Molecular Phylogenetics and Medicinal Plants of Asclepiadoideae from India

See discussions, stats, and author profiles for this publication at: https://www.researchgate.net/publication/29843773

Molecular phylogenetics and medicinal plants of Asclepiadoideae from India

Article · January 2008 Source: OAI

CITATION READS 1 315

1 author:

Siddharthan Surveswaran The University of Hong Kong

17 PUBLICATIONS 568 CITATIONS

SEE PROFILE

All content following this page was uploaded by Siddharthan Surveswaran on 04 March 2015.

The user has requested enhancement of the downloaded file. Molecular phylogenetics and medicinal plants of Title Asclepiadoideae from India

Author(s) Surveswaran, Siddharthan

Citation

Issue Date 2008

URL http://hdl.handle.net/10722/53090

Rights unrestricted MOLECULAR PHYLOGENETICS AND MEDICINAL PLANTS OF ASCLEPIADOIDEAE FROM INDIA

SIDDHARTHAN SURVESWARAN

Ph.D. THESIS

The University of Hong Kong

2007 Abstract of the thesis entitled

MOLECULAR PHYLOGENETICS AND MEDICINAL PLANTS OF ASCLEPIADOIDEAE FROM INDIA

submitted by

Siddharthan Surveswaran

for the degree of Doctor of Philosophy

at The University of Hong Kong in November 2007

Medicinal plants are rich sources of antioxidants and their antioxidant potential is an important factor for disease treatment. Traditional Indian medicine systems employ thousands of herbs in their formulations. A large scale evaluation of antioxidants in Indian medicinal plant species has not been done. In the first part of this study, 133 medicinal plants from 64 families used in Indian traditional medicine systems were systematically screened for antioxidant activities using ABTS (2,2-azinobis-3-ethyl-benzothiazoline-6-sulfonic acid), DPPH (1,1-diphenyl- 2-picrylhydrazyl) and FRAP (Ferric reducing antioxidant power) assays. Signifi- cant and positive linear correlations were found between total antioxidant capacities and phenolic contents (R=0.89–0.97), indicating that phenolic compounds were the dominant antioxidant constituents in the tested medicinal plants. The samples with highest antioxidant activities had high levels of hydrolysable tannins and gallic acid. It was found from the preliminary screening that subfamilies Asclepiadoideae and Periplocoideae (Apocynaceae) had moderately high antioxidant activities (> 5 to 20 mmol TEAC/100 g DW by ABTS assay). Twelve species of medicinal plants belonging to Asclepiadoideae and Periplocoideae were further surveyed for antioxidants, xanthine oxidase inhibition activity and hydroxyl radical scavenging activity. The principal phenolic phytochemicals from these plants were identified by LC-MS, including flavonoids, phenolic acids and phenolic terpenoids. Chlorogenic acid and rutin were detected in almost all the plant samples. The LC-MS analysis provided full fingerprints of the principal phenolic compounds which will also be useful in the authentication and quality evaluation of these medicinal herbs. The family Apocynaceae was revised recently and the former Asclepiadaceae was subsumed into it based on molecular data. Earlier works concentrated on tribal and subtribal divisions of Apocynoideae, and the sampling of Asclepiadoideae was limited. In this study, the phylogeny of Asclepiadoideae was further investigated with improved sampling of the taxa. In the family level analysis of Apocynaceae s.l. using rbcL gene data, the subfamilies, Asclepiadoideae, Secamonoideae and Periplocoideae, were well resolved. Within

Asclepiadoideae, the three tribes were also well resolved. Tribe Asclepiadeae, which is the largest and comprising seven subtribes, was polyphyletic, whereas tribes Mars- denieae and Ceropegieae were monophyletic. Subtribal classiﬁcation within tribe Asclepiadeae is discussed based on previous morphological work.

Molecular systematics of three genera, Ceropegia, Brachystelma and Caralluma of the tribe Ceropegieae (Asclepiadoideae), were studied in detail based on samples collected from India using the nuclear ribosomal internal transcribed spacer (ITS) region, chloroplast trnL, trnT-L, and trnL-F intron and intergenic spacers. The

Western Ghats Ceropegia were separated into two major clades that can be diﬀer- entiated based on broad or narrow leaves. Ceropegia was polyphyletic and closely related to Brachystelma. The study of the genus Caralluma and allies showed several clades supporting the revised morphological classiﬁcation of the genus. MOLECULAR PHYLOGENETICS AND MEDICINAL PLANTS OF ASCLEPIADOIDEAE FROM INDIA

Siddharthan Surveswaran

B.Sc. Botany, Loyola College, Madras, India M.Sc. Plant Science, University of Madras, India

A thesis submitted in partial fulﬁllment of the requirements for the Degree of Doctor of Philosophy at The University of Hong Kong

November 2007 Declaration

I declare that this thesis represents my own work, except where due acknowledge- ment is made, and that it has not been previously included in a thesis, dissertation or report submitted to this University or to any other institution for a degree, diploma or other qualiﬁcations.

Signed...... (Surveswaran Siddharthan)

i Acknowledgements

First of all I would like to express gratitude to my supervisors Dr. Mei Sun and Dr. Harold Corke for their insightful advice, encouragement, guidance and support throughout my PhD studentship period. I am indebted to Dr. Yi-Zhong Cai for his expert guidance in my research and in preparation of manuscripts. I wish to thank the Faculty of Science and Graduate School of the University of Hong Kong for my postgraduate studentship. I would like to express my thanks to Prof. Shrirang Yadav and Dr. Mayur Kamble, Shivaji University, Kolhapur, for their invaluable help in the collection of specimens and discussion of the results. I am also thankful to Prof. T. Pullaiah and Dr. S. Karuppusamy of Sri Krishnadevaraya University, Anantapur, for helping me in collection of specimens. I wish to thank Juan Manuel Laulh´eof www.xerics.com for sending two specimens from the Canaries.

Thanks are due to friends at Shivaji University, Nilesh, Mansingh, Shankar, Nilesh, Girish for their loving help during collection. Many thanks to present and past labmates and friends, Dr. Huang Junchao, Ms. Wuyang Huang, Ms. Shan Bin, Dr. Lu Bei, Ms. Vivian Luk, Ms. Zhongquan Sui,

Mr. Xiang Li Kong and Dr. Anil Gunaratne, for their help and support during my PhD period. Thanks are due to the timely technical assistance of Ms. M.W. Fong. My thanks to Vijaykrishna Dhanashekar and Belle Damodara Shenoy for teaching me phylogenetic analysis. Special thanks go to my friend Senthil Kumar for teaching me LATEX and guiding me in typesetting this thesis with wonderful open source software.

ii I express my gratefulness to my wife Vatsala Mrinalini for her love and patience during my study. Finally, I express my gratitude to my parents who have loved and guided me all through my life, without whom my PhD study would not have been possible. I wish to thank all my relatives and friends both in India and Hong Kong who have shared happy moments with me and greatly helped me to achieve my goal.

iii Contents

Declaration ...... i Acknowledgements ...... ii Abbreviations ...... xiv

1 Review of Literature 1 1.1 Free radicals, Antioxidants and Health ...... 1

1.1.1 Antioxidants and their role in cancer ...... 3 1.2 Phenolic compounds and antioxidation ...... 4 1.3 Alternativemedicine ...... 5 1.4 Traditional Indian medicinal systems ...... 5 1.5 Antioxidants from Indian medicinal plants ...... 8

1.6 Medicinal plants from Asclepiadoideae and Periplocoideae ...... 9 1.6.1 Antioxidants from Asclepiadoideae and Periplocoideaeplants . 9 1.7 Classiﬁcation of the family Apocynaceae s.l...... 11 1.8 Classiﬁcation of the subfamily Asclepiadoideae ...... 12

1.8.1 Salient features of Asclepiadoideae ...... 13 1.8.2 Molecular systematics of Apocynaceae s.l...... 16 1.8.3 Recent updates on Apocynaceae s.l...... 17 1.9 Classiﬁcation and phylogeny of the tribe Ceropegieae (Asclepiadoideae) 17

1.9.1 The genus Ceropegia ...... 17 1.9.2 The genus Caralluma ...... 26 1.10 Objectives ofthisresearchproject ...... 28

iv 2 Antioxidant properties of Indian medicinal plants and their phenolic compounds 31

2.1 Introduction...... 31 2.2 MaterialsandMethods ...... 32 2.2.1 Samplecollection ...... 32 2.2.2 Chemicalsandreagents...... 32

2.2.3 Extractpreparation...... 33 2.2.4 ABTSassay...... 33 2.2.5 DPPHAssay ...... 34 2.2.6 FRAPassay...... 34 2.2.7 Determination of total phenolic content ...... 35

2.2.8 RP-HPLCanalysis ...... 35 2.2.9 Statisticalanalysis ...... 35 2.3 Results...... 36 2.3.1 Total antioxidant capacity and phenolic content ...... 36

2.3.2 Relationships among total antioxidant capacities by ABTS, DPPH,andFRAPassays ...... 50 2.3.3 Relationship between total antioxidant capacity and phenolic content...... 51

2.3.4 Preliminary identiﬁcation and analysis of phenolic compounds 52 2.3.5 Discussion...... 65

3 Antioxidant properties and principal phenolic phytochemicals of Indian medicinal plants from subfamilies Asclepiadoideae and Periplo- coideae 69 3.1 Introduction...... 69

3.2 MaterialsandMethods ...... 70 3.2.1 Plantmaterial...... 70 3.2.2 Chemicalsandreagents...... 70 3.2.3 Extractpreparation...... 70

v 3.2.4 ABTSassay...... 70 3.2.5 FRAPassay...... 71

3.2.6 Xanthine oxidase (XO) inhibition assay ...... 71 3.2.7 Hydroxyl radical (OH−) scavenging activity assay ...... 71 3.2.8 Totalphenoliccontent(TPC) ...... 72 3.2.9 TotalFlavonoidcontent(TFC) ...... 72

3.2.10 Liquid Chromatography Mass Spectroscopy (LC-MS) . . ... 72 3.2.11 Statisticalanalysis ...... 73 3.3 Results...... 73 3.3.1 Total antioxidant capacity and total phenolic and ﬂavonoid contents ...... 73

3.3.2 Xanthine oxidase (XO) inhibitory activity and OH− radical scavengingactivity ...... 75 3.3.3 Relationship between total antioxidant capacity and total phe- nolicandﬂavonoidcontents ...... 76

3.3.4 LC-MS analysis of phenolic compounds ...... 77 3.4 Discussion ...... 78

4 Molecular systematics of Ceropegia based on nuclear ITS and chloroplast trnL trnT-L and trnL-F intron intergenic spacers 88 4.1 Introduction...... 88 4.2 MaterialsandMethods ...... 90

4.2.1 Plantmaterial...... 90 4.2.2 DNAextraction...... 90 4.2.3 PCRampliﬁcation ...... 91 4.2.4 Phylogeneticanalysis ...... 92

4.3 Results...... 98 4.3.1 ITSbasedphylogeny ...... 98 4.3.2 cpDNAbasedphylogeny ...... 99

vi 4.3.3 Relationship between Stapeliads and Ceropegia based on ITS data ...... 102

4.3.4 Relationship between African Stapeliads and Ceropegias based oncpDNAdata...... 105 4.4 Discussion ...... 105 4.4.1 Two major clades among Western Ghats Ceropegia ...... 105

4.4.2 PhylogenyofthetribeCeropegieae ...... 108 4.4.3 Molecular phylogenetic relationship between Brachystelma and Ceropegia ...... 109 4.4.4 Position of Ceropegia juncea ...... 110 4.4.5 Position of Ceropegia bulbosa ...... 110

4.4.6 Biogeography of Western Ghats Ceropegia ...... 111

5 Molecular systematics of Caralluma species occurring in India 113 5.1 Introduction...... 113 5.2 MaterialsandMethods ...... 114 5.2.1 Plantmaterial...... 114 5.2.2 DNA extraction, PCR ampliﬁcation and Sequencing ...... 114

5.2.3 Phylogeneticanalysis ...... 114 5.3 Results...... 116 5.3.1 Phylogenetic relationships among Indian Carallumas based on ITSsequences...... 116

5.3.2 Phylogeny based on cpDNA dataset ...... 119 5.4 Discussion ...... 119 5.4.1 Caralluma clade...... 122 5.4.2 Boucerosia clade ...... 123

5.4.3 Phylogeny and Biogeography of Frerea ...... 124

6 Molecular systematics of Apocynaceae s.l. based on rbcL sequences128

6.1 Introduction...... 128

vii 6.2 MaterialsandMethods ...... 129 6.2.1 Plantmaterial...... 129

6.2.2 DNA extraction, PCR ampliﬁcation and Sequencing ...... 129 6.2.3 Phylogeneticanalyses...... 130 6.3 Results...... 131 6.4 Discussion ...... 136

6.4.1 Subtribe Baisseinae is a derived group of Apocynaceae within theAsclepiadoideae...... 136 6.4.2 ThepositionofPeriplocoideae ...... 136 6.4.3 ThepositionofSecamonoideae ...... 137 6.4.4 BasaltaxaofthetribeAsclepiadeae...... 138

6.4.5 Position of the subtribes of Asclepiadeae ...... 138 6.4.6 Position of Marsdenieae and Ceropegieae ...... 140

7 Conclusions 144

Appendix 147

Bibliography 168

viii List of Figures

1.1 Productionoffreeradicals ...... 2 1.2 Pollinium of Seshagiria sahyadrica ...... 14 1.3 FloralpartsofAsclepiadoideae ...... 15

1.4 Floral morphology of Ceropegia ...... 19 1.5 MapofMaharashtra ...... 24

2.1 Distribution in percentage of 137 Indian medicinal plant samples among diﬀerent ranges of antioxidant capacity assayed by the ABTS method ...... 38

2.2 Relationship between the total antioxidant capacities by ABTS and DPPH assays of 137 Indian medicinal plant samples ...... 51 2.3 Relationship between the total antioxidant capacities by ABTS and total phenolic content of 137 Indian medicinal plant samples ..... 52

2.4 HPLC proﬁles of methanolic extracts from species possessing highest antioxidant capacities among 133 Indian medicinal plants ...... 63 2.5 HPLC proﬁles of methanolic extracts from species possessing highest antioxidant capacities among 133 Indian medicinal plants ...... 64

3.1 Xanthine oxidase (XO) inhibition and OH− scavenging activity of 12 Indian medicinal plants from Asclepiadoideae and Periplocoideae. . . 75 3.2 LC ﬁngerprints of the phenolic compounds in Indian medicinal plants from Asclepiadoideae and Periplocoideae ...... 79

4.1 Parsimony tree of ITS sequences ...... 100

ix 4.2 Maximum-likelihood tree based on ITS sequences ...... 101 4.3 Parsimony tree based on cpDNA sequences ...... 103

4.4 Maximum likelihood tree based on ITS sequence of Stapeliads . . . .104 4.5 Maximum likelihood tree based on cpDNA sequence of Stapeliads . . 106 4.6 Flowers of Ceropegia ...... 107

5.1 50% Majority-rule consensus tree of 184 equally parsimonious trees

basedonITSsequences...... 117 5.2 Maximum-likelihood tree based on ITS sequences ...... 118 5.3 50% Majority-rule consensus tree of the 180 equally parsimonious treesbasedoncpDNAsequences ...... 120

5.4 Maximum-likelihood tree based on cpDNA sequences ...... 121 5.5 Boucerosia andrelatedgenera ...... 125 5.6 Caralluma adscendens varieties and related species ...... 126

6.1 Maximum likelihood tree based on rbcL sequences ...... 132 6.2 Portion of the rbcL ML tree showing tribe Asclepiadeae ...... 133

6.3 Portion of the rbcL ML tree showing tribes Marsdenieae and Ceropegieae134 6.4 Flowers of Asclepiadoideae s.l...... 135

x List of Tables

1.1 Major classes of phenolic compounds in plants ...... 6 1.2 Medicinal plants from Asclepiadoideae and Periplocoideae from India andtheirmedicinalproperties ...... 10

1.3 Number of genera and species in Periplocoideae, Secamonoideae and Asclepiadoideae ...... 13 1.4 Ceropegia species found in the Indian region ...... 21

2.1 133 Indian medicinal plants (137 samples) studied and total antioxidant capacity and phenolic content of their methanolic extracts . . . 39

2.2 Correlations (R and R2) between antioxidant capacity parameters and total phenolic contents of 133 Indian medicinal plants ...... 50 2.3 Major phenolic compounds from selected Indian medicinal plants with antioxidantactivity ...... 55

3.1 Antioxidant activity, phenolic and ﬂavonoid contents of 12 medicinal plants Asclepiadoideae and Periplocoideae ...... 74 3.2 Correlations (R and R2) between antioxidant capacity, phenolic and ﬂavonoid contents, XO inhibition and OH− scavenging of plants from

Asclepiadoideae and Periplocoideae ...... 77 3.3 Major phenolic compounds from selected Indian medicinal plants of Asclepiadoideae and Periplocoideae ...... 84

4.1 Primers for ampliﬁcation of ITS region and cpDNA regions ...... 92

xi 4.2 List of plants, voucher information, location, and Genbank accession numbersDNAsequences ...... 94

4.3 Accession numbers of sequences obtained from Genbank / EMBL databases ...... 112

5.1 Caralluma species used in the study, voucher information and Gen- bankaccessionnumbers ...... 115

6.1 Primers for ampliﬁcation of rbcL region...... 129 6.2 Asclepiadoideae species used in the study ...... 142 6.3 Asclepiadoideae taxa from Genbank ...... 143

xii List of appendices

Appendix 1 - Descriptions of Western Ghats Ceropegia used in this study 147 Appendix 2 - Descriptions of Caralluma and Boucerosia used in this study 165

Appendix 3 - Photo credits for Figure 6.4 167

xiii List of Abbreviations

Degrees celcius µm Micrometre µmol Micromole A Androecium ABTS 2,2-azinobis-3-ethyl-benzothiazoline-6-sulfonic acid AIC Akaike information criterion AP-1 Activator protein 1 (transcription factor) ASK1 Apoptosis signal-regulating kinase 1 bp Base pairs BP Bayesian phylogeny BPP Bayesian posterior probability BS Bootstrap support CA Calyx CAA Cellular antioxidant activity CAM Crassulacean acid metabolism CAM Complementary and alternative medicine CI Consistency index CITES Convention on International trade in endangered species CNS Central nervous system CO Corolla cpDNA Chloroplast DNA CTAB Cetyl Trimethyl Ammonium Bromide CVD Cardiovascular disease DAD Diode array detector DCF Dichloroﬂuorescein DNA Deoxyribo nucleic acid DPPH 1,1-diphenyl-2-picrylhydrazyl DW Dry weight EDTA Ethylene diamine tetra acetic acid EMBL European molecular biology laboratory ESI Electrospray ionisation ESI-MS Electrospray ionisation - Mass spectrometry F81 Felsenstein (1981) model FRAP Ferric reducing antioxidant power

xiv FRLHT Foundation of the revitalization of local health traditions g Grams GAE Gallic acid equivalent GARLI Genetic algorithm for rapid likelihood inference GS Gynoecium GTR+I General time reversible + invariant sites GTR+I+G General time reversible + invariant sites + gamma H2O2 Hydrogen peroxide HI Homoplasy index HKY+I Hasegawa Kishino Yano (1985) model + invariant sites HPLC High performance liquid chromatography HO2• Hydroxyperoxyl radical hr Hour ITS Internal transcribed region kbp Kilobase pairs KH Kishino Hasegawa kV Kilo volts L Litre LC-MS Liquid chromatography Mass spectrometry LDL Low density lipoprotein LSD Least significant difference m/z Mass-to-chargeratio MAPK Mitogen-activated protein kinase matK MaturaseK MCMCMC Metropolis coupled Monte Carlo Markov chain min Minutes mL Millilitre ML Maximum likelihood mmol Millimole MP Maximum parsimony N Normal (Normality) ndhF NADH dehydrogenase (subunit 5) NFκB Nuclear factor-kappa B NJ Neighbour-joining nm Nanometre NMR Nuclear magnetic resonance − O2 Superoxide radical OH− Hydroxyl radical ORAC Oxygen radical absorbance capacity PAUP Phylogeny analysis using parsimony PCR Polymerase chain reaction R Correlation coefficient R2 Coefficients of determination rbcL Ribulose bisphosphate carboxylase large subunit RI Retension index RO• Alkoxyl radical RO2• Peroxyl radical ROS Reactive oxygen species

xv RP-HPLC Reverse phase - High performance liquid chromatography s.l. Sensu lato SYM+I. Symmetrical change model (Zharkikh, 1994) + invariant sites TCM Traditional chinese medicine TE Tris EDTA TEAC Trolox equivalent antioxidant capacity TFC Total ﬂavanoid content TL Tree length TPC Total phenolic contents TPTZ 2,4,6-tripyridyl-s-triazine trnD-T tRNA Asp - tRNA Thr intergenic spacer trnL tRNA Leu intron trnL-F tRNA Leu - tRNA Phe intergenic spacer trnT-L tRNA Thr - tRNA Leu intergenic spacer UV Ultra violet XO Xanthine oxidase

xvi Chapter 1

Review of Literature

1.1 Free radicals, Antioxidants and Health

Free radicals are deﬁned as molecules having an unpaired electron in the outer orbit (Halliwell and Gutteridge, 1999). They are generally unstable and very reactive.

−• • Examples of oxygen free radicals are superoxide (O2 ), hydroxyl(OH ), peroxyl

• • • (RO2), alkoxyl (RO ), and hydroperoxyl (HO2) radicals. Free radical production may be due to endogenous or exogenous sources (Young and Woodside, 2001) (Fig- ure 1.1). These reactive species are beneficial in defense against foreign bodies and they also act as modulators of cell proliferation, inflammation, signal transduction, cell-cell adhesion, transcription and apoptosis (Soobrattee et al., 2006). However if their levels increase they may be damaging to biomolecules and may lead to several pathological conditions. Free radicals are implicated in contributing to artherosclerosis, aging, immunosuppression, inflammation, ischemic heart disease, diabetes, hair loss, and neurodegenerative disorders such as Alzheimer’s disease and Parkin- son’s disease (Beal, 1995; Maxwell, 1995; Poulsen et al., 1998). Free radicals are involved in causing various types of cancer by causing DNA damage, altering cell signalling pathways (MAPK, NFκB, AP-1, ASK1) and modulating gene expression of proto-oncogenes and tumour suppressor genes (Soobrattee et al., 2006)

An antioxidant can be deﬁned as “any substance that, when present in low concentrations compared to that of an oxidisable substrate, signiﬁcantly delays or

1 Figure 1.1: Production of free radicals. From Young and Woodside (2001). inhibits the oxidation of that substrate” (Halliwell and Gutteridge, 1995). Natural defence against free radicals is provided by β-carotene (pro vitamin A), vitamin E (α-tocopherol), vitamin C (ascorbic acid), Selenium etc. Antioxidants prevent free-radical-induced tissue damage by preventing the formation of radicals, scavenging them or by promoting their decomposition. The disruption of the delicate balance between pro- and antioxidants is termed oxidative stress and has been implicated in the pathophysiology of many chronic diseases, including cardiovascular diseases (CVD), ageing, diabetes and cancer. Several studies have shown that higher levels of vitamin C, vitamin E, the carotenoids (e.g. β-carotene, lycopene and lutein), selenium and the ﬂavonoids (e.g. quercetin, kaempferol, myricetin, luteolin and apigenin), prevent carcinogenesis and atherogenesis by interfering passively with oxidative damage to DNA, lipids and proteins (Stanner et al., 2007). Oxidation of low density lipoprotein (LDL) is the key step which leads to artherosclerosis, a major risk factor in developing CVD. Apart from CVD and cancer speciﬁc diseases which are caused by reactive oxygen species (ROS) are Alzheimer’s disease, Parkinson’s disease, artherosclerosis, cancer and ischemic reperfusion injury. Apart from these diseases, free radicals also cause

2 aging, immunosuppression and hair loss (Maxwell, 1995; Govindarajan et al., 2005).

1.1.1 Antioxidants and their role in cancer

Cancer is the second leading cause of death in the United States and in many Western countries next to cardiovascular disease (Soobrattee et al., 2006). Carcinogenesis is a multimechanism process involving the environment, diet, lifestyle, genetic makeup, age, sex etc. (Trosko and Chang, 2001). Though causes of cancer are multifacto- rial the role of oxidative stress in cancer etiology cannot be underestimated. The development of cancer in general involves a three step process: 1) a mutation in the DNA of a somatic cell (initiation) 2) stimulation of a tumorigenic expansion of the cell clone (expansion) and 3) malignant conversion of the tumour into cancer (progression). Free radicals can stimulate cancer development in all three stages

(Dreher and Junod, 1996). Several in vitro and in vivo studies, epidemiological surveys and clinical trials have proven that plant-based diets have protective effects towards various cancers. It has also been suggested that 7 to 31% of the worldwide incidence of cancers could be reduced with diets rich in fruits and vegetables (Glade, 1999). Numer- ous epidemiologic studies indicate that an increase in the consumption of fruits and vegetables is associated with a decrease in the incidence of CVD, coronary heart disease, and stroke (Kris-Etherton et al., 2002). Plant-based foods are rich in various bioactive compounds (Surh, 2003). Many plant-based bioactive compounds have been identified and there have been numerous epidemiological, clinical, and experimental studies conducted to evaluate their health effects. The important bioactive compounds of plant origin are phenolic compounds, including flavonoids, phenolic acids and tannins.

3 1.2 Phenolic compounds and antioxidation

Antioxidant activity is essential for life. Many of the biological functions, such as antimutagenicity, anticarcinogenicity, and antiaging, among others, originate from this property. Antioxidants can be synthetic or natural. Synthetic antioxidants may be compounds with phenolic structures with various degrees of alkyl substitution. Natural antioxidants can be phenolic compounds (ﬂavonoids and phenolic acids), nitrogen compounds (alkaloids, chlorophyll derivatives, amino acids, and amines), or carotenoids and also ascorbic acid (Cook and Samman, 1996; Velioglu et al.,

1998). Phenolic compounds are known to have multiple pharmacological effects such as antibacterial, anti-inflammatory, antiallergic, hepatoprotective, antithrombotic, antiviral, neuroprotective, vasodialatory and anti-carcinogenic actions. There are wide variety of phenolic compounds ranging from simple molecules to highly polymerised compounds among which flavonoids are the most common, widely distributed and most diverse with more than 4000 structures elucidated (Bravo, 1998). Plant parts (roots, leaves, branches / stems, bark, flowers and fruits) are the common rich sources of phenolic compounds such as flavonoids, phenolic acids and stilbenes, tannins, coumarins, lignans and lignins (Larson, 1988; Cai et al., 2004). The antioxidant properties of phenolic acids and flavonoids are due to their redox properties, ability to chelate metals and quenching of singlet oxygen (Rice-Evans et al., 1996). Flavonoids, which are mostly responsible for the pigmentation of flowers, fruits and leaves, have a basic structure with a basic backbone of C6-C3-C6. Flavonoids and other phenolic compounds are derived from a common origin, the amino acid phenyl alanine. Therefore these compounds have a common building block in their skeleton, the phenylpropanoid unit, C6-C3. From this basic unit various biosynthetic pathways lead to a wide variety of plant phenolics: benzoic acids (C6-C1), cinnamic acids (C6-C3), coumarins (C6-C3), flavonoids (C6-C3-C6), proanthocyanidins (C6-C3-C6)n and lignins (C6-C3)n (Table 1.1). Several types of flavonoids such as flavanols, flavonols, flavones, flavanones and

4 anthocyanins are formed on the basis of the saturation of the ﬂavan ring and also their hydroxylation. They occur mostly as glycosylated derivatives, sometimes con- jugated with sulphate or organic acids (Youdim et al., 2002). Phenolic acids, such as caﬀeic, chlorogenic, ferulic, sinapic, and p-coumaric acids, are known to have more antioxidant properties than the hydroxy derivatives of benzoic acid such as p-hydroxybenzoic, vanillic, and syringic acids (Larson, 1988).

1.3 Alternative medicine

Traditional knowledge of medicinal plants has always been a valuable guide in the quest for new medicines. In spite of the advent of modern high throughput drug discovery and screening techniques, traditional knowledge systems have given clues to the discovery of valuable drugs (Buenz et al., 2004). Traditional medicine offers distinct advantages even in modern times because they are often cheaper, locally available, and easily consumable as raw or simple medicinal preparations. Their role is still more predominant in developing countries. Nowadays traditional medicines and practices form an integral part of complementary and alternative medicine (CAM). Although their efficacy and mechanisms of action have not been tested scientifically in most cases, these simple medicinal preparations often mediate beneficial responses due to their active chemical constituents (Park and Pezzuto, 2002).

1.4 Traditional Indian medicinal systems

Ayurveda is probably the oldest scientiﬁc system of medicine in the history of the world. It has been a part of ancient vedic scripts and must have been practiced for thousands of years, since the Vedic period, about 3,500 years ago. The sages who lived in the snow-clad Himalayas developed and recorded a deep knowledge of health and the human body. The approach of Ayurveda is both preventative and curative (Upadhyay, 1997). The ﬁrst recorded ayurvedic medicine book, Charaka

Samhita, was written in 600 BC (Schuppan et al., 1999).

5 Table 1.1: Major classes of phenolic compounds in plants. Reproduced from Soo- brattee et al. (2006) Class Basic Skele- Basic Structure Examples ton

T T TT OH TT Simple phenols C6 Cresol, Thymol

T T HO TT COOH TT Benzoic acids C6-C1 Gallic acid, Vanillic acid

T T TT CH=CH-COOH TT Cinnamic acids C6-C3 p-Coumaric acid, Ferulic acid

"b "b """ b" bbb

bbb "bb ""bb b" O O 6 3 Coumarins C -C "b Umbelliferone, Aesculetin """ b

"b "Ob b """ b" b""bb""

b bb""bb""

Flavone C6-C3-C6 O Apigenin, Luteolin, Chrysin "b """ b

"b "Ob b """ b" b""bb""

bbb "b "bb b" b" OH Flavonol O Quercetin, Kaempferol,

"b Myricetin """ b

"b "Ob b """ b" b""bb""

bbb "b " b" b" OH Flavan-3ols Catechin, Epicatechin, Epi-

"b gallocatechin """ b

HO "b "Ob b b """ b" +bb""bb""

bbb "b """ b" b" OH Anthocyanin OH Cyanidin, Malvidin, Del- phinidin

H3CO H

O CH CH

CH2OH H3CO Lignins (C6-C3)n n

O HO OH

n OH

Proanthocyanidins (C6-C3-C6)n Proanthocyanidins, Prodel- phinidin

6 Ayurveda therapy aims to promote positive health, obtained by maintaining the balance between the three humors of the body: ‘vayu’(wind), ‘pitta’(bile) and

‘kauf’(phlegm). An imbalance in these leads to poor body functioning and ulti- mately causes many diseases. Thus, to enhance body’s resistance power and to promote positive health, rasayanas are used in Ayurvedic therapeutics. Rasayanas are prepared by extracting the juices from various plant materials. These are then used as a drug in Ayurvedic therapeutics along with the practice of diet, physical and mental exercises and disciplined lifestyle. According to Charaka (ancient Indian literature on medicine), one can become intellectual, powerful, youthful, free from diseases and live longer by consuming rasayanas. The rasayanas are preparations from several plant extracts, which contain strong antioxidants and are used as rejuvenators or nutritional supplements (Sharma et al., 1992; Thyagarajan et al., 2002; Govindarajan et al., 2005). They act in the body by modulating the neuro-endocrino-immune systems. The rasayana herbs prevent ageing, strengthen the body, brain power, prevent diseases and increase the resistance of the body to any attack (Sharma, 1983; Brahma and Debnath, 2003). Siddha is another ancient system of medicine from India practiced by a class of sages called Siddhas or ‘holy- immortals’ in the southeastern part of India. It is observed that Siddha medicine has its origin from Chinese alchemy, Taoism and

Taoist patrology, each emphasizing on the ‘herbs for immortality’. One distinctive technique in Siddha treatment, called ‘kaya-kalpha’ aims in rejuvenation of the body. Today, Siddha practitioners have about 242 drugs involving more than 100 plants along with several minerals (Subbarayappa, 1997).

