British Microbiology Research Journal 5(2): 152-168, 2015, Article no.BMRJ.2015.017 ISSN: 2231-0886
SCIENCEDOMAIN international
www.sciencedomain.org
Morphological, Molecular and Biochemical Comparative Studies of Two Novel Fungal Honey Isolates
Amany Lotfy Kansoh 1, Zeinab Hassan Kheiralla 2, Hala Abd Elmonem Ahmed 2, Tarek Kahil 1, Eman Karam Abd El-Hameed 1 and Mona Abdeltawab Esawy 3*
1Microbial Chemistry Department, National Research Centre, Cairo, Egypt. 2Botany Department, College of Women for Arts, Science and Education, Ain Shams University, Cairo 11757, Egypt. 3Chemistry of Natural and Microbial Products Department, Pharmaceutical Industry Dev., National Research Centre, Dokki, Cairo, Egypt.
Authors’ contributions
This work was carried out in collaboration between all authors. Author MAE has suggested the point and authors MAE, ALK and ZHK have written the protocol. Authors MAE, ALK, HAEA and EKAEH have designed the study and managed the literature searches at the beginning. Author MAE and TK have wrote the first draft of manuscript and author EKAEH has carried out the experiments. All other authors have supervised the thesis and experimental work and managed the literature searches needed during writing the script, discussing the results and publishing. All authors read and approved the final manuscript.
Article Information
DOI: 10.9734/BMRJ/2015/12695 Editor(s): (1) Ram Kumar Pundir, Ambala College of Engineering and Applied Research, India. (2) Hung-Jen Liu, Distinguished professor, Director, Institute of Molecular Biology, National Chung Hsing University, Taiwan. Reviewers: (1) Anonymous, Federal University of Santa Maria (UFSM), Brazil. (2) Anonymous, MAHSA University, Malaysia. Complete Peer review History: http://www.sciencedomain.org/review-history.php?iid=666&id=8&aid=6319
Received 14 th July 2014 th Original Research Article Accepted 30 August 2014 Published 4th October 2014
ABSTRACT
Aims and Study Design: The stress honey medium expected to have spores with unique feature. Within this context, two honey isolates were identified, characterized, and evaluated as secondary metabolite producers. Place and Duration of Study: The study was undertaken in the National research center, 33 Al Behous, Dokki, Giza, Egypt. The duration of study was during the period of January 2012 to ______
*Corresponding author: Email: [email protected];
Kansoh et al.; BMRJ, 5(2): 152-168, 2015; Article no.BMRJ.2015.017
February 2013. Methodology: Two strains were isolated from mountain honey, Yemen. They were identified based on morphological characterization and 18S rRNA sequence analysis. Validation of novelty was supported further by their protein profile and randomly amplified polymorphic DNA PCR patterns (RAPD). Growth parameters were studied to determine optimum growth factors. In addition, they were undergone to enzymatic, antibiotic, antioxidant, ochratoxins and aflatoxins testes. Results: Two novel honey isolates were identified and designed as Aspergillus niger EM77 and Aspergillus awamori EM66. Intracellular protein profiles showed clear difference among the honey isolates and their references. The RAPD referred to 51% coincidence between the two isolates and showed different RAPD patterns between the references and honey isolates. Different parameters which affected isolates growth such as pH, temp, carbon and nitrogen sources were studied. Effect of NaCl concentrations referred to the halo-tolerant feature of both isolates. Both strains showed strong antimicrobial activity against Candida albicans , C. tropicalis and Pseudomonas species. Reducing power assay reported 82% and 83% antioxidant activity of Aspergillus niger EM77 and A. awamori EM66, respectively. Aflatoxins and ocratoxins tests revealed that both isolates had negative results. In addition, two fungal honey isolates showed relatively similar enzymatic activities. Conclusion: This research continues in highlights the honey as a new reservoir of unique isolates. In addition, it was suggested that the honey osmophilic stress carried spores have novel properties.
Keywords: Aspergillus awamori; Aspergillus niger; polymerase chain reaction; secondary metabolites; enzymes.
1. INTRODUCTION No vegetative forms of disease-causing bacterial species have been found in honey. The fungi Previously, honey reports focused in the strains isolated from different honey sources antimicrobial, antioxidant and anticancer agents were studied by many researchers. Felšöciová, of honey, but until now there is insufficient et al. [6] carried out characterization studies for information concerning honey isolates some honey samples from Poland on the basis characterization and their bioactive properties of their microbiological (fungi and yeasts) [1,2]. Knowledge concerning the moisture and analysis. The isolated fungi were Alternaria spp., temperature conditions influencing Aspergillus spp., Cladosporium spp., Fusarium microorganisms’ growth in honey has long been spp., Mycelia sterilia , Rhizopus spp. and used to control the spoilage of honey. Honey Penicillium spp. The status of the microorganisms usually come from pollen, the microorganisms found in honey in the spore form digestive tracts of honeybees, dirt, dust, air and called dormant [6]. The knowledge regarding the flowers. However, it is important to note that diversity and functions of honey microorganism’s honey frequently contains dormant endospores. community remains limited. However, the need Most of these organisms are said to be in for additional microbiological data on honey will inactive forms as they can hardly survive in increase as new technologies for, and uses of honey because of its several properties including honey develop [3]. The high osmolality, acidity hygroscopicity, hyperosmolarity, acidity, peroxide and antimicrobial properties of honey, content, antibiotic activities etc. Most of the recommended their microorganisms to have new honeybee isolates were identified as Bacillus feature and properties [4]. spp. and showed very strong activity against honeybee pathogens [3]. Esawy et al. [4] The Aspergillus genus belongs to a filamentous reported in six Bacillus subtilis isolated from fungal group characterized by wide dispersion in different honey sources. The six isolates were the environment. Some species are associated highly potential producer of antibiotic and with diseases, while others are of economical antioxidant activities. In addition, it was importance due to biotechnological applications. mentioned that aerobic spore-forming Bacillus Until this moment, there are rare reports in spp. was the most frequently encountered Aspergilli. as honey isolates [7]. Filamentous microbe on the external surface, crop and fungi such as Aspergillus niger are well known intestine of honeybees [5]. The spores of for their exceptionally high capacity for secretion Clostridium botulinum are found in a fraction of of proteins, organic acids, and secondary the honey samples tested normally at low levels. metabolites and they are therefore used in
153
Kansoh et al.; BMRJ, 5(2): 152-168, 2015; Article no.BMRJ.2015.017
