 1998). The autophosphorylation of

GRK1 occurs rapidly, and is thought to play a role in the dissociation of the enzyme from the receptor after phosphorylation (Buczylko, Gutmann, & Palczewski, 1991). The role of autophosphorylation of SQRK remains to be elucidated as well as its effect on the ability of

SQRK to phosphorylate its substrates metarhodopsin and arrestin.

1.4. Arrestin

Arrestins play a primary role in regulating GPCR signalling (Krupnick & Benovic, 1998). The four vertebrate family of arrestins are well conserved and accommodate the regulation of a very large family of GPCRs. There are two visual arrestins and two non-visual arrestins. The two visual arrestins are named arrestin 1 (visual or rod arrestin) and arrestin 4 (cone arrestin); these visual arrestins are expressed solely in rod and cone photoreceptors in the retina, respectively

(Sutton et al., 2005). The two non-visual arrestins are ubiquitously expressed and named arrestin

2 and 3, which are also referred to as β-arrestin 1 and 2, respectively. These arrestin proteins range in size from 44-48kDa (Gurevich & Gurevich, 2013). The first vertebrate arrestin discovered, cloned and crystallized was arrestin 1 (Granzin, Wilden, Choe, Krafft, & Bu, 1998;

Kuhn, 1978; Shinohara et al., 1987). All four mammalian arrestins have now been crystallized and show similar overall structure (Granzin et al., 1998; Han et al., 2001; Sutton et al., 2005;

Zhan, Gimenez, Gurevich, & Spiller, 2011).

1.4.1. Arrestin Structure

Crystallization of arrestin revealed a unique structure consisting of two cup-like domains consisting of seven strands of β-sheets (Figure 8). These domains, named carboxyl-terminal domain (C-terminal domain) and amino-terminal domain (N-terminal domain) give the arrestin structure a saddle-like shape. The domains are connected by a hinge region and held together by a polar core region. The polar core region forms a network of salt bridges, and acts as the main phosphate sensor of arrestin upon binding to the activated-phosphorylated receptor. The receptor binding elements are present on the concave surface of both the N- and C-domains of arrestin

(Modzelewska, Filipek, Palczewski, & Park, 2006; Ostermaier, Peterhans, Jaussi, Deupi, &

Standfuss, 2014; Vishnivetskiy, Hosey, Benovic, & Gurevich, 2004). The C-terminal tail has not been resolved fully in the crystal structures of arrestin however, information from the structure and mutagenesis studies suggests that the C-terminal tail is tucked into the arrestin structure in the basal conformation (Granzin et al., 1998; Gurevich, 1998; Sutton et al., 2005; Zhan et al.,

2011). This forms a structural feature known as the three-element interaction, consisting of the β- strand 1, α-helix 1 and β-strand XX of the C-terminal tail (Figure 8B). The variability between the structures of the arrestin subtypes (arrestin 1-4) is in the loops and inter-domain hinge; however these differences reflect the flexibility of these regions, as the variability between the structures of arrestin subtypes and monomers of the same arrestin are similar (Gurevich &

Gurevich, 2013).

Figure 8: Crystal structures of mammalian arrestins (A) and enlargements of the two stabilizing structural features, the 3-element interaction (B) and the polar core (C). This figure shows the overlay of arrestin 3 (yellow) and 2 monomers of arrestin 1 (red, pink) and arrestin 2 (cyan and blue). Arrestins are made up of two domains, the N- and C-domain, connected by an inter-domain hinge. The C-terminal tail is not resolved in the crystal structures of the mammalian arrestins. The enlargement in part B (red circle and arrow) shows 3-element interaction made up of the C-terminal tail (orange), α-helix I (red) and β-strand I (green). The two lysines are highlighted and involved in guiding the phosphorylated C-terminus of the receptor to the arrestin. The enlargement in part C (black circle and arrow) shows the polar core of arrestin-1 which is well conserved structural feature of both invertebrate and mammalian arrestins, with the exception of squid arrestin, where there is an asparagine (293) in place of the aspartic acid. The polar core acts as the phosphosensor upon binding to the phosphorylated receptor. This figure has been modified from Gurevich & Gurevich, 2004 and 2013.

1.5. Key Binding Elements in Arrestin

The receptor binding elements exist in both the N- and C-terminal domains of the concave surface of arrestin (Gurevich & Gurevich, 2013; Modzelewska et al., 2006; Ostermaier et al.,

2014; Smith, Dinculescu, Peterson, & Mcdowell, 2004; Vishnivetskiy et al., 2004). These

20 domains are stabilized by three main intramolecular interactions; the hydrophobic interactions within the domains, the polar core and the 3-element interaction (Gurevich & Gurevich, 2006;

Hirsch et al., 1999). In order for arrestin to move into a high affinity binding state, these interactions must be destabilized.

1.5.1. Polar Core Residues

The polar core consists of a network of salt bridges formed by the amino acid residues, D30,

R175, D296, D303 and R382 (based on arrestin-1) (Figure 8) (Gurevich & Gurevich, 2013;

Hirsch et al., 1999; Vishnivetskiy et al., 1999). The salt bridge between R175 and D296 acts as the key phosphate sensor of arrestin upon binding to the phosphorylated receptor. The negatively charged phosphates disrupt the ionic interaction between R175 and D296 thereby turning the phosphosensor on, allowing the arrestin to transition into the high affinity binding state

(Gurevich & Benovic, 1995, 1997). This key role for Arg175 was determined through mutagenesis of Arg175 to all other 19 amino acid residues, revealing that the positive charge is essential for the selectivity of binding to phosphorylated-metarhodopsin (Gurevich & Benovic,

1997). All other mutations (neutralization and charge reversal) showed increased binding to unphosphorylated-activated rhodopsin (Gurevich & Benovic, 1997). The negative partner of

R175, D296, was also determined through mutagenesis, where charge reversal mutants of D296 were found to bind to metarhodopsin, in the absence of phosphorylation (Vishnivetskiy et al.,

1999). Charge reversal of both D296 and R175 restored the salt bridge between the two residues and the selective phosphorylated-metarhodopsin binding (Gurevich & Gurevich, 2004;

Vishnivetskiy et al., 1999). The polar core residues are conserved in all four mammalian arrestins as well as some invertebrate arrestins from Drosophila and Limulus (Gurevich &

Gurevich, 2006b). However, squid arrestin is missing one negatively charged aspartic acid

(D296 in arrestin-1) which is replaced by an asparagine residue (N293 in squid arrestin), this 21 difference may make the polar core of squid arrestin less tightly bound and contribute to the ability of squid arrestin to bind unphosphorylated metarhodopsin.

In order for arrestin to move into a high-affinity receptor binding state, the phosphates must reach this polar core which is buried within the arrestin, and disrupt the salt bridge (Gurevich &

Gurevich, 2006b; Hirsch et al., 1999). Two lysines (K14 and K15) have been shown to drastically decrease arrestin binding to phosphorylated-metarhodopsin when either or both are mutated to uncharged amino acids (Gimenez et al., 2012; Gurevich & Gurevich, 2004;

Vishnivetskiy et al., 2000). It has also been demonstrated that neutralizing mutations of these two lysines have minimal to no effect on arrestin binding to phosphorylated-metarhodopsin, once the polar core has already been destabilized (Gurevich & Gurevich, 2004; Vishnivetskiy et al.,

2000). These findings suggest that the lysines play a guiding role, by initially interacting with the receptor-attached phosphates and “guiding” them into the polar core (Figure 8B) (Gurevich &

Gurevich, 2004, 2006b; Vishnivetskiy et al., 2000). The two lysines are conserved in various invertebrate arrestins including squid (Loligo pealei), fruit fly (Drosophila melanogaster), and horseshoe crab (Limulus polyphemus), in addition to all four mammalian arrestins.

1.5.2. 3- Element Interaction

When arrestin is in the basal state, the C-terminal tail is within the arrestin structure, held in place by several electrostatic, van der Waals and hydrogen-bond interactions (Hirsch et al.,

1999). In addition to interacting with the polar core, the C-terminal tail (β-strand XX) interacts with β-strand I, and α-helix I creating the structural feature known as the 3-element interaction

(Figure 8B). As with other mutations to the key binding elements, mutation of any of the 3 elements in this interaction results in constitutively active arrestin mutants (Gurevich &

Gurevich, 2004; Gurevich, 1998). Downstream of the hydrophobic residues of β-strand 1

22 involved in the 3-element interaction are the two lysines, K14 and K15, which guide receptor- attached phosphates into the polar core (Figure 8B) (Gurevich & Gurevich, 2004). It has been proposed that when these lysines interact with the phosphates, the lysine residue at position 14 flips over, disrupting the 3-element interaction, resulting in the release of the C-terminal tail, which releases one of the polar core residues (R382), thereby allowing the phosphates to move into the polar core to Arg175 (Gurevich & Gurevich, 2004; Gurevich, 1998). α-helix 1 also becomes more flexible as it has no intramolecular partners to interact with following activation

(Gurevich & Gurevich, 2004; Han et al., 2001).

Prior to the resolution of the crystal structure of basal arrestin, release of the C-terminus was one of the first suggested structural features that transitions arrestin from the basal state into a high affinity binding state. This was determined from the increase in proteolysis of the C-terminal tail upon arrestin binding to phosphorylated-activated rhodopsin (Gurevich, Chen, Kim, & Benovic,

1994; Ohguro et al., 1998; Palczewski, 1994; Palczewski, Pulvermuller, Buczylko, & Hofmann,

1991).

1.5.3. N- and C- Domain Residues

It has been shown that there are both activation and phosphorylation recognition sites in both domains of mammalian arrestins (Gurevich & Benovic, 1995; Gurevich & Benovic, 1993;

Vishnivetskiy et al., 2004). The N domain activation recognition site has been termed the primary site (residues 29-163), while the site in the C-domain has been termed the secondary site

(residues 191-355) (Gurevich & Benovic, 1993; Gurevich et al., 1995). The C-domain is considered a secondary site, as it has been shown that once the C-domain is cleaved (truncated arrestin 1-191), the arrestin molecule can still bind phosphorylated-activated rhodopsin however, the selectivity towards the phosphorylated-activated rhodopsin is decreased compared to full

23 length arrestin; therefore implicating the additional binding elements in the C-domain (Gurevich

& Benovic, 1993, 1995, 1992). Hydrogen/deuterium exchange (HDX) analysis of the complex of

β2V2R-β-arrestin 1 (with Fab30) revealed that the N & C-domain regions were more dynamic when interacting the receptor (Shukla et al., 2014).

Within these domains, it has been determined that residues of the N-domain (45-86), consisting of β-strand V & VI, with adjacent loops and C-domain residues (237-268), which correspond to the β-strand XV and XVI, are involved in receptor specificity (Han et al., 2001; Hirsch et al.,

1999; Vishnivetskiy et al., 2004). These residues are not involved in phosphorylation recognition, but bind to other areas of the receptor that determine arrestin-receptor preference

(Vishnivetskiy et al., 2004).

Experimentally, it has been shown using numerous methods such as mutagenesis, antibody competition, fluorescent labelling, hydrogen/deuterium exchange, epitope insertion, spin- labelling and double electron-electron resonance (DEER), the involvement of both the N and C domain of arrestin in binding to phosphorylated-activated rhodopsin (Dinculescu et al., 2002;

Gurevich & Benovic, 1995; Gurevich & Benovic, 1993, 1992; Gurevich et al., 1995; Kim et al.,

2012; Krafft et al., 2007; Ohguro, Palczewski, Walsh, & Johnson, 1994; Ostermaier et al., 2014;

Shukla et al., 2014; Smith et al., 2004; Vishnivetskiy et al., 2004). Thus far, three main loops have been determined to be involved in the transition of arrestin into the high-affinity receptor binding state; the middle, or “139” loop (residues 133-142), finger loop (residues 68-77) and the lariat loop (residues 248-253) (Dinculescu et al., 2002; Gurevich, Hanson, Song, Vishnivetskiy,

& Gurevich, 2011; Kim et al., 2012; Krafft et al., 2007; Ostermaier et al., 2014; Smith et al.,

2004; Vishnivetskiy et al., 2011). Upon crystallizing a pre-activated cleaved arrestin (p44), it was shown that the lariat loop moves into the space that once occupied the C-terminal tail, and may be involved in engaging the activated receptor (Kim et al., 2013). It was also shown that the 24 large movements of the finger loop and middle loop were consistent with the aforementioned structural studies; where the finger loop moves in the direction of the receptor and the middle loop moves away from the receptor (Gurevich et al., 2011; Kim et al., 2012; Kim et al., 2013;

Ostermaier et al., 2014; Smith et al., 2004; Vishnivetskiy et al., 2011). Kim and colleagues

(2012) also determined that additional loops, named the plastic loops, located on the tips of the

N- and C- domain had slight inward movements when arrestin bound the activated- phosphorylated receptor.

In addition to the loops within the domains, the flexible hinge (179-191) connecting the N- and

C-domain is also an important binding element; when the hinge is shortened, arrestin binding to phosphorylated-activated rhodopsin was reduced (Modzelewska et al., 2006; Vishnivetskiy et al.,

2002). The question that still remains is whether the movement of the N- and C- domain are large conformational changes upon binding to the receptor, or smaller movements of the loops within these domains.

1.6. Models of Arrestin Binding

There have been several proposed models of the interaction between arrestin and rhodopsin with varying degrees of evidence for each. The exact interaction of arrestin and rhodopsin remains unknown and the proposed interactions between arrestin and rhodopsin will remain models until they are revealed by the co-crystallization of an arrestin and its respective receptor.

1.6.1. Clam-Shell Model

The clam-shell model proposed large movements of the N- and C-domains of arrestin upon binding to phosphorylated-metarhodopsin. This model is based on two findings which together suggest a considerable conformational change. The first is the high Arrhenius activation energy of the arrestin-rhodopsin complex and secondly, the finding that the binding elements of visual 25 arrestin do not interact with light-activated rhodopsin or inactive-phosphorylated rhodopsin but are involved in the interaction with phosphorylated-metarhodopsin (Gurevich & Benovic, 1995;

Gurevich & Benovic, 1993; Schleicher, Kuhn, & Peter, 1989). The inter-domain hinge of arrestin must also be full length since previous experiments have shown that upon shortening the hinge, arrestin can no longer bind to the receptor (Vishnivetskiy, 2002). The flexible hinge would allow substantial movement of both domains toward the receptor, contributing to the high activation energy associated with the complex and allowing for the availability of the binding elements on the receptor binding surface of arrestin. The clam-shell model also addresses the large size and shape of arrestin and how this protein is able to bind the smaller rhodopsin molecule through large conformational changes in both domains.

As of yet, there is no direct evidence for the large movement of the two domains. A study by

Kim and colleagues (2012) used spin-labeling and long-range distance measurements to obtain

25 or more distances between residues of free and bound-arrestin 1. These measurements revealed that there were only slight movements of the arrestin domains, which are not consistent with of the clam-shell model.

1.6.2. Multi-Site Interaction Model

The multi-site interaction model is based on the affinity of arrestin for different forms of rhodopsin. Arrestin-1 has low affinity for inactive-unphosphorylated rhodopsin, active- unphosphorylated rhodopsin and inactive-phosphorylated rhodopsin. Once mammalian rhodopsin is both light-activated and phosphorylated, arrestin-1 will bind with high affinity

(Figure 9A) (Gurevich & Benovic, 1993). This interaction likely involves an activation sensor— binding elements of arrestin which interact with light-activated rhodopsin, and a phosphate sensor—those binding elements which interact with the phosphorylated-rhodopsin (Figure 9D)

(Gurevich & Benovic, 1993; Gurevich & Gurevich, 2004). These two sensors are two distinct areas on the receptor-binding surface of arrestin, where the primary activation sensor is within the first 191 residues, and the phosphate sensor region is between residues 158-185 (Gurevich &

Benovic, 1993). In addition to the primary activation sensor, there is a secondary binding site of arrestin within the C-domain which is engaged once arrestin has bound the activated- phosphorylated receptor. When either of these interactions occur, there is low-affinity binding of arrestin to the respective forms of rhodopsin, however once both of these elements are engaged, the arrestin moves into the high-affinity receptor binding state, where maximal binding occurs

(Figure 9A,C). As previously discussed, the C-terminal tail of arrestin is released in the initial complex of arrestin with the receptor-attached phosphates (Gurevich et al., 1994; Gurevich &

Gurevich, 2004; Gurevich, 1998; Kim et al., 2013). There is slight movement of both the N- domain (163-loop) and C-domain (344-loop) towards the receptor (Figure 9B,C) (Gurevich et al., 2011; Kim et al., 2012). There is also large movement of two flexible loops on the receptor- binding surface of arrestin, the finger loop and 139-loop (middle loop). The 139-loop moves away from the receptor, while the finger loop moves in the direction of the incoming receptor

(Figure 9B,C) (Gurevich et al., 2011; Kim et al., 2012; Ostermaier et al., 2014). It has been shown that the 139 loop acts as a stabilizer when arrestin-1 is in the basal state (Figure 9B), and is involved with receptor selectivity (Kim et al., 2012). This model initially proposed in 1993 by

Gurevich & Benovic, has gained support experimentally, and is consistent with the crystal structures of basal and pre-activated arrestin as well as HDX analysis of the purified complex of

β2V2R and β-arrestin 1 (with Fab30) (Gurevich & Gurevich, 2004; Gurevich, 1998; Kim et al.,

2012; Kim et al., 2013; Ostermaier et al., 2014; Shukla et al., 2014; Vishnivetskiy et al., 2004).

Figure 9: The multi-site interaction model of arrestin binding to phosphorylated- metarhodopsin. A) Binding results of arrestin-1 to the different forms of rhodopsin. This shows the dependence of arrestin binding on both light activation and phosphorylation of metarhodopsin, consistent with the multi-site interaction model. B) Crystal structure of arrestin in the basal state and C) the modelled structure of arrestin in the high-affinity binding state. The N- and C- domains are shown in green and purple respectively, with the C- terminal tail shown in brown. The two distal loops on the N- and C-domains are shown in magenta and blue, respectively; these move toward the receptor when arrestin is in the high affinity binding state (C). The finger loop and 139 loop are shown in light green and cyan, respectively. When arrestin is in the high affinity binding state (C), the finger loop has slight movement towards the receptor, and the 139 loop has a large movement away from the receptor. D) The multi-site interaction model, showing the engagement of arrestin (white font) upon light activation of rhodopsin (i) and upon phosphorylation of rhodopsin (ii), once both occur, arrestin moves into the high affinity binding state (arrestin written in red).These figures were modified from Gurevich & Gurevich, 2004 and Gurevich et al., 2011.

1.6.3. One Arrestin to Two Rhodopsin Binding Model

This proposed model is the binding of one arrestin to two rhodopsins in a dimer. This model suggests that there is one rhodopsin molecule in each domain of the arrestin (Figure 10). This model, similar to the clam-shell model, accommodates the size and shape of arrestin; as the large surface of arrestin could bind the rhodopsin dimer. However, it is important to note that in order for this model to be true, two things must be ignored, the first is that arrestin doesn’t bind inactive rhodopsin with high affinity and the second is to disregard the receptor C-terminus, despite the certainty of its involvement in arrestin binding (Gurevich & Benovic, 1997; Gurevich et al., 1994). There have been experiments performed, providing results in favour and against the

1:2 binding model.