Apart from Ayurveda and Siddha there are several folklore medicines which are practised by the tribals of India. Their knowledge is passed on from generation to generation orally and through experience rather than as written texts. Local communities all over India have discovered the medical uses of thousands of plants around their surroundings. They have used them for a wide variety of health related applications from common cold to memory improvement: treatment of snake

7 bites to cure muscular dystrophy and enhancement of the body’s general immu- nity. The FRLHT (Foundation for the Revitalization of Local Health Traditions) database lists about 7,637 species of medicinal plants used in Ayurveda, Siddha, Unani, Homeopathy, Tibetan, and other folk medicines (FRLHT, 2007)

1.5 Antioxidants from Indian medicinal plants

There have been several studies on the antioxidant activities of various herbs/plants with medicinal values e.g. K¨ahk¨onen et al. (1999); Zheng and Wang (2001); Dragland et al. (2002). A systematic assay of antioxidant capacities of 112 Chinese medicinal plants associated with anticancer was conducted (Cai et al., 2004). Fifteen Indian medicinal plants commonly used in Ayurveda were recently reviewed in detail with respect to their antioxidant capacities (Govindarajan et al., 2005). Seven important medicinal plant species used in Ayurveda had been reviewed earlier with detailed data on their secondary metabolites and antioxidant properties (Scartezzini and Speroni, 2000). Auddy et al. (2003) used the ABTS (2,2’-azinobis-3-ethyl- benzothiazoline-6-sulfonic acid) method and lipid peroxidation assay to evaluate the antioxidant potential of three species, Sida cordifolia, Evolvulus alsinoides, and

Cyanodon dactylon, which are used in the treatment of neurodegenerative disorders. A similar study was done using four other plants, Momordica charantia, Glycyrrhiza glabra, Acacia catechu, and Terminalia chebula (Naik et al., 2003). Jadav and Bhutani (2002) studied antioxidant properties of methanolic extracts of twelve Indian medicinal plants using the DPPH (1,1-diphenyl-2-picrylhydrazyl) method. However, all these previous studies included only a small number of medicinal plants and used only one assay method. In the current study, 133 species of Indian medicinal plants were systematically studied for their antioxidant capacity and their chemical components.

8 1.6 Medicinal plants from Asclepiadoideae and Periplo-

coideae

The subfamilies Asclepiadoideae and Periplocoideae, formerly known as Asclepi- adaceae (Endress and Bruyns, 2000), are well known for their ethnobotanically important plants. In Ayurveda, Siddha and other Indian folk medicines, several of Asclepiadoideae and Periplocoideae members have been used. Table 1.2 shows their scientific names and medicinal usage. An ethnobotanical survey of 14 taxa from As- clepiadoideae was conducted on a group of tribals from Gujarat. The study showed that 7 plants were used as food, 4 as fodder and most were used as medicines to cure abscesses, fever, rheumatism, sprue, asthma, sores, tooth ache, ear ache, snakebite and others (Jadeja et al., 2004). The members of this group contain latex which is known to have polypregane glycosides and cardenolides (Lhinhatrakool and Sutthivaiyakit, 2006; Hamed et al., 2006; Warashina and Noro, 2006; Spera et al., 2007). The hunger suppressant steroidal glycoside P57 from Hoodia gordonii is a paramount example for pharmaceu- tically important compounds from this group (MacLean and Luo, 2004). Gymnemic acid from Gymnema sylvestre is a well known antidiabetic with antisweet, antihyper- glycemic, glucose uptake inhibitory, and gut glycosidase inhibitory effects (Kimura, 2006). Caralluma edulis is known to possess antioxidant properties and hunger suppresant effects (Ansari et al., 2005). Extracts of Calotropis procera showed antipyretic effects in rats (Chitme et al., 2005). The aqueous and butanol extracts of Stapelia nobilis and Caralluma stalagmifera showed significant anti-inflammatory and antiarthritic activities (Reddy et al., 1996).

1.6.1 Antioxidants from Asclepiadoideae and Periplocoideae

plants

Several earlier works have shown antioxidant activity among the popular medicinal plants from this group such as Hemidesmus indicus, Gymnema sylvestre, Calotropis

9 Table 1.2: Medicinal plants from Asclepiadoideae and Periplocoideae from India and their medicinal properties (Kirtikar and Basu, 1975; Warrier et al., 1993) Name Medicinal value Calotropis gigantea Leprosy, syphilis, elephantiasis, dysentery, ear-ache Caralluma adscendens Anti-diabetic and anti-hyperglycaemic, anti-pyretic, var. attenuata anti-inflammatory, anti-oxidant effects. Appetite- suppressants as well as CNS stimulants. Cryptostegia grandiflora Root used as antidote for scorpion sting and snake-bite Decalepis hamiltonii The root decoction is used for burning micturation and leucorrhoea Hemidesmus indicus Ulcer, stomach pain, diaphoretic, diuretic, immunosup- pressant, tonic Gymnema sylvestre Anti-diabetes, cardiac stimulant, eye diseases, antiallergic, antiviral, lipid lowering Leptadenia reticulata Eye diseases, haemetemesis, emaciation, cough, dys- pnoea, fever, burning sensation, dysentery, night- blindness, poisonous affections and tuberculosis Oxystelma esculentum Jaundice, coolant, general tonic, increases male fertility Pentatropis nivalis Antimicrobial, antifungal activity. Pergularia daemia Snake-bites , stomach disorders, cough, asthma, bleed- ing piles Sarcostemma acidum Emetic, employed in leprosy treatment, cures snake bite and rabies Tylophora indica Anti-asthmatic, anti-leukemic, immunosuppressive, anti-inflammatory Wattakaka volubilis Activity on the central nervous system, anticancer activity against sarcoma

10 procera and Tylophora indica. Ravishankara et al. (2002) studied the antioxidant activity of the root extract of Hemidesmus indicus using several methods. Methano- lic extract of Hemidesmus indicus roots was shown to inhibit lipid peroxidation and scavenge hydroxyl and superoxide radicals in vitro along with antithrombotic activity (Mary et al., 2003). Similarly, Sultana et al. (2003) used ethanolic extracts of H. indicus to suppress cumene hydroperoxide induced oxidative stress in rats.

Oxidative stress plays an important role in chronic complications of diabetes being associated with increased lipid peroxidation. Leaf extracts of Gymnema montanum was eﬀective in controlling the oxidative stress in diabetic rats (Ananthan et al., 2004). Roy et al. (2005) showed that the dry latex of Calotropis procera had high antioxidant and anti-hyperglycemic activities in rats. Gymnema indorum showed the highest antioxidant activity among 43 edible plant species from eight families that are widely used in Thailand (Chanwitheesuk et al., 2005). In the present study the antioxidant activity, Xanthine oxidase inhibition and free radical scanvenging activity of 12 species exclusively from these two subfamilies in reported.

1.7 Classiﬁcation of the family Apocynaceae s.l.

There are several important medicinal plants within the family Apocynaceae such as Catharanthus (anticancer compounds, vinblastine and vincristine) and Rauvolﬁa (Quinine, the ﬁrst anti malarial drug). In this Section the phylogeny of the family and two genera of this family is discussed.

Apocynaceae is an important family in the order Gentianales which includes Gentianaceae, Rubiaceae and Loganiaceae. The circumscription of Gentianales (Wa- genitz, 1992) is also supported by molecular studies (Downie and Palmer, 1992; Olm- stead et al., 1993). The order has the following features: woody plants with opposite, entire leaves mostly with stipules, special multicellular glands on stipules or calyx lobes called colleters, ﬂowers sympetalous, actinomorphic with isomerous stamens. Alkaloids and cardenolides are commonly present (Wagenitz, 1992). Apocynaceae now including its subfamilies has about 4800 species and 480 genera (Struwe et al.,

11 1994; Mabberley, 1997). The history of the family Apocynaceae dates back to Jussieu (1789) when he included this family in his taxonomic treatise Genera Plantarum. In his work he included the members of the current Asclepiadoideae. In 1810 Robert Brown segre- gated 38 genera of Apocynaceae which have pollen grains organised in special structures called translators into a new family Asclepiadaceae (Swarupanandan et al.,

1996). Schumann (1895) formalized the treatment and this grouping was maintained for about 180 years when molecular data (Sennblad and Bremer, 1996) proved beyond doubt that Asclepiadaceae is a clade within Apocynaceae. Shortly after the discovery of molecular evidence for the monophyly of Asclepiadaceae and Apocy- naceae, Endress and Bruyns (2000) proposed a revised classification of Apocynaceae which includes five subfamilies: Rauvolfiodeae, Apocynoideae, Periplocoideae, Se- camonoideae and Asclepiadoideae.

1.8 Classiﬁcation of the subfamily Asclepiadoideae

The former Asclepiadaceae, is now classiﬁed into three tribes, Asclepiadoideae, the largest and cosmopolitan, Periplocoideae and Secamonoideae which are restricted to the old world (Table 1.3). Periplocoideae and Secamonoideae are small subfamilies and do not have tribes. Asclepiadoideae has 177 genera and 3000 species (Meve, 2002b) and has four tribes, Fockeeae, Asclepiadeae, Marsdenieae and Ceropegieae (Endress and Bruyns, 2000). Characters used to distinguish the subfamilies are mostly palynological as originally used by Brown (1810). The bases for separating the 5 subfamilies within Apocynaceae are as follows (after Takhtajan (1997)):

1. Translators absent 2. Anthers not adherent to the style head by a reticulum of viscid exudates;

pollen filling the thecae and only rarely spinose; seeds ecomose — Rauvolfioidea 2. Anthers adherent to style head by a reticulum of viscid exudates; pollen not filling the thecae and always spinose; seeds ecomose or comose — Apocynoideae

12 1. Translators present 3. Filaments free; anthers tetrasporangiate; pollinia 2 in each locule; translator spoon-shaped with a sticky disk; pollen granular and in tetrads — Periplocoideae

3. Filaments connate; pollen massed in pollinia. 4. Anthers tetrasporangiate; pollinia 4 per translator — Secamonoideae 4. Anthers disporangiate; pollinia 2 per translator — Asclepiadoideae

Table 1.3: Number of genera and species in Periplocoideae, Secamonoideae and Asclepiadoideae (Meve, 2002b)

Subfamily No. of Genera No. of Species Distribution Periplocoideae 45 190 Old world Secamonoideae 9 180 Old world Asclepiadoideae 177 3000 Old & New world

1.8.1 Salient features of Asclepiadoideae

Asclepiadoideae have the most elaborate and complex ﬂowers of all dicots (Endress, 1994). Synorganization between diﬀerent organs have led to the evolution of new organs that are not present in other angiosperms. The most peculiar structures are the staminal corona, the translator and pollinia. Synorganization of the corolla and androecium has led to the formation of ‘corona’. Synorganization of the androecium and gynoecium forms the gynostegium (Fig. 1.3) and pollinaria (Fig. 1.2) The anthers are organized into special structures called pollinia. The translator formed by the hardened secretions from the stigma helps in attachment of the pollinia to the pollinator insect. The salient features of Asclepiadoideae s.l (including Periplocoideae and Secamonoid- eae) are as follows: “Lianas, vines, scrambling shrubs or herbs, infrequently shrubs or small trees, occasionally succulent and cactoid, with a well developed laticifer system; leaves opposite or infrequently verticillate, rarely alternate, simple and entire, rarely lobed or toothed, greatly reduced and scalelike in most succulent species.

13 Figure 1.2: Pollinium of Seshagiria sahyadrica (Photo credit: Dr. Mayur Kamble)

The stipules typically lacking or if present, mostly vestigial to small and interpetio- lar; inflorescences arranged in mostly umbelliform cymes or occasionally in racemes; flowers usually small to mid size, bisexual or rarely unisexual, actinomorphic, hypog- ynous, sepals 5, connate into a tube, the lobes imbricate or valvate, often reflexed, petals 5, sympetalous with a short to long tube, the lobes contorted, rarely imbricate or valvate, often spreading or reflexed, the lobes convolute or infrequently imbricate or valvate, often with a thickened ring of connate scales at the throat; stamens epipetalous, as many as and alternating with the corolla lobes, free (in

Periplocoideae) or connate around the style, forming a central column of coronal appendage typically translators called a gynostegium, the corona of diverse sizes and shapes and variously erect or incurved, typically with ﬁve alternating, petaloid or often hooded or horn-like nectary-glands at the union of the ﬁlaments and corolla, the nectary-disk wanting, the anthers tetrasporangiate and 2-locular, dehiscing by longitudinal or apical slits in Periplocoideae or bisporangiate in the Asclepiadoideae (except Secamone), the pollen amassed in two pollinia in the tetrasporangiate taxa and a single one in the bisporangiate taxa, with a specialized translator to ex- tact the pollinia; gynoecium superior, the carpels 2 and each forming a separate unilocular ovary united only by the common style, the styles connate and thickened apically with laterally positioned stigmas, the ovules (1) many-numerous, parietal, anatropous, unitegmic and tenuinucellar, the integument thin; fruits of two distinct

14 Figure 1.3: Floral parts of Asclepiadoideae. (a) Flower of Calotropis procera; (b) Longitudinal section of Calotropis procera ﬂower (Photo credits: (a) Dr. Gerald Carr, (b) Dr. Mayur Kamble)

15 follicles but often only a single one developing to maturity, the seeds often with a terminal coma of long hairs, the embryo large, straight in scanty, oily endosperm;

Floral formula, CA(5) [CO(5) A(5 GS(2)]. Presence of indole alkaloids and cardenolides are common. Widespread and common in tropical and subtropical regions, less common in warm temperate and temperate regions” (Reveal, 1999). The Asclepiadoideae are the source of latex, ﬁber, gums, and ornamentals. The most remarkable species are especially the African succulents such as genus Stapelia and its allies usually called Stapeliads or wax plants. There are several medicinal plants as discussed in previous sections.

1.8.2 Molecular systematics of Apocynaceae s.l.

The ﬁrst and important molecular work on the family Apocynaceae s.l. which led to the rebirth of the family was by Sennblad and Bremer (1996). They studied 24 taxa of Apocynaceae s.l. using rbcL and found that Asclepiadaceae was nested within the Apocynaceae. Their work also showed that Alstonia was the basal genus in Apocynaceae s.l. rather than Carisseae which have syncarpous ovaries. The next molecular work was by Endress et al. (1996) which was based on rbcL and matK genes. Later Sennblad et al. (1998) studied the phylogeny of the tribe Wrightieae using rbcL sequences of 21 taxa of Apocynaceae s.l. Civeyrel et al. (1998) re-examined the classiﬁcation of Asclepiadaceae (sensu Brown) based on palynological characters and matK -based molecular data. They included 46 taxa of the Gentianales and the results showed that the subfamilies of Asclepiadoideae, Secamonoideae and Periplo- coideae are monophyletic. Potgieter and Albert (2001) carried out a most comprehensive study of Apocynaceae s.l using the plastid trnL intron and trnL-F spacer of 152 taxa (75 Apocynaceae and 48 Asclepiadaceae). Their results were basically similar to earlier works (Sennblad and Bremer, 1996; Sennblad et al., 1998; Civeyrel et al., 1998) but led to better resolution of the clades due to extensive sampling. The basal most clades of the Apocynaceae were well resolved and there were several taxa basal to Alstonia which was the basal in Sennblad and Bremer’s (1996) study. The

16 revised classiﬁcation of Apocynaceae by Endress and Bruyns (2000) was greatly in- ﬂuenced by the shared data from Potgieter and Albert (2001) before its publication.

Later, Sennblad and Bremer (2002) proposed a new classiﬁcation of Apocynaceae s.l. combining classical Linnaean taxonomy and the phylogenetic taxonomy or Phy- locode system (de Queiroz and Gauthier, 1992; Cantino and de Queiroz, 2000) based on their earlier work (Sennblad and Bremer, 1996) on rbcL data and with some new taxa and ndhF gene sequences included.

1.8.3 Recent updates on Apocynaceae s.l.

Since the “rebirth” of the Apocynaceae in the year 2000 (Endress and Bruyns, 2000), there has been active research in this area. There have been two symposia on Apocynaceae held during the 16th and 17th International Botanical Congresses in 1999 (St. Louis) and 2005 (Vienna). A great deal of research on Apocynaceae covering a wide range of topics from chemical ecology to molecular systematics have been published in two special issues of Annals of the Missouri Botanical Garden (Volume 88, Issue 4, 2001 and Volume 94, Issue 2, 2007). Several problems in Apoc- ynaceae taxonomy have been addressed in the recent publications using molecular data (Endress et al., 2007).

1.9 Classiﬁcation and phylogeny of the tribe Ceropegieae

(Asclepiadoideae)

1.9.1 The genus Ceropegia

The genus Ceropegia L. is the largest genus of the tribe Ceropegieae with more than 200 species distributed only in the old world, ranging from the Spanish Canary Islands in the west, through Central, Southern, and Northern Africa, Madagas- car, Arabia, India, Southeast Asia to Northern Australia in the East (Good, 1952; Bruyns, 2003). The genus is found only in the tropical and subtropical regions of the

17 old world. Ceropegia is one of the largest and diversified genus of Asclepiadoideae. The type species of the genus is Ceropegia candelabrum Linné. The etymology of the name Ceropegia is probably from Greek: ‘keros’, wax candle; ‘pegnynai’, as- semblage; perhaps referring to the beautiful chandelier-like inflorescences in some species (Meve, 2002a). The diagnostic features of this genus are: “perennial herbs, leaf and / or stem succulents with fibrous roots, fleshy lateral root tubers. Stems prostrate to erect, often twining, terete, compressed or 4-(to 6-) angled; leaf petiolate or sessile, triangular, linear to ovate, simple, minute to large, stipular rudiments usually present; inflorescence: extra-axillary, usually shortly pedunculate; flowers sessile or pedunculate, one-many flowered in subumbellate cymes. calyx five-lobed; corolla straight or curved, tubular, inflated at base, attenuated above, generally dilated at mouth, rarely fusiform, urceolate or campanulate; lobes connate at apex, sometimes free; corolla mostly multi-coloured, blotched or striped, outside glabrous, rarely hairy, corolla tube inside often with hairs reminiscent of a fish trap (Fig. 1.4); corona staminal, uni- or bi-seriate, outer entire, bifid, hairy or glabrous; inner rarely bifid, erect convergent, divergent or hooked at tips; anthers mostly without membraneous appendage, pollen masses solitary in each anther locus, waxy, with pellucid margin, horizontal or erect; pollinia ovoid to pear-shaped, germination crest situated along the inner margins or near the apex; stigma truncate or shortly conical, five-angled. Follicles linear-lanceolate; seeds: brown, comose”. From: Jagtap and Singh (1999); Meve (2002a) The various species of the genus were placed under 21 sections by Huber (1957) in his revision of the genus, and the Indian species fall under 10 sections of this revision. Some species show various forms of succulence in stem, leaf and tuber and they are mostly found in Africa and Madagascar (Meve, 2002a). The hallmark features of Ceropegia is its tuberous roots and elaborate flowers. The corolla is tubular and dilated at the base. The corolla lobes are generally united at the tips. The leaves may be linear or broad and some species are erect and some are climbing in habit.

18 Figure 1.4: Floral morphology of Ceropegia. A– C. bulbosa,B– C. fantastica,C– C. vincaefolia,D– C. oculata. Photos from Dr. Mayur Kamble.

19 Several species within this genus are rare and endangered. The major threats to these plants are habitat destruction and local people’s use of the edible tubers as food. Due to their elaborate flower forms and ornamentation, several species have horticultural value (CITES, 2007). Some species of Ceropegia possess a flytrap mechanism as a means to enhance cross pollination (Percival, 1965; Endress, 1994). They show great diversity in flower architecture, corolla size, shape and colouring, corona structures and mechanisms of illumination of essential organs (Yadav, 1996). Pollination biology of Indian species has been studied to some extent (McCann, 1943; Chaturvedi, 1993a,b; Yadav, 1996). Morphotaxonomical study by Patil (1997) and physiological work by Gaikwad et al. (1989) and Supate et al. (1990) on some Indian species has contributed to a better understanding of the genus. Maximum diversity of Ceropegia occurs in southern Africa followed by Kenya and Madagascar. Their distribution eastwards diminishes in Arabia where only 10 species were recorded and only one species in Pakistan. Their diversity again seems to rise in India with about 52 species reported so far including 4 varieties (Table 1.4). In China there are 17 species with two species overlapping with India (Li et al., 1995). In India there seems to be two major distributions of this genus, the Himalayan region and the Peninsular region. The Himalayan species, such as C. longifolia and C. macrantha, are distinct from Peninsular species in that they do not possess tubers and all are non-succulent and herbaceous (Bruyns, 1997).

20 Table 1.4: Ceropegia species found in the Indian region – type specimen, distribution and ﬂowering period

No. Species Type specimen Distribution Flowering period 1 C. anantii Yadav Maharashtra: Maharashtra (endemic) July– et al. Sindudurg September 2 C. andamanica Andaman Island: Andaman & Nicobar December Shreekumar et al. Mount Harriet National Islands (Endemic) Park 3 C. angustifolia BANGLADESH: Silhet Arunachal Pradesh, July– Wight Assam, Meghalaya, September Sikkim, Uttar Pradesh, West Bengal, BANGLADESH 4 C. anjanerica Maharashtra: Nasik Maharashtra (endemic) July– Malpure et al. September 5 C. arnottiana MYANMAR: Prome Meghalaya (endemic) September Wight hills 6 C. attenuata Hook. Maharashtra: Malwa Goa, Karnataka, August– f. Maharashtra, Rajasthan October 7 C. barnesii Bruce South India Karnataka, Tamilnadu May–June & Chatterjee 8 C. beddomei Hook. Kerala: Peermade Kerala (endemic) November f. 9 C. bulbosa var. Coromandel Throughout India; July– bulbosa Roxb. PAKISTAN September 10 C. bulbosa var. Coromandel Throughout India September– lushii (Grah.) October Hook. f. 11 C. candelabrum L. Hortus Malabaricus Andra Pradesh, Assam, November– var. candelabrum Gujarat, Karnataka, March Kerala, Madhya Pradesh, Orissa, Tamilnadu; SRILANKA 12 C. candelabrum L. Ceropegia 110, Andhra Pradesh, August– var. biﬂora Hermann Herbarium Karnataka, Kerala, December (Ansari) Orissa, Tamilnadu 13 C. ciliata Wight Tamilnadu : Nilgiri hills Kerala, Tamilnadu August– September 14 C. decaisneana Tamilnadu : (Sisparah Karnataka, Kerala, October– Wight ghats) Nilgiri hills Tamilnadu; SRILANKA December 15 C. elegans Wall. Botanical Magazine Karnataka, Kerala, June– 1830 Tamilnadu December 16 C. ensifolia Bedd. Tamilnadu: Anaimalai Kerala, Tamilnadu August– hills September 17 C. evansii McCann Maharashtra: Khandala Maharashtra (endemic) July– September 18 C. fantastica Karnataka: Sulgeri, N. Goa, Karnataka, August Sedgwick Kanara Maharashtra 19 C. ﬁmbriifera Tamilnadu: Anaimalai Karnataka, Kerala, July–August Bedd. hills Tamilnadu 20 C. hirsuta Wight Tamilnadu: Nilgiri hills Throughout India July– & Arn. except Himalayas, November THAILAND 21 C. hookeri C. B. Sikkim: Lachen (11000 Sikkim; NEPAL June–July Clarke ex Hook. f. ft) ...Continued on next page

21 No. Species Type specimen Distribution Flowering period 22 C. huberi Ansari Maharashtra : Amba Maharashtra (endemic) August– ghat, Ratnagiri September 23 C. intermedia Tamilnadu : Sirumalai, Karnataka, Kerala, August– Wight Dindigul Tamilnadu January 24 C. jainii Ansari & Maharashtra : Maharashtra (endemic) August– Kulkarni Ambolighat, Ratnagiri September 25 C. juncea Roxb. Plate 10 Roxburgh Andhra Pradesh, July– Coromandel Karnataka, Kerala, November Maharashtra, Tamilnadu; SRILANKA 26 C. kachinensis MYANMAR: Kachin Sikkim (maybe extinct) October– Prain hills November 27 C. lawii Hook. Maharashtra: Konkan Maharashtra (endemic) August– September 28 C. longifolia Wall. NEPAL Himachal Pradesh, August– Meghalaya, Mizoram, September Sikkim, Uttar Pradesh, West Bengal, NEPAL 29 C. longifolia var. CHINA: Szetchwan Arunachal Pradesh, July–August sinensis Huber Meghalaya; CHINA 30 C. lucida Wall. Bangladesh: Silhet Assam, Meghalaya, September– Sikkim; November BANGLADESH 31 C. maccannii Maharashtra: Maharashtra (endemic) July–August Ansari Sinhagadh hill, Pune 32 C. macrantha Uttar Pradesh: Kashmir, Madhya June– Wight Kumaon, Khurie Pass & Pradesh, Meghalaya, August Himachal Pradesh, Sikkim, Uttar Pradesh, Jammu West Bengal; NEPAL, PAKISTAN 33 C. maculata Bedd. Tamilnadu: Anaimalai Kerala, Tamilnadu June– hills (2500 ft) February 34 C. mahabalei Maharashtra: Ralegaon Maharashtra (endemic) August– Hemadri & Ansari hills, Junnar September 35 C. media (Huber) Maharashtra: Maharashtra (endemic) September– Ansari Bhimashankar hills, October Pune 36 C. mohanramii Maharashtra: Maharashtra (endemic) July– Yadav Sindudurg September 37 C. metziana Miq. Tamilnadu: Devala, Karnataka, Kerala, September– Nilgiris Tamilnadu December 38 C. noorjahaniae Maharashtra: Maharashtra (endemic) July–August Ansari Wai-Panchgani ghat, Satara 39 C. oculata Hook. Botanical Magazine Kerala, Maharashtra, July–August 1844 Tamilnadu 40 C. odorata Nimmo Maharashtra: Konkan Gujarat, Maharashtra, August– Rajasthan September 41 C. omissa Huber Travancore, Coutrallam Tamilnadu (endemic) September 42 C. panchganiensis Maharashtra: Maharashtra (endemic) July–August Blatter & McCann Lingamala near Mahabaleshwar, Satara 43 C. pubescens Wall. NEPAL Meghalaya, Nagaland, June– Sikkim, West Bengal; September NEPAL ...Continued on next page

22 No. Species Type specimen Distribution Flowering period 44 C. pusilla Wight & Tamilnadu: Nilgiri hills Karnataka, Kerala, June– Arn. Maharashtra, Punjab, August Tamilnadu 45 C. rollae Hemadri Maharashtra: Dhak Maharashtra (endemic) August– khilla near Junnar September 46 C. sahyadrica Maharashtra: Maharashtra (endemic) August– Ansari & Kulkarni Ambolighat, Ratnagiri September 47 C. santapaui Maharashtra: Mahad Maharashtra (endemic) August– Wadhwa & Ansari Ghats near September Mahabaleshwar 48 C. schumanniana Tamilnadu: Kharian Tamilnadu (endemic) December Swarup. & Shola near Top slip, Mangaly Coimbatore 49 C. spiralis Wight Tamilnadu: Balaghat Andra Pradesh, August– hills Karnataka, Kerala, October Tamilnadu 50 C. thwaitesii Hook. Botanical Magazine Kerala, Tamilnadu April–June 1854 51 C. vincaefolia Botanical Magazine Maharashtra (endemic) August– Hook. 1839 September 52 C. wallichii Wight NEPAL Himachal Pradesh, May–June Punjab, Uttar Pradesh

23 In India, there are three widespread species Ceropegia bulbosa, Ceropegia juncea and Ceropegia hirsuta (C. hirsuta has been discovered as far as in Thailand (Boon- jaras and Thaithong, 2003). Many species of the Northern Western Ghats are endemic to the region (Malpure et al., 2006). Twenty species occur in the western Indian state of Maharashtra (Fig. 1.5), of which 14 occur only in Maharashtra. Most of the endemic species of Western Ghats are restricted to a narrow range of distribution and some of them occur only in their type localities. Species like C. evansii, C. fantastica, C. huberi, C. lawii, C. maccannii, C. mahabalei, C. noorjahaniae, C. odorata, C. panchganiensis, C. rollae, C. sahyadrica, and C. santapaui may become extinct in a few decades unless conservation measures are taken.

Figure 1.5: Location of Maharashtra state within India

The Indian species could be grouped into three based on stem and leaf succulence and ecological adaptations. The two varieties of C. bulbosa, C. bulbosa var. bulbosa

24 and C. bulbosa var. lushii, show slight succulence in stem and leaf and features CAM (Crassulacean acid metabolism) (Supate et al., 1990) and occurs in comparatively drier parts of the country. Ceropegia juncea is widespread throughout India and possesses small reduced leaves, ﬂeshy green twining stem, shows CAM (Gaikwad et al., 1989) and occurs in dry regions. The remaining species such as C. attenuata and C. media have membraneous leaves and grow in moist forests of Western Ghats.

Physiological adaptations could be well correlated to the distribution of Ceropegia species in Peninsular India (Yadav, 2005). Of the 20 species that occur in Northern Western Ghats, 8 show erect habit, C. noorjahaniae shows both erect and climbing habit, while 11 others show climbing habit. Erect species usually occur in open grassy grounds while climbing species grow in open shrubby forests. Ceropegia species have little economic signiﬁcance, but their biological and ecological role is signiﬁcant. Their tubers are starchy and edible and some wild animals, like wild boar, bear etc., eat them. Some tribals in India also consume the tubers as food which in turn poses a threat to the survival of these plants. Ceropegia tubers have been a important source of food in the course of human evolution (Laden and Wrangham, 2005). The tubers of C. bulbosa are used in Bihar state of India to cure cold and eye-diseases. The bitter principle of the root of C. bulbosa is an alkaloid,

Ceropegin (Mabberley, 1997). The bitter tuber of C. bulbosa also cures diarrhoea and dysentery, inflammation of gums, delirious fevers of parturition (Kirtikar and Basu, 1975). Butterflies lay their eggs on leaves of certain species and their larvae feed on leaves of Ceropegia species such as C. bulbosa, C. panchganiensis, C. oculata and C. vincaefolia to complete their life cycle. Some of the butterflies are host specific and thus conservation of Ceropegia is crucial from an ecological perspective (Yadav, 2005). Meve and Liede (2004) conducted a molecular study of the tribe Ceropegieae, only 4 species of Ceropegia were included. In a recent study, Meve and Liede-

Schumann (2007) have proved the paraphyly of Ceropegia with 36 species. In their

25 results Ceropegia was in seven clades and in one clade was shared with Brachystelma species. They discuss the paraphyletic situation of Ceropegia and Brachystelma but support the classical morphological groupings instead of renaming the genera. In the present study the molecular phylogenetic position of Ceropegia was re-tested with 26 Indian species. A few species of Brachystelma were also included in this study. The main aim of this study was to ﬁnd the phylogenetic relationships of Ceropegia which occur as endemics in the Western Ghats region of India.

1.9.2 The genus Caralluma

Caralluma R. Br. is a genus with about 70 species with cactus like features from the old world. They occur in dry regions of tropical Asia including India and Burma, Arabia, Mediterranean, North East and North Central Africa (Plowes, 1995; Müller and Albers, 2002). Caralluma is part of a group of succulents of the subfamily Asclepiadoideae commonly referred to as Stapeliads or more commonly ‘wax flowers’. Stapeliads have enormous horticultural value because of their extremely beautiful flowers. The etymology of the word ‘Caralluma’ is from Arabian, ‘qarh al-luhum’, meaning wound in the flesh or abscess probably from the floral odour in some taxa

(Müller and Albers, 2002). The genus was first described by Robert Brown in 1810 to describe an Indian species with enlongated stem. The type species is Caralluma adscendens (Roxburgh) R.Brown from the Coromandel coast in South India. All species of Caralluma are perennial succulents. The diagnostic features of the genus are: “4-ribbed or 4-angled stems often tapering towards the tips, glabrous, ribs continuous or divided into tubercles; tubercles usually laterally compressed, rarely rounded or conical; leaves when present minute, lanceolate or subulate scales, deciduous; flowers single or few or many in umbel-like cymes at the apex of the stem. Peduncle terete, glabrous, mostly bracteate; calyx five-lobed; sepals short, deltoid to lanceolate, glabrous; corolla rotate or broadly campanulate, five-lobed valvate; corona staminal, double outer five deeply bifid segments, inner of five linear segments, incumbent on anthers; anthers without membraneous appendage; pollen

26 masses solitary in each anther loculus, waxy ascending with pellucid margin; Stigma five-angled; follicles narrowly fusiform, slender, smooth; seeds comose”(from Müller and Albers (2002)). Since Brown (1810) several related genera were described such as Desmidorchis, Boucerosia, Hutchinia, Apteranthes, Sarcocodon and Quaqua. Most of the generic names were hardly used until the genus Quaqua was revived by Bruyns (1983). One generic name to be frequently used was Boucerosia, first described by Wight and Arnot (1834) to include Indian species with flowers in terminal umbels. Boucerosia was widely used to describe species from Indian, Arabian and Mediterranean regions until Brown (1892) used the name Caralluma to jointly describe all species discovered in Southern Africa and species named under Boucerosia, based on coronal characters. Schumann (1895) recognised 3 sections within the group, “Eucar- alluma”(= Caralluma), Lalacaralluma and Boucerosia. But he left out southern African species and included only species from East Africa northwards. The first comprehensive account of the entire genus was by White and Sloane (1937) who followed Brown (1892). They described Caralluma as what species out when all Stapeliad genera have been removed and made the genus like a “dust bin” full of species that could not be fitted into other genera (Plowes, 1995). Two recent revisions of the genus were given by Gilbert (1990) and Plowes (1995).