biotechnology as versatile microbial production abundant food-contaminating mycotoxin. platforms [8]. Black-spored aspergilli are difficult Mycotoxins are secondary fungal metabolites to classify and the taxonomy of this section is still having toxic response with well-known health unclear [9]. A diagnostic phenotypic procedure effects including; carcinogenesis, and immune- based on biochemical traits on agar media along suppression [16]. Nevertheless, studies have with some molecular approaches has been shown that less that 10% of the A. niger strains recently reviewed [10]. The 18S rRNA gene is a were tested positive for ochratoxin A, under molecular marker helps in introducing a large conditions that were favorable [17]. number of sequences available in the data banks [11]. SDS PAGE protein pattern analysis is an In the present study, two fungal strains were easily method to distinguish between Aspergillus isolated from mountain honey, the morphological spp. This technique can be successfully and molecular identification by18SRNA were implemented with proper assessing techniques achieved. The protein pattern and the fingerprint to evaluate the degree of similarity among were done to distinguish between the two species of the same genus or of closely related isolates. In addition, the effect of different genera [12]. The RAPD method has several temperature, pH, carbon and nitrogen sources, unique advantages: it is extremely fast (yielding and NaCl concentrations were studied. Finally, results within 48 h), it has potential to the antioxidant, antimicrobial and some discriminate between closely related strains enzymatic activities of the fungal strains were (provided multiple primers are used), it works investigated. The results pointed to the isolates well with crude DNA lysates hence eliminating novelty. the cost of extensive purification, and it has been used with great success for several types of 2. MATERIALS AND METHODS fungal species [13]. Moreover, it has a role in evaluation the novelty of strains [14]. 2.1 Sample Collection
Until now, there is scarce information concerning Two isolates were isolated from Yamane enzymes from honey microorganisms [1]. Last honeybee collecting nectar from mountain flower. few years, researchers have paid attention to the Honey samples are fresh non-treated ripe honey enzymatic products of the honey isolates. (directly collected in beehives) in sterile vials. Recently, it was reported in levansucrase from six novel honeys Bacillus subtilis isolates 2.2 Isolation of Fungal Strains from capable of producing antiviral levans [1]. On the other hand, a new isolate was identified as Honey Samples Aspergillus sp. M1; was isolated from honeycomb and characterized as a good Honey samples one hundred micro liters was invertase producer [15]. Similarly, the dextranase spread on Czapek Dox agar plates (g/L): production from Bacillus subtilis KNRC honey Sucrose, 20.0; Na 2NO 3, 2.0; KCl, 0.5; MgSO 4, isolates was mentioned by Esawy et al. [2]. 0.5; FeSO 4, 0.01 and Agar, 20.0; pH 6. The plates were incubated at 30°C for 72h. The Honey has natural antioxidant properties that individual colonies were transferred separately to could destroy biologically destructive chemical the same medium and the growth was observed agents, which have been linked to many for 72h. The selected fungal isolates were diseases such as cancer, also the antimicrobial maintained onto Czapek Dox agar plates and activity of honey and its role in wounds is well preserved at 4°C. The purity of the fungal known. The antioxidant and antimicrobial studies isolates was assessed by colony morphology of honey isolates activity were still uncommon. and microscopy [18]. Previously, bacillomycin F produced by a bacterial honey isolate was purified and showed 2.3 Identification of the Two Isolates antimicrobial activity against Byssachlamys fulva [5,4]. On the other hand, Esawy et al. [2] showed For morphological identification, filamentous antioxidant and antimicrobial properties of six fungi were initially cultured on PDA medium Bacillus subtilis honey isolates. (Merck) (g/L): 200 potatoes (sliced washed unpeeled), 20 dextrose, 20 agar. The colonies Moreover, the species of filamentous fungi were observed with an optical microscope for produces several secondary metabolites; one of preliminary identification. This was done by the most important was ochratoxin A., as an morphotypic analysis of the colony, especially
154
Kansoh et al.; BMRJ, 5(2): 152-168, 2015; Article no.BMRJ.2015.017
color and appearance, using the method of Pitt & Vertical Slab gel unit, Model SE-400. The Hocking [19]. Initial identification of the genera prepared samples were loaded on the gel at Aspergillus was made with microscopic slide constant Voltage of 150V and 15 mA, until the examination of spores and mycelium. bromophenol blue dye reached the bottom of the gel. The duration of the separation was about 5-6 2.4 Molecular Analysis hours. The gel was directly placed in the Coomassie brilliant blue staining solution Culture and collection of the mycelium was overnight. The gels were destained several times carried out as reported by Zhao et al. [20]. For for twelve hours in the destaining solution. After sequence analysis DNA was extracted from the destaining, the gel was photographed, dried and tow isolates using a fungal sequences DNA kept for comparison. isolation kit (RKT13: Chromous Biotech, India). The 18S rDNA sequences were amplified by 2.7 Subunit Molecular Weight Estimation (polymerase chain reaction PCR) with primer by SDS-PAGE pairs 413 bp. (GTGGGGGTAGGATGAGATGATG) and BA1r The labimage program was used to determine (TGAGTGCTGGCGGAAACAAA). QIA quick the apparent (subunit) molecular weight of PCR purification kit (Qiagen, Germany) was used proteins dissolved or extracted in the presence of to purify the amplified products of BA2f/BA1r SDS. Electrophoretic mobility’s were calculated specific primer of 20 fungal isolates. relative to the mobility of the bromophenol blue marker band in 12% and 5% polyacrylamide slab A GeneAmp PCR System 9700 (Perkin Elmer, gel. The following proteins were used as Norwalk, CT) thermo-cycler device was used molecular weight standards for the samples: with the following program: 94°C for 5min, as (232.0 KDa), (218.0 KDa), (210.0 KDa), initial denaturation cycle and 35 cycles consisting (208.0KDa), (180.0KDa), (175 KDa), (133 KDa), of denaturation at 94°C for 30 sec, annealing of (130 KDa) , (122 KDa), (115 KDa), (110 KDa), primer at 60°C for 30 sec and extension for 1 min (96 KDa), (92 KDa), (87 KDa), (81 KDa), (77 at 72°C and finally addition of 3` terminal at 72°C KDa), (76 KDa), (74 KDa), (72 KDa), (71 KDa), for 10 min. (67 KDa), (65 KDa), (60 KDa), (59 KDa), (47 KDa), (45 KDa), (41KDa), (39 KDa), (38 KDa), 2.5 PCR Amplification (37 KDa), (36 KDa), (35 KDa), (33 KDa), (19 KDa), (17 KDa), (8 KDa), (7 KDa), (5 KDa), (2 PCR amplification was performed according to KDa). Thompson et al. [21] in a total reaction volume of 25 l. The nucleotide sequences were edited and 2.8 Differentiation of Two Isolates by carried out using CLUSTAL/W (1.82) Finger Printing (RAPD-PCR http://www2.ebi.ac.uk/clustalw [21]. Bootstrap Conditions and Analysis) neighbor-joining tree was generated using MEGA version 3.1 from CLUSTAL/W alignments [22]. Twenty-three short- mer arbitrary primers were Comparisons with sequences in the GeneBank used for RAPD analysis. Sequences of all database were achieved in BLASTN searches at primers are: the National Center for Biotechnology