One study examined potential 1:1 and 1:2 arrestin-rhodopsin binding conceptual models

(Modzelewska, et al., 2006). From these models, it was the 1:2 binding model which appeared to have the most stable arrangement, most favourable interaction and the largest surface area of contact. The 1:1 binding models including rhodopsin solely engaged with the N-domain, solely with the C-domain and arrestin docked centrally on rhodopsin, had no interaction of rhodopsin with both domains of arrestin, simultaneously. The 1:2 binding model did have simultaneous interactions with both arrestin domains. Another study by Sommer and colleagues (2011) investigated the stoichiometry of arrestin binding to rhodopsin at varying levels of receptor photoactivation density. At low receptor photoactivation, the binding ratio of arrestin to rhodopsin is 1:1, however at high receptor photoactivation, the arrestin-rhodopsin binding ratio was 1:2 (Sommer, Hofmann, & Heck, 2011). If this 1:2 binding model is in fact the way in which the arrestin interacts with rhodopsin, physiologically it would be quite advantageous, as it 29 would increase the quenching power of arrestin at high illumination levels. However, as previously stated, there are assumptions to be made regarding this 1:2 binding model which are not in agreement with experimental evidence of arrestin-rhodopsin binding, as discussed in the other binding models.

Figure 10: One arrestin to two rhodopsin binding model. In this model, 1 arrestin will bind a rhodopsin dimer, with one rhodopsin in each domain of arrestin. There is little experimental evidence supporting this model. This figure was reproduced with permissions from Modzelewska, et al. 2006.

1.7. Invertebrate Arrestin

Invertebrate visual arrestins have been cloned from Drosophila (LeVine III et al., 1991),

Calliphora (Bentrop, Plangger, & Paulsen, 1993), Limulus (Smith et al., 1995) and Loligo pealei

(Mayeenuddin & Mitchell, 2003), and thus far none of the invertebrate arrestins have been crystallized. Limulus and Loligo arrestins have a single isoform, whereas Drosophila and

Calliphora have two isoforms. Squid (Loligo pealei) visual arrestin, a 55kDa protein, was cloned and purified in our lab (Mayeenuddin & Mitchell, 2003; Swardfager & Mitchell, 2007). It shares highest protein sequence identity with the mammalian non-visual arrestin families (41-43%), one isoform of Drosophila arrestin, Arr 2 (43%), and to a lesser degree with the mammalian visual arrestin, arrestin-1, Limulus arrestin and the other isoform of Drosophila, Arr 1 (37-38%). The structure of invertebrate visual arrestins can be modelled based on the existing crystal structures of mammalian arrestins, as we have the primary amino acid sequences of our invertebrate visual arrestins. The overall structure of squid arrestin, based on modelling, is similar to that of the mammalian arrestins; consisting of the saddle-like shape formed by the N- and C-domains connected by an inter-domain hinge (Figure 12). The loops (finger, lariat and middle) previously discussed are also present in the modelled squid arrestin structure. As the C-terminal tail is not fully resolved in any of the mammalian arrestin structures, it could not be resolved through modelling for squid arrestin. Although the mammalian and invertebrate arrestins are very similar in structure, there is a major functional difference between these arrestins; invertebrate arrestins are unique as compared to the mammalian counterparts as they do not require receptor phosphorylation in order to bind. Arrestin binding in the absence of receptor phosphorylation has been investigated thoroughly by Vishnivetskiy, Gurevich and colleagues to design mammalian arrestins with specific functional characteristics (Gurevich & Gurevich, 2004; Vishnivetskiy et al., 1999; Vishnivetskiy et al., 2013).

Figure 11: Modelled crystal structure of squid arrestin. This crystal structure is a model for squid arrestin based on primary sequence of squid arrestin and the crystal structures of the mammalian β-arrestins. Squid arrestin has two saddle-like domains, N- and C-domain shown in blue and purple, respectively, connected by an inter-domain hinge. As the C-tail of the mammalian arrestins is not resolved in their crystal structures, it could not be resolved in this modelled structure of squid arrestin. This model was created by Dr. Abhishek Bandyopadhyay, of Dr. Ernst’s laboratory.

Squid arrestin is unique from all arrestins in that there is one key difference in amino acid sequence of the polar core (Figure 12). As previously discussed, the polar core is the phosphate sensor of mammalian arrestins, consisting of 5 residues three aspartic acids (D30, D296, and

D303) and two arginines (R175 and R382) (Gurevich & Gurevich, 2004; Vishnivetskiy et al.,

1999). Squid arrestin has a neutral asparagine (position 293) in place of the negatively charged aspartic acid (position 296 in arrestin-1), which may contribute to the rhodopsin-phosphorylation independent nature of this protein. Charge reversal mutations of either the arginine at 175 or the aspartic acid at 296 resulted in enhanced binding of visual arrestin to light-activated, unphosphorylated rhodopsin (Gurevich & Benovic, 1995; Vishnivetskiy et al., 1999, 2000).

Mutation of Arg175 to Asn175 provided a particularly interesting result in which binding to light-activated rhodopsin was increased to the level of wild type mammalian arrestin-1; this was 32 not the case however, upon mutation of the Asp296 to Asn296 which maintained a requirement for light-activation and phosphorylation of rhodopsin in order for high affinity binding to occur

(Gurevich & Benovic, 1995; Gurevich et al., 2011; Vishnivetskiy et al., 2000). Mutations to the squid arrestin polar core have yet to be performed to determine whether squid arrestin binding will become dependent on rhodopsin-phosphorylation. The two lysines (K14 & K15) are also conserved through the invertebrate and mammalian arrestins. Interestingly, these residues have been shown to be involved in phosphate recognition in studies with mammalian arrestins, initiating the release of the C-terminal tail; however the invertebrate visual arrestins bind independent of receptor phosphorylation.

Figure 12: Sequence alignment comparing the polar core residues of invertebrate and mammalian arrestins. The polar core is a well conserved structural feature of arrestins, as can be seen by the sequence alignments of Drosophila (Accession Number: P19107), Limulus (P51484), mammalian arrestin- 1 (P08168) and β-arrestin 1 (P29066) (also named arrestin 2). The squid (Q963B5) polar core has a single amino acid change, an asparagine (293, shown in red) for the aspartic acid at approximately 290 for the other arrestins.

1.8. Arrestin Phosphorylation

Invertebrate and mammalian arrestins are phosphorylated by kinases and the phosphorylation appears to be involved in the inactivation pathway of the respective receptor system.

Phosphorylation sites have been determined for Drosophila (Alloway & Dolph, 1999;

Matsumoto et al., 1994), Limulus (Battelle, Andrews, Kempler, Edwards, & Smith, 2000;

Sineshchekova, Cardasis, Severance, Smith, & Battelle, 2004), and both of the β-arrestins (Lin et al., 2002; Lin et al., 1997) (Figure 13), all of which are C-terminally located. Our lab has previously determined that squid arrestin is phosphorylated and the kinase responsible for this phosphorylation is SQRK (Mayeenuddin & Mitchell, 2001, 2003; Swardfager & Mitchell, 2007).

There are three potential phosphorylation sites in the C-terminus of squid arrestin that may be phosphorylated by SQRK, serine392, threonine396 and serine397. Phosphorylation of squid visual arrestin by SQRK is unique to the squid visual system, as no other arrestin is phosphorylated by the G protein-coupled receptor kinase. Both Drosophila and Limulus arrestins are phosphorylated by calcium/calmodulin-dependent protein kinase II (CAM-PKII) (Calman,

Andrews, Rissler, Edwards, & Battelle, 1996; Kahn & Matsumoto, 1997; Matsumoto et al.,

1994). The single phosphorylation site, Ser412 of mammalian arrestin 2 is phosphorylated by extracellular-signal-regulated-kinases (ERKs)—ERK1 and ERK2 (Lin, Miller, Luttrell, &

Lefkowitz, 1999). The major phosphorylation site of mammalian arrestin 3 phosphorylation is

Thr383 which is phosphorylated by casein kinase II; there is an additional phosphorylation site,

Ser361, which is less phosphorylated by a kinase which has yet to be determined (Lin et al.,

2002). Similarly, Limulus visual arrestin has three phosphorylation sites which are phosphorylated sequentially; the major site of Ser381, followed by Ser377 and lastly Ser396

(Sineshchekova et al., 2004).

Figure 13: Sequence alignment of the phosphorylation sites of arrestins. This sequence alignment shows the phosphorylation sites which are located in the C-terminus. These sites have been determined for Drosophila (Accession Number: P19107), Limulus (P51484), and two mammalian arrestins, β-arrestin 1 (P29066) and β-arrestin 2 (P32121.2). There are three potential sites in the C-terminus of squid arrestin (Q963B5) that could be phosphorylated by SQRK (*); serine 392, threonine 396 and serine 397. The sites of phosphorylation are shown in red.

1.8.1. Role of Arrestin Phosphorylation

The role that the phosphorylation of arrestin plays in the inactivation pathway of GPCRs has been investigated in Drosophila and the mammalian non-visual arrestins (Alloway & Dolph,

1999; Lin et al., 2002; Lin et al., 1997, 1999). In both Drosophila and the non-visual arrestins, arrestin phosphorylation did not have an effect on the association of arrestin to the receptor.

In Drosophila, arrestin phosphorylation is not necessary for binding to light-activated rhodopsin; however it has been implicated in the dissociation of these two proteins once they have formed a complex (Alloway & Dolph, 1999). Mutation of the single phosphorylation site to an alanine resulted in an arrestin mutant that could not be released from rhodopsin once photoconverted back to its inactive state. Four additional arrestin mutants, which all exhibit low arrestin-2 phosphorylation, revealed the same outcome where the arrestin remained associated with rhodopsin upon photo-inactivation of the receptor.

Both of the non-visual arrestins are constitutively phosphorylated in the cytosol (Lin et al., 2002;

Lin et al., 1997, 1999). Upon agonist stimulation, these phosphorylated arrestins are translocated

35 to the plasma membrane and bind the activated, phosphorylated receptor. Agonist stimulation also results in the dephosphorylation of arrestin; this dephosphorylation is not required in order for arrestin to bind the receptor nor is it required for desensitization of the receptor (Lin et al.,

2002; Lin et al., 1999). When the dephosphorylation of arrestin actually occurs, whether it be before or after it is bound to the receptor, has yet to be determined. Arrestin mutants in which the phosphorylation sites are mutated to alanine (unphosphorylated) or to aspartic acid (mimics phosphorylation) both bound and desensitized the receptor showing that the phosphorylation state of these arrestins does not have an effect on the association of these two proteins. Both non- visual arrestins must be dephosphorylated in order for the receptor to be internalized through clathrin-coated pits (Lin et al., 2002; Lin et al., 1997, 1999). It was shown for both arrestin 2 and arrestin 3 that when phosphorylated, there was a reduction in arrestin binding to clathrin, and therefore a reduction in internalization of the receptors. It is thought that the phosphorylation/dephosphorylation of these arrestins regulates clathrin binding and the subsequent internalization of the receptor. They have suggested that the kinases responsible for phosphorylating these arrestins may also be involved in a negative feedback regulation, where the pathways which activate ERKs and the casein kinase II- like activity, will again phosphorylate the arrestin and reduce their functions (Lin et al., 2002; Lin et al., 1997, 1999).

Similar to the mammalian non-visual arrestins, the Drosophila visual arrestin binds to clathrin in the unphosphorylated state, and is controlled reversibly by this phosphorylation (Kiselev et al.,

2000).

The role of arrestin phosphorylation in squid arrestin has yet to be elucidated. As seen with vertebrates and invertebrate arrestins, the role of arrestin phosphorylation may be involved in the dissociation of the arrestin-rhodopsin complex, once the receptor has been photoisomerized back to the inactive state, but this remains to be assessed.

1.9. Rationale

Our lab has previously cloned, purified and characterized several proteins of the squid visual system including, Gq, SQRK, PLC and arrestin. The squid visual system is a unique system which allows us to study the Gq pathway and the different features of each of the proteins involved in the activation and inactivation of vision. Interactions between arrestin and GPCRs have been extensively studied, and will continue to be studied, even after the co-crystal structure of this complex is solved. We can examine the key structural features of the arrestin proteins, such as the polar core, using squid arrestin and compare it to its mammalian counterpart to further understand the interactions that occur between these two proteins. Less is known of the inactivation pathway and the role that arrestin and rhodopsin phosphorylation has in squid vision, as arrestin binds independently of receptor phosphorylation. We can gain a better insight into the cycle of squid rhodopsin activation and inactivation and the significance of the phosphorylating steps in the inactivation pathway.

1.10. Research Goals

1. Investigate squid arrestin binding to metarhodopsin, in the absence of receptor

phosphorylation

2. Investigate the unique polar core of squid arrestin to determine its effects on arrestin

binding from rhodopsin

3. Determine the phosphorylation sites on squid arrestin

4. Investigate the role of arrestin phosphorylation on the interaction between arrestin and

metarhodopsin, in both association and dissociation of the arrestin-rhodopsin complex

1.11. Hypotheses

1. Mutations to the polar core region of squid arrestin will have an effect on the ability of

squid arrestin to bind metarhodopsin.

a. Mutation of asparagine at position 293 to an aspartic acid will create a mutant

with a tighter polar core and will require metarhodopsin phosphorylation in order

to bind, similar to mammalian-arrestin 1.

b. Mutation of asparagine at position 293 to an arginine will create an arrestin

mutant with a polar core that is less tightly bound than the WT squid arrestin,

resulting in the disruption of the polar core, and thereby decreasing squid arrestin

binding to metarhodopsin.

2. Squid arrestin is phosphorylated in the C-terminal tail by SQRK at one or more of the

following phosphorylation sites; Serine 392, Threonine 396 and Serine 397.

3. Arrestin phosphorylation will have no effect on the association of squid arrestin with

squid metarhodopsin.

4. Arrestin phosphorylation facilitates the dissociation of the arrestin-rhodopsin complex.

2. Materials and Methods

2.1. Materials

Squid (Loligo pealei) eyes were generously provided by our collaborating laboratory, Dr. Ernst, who purchased them from Marine Biology Institute, Woods Hole, MA. Radioactive adenosine

[γ32-P] triphosphate (250μCi) was purchased from PerkinElmer Inc. Diethylaminoethyl (DEAE)

Sepharose and Heparin Sepharose resins were purchased from GE Healthcare Life Sciences.

Strep-Tactin resin was purchased from iba Solutions for Life Sciences. Sodium phytate, also known as inositol hexaphosphate (IP6) was purchased from Santa Cruz Biotechnology, Inc (SC-

203329). Primary polyclonal antibodies were previously produced in our laboratory by raising them against the purified squid visual system proteins (in rabbit) (Mayeenuddin & Mitchell,

2003). The secondary antibody used for detecting our proteins of interest in western blotting was the AntiRabbit IgG horseradish peroxidase linked whole secondary antibody (from donkey) purchased from GE Healthcare Life Sciences (NA934V). All other reagents were purchased as reagent grade level, unless stated otherwise.

2.2. Purification of native squid visual proteins

Purification of the native squid visual proteins followed the procedures described by Swardfager and Mitchell (2007) with some modifications. 50 squid eyes were thawed in the dark for one hour in 1XHEDS extraction buffer (10mM Hepes pH 7.5, 1mM EGTA, 1M DTT, 500mM NaCl,

1X protease inhibitor cocktail (PIC)) with 2mL per eye. The eyes in extraction buffer were shaken vigorously and vortexed prior to filtering through cheese cloth to remove the eye cup and lens. The membranes were homogenized by douncing and the resulting homogenate was centrifuged at 30 000 x g for 20 minutes at 4°C.The supernatants were removed and kept on ice, while the pellets were resuspended in 100mL of 1X HED buffer with no salt, homogenized and

39 centrifuged at 30 000 x g for 20 minutes at 4°C.The two supernatant fractions, which contains the soluble proteins, arrestin, SQRK and PLC were combined and the pellets which contain rhodopsin were resuspended in 60mL of 1X HED, and kept in the dark, on ice.

2.2.1. Rhodopsin

The resuspended pellets were then layered on top of sucrose solution (34% sucrose), and were centrifuged at 20 000 x g for 40 minutes at 4°C. The membrane suspensions were removed and diluted 2-fold with 1XHEDS (150mM NaCl) to decrease the sucrose concentration and then centrifuged at 30 000 x g for 1 hour at 4°C. These pellets were resuspended in 10mL cholate wash (CW) buffer (1XHEDS 150mM NaCl with 0.5% Na-Cholate) and rotated constantly for 45 minutes, in the dark at 4°C. The membranes were then centrifuged at 18 000 x g for 30 minutes at 4°C. The pellets were cholate washed for a second time, using 10mL CW buffer and left for 30 minutes, in the dark and 4°C with constant motion followed by centrifugation at 18 000 x g for

30 minutes at 4°C. The pellets were then resuspended in 10mL high salt 1X HEDS (500mM

NaCl) and re-centrifuged as previously stated. These pellets were then washed two times with

10mL no salt 1XHED buffer, and centrifuged as before between each wash. The membranes were finally resuspended in 1mL 1XHEDS-PIC (150mM NaCl), aliquoted and stored at -80°C, in the dark.

2.2.2. Arrestin, SQRK and PLC

The original eye supernatant fractions which contain arrestin, SQRK and PLC were diluted to

75mM NaCl and centrifuged at 30 000 x g for 30 minutes at 4°C. The cleared supernatants were loaded onto a DEAE Sepharose Fast Flow column pre-equilibrated with 1XHEDS (75mM

NaCl). The DEAE flow through, containing SQRK and PLC, was loaded on to a 5-mL Heparin

Sepharose 6 Fast Flow column previously equilibrated with 1XHEDS (100mM NaCl). The

40 column was washed with 1XHEDS (100mM NaCl) until the OD280 was below 0.3. A 100mL linear salt gradient (200-600mM NaCl in 1XHED) was applied to the column to elute SQRK and

PLC; SQRK and PLC-containing fractions which elute at approximately 300mM NaCl, were pooled and diluted to 50mM NaCl using 10mM Hepes pH 7.5. The SQRK and PLC pool was then concentrated and stored at -80°C.

Squid arrestin binds to DEAE Sepharose, once the DEAE column was loaded, the column was washed with two column volumes of 1X HEDS (75mM NaCl). A 100mL linear salt gradient (75-

350mM NaCl in 1XHED) was applied to the column to elute squid arrestin. Arrestin-containing fractions were eluted at approximately 150-225mM NaCl and were pooled and diluted 1:2 in 1X

HED buffer. The diluted arrestin pool was loaded onto 5mL-Heparin Sepharose column pre- equilibrated with 1XHEDS (100mM NaCl) and then washed until the OD280 was undetectable.

The arrestin was eluted using a 90mL linear IP6 gradient (0-8mM IP6 in 1X HED). The arrestin eluted at 2-3.5mM IP6, the arrestin containing fractions were pooled and dialyzed overnight against 1XHEDS buffer. This was concentrated and stored at -80°C.

At each stage of purification, samples were run on 11% SDS-polyacrylamide gels followed by

Coomassie staining and western blotting to confirm the presence and purity of the protein of interest.