Gilbert (1990) divided the Caralluma group in to 4 genera based on stem and ﬂower morphology. They are 1) Frerea, the monotypic genus with prominent leaves from India, 2) Caralluma a large genus comprising of 3 subgenera (a) Caralluma (b) Urmalcala and (c) Boucerosia, 3) Pachycymbium, also called ‘Ango’ group and 4)

Duvalliandra. Some more species were moved to Duvalia and Rhytidocaulon. The basis of this classiﬁcation was the stem morphology and pollinial characters rather than coronal characters. Plowes (1995), based on his exhaustive study, further revised the group into 17 genera and 70 species based on stem characters and the morphology of the pollinium. In his work he reinstated genera such as Apteranthes

Mikan, Boucerosia Wight & Arnot and Spathulopetalum Chiovenda and proposed

27 several new genera. Later the number of genera in this group were reduced by inclusion of Huerniopsis in Piaranthus (Bruyns, 1999b) and of Angolluma, Pachy- cymbium, Orbeanthus and Orbeopsis in Orbea (Bruyns, 2000b). New monotypic genera such as Baynesia, Ballyanthus and Socotrella were also described (Bruyns, 2000a; Bruyns and Miller, 2002). For several years the origin of stem-succulent Stapeliads was thought to be in India because the only succulent Stapeliad with true leaves, Frerea indica (= Boucerosia frerei) was found there. But F. indica is a polyploid with 2n=44 (Al- bers, 1983) whereas other Indian Boucerosia have a diploid chromosome number of 22 (Albers and Meve, 2001). Further, Meve (1997) demonstrated that the centre of Stapeliad origin is in East Africa where the maximum diversity of Caralluma s.l. group occurs. Bruyns (2000c) performed a cladistic biogeographical study and came to the same conclusion about the origin of the Stapeliads. Molecular systematic work on the stapelioid Ceropegieae was done by Meve and Liede (2002). They found support for seven (Caralluma, Apteranthes, Austral- luma, Boucerosia, Caudanthera, Desmidorchis and Monolluma) of the 17 genera designated by Plowes (1995) within the Caralluma complex. Several taxonomical corrections were proposed based on this molecular study. In the present study 12 taxa from India were included with the aim of ﬁnding the phylogenetic relationships of Indian representatives of Caralluma among themselves and with those from other areas.

1.10 Objectives of this research project

The main aims of this research are the screening of antioxidant capacities from Indian medicinal plants and phylogenetic analysis of some groups of the Asclepiadoideae

(Apocynaceae). As described in Section 1.4 there are thousands of plants used in traditional Indian medicine systems. Since the dawn of modern medicine, plants have served as major source of drugs. There is always a demand for new medicines and especially new compounds as drugs and traditional knowledge has been greatly

28 helpful in the discovery of new drugs (Fabricant and Farnsworth, 2001). Antioxi- dants are gaining importance in both medicine and food industry in recent times

(Bray, 1999). However, there are no large scale studies on the antioxidant activities of Indian medicinal plants which are a potential source of natural antioxidants. The subfamilies of Asclepiadoideae and Periplocoideae have several medicinal properties but antioxidant screening of these two families have not been done before.

Therefore these two families were screened for antioxidant potential and free radical scavenging activity. Major phenolic compounds were also aimed to be identiﬁed in this study. Ceropegia is a speciose genus of Asclepiadoideae which has evolved a myriad of ﬂower forms and spread only in the old world. There are several endemic species in the Western Ghats region of India. Their biogeography and molecular phylogeny has not been studied. In this study, 26 of the Indian species and 4 of a related genus Brachystelma were studied. Though there have been two studies on the tribe Ceropegieae, many Indian species have not been studied so far. Therefore, Indian representatives of Caralluma and Boucerosia were studied in relation to other species from Africa. Molecular phylogeny of the family Apocynaceae has recently been published (Sennblad and Bremer, 2002), yet their sampling of the subfamily Asclepiadoideae was limited. In order to better resolve the tree from previous studies, in the present study, several genera representing Asclepiadoideae and its tribes were studied using rbcL gene sequences. Chapter 1 of this thesis is the review of literature which introduces about antioxidants, Indian medicinal plants, medicinal plants of Asclepiadoideae and Periplo- coideae, morphology and systematics of Apocynaceae and also about the genera Ceropegia and Caralluma Chapter 2 is about the screening of antioxidant activities from 133 species of Indian medicinal plants. The plants with high antioxidant activities were further screened for major phenolic compounds using HPLC. A comparison between the

29 known compounds and new compounds from this study is also listed. From an initial screening of antioxidants from several Indian medicinal plants, it was observed that Asclepiadoideae and Periplocoideae have moderately high antioxidant activities (> 5 mmol TEAC/100 g DW by ABTS assay) and research on antioxidants from other species of these subfamilies have not been done. Chapter 3 describes the antioxidant study of 12 species of medicinal plants from these two subfamilies. Their major compounds were also studied by LC-MS and described along with new compounds. In Chapter 4, the molecular systematics of 26 species of the genus Ceropegia is described using nuclear ITS, chloroplast trnT-L, trnL and trnL-F regions. Com- parative phylogeny with other related genera and species from Africa was done in reference to published data. Chapter 5 describes the molecular study of Indian species of Caralluma and Boucerosia and their phylogenetic position with relation to closely related genera using ITS and cpDNA markers.

Chapter 6 describes the molecular systematics of Apocynaceae with special reference to Asclepiadoideae using rbcL exon. The relationship of the tribes and subtribes within the subfamily are discussed based on the results. Chapter 7 is a discussion about the major conclusions from this study.

30 Chapter 2

Antioxidant properties of Indian medicinal plants and their phenolic compounds

2.1 Introduction

Though several workers have reported on the antioxidant activity of various Indian medicinal plants, a comparative, multi-method screening of antioxidant activity for a large number of Indian medicinal plants in relation to their phenolic compounds is needed to provide a better understanding of their relative importance as natural antioxidants.

Several diﬀerent methods are available and have been used to assess the total antioxidant capacity of plant extracts, such as the ABTS assay (Miller et al., 1993), the ferric reducing antioxidant power (FRAP) assay (Benzie and Strain, 1996), and the oxygen radical absorbance capacity (ORAC) assay (Cao et al., 1993). In the present study, the total antioxidant capacities of 133 traditional Indian medicinal plant species from 64 families were evaluated using an improved ABTS method (Re et al., 1999; Cai et al., 2004), an improved FRAP assay, and a modiﬁed DPPH assay. Total phenolic contents of these plants were evaluated using the classical Folin-

31 Ciocalteau reagent, and the relationship between the total antioxidant capacities and phenolic contents in the samples was also studied. Furthermore, reversed-phase high performance liquid chromatography (RP-HPLC) was used to identify major phenolic compounds in the Indian medicinal plants with high antioxidant activity. These data will be helpful for comparison of the antioxidant activities and phenolic compounds of diﬀerent medicinal plants and also useful for understanding their chemical constituents and functionality.

2.2 Materials and Methods

2.2.1 Sample collection

A total of 137 samples, representing 133 traditional Indian medicinal plant species from 64 families, were collected from traditional medicine stores in Madras, India. These medicinal plants were harvested, dried, and were made ready for medicinal preparations according to Ayurveda and Siddha traditions. The identity of the specimens were confirmed by Google searches of the images or descriptions. For some specimens clarified by expert botanists working on Indian medicinal plants. The scientific names of the species and families studied, code number, and parts used are detailed in Table 2.1. The plant parts used in this study are the same as those generally used in medicinal preparations in traditional Indian medicine, such as leaves, stems/barks, flowers, fruits, seeds, roots/tubers/rhizomes, or even the whole plant.

2.2.2 Chemicals and reagents

2,2-azinobis (3-ethylbenzothiazoline-6-sulfonic acid) diammonium salt (ABTS), 1,1- diphenyl-2-picrylhydrazyl (DPPH), 2,4,6-tripyridyl-s-triazine (TPTZ), FeCl3.3H2O, potassium persulfate, sodium acetate, and sodium carbonate, xanthine oxidase (from bovine milk) and xanthine were purchased from Sigma/Aldrich (St. Louis, MO). Folin-Ciocalteau reagent, formic acid, glacial acetic acid, and HPLC grade or-

32 ganic solvents were purchased from BDH (Dorset, England). Trolox (6-hydroxy- 2,5,7,8-tetramethylchromate-2-carboxylic acid) was from Fluka Chemie AG (Buchs,

Switzerland). Authentic standards for various phenolic compounds, such as hydroxybenzoic acids, hydroxycinnamic acids, flavones, flavonols, flavanones, flavanols, isoflavones, coumarins, lignans, quinones, curcuminoids, phenolic terpenoids, phenolic volatile oils (e.g., eugenol, carvacrol, thymol), were obtained from Sigma/Aldrich and Fluka.

2.2.3 Extract preparation

The medicinal plants collected were ground to ﬁne powder (710 µm) by a Kenwood Multi-Mill (Kenwood Ltd. UK) and passed through a 24-mesh sieve. The ground samples were dried to constant weight in a desiccant at room temperature (∼23

◦C). For methanolic extraction, 50 mL 80% methanol was added to 2 g dried plant material in a conical flask, and kept it at room temperature overnight with occasional shaking. The extract was then filtered using a Millipore filter with 0.45 µm nylon membrane under vacuum at 23 ◦C. The filtrate was stored at 4 ◦C until use.

2.2.4 ABTS assay

Antioxidant activity was measured using a Spectronic Genesys 5 spectrophotometer using the improved ABTS method (Re et al., 1999; Cai et al., 2004). The ABTS radical cation (ABTS•+) solution was prepared by the reaction of 7 mM ABTS and 2.45 mM potassium persulfate, after incubation at 23 ◦C in dark for 16 hr. The ABTS•+ solution was then diluted with 80% ethanol to obtain an absorbance of 0.700 ± 0.005 at 734 nm. ABTS•+ solution (3.9 mL; absorbance of 0.700 ± 0.005) was added to 0.1 mL of the test sample and mixed thoroughly. The reaction mixture was allowed to stand at 23 ◦C for 6 min and the absorbance at 734 nm was immediately recorded. The samples were diluted with 80% ethanol so as to give 20 –

80 % reduction of the blank absorbance with 0.1 mL of sample. A standard curve was obtained by using Trolox standard solution at various concentrations (ranging from

33 0 – 15 µM) in 80% ethanol. The absorbance of the reaction samples was compared to that of the Trolox standard and the results were expressed in terms of Trolox equivalent antioxidant capacity (TEAC), expressed as mmol Trolox equivalents per 100 g dry weight of the plant material.

2.2.5 DPPH Assay

The traditional DPPH assay (Brand-Williams et al., 1995) was modiﬁed for use in this study. The assay procedure was similar to the ABTS method described above.

The DPPH radical (DPPH•) solution (60 µM) was prepared in 80% ethanol (Cai et al., 2003). The same samples of medicinal plant extracts diluted with 80% ethanol during the ABTS assay were used in the DPPH assay. The DPPH• solution (3.9 mL; absorbance of 0.68 ± 0.005 at 515 nm) was added to 0.1 mL of the tested extracts.

The reaction for scavenging DPPH• radicals was carried out at room temperature in dark for 120 min, and then the reduction in absorbance was recorded at 515 nm. A calibrated Trolox standard curve was also made. The results were also expressed as TEAC units (mmol Trolox equivalents per 100 g dry weight of sample).

2.2.6 FRAP assay

Ferric reducing antioxidant power (FRAP) assay was performed according to Benzie and Strain (1996) and Faria et al. (2005) with some modiﬁcations. The FRAP assay reagent was prepared by adding 10 vol 300 mM acetate buﬀer, pH 3.6 (3.1 g sodium acetate and 16 mL glacial acetic acid), 1 vol 10mM TPTZ prepared in 40 mM HCl and 1 vol 20 mM FeCl3. The mixture was diluted to 1/3 with methanol and pre- warmed at 37 ◦C. This reagent (3 mL) was mixed with 0.1 mL diluted test samples similar to those used for the ABTS and DPPH assays. The mixture was shaken and incubated at 37 ◦C for 8 min and the absorbance was read at 593 nm. A blank with 0.1 mL methanol was used for calibration. A standard curve was made with Trolox and the results were expressed as micromoles of Trolox equivalents (TE) per gram dry weight of sample (µmol/g DW)..

34 2.2.7 Determination of total phenolic content

The total phenolic content (TPC) of each sample was estimated using the Folin- Ciocalteau colorimetric method according to Liu et al. (2002) and Cai et al. (2004) with minor modiﬁcations. Appropriately diluted test sample (0.2 mL) was reacted with 0.5 N Folin-Ciocalteau reagent for 4 min at room temperature. The reaction was then neutralized with saturated sodium carbonate (75 g/L) and allowed to stand for 2 hr in dark at room temperature. Later the absorbance of the resulting blue color was measured at 760 nm with a spectrophotometer. Quantiﬁcation was done on the basis of a standard curve with gallic acid. Results were expressed as gram of gallic acid equivalent (GAE) per 100 g dry weight.

2.2.8 RP-HPLC analysis

RP-HPLC analysis was conducted on a Hewlett-Packard HPLC System (HP 1100 series, Waldbronn, Germany), consisting of a binary pump and a diode-array detector (DAD) and equipped with a 250 × 4 mm i.d., 5-µm, Nucleosil 100-5 C18 column (Agilent Technologies, Palo Alto, CA). The chromatographic conditions followed according to Cai et al. (2004) with minor modifications (solution A: 2.5% formic acid; solution B: 100% methanol; gradient elution program: 0 min, 5% B; 15 min, 30% B; 40 min, 40% B; 60 min, 50% B; 65 min, 55% B; and 90-98 min, 100% B). Flow rate was 0.8 mL/min and injection volume was 20 µL. Detection was monitored at different wavelengths (around λmax) for various phenolic compounds, i.e., 280 nm for hydroxybenzoic acids, tannins, flavanones, flavanols, isoflavones, lignans, quinones, phenolic diterpenes, and some volatile oils (aromatic compounds); 320 nm for hydroxycinnamic acids, flavones, and coumarins; 370 nm for flavonols and chalcones; 420 nm for curcuminoids and anthraquinones, and 520 nm for anthocyanins.

2.2.9 Statistical analysis

All determinations of antioxidant capacity by ABTS, DPPH, and FRAP assays and measurements of TPC were conducted in triplicate. The reported value for each

35 sample was calculated as the mean of three measurements. Correlation coeﬃcients (R) and coeﬃcients of determination (R2) were calculated using Microsoft Excel

2000.

2.3 Results

2.3.1 Total antioxidant capacity and phenolic content

The results of three in vitro assays (ABTS, DPPH, and FRAP) for antioxidant properties of the 137 samples are given in Table 2.1. The TEAC values of ABTS assay exhibited extremely large variation from 0.16 to 500.70 mmol Trolox equivalents per 100 g dry weight (mmol TEAC/100g DW). The mean value of all tested medicinal plants was 27.07 mmol TEAC/100g DW. The highest antioxidant activity was found in the fruit extract of Terminalia chebula (500.70 mmol TEAC/100g DW), followed by the gum extract of Acacia catechu (428.62 mmol TEAC/100g DW), pericarp extract of Punica granatum (316.29 mmol TEAC/100g DW), gall extract of Rhus succedanea (224.19 mmol TEAC/100g DW), seed extract of Mangifera indica (166.89 mmol TEAC/100g DW), bark extract of Myrica nagi (153.76 mmol TEAC/100g DW), fruit extract of Terminalia bellirica (132.53 mmol TEAC/100g DW) and leaf & ﬂower extract of Cassia auriculata (118.63 mmol TEAC/100g DW). The total antioxidant capacity determined by the DPPH assay also showed a wide variation in TEAC values from 0.00 to 679.69 mmol per 100 g dry weight (DW) with an average of 28.05 among the 137 medicinal plant samples. Similar to the results of the ABTS assay, high antioxidant capacities were found in the same set of species. The species with the highest TEAC value (679.69 TEAC/100g DW) was also Terminalia chebula. Acacia catechu had the next highest value (421.18 mmol TEAC/100g DW), followed by Punica granatum (394.66 mmol TEAC/100g DW), Rhus succedanea (236.49 mmol TEAC/100g DW), Mangifera indica (184.62 mmol TEAC/100g DW), Terminalia bellirica (161.30 mmol TEAC/100g DW), Myrica nagi (149.81 mmol TEAC/100g DW), and Cassia auriculata (112.25 mmol TEAC/100g

36 DW). In contrast, Cucumis sativus had very low antioxidant capacity. Its DPPH value was close to 0 and its ABTS value was also very low (0.51 mmol TEAC/100 g DW). The values of FRAP assay were expressed as µmol TEAC per g DW of the sample (µmol TEAC/g DW). The FRAP values of the samples varied from 0.16 to 124.05 µmol TEAC/g DW with a mean value of 6.56 (Table 2.1). Acacia catechu showed the highest antioxidant capacity with a FRAP value of 124.05 µmol TEAC/g DW, followed by Rhus succedanea (102.45 µmol TEAC/g DW), Punica granatum (90.47 µmol TEAC/g DW) Terminalia chebula (85.60 µmol TEAC/g DW), Cassia auriculata (67.88 µmol TEAC/g DW), Myrica nagi (26.53 µmol TEAC/g DW) and Terminalia bellirica (26.42 µmol TEAC/g DW).

The percentage distribution of diﬀerent classes of TEAC values of the tested plants by the ABTS assay was shown in Fig. 2.1 Of the 137 samples studied, eight samples (6%) had very high antioxidant capacity (>100.01 mmol/100 g DW). Nearly half of the samples (69 samples, 50%) had TEAC values between 5.01 to

100.00 mmol/100 g DW, and 46 samples (34%) between 1.01 to 5.00 mmol/100 g DW. Only 14 samples (10%) showed very low antioxidant activity (less than 1.00 mmol/100 g DW). The distribution chart indicated that most of the Indian medicinal plant extracts had intermediate levels of total antioxidant capacities, similar to the previous ﬁndings in 112 traditional Chinese medicinal (TCM) plants (Cai et al., 2004).

37 Figure 2.1: Distribution (percentage) of 137 Indian medicinal plant samples among diﬀerent ranges of total antioxidant capacity assayed by ABTS method (TEAC value, mmol/100g DW). A: > 100.1; B: 50.01–100; C: 25.01–50; D: 10.01–25; E: 5.01–10; F: 1.01–5; G: <1.

38 Table 2.1: 133 Indian medicinal plants (137 samples) studied and total antioxidant capacity and phenolic content of their methanolic extracts

Family and species (code number)5 Medicinal part ABTS 1 DPPH 2 FRAP3 TPC4 Acanthaceae Andrographis paniculata (Burm.f.) Wallich ex Nees. (1) Whole plant 4.76 0.79 1.77 0.72 Blepharis edulis Pers. (2) Seed 9.80 11.21 1.64 1.75 Hygrophila auriculata (Schum.) Heine (3) Seed 7.21 6.89 1.81 1.08

Acoraceae Acorus calamus L. (4) Rhizome 2.55 1.11 0.52 0.49

39 Aizoiaceae Mullogo nudicaulis Lam. (5) Whole plant 1.25 0.96 0.80 0.96

Amaranthaceae Achyranthes aspera L. (6) Whole plant 3.03 0.88 0.90 0.39 Aerva lanata (L.) Juss. (7) Whole plant 2.43 0.59 0.88 0.35

Anacardiaceae Rhus succedanea L. (8) Galls 224.83 236.49 104.45 12.13 Semecarpus anacardium L.f(9) Seed 20.19 26.10 3.15 1.64 Mangifera indica L. (10) Seed 166.89 184.62 25.32 8.67

Apiaceae (Umbelliferae) Anethum sowa Roxb. (11) Seed 8.28 4.45 1.75 1.45 Continued on next page Table 2.1 – continued from previous page Family and species (code number)5 Medicinal part ABTS 1 DPPH 2 FRAP3 TPC4 Carum copticum (L.) Benth. & Hook. F (12) Seed 42.44 8.87 8.86 3.15 Coriandrum sativum L.(13) Seed 2.22 2.90 0.33 0.41 Cuminum cyminum L.(14) Seed 6.31 14.02 1.82 0.78 Foeniculum vulgare Mill. (15) Seed 6.99 2.63 1.79 1.11

Apocynaceae Holarrhena antidysenterica Wall. (16) Fruit 9.49 4.69 1.83 0.94 Rauvolﬁa serpentina (L.) Benth. ex Kruz. (17) Stem 6.66 2.58 0.92 0.93

Aristolochiaceae Aristolochia bracteata Retz.(18) Leaf,stem,pod 4.94 2.61 0.89 0.63

40 Asclepiadaceae Calotropis gigantea (L.)R.Br.(19) Root 11.82 8.29 1.83 1.28 Gymnema sylvestre (Retz.) R.Br. ex Reomer & Schultes (20) Leaf 6.90 1.25 1.69 1.31 Hemidesmus indicus R.Br.(21) Root 17.24 15.76 3.46 2.19

Asteraceae (Compositae) Anacyclus pyrethrum L.(22) Root 4.25 4.54 1.41 0.92 Artemisia abrotanum L.(23) Leaf, 2.43 1.68 0.34 0.49 Eclipta alba (L.) Hassk. (24) Leaf, ﬂower 2.02 1.24 0.54 0.30 Vernonia anthelmintica (L.) Willd. (25) Seed 9.82 13.34 3.39 1.66

Berberidaceae Berberis aristata DC.(26) Root 3.59 1.65 0.70 0.36

Continued on next page Table 2.1 – continued from previous page Family and species (code number)5 Medicinal part ABTS 1 DPPH 2 FRAP3 TPC4 Bignoniaceae Oroxylum indicum (L.)Kunze(27) Root 5.39 3.51 1.81 0.24

Bombacaceae Bombax malabaricum DC.(28) Gum 55.38 80.12 9.06 5.89

Brassicaceae Brassica alba (L.) Boiss (29) Seed 2.67 1.49 0.17 0.30 Brassica nigra (L.)Koch(30) Seed 2.82 1.45 0.55 0.32 Lepidium sativum L. (31) Seed 1.60 1.66 0.65 0.15 Matthiola incana (L.)Ait.f.(32) Seed 3.64 3.27 0.83 0.47

41 Burseraceae Balsamodendron mukul Hookex.Stocks(33) Gum 11.08 7.23 1.90 1.56 Boswellia serrata Roxb.(34) Gum 0.16 0.01 0.18 0.22 Canarium strictum Roxb.(35) Gum 0.51 0.20 0.17 0.22

Caesalpinaceae (Leguminosae) Caesalpinia bonducella (L.) Roxb. (36) Seed 0.61 0.13 0.18 0.13 Caesalpinia sappan L.(37) Heartwood 34.65 28.33 7.96 5.46 Cassia auriculata L. (38) Leaf,Flower 118.63 112.25 67.88 9.47 Cassia ﬁstula L. (39) Pod 9.38 7.69 1.58 1.01 Cassia tora L. (40) Seed 7.27 6.01 1.63 0.64

Capparaceae Cleome viscosa L. (41) Seed 2.16 0.85 0.36 0.25 Continued on next page Table 2.1 – continued from previous page Family and species (code number)5 Medicinal part ABTS 1 DPPH 2 FRAP3 TPC4 Celastraceae Celastrus paniculata Willd. (42) Seed 0.76 0.35 0.19 0.27

Combretaceae Terminalia arjuna (DC.)Wight&Arn.(43) Bark 73.00 85.64 18.1 4.78 Terminalia bellirica Roxb.(44) Fruit 132.53 161.3 26.42 9.27 Terminalia chebula Retz.(45) Fruit 500.7 679.69 85.60 35.63

Convolvulaceae Evolvulus alsinoides (L.)(46) Wholeplant 2.27 1.85 0.18 0.31 Ipomoea digitata L. (47) Root 0.40 0.08 0.17 0.06 Ipomoea turpethum R.Br.(48) Root 8.40 5.54 1.77 0.69 42

Cucurbitaceae Corallocarpus epigaeus (Rottl.)Clarke(49) Tuber 0.71 0.36 0.18 0.15 Cucumis sativus L. (50) Seed 0.51 0 0.18 0.07 Mukia scabrella (L.)Arn(51) Wholeplant 1.29 0.36 0.18 0.16 Trichosanthes cucumeria L.(52) Wholeplant 1.51 0.33 0.18 0.18

Cyperaceae Cyperus rotundus L. (53) Root 9.84 9.65 1.74 1.49

Elaeocarpaceae Elaeocarpus tuberculatus Roxb. (54) Seed 2.56 1.10 0.54 0.28

Euphorbiaceae Continued on next page Table 2.1 – continued from previous page Family and species (code number)5 Medicinal part ABTS 1 DPPH 2 FRAP3 TPC4 Euphorbia hirta L. (55) Whole plant 38.35 50.66 1.69 3.24 Euphorbia lathyrus L.(56) LeafandSeed 4.54 6.01 0.91 1.15 Phyllanthus amarus Schum. & Thonn. (57) Whole plant 55.05 67.60 9.06 5.70 Ricinus communis L.(58) Seed 0.65 0.22 0.19 0.11

Fabaceae Abrus precatorius L. (59) Seed 75.98 94.84 13.59 3.97 Dolichos biﬂorus L. (60) Seed 4.68 2.35 1.37 0.35 Mucuna pruriens (L.)DC.(61) Seed 90.80 80.08 13.01 6.15 Psoralea corylifolia L.(62) Seed 21.08 2.35 3.54 2.53

Fagaceae 43 Quercus infectoria Oliv. (63) Seed 11.71 5.39 1.85 1.64

Flacourtiaceae Hydnocarpus kurzii (King)Warb.(64) Seed 0.54 0.22 0.18 0.12

Gentianaceae Gentiana kurroo Roy.(65) Root 21.38 17.40 5.31 3.90

Guttiferae Garcinia mangostana L.(66) Pericarp 39.19 26.91 8.56 5.10 Mesua ferrea L. (67) Seed and pericarp 35.22 56.67 8.99 4.18

Hypoxidaceae Curculigo orchioides Gaert.(68) Rhizome 10.60 6.96 1.69 1.32 Continued on next page Table 2.1 – continued from previous page Family and species (code number)5 Medicinal part ABTS 1 DPPH 2 FRAP3 TPC4

Illiciaceae Illicium verum Hook.ﬁl.(69) Fruit 16.22 17.63 1.69 2.37

Lamiaceae Ocimum basilicum L.(70) Leaf 25.06 23.45 7.04 2.63 Ocimum sanctum L. (71) Leaf 7.05 7.18 0.89 0.98

Lecythidaceae Barringtonia racemosa (L.) Blume ex. DC. (72) Seed 18.39 18.61 2.64 1.68

Liliaceae 44 Aloe littoralis Baker. (73) Leaf 49.13 53.08 8.68 6.2 Asparagus adscendens Roxb.(74) Root 1.68 0.37 0.33 0.27 Smilax china L. (75) Root 8.75 9.70 1.70 1.38

Loganiaceae Strychnos nux-vomica L.(76) Seed 0.61 0.38 0.16 0.11 Strychnos potatorum L.(77) Seed 1.70 0.71 0.38 0.26

Lythraceae Lawsonia inermis L. (78) Seed 16.33 7.16 2.62 3.68

Malvaceae Althea oﬃcinalis L. (79) Seed 1.45 0.67 0.18 0.26 Hibiscus rosa-sinensis L.(80) Flower 21.15 24.66 5.31 3.15 Continued on next page Table 2.1 – continued from previous page Family and species (code number)5 Medicinal part ABTS 1 DPPH 2 FRAP3 TPC4

Menispermaceae Anamirta cocculus (L.) Wight & Arn. (81) Fruit 7.01 7.37 1.52 1.18 Tinospora cordifolia (Lour.)Miers.(82) Root 4.08 1.75 0.72 0.45

Mimosaceae Acacia arabica (Lam.) Willd. (83) Gum 0.75 0.59 0.17 0.06 Acacia catechu Willd.(84) Gum 428.62 421.18 124.05 41.47 Entada rheedii Sprengel (85) Seed 59.40 53.80 16.83 5.60

Moringaceae Moringa oleifera Lam.(86) Seed 0.74 0.47 0.17 0.18 45

Myricaceae Myrica nagi Thunb. (87) Bark 153.76 149.81 26.53 15.02

Myrisinaceae Embelia ribes Burm.f.(88) Fruit 33.31 16.01 8.82 2.36

Myristicaceae Myristica fragrans Houtt.(89) Seedcoat(mace) 26.03 9.70 5.37 1.98 Myristica fragrans Houtt.(89) Seed(nutmeg) 17.92 13.31 5.12 1.30

Myrtaceae Syzygium cumini (L.) Skeels (90) Seed 85.10 99.16 18.37 3.30

Continued on next page Table 2.1 – continued from previous page Family and species (code number)5 Medicinal part ABTS 1 DPPH 2 FRAP3 TPC4 Nyctaginaceae Boerhaavia diﬀusa L.(91) Root 1.18 0.43 0.18 0.19 Pedaliaceae Pedalium murex L. (92) Fruit 3.43 0.91 0.84 0.49

Pinaceae Cedrus deodara (Roxb.exD.Don)G.Donf.(93) Wood 10.10 23.68 5.22 1.53

Piperaceae Piper chaba Hunter (94) Fruit 6.34 3.77 1.81 0.88 Piper cubeba L. (95) Fruit 4.19 1.88 1.42 0.86 Piper longum L. (96) Fruit 4.76 0.94 1.47 0.68 46 Piper nigrum L. (97) Fruit (black) 2.81 0.91 0.72 0.65 Piper nigrum L. (97) Fruit (white) 1.36 0.50 0.18 0.38

Plantaginaceae Plantago ovata Forsk. (98) Seed 0.79 0.49 0.17 0.10

Plumbaginaceae Plumbago rosea L. (99) Root 43.24 37.66 8.69 4.41

Punicaceae Punica granatum L.(100) Seed 3.53 2.90 0.94 0.51 Punica granatum L.(100) Pericarp 316.29 394.66 90.70 19.22

Ranunculaceae Continued on next page Table 2.1 – continued from previous page Family and species (code number)5 Medicinal part ABTS 1 DPPH 2 FRAP3 TPC4 Aconitum ferox Wall.exSer.(101) Root 1.77 1.09 0.18 0.59 Aconitum heterophyllum Wall.(102) Root 3.49 3.19 0.91 0.46 Nigella sativa L. (103) Seed 1.66 1.08 0.52 0.35

Rubiaceae Adina cordifolia (Roxb.)Hook.f.exBrandis(104) Root 10.07 9.32 1.46 1.56

Rubia cordifolia L. (105) Root 10.49 8.23 1.83 1.15 Spermacoce hispida L.(106) Wholeplant 3.91 2.73 0.92 0.77

Rutaceae Feronia elephantum Correa(107) Pericarp 8.91 2.07 1.79 1.70 47 Murraya exotica L. (108) Leaf 10.33 8.57 1.80 1.23 Toddalia aculeata Pers.(109) Bark 12.06 6.53 0.87 2.03

Sapotaceae Mimusops elengi L. (110) Flower 14.48 17.83 1.78 1.57

Scrophulariaceae Bacopa moniera (L.) Pennell (111) Whole plant 1.44 1.41 0.72 0.31 Picrorrhiza kurroa L.(112) Root 20.69 21.47 8.99 3.14

Solanaceae Datura alba Nees. (113) Seed 3.67 3.38 0.88 0.47 Solanum nigrum L. (114) Fruit 3.66 2.53 0.89 0.54 Solanum xanthocarpum Schrad. & Wendl. (115) Fruit 11.58 11.81 2.72 1.98 Continued on next page Table 2.1 – continued from previous page Family and species (code number)5 Medicinal part ABTS 1 DPPH 2 FRAP3 TPC4 Withania somniferum (L.)Dunal(116) Root 1.13 0.66 0.16 0.16