Information (NCBI) site G-17 5'-ACGACCGACA-3, H-18 5'- (http://www.ncbi.nlMnih.gov ). GAATCGGCCA-3', H-01 5'- GGTCGGAGAA-3',
B-10 5'- CTGCTGGGAC-3', Q-15 5'- 2.6 Sodium Dodecyl Sulphate- GGGTAACGTG-3', Z-02 5'-CCTACGGGGA- Polyacrylamide Gel Electrophoresis 3', H-03 5'-AGACGTCCAC-3', M-18 5'- for Separation of Denatured Proteins CACCATCCGT-3', G-04, 5'AGCGTGTCTG-3', Z-08 5'-GGGTGGGTAA-3', Z-02 5'- The extracts of fungi were analyzed by making CCTACGGGGA-3', H-01 5'- GGTCGGAGAA-3', use of SDS-PAGE method with 12% separating M-18 5'- CACCATCCGT-3', Q-15 5'- gel and stacking gel 5% in a discontinuous buffer GGGTAACGTG-3', H-18 5'-GAATCGGCCA-3', system according to the method of Laemmli [23]. Q-07 5'-CCCCGATGGT-3', Q-09 5'- Thirty µl of the protein extract were mixed with 5 TCCCACGCAA-3', Q-08 5'-CCTCCAGTGT-3', µl of sample buffer, then heated in a boiling Z-07 5'-CCAGGAGGAC-3', M-05 5'- water bath for 3 minutes for protein denaturation. GGGAACGTGT-3', G-11 5'-TGCCCGTCGT-3', Electrophoresis was carried out using Hoefer
155
Kansoh et al.; BMRJ, 5(2): 152-168, 2015; Article no.BMRJ.2015.017
O-18 5'-TGCCCGTCGT-3', H-08 5'- Pair-Group Method with Arithmetical Averages) GAAACACCCC-3' using NTSYS-PC software [25]. Aspergillus niger obtained from Taxonomy Department, Ain Shams University, Cairo, Egypt 2.10 Fermentation Conditions and Aspergillus awamori is commercial isolate from Japan . The both are soil isolates. They The Czapek Dox (CMF) liquid medium were used through this study as reference and (mentioned above) was used for enzyme marked as C and C w, respectively. production under submerged fermentation (CMF). Cultivation was carried out in 250 ml For RAPD analysis, PCR amplification was Erlenmeyer flasks each containing 50 ml of 6 carried out in a 25 µl final volume containing; 2.5 sterile medium After inoculation (10 spores/ml), µl 10 x PCR buffer, 1 µl 10 mM Mg Cl 2, 1 µl 2.5 the flasks were incubated at 30°C for three days mM dNTPs (for each), 1 µl (50 pmol) of primer, 1 in an incubator shaker at 150 rpm At the end of µl (approximately 50 ng) of fungal template DNA, fermentation period, the supernatant was 0.3 µl (5 units µl -1) Taq DNA polymerase harvested by filtration and was used as crude (Promega, Germany) and 18.2 µl sterile distilled enzyme extract. The mycelia mass was collected H2O. PCR amplification was performed in a and its dry weight was determined. thermal cycler (Eppendorf, Germany) programmed for one cycle at 94°C for 5 min 2.11 Effect of Different Growth followed by 35 cycles each with 30 s at 94°C for Parameters denaturation, 1 min at 30°C for annealing and 2 min at 72°C for extension. Reaction mixture was 2.11.1 Temperature then conducted at 72°C for 10 min for final extension and hold at 4°C. The cultivation medium Czapek Dox (CMF) was incubated at different temperatures (25, 30, 35, Five µl of the PCR amplification products were 40 & 45°C) for 72h to study their effect on the mixed with 2 µl of 6X gel loading dye and loaded fungal isolates growth. onto1.5% agarose/0.5X TBE gels. One kbp DNA ladder (New England Biolabs) with size marker, 2.11.2 pH values ranged from 100 to 1000 bp was used as In this experiment, the pH of culture medium was molecular size standard. Electrophoresis was adjusted to pH (2.0-9.0) by using 0.1 N HCl or performed at 100 Volt with 0.5X TBE as running 0.1N NaOH. The cultivation medium (CMF) was buffer. The gel was stained in 0.5 µg/ml (w/v) incubated at 30°C for 72h. ethidium bromide solution and distained in deionized water for 10 min [24] and visualized on 2.11.3 Carbon sources an ultraviolet dual intensity trans illuminator (WVP, USA), and photographed using gel In order to measure the effects of different documentation system (WVP, USA). carbon sources on fungal isolates growth, the sucrose in CMF was replaced by 2% (w/v) of 2.9 Data Handling and Cluster Analysis different carbon sources (Fructose, Galactose, Mannose, Lactose, Casein, Glucose, Cellulose Data were scored for computer analysis on the and pectin). basis of the presence or absence of the amplified products for each primer. Presence and absence 2.11.4 Nitrogen sources of RAPD bands produced from the use of four primers were scored visually from the resulting Addition effect of equal-molar amounts of photographs. different inorganic nitrogen (NaNO 3, NH 4NO 3, (NH 4)3PO 4, (NH 4)2HPO 4, NH 4H2PO 4, NH 4Cl, If a product was present in fungal genotype, it KNO 3) and organic nitrogen (Yeast extract, was designated '1', and if absent it was Peptone) sources on fungal isolates growth was designated '0' after excluding un-reproducible also studied. bands. Pair-wise comparison of genotypes, based on the presence or absence of unique and 2.11.5 NaCl concentrations shared polymorphic products, was used to generate similarity coefficients, which were used In this experiment, the salinity effect on the to construct a dendrogram by UPGMA (Unweight growth of fungal isolates was carried out by growing the organisms in CMF medium
156
Kansoh et al.; BMRJ, 5(2): 152-168, 2015; Article no.BMRJ.2015.017
contained different final concentrations of NaCl sugars as glucose/min. Levansucrase assays (2, 4, 6, 8, 10, 12 & 14%) at the same previous were performed according to the method of conditions. Yanase et al. [29] with some modifications [30]. One unit of enzyme activity was defined as the 2.12 Antioxidant Property (Radical amount of enzyme that produced decreasing Scavenging Activity) sugars equivalent to one mol glucose/min . Invertase activity was measured by the release The assay of di-phenyl-picryl-hydrazyl (DPPH) of reducing sugars according to Miller 1959 [31]. was carried out according to Bhandari and One unit of enzyme activity (U) was defined as Kawabata [26]. Aliquots (2 ml) of the fungus amount of enzyme that releases one µmol of isolates spore suspension were added to 50 ml glucose per min under the assay conditions . of CMF medium, and incubated at 30°C for one Dextranase activity was measured using the day. The medium were centrifuged; 1 ml of the Somogyi-Nelson method [32] and dextran of filtrate was lyophilized, and then re-dissolved in 1 molecular weight 250 KDa was used as ml of methanol. Fifty- l volumes of methanolic substrate. One unit (U) of enzyme is defined as extract were added to 5 ml of 0.004% methanol the amount of enzyme, which liberates one mol solution of DPPH. After 50 min incubation period of glucose equivalent in one min. Inulinase at dark, the absorbance was read against a blank activity was measured using the Somogyi - at 517 nM Free radicals DPPH inhibition in Nelson method [32]. One inulinase unit was percent was calculated as follows: defined as the amount of enzyme liberating one micromole of fructose equivalent per minute I (%) = (A blank – A sample/A blank) ×100 under the tested conditions. The pectinase activity was determined using by the Somogyi- Where: A blank is the absorbance of the control Nelson method [32]. One unit (U) of pectinase reaction (containing all reagents except the test activity was defined as the amount of enzyme compound), and A sample is the absorbance of producing one µmol galacturonic acid per min . the test sample. Exochitinase activity was determined according