2.3. cDNA Preparation

The cDNA of squid arrestin that was previously cloned by our lab was used as the full-length wild-type squid arrestin (WTsArr) (Mayeenuddin& Mitchell, 2003). This cDNA was transferred to the pET15B vector (Novagen) which was used as a template for further manipulations to the cDNA including mutagenesis and insertion of an affinity tag. An 8-amino acid Strep-Tactin tag

(WSHPQFEK) was designed using optimized codons of E.Coli and attached N-terminally to the

WTsArr for affinity purification; this insertion also had 4 GS linkers C-terminal to the Strep tag and 1 GS linker N-terminally located (GSWSHPQFEKGSGSGSGS). Primers for insertion of the

Strep tag with the GS linkers were designed using optimized codons for E.Coli and ordered from

Integrated DNA Technologies (IDT);

5’/5Phos/CATGGGTAGCTGGAGCCATCCGCAGTTTGAAAAAGGTAGCGGTAGCGGTAGCGGTTC-3’ and 5’-

/5Phos/CCATGGAACCGCTACCGCTACCGCTACCTTTTTCAAACTGCGGATGGCTCCAGCTACC-3’. These primers were annealed following the Sigma Aldrich protocol (See Appendix A). The Strep tag was ligated at a 5:1 (linker to vector) ratio, using the annealed primers (linker), cDNA which had been previously cut and PCR purified using the PureLink PCR Purification Kit (Invitrogen), T4-

DNA ligase and the T4 buffer (New England Biolabs). The ligation reactions were left to incubate overnight at 16°C. These were transformed into XL1 competent cells (procedure discussed in 2.3.1), plated on LB plates and grown overnight at 37°C. Several colonies of these transformations were mini prepped and sent for sequencing at The Centre of Applied Genomics

(TCAG) in Toronto to confirm the proper insertion of the Strep tag and linkers.

2.3.1. Preparation of XL1 Competent Cells

The XL1 competent cells were made fresh for the transformation. A 5mL LB (no ampicillin

(AMP)) culture of the XL1 competent cells was grown overnight at 37°C at 225-250rpm. The

5mL overnight culture was added to 75mL LB broth (no AMP) and grown for 2 hours at 37°C and 250rpm. The culture was centrifuged in two tubes at 1455 x g for 10 minutes at 4°C. Each pellet was resuspended in 1mL KMES buffer (60mM CaCl2, 20mM KMES, 5mM MgCl2, 5mM

MnCl2) then brought up to a 20mL final volume (per resuspended pellet) with the same KMES buffer and left on ice for 1 hour. These were centrifuged at 1455 x g, 4°C for 10 minutes and each pellet was resuspended in 2mL of KMES buffer, combined and left on ice until being used for the transformation. 42

2.4. Mutagenesis of the Phosphorylation Sites and of the Polar Core of Squid Arrestin

The WTsArr cDNA was used as the template for creating six arrestin mutants; four mutants investigating the potential phosphorylation sites of squid arrestin and two mutants exploring the polar core region of squid arrestin.

The four phosphorylation site mutations are as follows, the triple alanine mutant termed 3A mutant (S392A, T396A, & S397A), the double alanine mutant, 2A mutant (S392A & S397A) and two single alanine mutants, 1A1 mutant-S392A and 1A2 mutant-S397A. The two polar core mutants were created by mutation of the asparagine at 293 to an aspartic acid (N293D mutant) and to an arginine (N293R mutant). The mutants were created using QuikChange II XL Site-

Directed Mutagenesis Kit (Agilent Technologies) using the primers listed in Tables 1 and 2.

Primers were designed using IDT’s PrimerQuest and Oligo Analyzer 3.1 programs and subsequently purchased from IDT. All of the mutants, with the exception of the 2A mutant, were mutated in one mutagenesis step. The 2A mutant had to be performed in two stages; where we first created our single alanine mutants and then used the 1A2 mutant as the template to mutate the second serine to an alanine, creating our double alanine mutant. All of the mutants were confirmed for proper mutagenesis by sequencing at TCAG. The arrestin mutants were then transformed into BL2DE3 cells (New England Biolabs) for expression.

Table 1: The forward and reverse primers for creating the arrestin phosphorylation mutants. The primers were designed using IDT’s PrimerQuest and Oligo Analyzer 3.1 program and ordered from IDT. The primers were based on the original WTsArr sequence, with the exception of the 2A mutant which used the 1A2 arrestin mutant as the template DNA (*).

Forward Primer Reverse Primer

3A Mutant 5'- 5'- (S392A, ggggttcgaggatgaagttgctggag tattcccatcgcggcgaggcct T396A, S397A gcctcgccgcgatgggaata-3' ccagcaacttcatcctcgaacc cc-3'

2A Mutant* 5'- 5'- (S392A,S397A) gctggaggcctcaccgcgatgggaat ccttatattcccatcgcggtga ataagg-3' ggcctccagc-3'

1A1 Mutant 5'- 5'- (S392A) gtgaggcctccagcaacttcatcctc tcaaggggttcgaggatgaagt gaaccccttga-3' tgctggaggcctcac-3'

1A2 Mutant 5'- 5'- (S397A) agtggaggcctcaccgcgatgggaat ccttatattcccatcgcggtga ataagg-3' ggcctccact-3'

Table 2: The forward and reverse primers designed for creating the arrestin polar core mutants. The primers designed using IDT’s PrimerQuest and Oligo Analyzer 3.1 program and ordered from IDT. The primers were based on the original WTsArr sequence.

Forward Primer Reverse Primer

N293D Mutant 5'- 5'- cgggctgggttggcccttgatggaa tatttcacttttccatcaagggc aagtgaaata-3' caacccagcccg-3'

N293R Mutant 5'- 5'- ggcgggctgggttggcccttagggg tcatatttcacttttcccctaag aaaagtgaaatatga-3' ggccaacccagcccgcc-3'

2.5. Production and Preparation of Recombinant Squid Arrestin

4-mL cultures of the recombinant arrestins expressed in BL21DE3 cells were grown overnight at

37°C and 225rpm, in the presence of 0.1mg/mL AMP. These cultures were used to inoculate 2L of LB Broth (Lennox); with 150μL of culture per litre and 0.1mg/mL AMP per litre. The OD600 was monitored as these cultures grew at 37°C and 160 rpm. When the OD600 reaches 0.9-1, each litre of culture was induced with 100μM isopropyl β-D-1-thiogalactopyranoside (IPTG) at 16°C and were grown overnight at 160rpm. Cells were harvested by centrifugation at 5044 x g for 20 minutes at 4°C and the cell pellets were resuspended in lysis buffer (HEDS-20mM Hepes pH

7.5, 5mM EGTA, 1mM DTT, 500mM NaCl, 1X PIC) which was then lysed three times using an

EmulsiFlex C3 homogenizer (Avestin). The lysate was centrifuged at 58440 x g for 40 minutes at 4°C to pellet cell debris. The supernatants were combined with ammonium sulfate, to a final concentration of 4M, for 1 hour with constant rocking at 4°C and subsequently centrifuged at

48297 x g for 40 minutes at 4°C. The pellets were resuspended in 40mL of HEDS buffer (20mM

Hepes pH 7.5, 2mM EGTA, 1mM DTT, 500mM NaCl), and dialyzed overnight against the same

HEDS buffer to remove the ammonium sulfate. Prior to affinity chromatography, the dialyzed pool was centrifuged at 48297 x g for 30 minutes at 4°C. The supernatant was loaded onto a

1mL-Strep-Tactin SuperFlow High Capacity column which was pre-equilibrated with at least 20 column volumes of HEDS buffer (20mM Hepes pH 7.5, 2mM EGTA, 1mM DTT,

500mMNaCl). After the column was loaded, it was washed with 2 column volumes of HEDS buffer and the arrestin was eluted from the column in 5 individual 1mL volumes using Strep-

Tactin elution buffer, 2.5mM desthiobiotin in HEDS buffer. The majority of Strep-tagged arrestin eluted in the first two 1-mL eluates. The WT squid arrestin was purified first of all the

Strep-tagged arrestin proteins, in this purification the column was washed three times, however

45 the third wash contained a large amount of arrestin, so the purification of the remaining Strep- tagged arrestin constructs had two column washes prior to elution.

2.6. Arrestin Binding Assays

In general, arrestin binding assays were conducted as described by Swardfager and Mitchell,

2007. Arrestin (2μg) was combined with rhodopsin (10μg) in either the dark or light with salt and binding buffer (25mM Tris pH 7.5, 1mM EGTA, 2mM CaCl2) to a total reaction volume of

30μL for a 15 minute reaction time, followed by centrifugation 12879 x g for 15 minutes at 4°C to pellet the rhodopsin and membrane-bound arrestin. Supernatants were removed and combined with 30μL of 2X sample buffer and the pellets were resuspended in 50μL 1X sample buffer. The samples were then separated using 11% sodium dodecyl sulfate- polyacrylamide gel electrophoresis (SDS-PAGE) followed by western blotting. The quantities of arrestin and rhodopsin used in the arrestin binding assays were 2μg and 10μg, respectively, unless otherwise specified.

Saturation binding curves were generated from experiments combining 1μM metarhodopsin with increasing arrestin (0.025-0.25μM) in the presence of 500mM NaCl. These curves were generated for both phosphorylated and unphosphorylated arrestin and metarhodopsin. In reactions in which the metarhodopsin is phosphorylated, the phosphorylation reaction of metarhodopsin was performed first and as described in the subsequent section (2.6

Phosphorylation assays) followed by centrifugation at 12879 x g for 15 minutes at 4°C. The phosphorylated, pelleted metarhodopsin was resuspended in the components of the binding assay

(salt, arrestin, and water) and the reaction was started upon the addition of the binding buffer.

The reactions in which the arrestin was phosphorylated were performed as follows. First, the binding assay components (salt, water and rhodopsin) were combined then the arrestin was

46 phosphorylated for 10 minutes, as described in section 2.6, and aliquoted accordingly, and finally the binding reaction began upon the addition of binding buffer. When both metarhodopsin and arrestin were phosphorylated, the metarhodopsin phosphorylation reaction and subsequent centrifugation and pellet resuspension were performed first, followed by the arrestin phosphorylation reaction which was then aliquoted and the binding reactions begun upon addition of the binding buffer.

2.7. Phosphorylation Assays

Phosphorylation reactions were performed as previously described by Swardfager and Mitchell,

2007, with some modifications. In a total reaction volume of 30μL, purified rhodopsin (10μg) was combined with purified SQRK (2μg) with phosphorylation reaction buffer (50mM Tris pH

8.0, 15mM MgSO4, 9mM EGTA, 2mM DTT, 0.1mM ouabain, 0.1mM AEBSF, 1μM GTPγS,

2mM ATP (greater than 200 000cpm ATPγ[32P] per μL of reaction buffer)) for a 10 minute reaction time in the dark and light. Reactions were stopped by the addition of 30μL of 2X sample buffer. The entire sample was loaded and run on an 11% SDS- polyacrylamide gel, stained using

Coomassie Blue and subsequently destained until the protein bands were visible. The gels were then dried between glycerol soaked cellophane sheets prior to exposure to x-ray films for autoradiography to visualize the phosphorylated proteins.

Arrestin phosphorylation experiments investigating the phosphorylation sites and role of this phosphorylation, followed the same phosphorylation procedure where comparable quantities of the various arrestin constructs were incubated in the presence and absence of rhodopsin, with

SQRK (2μg) and phosphorylation reaction buffer for 10 minutes in the dark or light.

Native SQRK (nSQRK), purified from squid eyes, was used in the phosphorylation experiments, as well as recombinant SQRK (rSQRK) that was purified from ESF921 cells by Wei-Lin Ou, a member of Dr. Oliver Ernst’s laboratory (See Appendix B for rSQRK purification protocol).

2.8. Dissociation Assays

Arrestin and metarhodopsin were phosphorylated and associated as described previously, on a larger scale. The association reaction was in 120mM salt. The membrane-bound proteins were pelleted by centrifugation for 15 minutes at 12879 x g and 4°C and resuspended in Tris-EGTA buffer (25mM Tris pH 7.5, 1mM EGTA) and aliquoted to individual tubes for the dissociation reactions. To dissociate the arrestin-rhodopsin complex, the resuspended pellets were combined with salt to final concentrations ranging from 100mM to 2M NaCl. The dissociation reactions were left in the dark or the light for one hour, followed by centrifugation in the dark or light, respectively, for 15 minutes at 12879 x g and 4°C. The pellets were resuspended in 50uL of 1X sample buffer and the supernatants in 30uL of 2X SB, followed by SDS-PAGE and western analysis.

2.9. Additional Methods

Total protein concentrations were determined using the Amido Black protein assay. SDS-PAGE was performed as described by Laemmli (1970) on 11% SDS-polyacrylamide gels. To detect proteins through western blotting techniques, proteins were transferred to nitrocellulose, blocked using 3% BSA in PBST and exposed to primary polyclonal antibodies diluted 1:5000 in 1%BSA in PBST (previously produced by members of the Mitchell lab), followed by incubation with the horseradish peroxidase linked secondary antibody diluted 1:5000 in 1%BSA in PBST. These were then visualized using Amersham Enhanced Chemiluminescence (ECL) Western Blotting

Detection Reagents (GE Healthcare Life Sciences). Western blots and autoradiographs were scanned and densitometry was performed using ImageQuant® software.

2.10. Data Analysis

Data was analyzed using GraphPad Prism software. Saturation binding curves were formed from

2 replicates per experiment with 3 experiments per condition and were compared to the control curve (WTsArr with metarhodopsin) using a two-way ANOVA test with the Bonferroni post hoc test, when applicable. The dissociation curves, with a total of 3 experiments, were also compared using a two-way ANOVA test with the Bonferroni post hoc test for all conditions investigated

(metarhodopsin vs phosphorylated-metarhodopsin, arrestin versus phosphorylated arrestin, and dark versus light). Normalized densitometry from phosphorylation assays were statistically analyzed using one-way ANOVA with Tukey for multiple comparisons test.

3. Results

3.1. Purification of Native Proteins of the Squid Visual System

Using methods previously employed by our laboratory (Swardfager & Mitchell, 2007), with slight modifications, we were able to purify native proteins of the squid visual system including rhodopsin (Figure 14, 15), arrestin (Figure 16, 17) and SQRK (Appendix C). A Coomassie stained polyacrylamide gel displaying a representative purification scheme of squid rhodopsin is shown in Figure 14, where the last lane shows the final cholate-washed membranes after purification. In most squid rhodopsin preparations, there was a mixture of intact and cleaved rhodopsin (Figure 14, green and red arrows, respectively) with several other contaminating proteins remaining on the membranes. The total protein recovered at each stage of purification

49 can be seen in Table 3. The total protein of the final, washed membranes was approximately 3mg from 50 squid eyes. Several batches of squid rhodopsin-containing membranes were purified throughout these experiments, all following the procedure outlined in the methods section; for all the binding curves (Sections 3.3 and 3.5) the same preparation of membranes was used in all experiments. Before commencing the association, phosphorylation and dissociation assays, the final squid rhodopsin membranes were tested for the presence of arrestin and SQRK by resolving increasing quantities (1-10µL) of the membranes on a polyacrylamide gel, and immunoblotting using the primary arrestin and SQRK antibodies previously developed in our lab (Mayeenuddin

& Mitchell, 2003). As seen in Figure 15, the membranes used in subsequent assays were clean of both arrestin and SQRK.

Figure 14: SDS-polyacrylamide gel of each stage in the purification of squid rhodopsin. The membranes were first salt washed, followed by a sucrose floatation and finally cholate washed. A 20uL sample was taken at each stage of purification and analyzed by SDS-PAGE followed by Coomassie Blue staining. Intact rhodopsin is approximately 50kDa and represented by the green arrow and cleaved rhodopsin is represented by the red arrow.

Table 3: The total protein recovered throughout the purification of squid rhodopsin from 50 squid eyes as determined by the Amido Black protein assay.

Stage Total Protein (mg) Salt Wash 83.2 Sucrose Float 0 G protein pool 11.4 Cholate Washed Membranes 2.98

A B

Figure 15: Western blot probing for the presence of arrestin and SQRK after purifying rhodopsin. For each panel, 1, 2, 3, 5, and 10uL of the final purified rhodopsin and a positive control for arrestin and SQRK (panel A and B, respectively) were loaded on an 11% polyacrylamide gel and transferred to nitrocellulose and immunoblotted with the respective arrestin (panel A) and SQRK (panel B) antibodies. The red arrows indicate the molecular weight standards.

Native arrestin was purified from the 500 mM salt wash of dark-adapted squid eye membranes as previously described (Swardfager & Mitchell, 2007) using ion-exchange chromatography, followed by affinity chromatography. DEAE ion exchange chromatography allowed for the separation of arrestin from SQRK and PLC, two other important proteins of the squid visual system, as well as a chromophore which can be seen in the bottom of the first two lanes, the column load and pass, in Figure 16A. The majority of the arrestin protein eluted between approximately 150-250mM NaCl along with several other proteins (Figure 16). The fractions containing the majority of the arrestin (fractions 40-80) were pooled from 4 batches of arrestin, diluted to lower the salt concentration and loaded on a Heparin Sepharose column. The arrestin was eluted from this column with a gradient of IP6 with arrestin eluting between IP6 concentrations of approximately 2mM to 3.5mM (Figure 17). After affinity chromatography, the arrestin pool was much cleaner, as the 55kDa arrestin protein was visible simply by Coomassie staining (Figure 17A), with confirmation that it was the arrestin protein by immunoblotting with the squid arrestin primary antibody (Figure 17B). The fractions containing the majority of the arrestin (Figure 17) were pooled and concentrated using a Centriprep-30® column. The final native arrestin product while not homogeneous, contained significant amounts of arrestin.

A C 4 400 OD280 350 Gradient 3 300 Pooled

250 [NaCl] Arr

280 2 200

OD 150 1 100 50 0 0 0 25 50 75 100 125 150 Fractions

Figure 16: Purification of native squid arrestin over a DEAE ion exchange column using a linear salt gradient of 75mM to 350mM. In panel A and B, the load (L), pass (P) and fractions eluted from the column are shown after SDS-PAGE analysis with Coomassie Blue staining (panel A) and western blot analysis (panel B) with the squid arrestin primary antibody; where the arrestin is shown with a green arrow. The arrestin fractions which were pooled for further purification are shown by a red box. The 48.5kDa marker represents roughly where we would expect to see squid arrestin (55kDa in size). An elution profile of the eluted fractions is shown in panel C, with the OD280 shown in blue, the salt gradient in black and the arrestin fractions which were pooled in red.

C 4 8 7 OD280 3 6 [IP6] 5 [IP Pooled

280

2 4 6

] Arr

OD 3 1 2 1 0 0 0 10 20 30 40 50 60 70 80 90 100 Fractions

Figure 17: Purification of native squid arrestin over a Heparin-Sepharose column using a linear IP6 gradient of 0mM to 8mM. In this stage of purification, four DEAE arrestin pools were combined and purified over Heparin- Sepharose. In panel A and B, the load (L), pass (P), wash (W) and fractions eluted from the column are shown after SDS-PAGE analysis with Coomassie Blue staining (panel A) and western blot analysis (panel B) with the squid arrestin primary antibody. The arrestin is shown with a green arrow and the arrestin fractions which were pooled are shown by the red box. The 55kDa molecular weight standard is shown by the red arrow. An elution profile of the eluted fractions is shown in panel C, with the OD280 shown in blue, the IP6 gradient in black and the arrestin fractions which were pooled shown in red.