Sterculiaceae Helicteres isora L. (117) Pod 25.24 27.01 13.44 2.61

Styraceae Styrax benzoin Dry. (118) Gum 12.51 5.77 1.86 1.53

Valerianaceae Nardostachys jatamansi (Jones)DC.(119) Root 2.36 1.50 0.90 0.34 Valeriana oﬃcinalis L.(120) Root 8.42 7.88 1.78 1.42

48 Verbenaceae Gmelina arborea Roxb.(121) Root 14.55 11.69 1.77 0.88 Phyla nodiﬂora (L.)Greene(122) Aerialparts 9.07 13.31 1.83 1.53 Premna herbacea Roxb.(123) Root 11.46 8.27 1.70 1.77 Vitex negundo L. (124) Leaf 5.90 6.97 1.44 0.99

Violaceae Viola serpens Wall.exGing.(125) Leaf 3.48 3.24 0.91 0.82

Zingiberaceae Alpinia chinensis Rosc.(126) Rhizome 47.17 40.98 6.70 5.44 Alpinia galanga (L.) Willd. (127) Rhizome 2.54 0.84 0.49 0.35 Curcuma longa L. (128) Rhizome (long) 22.70 6.43 3.76 2.13 Curcuma longa L. (128) Rhizome (round) 18.88 7.60 3.70 2.16 Continued on next page Table 2.1 – continued from previous page Family and species (code number)5 Medicinal part ABTS 1 DPPH 2 FRAP3 TPC4 Curcuma xanthorrhiza Roxb.(129) Rhizome 15.63 5.74 3.63 1.29 Curcuma zedoaria (Christm.) Rosc. (130) Rhizome 0.98 0.23 0.17 0.12 Kaempferia galanga L.(131) Rhizome 4.78 2.00 0.87 0.41 Zingiber oﬃcinale Rosc.(132) Rhizome 10.26 6.71 1.76 0.78

Zygophyllaceae Tribulus terrestris L.(133) Spines 2.25 1.14 0.54 0.39

Overall mean 27.07 28.05 6.56 2.44 49

1TEAC (Trolox equivalent antioxidant capacity) assayed by ABTS method. Data expressed as millimoles of Trolox equivalents per 100 g dry weight (DW). 2TEAC (Trolox equivalent antioxidant capacity) assayed by DPPH method. Data expressed as millimoles of Trolox equivalents per 100 g DW. 3FRAP (Ferric reducing antioxidant power) Data expressed as micromoles of Trolox equivalents per g DW. 4TPC (Total phenolic content). Data expressed as gallic acid equivalents(GAE) per 100 g DW. 5Code numbers in parenthesis coincide with code number in Table 2.3. 133 medicinal plant samples include 137 medicinal plant samples. Myristica fragrans Houtt.(89), Piper nigrum L. (97), Punica granatum L. (100) and Curcuma longa L. (128) have two tested samples (diﬀerent parts used or various genotypes used), respectively. Table 2.2: Correlations (R and R2) between antioxidant capacity parameters (by ABTS, DPPH and FRAP assays) and total phenolic contents (TPC) of 133 Indian medicinal plants (n=137 samples) R (R2)a ABTS DPPH FRAP DPPH 0.9866*** b (0.9734) FRAP 0.9618*** (0.8535) 0.8810*** (0.7762) TPC 0.9690*** (0.9390) 0.9378*** (0.8789) 0.8941*** (0.7995)

aR, correlation coefficient. R2, coefficient of determination. The values in parentheses represent the R2 values. b*** Significance level at P <0.001

2.3.2 Relationships among total antioxidant capacities by

ABTS, DPPH, and FRAP assays

To evaluate the suitability and reliability of the three assay methods used to deter- mine the total antioxidant capacities of the 137 Indian medicinal plant samples, a linear regression and correlation analyses of the values of total antioxidant capacity obtained by these methods was performed. The correlation coefficients (R) and coefficients of determination (R2) are given in Table 2.2. All R-values were positive at the P < 0.001 significance level, indicating that the values of antioxidant capacities assayed by the three different methods are highly correlative. These results showed that the three assay methods were all suitable and reliable for assessing total antioxidant capacities of plant extracts, although there were some samples showing differences in total antioxidant capacities between assay methods in the present study. Fig. 2.2 and Table 2.2 show a highly significant linear correlation (R2 = 0.9734 and R = 0.9866) between the total antioxidant capacities assayed by ABTS and DPPH assays of the 137 samples. The R-values between ABTS and FRAP assays and between DPPH and FRAP assays were 0.9618 and 0.8810, respectively. Al- though these two R-values are both highly significant (P < 0.001), they were lower than the R-value (0.9866) between ABTS and DPPH assays. We found more samples showing differences in total antioxidant capacities between FRAP and ABTS assays or between FRAP and DPPH assays than between ABTS and DPPH as-

50 800 y = 1.1839x - 3.9961 700 R 2 = 0.9734 600

500

400

300

200

100 TEAC by DPPH (mmol/100 g DW) 0 0 100 200 300 400 500 600 TEAC by ABTS (mmol/100 g DW)

Figure 2.2: Relationship between the total antioxidant capacities (TEAC, mmol/100 g DW) by ABTS and DPPH assays of 137 Indian medicinal plant samples says. For example, the order of top ﬁve samples with highest antioxidant capacity by FRAP assay was diﬀerent from those by ABTS or DPPH assays. These results could indicate that ABTS and DPPH assays are more accurate and reliable than the FRAP assay for assessing total antioxidant capacities of plant extracts. Although all the three assay methods can be used for assessing total antioxidant capacity of medicinal plant extracts, the current results as shown in Table 2.2 and previous studies (Cai et al., 2004; Shan et al., 2005) favour the improved ABTS assay, which was more rapid, robust and accurate for systematically assessing total antioxidant capacity of crude extracts from plant materials on a large scale.

2.3.3 Relationship between total antioxidant capacity and

phenolic content

The correlative relationship between total antioxidant capacity and phenolic content of the 137 Indian medicinal plant samples was ﬁrmly established (Table 2.2, Fig. 2.3). A large number of samples with a suitable range of parameter values can provide reasonable R2 values and representative correlation. The relationship between total antioxidant capacity (ABTS assay) and total phenolic content for all

51 45 y = 0.0745x + 0.4214 40 R 2 = 0.9390 35

5 Total Phenolic content (g/100 g DW) 0 0 100 200 300 400 500 600 TEAC by ABTS (mmol/100 g DW)

Figure 2.3: Relationship between the total antioxidant capacities (TEAC, mmol/100 g DW) by ABTS and total phenolic content (g GAE/100 g DW) of 137 Indian medicinal plant samples

137 samples was a highly positive linear correlation (Table 2.2: R = 0.9690; Fig. 2.3: R2 = 0.9390; P < 0.001). Signiﬁcant correlations were also found between total antioxidant capacity assayed by DPPH or FRAP methods and phenolic content of the 137 samples (R = 0.9378 or 0.8941, P < 0.001, Table 2.2), but the correlations were lower than that between TEAC value by ABTS assay and the total phenolic content.

2.3.4 Preliminary identiﬁcation and analysis of phenolic com-

pounds

In the present study, 83 Indian medicinal plants with higher antioxidant capacity

(> 4 mmol TEAC/100 g DW by ABTS assay, Table 2.3) were selected from the 133 tested medicinal plants for preliminary identification of phenolic compounds by RP- HPLC with a diode-array detector (DAD). Phenolic compounds (phenolics) can be defined as a large series of chemical constituents possessing at least one aromatic ring bearing hydroxyl and other subconstituents, including their functional derivatives (Strack, 1997). RP-HPLC analysis is the most used method for identification of

52 plant phenolics. The related HPLC methods for most categories of phenolics in plants have been developed (Andrade et al., 1998; Santos-Buelga and Williamson,

2003). In particular, a library of the analytical characteristics of more than 100 phenolic standards established by Sakakibara et al. (2003) and (Cai et al., 2004) provided important reference data (such as retention times, UV/visible λmax, and spectra shapes) for rapid identification of major phenolic compounds in the plant extracts by RP-HPLC. Because of the diversity and complexity of natural phenolic compounds in hun- dreds of medicinal plant extracts, it is rather difficult to characterize every compound and elucidate its structure. It is not difficult, however, to identify major categories of phenolic compounds and representative phenolics (Cai et al., 2004).

In the present study, a preliminary identification of representative natural phenolic compounds was conducted from selected Indian medicinal plants by cochromatography with dozens of phenolic standards and by comparison with literature data (Sakakibara et al., 2003; Cai et al., 2004). The results showed that the tested In- dian medicinal plants possessed a wide variety of natural phenolic compounds with various molecular structural features. Major types and representative components of natural phenolics identified in the 83 selected medicinal plants are summarized in Table 2.3. Their known bioactive constituents associated with phenolic structure are also given in Table 2.3 based on literature search. As shown in Table 2.3, major types and representative components of phenolic compounds identified in the present study mainly included simple phenolic constituents, e.g., phenolic acids (hydroxycinnamic acids and hydroxybenzoic acids), polyphenolic compounds, e.g., tannins, flavonoids, curcuminoids, coumarins, lignans, and quinones, and some other mixed categories of phenolics, e.g., phenolic terpenoids, phenolic alkaloids, and special phenolic glycosides. The identified phenolic types were similar to the majority of phenolic types found in the 112 TCM plants in a previous study (Cai et al., 2004). Because various phenolic types possess different UV/visible spectra and molecular polarities, each phenolic type has

53 typical spectral characteristics and relatively ﬁxed retention time range under the reversed-phase chromatographic conditions. The whole HPLC proﬁles of all identi-

fied phenolics were obtained within 90 min. The retention times of various phenolics (including phenolic standards) identified in this study were approximately in the following ranges: 8.0–31.4 min for phenolic acids (except for rosmarinic acid: 46.8 min); 5.7–40.0 min for tannins; 11.0–30.2 min for flavanols (flavan-3-ols); 21.5–51.0 min for glycoside forms of flavones, isoflavones, flavonols, and flavanones, and 24.8–75.0 min for their aglycone forms; 44.0–75.6 min for chalcones; 23.5–41.5 min for anthocyanins; 20.8–48.6 min for coumarins; 79.0–82.4 min for curcuminoids, 47.5–86.6 min for quinones; 46.0–88.7 min for lignans; 65.0–81.5 min for phenolic diterpenes; and 62.0–90.0 min for some volatile oils (e.g., aromatic compounds: 62.4 min for eugenol, 75.1 min for carvacrol). Their maximum UV/visible absorbance wavelength ranges have previously been described (Xiao et al., 2000; Sakakibara et al., 2003; Santos-Buelga and Williamson, 2003). The typical HPLC chromatograms of methanolic extracts are shown in Fig. 2.4

A-D for the top four Indian medicinal plants with highest TEAC values (ABTS assay). Major peak identification (a1-a9, b1-b5, c1-c5, and d1-d4) of the extracts from fruits of Terminalia chebula (A), gum of Acacia catechu (B), pericarps of Punica granatum (C), and galls of Rhus succedanea (D) was detailed in Fig. 2.4. Three of the samples (A, C, and D) had very high levels of hydrolysable tannins and gallic acid. Hydrolysable tannins include gallotannins and ellagitannins (Khanbabaee and van Ree, 2001), actually belonging to gallic acid (galloyl) derivatives with a central core (mostly D-glucosyl unit) of polyhydric alcohol with 5 hydroxyl groups ester- ified by 1-5 galloyl groups (gallotannins) or by 1-2 hexahydroxydiphenoyl groups (ellagitannins). Because they possess a large number of hydroxyl groups, especially the ortho-dihydroxy or galloyl group, gallotanins and ellagitannins are potent free radical scavengers and powerful antioxidant agents (Yokozawa et al., 1998). The gum of Acacia catechu contained high levels of catechin and epicatechin, in addition to tannin constituents (Fig. 2.4-B). Catechin and epicatechin belong to flavanols

54 (ﬂavan-3-ols), also strong phenolic antioxidants (Rice-Evans et al., 1996). Therefore, this may explain why these four medicinal samples (A-D) have the top four highest

TEAC values. Tannin constituents in the fruit of Terminalia chebula and gum of Acacia catechu have been identified in previous studies (Lin et al., 1990; Gao et al., 2000; LihJeng et al., 2004). In this study, a good separation and identification of several hydrolysable tannins (e.g., punicalagin, corilagin, and chebulagic acid) and phenolcarboxylic acids (e.g., gallic acid, and chebulic acid) were obtained from the fruit of Terminalia chebula (Fig. 2.4-A) and from the pericarp of Punica granatum (Fig. 2.4-C), whereas the high level of catechu-tannin acid was not well isolated from the gum of Acacia catechu, leading to a “high plateau” (≈ 15-73 min), but with no influence on the separation of catechin (17.0 min) and epicatechin (22.1 min) (Fig.

2.4-B). Tannin constituents in the gall of Rhus succedanea were similar to those in the gall of Rhus chinensis (common name, the Chinese gall) which contained Chi- nese tannins (gallotannins) (Cai et al., 2004), but the Chinese gall exhibited much higher radical scavenging activity and contained far more gallotannins than the gall of Rhus succedanea.

Table 2.3: Major phenolic compounds from selected Indian medicinal plants with antioxidant activity

Scientific name (code Bioactive constituents from HPLC-DAD identification in number) reference this study Flavones, flavonol glycosides, Very high content of hy- Abrus precatorius (59) triterpenoid saponins drolysable tannins (gal- lotaninns), flavonoids

Acacia catechu (84) Tannins (phlobatanin, Catechin, epicatechin, hy- protocatechu tannin), drolysable tannins catechu-tannin acid, (+)-catechin, ﬂavonoids, polysaccharides

Adina cordifolia (104) Flavanoids, monoterpenoid High content of chlorogenic acid alkaloid (cadambine) (phenolic acid), ﬂavones

Aloe littoralis (73) Littoraloin, deacetyllittoraloin, Hydrolysable tannins, phenolic C,O-diglucosylated oxanthrone acids, oxanthrones (littoraloside), coumarins, naphthalenes and ﬂavonoids

..continued on next page

55 Scientiﬁc name (code Bioactive constituents from HPLC-DAD identiﬁcation in number) reference this study Alpinia chinensis (126) Essential oils, diterpenoids Very high levels of phenolic volatile oils, phenolics acids

Anacyclus pyrethrum (22) No information on phenolics Phenolic terpenoids, phenolic acids (chlorogenic acid), ﬂavone glycosides

Anamirta cocculus (81) Sesquiterpenes (picrotoxin Phenolic terpenoids, phenolic derivatives), triterpenoids, acids alkaloids (berberine, magnoﬂorine)

Andrographis paniculata Diterpenoids (andrographolide, Phenolic acids (chlorogenic (1) neoandrographolide, acid), flavonol glycosides, phe- homoandrographolide), nolic terpenoids flavonoids (flavone glycosides)

Anethum sowa (11) Essential oils (carvone, Phenolic volatile oils (carvacrol, limonene, dillapiole), biphenyl estragole), phenolic acids (p- derivatives hydroxybezoic acid, chlorogenic acid), ﬂavonol glycosides

Aristolochia bracteata Carboxylic acid derivatives Phenolic acids (hydroxycinnamic (18) (aristolochic acid) acids), volatile oils

Balsamodendron mukul Triterpenes (myrrhanol A and Many kinds of terpenoids (in- (33) myrrhanone A) cluding phenolic terpenoids)

Barringtonia racemosa No information on active Flavonoids, phenolic acids (gal- (72) compounds from the seeds lic acid, caﬀeic acid, p-coumaric acid)

Blepharis edulis (2) Benzoxazine glucoside, Phenolic acids (p- benzoxazolone hydroxybenzoic acid), ﬂavone glucosides

Bombax malabaricum Phenolic acids, xanthone Phenolic acids, but others were (28) (mangiferin), naphthoquinone, not isolated and identiﬁed by sesquiterpene lactone, ﬂavonols HPLC under current chromatographic conditions

Caesalpinia sappan (37) Flavonoids (chalcones, brazilin, High content of tannins, chal- 4-O-methylsappanol cones, ﬂavonols protosappanin A, caeasalpin J, homoisoﬂavones)

Calotropis gigantea (19) Oxypregnane oligoglycosides Chlorogenic acid and its deriva- (calotroposides A and B), tives Triterpenoids from root bark

Carum copticum (12) Essential oils (thymol, Phenolic volatile oils (very high γ-terpinene, β-pinene, level of thymol), phenolic acids p-cymene), phenolic glucosides (chlorogenic acid), coumarins

..continued on next page

56 Scientiﬁc name (code Bioactive constituents from HPLC-DAD identiﬁcation in number) reference this study Cassia auriculata (38) Anthraquinone glycosides, Flavonol glucosides, hydroxyan- terpenoid glycosides, thraquinones and their glyco- protoanthocyanidin sides, phenolic acids (gallic acid)

Cassia ﬁstula (39) Flavonoids (catechin, ﬂavone Hydroxyanthraquinones (rhein, glycosides), proanthocyanidins, emodin, physcion, chryso- anthraquinones, triterpene phanol), phenolic acids, tannins derivatives (proanthocyanidins)

Cassia tora (40) Many kinds of anthraquinones Hydroxyanthraquinones (aloe- emodin, rhein, emodin, chrysophanol, physcion) and their glucosides

Cedrus deodara (93) Neolignans, (–)-matairesinol, Lignans (neolignans), phenolic (–)-nortrachelogenin, centdarol, volatile oils (sesquiterpenoids), himachlol, lawsaritol, ﬂavonoids allohimachlol, dihydroﬂavonols

Cuminum cyminum (14) Essential oils (cumin aldehyde, Phenolic volatile oils, pheno- cuminal, β-pinene, γ-terpinene, lic acids (chlorogenic acid), ﬂa- safranal) vanoids, coumarins

Curculigo orchioides (68) Phenolic glucosides Many known/unknown phenolic (curculigoside A, B and C, glucosides orchiosides A and B), triterpene glycosides, 2,6-dimethoxyl benzoic acid

Curcuma longa L. (128) Curcuminoids (curcumin, Curcuminoids (curcumin, bisdemethoxycurcumin, bisdemethoxycurcumin, demethoxycurcumin), essential demethoxycurcumin) oils (sesquiterpenoids)

Curcuma xanthorrhiza Curcuminoids (curcumin, Curcuminoids (curcumin, (129) bisdemethoxycurcumin, bisdemethoxycurcumin, demethoxycurcumin), essential demethoxycurcumin), phenolic oils (sesquiterpenoids: volatile oils (xanthorrhizol) xanthorrhizol)

Cyperus rotundus (53) Sesquiterpene hydrocarbons Phenolic volatile oils (sesquiter- [(–)-isorotundene, penoids), ﬂavonoid glycosides, (–)-norrotundene], sesquiterpene phenolic acids alkaloids (rotundines A, B, and C)

Dolichos biﬂorus (60) Tannins Phenolic acids (hydroxybenzoic acids) and tannins

Embelia ribes (88) Benzoquinone derivatives Very high content of hydroxy- (embelin, embelinol, benzoquinones embeliaribyl ester, embeliol)

..continued on next page

57 Scientific name (code Bioactive constituents from HPLC-DAD identification in number) reference this study Entada rheedii (85) Phenylacetic acid derivatives, Tannins, flavonoids, phenolic sulfur-containing amides, acids (hydroxybenzoic acids) saponins

Euphorbia hirta (55) Gallic acid, hydrolysable High level of hydrolysable tan- tannins, flavonoids (quercitrin, nins (ellagitannins and gallotan- myricitrin) nins), phenolic acids (gallic acid), flavonoids (flavonol glycosides) Euphorbia lathyrus (56) No information on phenolics High levels of flavones and from references flavonol glucosides

Feronia elephantum (107) No information on phenolics in Phenolic acids (gallic acid, hy- the pericarp droxybenzoic acid), other compounds were not well separated by HPLC

Foeniculum vulgare (15) Essential oils, hydroxycinnamic Phenolic acids (caffeoylquinic acid derivatives, flavonoids and acid derivatives), flavonols and their glycosides flavones and their glycosides, coumarins, phenolic volatile oils

Garcinia mangostana Xanthones (mangostins, High concentrations of xan- (66) garcinone-E, thones (α-mangostin, β- methoxy-β-mangostin, mangostin, γ-mangostin) garcimangosone A, garcimangosone B, garcimangosone C)

Gentiana kurroo (65) Flavone-C -glucosides Phenolic acids (coumaric acid, (isovitexin), iridoid glucosides, ferulic acid), many kinds of xanthones ﬂavone glucosides

Gmelina arborea (121) Iridoid glycosides (gmelinosides) Phenylpropanoid glycosides, lig- in leaves, keto-lignans (arboreal, nans arborone, gemelanone) in heartwood

Gymnema sylvestre (20) Flavonoid compounds, antisweet Flavonoids (quercetin and saponins (oleanane-toye kaempferol glycosides), phenolic triterpenes, e.g., gymnemic triterpenoids, phenolic acids acids)

Helicteres isora (117) Flavones (trifolin and hibifolin), Phenolic acids (rosmarinic acid flavonoid glucuronides, and its derivatives), flavonoids rosmarinic acid, neolignans (flavones and their glycosides) (helicterins)

Hemidesmus indicus (21) 2-hydroxy-4- Phenolic acids (caf- methoxybenzaldehyde, acyclic feic acid), 2-hydroxy-4- triterpenic acid, acyclic methoxybenzaldehyde diterpenic ester and monocyclic sesterterpene ester, and other triterpenes

..continued on next page

58 Scientific name (code Bioactive constituents from HPLC-DAD identification in number) reference this study Hibiscus rosa-sinensis Anthocyanins, cyclopropenoids Phenolic acids (chlorogenic (80) acid), hydrolysable tannins, flavonols and their glycosides, anthocyanins

Holarrhena Phenolic acids (ferulic acid), Phenolic acids (hydroxybenzoic antidysenterica (16) steroidal alkaloids acid, chlorogenic acid, ferulic acid)

Hygrophila auriculata (3) Triterpenes Very high content of ferulic acid (phenolic acid)

Illicium verum (69) Essential oils (anethole), Phenolic volatile oils (anethole) phenylpropanoid glucosides, lignans, sesquiterpenoids (veranisatins A, B and C)

Ipomoea turpethum (48) No information on phenolics Phenolic acids (gallic acid, vanil- from references lic acid)

Kaempferia galanga (131) Essential oils, flavonoids, Phenolic volatile oils, flavonols p-methoxycinnamic acid, ethyl (kaempferol), phenolic acids (hy- p-methoxycinnamate droxybenzoic acids) Lawsonia inermis (78) p-coumaric acid, apiin, High levels of flavonol and apigenin, luteolin, and flavone glucosides, phenolic acids cosmosiin, triterpenoids (protocatechuic acid) (lawsowaseem and lawsoshami)

Mangifera indica (10) Gallotannins Gallotannins (mono-, di-, and tri-O-galloyl-glucoses) and phenolic acids (gallic acid).

Mimusops elengi (110) Pentacyclic triterpenes, Phenolic acids, flavonoids flavonoids, phenolic acids, (flavonols and flavones) triterpenoid saponin (mimusin, mimosopin) identified from seeds and barks, but no information on phenolics from flowers

Mucuna pruriens (61) Dopamine, A large amount of 6- tetrahydroisoquinoline alkaloids hydroxydopamine, phenolic acids

Murraya exotica (108) Coumarins (murrayatin, High levels of coumarins, phe- murrangatins), furocoumarins, nolic acids (chlorogenic acid), bicoumarins (murradimerins), ﬂavonoids, phenolic volatile oils essential oils

Myrica nagi (87) Diarylheptanoids (myricanol, High levels of hydrolysable myricanone, 13-oxomyricanol) tannins, diarylheptanoid constituents were isolated by HPLC but not identiﬁed because of unavailable standards and no detail literature data ..continued on next page

59 Scientiﬁc name (code Bioactive constituents from HPLC-DAD identiﬁcation in number) reference this study

Myristica fragrans (89) Essential oils (sabinene, safrole, Phenolic volatile oils terpinen-4-ol, elemicin, myristicin), lignans (myrisfragransin)

Ocimum basilicum (70) Rosmarinic acid, lithospermic Phenolic acids (very high con- acid, salvigenin, nevadensin, tent of rosmarinic acid, caﬀeoyl cirsileol, cirsilineol, eupatorin, derivatives), phenolic diterpenes, apigenin, acacetin, genkwanin, phenolic volatile oils (carvacrol), cirsimaritin, ladanein, gardenin ﬂavonoids (catechin) B

Ocimum sanctum (71) Phenolic acids (rosmarinic acid, Phenolic acids (very high con- chlorogenic acid, caffeic acid), tent of rosmarinic acid, caffeoyl flavonoids (orientin, vicenin, derivatives), phenolic diterpenes apigenin, luteolin, apigenin (carnosic acid), phenolic volatile glycosides, luteolin glycosides, oils (carvacrol), flavonoids vitexin, isovitexin, isoorientin), aesculetin, aesculin, eugenol

Oroxylum indicum (27) Flavonoids from seeds (chrysin, Flavonoids, phenolic acids baicalein, baicalein-7-O-glucoside, baicalein-7-O-diglucoside)

Phyla nodiflora (122) Flavonoids (flavone aglycones, Phenolic acids (high content flavone sulphates) of p-coumaric acid), flavonoids (flavones)

Phyllanthus amarus (57) Hydrolysable tannins, gallic Hydrolysable tannins, ﬂavonoids acid, ﬂavonoids (quercetin, (rutin, quercitrin), phenolic apigenin, rutin), lignans acids (gallic acid) (phyllanthin, hypophyllanthin, geraniin)

Picrorrhiza kurroa (112) No information on phenolics Flavonoids (ﬂavone glycosides, from references ﬂavanone glycosides), phenolic acids

Piper chaba (94) Sesquiterpenoids, caryophyllene Volatile oils, phenolic amides, a oxide, phenolic amides: few phenolic acids, high level of piperchabamides (A, B, C, and unknown/identiﬁed ﬂavonoids D)

Piper cubeba (95) Methylenedioxyphenyl lignans: Several lignans (HPLC proﬁle (-)-clusin, (-)-dihydroclusin, was similar to that of reference), (-)-yatein, (-)-hinokinin, and phenolic amides, a few phenolic (-)-dihydrocubebin, essential acids (p-hydroxybenzoic acid), oils (caryophyllene) volatile oils

Piper longum (96) Phenolic amides (piperine, Volatile oils, phenolic amides, a piperanine, pipernonaline), few phenolic acids essential oils (caryophyllene, pentadecane) ..continued on next page

60 Scientiﬁc name (code Bioactive constituents from HPLC-DAD identiﬁcation in number) reference this study

Plumbago rosea (99) Naphthoquinones (plumbagin, Not isolated and identiﬁed by droserone, elliptinone, HPLC under current chromato- zeylanone), coumarins graphic conditions

Premna herbacea (123) Diterpenoids (sirutekkone) Phenolic terpenoids, ﬂavonoids

Psoralea corylifolia (62) Coumarins (bakuchiol, psoralen, Furocoumarins (psoralen and isopsoralen, corylifolin, corylin isopsoralen), flavonoids (flavones and psoralidin), flavonoids and chalcones), phenolic volatile (4’-methoxy flavone), chalcone oils (bavachalcone)

Punica granatum (100) Hydrolysable tannins and High levels of hydrolysable tan- phenolic acids (gallic acid) nins (punicalin, punicalagin), gallagic acid, ellagic acid, and gallic acid

Quercus infectoria (63) Tannins, syringic acid, and Flavonol and ﬂavone glycosides, ellagic acid identiﬁed from galls phenolic acids, phenolic volatile or gallnuts, but no information oils on phenolics from seeds

Rauvolﬁa serpentina (17) Flavonoids, alkaloids (ajmaline, Flavonoids (rutin), phenolic ajmalicine, reserpine) acids (p-hydroxybenzoic acid, p-coumaric acid)

Rubia cordifolia (105) Naphthohydroquinones Hydroxyanthraquinones and (rubinaphthin A–D), their glycosides (alizarin, pur- anthraquinones, ﬂavonoids purin, munjistin, ruberythric acid, alizarin-glucoside)

Rhus succedanea (8) Biflavanoids (amentoflavone, Very high levels of hydrolysable agathisflavone, robustaflavone, tannins (gallotannins), phenolic hinokiflavone, rhusflavanone) acids (gallic acid) from fruits/seeds, but no information on phenolics from galls

Semecarpus anacardium Trihydroxyflavone, biflavonoids Phenolic volatile oils, but (9) (biflavones), bhilawanols, flavonoids were not isolated and anacardoside identified from crude extracts of seeds

Smilax china (75) Steroidal saponins, β-sitosterol, Phenolic acids dihydrokaempferol-5-O-β-D- glucoside

Solanum xanthocarpum Steroidal alkaloid (solasodine) Very high content of phenolic (115) acids (chlorogenic acid, caﬀeic acid)

Styrax benzoin (118) Cinnamic and benzoic acids Phenolic acids, but a very big peak (Rt = 47.6 min) was not identiﬁed ..continued on next page

61 Scientific name (code Bioactive constituents from HPLC-DAD identification in number) reference this study Syzygium cumini (90) Gallic acid, tannins, and Gallic acid, high levels of tan- anthocyanins in fruits nins, flavonoids

Terminalia arjuna (43) Tannins, triterpene glycosides High levels of tannins (ellagitan- (terminoside A), oleane nins), low levels of ﬂavonoids and derivatives (arjunic acid, terpenoids arjunolic acid, arjungenin, arjunetin, and arjunglucoside I)

Terminalia bellirica (44) Hydrolysable tannins, High level of gallic acid, hy- chebulagic acid, ellagic acid, drolysable tannins gallic acid

Terminalia chebula (45) Hydrolysable tannins Very high levels of ellagitannins (chebulanin, punicalagin, and gallotannins (punicalagin, terchebin, chebulinic acid), chebulanin, corilagin, chebulagic tannic acid, ellagic acid, gallic acid, di-/tri-galloyl-glucoses), el- acid lagic acid, chebulic acid, gallic acid

Tinospora cordifolia (82) Diterpene glucosides Many terpenoids were isolated (amritosides), furanoditerpene by HPLC, but most could not be glycoside (cordifolisides), identiﬁed because there were no sesquiterpenes corresponding standards

Toddalia aculeata (109) Coumarins Coumarins, phenolic acids (5-methoxysuberenon, (chlorogenic acid), ﬂavones norbraylin, toddalenone, toddalolactone), alkaloids

Valeriana oﬃcinalis Sequiterpenes, ﬂavonoid Flavone glucosides, high content (120) glycoside (linarin, hesperidin), of chlorogenic acid valerenic acid, hydroxyvalerenic acid, essential oils

Vernonia anthelmintica Flavonoids (flavones, chalcones) Phenolic acids (chlorogenic acid, (25) caffeic acid, other caffeoyl derivatives), flavone glucosides

Vitex negundo (124) Flavonoids (vitexicarpin, Phenolic acids (p- vitexoside), triterpenoids hydroxybenzoic acid, proto- (oleanolic acid, betullinic acid catechuic acid), terpenoids and ursolic acid), diterpenes (oleanolic acid, ursolic acid), (vitedoin B), lignans (vitedoin), ﬂavonoids phenolic acids, α-sitosterol

Zingiber oﬃcinale (132) Gingerols, shogaols, gingediols, Phenolic volatile oils (gingerol, paradols, zingerone, shogaol) dehydrozingerone, diarylheptanoids (gingerinone)

mAU a mAU a 8 b4 6 (A) Terminalia chebula 600 (B) Acacia catechu 2000 500 1500 400 b5 a4 b a 300 2 1000 a3 5 a2 a7 200 500 a1 a 100 9 b1 b3 0 0 0 20 40 60 80 min 0 20 40 60 80 min

mAU mAU c d2 500 3 (C) Punica granatum d (D) Rhus succedanea 2000 1 400 c2 1500 300 1000 200

d3 c1 d4 100 500 c c4 5 0 0

0 20 40 60 80 min 0 20 40 60 80 min

Figure 2.4: A–D: HPLC proﬁles (280 nm) of methanolic extracts from four species possessing top four highest antioxidant capacities among 133 Indian medicinal plants; a1, chebulic acid; a2, gallic acid; a3, punicalagin isomer; a4, punicalagin; a5, chebulanin; a6, corilagin; a7, neochebulinic acid; a8, chebulagic acid; a9, ellagic acid; b1 b3, hydrolysable tannins; b4, catechin; b5, epicatechin; c1, gallic acid; c2, punicalin; c3, punicalagin; c4, gallagic acid; c5, ellagic acid; d1, gallic acid; d2, mono-O-galloyl-β-D-glucopyranoside; d3, di-O-galloyl-β-D-glucopyranoside; d4, tri-O-galloyl-β-D-glucopyranoside

mAU mAU e 350 f8 300 e4 6 (E) Cassia tora 300 (F) Anethum sowa 250 e5 250 200 e8 200 e9 150 e7 150 f7 e2 f 100 e10 9 100 f e f 5 e1 e11 12 1 50 f10 e3 50 f2 f6 f4 f3 0 0 0 20 40 60 80 min 0 20 40 60 80 min

mAU mAU g3 h5 250 350 (G) Ocimum sanctum (H) Anacylus pyrethrum 300 200 250 150 200 h4 g6 h1 150 100 h6 100 h g1 h3 6 g 50 50 g2 g 7 h 4g5 2 0 0 0 20 40 60 80 min 0 20 40 60 80 min

Figure 2.5: E–H: HPLC profiles (280 nm) of methanolic extracts from four other species possessing top four highest antioxidant capacities among 133 Indian medicinal plants. e1 e7, anthroquinone glycosides; e8, aloe-emondin; e9, rhein; e10, emondin; e11, chrysophanol; e12, physcion; f1, p-hydroxybenzoic acid; f2, chlorogenic acid; f3, ferulic acid; f4 f6, flavonol glycosides; f7, carvacrol; f8, estragole; f9 and f10, other phenolic volatile oils; g1, caffeic acid; g2, flavone glycoside; g3, rosmarinic acid; g4, carvacrol; g6, carnosic acid; g5 and g7, other phenolic diterpenes; h1, chlorogenic acid; h2, flavone glycoside; h3 h6, phenolic terpenoids.