to the method of Matsumoto et al. [33] using the 2.13 Antimicrobial Properties chromogenic substrate p- nitro phenyl-β-D-N- acetyl glucose aminide (PNP-β-GlcNAc) as a The antimicrobial tests were carried out by the substrate One unit of the enzyme activity was disc-diffusion method [27]. Each culture of both defined as the amount of enzyme releasing isolates was cultivated into 50 ml of nutrient broth 1µmol of P-nitrophenol per minute under the media, incubated shaking at 30°C for 3 days. specified assay conditions. The media were centrifuged, the filtrates were extracted by 150 ml ethyl acetate several times, 2.15 Determination of Aflatoxins by HPLC then dried under reduced pressure at 40°C and 50 g of culture extract were dissolved in one ml Derivatization: The derivatives of tested samples ethyl acetate. One hundred l of the culture and standards were done as follow: extract were used to saturate filter paper discs (6 mm diameter) and placed gently on the surface Two-hundred µl hexane were added to the clean of nutrient agar medium previously inoculated up dry film of standard and tested samples with one ml of cell suspension of clinical tested followed by 50µl Trifluoroacetic acid (TFA) and strains. Negative controls were prepared using mixed by vortex vigorously for 30s. The mixture the ethyl acetate alone. The plates were was let to stand for 5 min. To the mixture, 450 ml incubated at 30°C for 72 h. Antimicrobial activity water-acetonitrile (9+1, v/v) was pipetted into the was evaluated by measuring the zone of mixture and mixed well by vortex for 30 seconds, inhibition against the test organisms. and the mixture was left to stand for 10 minutes to form two separate layers. The lower aqueous 2.14 Enzymatic Assays layer was used for HPLC analysis (AOAC 2000).
The amylase, invertase, levansucrase, An isocratic system with water: methanol: dextranase, inulinase, pectinase, and acetonitrile 240:120:40 [34]. The separation was exochitinase activities were determined . performed at ambient temperature at a flow rate Amylase activity was done according to the of 1.0 ml/min. The injection volume was 20 µL for method of Bergmann et al. [28]. One unit of both standard solutions and sample extracts. The enzyme activity (U) was defined as the amount of fluorescence detector was operated at the enzyme liberating one µmole of reducing
157
Kansoh et al.; BMRJ, 5(2): 152-168, 2015; Article no.BMRJ.2015.017
wavelength of 360 nm for excision and 440 nm Aspergillus niger and Aspergillus awamori for emission. respectively (Table 1). It is being increasingly recognized that comparative sequence based Quantitation: The mixed solutions of standard as methods used in conjunction with traditional well as sample extract after derivatization were phenotype based methods could offer better filtered through a 0.22 mm membrane filter and resolution of Aspergillus species [36]. loaded (20 mL) into a 20-µL injection loop. The Accordingly, 18S rRNA gene sequence was elution order of the four aflatoxins was G2, B2, used. The aligned sequence of this amplified 566 G2a (G1 derivative), B2a (B1 derivative). AFs bp region of the 18S rRNA segment from isolate contents in samples were calculated from A and 640 bp 18S rDNA segment from isolate E chromatographic peak areas using the standard was submitted to Genbank. After homology curve. searching against the Genbank, the sequences of isolate A was found to share 96% similarity 2.16 Determination of Ochratoxin by with those of Aspergillus niger and isolate E was HPLC found to shear 95% similarity with those of Aspergillus awamori . They were designed as The fore-mentioned columns elutes were Aspergillus niger EM77 (KF774181) and dissolved in 500 µl mobile phase consisted of Aspergillus awamori EM66 (KF774180). A acetonitrile: water: acetic acid (99:99:2) and phylogenetic relationship was established filtered through 0.45 µm micro-filter into 5ml through the alignment and cladistic analysis of screw-capped vial for subsequent HPLC homologous nucleotide sequences among these analyses. High performance liquid fungal for both isolates (Figs.1 a,b). The similarity chromatography (HPLC) was used to ochratoxins percent less than 97% pointed to the novelty of A determination. The system equipped with both isolates. The 18S rRNA gene as a (Waters 600) delivery system HPLC column; a molecular marker offers the advantage of a large reverse phase analytical column packed with number of sequences available in the data banks C18 material (Spheris orb 5 µm ODS2, [10]. The following part aimed to compare 15cm×4.6nm). The detection was performed between the two stress honey isolates and their using the fluorescence detector, which was references from normal soil medium (Fig. 2). operated at an excitation wavelength of 330 nm Data analyzed by the gel document system (GD), and an emission wavelength of 460 nm .The indicated that the total number of protein bands separation was performed at ambient of honey isolates and its references ranged from temperature at a flow rate of 1.0 ml/ min. Data 14-18 band (Table 2). In general, the results were integrated and recorded using a Millennium pointed to unique characteristic profile of each Chromatography. Manger Software 2010 honey isolate. In Aspergillus niger EM77 and its (Waters, Milford MA01757). Quantitation: reference the pattern of bands suggested the Calculated from chromatographic peak areas presence of two common bands in the stressed using a standard curve. and normal isolates. The first and second bands were at 92KDa and 38KDa, respectively. The 3. RESULTS AND DISCUSSION honey isolate showed ten new bands with
different MW compared with its reference. In Extreme environments have long been Aspirgillus awamori EM 66 and its reference the considered as the best medium for unique pattern of bands suggested the presence of microorganisms. Thus, the researchers paid seven common bands. They were at 122, 92, 65, attention to honey isolates characteristics and 55, 33, 8, 2 KDa. It revealed new eleven bands their bioactive products [1,35,15]. with different MW as it compared with its The present study aimed to reply the question of reference. The new bands could be due to the whether the honey dormant spores have response of these isolates to honey osmophilic properties or features recommended them to be stress. Also, it was an indication to the novelty of considered as unique strains. Within this context, these isolates. two fungi were isolated from Yamane mountain It was found that although RAPD-PCR analysis honey on mature stage. They were identified could be applied as a simple, rapid, and very based on their morphological examination and effective method for differentiating Aspergillus the results were confirmed by using 18SrRNA strains, selecting the best primers is a critical gene sequences. The microscopic examination step to reach the desirable potential of the two strains revealed that the isolate (A) discrimination [37]. RAPD analysis is also used and isolate (E) fungi were belonging to the