3.2. Purification of Recombinant, Strep-Tagged Squid Arrestin Proteins

Previous, unpublished data from our laboratory explored the solubility of recombinant arrestin proteins produced in different bacterial strains with a variety of protein tags and found that a majority of the recombinant arrestin was insoluble or had very low solubility. Due to the insolubility of the recombinant arrestin, we initially cloned WT recombinant squid arrestin into a pET15B vector, without any tags and purified the protein with production of a relatively pure protein (data not shown). However this was not at the desired level of purity and therefore a

Strep-tag (WSHPQFEK) and 4-GS flexible linker at the N-terminus of recombinant squid arrestin was added to the squid arrestin sequence to facilitate fast and effective purification of the protein (Figure 18). In addition to providing a WT squid arrestin protein that was more pure than we were able to obtain from native squid eyes; a tagged-recombinant system allowed us to generate mutants to investigate the potential phosphorylation sites and the polar core of squid arrestin. Four phosphorylation mutants were generated in which the potential sites of phosphorylation (S392, T396, S397) were mutated to alanines, as described in the methods section. Two polar core mutants were generated in which the asparagine at position 293 was mutated to an aspartic acid (N293D) or an arginine (N293R). These 6 mutants and the WT squid arrestin were each expressed in E. Coli and purified following the same purification scheme shown in Figure 18 (a representative figure showing the purification of WTsArr). The majority of the arrestin was eluted within the first two 1mL-elutions from the Strep-Tactin affinity resin

(Figure 18, lanes 9 and 10). Differences in purity between the native arrestin protein and all of the recombinant Strep-tagged arrestins was visible when these proteins were run on SDS-PAGE; where the recombinant tagged proteins were much cleaner than the native arrestin prepared from squid eyes (Figure 19). There were differences in both the quantity and purity of the various recombinant arrestin pools; where the 1A1 and 1A2 phosphorylation mutants and the N293D

55 polar core mutant had much more arrestin than the other mutants. On the other hand, there was much less N293R arrestin than the other arrestin constructs. Additionally, the WT squid arrestin,

3A and 2A phosphorylation mutants appeared to have greater purity than the remaining phosphorylation mutants and polar core mutants. The reason for these differences in purity and concentration of the various arrestin proteins was the limited capacity of the Strep-Tactin resin that was reduced with each use; in purifying these mutants, the column was by necessity of cost regenerated several times in order to purify the different batches of arrestins. Despite this limitation, the final preparations were all assessed as being composed of at least 90% arrestin, with the exception of the N293R mutant (Figure 19).

Figure 18: Purification of recombinant Strep-tagged WT squid arrestin by ammonium sulfate precipitation followed by affinity chromatography. A 20uL sample was taken from each stage of purification and loaded on an 11%-SDS- polyacrylamide gel which was stained with Coomassie Blue (panel A) or immunoblotted with a squid arrestin primary antibody (panel B). Arrestin is marked by the green arrow. 1- Lysate, 2- Ammonium sulfate precipitation-supernatant, 3-Arrestin pool after ammonium sulfate precipitation, prior to overnight dialysis, 4- Strep column load, 5- Strep column flow through, 6- First wash , 7- Second wash , 8-Third wash, 9-Elute 1, 10-Elute 2, 11-Elute 3, 12-Elute 4, 13- Elute 5. Elute 1 and 2 shown in lanes 9 and 10, respectively, were pooled (as shown by the red box) and used in subsequent experiments.

Polar Core Phosphorylation Mutants Mutants Figure 19: Purified squid arrestin proteins resolved on an 11% polyacrylamide gel and stained with Coomassie Blue. 10uL of each purified protein was loaded on the gel. Native squid arrestin was purified using DEAE and Heparin Sepharose columns, whereas the recombinant squid arrestins were purified using ammonium sulfate precipitation and Strep-Tactin column purification.

3.3. Rhodopsin-Arrestin Association Assays

As most of the rhodopsin preparations resulted in a mixture of intact and cleaved rhodopsin as a result of the presence of an endogenous enzyme that cleaves rhodopsin, we first investigated the ability of native arrestin to bind to intact and cleaved rhodopsin. Cleaved rhodopsin preparations were generated by a member of our collaborating laboratory, Dr. Ernst’s laboratory, in which a

V8-protease was used to cleave the C-terminus of squid rhodopsin. When native recombinant arrestin was bound to rhodopsin in the absence of salt in the binding buffer all of the arrestin bound to the membranes and this binding was the same whether the assay was performed in the

58 dark or the light. In the presence of 200mM NaCl, binding to the membranes in the dark was reduced and there was now discrimination between binding in the light and the dark. Under these conditions there was virtually no difference in arrestin binding to cleaved or intact rhodopsin and the dark-light discrimination of arrestin was present for both (Figure 20). We next optimized the binding conditions to give the greatest discrimination between dark and light binding by using salt concentrations (0-1M) in the association assay of arrestin to rhodopsin in the dark and light.

The interactions between arrestin and the membranes are ionic and therefore when no salt is added to the reaction, there was 100% binding in the dark and light (Figure 20 & 21). As the salt concentration increases, to 200mM NaCl, the dark background binding decreases significantly however; the light binding of arrestin to metarhodopsin also decreases with increased salt concentration (Figure 21). The optimal salt concentration was determined to be 500mM NaCl, as that gave the largest dark-light discrimination, with an approximate 2.5 fold difference.

Therefore, this was the salt concentration used in subsequent binding association assays.

100

50 Intact Rhodopsin Cleaved Rhodopsin

Percent Percent Bound(%)

0 D L D L D L D L 0mM NaCl 200mM NaCl

Figure 20: Association of native arrestin to intact and cleaved rhodopsin in the presence and absence of salt, in dark (D) and light (L) conditions. The association is represented by the percent bound ((pellet/(pellet+ supernatant))*100) against 0mM and 200mM salt. Intact rhodopsin and cleaved rhodopsin are represented by blue and red, respectively. Plain bars and patterned bars represent 0mM salt and 200mM salt, respectively. Cleavage of the C-terminal end of squid rhodopsin does not have an effect on arrestin binding.

100

80 Dark Light 60

Percent Percent Bound 20

0 0 200 300 500 700 1000 Salt Concentration (mM)

Figure 21: Association of native arrestin to rhodopsin and metarhodopsin across a range of salt concentrations (0-1M). Association to rhodopsin is represented by the dark blue bars and association to metarhodopsin is represented by the light blue bars, as determined by the percent bound ((pellet/(pellet + supernatant))*100) at each respective salt concentration. The results displayed are a combination of several individual association assays; 0mM- n of 2; 200mM- n of 2; 300mM- n of 3; 500mM- n of 4; 700mM- n of 2; 1M- n of 1.

The association of recombinant WT squid arrestin (WTsArr) to metarhodopsin was investigated using 1µM metarhodopsin and increasing concentration of WTsArr (0.025µM-0.25µM). The resulting saturation binding curve can be seen in Figure 22, fitting these data using a one site specific binding equation determined the dissociation constant (Kd) for this interaction to be

32.5nM and the Bmax to be approximately 86% (Table 4). This Kd suggests a high affinity interaction between arrestin and metarhodopsin.

Figure 22: Association of Strep-tagged WT squid arrestin to metarhodopsin in the presence of 500mM NaCl. In panel A is a representative western blot showing the pellets of WTsArr binding to metarhodopsin and the total arrestin added (µM) to the reaction. Panel B displays the saturation binding curve showing the percent bound ((pellets/total arrestin added)x100) of WTsArr (0.025- 0.25µM) to metarhodopsin (1µM). The Kd value for WTsArr is 32.5nM. n=3; with 2 replicates per experiment.

3.4. Effect of Mutations to the Polar Core on Arrestin-Rhodopsin Binding

Two polar core mutants were generated to investigate the single amino acid (asparagine 293), difference in the squid arrestin polar core as compared to other arrestins (mammalian,

Drosophila, Limulus) in which the 5 amino acids (3 aspartic acids and 2 arginines) making up the polar core are well conserved. The first polar core mutant, N293D, mutated the squid arrestin polar core to the well conserved aspartic acid that forms a salt bridge with arginine 175 in the

62 polar core of other arrestins; whereas the second polar core mutant, N293R, would create repulsion between the arginine residue at position 293 and the arginine residue at position 175 in the polar core. The saturation binding curves of the N293D and N293R polar core arrestin mutants binding to metarhodopsin are presented in Figures 23 and 24, respectively, with the

WTsArr binding curve as a control. Upon examining the binding curve of the N293D mutant compared to WTsArr, there is an apparent increase in binding affinity of the N293D mutant

(Figure 23B). Two-way ANOVA analysis revealed a significant difference between the binding curves of N293D mutant and WTsArr demonstrating that the N293D mutant bound with higher affinity (Kd 11.9nM) to metarhodopsin than WTsArr (Kd 32.5 nM).

The N293R polar core mutant showed a steeper curve that was also found to be significantly different from that of WTsArr when analyzed using two-way ANOVA. The Kd value of 13.7nM, which was similar to that found for the N293D polar core mutant, suggests a higher affinity interaction of both mutant proteins with metarhodopsin, than WTsArr. The Kd and Bmax values for the interaction of each arrestin with metarhodopsin are reported in Table 4.

Figure 23: Association of the polar core mutant N293D to metarhodopsin, as compared to WTsArr in the presence of 500mM NaCl. In panel A is a representative western blot showing the pellets of N293D binding to metarhodopsin and the total arrestin added (µM) to the reaction. Panel B displays the saturation binding curve showing the percent bound ((pellets/total arrestin added)x100) of the polar core arrestin mutant N293D and WTsArr (0.025-0.25µM) to metarhodopsin (1µM). WTsArr and N293D are represented by blue and red, respectively. The Kd values for WTsArr and N293D are 32.5nM and 11.9nM, respectively. n=3; with 2 replicates per experiment. Two-way ANOVA with Bonferroni post-hoc test was performed demonstrating that the two curves were significantly different p=0.0001(***). p<0.05(*) for the comparison of the individual point on the curves.

Figure 24: Association of the polar core mutant N293R to metarhodopsin, as compared to WTsArr in the presence of 500mM NaCl. In panel A is a representative western blot showing the pellets of N293R binding to metarhodopsin and the total arrestin added (µM) to the reaction. Panel B displays the saturation binding curve showing the percent bound ((pellets/total arrestin added)x100) of the polar core arrestin mutant N293R and WTsArr (0.025-0.25µM) to metarhodopsin (1µM). WTsArr and N293R are represented by blue and red, respectively. The Kd values for WTsArr and N293R are 32.5nM and 13.7nM, respectively. n=3; with 2 replicates per experiment. Two-way ANOVA with Bonferroni post-hoc tests were performed demonstrating that the two curves were significantly different p=0.0307(*).

Table 4: The Kd and Bmax values for the interactions of WTsArr and the polar core mutants (N293D & N293R) with metarhodopsin. The standard deviation is reported to the right of each value based on the 3 association experiments, with 2 replicates per experiment. WTsArr N293D N293R Kd (nM) 32.5 0.006447 11.9 0.008232 13.7 0.005452 Bmax (%) 86 5 83 6 78 6 65

3.5. Determination of Phosphorylation Sites of Squid Arrestin

Prior to determining the potential sites of phosphorylation on squid arrestin, we examined whether the alanine mutations made to the arrestin constructs had an effect on the ability of arrestin to bind metarhodopsin, as a test that the proteins were properly folded. All of the phosphorylation mutants discriminated between dark and light-activated rhodopsin, to virtually the same degree as native squid arrestin and WT squid arrestin (Figure 25). These results also revealed that the addition of a Strep-tag and the 4 GS linker to the arrestin did not affect the ability of arrestin to bind to metarhodopsin, as all the recombinant, Strep-tagged arrestins bind in the same manner as the native arrestin that did not have a tag and linker (Figure 25).

We then tested the ability of the Strep-tagged WTsArr as compared to the native squid arrestin to be phosphorylated by recombinant squid rhodopsin kinase (rSQRK) in the presence and absence of metarhodopsin. First, it can be seen that rhodopsin was phosphorylated by rSQRK in a light- dependent manner (Figure 26B, first two lanes, green arrows). It can also be seen that rSQRK was autophosphorylated independent of light and rhodopsin (Figure 26B, all lanes, pink arrows).

Native arrestin was phosphorylated by rSQRK in both the dark and the light in the presence of metarhodopsin, as well as in the absence of any membranes when added to rSQRK alone (Figure

26B, lanes 3-5, blue arrow). WTsArr was also phosphorylated by rSQRK in the presence of rhodopsin and metarhodopsin and in the absence of membranes (Figure 26B, lanes 5-7, blue arrow). Both native and WTsArr were maximally phosphorylated in the absence of membranes and least phosphorylated in the presence of phosphorylated-metarhodopsin. These experiments demonstrated that the Strep-tag on the N-terminus of recombinant arrestin did not have an effect on the ability of squid arrestin to be phosphorylated by rSQRK.

Percent Bound (%) Percent Bound

0 D L D L D L D L D L D L Native WT S392A S392A S392A S397A T396A S397A S397A

Figure 25: Comparison of the association of native, WTsArr and the phosphorylation mutants to rhodopsin and metarhodopsin at 500mM NaCl. Association of arrestin to rhodopsin are represented by the bars labelled D (dark); association of arrestin to metarhodopsin are represented by the bars labelled L (light). The results are displayed as percent bound ((pellet/(pellet + supernatant))*100) from two experiments, with 1 replicate per experiment.

Figure 26: Phosphorylation of native arrestin and WTsArr in the presence and absence of rhodopsin by rSQRK as detected by autoradiography. Panel A displays the Coomassie Blue stained polyacrylamide gel, and panel B is the resulting autoradiograph. In panel B, the first two lanes display rhodopsin phosphorylation by rSQRK in the dark and light in the absence of arrestin. The following two lanes display rhodopsin and native arrestin phosphorylation by rSQRK in the dark and light, followed by the phosphorylation of arrestin in the absence of any membranes. The final three lanes show WTsArr and rhodopsin phosphorylation in the dark and light, and WTsArr phosphorylation in the absence of membranes. The red arrows represent the molecular weight markers. The pink arrow represents rSQRK autophosphorylation, the blue arrow represents arrestin phosphorylation by rSQRK, and the green arrow represents metarhodopsin phosphorylation by rSQRK.

To determine the phosphorylation sites of arrestin, the mutated arrestins were combined with rSQRK in the absence of membranes, in the phosphorylation assay described in the methods section. As shown in Figure 27, the triple alanine mutation in which all three potential phosphorylation sites (S392, T396, S397) were mutated was not phosphorylated. The double alanine mutation in which the two serine residues were mutated to alanines, had a faint band present at 55kDa, but was significantly less phosphorylated than the WTsArr as determined by one-way ANOVA test (Figure 27B). The two individual serine mutations were equally phosphorylated, but both were significantly less phosphorylated than the WTsArr, and greater than the double and triple alanine mutations when corrected for the amount of each arrestin protein in the assays. These results demonstrate that the primary sites for arrestin phosphorylation by SQRK were on Serine 392 and Serine 397 with minimal phosphorylation to the threonine residue at position 396.

Figure 27: Determination of the phosphorylation sites on arrestin by creating 4 arrestin mutants in which the potential phosphorylation sites are mutated to alanines. Panel A displays the Coomassie Blue stained polyacrylamide gel and the resulting autoradiograph, with SQRK represented by a pink arrow and arrestin represented by a blue arrow. Panel B is the resulting graph of two separate phosphorylation experiments, where the densitometry units determined by ImageQuant® are normalized to the Coomassie Blue stained protein band, and then normalized to native arrestin phosphorylation. The two individual alanine mutants at Ser392 and Ser 397 were equally phosphorylated, whereas the double and triple alanine mutant had little to no phosphorylation. One-way ANOVA with the Tukey post-hoc test was performed in GraphPad Prism®. p<0.01(**), p<0.001(***), n=2.

3.6. Role of Phosphorylation of Arrestin and Rhodopsin on Association

In the invertebrate visual system, metarhodopsin phosphorylation is not required for arrestin to bind unlike the mammalian system in which high-affinity arrestin binding to the receptor only occurs when metarhodopsin is also phosphorylated. The role that squid metarhodopsin and arrestin phosphorylation plays in the inactivation of the squid visual system has not been previously determined and was one of the major foci of this thesis. The WTsArr-metarhodopsin saturation binding curve presented in section 3.3 (Figure 22) was used to compare the effect of both metarhodopsin and arrestin phosphorylation on the association of these two proteins. The effect of metarhodopsin phosphorylation on WTsArr binding was first investigated and as seen in Figure 28B, squid arrestin bound to phosphorylated-metarhodopsin with similar affinity to that of WTsArr binding to unphosphorylated metarhodopsin (Table 5). Two-way ANOVA test was also performed to compare the two WTsArr binding curves and a significant difference was determined between these two curves (Figure 28B).

Having determined the phosphorylation sites of squid arrestin, we next addressed the role that the phosphorylation plays. When arrestin was phosphorylated, there was a significant decrease between the saturation binding curves of phosphorylated arrestin and WTsArr with metarhodopsin as determined by a two-way ANOVA test; the Bonferroni post-hoc test revealed a significant difference between all arrestin concentrations with the exception of 0.15µM (Figure

29). The same trend was seen upon comparing the binding curve for WTsArr and metarhodopsin and the curve for phosphorylated arrestin and phosphorylated-metarhodopsin, with a significant difference between the two curves, and all arrestin concentrations but 0.15µM were significantly different (Figure 30). The two phosphorylated-arrestin binding curves (to metarhodopsin and phosphorylated-metarhodopsin) also had decreased affinity, with identical Kd values of 104nM, as compared to the affinity of WTsArr for metarhodopsin (36.1nM) (Table 6). The Kd and Bmax 71 values for each interaction are reported in Table 6. Importantly, these assays only used concentrations of arrestin up to 0.2µM as there was a volume limitation in the assay that precluded inclusion of the 0.25µM concentration used in the previous assays. There was a significant difference between the binding curves of WTsArr with metarhodopsin compared to phosphorylated-metarhodopsin which suggests that squid arrestin can discriminate the phosphorylation state of metarhodopsin. Squid arrestin phosphorylation on the other hand, decreased the affinity of arrestin for both metarhodopsin and phosphorylated-metarhodopsin, with significant differences between the control (WTsArr & Rh*) binding curve and both phosphorylated arrestin binding curves at almost all arrestin concentrations.

B 100 Arr + Rh* 80 Arr + P-Rh*

Percent Percent Bound(%)

0 0.0 0.1 0.2 0.3 Arrestin (M)

Figure 28: Association of WTsArr to metarhodopsin (Rh*) and phosphorylated metarhodopsin (P-Rh*) at 500mM NaCl. In panel A is a representative western blot showing the pellets of WT squid arrestin binding to phosphorylated-metarhodopsin and the total arrestin added (µM) to the reaction. In panel B is the saturation binding curve showing the percent bound ((pellets/total arrestin added)x100) of the WTsArr (0.025-0.25µM) to metarhodopsin and phosphorylated-metarhodopsin (1µM). WTsArr with Rh* and WTsArr with P-Rh*are represented by blue and red, respectively. The Kd values for WTsArr + Rh* and WTsArr + P-Rh* are 32.5nM and 20.7nM, respectively. n=3; with 2 replicates per experiment. Two-way ANOVA with Bonferroni post-hoc tests were performed demonstrating that the two curves were significantly different, p=0.0418 (*).

Table 5: The Kd and Bmax values for the interaction of WTsArr with metarhodopsin (Rh*) and phosphorylated-metarhodopsin (P-Rh*). The standard deviation is reported to the right of each value based on the 3 association experiments, with 2 replicates per experiment. WTsArr & Rh* WTsArr & P-Rh* Kd (nM) 32.5 0.006447 20.7 0.006117 Bmax (%) 86 5 85 9

Figure 29: Association of phosphorylated arrestin (P-Arr) to metarhodopsin (Rh*) as compared to WTsArr, in 500mM NaCl. In panel A is a representative western blot showing the pellets of phosphorylated arrestin binding to metarhodopsin and the total arrestin added (µM) to the reaction. In panel B is the saturation binding curve showing the percent bound ((pellets/total arrestin added)x100) of the WTsArr and phosphorylated squid arrestin (0.025-0.2µM) to metarhodopsin (1µM). The arrestin concentration range stops at 0.2µM due to limitations in the reaction volume size. WTsArr and phosphorylated arrestin are represented by blue and red, respectively. The Kd values for WTsArr and P-Arr with Rh* are 36.1nM and 104nM, respectively. n=3; with 2 replicates per experiment. Two-way ANOVA with Bonferroni post-hoc tests were performed demonstrating that the two curves were significantly different, p<0.0001(***). p<0.001(***); p<0.01(**); p<0.05(*) for individual points on the curves.