64 2.3.5 Discussion

Although both the present and previous studies (Cai et al., 2004) used the same ABTS assay method, the calculation and unit of TEAC value were slightly diﬀerent. After all the TEAC (µmol /100 g DW) values of the 112 TCM plants by ABTS assay were multiplied by a conversion coeﬃcient (40/1000) and expressed as mmol/100 g

DW, a direct comparison with the present results and the results reported in Cai et al. (2004) could be obtained. It was found that the overall mean TEAC value of the 137 Indian medicinal samples was 27.07 mmol/100 g DW (Table 2.1), lower than the overall mean (941.1 × 40 ÷ 1000 = 37.64 mmol TEAC/100 g DW) of the

112 TCM plants (Cai et al., 2004). However, the mean TEAC value of top twenty Indian samples was 137.9 mmol/100 g DW, similar to the mean value of 155.0 mmol/100 g DW of the top twenty TCM plants. The highest antioxidant capacity (500.70 mmol TEAC)/100 g DW) in this study was found in the fruit of Terminalia chebula, while the highest antioxidant capacity (692.9 mmol TEAC)/100 g DW) was found in the galls of Rhus chinensis among the 112 TCM plants ((Cai et al., 2004). The differences in TEAC values between the two studies are possibly attributable to different medicinal species/parts that are traditionally used in different cultural practices.

High antioxidant capacity and phenolic content were generally found in roots, bark, seeds, gum, or galls of most medicinal plants, but in some other plants, high antioxidant capacity was found in the leaves and ﬂowers, e.g. Cassia auriculata (118.63 mmol TEAC/100 g DW), which has been shown to prevent brain lipid peroxidation in rats (Latha and Pari, 2003). The total phenolic contents (TPC) of the 137 Indian medicinal plant samples was estimated using the classical Folin-Ciocalteau colorimetric method. It was found that TPC of the 137 samples also showed signiﬁcant variation, ranging from 0.06 to

41.47 g of gallic acid equivalents (GAE)/100g dry weight (DW) with a mean of 2.44 g GAE/100 g DW (Table 2.1). Acacia catechu showed the highest value of 41.47 g GAE/100g DW, followed by Terminalia chebula (35.63 g GAE/100g DW), Punica

65 granatum (19.22 g GAE/100g DW), Myrica nagi (15.02 g GAE/100g DW), Rhus succedanea (12.32 g GAE/100g DW), Cassia auriculata (9.47 g GAE/100g DW), and Terminalia bellirica (9.27 g GAE/100g DW). Previous studies have found that phenolic compounds are major antioxidant constituents in selected herbs, vegetables and fruits, and there are direct relationships between their antioxidant activity and total phenolic content (Velioglu et al., 1998;

Dorman et al., 2004). However, the number of the plant samples tested in previous studies is often very limited. In the present study, 137 samples representing 133 plant species used in Ayurvedic and Siddha system of medicine were systematically estimated. The highly significant correlations obtained in this study support the hypothesis that phenolic compounds contribute significantly to the total antioxidant capacity of medicinal plants. The ABTS•+ and DPPH• radical scavenging activity and ferric reducing antioxidant power could be credibly predicted on the basis of the Folin-Ciocalteu assay for total phenolic content. The preliminary HPLC analysis of major phenolic compounds (Table 2.3) showed that phenolic acids and flavonoids were widely distributed in most of the tested Indian medicinal plants. About 70% and 53% of the identified samples were found to have phenolic acids and flavonoids, respectively. Phenolic terpenoids or volatile oils and tannins also commonly occurred in the tested plants and were detected in about 35% and 16% of the samples, respectively. Coumarins, lignans, quinones, and curcuminoids were observed in only about 3–8% of the tested plants. For example, several anthraquinones and their glycosides were identified in the seeds of Cassia tora (Fig. 2.5-E). Hydroxycinnamic acids (chlorogenic acid, and ferulic acid), p- hydroxybenzoic acid, flavonol glylcosides, and phenolic volatile oils (e.g., aromatic compounds: carvacrol and estragole) were detected in the seed of Anethum sowa (Fig. 2.5-F). Phenolic diterpenes (e.g., carnosic acid), flavone glycoside, and a very high level of rosmarinic acid were identified in the leaf of Ocimum sanctum (Fig. 2.5-G).

Major phenolic compounds were separated and identiﬁed from many Indian

66 medicinal plants (e.g., Anacyclus pyrethrum, Euphorbia lathyrus, Ipomoea turpethum, and Picrorrhiza kurroa) using RP-HPLC under the chromatographic conditions for the first time. For instance, several phenolic terpenoids, flavone glycoside, and high content of chlorogenic acid were isolated and identified in the root of Anacyclus pyrethrum (Fig. 2.5-H). Seeds of Abrus precatorius had a very high level of hydrolysable tannins, roots of Adina cordifolia contained high content of chlorogenic acid, seeds of Hygrophila auriculata possessed a high level of ferulic acid, and seeds of Quercus infectoria were rich in phenolic acids, flavonoid glycosides, and phenolic volatile oils. The phenolics identified in these medicinal plants have not been reported before. Some of the reviews and references reported that certain Indian medicinal plants contained phenolics, but these phenolics were not shown under the present chromatographic conditions. For example, the gum of Bombax malabaricum and roots of Plumbago rosea exhibited high antioxidant capacity (55.4 and 43.2 mmol TEAC/100 g DW, respectively) and contained xanthones, naphthoquinones, flavonols, and coumarins (Shahat et al., 2003; Reddy et al., 2003; Lin et al., 2003), but those phenolic compounds were not found in the present samples. In summary, this study has revealed that a great range of total antioxidant capacities and phenolic contents exist among the 133 Indian medicinal plants assayed. A highly significant, positive correlation was found between antioxidant capacity and phenolic content, indicating that phenolic compounds are a major contributor of antioxidant activity in the medicinal plants. Some medicinal plants with the strongest antioxidant capacity and the highest phenolic content were screened, such as Termi- nalia chebula, Punica granatum, Acacia catechu, Rhus succedanea, Myrica nagi, and

Cassia auriculata. By comparing with authentic standards and related literature references, RP-HPLC was used in this study to identify many known phenolic compounds and major phenolic categories from the 83 selected Indian medicinal plants. Major types of the phenolics in the tested plants were identiﬁed as phenolic acids, tannins, ﬂavonoids, curcuminoids, coumarins, lignans, and quinones. In addition, new unknown phenolic compounds in some of the Indian medicinal plants were

67 discovered. However, these medicinal plants also contain other complex phenolic compounds, especially phenolic terpenoids or volatile oils which are not commonly identified by RP-HPLC. Therefore, the unidentified/unknown phenolic constituents in the tested plants warrant further analysis with the aid of other advanced techniques and equipments (e.g., GC, GC-MS, LC-MS, and NMR). This systematic evaluation of a large number of Indian medicinal plants is useful for understanding their functionality and chemical constituents, and also supports the view that they can be potential sources of potent natural antioxidants. Since not all plant species used in traditional Indian medicine were collected and assayed in this study, future work is needed to include the omitted samples. Though several in vitro antioxidant assays are available, the efficacy of these compounds in vivo remains unknown. Modern advances in cell imaging have led to a new method for measuring cellular antioxidant activity (CAA). The method employs a compound Dichlorofluorescein (DCF) which floureses on oxidation. Flourescense of DCF when cultured carcinoma cells are subjected oxidation by 2,2’azobis(amidinopropane) can be measured. Cells can be treated with antioxidant compounds and the decrease in cellular uorescence when compared to untreated cells indicates the antioxidant capacity of those compounds (Wolfe and Liu, 2007). Future work on antioxidants should involve such new assays which reflect the conditions in vivo.

68 Chapter 3

Antioxidant properties and principal phenolic phytochemicals of Indian medicinal plants from subfamilies Asclepiadoideae and Periplocoideae

3.1 Introduction

From the preceding chapter on large scale screening of Indian medicinal plants, it was observed that Asclepiadoideae (Calotropis procera) and Periplocoideae (Hemidesmus indicus) members have moderately high antioxidant activity. Moreover, the antioxidant activities of the other medicinal plants in these two related subfamilies have not been studied in large scale so far. Therefore, in the present study antioxidant activities of twelve species from Asclepiadoideae and Periplocoideae were evaluated by the improved ABTS method (Cai et al., 2004) and improved Ferric reducing antixo- dant power (FRAP) assay (Surveswaran et al., 2007). In addition, xanthine oxidase inhibition and scavenging activity against metal ion dependent hydroxyl radicals

69 were also measured. The total phenolic and flavonoid contents from these plants were quantified. Furthermore, the major phenolic compounds in these plants were identified by reverse phase high performace liquid chromatography (RP-HPLC) and Liquid chromatography-Mass spectrometry (LC-MS). Several described compounds were identified and some unidentified compounds from these species are reported in this study.

3.2 Materials and Methods

3.2.1 Plant material

Fifteen samples (diﬀerent parts of the same species) representing 12 Indian medicinal plant species from Asclepiadoideae and Periplocoideae were used in this study. Of these species, 11 are native to India and they were either collected from the wild or obtained from medicinal plant collectors in India. One species, Tylophora ovata, occurs in Hong Kong and was thus collected locally. The tested parts of all plant species were mainly leaves, but stems, ﬂowers or roots were also collected for some species (Table 3.1).

3.2.2 Chemicals and reagents

Refer to Section 2.2.2

3.2.3 Extract preparation

Extract preparation was similar to Section 2.2.3

3.2.4 ABTS assay

The ABTS assay was carried out as described in Section 2.2.4.

70 3.2.5 FRAP assay

The FRAP assay was performed as described in Section 2.2.6 but the the antioxidant potentials were expressed as micromoles of Trolox equivalents (TE) per 100 g dry weight of sample (µmol/100g DW).

3.2.6 Xanthine oxidase (XO) inhibition assay

Xanthine oxidase (XO) activity was measured according to Noro et al. (1983). The assay mixture consisted of 100 µL diluted test solution, 300 mL 50 mM phosphate buﬀer (pH 7.4) and 100 µL xanthine oxidase (0.5 U/mL). After a pre-incubation of the mixture are 25 ◦C for 15 min, the reaction was initiated by adding 200 mL of 0.15 mM xanthine solution and was incubated at 25 ◦C for 30 min. The reaction was stopped by adding 300 mL of 0.1N HCl, and the absorbance was measured at 290 nm using a spectrophotometer. A blank was prepared in the same manner; however, the enzyme solution was added to the assay mixture after adding 0.1 N HCl. One unit of XO was deﬁned as the amount of enzyme required to produce 1 mM uric acid per minute at 25 ◦C. The XO inhibitory activity was expressed as the percentage inhibition of XO in the above assay system, calculated as (1 - B/A) ÷

100, where A is the activity of the enzyme without the test material and B is the activity of the enzyme with the test material. The OD value was taken from an average of triplicate determinations.

3.2.7 Hydroxyl radical (OH−) scavenging activity assay

The hydroxyl radicals were determined using the deoxyribose method described by Song et al. (2005). Each 0.5 mL of plant sample solution with uniform appropriate dilution was added to 1.0 ml of 20 mM (pH 7.4) potassium phosphate buﬀer including 2-deoxy-ribose 2.8mM, EDTA 104 mM, FeCl3 100 µM and hydrogen peroxide 1mM. The mixture was incubated at 37 ◦C for 1 h, then an equal volume of 0.5% thiobarbituric acid in 10% tricholoracetic acid was added and the mixture was boiled at 100 ◦C for 15 min. Deionized water was used as a blank. The absorbance

71 at 532 nm was measured. The hydroxyl radical (OH−) scavenging activity (%) was calculated using the following equation: ((A532 of blank - A532 of sample)/A532 of blank) ÷ 100. All tests were performed in duplicate.

3.2.8 Total phenolic content (TPC)

Estimation of total phenolic content was similar to Section 2.2.7

3.2.9 Total Flavonoid content (TFC)

Total flavonoid content (TFC) was measured using the colorimetric method described by Chun et al. (2003) with some modifications. 1 mL of appropriately diluted plant extract was mixed with 0.1 mL of 5% NaNO2. After 6 min, 0.1 mL of 10% AlCl3.6H2O solution was added. Then 1 mL of 1 M NaOH was added to the mixture after 5 min. The reaction mix was allowed to stand for 15 min and the absorbance was measured at 510 nm. The total flavonoid content was calculated with a rutin standard curve and expressed as rutin equivalent per gram dry weight (mg/g DW).

3.2.10 Liquid Chromatography Mass Spectroscopy (LC-MS)

A LC-MS-2010EV system (Shimadzu, Japan) and a VP-ODS C18 column (250 × 2.0 mm, 4.6 µm) (Shimadzu, Japan) were used in this study. LC conditions were as follows: solvent A, 0.1% formic acid, and solvent B, MeOH with 0.1% formic acid. A gradient elution used was 0-5 min, 5% B; 5-15 min, 5-30% B; 15-40 min, 30-40% B; 40-60 min, 40-50% B; 60-65 min, 50-55% B; 65-90 min, 55-100% B; 90- 95 min, 100% B; 95-96 min, 100-5% B; and 96-100 min, 5% B. The ﬂow rate was 0.2 mL/min, injection volume was 5-10 mL, and detection was at 280 nm. The scan range of ESI-MS was m/z 160-800. The ESI voltage was 4.5 kV in positive ion mode and 3.5 kV in negative ion mode. A nebulizing gas of 1.5 L/min and a drying gas of 10 L/min were applied for ionization using nitrogen in both cases. Quantitative analysis of representative phenolic compounds (chlorogenic acid and

72 rutin) was carried out by comparison with the corresponding authentic standards. Relative percentage amount of chlorogenic acid and rutin in the tested medicinal plants was calculated according to the corresponding individual peak area and total peak area of LC chromatograms.

3.2.11 Statistical analysis

All determinations of antioxidant capacity by ABTS and FRAP methods and measurement of TPC and TFC were conducted in triplicate. The reported value for each sample was the mean. Correlation coefficients (R) and coefficients of determination (R2) were calculated using Microsoft Excel 2003. Differences between these mean values were compared by least significant difference (LSD) calculated using the Statistical Analysis System (SAS Institute Inc., Cary, NC).

3.3 Results

3.3.1 Total antioxidant capacity and total phenolic and ﬂavonoid

contents

Total antioxidant capacity (TEAC and FRAP) and total phenolic and flavonoid contents (TPC and TFC) of 12 Indian medicinal plants (a total of 15 samples including leaves, roots, stems or flowers) from Asclepiadoideae and Periplocoideae were systematically assayed in this study (Table 3.1). The TEAC values of the 15 samples exhibited a considerable large variation from 2.91 to 34.79 mmol/100 g DW with an average of 9.80, and their FRAP values varied from 92.87 to 557.01 µmol/100 g DW with a mean value of 185.84. Two species (3 samples) of Periplocoideae possessed significantly higher TEAC and FRAP values than the 10 other plant species (12 samples) of Asclepiadoideae (Table 3.1). The highest TEAC value by the ABTS assay was in the leaves of Decalepis hamiltonii with 34.79 mmol/100 g DW followed by the leaves and roots of Hemidesmus indicus (Table 3.1). The lowest TEAC value was detected in the leaves of Pen-

73 Table 3.1: Antioxidant activity (TEAC and FRAP), total phenolic content (TPC) and total ﬂavonoid content (TFC) of 12 Indian medicinal plants (15 samples) from Asclepiadoideae and Periplocoideae Name of subfamily and plant species TEAC FRAP TPC TFC (the tested parts) [code] (mmol/100(µmol/100 (g/100 g (mg/100 g DW) g DW) DW) g DW) Asclepiadoideae Calotropis gigantea (root)[CR] 11.92 185.71 1.29 44.44 Calotropis gigantea (ﬂower) [CF] 4.28 186.13 0.69 6.90 Calotropis gigantea (leaf)[CL] 3.65 93.07 0.69 6.04 Gymnema sylvestre (leaf)[GS] 6.81 93.04 1.02 10.23 Leptadenia reticulata (leaf)[LR] 4.78 185.98 0.83 15.20 Oxystelma esculentum (leaf)[OE] 5.04 93.01 0.79 10.47 Pentatropis nivalis (leaf) [PN] 2.91 93.03 0.52 9.16 Pergularia daemia (leaf)[PD] 4.53 92.99 0.68 12.68 Sarcostemma brevistigma (stem) [SB] 9.33 185.84 0.72 12.51 Tylophora indica (leaf)[TI] 6.57 92.87 1.09 23.66 Tylophora ovata (leaf)[TO] 9.83 185.95 1.71 28.96 Wattakaka volubilis (leaf)[WV] 6.74 92.98 1.12 14.24

Periplocoideae Decalepis hamiltonii (leaf)[DH] 34.79 557.01 3.84 102.99 Hemidesmus indicus (leaf)[HL] 18.34 278.61 1.57 25.67 Hemidesmus indicus (root)[HR] 17.38 371.30 2.23 65.36 Overallmean 9.80 185.84 1.25 25.95 LSD (p < 0.05) a 0.64 0.01 0.05 0.59

aLSD (p < 0.05): least significant difference, was used for difference comparison among means of various medicinal plant samples.

74 tatropis nivalis (2.91 mmol/100 g DW). Similar results were also obtained from the FRAP assay (Table 3.1). The highest FRAP value was found in the leaves of

D. hamiltonii (557.01 µmol/100 g DW). The roots and leaves of H. indicus also had high FRAP values. Calotropis gigantea roots and ﬂowers, Leptadenia reticulata leaves, Tylophora ovata leaves, and Sarcostemma brevistigma stems showed medium FRAP values.

The highest total phenolic content (TPC) (3.84 g/100g DW) was detected in the leaves of D. hamiltonii, followed by the roots of H. indicus (Table 3.1). The lowest TPC value (0.52g/100g DW) was detected in the leaves of P. nivalis. The highest total ﬂavonoid content (TFC) (102.99 mg/100g DW) was also detected in the leaves of D. hamiltonii, followed by the roots of H. indicus. The roots of C. gigantea also had high ﬂavonoid content. The lowest TFC value (6.04 mg/100g DW) was found in the leaves of C. gigantea.

3.3.2 Xanthine oxidase (XO) inhibitory activity and OH−

radical scavenging activity

Figure 3.1: Xanthine oxidase (XO) inhibition (cross-striped bars) and OH− scavenging activity (cross-hatched bars) of 12 Indian medicinal plants (15 samples) from Asclepiadoideae and Periplocoideae. Code names of samples in the ﬁgure correspond with the code names of the medicinal plants in Table 3.1.

The XO inhibitory activity and OH− radical scavenging activity of the tested

75 medicinal plants were also assayed in the present study. The stems of S. brevistigma exhibited the highest XO inhibition (55.5%), followed by the roots of H. indicus

(51.7%), whereas the roots of C. gigantea showed the lowest XO inhibition activity (5.0%) ( Fig. 3.3.2). The ﬂower of C. gigantea and leaves of Pergularia daemia had fairly high XO inhibition. The roots of H. indicus exhibited the highest OH− scavenging activity (30.5%), followed by the leaves of T. indica (17.9%) and D. hamiltonii (17.2%) (Fig. 3.3.2). Some medicinal plants (e.g., H. indicus and T. indica) also showed higher OH− scavenging activity. The leaves of P. nivalis showed the lowest OH− scavenging activity (4.8%) (Fig. 3.3.2)

3.3.3 Relationship between total antioxidant capacity and

total phenolic and ﬂavonoid contents

To find the relationship between the antioxidant activity and phenolic contents, a linear regression and correlation analyses of the values of total antioxidant capacity by ABTS and FRAP methods and also with the total phenolic and flavonoid contents were performed. The correlation coefficients (R) and coefficients of determination

(R2) are listed in Table 3.2. All R-values were positive and high (R = 0.911– 0.958) at the P < 0.001 significance level, suggesting that there were significant and positive correlations between antioxidant capacity parameters (TEAC and FRAP) and total phenolic and flavonoid contents (TPC and TFC). For example, there was a highly significant linear correlation (R = 0.956 and R2 = 0.914) between ABTS assayed antioxidant potential (TEAC) and total phenolic content (TPC). Similarly significant correlation was also found between FRAP and TPC (Table 3.2). Therefore it could be inferred that a high level of phenolic compounds was responsible for high antioxidant capacity.

The positive correlation between TEAC and TFC was also highly signiﬁcant at P < 0.001 (R = 0.927 and R2 = 0.859). The same phenomenon was also observed between FRAP and TFC (Table 2). This suggested that high levels of ﬂavonoids were also responsible for high antioxidant capacity. Additionally, there was a highly

76 Table 3.2: Correlations (R and R2) between antioxidant capacity by ABTS and FRAP methods, total phenolic content (TPC), total ﬂavonoid content (TFC), xanthine oxidase inhibitory activity (XO) and OH− radical scavenging activity (OH−) of 12 Indian medicinal plants (n = 15 samples) from Asclepiadoideae and Periplo- coideae

R (R2)a ABTS FRAP TPC TFC XO (TEAC) FRAP 0.942*** b (0.887) TPC 0.956*** 0.914*** (0.914) (0.836) TFC 0.927*** 0.911*** 0.958*** (0.859) (0.830) (0.917) XO 0.183 0.3198 0.0819 0.111 (0.034) (0.102) (0.007) (0.012) OH− 0.554 0.654 0.552 0.631 0.515 (0.307) (0.428) (0.305) (0.398) (0.266)

aR, correlation coefficient. R2, coefficient of determination. The values in parentheses represent the R2 values. b*** Significance level at P <0.001

positive correlation (R = 0.958 and R2 = 0.917) between TPC and TFC, because ﬂavonoids were major phenolic compounds in the tested samples.

3.3.4 LC-MS analysis of phenolic compounds

A preliminary analysis of the principal phenolic phytochemicals in the Indian medicinal plants from Asclepiadoideae and Periplocoideae was made. Major types of phenolic compounds and representative constituents present in the medicinal plants were tentatively identified using LC-MS, according to the UV-vis spectra, chromatographic profiles (retention time, Rt) and MS data and by cochromatography with dozens of phenolic authentic standards as well as by comparison with literature data (Sakakibara et al., 2003; Cai et al., 2004). The preliminary results showed that major types of bioactive compounds in these medicinal plant species included flavonoids, phenolic acids and their derivatives, phenolic terpenoids and alkaloids. Major types of phenolic compounds and representative components found in the present study and details of the bioactive compounds reported earlier are listed (Table 3.3).

77 Fig. 3.2 shows LC chromatograms (fingerprints) of the phenolic compounds in the 12 Indian medicinal plants from Asclepiadoideae and Periplocoideae. The same peak (Rt = ∼20.9 min) in LC profiles of all tested plants (peak 2) was easily identified as chlorogenic acid ([M – H]− ion at m/z 353, [M + H]+ ion at m/z 355, and [M + Na]+ ion at m/z 377) and peak 3 (∼37.6 min) was readily identified as rutin (quercetin 3-rutinoside) ([M – H]− ion at m/z 609, [M + H]+ ion at m/z

610, and [M + Na]+ ion at m/z 633) according to ESI-MS data and by comparison with the corresponding authentic standards. Additionally, a dominant peak (peak 1) was tentatively identiﬁed as a new hydroxybenzoic acid ([M – H]− ion at m/z 203 and [M + H]+ ion at m/z 205). The peaks (95-98 min) (4) were tentatively identiﬁed as phenolic terpenoids. In the LC quantitative analysis, the contents of chlorogenic acid (2) and rutin (3) in all the tested plant samples ranged from 21 to 1419 µg/g and from 64 to 446 µg/g, respectively (Fig. 3.2). It was found that D. hamiltonii had the highest content of these two compounds (3127 µg/g and 446 µg/g, respectively) (Fig. 3.2).

3.4 Discussion

It has been well known that the subfamily Asclepiadoideae and the closely related Periplocoideae are sources of many indigenous Indian medicinal plants. Medicinal properties and bioactive compounds (mainly terpenoids and alkaloids, e.g., pregnane glycosides) of these medicinal plants had been widely studied (Khare et al.,

1987; Ali and Gupta, 1999; Chandra et al., 1994; Zhen et al., 2002; Sultana et al., 2003; Hamed et al., 2004), and there were also several reports about antioxidant activity and phenolic compounds of a few medicinal plants from Asclepiadoideae and Periplocoideae (Ravishankara et al., 2002; Mary et al., 2003; Harish et al., 2005;

Roy et al., 2005; Heneidak et al., 2006). In the present study, the antioxidant properties (TEAC, FRAP, XO inhibitory activity and OH− radical scavenging activity) and major phenolic compounds of the 12 Indian medicinal plants selected from As- clepiadoideae and Periplocoideae were systematically investigated. Periplocoideae

78 Figure 3.2: LC ﬁngerprints of the phenolic compounds in Indian medicinal plants from Asclepiadoideae and Periplocoideae (stems of Sarcostemma brevistigma and leaves of other 11 medicinal plants) and quantitative analysis of their representative phenolic compounds (2 and 3). Content of chlorogenic acid (2) and rutin (3) in the tested samples is expressed in µg/g of dry weight (DW).

79 members exhibited stronger antioxidant capacity than Asclepiadoideae members, as shown in Table 3.1. The highest antioxidant activity was shown by the members of Periplocoideae (D. hamiltonii and H. indicus). This might be due to signiﬁ- cantly higher levels of total phenolics (e.g., chlorogenic acid) and higher contents of total ﬂavonoids (e.g., rutin) occurring in the Periplocoideae members than in the Asclepiadoideae ones (Table 3.1 and Fig. 3.2).

The statistic analyses of the correlations (R and R2) between different antioxidant capacity parameters and total phenolic and flavonoid contents could directly reflect the relationships between antioxidant properties and major bioactive compounds of the tested medicinal plant samples and could ascertain whether the major compounds identified in the tested samples contribute significantly to their antioxidant properties. All R and R2 values obtained in this study are listed in Table 3.2. The highly significant and positive correlations (R = 0.956 and 0.914) between total antioxidant capacity (TEAC and FRAP) and total phenolic content (TPC) indicated that the phenolic compounds contributed significantly to the antioxidant capacity of the tested medicinal plants. The result was consistent with the previous findings for 112 traditional Chinese medicinal (TCM) plants and 133 Indian medicinal plants (Cai et al., 2004; Surveswaran et al., 2007). Additionally, the highest positive correlation (R = 0.958) between TFC and TPC and the highly positive correlations (R = 0.923 and 0.911) between the total antioxidant capacity (TEAC and FRAP) and total flavonoid content (TFC) of the tested samples (Table 3.2) suggested that the flavonoids were the main phenolic components in these medicinal plants and responsible for their antioxidant capacity.

Flavonoids and other phenolic compounds are important plant secondary metabolites with many biological and pharmacological activities. Some ﬂavonoids inhibit xanthine oxidase and have superoxide anion radical scavenging potential (Nagao et al., 1999). Xanthine oxidase (XO) plays an important role in the metabolism of xanthines. XO converts hypoxanthine to xanthine and ﬁnally to uric acid, which can accumulate and lead to hyperuricemia associated with gout (Noro et al., 1983). In-

80 hibitors of XO are thought to be useful in treating hyperuricemia associated gout and kidney stones. Nagao et al. (1999) reported that some flavonoids inhibited xanthine oxidase and had superoxide anion radical scavenging potential were assessed. Since many of the medicinal plants tested in this study showed high total phenolic and flavonoid contents, their XO inhibition and OH− radical scavenging activity. The results showed that several medicinal plants (e.g., H. indicus and S. brevistigma) from Asclepiadoideae and Periplocoideae exhibited quite high XO inhibitory activity and strong OH− scavenging activity. However, the correlation analyses (Table 3.2) revealed the poorest correlations (R = 0.082–0.320) between XO inhibitory activity, total antioxidant capacity, TPC and TFC of the tested samples and also the poor correlations (R = 0.515–0.654) between OH− scavenging activity and other parameters. This suggested that the phenolic compounds including flavonoids might not be responsible for their XO inhibitory and OH− scavenging activities. Potent XO inhibitors and OH− scavengers may be from the non-phenolic bioactive compounds in the medicinal plants of Asclepiadoideae and Periplocoideae. It needs to further investigate if other bioactive compounds (e.g., pregnane glycosides and other terpenoids and alkaloids) reported previously in the medicinal plants from these two subfamilies contribute significantly to their XO inhibitory and OH− scavenging activities.

The analytical characteristics of more than 100 phenolic standards established by Sakakibara et al. (2003) and Cai et al. (2004) could provide important reference data

(e.g., retention times (Rt), UV/visible λmax, and spectra shapes) for rapid identiﬁ- cation of major phenolic compounds in the plant extracts by reverse phase-HPLC.

In the present study, as shown in Table 3.3, a large number of known/unknown phenolic compounds were identified in the tested medicinal plants using LC-MS by comparison with authentic phenolic standards and the related literature data (Sakakibara et al., 2003; Cai et al., 2004). Flavonoids (flavonol glycosides and flavone glycosides, e.g., rutin and other quercetin/kaempferol glucosides, luteolin/apigenin glucosides), phenolic acids and their derivatives (hydroxycinnamic acids and hydrox-

81 ybenzoic acids, e.g., chlorogenic acid, ferulic acid, di-caffeoylquinic acids), phenolic terpenoids and alkaloids were also identified (Table 3.3. Because of the diversity and complexity of phenolic compounds in the medicinal plant extracts, it is rather difficult to characterize every compound and elucidate its structure under one chromatographic condition. It is not difficult, however, to isolate and identify major categories of phenolic compounds. The peaks (95–98 min) (peak 4) in LC profiles of all tested plants (Fig. 3.2) were easily identified as phenolic terpenoids and the peaks (∼12–33 min) in some tested plants (T. indica and T. ovata) were also readily identified as phenolic alkaloids in the present chromatographic condition, according to the previous findings identified in 112 TCM plants and 133 Indian medicinal plants (Cai et al., 2004; Surveswaran et al., 2007) and other studies (Ali et al.,

1991; Zhen et al., 2002). However, because there are no corresponding authentic standards, individual components of these phenolic terpenoids and alkaloids could not be ascertained in the present study. Additionally, some references (Chandra et al., 1994; Sahu et al., 1996; Deepak et al., 1997) reported that these medicinal plants contained many other bioactive compounds (e.g., pregnane glycosides and triterpenoid saponins). These non-phenolic terpenoids and alkaloids could not be identified under the chromatographic condition of the present study. Interestingly, in the present study it was found that a phenolic acid, chlorogenic acid (peak 2), and a flavonoid, rutin (quercetin 3-rutinoside) (peak 3), were present in nearly all the tested plant samples (especially, a high level of chlorogenic acid in Fig. 3.2). Moreover, some phenolic compounds were firstly identified from the tested Indian medicinal plants using LC-MS under the presently described chromatographic condition. For instance, a dominant peak (peak 1: Rt = ∼16.5 min, λmax = 278 nm, MW = 204) in LC profiles of five plants (i.e., C. gigantea, L. reticulata, O. esculentum, P. nivalis, and P. daemia) (Fig. 3.2) was tentatively identified as a new hydroxybenzoic acid which possesses typical chromatographic and spectral characteristics (e.g., Rt, λmax and spectral shape) of common hydroxybenzoic acids.