158
Kansoh et al.; BMRJ, 5(2): 152-168, 2015; Article no.BMRJ.2015.017
to confirm the strain novelty [38]. Accordingly, the favorable carbon source for both isolates growth random amplified polymorphic DNA (RAPD) was was mannose, followed by pectin and cellulose implemented by using 10 primers, a total of Moreover, the best nitrogen source for both different reproducible RAPD markers were strains was casein, followed by NH 4Cl. These generated from the isolate genomes. Record of results confirmed the similarity between the two presence or absence of molecular weights isolates. Similar result was obtained by corresponded to RAPD primers, was evaluated. Kosalková et al. [42], since Aspergillus awamori In addition, 10 primers gave representative achieved increase (40 to 80-fold) in mass profiles for the fungal isolate clusters (Fig. 3a). In production with casein or casein RAPD-PCR analysis by using 10 primers, phosphopeptides (CPPs). On the other side, it different reactions were generated from both was reported that maltose supported Aspergillus fungal isolates. It was concluded that distinct niger growth substantially more than either RAPD fingerprints among the different species sucrose, glucose or fructose [43]. For were obtained when suitable primers were used determination the effect of NaCl on the two [39]. According to these results, the RAPD isolates growth, they were cultivated in the technique indicated 51% coincidence between presence of different NaCl concentrations (2- fungi A and fungi E, indicating a relative similarity 14%). The results showed that both of them were between these two isolates. Our results were in characterized by the halo-tolerant feature, since agreement with Ferracin et al. [40]. Randomly the Aspergillus EM77 (KF774181) and amplified polymorphic DNA (RAPD) patterns of Aspergillus awamori EM66 (KF774180) could whole-cell lysates from Aspergillus niger EM77 grow in the presence of 10 and 12% NaCl including one reference ( A. niger, soil isolate ) respectively. Above this concentration, none of was done (Fig. 3b). The result revealed the tested fungi could grow (Table 3). Many polymorphism in 51% between the two isolates. authors talk about the halotolerant property of In addition, RAPD patterns of whole-cell lysates Aspergillus sp. [44]. from Aspergillus awamori EM66 by using Aspergillus awamori soil isolate as reference was Filamentous fungi have been identifying as implemented (Fig. 3c) . The result revealed promising hosts for the production of polymorphism in 58% of the two analyzed recombinant proteins due to their desirable Aspergillus awamori . This result indicated clearly growth characteristics. They can produce and the novelty of the two isolates and it could be secrete exceptionally large amounts of protein attributed to the presence of these isolates under [45]. Synthesis of enzymes depends on the type stress, which affects the molecular structure of its of nutrients available to the organism and dormant spores to adapt its harsh environment. besides an adequate carbon source; other On contrary, [41] showed RAPD patterns of nutrients could be equally important to the whole-cell lysates from five Aspergillus niger composition of the medium [46,47]. Within this isolates, including one reference strain, two context, some enzymatic activities studies were isolated from deep freeze, and two achieved. The results referred to the ability of environmental strains from soil and plant both isolates to produce different amounts of infections. Comparison of deep freeze isolates important enzymes (Table 4). The most showed identical RAPD patterns in some of the pronounced activity was noticed with pectinases, reference and environmental isolates. levansucrase and chitinases. This result explained clearly the high mass production for The following part aimed to evaluate different the tow fungi in the presence of pectin as parameters, which affected the isolates growth substrat. It was mentioned by Carpita and and summarized it in Table (3). The results Gibeaut [48] that A. niger produced pectinase as indicated that the optimum pH and temperature major enzyme to degrade pectin though there for the maximum growth were the same for both are many other enzymes also secreted but the fungal isolates (pH7 and 30°C). Below and prominent one is pectinase [49]. On the other above the previous values the fungi growth side, many authors reported in Aspergillus decreased gradually. In addition, the results awamori as a good pectinase producers [50]. indicated the isolates ability to grow in wide pH This result confirmed the potentially of both range (2-9). isolates in producing important enzymes and referring to its unique characteristic. On the other hand, both isolates have the ability to grow in all the used carbon and nitrogen Fungi are known to produce a vast array of sources. In addition, the results cleared that most secondary metabolites that are gaining
159
Kansoh et al.; BMRJ, 5(2): 152-168, 2015; Article no.BMRJ.2015.017
importance for their biotechnological Pseudomonas sp . The two isolates had negative applications. Accordingly, the antimicrobial effect on Escherichia coli . In this concern, it was activity of both fungi was tested. Table (5) reported in Bacillus subtilis M honey isolate as showed significance antimicrobial activities of the strong antimicrobial agent against Candida Aspergillus niger EM77 and Aspergillus awamori albicans ATCC2443 [4]. On contrary, Fawzy et EM66 against Candida albicans and tropicalis, al. [51] reported that the extracellular extracts of
Table 1. Morphological identification of the two isolates
Character Examination Isolate (A) Isolate (E) * Culture exam.: Colonies typically purple Colonies on Czapek agar growing rapidly attaining Growth characteristics black powdery. On dox a diameter of 5.0 cm in 7 days, white basal media reaching 6-7 cm in mycelium bearing abundant conidial structures seven days at 28-30°C. with black color and white at the margin. * Microscopic exam. Hyphae are dark brown and Hyphea septate, averaging 2.5-4.2 m in diameter. Conidiophores Conidiophores arising from Conidiophores thick walled 13.5 µm diameters. long, broad, thick walled, branched foot cells, 10-13 ųm, in diameters. Phialides Phialides borne on directly - on vesicale, born on metulae, conidial head black. Strigmata Strigmata biseriate, primary (9.0 X 3.0 µm), secondary (7.0 X 2.6 m). Vesicles Vesicles appear globose Vesicle globose, 47 µm in diameter, fertile over shape 20-35 ųm, diam., their entire surface. Conidia Conidia in large, mostly Conidia globose, 4.8 µm. globose to subglobose, black in color, irregularly roughened 4.0-5.0 ųm, diam.,uninucleate.