Figure 30: Association of phosphorylated arrestin (P-Arr) to phosphorylated- metarhodopsin (P-Rh*), as compared to WTsArr with metarhodopsin (Rh*), in 500mM NaCl. In panel A is a representative western blot showing the pellets of phosphorylated arrestin binding to phosphorylated-metarhodopsin and the total arrestin added (µM) to the reaction. In panel B is the saturation binding curve showing the percent bound ((pellets/total arrestin added)x100) of the WTsArr (0.025-0.2µM) and metarhodopsin (1µM) and phosphorylated squid arrestin (0.025- 0.2µM) with phosphorylated-metarhodopsin (1µM). The arrestin concentration range stops at 0.2µM due to limitations in the reaction volume size. WTsArr + Rh* and P-Arr + P-Rh*are represented by blue and red, respectively. The Kd values for WTsArr + Rh* and P-Arr + P-Rh* are 36.1nM and 104nM, respectively. n=3; with 2 replicates per experiment. Two-way ANOVA with Bonferroni post-hoc tests were performed demonstrating that the two curves were significantly different p<0.0001(***). p<0.001(***); p<0.01(**); p<0.05(*) for individual points on the curves.

Table 6: The Kd and Bmax values for WTsArr and phosphorylated arrestin (P-Arr) with metarhodopsin (Rh*) and phosphorylated metarhodopsin (P-Rh*). The standard deviation is reported to the right of each value based on the 3 association experiments, with 2 replicates per experiment. WTsArr & Rh* P-Arr & Rh* P-Arr & P-Rh* Kd (nM) 36.1 0.006519 104 0.02208 104 0.086178 Bmax (%) 89 7 95 8 93 10

3.7. Role of Phosphorylation of Arrestin and Rhodopsin on Dissociation

In addition to investigation of the role of arrestin phosphorylation and rhodopsin phosphorylation on binding affinity, we also wanted to investigate the dissociation of the two proteins. Similar to the association assays, we looked at the effect of rhodopsin phosphorylation and arrestin phosphorylation on the dissociation of the complex using increasing salt concentrations, up to

2M. These reactions were performed in either the dark or the light where the dissociation reaction took place over 1 hour in the presence of increasing salt concentrations (Figures 31-34).

As expected, as the salt concentration increased in the dissociation buffer, there was more arrestin dissociation under all light conditions. At low salt concentrations, up to 300mM in the dark, arrestin and phosphorylated arrestin both dissociated from phosphorylated-rhodopsin more readily than from rhodopsin (Figures 31 and 33). This was also true for arrestin when the dissociation was performed in the light (Figure 32). However, when the dissociation assay was performed in the light, phosphorylated arrestin no longer discriminated between rhodopsin and phosphorylated rhodopsin and the two dissociation curves were superimposable (Figure 34). The

IC50 values for each dissociation curve can be seen in Table 7. In the dark and light, arrestin and phosphorylated arrestin in complex with phosphorylated-metarhodopsin had lower IC50 values than when in complex with unphosphorylated metarhodopsin, suggesting that the arrestin and phosphorylated-metarhodopsin complex was less stable than that formed with unphosphorylated rhodopsin. Additional analyses using the two-way ANOVA test with the Bonferroni post-hoc 76 test (when applicable) to compare the various conditions of the dissociation reactions, revealed a significant difference between the dissociation curves of phosphorylated-arrestin with phosphorylated-metarhodopsin in the dark versus the light (Table 8). The Bonferroni post-hoc test revealed a significant difference in the 121mM salt concentration between the curves for the dark and the light. All other combinations of comparing the dissociation curves for dark versus light and arrestin versus phosphorylated arrestin had no significant difference.

Figure 31: Dark dissociation of arrestin from metarhodopsin (Rh*) and phosphorylated- metarhodopsin (P-Rh*). In panel A is a representative western blot showing the pellets (P) and supernatants (S) after dissociation in the dark for 1 hour in increasing NaCl (mM concentration). In panel B is the dissociation curve showing the percent bound ((pellet/(pellet + supernatant))*100) versus increasing salt concentration up to 2M. The IC50 values for Rh* and P-Rh* are 299mM and 251mM NaCl, respectively. Rh* and P-Rh* are represented by labels in blue and red, respectively, in both panels A and B. Two-way ANOVA with Bonferroni post-hoc tests were performed demonstrating that the two curves were significantly different, p=0.01136(*). p<0.01(**) for individual points on the curves.

Figure 32: Light dissociation of arrestin from metarhodopsin (Rh*) and phosphorylated- metarhodopsin (P-Rh*). In panel A is a representative western blot showing the pellets (P) and supernatants (S) after dissociation in the light for 1 hour in increasing NaCl (mM concentration). In panel B is the dissociation curve showing the percent bound ((pellet/(pellet + supernatant))*100) versus increasing salt concentration up to 2M. The IC50 values for Rh*and P-Rh*are 276mM and 266mM NaCl, respectively. Rh* and P-Rh* are represented by labels in blue and red, respectively, in both panels A and B. Two-way ANOVA with Bonferroni post-hoc tests were performed. p<0.01(**) for individual points on the curves.

Figure 33: Dark dissociation of phosphorylated arrestin (P-Arr) from metarhodopsin (Rh*) and phosphorylated-metarhodopsin (P-Rh*). In panel A is a representative western blot showing the pellets (P) and supernatants (S) after dissociation in the dark for 1 hour in increasing NaCl (mM concentration). In panel B is the dissociation curve showing the percent bound ((pellet/(pellet + supernatant))*100) versus increasing salt concentration up to 2M. The IC50 values for Rh* and P-Rh* are 383mM and 310mM NaCl, respectively. Rh* and P-Rh* are represented by labels in blue and red, respectively, in both panels A and B. Two-way ANOVA with Bonferroni post-hoc tests were performed demonstrating that the two curves were significantly different, p=0.0277(*). p<0.001(***) for individual points on the curves. p<0.0001 (***) for the interaction; salt concentration and phosphorylation state of Rh*.

150 Rh* B P-Rh* 100

Percent Percent Bound(%)

0 0 500 1000 1500 2000 Salt Concentration (mM)

Figure 34: Light dissociation of phosphorylated arrestin (P-Arr) from metarhodopsin (Rh*) and phosphorylated-metarhodopsin (P-Rh*). In panel A is a representative western blot showing the pellets (P) and supernatants (S) after dissociation in the light for 1 hour in increasing NaCl (mM concentration). In panel B is the dissociation curve showing the percent bound ((pellet/(pellet + supernatant))*100) versus increasing salt concentration up to 2M. The IC50 values for Rh* and P-Rh* are 253mM and 241mM NaCl, respectively. Rh* and P-Rh* are represented by labels in blue and red, respectively, in both panels A and B. Two-way ANOVA with Bonferroni post-hoc test showed no significant differences between the two curves or any individual points.

Table 7: The IC50 values (mM salt) of the dissociation experiments investigating the effect of arrestin and rhodopsin phosphorylation. With an N of 3 per condition, the standard deviation is reported to the right of the IC50 value. Dark Light IC50 SD IC50 SD WT Arrestin Rh* 299mM 67mM 276mM 106mM P-Rh* 251mM 61mM 266mM 53mM

Phosphorylated Rh* 383mM 110mM 253mM 58mM Arrestin P-Rh* 310mM 37mM 241mM 50mM

Table 8: Results of the two-way ANOVA test with Bonferroni post-hoc test comparing the various conditions in which the dissociation experiments were performed. Two-way ANOVA analyses compared the dissociation curves of phosphorylated arrestin (P-Arr) and unphosphorylated arrestin from metarhodopsin (Rh*) and phosphorylated-metarhodopsin (P- Rh*), in the dark and light. N of 3 per experimental condition. N.S. = not significant. Arrestin, Dark Arrestin, Light P-Arr, Dark P-Arr, Light

Rh* vs P-Rh* p=0.0136 (*) N.S. P=0.0277 (*) N.S.

Rh*, Dark Rh*, Light P-Rh*, Dark P-Rh*, Light

Arrestin vs P- N.S. N.S. N.S. N.S. Arr

Arr + Rh* Arr + P-Rh* P-Arr + Rh* P-Arr + P-Rh*

Dark vs Light N.S. N.S. N.S. P<0.0001 (***); 121mM point - p<0.0001 (***)

4. Discussion

4.1. Summary of Results

Our lab has previously cloned and purified several proteins of the squid visual system, including

SQRK and arrestin (Mayeenuddin & Mitchell, 2001, 2003). The function of squid arrestin has also been previously characterized in our lab; where it was determined that squid arrestin binds in a light-dependent manner to metarhodopsin, in the absence of receptor phosphorylation, inhibiting the interaction of the Gqα subunit with the receptor therefore arresting downstream signalling (Swardfager & Mitchell, 2007). It has also been shown that both metarhodopsin and arrestin are substrates for SQRK; where metarhodopsin is phosphorylated in a light-dependent manner, and arrestin is phosphorylated in a light- and membrane- dependent manner

(Mayeenuddin & Mitchell, 2003; Swardfager & Mitchell, 2007). The function of both rhodopsin and arrestin phosphorylation had yet to be elucidated in the squid visual system; as rhodopsin phosphorylation is not required for arrestin to bind. We also had yet to fully determine the sites of phosphorylation on squid arrestin.

In this study, we have used both native and recombinant arrestins to determine the sites of phosphorylation on arrestin, and the effect that both arrestin and metarhodopsin phosphorylation have on the association and dissociation of these two proteins. We were able to purify recombinant WTsArr and 6 arrestin mutants by adding an N-terminal Strep-tag onto arrestin and expressing these proteins in bacteria and then purifying the proteins using affinity chromatography. By obtaining, for the first time clean preparations of purified WTsArr, we were able to assess the affinity of interaction of WTsArr to metarhodopsin, and investigate mutations to the polar core of squid arrestin, which increased affinity of arrestin to metarhodopsin. By creating 4 arrestin phosphorylation mutants, we determined that there were two major sites of phosphorylation in the C-terminus of squid arrestin—Serine 392 and Serine 397. Upon 83 investigating the role of metarhodopsin phosphorylation on arrestin association, there was a small increase in affinity in binding of the two proteins. When squid arrestin was phosphorylated however, there was a large decrease in affinity for both metarhodopsin and phosphorylated- metarhodopsin, as compared to unphosphorylated WTsArr. Arrestin phosphorylation had no significant effect on dissociation of the complex, but phosphorylation of metarhodopsin did increase the dissociation of the complex in the dark.

4.2. Purification of Recombinant Arrestin

Previous unpublished work in our laboratory investigated the production of recombinant arrestin in E.Coli using different tags and bacterial strains, as well as different growing and induction conditions. In all the trials that were performed, there was consistently an issue of the solubility of recombinant arrestin in which the majority of the protein was insoluble. In those studies, in order to obtain sufficient soluble protein, recombinant arrestin was grown in E.Coli cells on a large scale. In producing recombinant arrestins, this large scale production of recombinant arrestin still did not provide sufficient protein yields for further purification of the arrestin and measurement of affinities of arrestin with rhodopsin were not feasible.

In this study, we also wanted to use a recombinant E.Coli expression system, as it is a fast, economical way to produce large quantities of protein that can then be used in biochemical assays. Previously published reports of expression and purification of the mammalian arrestins also used the E.Coli expression system, and were scaled up to obtain the necessary quantities for crystallography (Gurevich & Benovic, 1992; Han et al., 2001; Zhan et al., 2011). Thus it seemed possible to obtain good quality arrestin preparations from this route and therefore we explored if the insolubility of sArr previously generated by our lab was the result of the type of tag attached to the protein. We first expressed untagged sArr in E.Coli using a pET15b vector. After

84 production and purification of the untagged recombinant arrestin using ammonium sulfate precipitation, followed by DEAE ion-exchange chromatography and Heparin Sepharose affinity chromatography, the arrestin was purified to a similar level of purity as that obtained using native squid arrestin extracted from squid eyes (data not shown). As this procedure was neither more efficient nor effective in producing clean squid arrestin we continued to explore other options. The addition of an N-terminal Strep-tag was proposed by Dr. Abhishek Bandyopadhyay

(Dr. Oliver Ernst’s laboratory) and was used in this study to insert a Strep-tag on the N-terminus of full-length recombinant WT squid arrestin. The addition of the Strep-tag not only decreased the amount of time required for purifying proteins, but also increased the purity of the arrestin preparations to greater than 90 percent. This modification allowed us to purify sufficient quantities of WTsArr and modified forms of this protein to perform multiple binding, phosphorylation and dissociation assays from 2L preparations of transfected bacteria.

Most importantly, the addition of the Strep-tag did not have an effect on the ability of WTsArr to discriminate between dark rhodopsin and light-activated rhodopsin, as the dark-light discrimination of WTsArr was virtually identical to that seen with purified native squid arrestin.

The Strep-tagged WTsArr was also phosphorylated by SQRK to a similar level as found with the native arrestin. Both of these preliminary investigations, allowed us to investigate three key issues; first, the affinity of interaction between WTsArr and metarhodopsin; second, the role of the polar core in squid arrestin binding to metarhodopsin and thirdly, to determine the specific sites of phosphorylation on arrestin and their effect on rhodopsin-arrestin binding and dissociation.

4.3. Arrestin-Rhodopsin Association Assays

Arrestin and rhodopsin association has been studied in many systems from invertebrates to mammals. These studies have employed various methods including mutational studies, pull- down assays, fluorescent labelling, spin-labelling, HDX, and DEER (Dinculescu et al., 2002;

Gurevich & Benovic, 1993, 1995, 1992; Gurevich et al., 1995; Kim et al., 2012; Ohguro et al.,

1994; Ostermaier et al., 2014; Shukla et al., 2014; Skegro et al., 2007; Smith et al., 2004;

Swardfager & Mitchell, 2007; Vishnivetskiy et al., 2004). In this study, we used pull-down assays to investigate the interactions between arrestin and rhodopsin, first optimizing the conditions in which these two proteins interact followed by saturation binding curves to determine the affinity of arrestin for rhodopsin. Previous studies in our laboratory had shown that squid arrestin binds rhodopsin in a light-dependent manner, and dark-light discrimination could be improved upon the addition of IP6 which suggests that the dark background binding is a result of arrestin interacting with membrane lipids (Swardfager & Mitchell, 2007). In this study, we investigated the effect of increasing salt concentration on the association of native squid arrestin to rhodopsin, in the dark and the light. As expected, in the absence of salt there was no discrimination between light and dark binding of arrestin, as there is nothing to compete with arrestin in its association with membrane lipids. As the salt concentration increases, there is a decrease in arrestin binding to the membranes in the dark, while arrestin continues to bind to metarhodopsin. As the salt concentration continues to increase, the binding to metarhodopsin also begins to decrease, while the dark, background binding remains low. From these studies, it was determined that the optimal salt concentration to use in subsequent assays was 500mM

NaCl, as there was a 2.5 fold difference between the dark background binding and the light binding.

We also investigated the ability of native squid arrestin to bind to intact and cleaved rhodopsin, as a majority of the preparations of rhodopsin resulted in the partial cleavage of the C-terminus of rhodopsin. As noted earlier, there is an endogenous calcium-activated enzyme in the squid eye that cleaves several proteins including rhodopsin and the Gqα protein (Bamsey et al., 2000). We showed that the dark-light discrimination of arrestin binding to intact and cleaved metarhodopsin was the same. The removal of the proline-rich C-terminal tail of rhodopsin has been shown to have no effect on activating the G protein (Ashida, Matsumoto, Ebrey, & Tsuda, 2004), but is thought to facilitate receptor trafficking and morphogenesis (Williamson, 1994). The proline-rich

C-terminal tail contributes to less ordered rhodopsin clusters in native members, limiting the formation of highly ordered crystalline arrays (Venien-Bryan et al., 1995). The removal of the C- terminal tail in squid (Todarodes pacificus) rhodopsin with a V8 protease cleaved a peptide bond at Glu373, which is also present, and the likely site of cleavage for Loligo pealei rhodopsin

(Glu372) as it is downstream of the potential phosphorylation sites of squid rhodopsin, serine

360 and threonine 364. The two potential sites of phosphorylation have yet to be confirmed, but are located in the C-terminus after the seventh transmembrane domain but before the proline-rich tail. We also showed that cleaved rhodopsin can be still be phosphorylated, therefore the C- terminal cleavage does not remove both of these sites. Squid rhodopsin was also cleaved, in order to obtain the crystal structures of this protein (Davies et al., 2001; Murakami & Kouyama,

2008). Since the arrestin and the SQRK still interact with the cleaved form of metarhodopsin as they do with the intact form, this could be a potential route for crystallographers to obtain co- crystal structures of the arrestin and metarhodopsin or of the kinase-metarhodopsin. Once the co- crystal structure of the activated-receptor and arrestin is obtained, the models that were discussed in detail in the introduction, will be resolved. Here, we continued to investigate the interactions of these two proteins in more detail through biochemical assays.

As demonstrated in the results section of this thesis, we compared native squid arrestin and recombinant WTsArr dark-light discrimination in a pull-down assay in the presence of 500mM

NaCl, showing no difference between the two arrestins, thus indicating that the addition of a

Strep-tag and 4-GS linker to the recombinant WT squid arrestin amino terminus did not have an effect on the ability of arrestin to bind to rhodopsin or metarhodopsin. Using the optimized binding conditions, we determined the affinity of WTsArr binding to metarhodopsin to be

32.5nM, suggesting a high affinity interaction between these two proteins. Comparing the affinity of squid arrestin to those for mammalian arrestins, keeping in mind that the experiments were performed by different methods, the affinity of mammalian arrestin-1 for phosphorylated- metarhodopsin was 4-5nM at room temperature (Bayburt et al., 2011), whereas WTsArr had an affinity of 21nM for phosphorylated-metarhodopsin in our experiments, approximately 4 times lower than that of arrestin-1. Binding of arrestin-1 shows a strong temperature dependence as a result of the high activation energy associated with this interaction, with a binding affinity at 4-

14°C of 20-50nM, similar to that of squid arrestin (Bayburt et al., 2011; Pulvermuller et al.,

1997; Schleicher et al., 1989). While we did not test the binding affinity of squid arrestin at temperatures lower than room temperature (approximately 20°C), squid arrestin may not show decreased affinity at lower temperatures given that squid live in the ocean with their ambient environmental temperature of around 12°C and therefore their metabolic processes must function efficiently at this low temperature. It will be interesting to test this experimentally in future work.

A key difference between squid arrestin and other invertebrate and mammalian arrestins is the single amino acid difference in the polar core at the centre of an otherwise well conserved arrestin structure. Squid arrestin has an asparagine (N293), a neutral amino acid, in the place of the negatively charged, aspartic acid (D296, for mammalian arrestin-1) in other arrestins. This amino acid difference may be one factor which allows squid arrestin to bind unphosphorylated-

88 metarhodopsin with high affinity, unlike mammalian arrestin-1 (Gurevich & Benovic, 1993). In this study, we generated two mutations at the 293 position of recombinant WTsArr. One mutation, asparagine to aspartic acid (N293D) introduced a negative charge into the polar core and was anticipated to change the binding to rhodopsin such that it would be phosphorylation- dependent, similar to the mammalian arrestin-1. This was not the case as the N293D sArr mutant bound to unphosphorylated squid metarhodopsin with higher affinity than the WTsArr (Kd

11.9nM). Similarly, introducing a positive charge into position 293 (N293R) was anticipated to disrupt the polar core and decrease sArr binding to metarhodopsin. This N293R arrestin mutant also bound with slightly higher affinity than the WTsArr (Kd 13.7nM). These Kd values suggest that both of these mutants have slightly higher affinities for metarhodopsin than WTsArr and two-way ANOVA revealed a significant difference between the two binding curves of N293D and N293R compared to WTsArr.