Its chemical structure will be elucidated with the aid of NMR. Several ﬂavonol

82 glycosides and high levels of chlorogenic acid were ﬁrstly isolated and identiﬁed in the leaves of D. hamiltonii, H. indicus, T. indica, T. ovata, and W. volubilis

(Table 3.3). Both flavonol and flavone glycosides were detected in the leaves of L. reticulata. Many flavonol glycosides and phenolic acids were identified in the stems of S. brevistigma. These phenolics have not been reported before for medicinal plants of Asclepiadoideae and Periplocoideae.

The roots of H. indicus, D. hamiltonii, and C. gigantea are traditionally used as folk medicines. The antioxidant capacity of their leaves was compared with their roots. The results showed that the leaves of H. indicus and D. hamiltonii, like their roots, exhibited potent antioxidant capacity, supporting the potential use of their leaves as the valued parts in medicines. However, the leaves of C. gigantea, unlike its roots, did not exhibit high antioxidant activity. The antioxidant properties of important Indian medicinal plants from the As- clepiadoideae and Periplocoideae are evaluated. The phenolic compounds identified in the tested species apparently have a significant contribution to their antioxidant capacity, which further contributes to their medicinal properties. Future research will be to decipher the exact modes of action of these compounds. Additionally, the LC-MS analysis of this study has provided full fingerprints (LC chromatograms) of the principal phenolic phytochemicals in the tested medicinal plants. The fingerprints can be applied in the authentication and quality control of these herbal medicines.

83 Table 3.3: Major phenolic compounds from selected In- dian medicinal plants of Asclepiadoideae and Periplo- coideae

Plant name Major types (representative compo- Bioactive compounds reported previ- nents) of phenolic compounds identi- ously (from references) fied by LC-MS Phenolic acids (e.g., hydroxybenzoic acids Terpenoids (including lupene and ursane Calotropis gigantea (L.) R. and hydroxycinnamic acids, especially fer- types, e.g., four ursane-type triterpenoids), Br. in Ait. f. ulic acid in flowers), flavonol glycosides cardenolides (e.g., proceragenin), cardeno- (rutin, kaempferol 3-rutinoside, isorham- lide glycosides, oxypregnane-oligoglycosides netin 3-rutinoside), phenolic terpenoids (calotroposides A and B), and flavonol glycosides (Sen et al., 1992; Ali et al., 1998; Ali and Gupta, 1999; Lhinhatrakool and Sut- 84 thivaiyakit, 2006)

Decalepis hamiltonii Wight High level of chlorogenic acid and di- 2-hydroxy-4-methoxybenzaldehyde, p- & Arn. caﬀeoylquinic acids, high concentrations anisaldehyde, vanillin, borneol, salicylalde- of ﬂavonol glucosides (rutin, quercetin 3- hyde, and decalepin (Nagarajan and Rao, galactoside, kaempferol 3-glucoside, etc.), 2003; Harish et al., 2005) high levels of unknown phenolics, low levels of phenolic terpenoids

Gymnema sylvestre (Retz.) Flavonol glycosides (rutin, Triterpenoid saponins (gymnemagenin, gym- Shult. quercetin/kaempferol triglycoside), phe- nemic acids I-XIV, gymnemasins A-D), nolic acids (chlorogenic acid) and terpenoids ﬂavonoid triglycosides (Sahu et al., 1996; Liu et al., 2004; Peng et al., 2005; Mukhopadhyay and Field, 2006) ..continued on next page Plant name Major types (representative compo- Bioactive compounds reported previ- nents) of phenolic compounds identi- ously (from references) ﬁed by LC-MS

Hemidesmus indicus (L.) High level of chlorogenic acid and low level Pregnane glycosides (hemindicusin, denicu- Ait. of di-caﬀeoylquinic acids, ﬂavonol glucosides nine, heminine, hemidescine and emidine), (rutin, quercetin3-sophoroside, kaempferol 3- pregnane oligoglycosides, triterpenoids, 2- rutinoside), other phenolic acids (benzoic hydroxy-4-methoxy benzoic acid and several acids) and terpenoids essential oils (Chandra et al., 1994; Deepak et al., 1997; Alam and Gomes, 1998; Sigler et al., 2000; Jirovetz et al., 2002; Sethi et al., 2006)

Leptadenia reticulata Flavonoids glycosides (luteolin 7-glucoside, Pregane glycosides (reticulin, deniculatin 85 (Retz.) Wight & Arn. apigenin glucosides, rutin, kaempferol trigly- and leptaculatin), pentacyclic triterpenoid cosides), phenolic acids (hydroxybenzoic (leptadenol) (Noor et al., 1993; Srivatsav acids) and terpenoids et al., 1994)

Oxystelma esculentum Flavonols glycosides (high level of quercetin Flavonol glycosides, polyhydroxypregane (L.f.) R. Br. diglucoside and triglucosides, kaempferol 3- glycosides (alpinoside A-C), and cardeno- rutinoside, kaempferol triglycosides), phe- lide diglycosides (oxystelmoside and oxys- nolic acids (hydroxybenzoic acids) and ter- telmine) (Srivastava et al., 1993; Hamed penoids et al., 2004; Heneidak et al., 2006)

Pentatropis nivalis (Gmel.) Phenolic acids (hydroxybenzoic acids), Flavonol glycosides, flavonol sulphates and Field & Wood flavonoids glycosides (apigenin glucosides, disulphates (Heneidak et al., 2006) kaempferol diglucosides/triglucosides), phenolic terpenoids ..continued on next page Plant name Major types (representative compo- Bioactive compounds reported previ- nents) of phenolic compounds identi- ously (from references) fied by LC-MS

Pergularia daemia High levels of phenolic acids (hydroxybenzoic Flavonol glycosides (Heneidak et al., 2006) (Forssk.) Chiov. acids and hydroxycinnamic acids), ﬂavonol glycosides (quercetin, other quercetin glucosides, kaempferol glucosides), phenolic terpenoids

Sarcostemma brevistigma Flavonols glycosides (quercetin glucosides, Pregnane glycosides (sarcovimiside A-C), Wight & Arn. kaempferol 3-glucoside and other kaempferol pregane derivatives (sarcogenin) (Khare glycosides), phenolic acids (chlorogenic acid, et al., 1987; Vleggaar et al., 1993) gallic acid derivatives) and phenolic ter- 86 penoids

Tylophora indica (Burm.f.) Phenolic acids (chlorogenic acid and other Alkaloids (tylophorine, tylophorinidine ty- Merr. caﬀeoylquinic acids), ﬂavonol glucosides loindicines, tyloindane) (Rao et al., 1971; Ali (kaempferol 3-rutinoside, other kaempferol et al., 1991) glucosides), phenolic alkaloids and terpenoids

Tylophora ovata (Lindl.) Phenolic acids (caﬀeoylquinic acids including Phenanthroindolizidine alkaloids (ty- Hook. ex Steud. chlorogenic acid), ﬂavonol glucosides (rutin), lophoridicine A, tylophorinine, O-methyl phenolic alkaloids and terpenoids tylophorinidine and tylophorinidine) (Zhen et al., 2002)

..continued on next page Plant name Major types (representative compo- Bioactive compounds reported previ- nents) of phenolic compounds identi- ously (from references) ﬁed by LC-MS Wattakaka volubilis (L.f.) Phenolic acids (chlorogenic acid and other Triterpenoids (Reddy et al., 2002) Stapf hydroxycinnamic acids), ﬂavonol glucosides (rutin, kaempferol 3-rutinoside, isorham- netin 3-rutinoside) ..continued on next page 87 Chapter 4

Molecular systematics of Ceropegia based on nuclear ITS and chloroplast trnL trnT-L and trnL-F intron intergenic spacers

4.1 Introduction

The maximum diversity of Ceropegia is in the subtropical Africa towards the eastern side of the continent where more than 50 species were reported (Dyer, 1983). Apart from this region, increasing species diversity occurs in Madagascar and in the Indian subcontinent (Bruyns, 1997). In India there are about 50 species and 4 varieties described so far, of which 33 are endemic to the subcontinent (Table 1.4). Ceropegia has very diverse habits like non-succulent twiners, erect herbs, and leaﬂess succulent twiners. The leaf varies from narrow to broad among the erect herbs and twiners. Some species have fascicled roots whereas most others have tubers. The corolla is tubular and dilated at the base. The corolla lobes are generally united at the tips.

Next to Ceropegia, the genus Brachystelma Sims. also has numerous species comprising of more than 120 members (Meve, 2002a). Most of the species of the

88 genera have restricted distribution. In India the genus is represented by 14 species, of which most are endemic. All the species of Brachystelma have swollen fleshy tubers and possess prominent leaves. The corolla is broadly campanulate. Corolla lobes are mostly flat and rotately spreading, rarely erect and coherent at the tips to form a cage-like structure. The recent classification of the family Apocynaceae by Endress and Bruyns

(2000) groups Ceropegia and Brachystelma under the tribe Ceropegieae of the subfamily Asclepiadoideae. Ceropegieae Decne. ex. Orb. comprises of 41 genera (Endress and Bruyns, 2000), majority of which are stem succulents characterised by clear latex, horizontal to erect pollinia, and germination crest along the upper or inner margin (Bruyns and Forster, 1991). A few genera within this tribe, such as Heterostemma, Leptadenia, most of Ceropegia, Brachystelma, Sisyranthus, Macropetalum, Riocreuxia, and Anisotoma are non-succulent and have prominent leaves. It was Bentham and Hooker (1876) who separated the group into two tribes Stapelieae and Ceropegieae according to the presence of stem succulents with slightly angled stems. Apart from this character, the pollinia and anthers are found to be extremely similar in both the tribes, hence later taxonomists (Bruyns and Forster, 1991; Liede and Albers, 1994) placed them into one tribe Stapelieae Decne. Stapelieae Decne is presently treated as Ceropegieae Decne. ex Orb. due to nomenclatural priority (Endress and Bruyns, 2000; Meve and Liede, 2004). Erect pollinia with upper or inward germination crest are the hallmark features of this tribe whereas other features such as corolla, development of staminal and corolline corona, the staminal column, appear to have evolved many times (Bruyns and Forster, 1991).

Though Meve and Liede (2004) conducted a molecular study of the tribe Ceropegieae, only 4 species of Ceropegia were included. In a recent study, Meve and Liede- Schumann (2007) have proved the paraphyly of Ceropegia with 36 species. In their results Ceropegia was in seven clades and in one clade was shared with Brachystelma species. They discussed the paraphyletic situation of Ceropegia and Brachystelma but support the classical morphological groupings instead of renaming the genera.

89 In the present study the molecular phylogenetic position of Ceropegia was re-tested with 26 Indian species. A few species of Brachystelma were also included in this study. The main aim of the study was to ﬁnd the relationships of Ceropegia which occur as endemics in the Western Ghats region of India at the molecular level. To ﬁnd out the relationships of Ceropegia with the Stapeliads was also an aim of this study.

4.2 Materials and Methods

4.2.1 Plant material

Fifty species of Ceropegia occur in India, 26 species including one new, unpublished species were used in this study. Fourteen species of Brachystelma are reported in In- dia and 4 were included in this study including one new unpublished species. Frerea indica and Caralluma umbellata were chosen as outgroups as they are succulent and possess angled stems and fall under the soft stemmed Stapeliads. The plants were collected from various places of Maharashtra and Karnataka states in Western In- dia (Fig. 1.5). The list of plants, location, voucher numbers and Genbank accession numbers is given in Table 4.2. All herbarium voucher specimens are deposited in the herbarium of Shivaji University, Kolhapur. Ceropegia dichotoma and Apteranthes burchardii from the Spanish Canary Islands were provided by from Juan Manuel

Laulh´e(www.xerics.com). DNA sequences of African Ceropegieae were obtained from EMBL databases, and their details can be found in Table 4.3.

4.2.2 DNA extraction

DNA was extracted from fresh young leaves, silica gel dried samples, or herbarium specimens according to Doyle and Doyle (1987) with some modiﬁcations. Brieﬂy,

20 to 50 mg of plant material was ground with 600 µl 2x CTAB (Cetyl Trimethyl Ammonium Bromide) buﬀer (50 mM Tris.HCl pH 8.0, 10 mM ETDA, 2% CTAB, 1.4 M NaCl and 0.1 % β-mercaptoethanol) with mortar and pestle and heated to 65

90 . The solution was extracted twice with choloroform:isoamyl alcohol (24: 1) and the supernatant was precipitated with 0.6 volumes of ice cold ethanol. The precipi- tate was then collected by centrifugation at maximum speed. The pellet was washed with 70% ethanol and air dried. The DNA pellet was ﬁnally dissolved in 100 µl TE

buﬀer (10 mM Tris-Cl, 1 mM EDTA, pH 8.0) and stored at -20. For some samples DNA extraction was done using DNeasy plant mini kit (Qiagen, Hilden, Germany) according to the manufacturer’s instructions. The DNA was visualized and quanti- ﬁed on 1% agarose gel using commercial DNA ladders (Fermentas, Ontario, Canada) as standards.

4.2.3 PCR ampliﬁcation

The ITS region was ampliﬁed with primers ITS4 and ITS5m (White et al., 1990;

Sang et al., 1995). The ITS amplification product was ∼ 700bp. Chloroplast trnT- L, trnL and trnL-F regions were amplified using primers a,b,c,d,e,f (Taberlet et al., 1991). The details of primers used in this study are listed in Table 4.1. The trnT-L, trnL and trnL-F regions were amplified using ab, cd and ef primer pairs and lengths of the regions were ∼ 1.1kbp, ∼ 550 bp and ∼ 400 bp respectively.

PCR DNA ampliﬁcations were performed in a 25 µl volume containing 10 ng genomic DNA template, 1 µl (10 pM/µl) of both 5’ and 3’ end-primers, 0.25 mM of each dNTPs, 1 U Taq polymerase, 2.5 mM MgCl2, l0× PCR buﬀer containing 50 mM of KCl, 10mM of HCl. PCR was performed on a Peltier Thermal Cycler (PTC-

200, MJ Research Inc. MA) with an initial 1 min at 95 followed by 35 cycles of

95 for 30 sec, 57 for 45s, 72 for 1 min, and finally 72 for 5 mins. The reaction products were electrophoresed on 1% agarose gels using 0.5× Tris-Acetic acid ETDA (TAE) buffer, stained with 0.5 µg/ml ethidium bromide and visualized under UV light to ensure specific amplifications before purification. Specific PCR products were excised from the gel and purified with PCR purification kit (Roche Diagnostic corporation, USA) according to the manufacturer’s instructions. Gel purified DNA samples were directly sequenced using the same primers as above with the Big Dye

91 Terminator kit v3.1 (Applied Biosystems, Warrington, UK) and Applied Biosystems model 3100 automatic sequencer. Each sequence was sequenced at least twice.

Table 4.1: Primers for ampliﬁcation of ITS region and cpDNA regions

Primer name Sequence Reference ITS4 TCC TCC GCT TAT TGA TAT GC White et al. (1990) ITS5 GGA AGT AAA AGT CGT AAC AGG G White et al. (1990) ITS5m GGA AGG AGA AGT CGT AAC AGG G Sang et al. (1995) a CAT TAC AAA TCG GAT GCT CT Taberlet et al. (1991) b TCT ACC GAT TTC GCC ATA TC Taberlet et al. (1991) c CGA AAT CGG TAG ACG CTA CG Taberlet et al. (1991) d GGGGATAGAGGGACTTGAAC Taberletetal.(1991) e GGT TCA AGT CCC TCT ATC CC Taberlet et al. (1991) f ATT TGA ACT GGT GAC ACG AG Taberlet et al. (1991)

4.2.4 Phylogenetic analysis

Sequences were aligned using ClustalW (Thompson et al., 1994) algorithm within the BioEdit package (Hall, 1999). Alignments were checked and cleaned manually using BioEdit. Phylogenetic analysis was performed using PAUP v4.0beta10 (Swof- ford, 2002). Gaps were treated as missing data and as fifth character to find the most parsimonious trees. Maximum parsimonious (MP) trees were obtained using heuristic search with 1000 random additions. Maxtrees were set to unlimited, branches of zero length were collapsed and all multiple parsimonious trees were saved. Goodness of fit scores of the trees were estimated by tree length (TL), consistency index (CI), retention index (RI), homoplasy index (HI) and log likelihood (-ln L) values. Boot- strap supports of the clades were assessed with a heuristic search of 1000 replicates, each with 10 replicates of random addition of taxa. The best-fit model of nucleotide evolution according to Akaike Information Cri- terion was obtained using MrModeltest v2.2 (Nylander, 2004). Maximum likelihood (ML) analysis with the appropriate substitution model was performed with PAUP by heuristic search with the same options as MP analysis. Neighbour-joining (NJ) analysis was also performed using PAUP. Bayesian posterior probability support for the

92 clades were obtained using Metropolis coupled Monte Carlo Markov chain (MCM- CMC) analysis as implemented in MrBayes (Ronquist and Huelsenbeck, 2003). Two simultaneous independent runs with 4 Markov chains were run for 1 million genera- tions and trees were sampled every 100th generation, resulting in 10,000 trees. The ﬁrst 1000 trees were considered as the burnin phase and discarded. A majority-rule consensus tree based on the remaining 9000 trees was computed and the probability of the branches are shown at the nodes. Trees were ﬁgured in Treeview v1.6.6 (Page, 2001).

93 Table 4.2: List of plants, voucher information, location, and Genbank accession numbers of ITS, chloroplast trnT- L, trnL and trnL-F sequences

No. Species Voucher Location ITS trnT-L trnL trnL-F Ceropegia anantii Kamble 2130 Sindudurg, Maharashtra EU106699 EU106712 EU119994 EU127963 1 Yadav state 2 Ceropegia attenuata Kamble 2123 Kolhapur, Mumbai, Pune, EU106700 EU106710 EU119992 EU127961 Hook.f. Raigad, Ratnagiri, Sindudurg, Thane,Maharashtra state. 3 Ceropegia anjanerica Kamble 2169 Nasik, Maharashtra state EU106690 EU106730 EU120012 EU127981 Malpure et al. 4 Ceropegia bulbosa Kamble 2118 Akola, Aurangabad, EU106687 EU106725 EU120007 EU127964 94 Roxb. var. bulbosa Kolhapur, Mumbai, Nanded, Pune, Raigad, Sindudurg, Satara, Thane, Maharashtra state. 5 Ceropegia elegans S. Sirumalai hills, Dindigul EU106677- - - Wall. Karuppusamy District, Tamilnadu state. 27679 (SKU) 6 Ceropegia evansii Kamble 2128 Kolhapur, EU106680 EU106721 EU120003 EU127975 McCan. Ratnagiri,Maharashtra state. 7 Ceropegia dichotoma Canary Islands EU312082 EU312086 EU120019 EU127989 Haw. 8 Ceropegia fantastica Kamble 2149 Kolhapur, Sindudurg, EU312083 EU106724 EU120006 EU127978 Sedgwick Maharashtra state. ...Continued on next page No. Species Voucher Location ITS trnT-L trnL trnL-F 9 Ceropegia hirsuta Kamble 2107 Akola, Aurangabad, EU106688 EU106720 EU120002 EU127974 Wight & Arn. Kolhapur, Mumbai, Nanded, Nasik, Pune, Raigad, Sindudurg, Satara, Thane,Maharashtra state. 10 Ceropegia huberi Kamble 2115 Kolhapur, Ratnagiri, EU106694 EU106722 EU120004 EU127976 Ansari Satara, Pune, Maharashtra state 11 Ceropegia intermedia S.Karuppusamy Sirumalai hills, Dindigul EU106678- - - Wight 27466(SKU) District, Tamilnadu, 12 Ceropegia jainii Kamble 2132 Kolhapur, Satara, EU106691 EU106717 EU119999 EU127971 Ansari & Kulkarni Sindudurg 13 Ceropegia juncea Kamble2135 Satara,Sangali EU106685 EU106723 EU120008 EU127965 95 Roxb. 14 Ceropegia lawii Kamble 2126 Ahmednagar, Kolhapur, EU106689 EU106714 EU119996 EU127968 Hook.f. Pune, Satara, Maharashtra state 15 Ceropegia maccannii Kamble 2137 Ahmednagar, Pune, EU106685 EU106723 EU120005 EU127977 Ansari Maharashtra state 16 Ceropegia mahabalei Kamble 2142 Pune, Thane, Maharashtra EU106692 EU106723 EU120005 EU127977 Hemadri & Ansari state 17 Ceropegia media Kamble 2151 Ahmednagar, Pune, EU106692 EU106723 EU120009 EU127966 (Huber) Ansari Satara, Maharashtra state 18 Ceropegia Kamble 2125 Sindudurg, Maharashtra EU106698 EU106728 EU120010 EU127979 mohanramii Yadav state 19 Ceropegia Kamble 2129 Satara, Maharashtra state EU106697 EU106719 EU120001 EU127973 noorjahaniae Ansari ...Continued on next page No. Species Voucher Location ITS trnT-L trnL trnL-F 20 Ceropegia oculata Kamble 2134 Ahmednagar, Amravati, EU106679 EU106716 EU119998 EU127970 Hook.f. Kolhapur, Mumbai, Nasik, Pune,Raigad, Sindudurg, Satara. 21 Ceropegia odorata Kamble 2144 Nandurbar, Thane, EU106701 EU106711 EU119993 EU127962 Hook.f. Maharashtra state. 22 Ceropegia Kamble 2124 Ahmednagar, Satara, EU106682 EU106729 EU120011 EU127980 panchganiensis Maharashtra state. Blatter & McCann 23 Ceropegia rollae Kamble 2166 Ahmednagar, Pune, EU106686 EU106715 EU119997 EU127969 Hemadri Maharashtra state. 24 Ceropegia sahyadrica Kamble 2148 Kolhapur, Pune, Ratnagiri, EU106684 EU106713 EU119995 EU127967 Ansari & Kulkarni Satara, Sindudurg, 96 Maharashtra state. 25 Ceropegia santapaui Kamble 2163 Satara, Ratnagiri, EU106695 EU106709 EU119991 EU127960 Wadhwa & Ansari Maharashtra state. 26 Ceropegia vincaefolia Kamble 2133 Kolhapur, Mumbai, Pune, EU106681 EU120020 - EU127990 Hook. Raigad, Satara, Thane, Maharashtra state. 27 Ceropegia sps. Kamble 2123 Nasik, Maharashtra state. EU106683 EU312084 EU120022 EU127992 28 Brachystelma edulis Kamble 2164 Kolhapur, Satara, EU106702 EU106731 EU120013 EU127982 Coll. & Hemsl. Maharashtra state. 29 Brachystelma naoroji Kamble 1172 Satara, Maharashtra state. EU106705 EU106732 EU120015 EU127983 Tetali et al., 30 Brachystelma Kamble 1175 Sindudurg, Pune, EU106702 EU106733 EU120014 malwanensis Yadav Maharashtra state. and N.P. Singh ...Continued on next page No. Species Voucher Location ITS trnT-L trnL trnL-F 31 Brachystelma sps. Kamble 1192 Belgaum,Karnataka state. EU106704 EU312088 EU312091 EU127984 Outgroups 32 Frerea indica Dalz. Kamble 1113 Satara, Pune, Nasik, EU106707 EU106708 EU119990 EU312087 Ratnagiri, Maharashtra state. 33 Caralluma umbellata Kamble1195 EU106706 EU106734 EU120016 EU127985 Haw. 34 Apteranthes Canary Islands. EU267708 EU312089 EU120018 EU127988 burchardii 97 4.3 Results

4.3.1 ITS based phylogeny

The ITS dataset (dataset I) consisted of 32 taxa which were newly sequenced for this analysis. The aligned dataset included 640 characters, out of which 524 were constant, 50 variable characters were parsimony uninformative and 66 were parsimony informative. When gaps were treated as a new state, there were 511, 57 and

72 constant, parsimony-uninformative and parsimony informative characters respectively. In this dataset Frerea and Caralluma were treated as outgroups and the rest of the 30 taxa were ingroups. Neighbour Joining (NJ), maximum parsimony (MP), maximum likelihood (ML) and Bayesian phylogenetic (BP) analyses were performed with this dataset. The best-fit model of nucleotide evolution according to the Akaike information criterion (AIC) (Akaike, 1981) for this dataset was SYM+I. A heuristic search with random addition of sequences and 100 repetitions yielded 110 equally most parsimonious trees when gaps were treated as 5th state, whereas the same kind of search yielded 462 trees when gaps were treated as missing data. A Kishino- Hasegawa test (Kishino and Hasegawa, 1989) showed the 110 trees (when gaps were treated as new state) were not significantly different (data not shown). One of the most parsimonious trees (TL=174, CI=0.805 , RI=0.899 , RC=0.723 , HI=0.195) obtained when gaps were treated as new state is shown in Fig. 4.1 . The bootstrap support of clades are shown above branches. A maximum likelihood heuristic search with stepwise addition and 10 repetitions incorporating the SYM+I model yielded a tree shown in Fig. 4.2. Bayesian posterior probability support of the clades in ML analysis is shown above the branches (Fig. 4.2).

Both trees obtained by Maximum-likelihood and Parsimony methods showed two major clades within Indian Ceropegia (Fig. 4.1, 4.2). In ITS DNA analysis, Clade I consisted of 12 species, Clade II consisted of 11 species, and 3 species did not fall under these two major clades. These major clades can be diﬀerentiated based on the vegetative character of leaf shape. Clade I primarily consisted of

98 broad leaved species and Clade II consisted of narrow leaved species. Within clade I, a subclade comprising of twiners can be recognised and the remaining are erect.

Similarly within clade II there were three subclades among which two subclades were erect species and one subclade consists of twiners: The four species of Brachystelma studied formed a clade, sister to the two large Ceropegia clades, clade I and clade II, but with weak bootstrap and Bayesian probability support. Ceropegia elegans, C. intermedia and C. juncea are divergent from other Ceropegias and Brachystelmas. The long branch of C. juncea suggests the sequence is much varied from the rest of the Ceropegias.

4.3.2 cpDNA based phylogeny

The Chloroplast DNA dataset (dataset II) consisted of a combined dataset of trnT-

L, trnL and trnL-F regions. The combined dataset had 1673 characters, of which 73 variable characters where parsimony uninformative and 42 variable characters were parsimony informative when gaps were treated as 5th character. The number of taxa included were 29 with Caralluma umbellata and Frerea indica as outgroups. Ceropegia vincaefolia, C. elegans, and C. intermedia which were included in the

ITS dataset were not included in this dataset as the trnT-L region from these taxa could not be ampliﬁed. A parsimony search similar to that of ITS dataset resulted in 2 equally most parsimonious trees which were identical in topology. One of the trees (TL=132, CI=0.871, RI=0.919, RC=0.800, HI=0.129) with boostrap support values is shown in Fig. 4.3. The best model found for this dataset was GTR+I. ML, Bayesian analysis made using the GTR+I model yielded trees of similar topology to the parsimony analysis (ﬁgure not shown). Two major clades were obtained were obtained based on the cpDNA data. Clade

I mostly contained broad leaved species and clade II contained narrow leaved species (Fig. 4.3). Two narrow leaved species C. media and C. huberi (denoted with asterisk in Fig. 4.3) were placed within Clade I among the other leaved species. The four species of Brachystelma included in the study were placed within Clade II, basal

99 Figure 4.1: One of the 110 most parsimonious trees obtained by parsimony analysis of ITS dataset. The bootstrap support values ≥ 50% are shown above the branches.

100 Figure 4.2: Maximum-likelihood tree based on ITS sequences with SYM + I model. Bayesian posterior probabilities ≥ 0.95 are shown above branches.

101 to narrow leaved Ceropegia species. Another major diﬀerence between the ITS tree and cpDNA tree is that C. juncea was at a basal position to Clade I and II similar to ITS data analysis. C. bulbosa var. bulbosa in Clade I of the ITS tree was placed in a basal position to all other taxa.

4.3.3 Relationship between Stapeliads and Ceropegia based

on ITS data

To study the relationships of Western Indian Ceropegias with African Stapeliads, a

ITS sequences data set (dataset III) was made with African Stapeliads and species of Brachystelma and Ceropegia whose sequences are already available from EMBL database. Sisyranthus compactus, a leafy species is from the subtribe Anisotominae (Meve and Liede, 2004) was used as outgroup. The dataset consisted of 76 taxa and

650 aligned characters with 336 constant characters, 124 parsimony uninformative variable characters and 190 parsimony informative variable characters. Parsimony analysis resulted in 5303 equally most parsimonious trees. A strict consensus of the parsimonious trees lacked resolution of the taxa. The best model for the dataset was found to be SYM+I+G. ML tree incorporating the SYM+I+G model with Bayesian posterior probability support in their branches is shown in Fig. 4.4. Most of the Brachystelma species are basal to Ceropegia clades except the four Indian species. The four Indian Brachystelma species were nested within a large

Clade of Ceropegia. The other major clade consisted of succulent Stapeliad genera. Within this clade two species of Ceropegia, C. striata and C. saxatilis were placed at basal position. The genus Ceropegia was apparently polyphyletic, with members being present in all major clades. Within the Stapeliad clade there were two major clades. One corresponds to the “southern clade” of Meve and Liede (2002). The

“southern clade” had many of the soft-stemmed succulents of southern Africa. The other clade had many of the species of Caralluma and allies from various regions like Northern Africa, Arabia and India.

102 Figure 4.3: One of the two equally most parsimonious trees obtained based on cpDNA dataset. The bootstrap support values ≥ 50% are shown above the branches.

103 Figure 4.4: Maximum likelihood tree based on ITS sequence of Stapeliads. Clades with ≥ 0.95 Bayesian support are thickened. Sequences from this study are indicated in green.

104 4.3.4 Relationship between African Stapeliads and Cerope-

gias based on cpDNA data

Dataset IV comprised of combined cpDNA sequences of 75 taxa, with 1788 total aligned characters, of which 1270 were constant and 352 variable characters were parsimony-uninformative and 166 were parsimony informative. A heuristic search resulted in 2178 equally most parsimonious trees. A strict consensus of the parsimonious trees lacked resolution of the taxa. The best model based on AIC was found to be GTR+I+G. A maximum likelihood tree using the GTR+I+G model is shown in Fig. 4.5. The tree also showed three major clades, the Brachystelma clade, the clade of Indian Brachystelma and Ceropegia the clade of soft-stemmed Stapeli- ads. Within the Stapeliad clade, two major clades were observed, one including Carallumas and the other including South-African Stapeliads. As with ITS data, Ceropegia saxatilis and Ceropegia striata were placed within the Caralluma clade in the Stapeliad group, but along with Caralluma. Ceropegia bulbosa var. bulbosa was also found in the Stapeliad clade but with no clear aﬃliation. The “southern clade” in Meve and Liede (2002) was observed but not clearly demarcated as in the ITS tree. There were many diﬀerences in positions occupied by some genera between ITS and cpDNA dataset. Apteranthes, Desmidorchis, Frerea and Caudan- thera which were sister to the Caralluma clade in the ITS tree were sister to the “southern clade” in the cpDNA tree.

4.4 Discussion

4.4.1 Two major clades among Western Ghats Ceropegia

All the Ceropegia species included in this study except C. juncea, C. bulbosa and C. hirsuta are endemics and they occur in high altitudes in the Western Ghats. It appears that vegetative structures are more reliable than ﬂoral structures in classifying species of Asclepiads (Meve and Liede, 2002). The leaf shape and peduncle length

105 Figure 4.5: Maximum likelihood tree based on cpDNA of Stapeliads. Clades with ≥ 0.95 Bayesian support are thickened. Sequences from this study are indicated in green.