Fig. 1a. Phylogenetic tree for the isolated fungus Aspragillus niger and the other A. niger isolated fungus listed on gene bank data base. The phylogeny was constructed based on the DNA nucleotide sequence of the 18S rRNA gene. The program was used in the tree construction is Mega4 program
160
Kansoh et al.; BMRJ, 5(2): 152-168, 2015; Article no.BMRJ.2015.017
KF154412 JN676109 JX945161 HQ170509 AY656630 62 HQ014691 HQ670692 HQ392477 47 KF305756 KF031033 70 KC895529 KF305758 JX559852 FJ040211 95 JN565296 A awamori
0.05 0.04 0.03 0.02 0.01 0.00
Fig. 1b. Phylogenetic tree for the isolated fungus Aspragillus awamori and the other A. awamori listed on gene bank database. The phylogeny was constructed based on the DNA nucleotide sequence of the 18S rRNA gene. The program was used in the tree construction is Mega4 program
Fig. 2. Electrophoretic protein patterns of the Aspragillus niger EM77 (1) and its reference (C1) and Aspragillus awamori EM66 (2) and its reference extracts by SDS-PAGE method
161
Kansoh et al.; BMRJ, 5(2): 152-168, 2015; Article no.BMRJ.2015.017
Table 2. Number of protein bands under study based on molecular weight (kilodalton) observed by the SDS-PAGE technique: soil isolate Aspergillus niger (C1), honey isolate Aspergillus niger EM77 (1), soil isolate Aspergillus awamori (C2) , honey isolate Aspergillus awamori EM66 (2)
Band No. Band molecular weight (kDa) C1 1 C2 2 1 232 + − − − 2 218 − + − − 3 210 − − − + 4 208 − − + − 5 180 − + − − 6 175 + − − − 7 133 + − − − 8 130 − + − − 9 122 − − + + 10 115 − − − + 11 110 − − + − 12 96 − − + − 13 92 + + + 14 87 − − + − 15 85 − + − − 16 84 + − − + 17 81 − + − − 18 77 − − + − 19 76 − + − − 20 74 − − + − 21 72 + − − − 22 71 − − − + 23 67 − + − − 24 65 − − + + 25 60 − − + − 26 59 − − − + 27 55 − − + + 28 52 − + − − 29 47 + − − + 30 45 + − + − 31 41 + − − + 32 39 − − + − 33 38 + + − + 34 37 + − + − 35 36 + − − + 36 35 − − + − 37 34 − − − + 38 33 − − + + 39 19 + − − − 40 17 − + − − 41 8 − − + + 42 7 − + − − 43 5 + − − − 44 2 − − + +
162
Kansoh et al.; BMRJ, 5(2): 152-168, 2015; Article no.BMRJ.2015.017
Fig. 3. Amplified polymorphic DNA fragments (bands) that produced by 10 primers in PCR reaction to discriminate the similarity between a.Lane 1, Aspergillus niger EM77; and lane 2, Aspergillus awamori EM66. b.Lane C. Aspergillus niger soil isolates and Lane 1 Aspergillus niger EM77 honey isolate. c.Lane C w. Aspergillus awamori soil isolates and Lane 2 Aspergillus awamori EM66
163
Kansoh et al.; BMRJ, 5(2): 152-168, 2015; Article no.BMRJ.2015.017
Table 3. Effect of different parameters in honey isolates growth
Mycelia weight Mycelia weight Mycelia weight Mycelia weight Mycelia weight mg mg mg mg mg pHs A. niger A. Temp. A. niger A. Carbon A. nig er A. Nitrogen A. niger A. NaCl (%) A. niger A. awamori (ºC) awamori sources awamori sources awamori awamori 2.0 9.5±0.7 8.5±0.7 30 54.0±1.4 41.5±0.7 without 00 0 0 without 0±0.0 0±0.0 without 59.0±1.4 40±0.7 3.0 19.0±1.4 20.0±2.8 35 46.5±0.7 37.0±1.4 Sucrose 50.5±0.7 42±0.7 NaNO 3 42±1.4 41±1.4 2 52.5±3.5 38±1.4 4.0 23.5±2.1 29.0±1.4 40 31.0±1.4 37.0±2.1 Fructose 45.0±1.4 40±1.4 NH 4NO 3 52±1.4 59±1.4 4 44.0±1.4 34±0.7 5.0 40.0±0.7 36.0±0.0 45 10.00± 19.5±0.7 Galactose 51.0±1.4 42±1.4 (NH 4)3PO 4 60±0.0 49±2.8 6 40.0±2.8 30±1.4 6.0 42.0±1.4 41.0±1.4 50 0 0 Mannose 83.0±4.2 77±1.4 (NH 4)2HPO 4 42±1.4 44±1.4 8 33.0±4.2 26±0.7 6.5 51.0±1.4 .44 ±.0.04 - 0 0 Lactose 44.5±2.1 33±1.4 NH 4H2PO 4 38±2.8 61±1.4 10 22.00.0 22±1.4 7.0 57.5±0.7 46.0±2.8 - - - Glucose 48.5±0.7 41±1.4 NH 4Cl 70±1.4 720.0 12 - 10±0.7 7.5 38.0±2.8 34.0±2.8 - - Cellulose 63.0±4.2 47.5±1.6 KNO 3 60±0.7 42±1.4 14 - - 8.0 31.0±1.4 25.5±0.7 Pectin 69.0±1.4 82±2.8 Yeast extract 55±0.0 43±1.4 - - 9.0 9.0±1.4 7.5±0.7 Peptone 70±0.0 80±1.4 -
Table 4. Enzyme activities of the two honey isolates in response to particular substrates
Tested enzymes Substrates Aspergillus niger EM77 Aspergillus awamori EM66 Honey enzyme activity U/ml U/ml U/ml Glucose oxidase Glucose 1.3±0.04 0 0.4±0.02 Invertase Sucrose 3.8 ±0.03 3.2±0.02 1.6±0.03 Levansucrase Sucrose 51 ±0.50 52±0.09 2.0±0.02 Amylase Starch 3.4±0.04 3.0±0.01 0.3±0.02 Dextranase Dextran 1.4 ±0.001 0.6±0.003 0.32±0.004 Inulinase Inulin 2.4±0.004 3.0±0.02 0 Pectinase Pectin 208±2.20 223±1.40 0 Chitinase Chitin 25±0.02 44±0.09 0 Protease Casein 0 0 0
164
Kansoh et al.; BMRJ, 5(2): 152-168, 2015; Article no.BMRJ.2015.017
Table 5. Antimicrobial activity of Aspergillus awamori EM66 and Aspergillus niger EM77
Isolates Aspergillus niger EM77 Aspergillus awamori EM66 (KF774181 ) (KF774180 ) Test orga nisms Zone diameter (mm) Zone diameter (mm) Candida tropicalis AINSH 25±0.06 22±0.04 Candida albicans ATCC2443. 15±0.02 12±0.04 Pseudomonas sp . 17±0.03 15±0.01 Escherichia coli ATCC25922 0 0
Aspergillus niger and Aspergillus flavus var. biochemical tests confirmed strongly the novelty showed their activity against Gram-negative of these honey isolates, as potential secondary bacteria only and they have no effect on Candida metabolite producers. All the previous results albicans . Moreover, antioxidant activity was recommended both isolates to be used in accessed by the reducing power assay. The tow industrial application in different aspects. isolates exhibited great antioxidant activities. The results registered 82 & 83% antioxidant activities COMPETING INTERESTS for Aspergillus niger EM77 and Aspergillus awamor i EM66, respectively. The antioxidant Authors have declared that no competing activity of Aspergillus spp. was established by interests exist. many authors [52]. REFERENCES Often, the capacity for the production of toxic or non-toxic metabolites (e.g., mycotoxins, proteins) 1. Esawy MA, Ahmed EF, Helmy WA, needs to be investigated to create a basis for Mansour NM, El-Senousy WM, El-Safty reliable risk assessment [53]. Aflatoxins and MM. Production of levansucrase from ocratoxins test recorded that both the isolates novel honey Bacillus subtilis isolates had negative results. It is not surprising to find capable of producing antiviral levans. that none of Aspergillus sp . has produced Carbohydr Polym. 2011;36:823-30. aflatoxins, because the production depends not 2. Esawy MA, Mansour SH, Ahmed EF, only of the genetic competence of the strains, but Hassanein NM, El Enshasy HA. is also influenced by a quite wide range of factors Characterization of Extracellular (substrate composition, very low water activity Dextranase from a Novel Halophilic (Aw ) and acidity of honey) and ecological Bacillus subtilis NRC-B233b a Mutagenic conditions [54]. Checking for ochratoxin A, a Honey Isolate under Solid State mycotoxin, can reduce any risks and will yield A. Fermentation. E J Chem. 2012;9:1494- niger as a safe organism [55]. 510.