Taken together, these results show that mutations to the polar core do not significantly decrease the affinity of squid arrestin for unphosphorylated squid metarhodopsin and suggest that the basal structure of squid arrestin may be different from that of other arrestins. The polar core has been studied extensively in mammalian arrestin-1 to investigate the high level of phosphorylation-dependence in binding of this particular arrestin (Gurevich & Benovic, 1993,

1997; Vishnivetskiy et al., 1999). Vishnivetskiy and colleagues (1999) investigated the effect of mutating the three aspartic acids of the polar core, to an asparagine, alanine and arginine. They determined that the single amino acid changes for each of the three aspartic acids had no effect on association to phosphorylated-metarhodopsin. Charge reversal mutations to two of the three aspartic acids (D296R; D303R) resulted in increased binding to phosphorylated inactive rhodopsin and to metarhodopsin; this was also true for the mutation to alanine, but to a lesser degree. The mutation to asparagine, the residue that is present in squid arrestin, at the 296

89 position did not change the pattern of arrestin binding to the different phosphorylation states of bovine rhodopsin, as compared to WT arrestin-1. Comparing these results with the more limited study of the squid arrestin polar core suggests there may be another region in squid arrestin that regulates how squid arrestin can bind in the absence of receptor phosphorylation, as the remaining polar core residues are conserved between the mammalian arrestins and the squid arrestin. This is further supported by other invertebrate arrestins, which have the 5 conserved polar residues and also bind in the absence of receptor phosphorylation (Kiselev et al., 2000;

Vinos et al., 1997). Future studies that could be performed to further investigate the squid polar core mutants would be to investigate the binding to different phosphorylation states of rhodopsin; phosphorylated-metarhodopsin, and rhodopsin (dark and unphosphorylated) similar to the study performed by Vishnivetskiy and colleagues (1999). These experiments may reveal differences between the polar core mutants and WTsArr which may further our understanding of the role of the polar core, if any, in squid arrestin.

The two arginine residues of the polar core that are well conserved through mammalian and invertebrate arrestins have also been mutated, and it was found that removal of the positive charge at either site (R175, R382 for mammalian arrestin-1) affected the binding profile of arrestin-1 (Gurevich & Benovic, 1997; Vishnivetskiy et al., 1999). Arg 175 of arrestin-1 has been mutated to every amino acid, and the charge reversal mutation at Arg175, R175E, was found to be the least phosphorylation dependent form of arrestin-1 while the remaining mutations all had an activating effect, to a lesser degree than the R175E (Gurevich & Benovic,

1997; Gurevich et al., 2011). Studies on mammalian arrestin-1 have also determined that mutation of either or both of the lysine residues in the N-terminus (K14 or K15) to alanines results in a large decrease of arrestin-1 binding to phosphorylated-metarhodopsin (Gurevich &

Gurevich, 2004; Vishnivetskiy et al., 2000). This is also true for the non-visual arrestins binding

90 to phosphorylated-metarhodopsin (Gimenez et al., 2012). These two lysine residues are well conserved from C. Elegans to mammals, including the squid arrestin of Loligo pealei (Gurevich

& Gurevich, 2006). It is interesting that the key residues in the mammalian arrestins that are involved in binding with high affinity to the phosphorylated-activated-receptor, are also conserved residues among the invertebrate arrestins, which can bind with high affinity to unphosphorylated-activated receptors. This suggests that there must be other key differences in the structure of invertebrate arrestins that allows these proteins to bind to receptors and stop signalling in the absence of receptor-phosphorylation. It is possible that squid arrestin is pre- activated, explaining why our mutations to the polar core result in arrestin that is still capable of binding with high affinity to metarhodopsin, in the absence of phosphorylation. Further experimentation that could investigate whether squid arrestin is pre-activated would be to perform hydrogen deuterium exchange (HDX) analysis, similar to the study by Shukla and colleagues (2014), to compare the structures of WT squid arrestin in the basal state, and in the presence of metarhodopsin, as well as compare the full-length sArr to the structure of the cleaved squid arrestin (P49, that has been generated by Dr. Abhishek Bandyopadhyay, of the Ernst lab) alone and in the presence of metarhodopsin. The cleaved squid arrestin, like the splice variant of mammalian arrestin-1 (p-44), may be a pre-activated form of squid arrestin and if there are no structural differences between WTsArr and P-49 sArr when interacting with metarhodopsin, this would indicate that the WTsArr is pre-activated, as our experiments here suggest.

4.4. Determination of the Phosphorylation Sites of Arrestin

Arrestin phosphorylation sites have been determined in many other arrestins including mammalian arrestin 2 and 3 (Lin et al., 2002; Lin et al., 1997), Limulus (Battelle et al., 2000;

Sineshchekova et al., 2004), and Drosophila (Alloway & Dolph, 1999; Matsumoto et al., 1994), all of which are located in the C-terminus of the various arrestins. We identified three potential 91 phosphorylation sites in the C-terminus of squid arrestin that could be phosphorylated by SQRK, serine 392, threonine 396 and serine 397. We determined that two of the three potential phosphorylation sites in the C-terminus of squid arrestin, serine 392 and serine 397, were phosphorylated equally by SQRK. The double serine to alanine mutant (S392A, S397A) had only a faint band present on the autoradiograph suggesting that threonine 396 in WT squid arrestin is not a favourable substrate for SQRK. When all three potential sites of phosphorylation were mutated to alanines (S392A, T396A, S397A), there was no phosphorylation of squid arrestin. In previous work from our laboratory (unpublished), it was determined that the threonine at position 396 was not phosphorylated, and that the site(s) of phosphorylation must be either, or both of the remaining serines; which is consistent with what we have now determined to be the phosphorylation sites of squid arrestin. In both Limulus and β-arrestin 2 which are two arrestins that have multiple phosphorylation sites, there is a clear preference at each site. In β- arrestin 2, the threonine 383 is the major phosphorylation site, with less phosphorylation at the serine residue 361 (Lin et al., 2002). In Limulus arrestin, there are three serine residues that are sequentially phosphorylated, serine 381, serine 377 and lastly serine 396 (Sineshchekova et al.,

2004). Serine residues at 377 and 381 are phosphorylated to a similar degree, while the most C- terminal serine (Ser396) is phosphorylated less (Sineshchekova et al., 2004). Squid arrestin is similar to the Limulus arrestin, in that the serine residues are phosphorylated, however these individual serine mutants were phosphorylated equally in sArr unlike Limulus arrestin, where arrestin isoforms with only one phosphorylation site present had varying levels of phosphorylation (Sineshchekova et al., 2004). In future experiments, another phosphorylation mutant could be generated where both serine residues are intact and the threonine is mutated to an alanine (T396A); we would expect this mutant to exhibit phosphorylation to the level of

WTsArr, confirming the two serine residues as the phosphorylation sites of squid arrestin.

Phosphorylation of WTsArr and native squid arrestin by SQRK was demonstrated under three different experimental conditions; in the presence of membranes in the dark, in the presence of membranes in the light, and in the complete absence of membranes, indicating that squid arrestin could be phosphorylated by SQRK regardless of its association with rhodopsin or membranes.

Previous work in our laboratory did not observe any phosphorylation of native squid arrestin in the absence of membranes, or in the absence of light, suggesting this protein was phosphorylated in both a membrane- and light-dependent manner (Swardfager & Mitchell, 2007). This is inconsistent with the results reported in this study, where arrestin phosphorylation was maximally phosphorylated in the absence of membranes, and was phosphorylated in the dark.

Our recent unpublished work from our laboratory found that both native and recombinant WT squid arrestin were phosphorylated by SQRK in the absence of membranes, consistent with the findings reported here. The discrepancy between this study, the unpublished work previously performed, and the published data by Swardfager & Mitchell (2007) may be a result of exposure time for the autoradiograms, as the arrestin phosphorylation is harder to detect in comparison to the squid rhodopsin which is detectable after only a short exposure time. A major difference between the previous study using purified sArr from squid eyes and the results using native and recombinant sArr of these current studies, is the effect of light on arrestin phosphorylation. In this study, arrestin phosphorylation was reduced in the presence of light and metarhodopsin, whereas previously it was shown that arrestin phosphorylation increased in the presence of light and metarhodopsin (Swardfager & Mitchell, 2007). In the experiments reported here, both native and WTsArr exhibited this reduction in arrestin phosphorylation in the presence of the light and membranes, so this difference was not the result of the addition of the Strep-tag to recombinant

WTsArr. In the Limulus system, there is an increase in arrestin phosphorylation in the presence of membranes in light-adapted fractions in comparison to the dark-adapted fractions; with the

93 last phosphorylation site to be phosphorylated exhibiting the most light-regulation (Battelle et al.,

2000; Sineshchekova et al., 2004). This light-induced phosphorylation of arrestin was also seen in the Drosophila system, in which there were only low levels of arrestin 2 phosphorylation in the dark (Alloway & Dolph, 1999). Thus, the results obtained in the current study are inconsistent with results published for other invertebrate systems investigating the light- dependence of arrestin phosphorylation. In the light, when metarhodopsin becomes a substrate for SQRK, there may be competition for SQRK between squid arrestin and squid rhodopsin, in which case the squid metarhodopsin-SQRK interaction may be more favoured and account for the reduction in squid arrestin phosphorylation seen in the light in the presence of membranes.

Another possible explanation for the differences seen in this study and those found previously by our lab is that in this study we used cholate-washed squid membranes as a source of rhodopsin whereas the study by Swardfager and Mitchell (2007) used squid eye membranes that had only been washed in buffers containing 500mM NaCl. Thus, it is possible that the cholate washing removed a protein from the membranes to which arrestin or SQRK binds in the dark and inhibits the interaction of these two proteins. Candidate proteins for this role are the Gq protein βγ subunits which are cholate soluble and thus removed along with Gqα when the membranes are cholate washed. While there is no evidence that sArr binds to Gqβγ, SQRK has a PH domain that is known to bind to G protein βγ subunits (Mayeenuddin & Mitchell, 2001) and may inhibit

SQRK phosphorylation of sArr. This possibility could be tested in future experiments by adding purified βγ proteins back to the cholate washed membranes to determine if this blocks SQRK phosphorylation of sArr in the presence of dark membranes.

4.5. Role of Phosphorylation on Arrestin and Rhodopsin Association

The role of squid arrestin phosphorylation and the role of rhodopsin phosphorylation had yet to be determined for the squid visual system. In the mammalian system, it is known that rhodopsin phosphorylation is essential for arrestin-1 to move into the high affinity binding state, and even the non-visual arrestins bind receptors that are phosphorylated with higher affinity than unphosphorylated receptors. In the squid visual system, it has now been shown that squid arrestin can bind to metarhodopsin with high affinity (32nM) and does not require metarhodopsin phosphorylation to do so, therefore the question remains as to the significance of light-dependent metarhodopsin phosphorylation by SQRK. The same question exists for the role of squid arrestin phosphorylation by SQRK. The association of WTsArr to phosphorylated metarhodopsin was first investigated and the affinity was determined to be 21nM indicating a slightly higher affinity interaction than that seen with WTsArr binding to metarhodopsin. While squid arrestin may discriminate slightly the phosphorylation state of metarhodopsin, it is not to the level of arrestin-

1 in the mammalian visual system that shows an absolute requirement for rhodopsin phosphorylation (Gurevich & Benovic, 1993). The squid visual arrestin is similar to the

Drosophila visual system, where arrestin 2 binds to metarhodopsin that has its phosphorylation sites mutated, or truncated, revealing that metarhodopsin phosphorylation is not required for

Drosophila arrestin 2 to bind (Kristaponyte, Hong, Lu, & Shieh, 2012; Vinos et al., 1997). It has been shown that Drosophila arrestin 2 binds unphosphorylated- and phosphorylated- metarhodopsin with the same affinity, and that mutations to the phosphorylation sites of metarhodopsin or arrestin 2 do not have an effect on the sensitivity or kinetics of phototransduction (Kiselev et al., 2000; Kristaponyte et al., 2012; Vinos et al., 1997).

Squid arrestin phosphorylation had a significant effect on its association to both metarhodopsin and phosphorylated-metarhodopsin, as determined by two-way ANOVA analysis of the binding 95 curves. The Kd values for phosphorylated WTsArr binding to either metarhodopsin or phosphorylated-metarhodopsin were both 104nM, which was 3-5 times lower affinity than that of WTsArr with metarhodopsin (36nM) or phosphorylated-metarhodopsin (21nM). These results therefore demonstrated that arrestin phosphorylation inhibited its binding to metarhodopsin.

Upon phosphorylation of both sites of phosphorylation on squid arrestin the C-terminus of the squid arrestin becomes more negatively charged, which is the case for all arrestins, however the

C-termini of other arrestins are overall less negatively charged than that of squid arrestin. This increase in charge when sArr is phosphorylated by SQRK may contribute to the decreased binding of phosphorylated arrestin to metarhodopsin (either phosphorylated or unphosphorylated). In all of the proposed models of arrestin binding to phosphorylated- metarhodopsin in mammalian systems, the one consistent element is the release of the C-terminal tail from the polar core when arrestin moves into the high-affinity binding state, in which the C- terminal tail likely moves away from the receptor (Gurevich & Benovic, 1993; Gurevich &

Gurevich, 2013; Schleicher et al., 1989). The lack of involvement of the C-terminus of arrestin in association with receptor is also confirmed by the ability of the splice variant of arrestin-1 (p-44) to bind to phosphorylated-metarhodopsin, as well as unphosphorylated-metarhodopsin (Granzin et al., 2012). Therefore, while the squid arrestin C-terminus may be more negatively charged compared to other arrestins, based on the results of many studies, it seems likely that this may not be the sole reason for the decreased affinity of phosphorylated squid arrestin for metarhodopsin.

Additionally, in a recent study, investigating the role of arrestin and rhodopsin phosphorylation in retinal degeneration of Drosophila, it was determined that arrestin phosphorylation, using an aspartic acid mutant (S366D), does not have an effect on the association of the protein to metarhodopsin and that the C-terminus of Drosophila arrestin 2 is not critical for its association 96 to metarhodopsin (Kristaponyte et al., 2012). The results within the Drosophila system are inconsistent, however an initial work conducted by Alloway and Dolph (1999) demonstrated that arrestin 2 phosphorylation was not required for arrestin to bind metarhodopsin where the majority of the phosphorylated form of arrestin was found in the supernatant, and the membrane- bound form of arrestin was unphosphorylated. In mammalian non-visual arrestins, arrestin phosphorylation does not have an effect on β-arrestin 1 or β-arrestin 2 (mammalian arrestin 2 and arrestin 3) receptor binding and their abilities to promote desensitization (Lin et al., 2002; Lin et al., 1997). In fact, the non-visual arrestins are dephosphorylated in response to agonist stimulation of receptors (Lin et al., 2002; Lin et al., 1997). This is in contrast to the Drosophila and Limulus visual systems where arrestin phosphorylation is increased in the light (Alloway &

Dolph, 1999; Battelle et al., 2000; Sineshchekova et al., 2004). Overall, the squid arrestin may be more similar to non-visual mammalian arrestins, as the results of this study revealed a potential for arrestin phosphorylation in the cytoplasm and presumably the need for dephosphorylation in order for arrestin to bind with high affinity to metarhodopsin. If squid arrestin is dephosphorylated upon light-activation, there must be a phosphatase in the squid visual system that has yet to be identified. Additional studies to further our understanding of the role of arrestin phosphorylation on association of the arrestin-metarhodopsin complex would involve generating a double aspartic acid arrestin mutant (S392D/S397D) to mimic phosphorylation and determine the affinity of this mutant with metarhodopsin and phosphorylated-metarhodopsin in comparison to WTsArr and the phosphorylated arrestin results reported here. Further studies to identify a phosphatase in the squid visual system, and to determine its role in the visual signalling pathway are also required.

4.6. Role of Phosphorylation on Arrestin and Rhodopsin Dissociation

The final aim of this project was to investigate how arrestin and metarhodopsin dissociate. When metarhodopsin is photoisomerized back into the inactive state, arrestin must dissociate from rhodopsin to allow for its renewed interaction with Gq. In the Drosophila visual system, when the phosphorylation site of arrestin 2 was mutated it did not release from rhodopsin when it was photoconverted back to the inactive state, unlike the WT arrestin 2 where about 80% was released (Alloway & Dolph, 1999). As Drosophila and squid visual systems are similar, we anticipated that the phosphorylation of squid arrestin may also increase its dissociation from activated squid rhodopsin, therefore we investigated the role of phosphorylation of both arrestin and metarhodopsin on the dissociation of these two proteins. The dissociation assays were performed in both the light and the dark, however it should be noted that neither of these conditions would result in consistent conversion of metarhodopsin to rhodopsin. In all but one condition, dissociation of arrestin from phosphorylated-rhodopsin occurred at low salt concentrations better than dissociation from unphosphorylated rhodopsin. This suggested that dissociation of the complex was facilitated by SQRK phosphorylation of metarhodopsin. An effect of sArr phosphorylation was not seen as the increased dissociation from phosphorylated rhodopsin was not enhanced further when arrestin was phosphorylated in our assays. Overall, these experiments did not give a clear answer to the role of arrestin or rhodopsin phosphorylation in dissociation of the complex and this was the result of our inability to homogeneously convert squid metarhodopsin to rhodopsin because of the similarity in wavelength of light required for these two isomerization reactions. However, it remains that the function of metarhodopsin phosphorylation in the squid visual system may be to facilitate the dissociation of arrestin.

The results of this study showed no role for arrestin phosphorylation in dissociation. While this is inconsistent with the report by Alloway and Dolph (1999) for the Drosophila visual system, a 98 more recent study in Drosophila also found that arrestin 2 phosphorylation was not important for regulating dissociation (Kristaponyte et al., 2012). As suggested for other future experimentation involving arrestin phosphorylation, we could use the same double aspartic acid arrestin mutant (S392D/S397D) in these experiments to examine how this mutant dissociates from either phosphorylated or unphosphorylated rhodopsin.

4.7. Clathrin-Binding Motif in Arrestins

While considering potential roles of arrestin phosphorylation, there is one other role that it may serve in the inactivation pathway. For many other arrestins, phosphorylation has been associated with endocytosis of the respective receptor-arrestin complex (Alloway & Dolph, 1999; Lin et al.,

2002; Lin et al., 1997, 1999; Sineshchekova et al., 2004). In both the non-visual mammalian arrestins, phosphorylation and dephosphorylation of these arrestins regulates their ability to bind clathrin and therefore internalize the receptor. Upon agonist stimulation, the non-visual arrestins are dephosphorylated, this is required for the arrestins to bind clathrin resulting in the internalization of the receptor, as opposed to the phosphorylated forms which have reduced association with clathrin, thereby reducing receptor internalization (Lin et al., 2002; Lin et al.,

1997, 1999). The same regulation of clathrin binding is seen in the Drosophila system with arrestin 2; where the unphosphorylated form of arrestin 2 strongly interacts with clathrin and the phosphorylated form reduces clathrin interaction (Kiselev et al., 2000). It has also been shown that the other arrestin in Drosophila, arrestin 1, is involved in endocytosis of phosphorylated- activated rhodopsin, as it promotes strong binding of arrestin-1; therefore both visual arrestins in

Drosophila have endocytotic properties (Satoh & Ready, 2005). In Limulus arrestin the most C- terminal phosphorylation site, Ser396, is in close proximity to an RxR adaptin binding domain, which suggests that this particular phosphorylation site, that is highly regulated by light, may regulate the interaction of Limulus visual arrestin with adaptin and thereby regulate endocytosis 99 of metarhodopsin via clathrin (Sineschekova et al., 2004). There is a potential clathrin binding motif in the C-terminus of squid arrestin, 374LIMEEF379; however this site is relatively far from the two C-terminal phosphorylation sites we have determined for squid arrestin. The foci of this study did not include the investigation of clathrin binding, however this could be investigated in future studies of the squid system.