106 Figure 4.6: Flowers of Ceropegia. a. C. rollae, b. C. maccannii, c. C. sahyadrica, d. C. lawii, e. C. panchganiensis, f. C. anantii, g. C. attenuata, h. C. anjanerica. i. C. mahabalei, and j. C.jainii. are important characters separating the two clades among the Ceropegia studied here. Clade I in Fig. 4.2 consists of broad leaved species with long peduncles. A small subclade within Clade I consisting of C. oculata, C. vincaefolia, C. evansii and C. fantastica have twining habit and glabrous stems (Fig. 4.2). Other species in this clade namely, C. panchganiensis, C. rollae, C. maccannii, C. sahyadrica, Ceropegia species and C. lawii have erect habit and hairy stems. The floral morphology of these species are also similar (Fig. 4.6,a-e). Within this clade C. hirsuta is twining with hairy stem, wheres C. bulbosa is twining and has glabrous stem. Clade II consists of narrow leaved species with short peduncles. Within the narrow leaved clade (Clade II), there is a well supported clade consisting of C. anantii, C. attenuata, C. anjanerica, C. mahabalei, and C. jainii which are all erect herbs. This clade shares common features such as hairy shoots, sessile or subsessile leaves, hairy corolla lobes, and uniflowered inflorescence. This group with fairly long,

107 elongate corolla lobes (Fig 4.6, f-j) forms the series Attenuate according to Huber’s (1957) revision of Ceropegia (Malpure et al., 2006). These ﬁve species also show close aﬃnity based on the cpDNA dataset (Fig. 4.3). Another sub-clade within the Clade II consists of C. huberi, C. santapaui, C. media, C. odorata which are closely related by the character of twining habit, glabrous shoots, petiolate leaves, and glabrous corolla lobes. C. noorjahaniae and C. mohanramii are erect and form a separate clade basal to the other two subclades. They also share the features of hairy shoots, sessile or sub-sessile leaves and hairy corolla lobes as the other erect species in Clade II. The ITS dataset shows convincing grouping of the species studied, based on morphological traits. The cpDNA dataset also shows similar grouping of the two major clades, but the position of C. huberi and C. media within the broad-leaved clade could not be well explained. One reason may be that the leaf shape character may be homoplasious.

4.4.2 Phylogeny of the tribe Ceropegieae

As stated by Meve and Liede (2004), Ceropegia and Brachystelma were polyphyletic in the present study as well. C. juncea, C. distincta, C. bulbosa, C. saxatilis and

C. dichotoma fall under diﬀerent clades (Fig. 4.4, 4.5). Therefore a taxonomical revision of these ambiguous taxa is needed. Apart from a few species such as C. striata and C. saxatilis which show genetic aﬃnity to the soft-stemmed Stapeliads the other Ceropegia and Brachystelma form a basal position along with Sisyranthus compactus. Leptadenia and Heterostemma could not be used as outgroups in the present analysis as their sequences are too diverse to obtain an alignment without large indels. Leptadenia reticulata is basal to Riocreuxia torulosa (subtribe Aniso- tominae) based on rbcL data (Chapter 6). As shown by Meve and Liede (2004) the leafy Anisotominae clade are the closest ancestor of Ceropegia, Brachystelma and other Stapeliads (subtribe Stapeliinae). It appears that the succulent Stapeliads are recently evolved genera which have developed succulence to conquer dry regions of Africa.

108 4.4.3 Molecular phylogenetic relationship between Brachys-

telma and Ceropegia

In Figures 4.1, 4.3, 4.4 and 4.5, the four Indian Brachystelma species studied show close aﬃnity with the Ceropegias. In Fig. 4.3 they show sister relationship to the

Clade II of Ceropegia with good bootstrap support. This result could not be explained. One explanation is that these species might show close aﬃnity to Ceropegias as they might have migrated very early and might have speciated in their present locations. This problem can be addressed by using remaining species of Brachys- telma from India. However obtaining these plants are very diﬃcult because they are not easily noticeable in the wild and also their occurrence is very rare. Even if more species are included, it may lead to more paraphyletic clades as discussed in Meve and Liede-Schumann (2007). In a recent work, Meve and Liede-Schumann (2007) showed seven clades within

African Ceropegia. In their analysis also, 8 species of African Brachystelma were nested within a clade of Ceropegia. As elucidated by Meve and Liede-Schumann (2007) it is not possible to characterise the taxa into observed clades and key them for morphological identiﬁcation. For example Brachystelma species study have campanulate corolla whereas Ceropegia species have tubular corolla hence it is not possible to name the Brachystelma species as Ceropegia or vice versa. This paraphyletic condition is probably due the fact that this group of plants are fast evolving (Klak et al., 2004) and that hybridization events could have lead to reticulate phylogeny (Sosef, 1997) of the two genera studied here. Therefore the paraphyly of Brachys- telma and Ceropegia has to be accepted at this stage for the sake of morphological identiﬁcation. A plea to accept paraphyletic taxa in the era of phylogenetic taxonomy was expressed in an open letter signed by over 150 taxonomists to the journal Taxon (Nordal and Stedje, 2005).

109 4.4.4 Position of Ceropegia juncea

Ceropegia juncea is the only succulent stemmed species with reduced leaves found in India (Bruyns, 1997). It is quite widespread within India occupying dryer areas. The position of the stem succulent C. juncea outside the Indian clade suggests that it might have migrated from the African continent recently. The distribution of C. juncea over a wide range such as Africa, Arabia, Pakistan, India and Bangladesh (Meve, 2002a) suggests that it is easily adaptable and can grow in dry areas. C. juncea being a CAM plant suggests it is suitable to grow in dry regions (Gaikwad et al., 1989). Moreover its chromosome number is 66 (Jagtap and Singh, 1999) compared to 22 which is common among Ceropegia. This also suggests that it is newly evolved species. Since most of the Ceropegias don’t show stem succulence, it appears that stem succulence is a relatively new character.

4.4.5 Position of Ceropegia bulbosa

Ceropegia bulbosa is another widespread species occurring in India, south of Hi- malayas and also Pakistan, southern Arabia and Ethiopia (Bruyns, 1988). Bruyns (1997) considers C. bulbosa as an African species with close affinity with C. linophyl- lum and falling in the C. africana, C. linearis, C. rendalii, C. purpurascens group which have discoid fleshy tubers, often fleshy leaves and similar floral structure. In the present molecular analysis, C. bulbosa var. bulbosa comes under Clade I in the ITS DNA analysis (Fig 4.1, 4.2), whereas in the cpDNA analysis, it is very distinct and falls outside C. juncea (Fig. 4.3). In the cpDNA dataset with African Stapeliads, it falls within the clade of African species (Fig. 4.5). The reason of this might be C. bulbosa must have migrated to India recently and hybridized with any of the Indian species within Clade I. As direct sequencing of the ITS region was performed, the chromatograms of C. bulbosa were infact, not clear and had to be repeated several times. This explains that their nuclear DNA has two different types ITS sequences, whereas the cpDNA which is unhybridized and most probably derived from the maternal species. C. bulbosa with succulent leaves also seems to

110 be a hardy species which is common distributed all over India, including the dry regions. This fact is supported by the fact that C. bulbosa is also a CAM plant exhibiting C4 photosynthesis (Ziegler et al., 1981). Bruyns (1997) states that C. mahabalei (Fig. 4.6-i) which forms a member of the series Attenuatae of Huber has close aﬃnities with the African species C. campanulata, C. insignis, C. turricula. Since the DNA sequences of these African Ceropegia species are sparse, their links with Indian Western Ghats species could not be clearly deciphered at this stage.

4.4.6 Biogeography of Western Ghats Ceropegia

Apocynaceae is proposed to be of Gondwanan origin and the success of this family is attributed to the presence of coma hairs in their seeds which help in their dispersal (Potgieter and Albert, 2001). On studying the relationships among Indian and

African species, it is apparent that the Indian species of Ceropegia and Brachystelma are closely related among themselves and diverse from their African counterparts. This divergence may be due vicariance. The common ancestors of these plants might have coexisted in the Gondwanaland supercontinent and after they have arrived in the Indian subcontinent, they have occupied specialised ecological niches within their habitats in India where they have evolved into such diverse species. The Western Ghats is a biodiversity hotspot, hosting several endemic species (Myers et al., 2000).

111 Table 4.3: Accession numbers of sequences obtained from Genbank / EMBL databases No Name ITS trnT-L trnL trnL-F 1 Stapelia glanduliflora AJ402152 AJ402127 AJ402128 AJ402151 2 Stapelia rufa AJ488825 AJ488465 AJ488466 AJ488467 3 Richtersveldia columnaris AJ402157 AJ402122 AJ402133 AJ402146 4 Tromotriche longipes AJ488831 AJ488483 AJ488484 AJ488485 5 Huernia kennedyana AJ488803 AJ488399 AJ488400 AJ488401 6 Orbea variegata AJ488815 AJ488432 AJ488433 AJ488434 7 Larryleachia cactiformis AJ402159 AJ402120 AJ402135 AJ402144 8 Duvalia angustiloba AJ488792 AJ488366 AJ488367 AJ488368 9 Australluma peschii AJ488776 AJ488321 AJ488322 AJ488323 10 Hoodia gordonii DQ231521 AJ488390 AJ488391 AJ488392 11 Lavrania haagnerae AJ402160 AJ402119 AJ402136 AJ402143 12 Notechidnopsis tessellata AJ402156 AJ402123 AJ402132 AJ402147 13 Stapelianthus decaryi AJ488826 AJ488468 AJ488469 AJ488470 14 Pectinaria articulata AJ402155 AJ402124 AJ402131 AJ402148 15 Quaqua ramosa AJ488822 AJ488456 AJ488457 AJ488458 16 White-sloanea crassa AJ488833 AJ488489 AJ488490 AJ488491 17 Caralluma subulata AJ488781 AJ488336 AJ488337 AJ488338 18 Caralluma priogonium AJ488780 AJ488333 AJ488334 AJ488335 19 Caralluma arachnoidea AJ310785 AJ410037 AJ410038 AJ410039 20 Echidnopsis angustiloba AJ488796 AJ488378 AJ488379 AJ488380 21 Caudanthera sinaica AJ488782 AJ488339 AJ488340 AJ488341 22 Caudanthera edulis AJ402162 AJ402116 AJ402139 AJ402140 23 Apteranthes europaea AJ488773 AJ488312 AJ488313 AJ488314 24 Apteranthes tuberculata AJ488775 AJ488318 AJ488319 AJ488320 25 Apteranthes munbyana AJ488774 AJ488315 AJ488316 AJ488317 26 Desmidorchis flava AJ488789 AJ488357 AJ488358 AJ488359 27 Desmidorchis acutangula AJ488786 AJ488348 AJ488349 AJ488350 28 Desmidorchis arabica AJ488788 AJ488354 AJ488355 AJ488356 29 Desmidorchis lavranii AJ488790 AJ488360 AJ488361 AJ488362 30 Ceropegia striata AJ310788 AJ410043 AJ410044 AJ410045 31 Ceropegia saxatilis AJ310786 AJ410040 AJ410041 AJ410042 32 Ceropegia distincta AJ488784 AJ488345 AJ488346 AJ488347 33 Ceropegia nilotica AJ402161 AJ402117 AJ402138 AJ402141 34 Sisyranthus compactus AJ310795 AJ410067 AJ410068 AJ410069 35 Brachystelma filifolium AJ310797 AJ410073 AJ410074 AJ410075 36 Brachystelma rubellum AJ310798 AJ410076 AJ410077 AJ410078 37 Brachystelma burchellii AJ310789 AJ410046 AJ410047 AJ410048 38 Brachystelma pygmaeum AJ310784 AJ410031 AJ410032 AJ410033 39 Brachystelma nanum AJ310783 AJ410028 AJ410029 AJ410029 40 Brachystelma christianeae AJ310796 AJ410070 AJ410071 AJ410073 41 Brachystelma macropetalum AJ310782 AJ410025 AJ410026 AJ410027

112 Chapter 5

Molecular systematics of Caralluma species occurring in India

5.1 Introduction

The genus Caralluma is an interesting group because of its diversity of beautiful

flowers. Several workers have attempted to classify this genus but still a convincing phylogenetic classification is lacking. Meve and Liede (2002) used several taxa of southern Africa in their study, yet the inclusion of taxa is not complete. The choice of taxa for this study was based on the earlier work by Meve and Liede (2002). In their work, they found a well supported clade “southern” clade which comprised of genera from Southern Africa including Madagascar. The samples in the southern clade were excluded in this analysis because they formed a separate clade apart from the core Caralluma which are “northern” sensu Meve and Liede (2002). Several important genera and species used in Gilbert (1990) and Plowes (1995) were not used probably because of unavailability of samples. In this study, Indian genera have been included to find the phylogeny of the genus within India and with relation to African species.. In India there are about 14 species of Caralluma (Bruyns, 2000c) distributed

113 in drier region of Deccan Peninsula, foot hill tracts of Western and Eastern Ghats. Out of the 14 species, about 8 species are represented in Peninsular India and more than half are endemic. In the present study molecular data was used to study the phylogenetic affinities among 12 taxa representing 8 species and 5 varieties (total of 12 taxa). The monotypic genus Frerea which is a leafy form was also included to find its genetic affinity with Caralluma. Ceropegia which is a leafy non succulent genus was used as outgroup. Nuclear ITS, chloroplast trnL intron and trnL-F intergenic spacers were used for the study. For comparative analysis some published sequences of the Caralluma allies from Meve and Liede (2002) were also used.

5.2 Materials and Methods

5.2.1 Plant material

8 species and 5 varieties of Caralluma were collected from the original localities where the plants occur. The voucher specimens are available in the herbarium of Sri Krishnadevaraya University, Anantapur, India. The species included in this study, their location, voucher information and Genbank accession numbers are listed in Table 5.1.

5.2.2 DNA extraction, PCR ampliﬁcation and Sequencing

DNA extraction, PCR ampliﬁcation and sequencing were similarly done as described in Section 4.2.2, 4.2.3.

5.2.3 Phylogenetic analysis

Phylogenetic analysis follows the methods as described in Section 4.2.4. with some modiﬁcations. For maximum likelihood analysis, the program Garli (Zwickl, 2006) was used because it uses the same algorithm as PAUP but takes lesser time to complete the analysis.

114 Table 5.1: Caralluma species used in the study, their location, voucher specimen and Genbank accession numbers of ITS, trnL and trnL-F regions No. Species / Variety Location Voucher ITS trnL trnL-F 1 Boucerosia indica (Wight & Satara district, Maharashtra Kamble 2131 EU267903 EU267099 EU267089 Arnott) Plowes. 2 Caralluma sarkariae Lavranos & Nagamalai hills, Madurai,Tamil SKU27965 EU267904 EU267102 EU267087 Frandsen Nadu 3 B. pauciﬂora (Wight) N.E.Br. Vallanadu forest, Palayam kotai, SKU28992 EU267905 EU267101 EU267091 Tamil Nadu 4 C. adscendens var. carinata Near Nagamalai hills, Madurai, SKU27939 EU267896 EU267096 EU267084 Grav. & Mayur. Tamil Nadu, India 5 C. adscendens var. attenuata Oddanchatram, Dindigul SKU27947 EU267897 EU267095 EU267083

115 (Wight) Grav. & Mayur. district, Tamilnadu 6 C. adscendens var. adscendens Near Air port, Madurai, Tamil SKU27963 EU267898 EU267094 EU267082 (Roxb.) R.Br. Nadu 7 C. adscendens var. gracilis Palni hills,Dindigul district, SKU27945 EU267899 EU267098 EU267086 Grav. & Mayur. Tamil Nadu 8 C. adscendens var. ﬁmbriata Kadiri, Anantapur district, SKU27937 EU267900 EU267097 EU267085 (Wall.) Grav. & Mayur. Andhra Pradesh 9 B. umbellata (Roxb.) Haworth Palni hills, Dindigul district, SKU27964 EU267901 EU267104 EU267092 Tamil Nadu 10 B. lasiantha (Wight) N.E.Br. Gooty hills, Anantapur district, SKU27970 EU267902 EU267100 EU267090 Andhra Pradesh 11 C. stalagmifera Fisher Near Nagamalai hills, Madurai, SKU27968 EU267894 EU267103 EU267088 Tamil Nadu 12 C. bhupinderana Sarkaria Vallanadu forest, Palayamkottai, SKU28000 EU267895 - - Tamil Nadu 5.3 Results

5.3.1 Phylogenetic relationships among Indian Carallumas

based on ITS sequences

The ITS dataset comprised of 35 taxa with 640 nucleotides. 491 characters were constant, 56 characters were parsimony-uninformative and 93 characters were parsimony informative when gaps were treated as missing characters. When gaps were treated as the 5th character there were 476, 62, 102 constant, parsimony uninformative and parsimony informative characters respectively. A heuristic search (10000 repetitions) with, random addition of sequences and TBR swapping resulted in 184 equally most parsimonious trees (TL=213, CI=0.779 , RI=0.872, RC=0.680,

HI=0.221) when gaps were treated as missing data. A Kishino-Hasegawa (KH) test (Kishino and Hasegawa, 1989) showed that the 184 trees were not significantly different (data not shown). A 50% majority rule consensus tree is shown in Fig. 5.1. Bootstrap support (with 1000 replicates of 10 repetitions of heuristic search with random additon and TBR branch swapping) is shown on the branches. The best model selected by MrModeltest was K80+G and SYM+G based hierarchical likelihood ratio test and Akaike information criterion (AIC), respectively. The maximum-likelihood tree with SYM+G model is shown in Fig. 5.2. Bayesian support values ≥ 0.90 are shown above the branches. The taxa sequenced in this study are indicated in magenta, whereas taxa obtained from published work are shown in green. The topology of the parsimony based trees and ML trees were similar. The taxa from India were placed in two separate clusters. The Caralluma clade is well supported in both MP and ML trees (Figs. 5.1, 5.2. This clade comprised of the core Caralluma group related to C. adscendens. Another well supported major Indian Caralluma clade comprised of B. umbellata, B. lasiantha, B. indica, B. pauciflora and C. bhupinderana (Boucerosia clade in Figs. 5.1, 5.2). Frerea indica was found closely related to this clade based on the ITS sequences.

116 Figure 5.1: 50% Majority-rule consensus tree based on ITS sequences. Bootstrap support ≥ 50% are shown above the branches. Sequences from this study are shown in purple.

117 Figure 5.2: Maximum-likelihood tree based on ITS sequences. Bayesian support values ≥ 0.90 are shown above the branches. Sequences from this study are shown in purple.

118 5.3.2 Phylogeny based on cpDNA dataset

Thirty-three taxa were used in the cpDNA dataset. Caralluma bhupinderana and Echidnopsis socotrana used in the ITS analysis were not used in the cpDNA analysis. Caralluma bhupinderana could not be used because its trnL sequence could not be obtained in full length. The combined cpDNA dataset consisted of trnL and trnL-F regions with 825 characters. 794 characters were constant and 19 variable characters were parsimony un-informative and 12 characters were parsimony informative when gaps were treated as missing data. When gaps were treated as the 5th state, 625 characters were constant, 170 variable characters were parsimony-uninformative and

30 characters were parsimony informative. A heuristic maximum parsimony search with gaps as missing resulted in 180 equally most parsimonious trees (TL = 37, CI=0.864, RI=0.925, RC=0.800, HI=0.135). Based on KH test the trees were not signiﬁcantly diﬀerent. A 50% majority-rule consensus tree of the 180 parsimonious trees is shown in Fig. 5.3. The best models of nucleotide evolution for this dataset were F81+G and HKY+I (hierarchical likelihood ratio test and Akaike information criterion (AIC)) which are simple models. The maximum-likelihood tree with Bayesian support values is shown in Fig. 5.4. In the cpDNA trees, two major clades were obtained. The core Caralluma clade had fairly good bootstrap support and Bayesian support (Figs. 5.3, 5.4). Boucerosia clade is not well supported in both MP and ML trees.

5.4 Discussion

From the present study it is observed that there are two separate genetic lineages of Caralluma s.l. within India based on ITS sequences, “Caralluma” clade and

Boucerosia clade (Figs. 5.1, 5.2). Plowes (1995) based his classification of Car- allumas on two groups, Group A - stems slender, tapering apically, inflorescences racemose, leaves usually lanceolate. Group B - stems robust, not tapering, inflorescence terminally umbellate or laterally displaced by further stem-growth, leaves

119 Figure 5.3: 50% Majority-rule consensus tree of the 180 equally parsimonious trees based on cpDNA sequences. Bootstrap support ≥ 50% are shown above the branches. Sequences from this study are shown in purple.

120 Figure 5.4: Maximum-likelihood treed based on cpDNA sequences. Branches with Bayesian support ≥ 0.90 are thickened. Sequences from this study are shown in purple.

121 broad, ovate-acute. The “Caralluma” clade falls in Group A and “Boucerosia” clade falls in Group B according to Plowes’ revision.

5.4.1 Caralluma clade

The “Caralluma” clade consists of the type specimen Caralluma adscendens. Ac- cording to Gilbert (1990) this group has the following features: “Stems non-rhizomatous, Stems usually erect, pale in colour and usually 4 angled, sometimes terete, tapering at the apex. Leaves lanceolate, leaf rudiments conspicuous. The apical part of the stem bears flowers and is usually long, slender, mostly terete, whip-like often withers after flowering. Inflorescence, few-flowers (2 or more flowers), opening in succession. Flowers usually pendent. They have tufted stipular hairs, corolla usually small, campanulate, brownish-purple with vibratile fusiform cilia. Corona mostly cup-like, often stipitate. Corpuscula flange-winged1, ellipsoidal, follicle pairs erect, V-shaped”. This group is distributed in peninsular India and Sri Lanka.” Caralluma subulata Forssk˚al ex. Decne. an Arabian species distributed in Yemen, Saudi Arabia, Sudan etc. is closely related to the Indian C. adscendens (Plowes, 1995; Müller and Albers, 2002). The close relation of C. subulata with the C.adscendens is shown in Figs. 5.1 and 5.2. Caralluma sarkariae and C. stalagmifera are nested within the Caralluma clade and also similar to C. adscendens group by morphology (Fig. 5.6). Caralluma stalagmifera shows close affinity to C. adscendens var. fimbriata based on ITS data with good statistical support (Fig. 5.1). The morphological sim- ilarity between the two are also high (Figs. 5.6(c), 5.6(e)). The difference between the two species are corolla characters which are darkish purple throughout with hairs on the margin in C. stalagmifera and corolla with transverse yellow striations and also with hairs on the margin in C. adscendens var. fimbriata. Similarly the distinguishing character between C. sarkariae and other C. adscendens varieties is

1Corpusculum with a triangular wing of thin transparent tissue starting at or slightly beyond the open end of the clasping slit and terminating at the centre of the corspuculum, therefore resembling like the body of a squid (Plowes, 1995)

122 only non-pendulous ﬂowers. Therefore these two species C. stalagmifera and C. sarkariae may be treated as varieties of C. adscendens rather than separate species.

Caralluma priogonium K. Shumann and C. arachnoidea (P.R.O.Bally) M.G. Gilbert from East Africa (Ethiopia, Kenya, Somalia and Tanzania) were found closely related to the “Caralluma” clade with good support based on both ITS and cpDNA datasets. Australluma peschii (Nel) Plowes (syn. C. peschii Nel) a monotypic Namibian endemic genus (Bruyns, 2002) with hairy corolla lobes groups with the core Caralluma clade but without much bootstrap and Bayesian support. In Meve & Liede’s (2002) analysis it was clustered with the “southern” clade also without support. According to Plowes (1995) A. peschii with slender stems is related to Caralluma whereas Meve and Liede (2002) predicted it to be in their “southern” clade. In this study it clusters with “Caralluma” clade, yet the exact position of A. peschii could not be conﬁrmed as there is no good statistical support.

5.4.2 Boucerosia clade

The “Boucerosia” clade consists of plants with the following features: “Stems uniformly coloured, erect, thick, 4-ribbed. Leaf rudiments small, ovate-deltoid, hori- zontally spreading or bent downwards. Stipular glands or hairs lacking. Flowers in terminal umbels, never laterally displaced. Corolla campanulate with spreading ovate-acute lobes, usually ciliate. Corolla lobes glabrous, hirsute or with minutely spiculate rugosities. Gynoecium subsessile, staminal column cup-shaped. Pollinia round-D-shaped. Corpuscula clavate1, ﬂange winged. Follicles slender, subulate. The members of this clade are distributed in southern India and Sri Lanka”, Plowes (1995)). Boucerosia lasiantha (Wight) N.E.Br. was described from Nuggur Hills of Dharma- puri district in Tamil Nadu. But now it has sunk into B. umbellata group. According to (Gamble, 1916) there are many marked diﬀerences between B. lasiantha and B. umbellata. B. umbellata has glabrous petals with purple striations on the inner side

1A corpusculum with the distal end widened like a shield (Plowes, 1995)

123 whereas B. lasiantha has petals with long hairs on the margin and upper half and uniform purple colour on the inner side. In the present analysis, B. lasiantha and

B. umbellata show close aﬃnity. Caralluma bhupinderana Sarkaria was not included under Boucerosia in Plowes’ (1995) revision, but it should be renamed as Boucerosia bhupinderana based on the present data from ITS sequences. Frerea indica is sister to the Boucerosia clade based on ITS sequences. Gilbert

(1990) separates Frerea as a separate genus, but based on ﬂoral morphology but (M¨uller and Albers, 2002) placed it as subgenus under Boucerosia. This treatment is acceptable based on the ITS based phylogeny. Caudanthera sinaica (syn. Boucerosia sinaica) and Caudanthera edulis are closely related to this group based on ITS sequences, with good support. Apteranthes and Desmidorchis are sister to this clade consisting of Caudanthera and Boucerosia, but without support. Apteranthes, Boucerosia and Desmidorchis fall under Group B which have robust stems (Plowes, 1995).

5.4.3 Phylogeny and Biogeography of Frerea

Frerea indica (syn. Boucerosia frerei) is a peculiar species in several aspects. It possesses well-defined leaves and most importantly fusiform underground tubers which are characteristics present only in leafy genera of Ceropegieae such as Ceropegia. The tubers are formed only in seed grown plants and not from stem cuttings (Sarkaria, 1980). These two characters have led to the speculation that Frerea is a relictual genus. But its chromosome number of 44 instead of 22 suggests that it is a polyploid and a derived species (Meve, 1997). Moreover a natural hybrid between Frerea and Caralluma europaea has been reported (Gilbert, 1990). This interbreeding suggests that Frerea is closely related to Caralluma. Based on the molecular data in this study Frerea is closely related to Boucerosia clade. Yet the morphology of solitary flowers in Frerea is in strong contrast to the terminal, clustered flowers in Boucerosia clade. Therefore there is a possibility that Frerea might be derived as a hybrid between a Caralluma-like ancestor and a Boucerosia-like ancestor. The presence of

124 (a) Boucerosia lasiantha (b) Boucerosia umbellata

(e) Apteranthes burchardii (f) Frerea indica

Figure 5.5: Boucerosia and related genera. Photos from Dr. Mayur Kamble and Dr. Sch¨onfelder 125 (a) (b) (c) C. adscendens var. adscendens C. adscendens var. attenuata C. adscendens var. ﬁmbriata

(d) (e) (f) C. adscendens var. carinata Caralluma stalagmifera Caralluma sarkariae

Figure 5.6: Caralluma adscendens varieties and related species. Photos from Dr. Karuppusamy

“primitive” characters like large leaves and tubers leads to confusing conclusions on the evolutionary origin of Frerea. These characters may be acquired later in evolution rather than derived from a Ceropegia-like ancestor. If these characters were derived from an ancient leafy ancestor, the diversity of species with these characters

126 viz. presence of leaves, tuber and succulent stems is void. Based on the present molecular data, it can be hypothesized that Frerea is a modern genus within the

Stapeliads with great level of genomic plasticity. To conﬁrm the exact position of this genus several other genes must also be sequenced. It would be fruitful to study the evolution of functional genes especially those responsible for leaf development among Frerea and its relatives. Biogeographically Frerea must be neoendemic in its present location in Maharashtra state in India. Considering that the origin of Caralluma s.l. is in Eastern Africa (Meve, 1997), the ancestor of Frerea might have moved eastwards via the dry regions to India. The phenotypic plasticity of Frerea indica can explain this phenomenon.

127 Chapter 6

Molecular systematics of Apocynaceae s.l. based on rbcL sequences

6.1 Introduction

Though several molecular phylogenetics works have be reported on Apocynaceae s.l. (Sennblad and Bremer, 1996; Civeyrel et al., 1998; Potgieter and Albert, 2001; Sennblad and Bremer, 2002), the sampling of taxa from Indian geographical region was sparse. The tribes Marsdenieae and Ceropegieae were under-represented. The focus of the past research was on the subtribal level of Apocynoideae. Moreover, in

Marsdenieae, there exist problems in resolution of some genera and the relationship between Marsdenieae and Ceropegieae remains unclear (Endress and Stevens, 2001). In the present study many more samples from Ceropegieae and Marsdenieae and also Asclepiadeae were taken and the phylogeny was resolved using rbcL gene. Some of the new taxa from a recent largescale biodiversity study by Forest et al. (2007) was also taken into account.

128 6.2 Materials and Methods

6.2.1 Plant material

Forty six species of ingroup taxa (Asclepiadoideae, Periplocoideae and Secamonoideae) were collected from various parts of India and Hong Kong. The voucher specimens are available in the herbarium of Shivaji University, Kolhapur, India and live plants are available in situ in Hong Kong. The names of plants used in this study, their location, voucher information and Genbank accession numbers are listed in Table 6.2. Sequences taken from Genbank database are listed in Table 6.3

6.2.2 DNA extraction, PCR ampliﬁcation and Sequencing

DNA extraction was the same as described in Section 4.2.2. The rbcL region was amplified using primers rbcL1F and rbcL1390R (Table 6.1). rbcL1F is a forward primer that corresponds to the first 20 base pairs of the rbcL exon and rbcL1390R is the reverse primer corresponding to the 24 nucleotides on the complementary strand from the 1390th position in reverse direction. The amplified product was about 1.4 kbp in length. For sequencing internal primers rbcL700F and rbcL800R were used. rbcL700F corresponds to nucleotides from 686 to 713 in the rbcL gene. rbcL800R corresponds to nucleotides between 791 and 812 in the complementary strand of rbcL gene. PCR amplifications and sequencing were similar to the information given in section 4.2.3.

Table 6.1: Primers for ampliﬁcation of rbcL region

Primer name Sequence rbcL1F ATG TCA CCA CAA ACA GAG AC rbcL700F CAT TAC TTG AAT GCT ACT GCA GGT AC rbcL800R AGC TCG TAT TTG CAG TGA ATC C rbcL1390R CTT TCC ATA CTT CAC AAG CAG CAG

129 6.2.3 Phylogenetic analyses

Sequence alignments were made using ClustalW (Thompson et al., 1994) and edited with the BioEdit package (Hall, 1999). Some nucleotides in the beginning and the end of the rbcL exon were trimmed to obtain of matrix of uniform length. After trim- ming the there were 1266 base pairs which where in frame with protein translation starting from the 40th base to 1306th base of the rbcL gene. Phylogenetic analyses were performed using PAUP v4.0beta10 (Swofford, 2002), MrBayes (Ronquist and Huelsenbeck, 2003) and Garli (Zwickl, 2006). The best model of evolution for each reading frame was selected using MrModeltest (Nylander, 2004). The dataset was partitioned into first, second and third codon positions, which were subjected to model selection according to Fernández et al. (2006). General time reversible (GTR) model (Tavare, 1986) was obtained for the dataset. GTR+I+G, GTR+I+G and GTR+G were the best models for the first, second and third reading frames respectively according to the Akaike information criterion (AIC). Bayesian posterior probabilities for the branches were calculated with a Metropolis-coupled Markov chain Monte Carlo (MCMCMC3) sampling method as implemented in the program MrBayes, v3.1.2. Two million repetitions, incorporating the obtained models were run, sampling every 100, resulting in 20000 trees and the first 20% considered as the burnin phase and eliminated. A majority rule consensus tree with the remaining 16000 trees was computed with the SUMT command in MrBayes. The resulting posterior probability support values for bipartitions were considered significant at ≥ 95%. Maximum-likelihood analysis was performed using Garli v0.95 implement- ing the GTR+I+G model. ML bootstrap (Davis et al., 2007) was obtained from 1000 ML nonparametric bootstrap replicates using Garliv0.95 according to Kronauer et al. (2007). The bootstrap replicates were used to calculate a majority rule consensus tree in PAUP. Bootstrap frequencies above 50% are indicated at the nodes.