4. CONCLUSION 3. Snowdon JA, Cliver DO. Microorganisms in honey. Int J Food Microbiol. 1996;31:426-35. This research continues in highlights the honey 4. Esawy MA, Awad GEA, Mansour H, as a new reservoir of unique isolates. In addition, Ahmed EF, Danial EN. Evaluation of honey it was suggested that the honey, with osmophilic as new reservoir for probiotic bacteria. Adv stress, carried spores have novel properties. The Food Sci. 2012;43:72-81. study referred to the isolation of two fungal spp. 5. Lee H, Churey JJ, Worobo RW. that were designed as Aspergillus niger EM77 Purification and structural characterization (KF774181) and Aspergillus awamori EM66 of bacillomycin F produced by a bacterial (KF774180). The molecular study through 18S honey isolate active against Byssochlamys rRNA sequence analysis, protein pattern and fulva H25. J Appl Microbiol. 2008;105:663– randomly amplified polymorphic DNA PCR 73. patterns (RAPD) was pointed to the isolates 6. Felšöciová S, Ka čániová M, Hleba L, novelty. Besides, the biochemical study showed Petrová J, Pavelková A, Dzugan M, that both isolates were efficient source for Grabek-Lejko D. Microscopic fungi isolated important enzymes. Both isolates showed strong from polish honey. Journal of Microbiology, antimicrobial and antioxidant activities. The Biotechnology and Food Sciences. aflatoxins and ocratoxins tests revealed that both 2012;2(3):1040-9. isolates had negative results. Accordingly, the
165
Kansoh et al.; BMRJ, 5(2): 152-168, 2015; Article no.BMRJ.2015.017
7. Olaitan BP, Adeleke OE, Ola IO. Honey: A 20. Zhao K, Zhou DP, Ping WX, Ge JP. Study reservoir for microorganisms and an on preparation and regeneration of inhibitory agent for microbes. Afr Health. protoplast from taxol-producing fungus 2007;Sci.7:159-65. Nodulisporum sylviforme . Nat Sci. 8. Kwon MJ, Jørgensen TR , Nitsche BM , 2004;2:52-9. Arentshorst M, Park J, Ram A FJ, Meyer 21. Thompson JD, Higgins DG, Gibson TJ, V. The transcriptomic fingerprint of Clustal W. Improving the sensitivity of glucoamylase over-expression in progressive multiple sequence alignment Aspergillus niger. BMC Genomics. through sequence weighting, position- 2012;13:701-801. specific gap penalties and weight matrix 9. Geiser DM, Klich MA, Frisvad JC, choice. Nucleic Acids Res. 1994;22:4673- Peterson SW, Samson RA. The current 80. status of species recognition and 22. Kumar S, Tamura K, Nei M. MEGA3: identification in Aspergillus . Stud Mycol. integrated soft ware for molecular 2007;59:1-10. evolutionary genetic analysis and 10. Samson RA, Noonim P, Meiger M, sequence alignment. Brief Bioinformatics. Houbraken, J, Frisvad JC, Varga J. 2004;5:150–63. Diagnostic tools to identify black aspergilla. 23. Laemmli UK. Cleavage of structural Stud Mycol. 2007;59:129-45. proteins during the assembly of the head 11. Anderson IC, Campbell CD, Prosser JI. 6 of bacteriophage. Nature T4. Potential bias of fungal 18S rDNA and 1970;227:680-5. internal transcribed spacer polymerase 24. Sambrook J, Fritsch EF, Maniatis T. chain reaction primers for estimating fungal Molecular cloning: A laboratory manual. biodiversity in soil Environ Microbiol. Cold Spring Harbor Laboratory, Press, 2003;5:36-47. New York. 1989;3:1,626. 12. Leila S, Azar S, Alireza K. Determining 25. Rolf FJ. NTSYS-pc numerical taxonomy protein patterns for three fungus species and multivariate analysis system. Exeter Aspergillus fumigatus , Asp. flavus and Software, Setauket, New York, USA. Asp. niger , obtained from outdoor air. Iran 1993;Version 1.8. Global Veterinaria. 2010;4:130-4. 26. Bhandari MR, Kawabata J. Organic acid, 13. Laidi RF, Sifour M, Sanker M, Hocine H. A phenolic content and antioxidant activity of new actinomycete strain SK4-6 producing wild yam Dioscorea spp. tubers of Nepal. secondary metabolite effective against Food Chem. 2004;88:163-8. methicillin-resistant Staphyloccus aureus. 27. Murray PR, Baron EJ, Pfaller MA, Tenover World J Micrbiol Biotechnol. 2008;24:2235- FC, Yolk RH. Manual of clinical 41. microbiology, 6 th edition ASM, Washington, 14. Soll DR. The ins and outs of DNA DC. 1995;509–19. fingerprinting the infectious fungi. Clin 28. Bergmann FW, Abe J, Hizukuri S. Microbiol Rev Clinical. 2000;13:332-70. Selection of micro-organisms, which 15. Patil RC. Invertase production from produce raw starch degrading amylases. Aspergillus SPP MI isolation from honey Appl Microbiol Biotechnol. 1988;27:443-6. comb. IJAB. 2012;4:1-5. 29. Yanase H, Fukushi H, Ueda N, Maeda Y, 16. Betina V. Mycotoxins: Chemical, biological Toyoda A, Tonomura K. Cloning, and environmental aspects. Bioactive sequencing and characterization of the molecules. V. Betina on Amazon com. intracellular invertase gene from 1989;9. Zymomonas mobilis . Agri Biol Chem. 17. Schuster E, Dunn-Coleman N, Frisvad JC, 1991;55:1383–90. van Dijck PW. On the safety of Aspergillus 30. Abdel-Fattah AF, Mahmoud DAR, Esawy niger : A review. Applied Microbiol MA. Production of levansucrase from Biotechnol. 2002;59:426-35. Bacillus subtilis NRC 33a and enzymic 18. Bahrimc G, Gheteu M. Improvement of synthesis of levan and fructo Aspergillus niger invertase production in oligosaccharides. Curr Microbiol. stationary fermentative system. Rom 2005;51:402-7. Biotech Lett. 2007;9:1933-8. 31. Miller GL. Use of dinitrosalicylic acid 19. Pitt JI, Hocking AD. Fungi and Food reagent for determination of reducing Spoilage, second edn, London, Blackie sugar. Anal Chem. 1959;31:426-8. Academic and Professional. 1997;593.