4.8. Summary and Modelling of the Inactivation Pathway of the Squid Visual System

We can draw the following conclusions from the results of this study:

1. Squid arrestin can bind metarhodopsin with high affinity regardless of the

phosphorylation state of metarhodopsin

2. Mutations to the polar core of squid arrestin do not decrease the affinity of squid arrestin

for squid metarhodopsin, suggesting the basal structure of squid arrestin may differ from

other arrestins

3. Serine 392 and Serine 397 were determined to be the phosphorylation sites of squid

arrestin. Arrestin phosphorylation decreases the affinity of squid arrestin for

metarhodopsin (phosphorylated or unphosphorylated).

4. Squid metarhodopsin phosphorylation, rather than arrestin phosphorylation, may

facilitate the dissociation of arrestin in the squid visual system.

From previous work in our lab and the results of the studies performed here, we can make the following model of the inactivation pathway in the squid visual system. In the dark SQRK and arrestin interact in the cytoplasm to maintain arrestin in a phosphorylated state that will not bind to rhodopsin. Upon light activation, metarhodopsin recruits SQRK to the membrane, possibly in association with GqβγSQRK phosphorylates metarhodopsin. In the cytoplasm arrestin may

100 become dephosphorylated by a phosphatase and in the dephosphorylated state it binds to metarhodopsin with high affinity and interferes with iGqα-Rh* interactions ceasing phototransduction. Metarhodopsin phosphorylation may facilitate the dissociation of arrestin upon photoconversion of metarhodopsin back to the inactive but still phosphorylated state.

Arrestin will dissociate from phosphorylated-rhodopsin which will then be dephosphorylated by a phosphatase. An alternative pathway, that has yet to be studied in the squid system, is one in which unphosphorylated arrestin bound to metarhodopsin may interact with clathrin through the potential clathrin binding motif (LIMEEF) resulting in the internalization of the arrestin- rhodopsin complex.

The inactivation pathway of the squid visual system is different from the mammalian system, as metarhodopsin can be photoregenerated back into rhodopsin upon the absorption of a photon of light unlike the mammalian metarhodopsin which is regenerated through enzymatic reactions.

While the role of phosphorylation has not been elucidated for the squid system, in the mammalian system, once the rhodopsin is dephosphorylated, the arrestin would no longer bind with high affinity, and dissociate. It is important to remember that the squid occupies a very different habitat than terrestrial mammals; squids are in the depths of the ocean where it is dark and the squid are likely responding solely to bioluminescence and not rays of sunlight as terrestrial mammals are. The squid rhodopsin may not need to be regenerated as rapidly as that of animals living in more illuminated environments.

Future studies should investigate further the role of WTsArr phosphorylation using mutants that mimic phosphorylation of Ser392 and Ser397 to confirm the lower affinity of phosphorylated

WTsArr for metarhodopsin. Further studies to investigate squid arrestin interactions with clathrin, and the role that arrestin phosphorylation/dephosphorylation may play in regulating this interaction would be important. And finally the identification, purification and cloning of a 101 phosphatase responsible for the dephosphorylation of arrestin and metarhodopsin would further our knowledge of how the proteins of the visual system get restored to the dark, inactive state.

102

Appendices

Appendix A-Protocol for Annealing Oligonucleotides as per Sigma-Aldrich Annealing Buffer: 10mM Tris, pH 7.5–8.0, 50mM NaCl, 1mM EDTA

1. Resuspending the Oligonucleotides: Resuspend both complementary oligonucleotides at the same molar concentration, using Annealing Buffer (see note below). For convenience, keep Annealing Buffer volume below 500µl for each oligo. Annealing should perform well over a wide range of oligo concentrations. For larger scale oligo syntheses, it may be necessary to use larger volumes that can be aliquoted after resuspension.

2. Annealing the Oligonucleotides: a. Mix equal volumes of both complementary oligos (at equimolar concentration) in a 1.5ml microfuge tube. b. Place tube in a standard heat block at 90–95°C for 3–5 minutes. c. Remove the heat block from the apparatus and allow to cool to room temperature (or at least below 30°C) on the workbench. Slow cooling to room temperature should take 45–60 minutes. d. Store on ice or at 4°C until ready to use. e. An alternative procedure for annealing involves the use of a thermal cycler. Dispense 100µl aliquots of the mixed oligos into PCR tubes (500µl size). Do not overlay the samples with oil. Place the tubes in a thermal cycler and set up a program to perform the following profile:

i. Heat to 95°C and remain at 95°C for 2 minutes; ii. Ramp cool to 25°C over a period of 45 minutes; iii. Proceed to a storage temperature of 4°C. Briefly spin the tubes in a microfuge to draw all moisture from the lid. Pool samples into a larger tube, store on ice or at 4°C until ready to use.

3. Long Term Storage: It may be necessary to aliquot and lyophilize the annealed sample. After drying, the sample may be stored at –20°C in a desiccated container. Resuspend the annealed oligos at the desired concentration with sterile distilled water. The annealed pair of oligonucleotides is ready for use.

NOTE: Oligos may also be resuspended in either 1x Ligase Buffer or 1x Kinase Buffer instead of the above Annealing Buffer (prior to annealing). See more at: http://www.sigmaaldrich.com/life-science/custom-oligos/custom-dna/learning- center/annealing-oligos.html#sthash.i3dJL1Fp.dpuf

103

Appendix B- Tni cell expressed SQRK-H6 Purification Purified by Wei-Lin Ou, PhD Candidate in Dr. Oliver Ernst’s laboratory, Department of Biochemistry, University of Toronto

Day 1: Harvest, and cobalt resin binding Reagents, solutions, and equipment  Tni PRO cell line (Expression Systems)  ESF921 cell culture media (Expression Systems)  Low speed refrigerated centrifuge and ultracentrifuge and accompanying rotors: Beckman Avanti J-26XP with JLA-8.1000, Beckman L-80XP with 45Ti  EmulsiFlex C3 homogenizer (Avestin)  1.5 mL cobalt resin (Clontech)  DTT (Bioshop, 1M aliquots stored at -20°C)  Benzamidine (Sigma-Aldrich, 100 mg/mL stock in water stored at -20°C)  PMSF (Bioshop, 100mM in 100% ethanol stored at -20°C)  Protease inhibitor cocktail tablet, EDTA-free (Sigma-Aldrich, Cat#S8830)  Buffer A (20mM HEPES, pH 7, 300mM NaCl, 2mM DTT, 1mM PMSF, 100μg/ml benzamidine. Fresh protease inhibitors are added immediately before lysis.)

Cell pellets from 0.8 litre cultures are resuspended in 100mL of buffer A and lysed with homogenizer (running under ~5000 psi with cooling system at 4°C). The cell lysate is passed through homogenizer for two times and lysis is verified under microscope. The lysate is clarified by ultracentrifugation at 130,000 × g for 45 min. The supernatant is collected and incubated with 1.5mL cobalt resin (pre-equilibrated with buffer A) in the presence of 1mM imidazole for overnight in cold room.

Day 2: Affinity and Ion Exchange Chromatography Reagents, solutions, and equipment • DTT (Bioshop, 1M aliquots stored at -20°C) • Protease inhibitor cocktail tablet, EDTA-free (Sigma-Aldrich, Cat#S8830) • Buffer A (20mM HEPES, pH 7, 300mM NaCl, 2mM DTT, 1mM PMSF,100 μg/ml benzamidine. Fresh protease inhibitors are added immediately before lysis.) • Buffer B (20mM HEPES, pH 7.5, 50mM NaCl, 2mM DTT, 2mM EGTA) • Buffer C (20mM HEPES, pH 7.5, 800mM NaCl, 2mM DTT, 2mM EGTA) • Buffer D (20mM HEPES, pH 7.5, 2mM DTT, 2mM EGTA) • 1 mL Mono Q 5/50 GL and Mono S 5/50 GL columns (GE Healthcare)

The resin is washed on column with five column volumes of buffer A plus 5mM imidazole (wash 1), washed with ten more column volumes of buffer A plus 10mM imidazole (wash 2), washed with five more column volumes of buffer A plus 30mM imidazole (wash 3), and then the SQRK is eluted in 1.5mL fractions with 10mL of buffer A plus 150mM imidazole. These column fractions are analyzed by SDS-PAGE and stained with Coomassie Blue (Figure A-1, A). Fractions are pooled and ready for ion exchange chromatography.

3mL of the affinity column pool is diluted to 15mL with buffer D to lower the salt concentration to 50mM of NaCl. The Mono Q and Mono S columns are connected in tandem and equilibrated in buffer B at a flow rate of 1 mL/min. The affinity column pool is loaded onto the tandem 104 columns. The Mono Q column is removed after 2-3 column washing. The Mono S column is washed with 5 column volumes of buffer B and then eluted with a 30mL linear gradient of 100- 600mM NaCl. The eluted fractions are analyzed by SDS-PAGE (Figure A-1, B). The pooled fractions are dialyzed against buffer B for overnight in the cold room and then stored at -80°C.

Figure A- 1: Purification of recombinant SQRK using affinity (A) and ion-exchange chromatography (B). Samples of each stage were analyzed by SDS-PAGE stained with Coomassie Blue. Figure A shows the load, flow through, wash and elution of rSQRK using affinity purification. Figure B shows the elution fractions of rSQRK from the ion-exchange resins.

105

Appendix C- Purification of Native SQRK and Comparison of Enzyme Function between Native and Recombinant SQRK

The purification of SQRK and PLC was outlined in the Methods section (2.2.2). In Figure A-2 is the Coomassie stained polyacrylamide gel of the purification of these proteins over DEAE ion- exchange resin and Heparin-Sepharose resin. A linear salt gradient of 200-600mM NaCl was used to elute the proteins. The SQRK and PLC elute together at approximately 300mM NaCl. SQRK can be seen at the 84kDa molecular weight standard, and PLC can be seen above the 116kDa molecular weight standard.

Figure A- 2: Purification of SQRK and PLC over DEAE and Heparin Sepharose Columns. SQRK and PLC do not bind to DEAE and flowed through the column. The first two lanes show the DEAE load and pass (blue font). The remaining lanes depict the purification of SQRK and PLC over Heparin Sepharose using a 200-600mM NaCl linear gradient, where both proteins elute together at approximately 300mM NaCl. PLC is shown by the red arrow and SQRK is shown by the green arrow.

As the rSQRK can be purified much more effectively than the native SQRK, it was more desirable to use this protein in our phosphorylation assays. In Figure A-3 is a comparison of the phosphorylation activity of increasing quantities of the native and recombinant SQRK incubated with bovine rhodopsin (which has been urea-washed to remove the native GRK). Both native and recombinant SQRK were able to phosphorylate bovine rhodopsin. Since rSQRK was able to phosphorylate the bovine rhodopsin, we moved forward with using the cleaner, recombinant SQRK preparations for our phosphorylation assays.

106

Figure A- 3: Phosphorylation of urea washed bovine rhodopsin by native and recombinant SQRK. The polyacrylamide gel stained with Coomassie Blue (top panel) and the resulting autoradiogram (bottom panel) are shown, with native SQRK phosphorylation (left panel), and rSQRK phosphorylation (right panel). In the left panel, there is no phosphorylation present in the first two lanes, as the first lane is in the dark, and the second lane is in the absence of SQRK, in the light. The remaining lanes are in the light, where bovine metarhodopsin is phosphorylated (blue arrow) in the presence of increasing quantities of native SQRK. In the right panel, the first two lanes have bovine rhodopsin that has not been urea-washed, therefore the GRK is present. The first lane is in the dark, and the second is in the light where phosphorylation of bovine rhodopsin is present. The remaining lanes show phosphorylation of bovine metarhodopsin (blue arrow) in the presence of increasing quantities of rSQRK. In all lanes with kinase present, light-dependent autophosphorylation of the kinase can be seen (green arrow).

107

References

Alloway, P. G., & Dolph, P. J. (1999). A role for the light-dependent phosphorylation of visual arrestin. Proc. Natl. Acad. Sci. USA, 96, 6072–6077.

Arshavsky, V. Y., Lamb, T. D., & Pugh, E. N. (2002). G proteins and phototransduction. Annual Review of Physiology, 64, 153–87.

Ashida, A., Matsumoto, K., Ebrey, T. G., & Tsuda, M. (2004). A Purified Agonist-Activated G- Protein Coupled Receptor: Truncated Octopus Acid Metarhodopsin A Purified Agonist- Activated G-Protein Coupled Receptor: Truncated Octopus Acid Metarhodopsin. Zoological Science, 21(3), 245–250.

Bamsey, C., Mayeenuddin, L. H., Cheung, R., & Mitchell, J. (2000). Dissociation of G-protein α from rhabdomeric membranes decreases its interaction with rhodopsin and increases its degradation by calpain. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 127(1), 75–83.

Battelle, B., Andrews, A. W., Kempler, K. E., Edwards, S. C., & Smith, W. C. (2000). Visual arrestin in Limulus is phosphorylated at multiple sites in the light and in the dark. Visual Neuroscience, 17(5), 813–822.

Bayburt, T. H., Vishnivetskiy, S. a, McLean, M. a, Morizumi, T., Huang, C.-C., Tesmer, J. J. G., … Gurevich, V. V. (2011). Monomeric rhodopsin is sufficient for normal rhodopsin kinase (GRK1) phosphorylation and arrestin-1 binding. The Journal of Biological Chemistry, 286(2), 1420–8. doi:10.1074/jbc.M110.151043

Bentrop, J., Plangger, A., & Paulsen, R. (1993). An arrestin homolog of blowfly photoreceptors stimulates visual-pigment phosphorylation by activating a membrane-associated protein kinase. European Journal of Biochemistry, 216(1), 67–73.

Bloomquist, B. T., Shortridge, R. D., Schneuwly, S., Perdew, M., Montell, C., Steller, H., … Pak, W. L. (1988). Isolation of a Putative Phospholipase C Gene of Drosophila, norpA, and Its Role in Phototransduction. Cell, 54, 723–733.

Buczylko, J., Gutmann, C., & Palczewski, K. (1991). Regulation of rhodopsin kinase by autophosphorylation. Proc. Natl. Acad. Sci. USA, 88, 2568–2572.

Calman, B. G., Andrews, A. W., Rissler, H. M., Edwards, S. C., & Battelle, B.-A. (1996). Calcium/calmodulin-dependent protein kinase II and arrestin phosphorylation in Limulus eyes. Journal of Photochemistry and Photobiology. B, Biology, 35, 33–44.

Calman, B. G., & Chamberlain, S. C. (1982). Distinct Lobes of Limulus Ventral Photoreceptors II . Structure and Ultrastructure. J. Gen. Physiol., 80, 839–862.

108

Cassill, J. A., Whitney, M., Joazeiro, C. A. P., Becker, A. N. N., & Zuker, C. S. (1991). Isolation of Drosophila genes encoding G protein-coupled receptor kinases. Proc. Natl. Acad. Sci. USA, 88, 11067–11070.

Choe, H.-W., Kim, Y. J., Park, J. H., Morizumi, T., Pai, E. F., Krauss, N., … Ernst, O. P. (2011). Crystal structure of metarhodopsin II. Nature, 471(7340), 651–5.

Davies, A., Gowen, B. E., Krebs, A. M., Schertler, G. F., & Saibil, H. R. (2001). Three- dimensional structure of an invertebrate rhodopsin and basis for ordered alignment in the photoreceptor membrane. Journal of Molecular Biology, 314(3), 455–63.

Dinculescu, A., McDowell, J. H., Amici, S. A., Dugger, D. R., Richards, N., Hargrave, P. a, & Smith, W. C. (2002). Insertional mutagenesis and immunochemical analysis of visual arrestin interaction with rhodopsin. The Journal of Biological Chemistry, 277(14), 11703–8.

Dorlochter, M., Klemeit, M., & Stieve, H. (1997). Immunological demonstration of Gq-protein in Limulus photoreceptors. Visual Neuroscience, 14, 287–292.

Edwards, S. C., Wishart, A. C., Wiebe, E. M., & Battelle, B.-A. (1989). Light-regulated proteins in Limulus ventral photoreceptor cells. Visual Neuroscience, 3, 95–105.

Fein, A. (1986). Blockade of visual excitation and adaptation in Limulus photoreceptor by GDP- Beta-S. Science, 232, 1543–5.

Fung, B. K., & Griswold-Prenner, I. (1989). G Protein-Effector Coupling : Binding of Rod Phosphodiesterase Inhibitory Subunit to Transducin. Biochemistry, 28, 3133–3137.

Gainetdinov, R. R., Premont, R. T., Caron, M. G., Lefkowitz, R. J., Schmidt, A. M., & Stern, D. (2000). Reply : receptor specificity of G-protein-coupled receptor kinases. Trends in Pharmacological Sciences, 21, 366–367.

Gaudet, R., Bohm, A., & Sigler, P. B. (1996). Crystal Structure at 2.4A Resolution of the Complex of Transducin BY and Its Regulator, Phosducin. Cell, 87, 577–588.

Gimenez, L. E., Kook, S., Vishnivetskiy, S. A., Ahmed, M. R., Gurevich, E. V, & Gurevich, V. V. (2012). Role of receptor-attached phosphates in binding of visual and non-visual arrestins to G protein-coupled receptors. The Journal of Biological Chemistry, 287(12), 9028–40.

Go, L., & Mitchell, J. (2003). Palmitoylation is required for membrane association of activated but not inactive invertebrate visual Gqα. Comparative Biochemistry and Physiology Part B: Biochemistry and Molecular Biology, 135(4), 601–609.

Go, L., & Mitchell, J. (2007). Receptor-coupling properties of the invertebrate visual guanine nucleotide binding protein iGqα. Cellular Signalling, 19(9), 1919–27.

109

Granzin, J., Cousin, A., Weirauch, M., Schlesinger, R., Büldt, G., & Batra-Safferling, R. (2012). Crystal structure of p44, a constitutively active splice variant of visual arrestin. Journal of Molecular Biology, 416(5), 611–8. doi:10.1016/j.jmb.2012.01.028

Granzin, J., Wilden, U., Choe, H., Krafft, B., & Bu, G. (1998). X-ray crystal structure of arrestin from bovine rod outer segments. Nature, 391, 918–921.

Gurevich, V. V. (1998). The Selectivity of Visual Arrestin for Light-Activated Phosphorhodopsin Is Controlled by Multiple Nonredundant Mechanisms. Journal of Biological Chemistry, 273(25), 15501–15506.

Gurevich, V. V, & Benovic, J. L. (1993). Visual Arrestin Interaction with Rhodopsin. Journal of Biological Chemistry, 268(16), 11628–11638.

Gurevich, V. V, & Benovic, J. L. (1995). Visual Arrestin Binding to Rhodopsin. Journal of Biological Chemistry, 270(11), 6010–6016.

Gurevich, V. V, & Benovic, J. L. (1997). Mechanism of Phosphorylation-Recognition by Visual Arrestin and the Transition of Arrestin into a High Affinity Binding State. Molecular Pharmacology, 51, 161–169.

Gurevich, V. V, & Benovic, L. (1992). Cell-Free Expression of Visual Arrestin. Journal of Biological Chemistry, 267(30), 21919–21923.

Gurevich, V. V, Chen, C.-Y., Kim, C. M., & Benovic, J. L. (1994). Visual Arrestin Binding to Rhodopsin. Journal of Biological Chemistry, 269(12), 8721–8727.

Gurevich, V. V, & Gurevich, E. V. (2004). The molecular acrobatics of arrestin activation. Trends in Pharmacological Sciences, 25(2), 105–11.

Gurevich, V. V, & Gurevich, E. V. (2006). Arrestins: ubiquitous regulators of cellular signaling pathways. Genome Biology, 7, 236.

Gurevich, V. V, & Gurevich, E. V. (2006). The structural basis of arrestin-mediated regulation of G-protein-coupled receptors. Pharmacology & Therapeutics, 110(3), 465–502.

Gurevich, V. V, & Gurevich, E. V. (2013). Structural determinants of arrestin functions. In Handbook of Experimental Pharmacology (Vol. 118, pp. 57–92). Elsevier Inc.

Gurevich, V. V, Hanson, S. M., Song, X., Vishnivetskiy, S. A., & Gurevich, E. V. (2011). The functional cycle of visual arrestins in photoreceptor cells. Progress in Retinal and Eye Research, 30, 405–30.

Gurevich, V., Dion, S., Onorato, J., Ptasienski, J., Kim, C., Sterne-Marr, R., … Benovic, J. L. (1995). Arrestin Interactions with G Protein-coupled Receptors. Journal of Biological Chemistry, 270(2), 720–731.

110

Han, M., Gurevich, V. V, Vishnivetskiy, S. A., Sigler, P. B., Schubert, C., & Haven, N. (2001). Crystal Structure of B-Arrestin at 1.9A: Possible Mechanism of Receptor Binding and Membrane Translocation. Structure, 9, 869–880.

Hirsch, J. A., Schubert, C., Gurevich, V. V, Sigler, P. B., Hughes, H., & Haven, N. (1999). The 2.8 A Crystal Structure of Visual Arrestin: A Model for Arrestin’s Regulation. Cell, 97, 257–269.

Hubbard, R., & Kropf, A. (1957). The Action of Light on Rhodopsin. Biochemistry, 44, 130– 139.

Hubbard, R., & St. George, R. (1958). The Rhodopsin System of the Squid. J. Gen. Physiol., 41(3), 501–528.

Kahn, E. S., & Matsumoto, H. (1997). Calcium / Calmodulin-Dependent Kinase II Phosphorylates Drosophila Visual Arrestin. Journal of Neurochemistry, 68, 169–175.

Kikkawa, S., Tominaga, K., Nakagawa, M., Iwasa, T., & Tsuda, M. (1996). Simple Purification and Functional Reconstitution of Octopus Photoreceptor Gq , Which Couples Rhodopsin to Phospholipase C. Biochemistry, 35(49), 15857–15864.

Kikkawa, S., Yoshida, N., Nakagawa, M., Iwasa, T., & Tsuda, M. (1998). A Novel Rhodopsin Kinase in Octopus Photoreceptor Possesses a Pleckstrin Homology Domain and Is Activated by G Protein Beta Gamma -Subunits. Journal of Biological Chemistry, 273, 7441–7447.

Kim, M., Vishnivetskiy, S. A., Van Eps, N., Alexander, N. S., Cleghorn, W. M., Zhan, X., … Hubbell, W. L. (2012). Conformation of receptor-bound visual arrestin. Proc. Natl. Acad. Sci. USA, 109(45), 18407–12.

Kim, Y. J., Hofmann, K. P., Ernst, O. P., Scheerer, P., Choe, H.-W., & Sommer, M. E. (2013). Crystal structure of pre-activated arrestin p44. Nature, 497, 142–6.

Kiselev, A., Socolich, M., Vinos, J., Hardy, R. W., Zuker, C. S., & Ranganathan, R. (2000). A Molecular Pathway for Light-Dependent Photoreceptor Apoptosis in Drosophila. Neuron, 28, 139–152.

Kristaponyte, I., Hong, Y., Lu, H., & Shieh, B.-H. (2012). Role of rhodopsin and arrestin phosphorylation in retinal degeneration of Drosophila. The Journal of Neuroscience, 32(31), 10758–66.

Krupnick, J. G., & Benovic, J. L. (1998). The role of receptor kinases and arrestins in G protein- coupled receptor regulation. Annual Review of Pharmacology and Toxicology, 38, 289–319.

Kuhn, H. (1978). Light-Regulated Binding of Rhodopsin Kinase and Other Proteins to Cattle Photoreceptor Membranes. Biochemistry, 17(21), 4389–4395.

111

Lee, Y.-J., Shah, S., Suzuki, E., Zars, T., O’Day, P. M., & Hyde, D. R. (1994). The drosophila dgq gene encodes a Gα protein that mediates phototransduction. Neuron, 13, 1143–1157.

Leung, H.-T., Tseng-Crank, J., Kim, E., Mahapatra, C., Shino, S., Zhou, Y., … Pak, W. L. (2008). DAG lipase activity is necessary for TRP channel regulation in Drosophila photoreceptors. Neuron, 58, 884–96.

LeVine III, H., Smith, D. P., Whitney, M., Malicki, D. M., Dolph, P. J., Smith, G. F. H., … Zuker, C. S. (1991). Isolation of a novel visual-system-specific arrestin: an in vivo substrate for light-dependent phosphorylation. Mechanisms of Development, 33, 19–25.

Lin, F., Chen, W., Shenoy, S., Cong, M., Exum, S. T., & Lefkowitz, R. J. (2002). Phosphorylation of B-Arrestin2 Regulates Its Function in Internalization of B2-Adrenergic Receptors. Biochemistry, 41, 10692–10699.

Lin, F.-T., Krueger, K. M., Kendall, H. E., Daaka, Y., Fredericks, Z. L., Pitcher, J. A., & Lefkowitz, R. J. (1997). Clathrin-mediated Endocytosis of the B-Adrenergic Receptor Is Regulated by Phosphorylation/Dephosphorylation of B-Arrestin1. Journal of Biological Chemistry, 272, 31051–31057.

Lin, F.-T., Miller, W. E., Luttrell, L. M., & Lefkowitz, R. J. (1999). Feedback Regulation of B- Arrestin1 Function by Extracellular Signal-Regulated Kinases. Journal of Biological Chemistry, 274, 15971–15974.

Lyon, A. M., Dutta, S., Boguth, C. a, Skiniotis, G., & Tesmer, J. J. G. (2013). Full-length Gα(q)- phospholipase C-β3 structure reveals interfaces of the C-terminal coiled-coil domain. Nature Structural & Molecular Biology, 20(3), 355–62.

Lyon, A. M., Tesmer, V. M., Dhamsania, V. D., Thal, D. M., Gutierrez, J., Chowdhury, S., … Tesmer, J. J. G. (2011). An autoinhibitory helix in the C-terminal region of phospholipase C-β mediates Gαq activation. Nature Structural & Molecular Biology, 18(9), 999–1005.

Matsumoto, H., Kurien, B. T., Takagi, Y., Kahn, E. S., Kinumi, T., Komori, N., … Tobin, S. L. (1994). Phosrestin I undergoes the earliest light-induced phosphorylation by a calcium/calmodulin-dependent protein kinase in drosophila photoreceptors. Neuron, 12, 997–1010.

Mayeenuddin, L. H., Bamsey, C., & Mitchell, J. (2001). Retinal phospholipase C from squid is a regulator of Gqα GTPase activity. Journal of Neurochemistry, 78, 1350–1358.

Mayeenuddin, L. H., & Mitchell, J. (2001). cDNA cloning and characterization of a novel squid rhodopsin kinase encoding multiple modular domains. Visual Neuroscience, 18, 907–915.

Mayeenuddin, L. H., & Mitchell, J. (2003). Squid visual arrestin: cDNA cloning and calcium- dependent phosphorylation by rhodopsin kinase (SQRK). Journal of Neurochemistry, 85, 592–600.

112

Mendez, A., Burns, M. E., Roca, A., Lem, J., Wu, L., Simon, M. I., … Chen, J. (2000). Rapid and Reproducible Deactivation of Rhodopsin Requires Multiple Phosphorylation Sites. Neuron, 28, 153–164.

Mitchell, J., Gutierrez, J., & Northup, J. K. (1995). Purification, Characterization, and Partial Amino Acid Sequence of a G Protein-activated Phospholipase C from Squid Photoreceptors. Journal of Biological Chemistry, 270(2), 854–859.

Mitchell, J., & Swardfager, W. (2010). Photoresponse in Squid. In Encyclopedia of the Eye (pp. 347–353). Elsevier.

Modzelewska, A., Filipek, S., Palczewski, K., & Park, P. S. (2006). Arrestin Interaction With Rhodopsin. Cell Biochemistry and Biophysics, 46, 1–15.

Monk, P. D., Carne, A., Liu, S.-H., Ford, J. W., Keen, J. N., & Findlay, J. B. C. (1996). Isolation, Cloning, and Characterisation of a trp Homologue from Squid (Loligo forbesi) Photoreceptor Membranes. Journal of Neurochemistry, 67, 2227–2235.

Montell, C. (1999). Visual Transduction in Drosophila. Annu. Rev. Cell Dev. Biol., 15, 231–268.

Murakami, M., & Kouyama, T. (2008). Crystal structure of squid rhodopsin. Nature, 453, 363–7.

Ohguro, H., Palczewski, K., Walsh, K. A., & Johnson, R. (1994). Topographic study of arrestin using differential chemical modifications and hydrogen/deuterium exchange. Protein Science, 3, 2428–2434.

Ohguro, H., Yoshida, N., Shindou, H., Crabb, J. W., Palczewski, K., & Tsuda, M. (1998). Identification of a Single Phosphorylation Site Within Octopus Rhodopsin. Photochemistry and Photobiology, 68(6), 824–828.

Ostermaier, M. K., Peterhans, C., Jaussi, R., Deupi, X., & Standfuss, J. (2014). Functional map of arrestin-1 at single amino acid resolution. Proc. Natl. Acad. Sci. USA, 111(5), 1825–30.

Palczewski, K. (1994). Structure and functions of arrestins. Protein Science, 3, 1355–61.

Palczewski, K., Kumasaka, T., Hori, T., Behnke, C. A., Fox, B. A., Trong, I., … Stenkamp, R. E. (2000). Crystal Structure of Rhodopsin: A G Protein-Coupled Receptor. Science, 289(5480), 739–745.

Palczewski, K., Pulvermuller, A., Buczylko, J., & Hofmann, K. P. (1991). Phosphorylated Rhodopsin and Heparin Induce Similar Conformational Changes in Arrestin. Journal of Biological Chemistry, 28, 18649–18654.

Pitcher, J. a, Freedman, N. J., & Lefkowitz, R. J. (1998). G protein-coupled receptor kinases. Annual Review of Biochemistry, 67, 653–92.

113

Pulvermuller, A., Maretzki, D., Rudnicka-Nawrot, M., Smith, W. C., Palczewski, K., & Hofmann, K. P. (1997). Functional Differences in the Interaction of Arrestin and Its Splice Variant , p 44 , with, 2960(97), 9253–9260.

Radding, C., & Wald, G. (1956). Acid-Base Properties of Rhodopsin and Opsin. J. Gen. Physiol., 39(6), 909–922.

Rasmussen, S. G. F., DeVree, B. T., Zou, Y., Kruse, A. C., Chung, K. Y., Kobilka, T. S., … Kobilka, B. K. (2011). Crystal structure of the β2 adrenergic receptor-Gs protein complex. Nature, 477, 549–55.

Rodbell, M. (1997). The complex regulation of receptor-coupled G-proteins. Advan. Enzyme. Regul., 37, 427–435.

Ryba, N., Findlay, J. B. C., & Reidt, J. D. (1993). The molecular cloning of the squid ( Loligo forbes) visual Gq-α subunit and its expression in Saccharomyces cerevisiae. Biochem. J., 292, 333–341.

Satoh, A. K., & Ready, D. F. (2005). Arrestin1 mediates light-dependent rhodopsin endocytosis and cell survival. Current Biology, 15, 1722–33.

Schertler, G. F. X. (2008). The rhodopsin story continued. Nature, 453, 292–293.

Schleicher, A., Kuhn, H., & Peter, K. (1989). Kinetics, Binding Constant and Activation Energy of the 48-kDa Protein-Rhodopsin Complex by Extra-Metarhodopsin II. Biochemistry, 28, 1770–1775.

Sekharan, S., Altun, A., & Morokuma, K. (2010). Photochemistry of Visual Pigment in a Gq Protein-Coupled (GPCR)- Insights from Structural and Spectral Tuning Studies on Squid Rhodospin. Chemistry, 16(6), 1744–1749.

Shimamura, T., Hiraki, K., Takahashi, N., Hori, T., Ago, H., Masuda, K., … Miyano, M. (2008). Crystal structure of squid rhodopsin with intracellularly extended cytoplasmic region. Journal of Biological Chemistry, 283, 17753–6.

Shinohara, T., Dietzschold, B., Craft, C. M., Wistow, G., Early, J., Donoso, L., … Tao, R. (1987). Primary and secondary structure of bovine retinal S antigen (48-kDa protein). Proc. Natl. Acad. Sci. USA, 84(20), 6975–6979.

Shortridge, R. D., Yoon, J., Lending, C. R., Bloomquist, B. T., Perdew, M. H., & Pak, W. L. (1991). A Drosophila Phospholipase C Gene that is Expressed in the Central Nervous System. Journal of Biological Chemistry, 266(19), 12474–12480.

Shukla, A. K., Westfield, G. H., Xiao, K., Reis, R. I., Huang, L.-Y., Tripathi-Shukla, P., … Lefkowitz, R. J. (2014). Visualization of arrestin recruitment by a G-protein-coupled receptor. Nature Letter, 1–17.

114

Sineshchekova, O. O., Cardasis, H. L., Severance, E. G., Smith, W. C., & Battelle, B.-A. (2004). Sequential phosphorylation of visual arrestin in intact Limulus photoreceptors: identification of a highly light-regulated site. Visual Neuroscience, 21, 715–24.

Skegro, D., Pulvermuller, A., Krafft, B., Granzin, J., Hofmann, K. P., Buldt, G., & Schlesinger, R. (2007). N-terminal and C-terminal Domains of Arrestin Both Contribute in Binding to Rhodopsin. Photochemistry and Photobiology, 83, 385–392.

Smith, W. C., Dinculescu, A., Peterson, J. J., & Mcdowell, J. H. (2004). The surface of visual arrestin that binds to rhodopsin. Molecular Vision, 10, 392–398.

Smith, W. C., Greenberg, R. M., Calman, B. G., Hendrix, M. M., Hutchinson, L., Donoso, L. A., & Battelle, B.-A. (1995). Isolation and Expression of an Arrestin cDNA from the Horseshoe Crab Lateral Eye. Journal of Neurochemistry, 64, 1–13.

Sommer, M. E., Hofmann, K. P., & Heck, M. (2011). Arrestin-rhodopsin binding stoichiometry in isolated rod outer segment membranes depends on the percentage of activated receptors. Journal of Biological Chemistry, 286(9), 7359–69.

Sterne-Marr, R., Dhami, G. K., Tesmer, J. J. G., & Ferguson, S. S. G. (2004). Characterization of GRK2 RH domain-dependent regulation of GPCR coupling to heterotrimeric G proteins. Methods in Enzymology, 390, 310–36.

Sutton, R. B., Vishnivetskiy, S. a, Robert, J., Hanson, S. M., Raman, D., Knox, B. E., … Gurevich, V. V. (2005). Crystal structure of cone arrestin at 2.3A: evolution of receptor specificity. Journal of Molecular Biology, 354, 1069–80.

Swardfager, W., & Mitchell, J. (2007). Purification of visual arrestin from squid photoreceptors and characterization of arrestin interaction with rhodopsin and rhodopsin kinase. Journal of Neurochemistry, 101, 223–31.

Terakita, A., Hariyama, T., Tsukahara, Y., Katsukura, Y., & Tashiro, H. (1993). Interaction of GTP-binding protein Gq with photoactivated the photoreceptor membranes of crayfish rhodopsin in. FEBS, 330(2), 197–200.

Venien-Bryan, C., Davies, A., Langmack, K., Baverstock, J., Watts, A., Marsh, D., & Saibil, H. (1995). Effect of the C-terminal proline repeats on ordered packing of squid rhodopsin and its mobility in membranes. FEBS Letters, 359, 45–49.

Vinos, J., Jalink, K., Hardy, R. W., Britt, S. G., & Zuker, C. S. (1997). A G Protein-Coupled Receptor Phosphatase Required for Rhodopsin Function. Science, 277, 687–690.

Vishnivetskiy, S. A., Chen, Q., Palazzo, M. C., Brooks, E. K., Altenbach, C., Iverson, T. M., … Gurevich, V. V. (2013). Engineering visual arrestin-1 with special functional characteristics. The Journal of Biological Chemistry, 288, 3394–405.

Vishnivetskiy, S. A., Gimenez, L. E., Francis, D. J., Hanson, S. M., Hubbell, W. L., Klug, C. S., & Gurevich, V. V. (2011). Few residues within an extensive binding interface drive

115

receptor interaction and determine the specificity of arrestin proteins. The Journal of Biological Chemistry, 286(27), 24288–99.

Vishnivetskiy, S. A., Hosey, M. M., Benovic, J. L., & Gurevich, V. V. (2004). Mapping the arrestin-receptor interface. Structural elements responsible for receptor specificity of arrestin proteins. The Journal of Biological Chemistry, 279(2), 1262–8.

Vishnivetskiy, S. A., Paz, C. L., Schubert, C., Hirsch, J. A., Paul, B., Gurevich, V. V, & Sigler, P. B. (1999). How Does Arrestin Respond to the Phosphorylated State of Rhodopsin? The Journal of Biological Chemistry, 274, 11451–11454.

Vishnivetskiy, S. A., Raman, D., Wei, J., Kennedy, M. J., Hurley, J. B., & Gurevich, V. V. (2007). Regulation of arrestin binding by rhodopsin phosphorylation level. The Journal of Biological Chemistry, 282(44), 32075–83.

Vishnivetskiy, S. A., Schubert, C., Climaco, G. C., Gurevich, Y. V, Velez, M. G., & Gurevich, V. V. (2000). An additional phosphate-binding element in arrestin molecule. Implications for the mechanism of arrestin activation. The Journal of Biological Chemistry, 275(52), 41049–57.

Westfield, G. H., Rasmussen, S. G. F., Su, M., Dutta, S., Devree, B. T., Young, K., … Skiniotis, G. (2011). Structural flexibility of the Gαs α-helical domain in the β2-adrenoceptor Gs complex. Proc. Natl. Acad. Sci. USA, 108(38), 16086–16091.

Williamson, M. P. (1994). The structure and function of proline-rich regions in proteins. Biochem. J., 297, 249–260.

Wood, S. F., Szuts, E. Z., & Fein, A. (1989). Inositol Trisphosphate Production in Squid Photoreceptors. Journal of Biological Chemistry, 264(22), 12970–12976.

Young, J. (1974). The Central Nervous System of Loligo I. The Optic Lobe. Philosophical Transactions B, 267, 263–312.

Zhan, X., Gimenez, L. E., Gurevich, V. V, & Spiller, B. W. (2011). Crystal structure of arrestin- 3 reveals the basis of the difference in receptor binding between two non-visual subtypes. Journal of Molecular Biology, 406, 467–78.

116