166
Kansoh et al.; BMRJ, 5(2): 152-168, 2015; Article no.BMRJ.2015.017
32. Somogyi M. Notes on sugar determination. 43. Margaris NS, Mitrakos K, Markou S. J Biol Chem. 1952;195:19-23. Carbon sources for Aspergillus niger 33. Matsumoto T, Inoue H, Sato Y, Kita Y, growth under different shaking Nakano T, Noda N, Eguchi-Tsuda M, programmes. Folia Microbiol. 1974;19:394- Moriwaki A, Kan OK, Matsumoto K. 6. Demethylallosamidin, a chitinase inhibitor, 44. Zheng J, Zhihong X, Wang YI, Hong K, Liu suppresses airway inflammation and P, Weiming Z. Cyclic Tripeptides from the hyper-responsiveness. Biochem Biophys Halotolerant Fungus Aspergillus Res Commun. 2009;390:103-8. sclerotiorum PT06-1. J Nat Prod. 34. Deabes MM, Darwish HR, Abdel-Aziz KB, 2010;73:1133-7. Farag IM, Nada SA, Tawfek NS. Protective 45. Gouka RJ, Punt PJ, Van den MJ, Hondel effects of Lactobacillus rhamnosus GG on J. Efficient production of secreted proteins aflatoxins-induced toxicities in male albino by Aspergillus : Progress, limitations and mic. E J Environment Analytic Toxicol. prospects. Appl Microbiol Biotechnol. 2012;2:132. 1997;47:1-11. 35. Salama BM. Physiological studies on 46. Thomas KC, Hynes SH, Ingledew WM. levansucrase productivity by honeybee Effect of nitrogen limitation on synthesis of Microbial isolates. Thesis, Faculty of enzymes in Saccharomyces cerevisiae science, El-Menoufia Univ., Egypt; 2012. during fermentation of high concentration 36. Balajee SA, Houbraken J, Verweij PE, of carboydrates. Biotechnol Lett. Hong SB, Yaghuchi T, Varga J, Samson 1996;18:1165-8. RA. Aspergillus species identification in the 47. Bertolin TE, Schmidell W, Maiorano AE, clinical setting. Stud Mycol. 2007;59:39-46. Casara J, Costa JA. Influence of carbon, 37. Mirhendi H, Diba K, Kordbacheh P, nitrogen and phosphorous sources on Jalalizand N, Makimura K. Identification of glucoamylase production by Aspergillus pathogenic Aspergillus species by a PCR- awamori in solid state fermentation. Z. restriction enzyme method. J Med Naturforsch. C. 2003;58:708-12. Microbiol. 2007;56:1568-70. 48. Carpita NC, Gibeaut DM. Structural 38. Leila S, Azar S, Alireza K. Determining models of primary cell walls in lowering protein patterns for three fungus Species plants: Consistency of molecular structure Aspergillus fumigatus , Asp. flavus and with the physical properties of the walls Asp. niger , obtained from outdoor air in during growth. Plant J. 1993;3:1-30. Iran. Global Veterinaria. 2010;4:130-4. 49. Teixeira MF, Lima S, Filho JL, Duran N. 39. Bagheri A, Paul JG, Langridge P, Rothjen Carbon sources effect on pectinase P. Genetic distance detected with RAPD production from Aspergillus japonicas 586. markers among selected Australian Braz J Microbiol. 2000;31:286-90. commercial varieties and boron-tolerant 50. Botella C, Orya I, Webb C, Cantero D, exotic germ plasm of pea . Pisum sativum Blandino A. Hydrolytic enzyme production L. Mol Breed. 1995;1:193-7. by Aspergillus awamori on grape pomace. 40. Ferracin LM, Frisvad JC, Taniwaki MH, Biochem Eng J. 2005;26:100-6. Iamanaka BT, Sartori D, Schaoavaloff ME, 51. Fawzy GA, Al-Taweel AM, Melake NA. In Fungaro MHP. Genetic relationships vitro antimicrobial and anti-tumor activities among strains of Aspergillus niger of intracellular and extracellular extracts of aggregate. Braz Arch Biol Techn. Aspergillus niger and Aspergillus flavus var 2009;52:241-8. columinaris . J Pharm Sci & Res. 41. Abed KF. Differentiation of Aspergillus 2001;3:980-7. niger by random amplification of 52. Arora DS, Chandra P. Antioxidant activity polymorphic DNA J Ind Microbiol of Aspergillus fumigates. ISRN Pharmacol Biotechnol. 2008;35:27-1032. 619395; 2001. 42. Kosalková K, Estrada CG, Barreiro G, 53. Fischer G, Muller T, Schwalbe R, Flórez GM, Mohammad SJ, Paniagua MA, Ostrowski R, Dott W. Species-specific Martín FJ. Casein phosphopeptides profiles of mycotoxins produced in cultures drastically increase the secretion of and associated with conidia of airborne extracellular proteins in Aspergillus fungi derived from bio-waste. Int J Hyg awamori. Proteomics studies reveal Environ Health. 2000;2:105-16. changes in the secretory pathway. Microb 54. Martins ML, Martins A, Fernando MA. Cell Fact. 2012;10:5-11. Bernard. Bacillaceae spores, fungi and
167
Kansoh et al.; BMRJ, 5(2): 152-168, 2015; Article no.BMRJ.2015.017
aflatoxins determination in honey RPCV. Aspergillus niger from chemostat culture 2003;98:85-8. and its potential use as a morphologically 55. Van de Vondervoort PJI, Poulsen BR, stable host for protein production. Ruijter GJG, Schuleit T, Visser J, Iversen, Biotechnol Bioeng. 2004;86:301-7. JJL. Isolation of a fluffy mutant of ______© 2015 Kansoh et al.; This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0 ), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited.
Peer-review history:
The peer review history for this paper can be accessed here: http://www.sciencedomain.org/review-history.php?iid=666&id=8&aid=6319
168