The trees were visualized using Treeview v1.6.6 (Page, 2001)

130 6.3 Results

The rbcL dataset comprised of 93 taxa with 1266 base pair length, with 959 characters constant. Of the 307 variable characters 191 characters were parsimony informative (nearly 10%). Since the dataset has numerous taxa, a parsimony based heuristic search would be time consuming and computationally intensive. Therefore a ML search was performed. With programs like Garli which implements the same algorithm as PAUP and can run faster, bootstrapping of ML trees can also be performed (Zwickl, 2006). The maximum likelihood tree obtained using the GTR+I+G model is shown in Figure 6.1. The branches with signiﬁcant (≥ 0.95) Bayesian posterior probability (BPP) are thickened and sequences sequenced in this study are indicated in purple, whereas published sequences from Genbank are in black. ML bootstrap support (BS) (≥ 50%) is shown above the branches. Holarrhena pubescens which belongs to the Apocynoideae were used as the outgroup. The ML tree shows that the subfamilies Periplocoideae, Secamonoideae and As- clepiadoideae appear in separate clades. Periplocoideae is basal to Secamonoideae and Secamonoideae is basal to Asclepiadoideae (Fig. 6.1). The basal portion of the tree is shown in Fig. 6.1. The Secamonoideae taxa are not well resolved. The Asclepiadoideae clade shows the four tribes Fockeeae, Asclepiadeae, Marsdenieae and Ceropegieae (Fig. 6.1). The subfamilial clades, Periplocoideae and Asclepi- adoideae are well supported by high BPP and fairly good bootstrap support (BS = 75% and 54% respectively for Periplocoideae and Asclepiadoideae). The taxa of the tribe Asclepiadeae are paraphyletic (Figs. 6.1, 6.2) whereas tribes Marsdenieae and Ceropegieae are monophyletic with high BPP and fair BS (Fig. 6.3). Marsdenieae and Ceropegieae are sister to the Asclepiadeae (Fig. 6.1).

131 Figure 6.1: Maximum likelihood tree of rbcL sequences. Branches with ≥ 0.95 Bayesian support are thickened. Bootstrap values (≥50%) are shown above the branches. Sequences from this study are indicated in purple.

132 Figure 6.2: Portion of the rbcL ML tree showing tribe Asclepiadeae. Branches with ≥ 0.95 Bayesian support are thickened. Bootstrap values (≥ 50%) are shown above the branches. Sequences from this study are shown in purple. Subtribes are indicated with parenthesis

133 Figure 6.3: Portion of the rbcL ML tree showing tribes Marsdenieae and Ceropegieae. Branches with ≥ 0.95 Bayesian support are thickened. Bootstrap values (≥ 50%) are shown above the branches. Sequences from this study are shown in purple

134 (a) Periploca graeca (b) Fockea edulis

(e) Hoya bella (f) Stapelia variegata

Figure 6.4: Flowers of Asclepiadoideae s.l. (Photo credits in appendix 3) 135 6.4 Discussion

6.4.1 Subtribe Baisseinae is a derived group of Apocynaceae

within the Asclepiadoideae

The subfamilies and tribes of Asclepiadoideae are well resolved in this study. Periplo- coideae forms a well supported clade (Fig. 6.1) at the basal position. Baissea, a genus belonging to Apocynoideae (tribe Apocyneae sensu Endress and Bruyns (2000)) falls intermediate between the Periplocoideae and Secamonoideae. The result is consistent with the ﬁndings of Sennblad and Bremer (2002) whose rbcL sequences were included in this study. The same position was occupied by Baissea in the study by trnL and trnL-F based study by Potgieter and Albert (2001). This has been recently reinforced by two more studies (Lahaye et al., 2007; Livshultz et al., 2007). In their study a clade comprising of Baissea, Oncinotis and Motandra was observed intermediate between Periplocoideae and Secamonoideae. Baissea, Oncinotis and Motandra was considered as a subtribe Baisseinae of Apocyneae by De Kruif

(1983) and now recognized at the tribal level (Lahaye et al., 2007). This tribe is a derived group of Apocynaceae which is found between Secamonoideae and Periplo- coideae and but not morphologically similar to Secamonoideae or Asclepiadoideae (Lahaye et al., 2007).

6.4.2 The position of Periplocoideae

In this study Periplocoideae members form a well-supported separate clade (BS=75%) basal to the Secamonoideae and Asclepiadoideae. With regard to pollinial morphology Ionta and Judd (2007) have identiﬁed the following: Asian pollinial genera and grooved translator genera. In their study the Asian pollinial clade was nested within the grooved translator clade. Many of the taxa such as Hemidesmus, Gymnanthera and Decalepis used in this study come under the asian pollinial clade. Grouping such as pollinial or grooved translator could not be identiﬁed in the present study. Moverover Hemidesmus indicus is found closely related to Pentopetia sp. a Mada-

136 gascan endemic genus with good statistical support (Fig.6.1). Similarly, in this study Gymnanthera and Periploca were grouped together, though without signiﬁcant support. Gymanthera has pollinia and grooved translators whereas Periploca (Fig. 6.4(a)) lacks them. This discrepancy could result from the diﬀerence in molecular markers used, because Ionta and Judd (2007) used chloroplast non-coding regions trnT-F, trnD-T and nuclear ITS regions. However, Mondia and Tacazzea were found to be closely related (90% bootstrap support) in the current analysis as well as in Ionta and Judd (2007).

6.4.3 The position of Secamonoideae

The position of Secamonoideae seems to be polyphyletic in the present analysis (Fig. 6.1). The number of Secamonoideae taxa is quite low due to unavailability of specimens. The infra-subfamilial relationships of Secamonoideae were reported by the recent work of Lahaye et al. (2007). In their study, the largest genus of the subfamily Secamone was found to be polyphyletic whereas small genera such as Pervillaea and Secamonopsis were monophyletic. Secamone has about 90 species mainly occurring in Madagascar and Mascarene Islands (Klackenberg, 1992b) and also in Africa, Asia and Australia (Klackenberg, 1992a). Toxocarpus occurs in Asia with about 50 species (Lahaye et al., 2007). Genianthus also occurs in Asia with 16 species (Klackenberg, 1995). The four other genera namely Pervillaea, Secamonop- sis, Calytranthera and Trichosandra are restricted to Madagascar and Mascarene islands with about 10 species each (Lahaye et al., 2007). The study of Lahaye et al. (2007) has focussed on three genera only, Secamone, Secamonopsis and Pervillaea. Moreover their choice of taxa has been mostly from Madagascar and not other species from Asia and Africa. To further resolve the phylogenetic biogeography of

Secamonoideae further sampling is necessary (Lahaye et al., 2007).

137 6.4.4 Basal taxa of the tribe Asclepiadeae

Fockea forms the basalmost clade of the Asclepiadoideae representing the tribe Fock- eeae. Fockea (Fig. 6.4(b)) has six species from tropical and southern Africa whereas the only other genus in the tribe, Cibirhiza, has two species, one in Oman and the other in Tanzania and Zambia. Kunze et al. (1994) gave a subtribal rank to the group whereas Endress and Bruyns (2000) included Fockea and Cibirhiza in Mars- denieae. The two important features that characterize Fockeeae are 1) gynostegial corona fused into an undulate annulus around the gynostegium and 2) absence of true caudicles in the pollinaria (Verhoeven et al., 2003). The tribal position of

Fockeeae was supported by morphological cladistics and trnT-L, trnL and trnL-F sequences Verhoeven et al. (2003). Similar result was obtained by Sennblad and Bremer (2002) based on rbcL sequences. Eustegia is a small genus with nine species endemic to south-western Africa.

It is peculiar in having 3 series of corona-lobes instead of the usual 1 or 2 series. This feature is shared only with a related monotypic genus Emiocarpus (Bruyns, 1999c). Eustegia forms a basal clade the tribe Asclepiadeae. Due to its peculiar morphological characters (Bruyns, 1999c) and isolated phylogenetic position (Liede (2001) and this study), Eustegia and Emiocarpus can be placed under a separate tribe “Eustegieae”.

6.4.5 Position of the subtribes of Asclepiadeae

The tribe Asclepiadeae is shown paraphyletic in the present study. The present study included only a few new world species (new world genera indicated by blue colour in Fig. 6.2). I attempted to test the subtribal groupings using rbcL dataset in reference to Liede’s (1997) circumscription of subtribes of Asclepiadeae. There are 6 subtribes (Liede, 1997), 1) Asclepiadinae 2) Astephaninae 3) Glossonematinae 4) Gonolobinae 5) Metastelmatinae and 6) Oxypetalinae. Of these, Gonolobinae and Oxypetalinae are new world subtribes, Glossonematinae and Astephaninae are old world subtribes, whereas Asclepiadinae and Metastelmatinae are cosmopolitan. Liede (1997)

138 described new “synapomorphies” in order to deﬁne the subtribes erected by Schu- mann (1895). These synapomorphies were seriously criticized by Bruyns (1999a).

Later, Liede published a revision of the subtribes using plastid trnT-L, trnL-F spacers and trnL intron (Liede, 2001). In the revision some rearrangements were made in Metastelmatinae and Astephaninae and one more subtribe, ‘Tylophorinae’ was erected, removing Tylophora and its allies from Astephaninae. Fig. 6.2 shows the subtribes in the rbcL tree from the present study. Representatives of Glossonematinae and Oxypetalinae were not used in the present study because of unavailability of specimens. In Liede’s (2001) revision, Eustegia was moved from Astephaninae to Metastelmatinae but the reasons for the transfer are not described. Molecularly, Eustegia is a diverse genus (as shown both in the present study and in Liede (2001)), hence it might be considered as a relic of a once more widespread and diverse group of Asclepiadoideae (Liede, 2001). The clade consisting of Astephanus, Microloma and Oncinema is the basal most group of the tribe Asclepiadeae with good support (BS=89%). This clade belongs to the subtribe Astephaninae in accordance with Liede (2001). The Astephaninae is distributed in the southern Africa also with Eustegia and considering them as relics of an old radiation, it can be speculated that the orgin of Asclepiadoideae probably lies in the southern African area (Liede, 2001).

The Indian monotypic endemic Seshagiria sahyadrica was placed in Astephani- nae based on the ‘assumption’ of clear latex (Liede, 1997). Bruyns (1999a) strongly criticized this assumption stating that the latex is actually milky. Still the subtribal position of Seshagiria is unclear, but based on the molecular evidence, it is closely related to Cosmostigma with good support, therefore Seshagiria may be considered belonging to Metastelmatinae. The description of the subtribes are not robust in Liede’s (1997) work (Bruyns, 1999a), therefore it could not be used to ﬁnd the position of Seshagiria. However, the close genetic aﬃnity of Cosmostigma and Seshagiria needs to be studied using morphological characters.

The subtribe Tylophorinae of Liede (2001) is well supported in the present analy-

139 sis with Tylophora, Vincetoxicum and Pentatropis. Similarly a well supported clade (BS=86%) consisting of Aspidoglossum, Xysmalobium, Gomphocarpus, Asclepias,

Calotropis (Fig. 6.4(d)), Holostemma, Pergularia and Oxystelma corresponds to subtribe Asclepiadinae. But the occurence of Holostemma and Oxystelma which belong to Metastelmatinae sensu. Liede (1997) is a discrepancy which needs to be addressed by further morphological study.

Overall, the molecular phylogenetic groupings seems to agree with Liede’s (1997) classiﬁcation of the subtribes. A recent study by Godyer et al. (2007) discusses the phylogenetic relationships within the subtribe Asclepiadinae in detail. The subtribes Asclepiadinae, Tylophorinae, Metastelmatinae, Gonolobinae and Astephan- inae could be recognised from the study. But future study should also include representatives of Glossonematinae and Oxypetalinae to give a better molecular phylogenetic picture of the tribe Asclepiadeae.

6.4.6 Position of Marsdenieae and Ceropegieae

The Marsdenieae and Ceropegia form monophyletic clades in the present study. Marsdenieae shows two well supported clades, one clade comprises of Hoya (Fig.

6.4(e)) and its relatives which account for a monophyletic Hoya according to Wan- ntorp et al. (2006). Subtribal classiﬁcation of Ceropegieae was proposed by Meve and Liede (2004). Similar grouping of the taxa are observed in the rbcL based tree also, though the number of taxa used from subtribes Heterostemminae, Leptadeni- inae and Anisotominae are few. The Stapeliinae forms a monophyletic clade within Ceropegia, Brachystelma and other Stapeliads. Within this clade, the stem succulent ‘Stapeliads’ e.g. Caralluma, Stapelia (Fig. 6.4(f)) and Quaqua form a monophyletic branch whereas Brachystelma and Ceropegia are paraphyletic. This observation is consistent with cpDNA introns dataset in Chapter 4 on the genus Ceropegia. The same observation is also reported in Meve and Liede (2004) and more recently in Meve and Liede-Schumann (2007). In summary, the present work includes many taxa not previously studied by

140 Sennblad and Bremer (2002). The topology of the tree is in accordance with several recent works. The improved sampling of taxa has improved the resolution of the clades especially in subfamily Asclepiadoideae. Due to unavailability of specimens, Secamonoideae could not be well resolved. However, recent papers have addressed these issues to some extent (Livshultz et al., 2007; Lahaye et al., 2007) . Yet, there remains more work to be done, especially at the subtribal levels of Asclepiadeae which is a very big tribe.

141 Table 6.2: Asclepiadoideae species used in the study

Species Voucher specimen Genbank accession Bidaria khandalense Kamble1120 EU232692 Brachystelma edule Kamble1134 EU196252 Brachystelma naoroji Kamble1172 EU196253 Calotropis gigantea Kamble1125 EU196254 Calotropis procera Kamble1136 EU196255 Caralluma adscendens var. attenuata Kamble1193 EU196256 Caralluma burchardii Canary Islands (in situ) EU196257 Caralluma indica Kamble2131 EU196258 Caralluma umbellata SKU27964 EU196259 Ceropegia bulbosa var. bulbosa Kamble2118 EU196260 Ceropegia dichotoma Canary Islands (in situ) EU196261 Ceropegia elegans SKU27679 EU196262 Ceropegia intermedia SKU27466 EU196263 Ceropegia juncea Kamble2135 EU196264 Ceropegia lawii Kamble2126 EU196265 Ceropegia media Kamble2151 EU196266 Ceropegia sahyadrica Kamble2148 EU196267 Cosmostigma racemosa Kamble1128 EU196268 Cryptostegia grandiﬂora Kamble1123 EU196269 Cynanchum callialatum Kamble1138 EU196270 Cynanchum tunicatum Kamble1155 EU196271 Decalepis hamiltonii Kamble1121 EU196272 Dischidia chinensis Hong Kong (in situ) EU196273 Frerea indica Kamble1113 EU196274 Graphistemma pictum Hong Kong (in situ) EU196275 Gymnanthera oblonga Hong Kong (in situ) EU196276 Hemidesmus indicus Kamble1122 EU196277 Heterostemma tanjorense Kamble1130 EU196278 Hoya carnosa Hong Kong (in situ) EU196279 Hoya retusa Kamble1160 EU196280 Hoya wightii Kamble1162 EU196281 Leptadenia reticulata Kamble2167 EU196282 Marsdenia tenacissma Kamble1145 EU196283 Oxystelma esculentum Kamble1143 EU196284 Pentatropis nivalis Kamble1178 EU196285 Pergularia daemia Kamble1153 EU196286 Sarcostemma brevistigma Kamble1182 EU196287 Sarcostemma intermedium Kamble1185 EU196288 Sarcostemma vimenale Kamble1154 EU196289 Secamone emetica Kamble1150 EU196290 Seshagiria sahayadrica Kamble2122 EU196291 Toxocarpus wightianus Hong Kong (in situ) EU196292 Tylophora dalzellii Kamble1148 EU196293 Tylophora ovata Hong Kong (in situ) EU196294 Tylophora rotundifolia Kamble1129 EU196295 Wattaka volubilis Kamble1141 EU196296 Wattakaka lanceolata Kamble1139 EU196297

142 Table 6.3: Asclepiadoideae species used in the study from Genbank

Species Genbank accession Reference Astephanus marginatus AM234831 Forestetal.(2007) Anisotoma cordifolia AM234829 Forestetal.(2007) Araujia hortorum AJ419734 SennbladandBremer(2002) Asclepias curassavica X91774 Sennblad and Bremer (1996) Asclepias exaltata L14390 Olmsteadetal.(1993) Asclepias incarnata DQ006053 Kressetal.(2005) Aspidoglossum AM234830 Forestetal.(2007) heterophyllum Brachystelma luteum AM234832 Forestetal.(2007) Ceropegia woodii X91775 Sennblad and Bremer (1996) Cibirhiza albersiana AJ419741 SennbladandBremer(2002) Cynanchum laeve DQ006054 Kressetal.(2005) Eustegia minuta AM234833 Forestetal.(2007) Fischeria stellata AJ419744 SennbladandBremer(2002) Fockea capensis AM234834 Forestetal.(2007) Gomphocarpus cancellatus AM234835 Forestetal.(2007) Hoya bella X91776 Sennblad and Bremer (1996) Matelea hirsuta AJ419747 SennbladandBremer(2002) Micholitzia obcordata AJ419750 SennbladandBremer(2002) Microloma tenuifolium AM234837 Forestetal.(2007) Mondia ecornuta AJ419751 SennbladandBremer(2002) Oncinema lineare AM234838 Forestetal.(2007) Orthosia serpyllifolia AJ419753 SennbladandBremer(2002) Parquetina nigrescens X91777 Sennblad and Bremer (1996) Pentopetia spSB2001 AJ419755 SennbladandBremer(2002) Periploca graeca AJ002889 SennbladandBremer(2002) Petopentia natalensis AJ419756 SennbladandBremer(2002) Quaqua mammillaris AM234840 Forestetal.(2007) Riocreuxia torulosa AM234841 Forestetal.(2007) Schizostephanus alatus AJ419758 SennbladandBremer(2002) Secamone afzelii X91779 Sennblad and Bremer (1996) Secamone geayi AJ419761 SennbladandBremer(2002) Stapelia leendertziae X91778 Sennblad and Bremer (1996) Tacazzea apiculata AJ419764 SennbladandBremer(2002) Tylophora sylvatica X91780 Sennblad and Bremer (1996) Tweedia coerulea AJ419765 SennbladandBremer(2002) Vincetoxicum hirundinaria AJ419769 SennbladandBremer(2002) Xysmalobium undulatum AM234842 Forestetal.(2007)

143 Chapter 7

Conclusions

The present research work has provided valuable information on the antioxidant capacities of Indian medicinal plants especially in the subfamilies Asclepiadoideae and Periplocoideae. Though a large scale study of 112 Chinese medicinal plants related to anticancer has been performed (Cai et al., 2004), no such work has been previously reported for Indian medicinal plants. The major conclusions from the antioxidant activity screening study are: 1) The highest antioxidant activity among 133 Indian medicinal plant species studied was found in the fruits of Terminalia chebula followed by the gum of Aca- cia catechu, pericarps of Punica granatum, the galls of Rhus succedanea, seeds of Mangifera indica, bark of Myrica nagi, fruits of Terminalia bellirica and leaves and ﬂowers of Cassia auriculata.

2) There is a high correlation between antioxidant activity and total phenol content suggesting that phenolic compounds are responsible for high antioxidant capacities of these medicinal plants. 3) Highest antioxidant activity is usually seen in roots, barks, seeds, gum or galls, whereas leaves and ﬂowers show only moderate to low antioxidant activity. The barks, galls etc., are high in antioxidants because they possess high levels of tannins. 4) About 62% of the samples showed fairly high amount (> 4 mmol TEAC/100 g DW by ABTS assay) of antioxidant activity. About 70% of the samples had phenolic

144 acids and 53% had ﬂavonoids. The samples with the highest antioxidant capacities had very high levels of hydrolysable tannins and gallic acid.

5) Several new compounds were identiﬁed in some species (e.g., Anacyclus pyrethrum, Euphorbia lathyrus, Ipomoea turpethum, Picrorrhiza kurroa, Hygrophila auriculata, Bombax malabaricum and Plumbago rosea) in this study. New phenolic compounds were also found in this study, the structure of which must be further resolved using

NMR. 6) In the study of antioxidant capacities within Asclepiadoideae and Periplo- coideae, the leaves of Decalepis hamiltonii showed the highest value followed by leaves and roots of Hemidesmus indicus. Sarcostemma brevistigma showed the highest xanthine oxidase inhibition and roots of Hemidesmus indicus showed the highest hydroxyl radical scavenging activity. 7) Chlorogenic acid and rutin were identified in all samples of Asclepiadoideae and Periplocoideae. Some phenolic compounds tentatively identified as hydroxybenzoic acids were identified for the first time in five species studied. Further classification of these compounds should be done using NMR. The molecular phylogenetic study of family Apocynaceae s.l and also the genera Ceropegia and Caralluma yielded several interesting results. The major results are as follows:

1) The Ceropegia species of Western Ghats show two major clades on the bases of leaf morphology and peduncle length. Clade I has species with broad leaves and long peduncles, whereas Clade II has species with narrow leaves and short peduncles. Furthermore the phylogenetic clustering within the two clades is in accordance with

ﬂoral morphology of elongated linear corolla lobes or hooded corolla lobes. 2) Ceropegia is polyphyletic and the Indian species of Brachystelma are nested within a clade of Ceropegia. 3) Ceropegia juncea sequences (both ITS and cpDNA) are highly divergent from the rest of the Ceropegia studied and similar to an African species, and this suggests its recent migration into its present locations.

145 4) The close genetic affinity within the Western Ghats Ceropegia suggests that they are neoendemics to this region and have rapidly radiated in their present location. 5) Molecular data from this study shows that the widespread species Ceropegia bulbosa may be a hybrid between an African migrant and an Indian species. 6) In the study of Indian species of Caralluma and Boucerosia, these two genera appear in distinct clades supporting the recent morphological revision of the group. 7) The Indian Caralluma species show affinity to the African Caralluma subulata based on ITS data. Similarly, the monotypic, leafy genus Frerea shows affinity to the Boucerosia clade. 8) Based on rbcL data of Apocynaceae s.l., the subfamilies, Asclepiadoideae and Periplocoideae are well resolved in this study. The tribes within Asclepi- adoideae, Asclepiadeae, Marsdenieae and Ceropegieae, are also resolved. Ascle- piadeae is paraphyletic whereas Marsdenieae and Ceropegieae are monophyletic. Tribes Ceropegieae and Marsdenieae are sister to each other.

9) A subtribal classiﬁcation within Asclepiadeae is suggested by this study and some genera need rearrangement based on the present data. The monotypic Sesha- giriya should be placed under Metastelmatinae rather than Astephaninae. 10) The Stapeliad clade is monophyletic within the tribe Ceropegieae whereas

Ceropegia and Brachystelma are paraphyletic, similarly found in previous results with ITS and cpDNA intron data. The present work deals with the antioxidant capacities and molecular phylogeny within some groups of Asclepiadoideae s.l. Future work in these lines should focus on isolation and characterization of the new antioxidant compounds in this group and also the molecular phylogeny of the subtribes of Asclepiadeae.

146 Appendix 1

Descriptions of Western Ghats Ceropegia used in this study

Source : Kamble (2007)

Identification key

1. Erect herbs: 2. Leaves linear-lanceolate, acute at base: 3. Herbs 15-50 cm tall; corolla more than 3 cm long ...... C. attenuata 3. Herbs up to 10 cm tall; corolla less than 3 cm long ...... C. jainii 2. Leaves ovate-cordate at base: 4. Corolla more than 5 cm long; tube broad with largely inflated base . . . C. sahyadrica 4. Corolla less than 3 cm long; tube narrow with slightly inflated base . . . C. lawii 1. Twining herbs: 5. Calyx segments shorter than the corolla: 6. Leaves membranous: 7. Corolla lobes shorter than tube: 8. Corolla tube funnel shaped above: 9. Stem and corolla glabrous; inner corona not hooked at tip . . . C. oculata 9. Stem hirsute; corolla hairy; inner corona hooked at tip . . . C. hirsuta 8. Corolla tube subcylindric, hardly dilated above . . . C. evansii 7. Corolla lobes equal or longer than tube: 10. Corolla lobes subcylindric, hardly dilated above. . . C. huberi 10. Corolla lobes funnel shaped above . . . C. vincaefolia 6. Leaves fleshy: 11. Leaves subsessile, narrowly linear acuminate ..C. bulbosa var. lushii 11. Leaves petiolate, the lowest almost orbicular, the upper ones elliptic-oblong or obovate, usually apiculate .. C. bulbosa var. bulbosa 5. Calyx segments longer than the corolla . . . C. fantastica

147 Ceropegia anantii Yadav et al.

Herbs, erect, tuberous; tubers 2-3 cm in diameter, depressed, roots fibrous. Stem sparingly hairy, terete, usually unbranched, 15-40 cm in height, 1-2 mm in diameter. Leaves opposite, subsessile, minutely puberulous, linear, 4-8 x 0.3-0.5 cm, acute at apex, tapering at base, scabrous on upper surface, glabrous on lower surface except the midrib, margins minutely hairy. Flowers solitary, axillary or extra axillary; pedicel 4-6 x 0.6-0.8 mm, pubescent; bracts solitary, attached a little above the middle of pedicel, linear, 2.3-2.6 x 0.3-0.4 mm, acute. Sepals 5-7 x 0.7-0.8 mm, linear, subacute, pubescent. Corolla 4-6.5 cm long, straight, greenish yellow; corolla tube 1-2.5 cm long, abruptly dilated at the base, glabrous, greenish outside, the lower inflated portion dark purple in throat and striated with purple lines in lower portion; corolla lobes up to 1.3-3.5 cm long, connate at tips, forming a long beak, greenish-white, pubescent inside, each lobe with dark spot on either side in basal part of corolla lobe. Gynostegial corona cupular, consisting of 5 deeply bifid lobes, densely ciliate on the margins; staminal corona of 5 linear lobes, connivent, erect, 4-5 mm long. Pollen masses yellow, attached to the brown pollen carriers by short caudicles, each pollinarium 0.3-0.35 x 0.2-0.25 mm. Follicles single or double, up to 6-7 x 0.2-0.25 cm, straight, tapering to a fine point, erect. Seeds 4 x 1.5 mm, ovate, oblong; coma 1-1.5 cm long, white, silky.

Fl.: August-September Fr.: September-November. Distribution: Restricted to ﬂat tops of Salva Hills in Sindhudurg district. Locality: Sindhudurg (Salva Hills) Status: Endemic to Maharashtra, Rare Vernacular/Local Name: Ghayal Note: New Species so far known only from Type locality

Ceropegia attenuata Hook.

Herbs, erect, tuberous, 14-30 cm in height; tubers 1.5-2 x 2-3 cm, globose, ovoid or depressed; stem more or less pubescent when young, glabrous when mature, usually 1 from each tuber, unbranched, terete. Leaves subsessile, 5-14 x 0.8-1 cm, linear, acute, narrowed at base, the young more or less pubescent, midrib prominent. Flowers usually solitary at the apex of pubescent pedicel; pedicel 0.6-1 cm long which arises from between the petioles; bracts subulate, 1-3 mm long; sepals 6- 7 mm long, pubescent, subulate, divided to base; corolla 4-9 cm long, straight, erect; tube 3-5 cm long, cylindric, slightly inﬂated at base, closely striately veined, greenish-yellow, corolla lobes 3-4 cm long, deltoid for 0.5 cm, then narrowly linear, united at tips, yellowish-green to reddish-yellow; corona biseriate, outer corona lobes deltoid-oblong, deeply biﬁd, the segments very acute, ciliate with long hairs, inner

148 corona lobes linear, erect to divergent. Pollinia ﬁve, pollen masses solitary in each anther cell, yellow, waxy with pellucid layer, attached by light-brown caudicles to dark-brown corpuscle. Follicles in pairs, 6-7 cm long, straight or slightly curved, tapering into a ﬁne point; seeds 3.7 x 2.2 mm, ovoid, oblong with thick margin, coma 1-1.5 cm long.

Fl.: May-August Fr.: August-October. Distribution: Kolhapur, Mumbai, Pune, Raigad, Ratnagiri, Sindhudurg, Thane. Localities: Kolhapur (Katyayani), Sindhudurg (Amboli). Status: Endemic to Goa, Karnataka, Rajasthan, Maharashtra & Vulnerable. Vernacular/Local Name: Tilori, Kaper halda. Economic Importance: The tubers are edible. Flowers are long and of ornamental value. Note: Found throughout shrubby open forest of Konkan, It grows in crevices of lateritic rocks in hilly tract. It grows at lower altitude ranging between sea-level to 700 meter and found on western side of Western Ghats. Home Gardens and Botanical Gardens could be good conservatoires for the species. It grows in crevices of lateritic rocks, soils accumulated on these rocks taking shelter of other bushes and shrubs. It shows great variations in length of ﬂower ranging from 4-9 cm. The species shows good fruit formation and seed setting. It grows in earthen pots and shows good fruit and seed setting both under cultivation as well as in wild. It shows great variation with reference to corolla length and corolla colour. Due to forest clearing, the populations of the species are decreasing day by day. Chr. No.: 2n= 22.

Ceropegia bulbosa Roxb. var. bulbosa Roxb.

Herbs, twining, tuberous;, tubers 7-8 x 3-4 cm, globose, ovoid or depressed. Stem slender, glabrous, usually reddish in colour. Leaves subsessile to petiolate, orbicular, ovate, glabrous. Flowers in pedunculate umbellate cymes; peduncles 1-3 cm long arising between the petioles, pedicels short 3-6 mm long, slender. Bracts linear, 2-3 mm long. Calyx divided to the base, sepals 2-3 mm long, lanceolate, acute. Corolla 1.5-2.5 cm long, grayish purple; tube 1-1.7 cm long, inﬂated at base, narrowed in the middle, funnel-shaped above, violet purple and glabrous inside; lobes 5-8 mm long, linear above from ovate-deltoid base, hairy inside and along margins in linear part, connate at tips. Corona biseriate, outer corona saucer-shaped entire or broadly shallow; inner corona lobes narrowly linear, 2 mm long, slender, sickle-shaped or divergent. Pollinia ﬁve, pollen masses solitary in each anther cell, yellow, waxy 284- 296 x 196-200 µm, with pellucid layer, attached by light-brown caudicles 32-40 µm long, 28-36 µm wide to dark-brown corpuscle ca 92 µm long and ca 32 µm wide.

149 Follicles 8-10 cm long, cylindric, tapering towards an acute apex, glabrous. Seeds 8 x 3 mm long, ovate-oblong, ﬂattened with a broad sub-membranous margins, coma 2.5-3 cm long.

Fls.: July-September Frts.: September-October. Distribution: Akola, Aurangabad, Mumbai, Nanded, Kolhapur (Appachiwadi, Babu Jamal, Bahubali, Kagal, Katyayani, Ramling, Panhala), Pune, Raigad, Satara (Kas Kartikswami, Khatav, Saikade), Thane. Localities: Satara (Kartikswami), Status: Common Vernacular/Local Name: Galya, Kharpudi, Khartundi, Khapparkadu. Economic Importance: Both leaves and tubers are edible. Note: It is usually found amongst spiny and thorny bushes, which provide protection from grazing animals. The leaves are thick and sour in test during morning hours and tasteless during evening. Similarly, some of the insects (Diptera?) lay eggs on the leaves and the larvae feed on ﬂeshy parts of the plant. It is a hardy species and grows well in garden and earthen pots. It is a CAM plant (Gaikwad et al, 1989), which explains its wide distribution range in drier parts.

Ceropegia bulbosa Roxb. var. lushii (Grah.) Hook.f. Ceropegia bulbosa Roxb. var. lushii is similar to Ceropegia bulbosa Roxb. var. bulbosa in morphology except the leaves linear to lanceolate, subsessile.

Fls.: July-September. Frts.: September-October. Distribution: Aurangabad, Kolhapur-Babu Jamal, Bahubali, Kagal, Ramling, Pune, Satara-Kas, Kartikswami Pusegaon, Karad, Thane. Localities: Kolhapur (Ramling), Satara (Kartikswami, Pusegaon) Status: Rare Vernacular/Local Name: Khapparkadu Economic Importance: Note: Usually grows in association Ceropegia bulbosa Roxb. var. bulbosa Roxb.

Ceropegia evansii McCan. Herbs, twining, tuberous; tuber subglobose, 2-6 x 1-3 cm; stem slender, terete, unbranched, glabrous or sparingly pubescent. Leaves petiolate, membranous, 7-14 x 3-7 cm, lower leaves ovate or ovate-lanceolate, upper ones smaller, lanceolate, all acute or shortly acuminate, rounded or subcordate at base, hairy above and along the nerves beneath, at length glabrous, ciliolate on margin, dark green above, paler beneath; petiole 1.8 -2.2 cm long, puberulous, groove on upper side. Inﬂorescence few ﬂowered in lateral umbellate cymes; peduncles arising from between the petioles,

150 ca 4 cm long, terete, hispidulous; ﬂowers pedicellate, pedicel 1-1.2 cm long, terete, hispid, bract 3-5 mm long, linear-lanceolate, acute, glabrous; calyx lobes 8-10 mm long, lanceolate, acute, glabrous; corolla 3.5 cm long, curved, tube 2.6 cm long, inﬂated at base, glabrous, lower half purple within, grayish outside, upper half ash- coloured, striated with faint grayish lines, lobes ca 8 mm long, obovate-oblong, folded longitudinally on the back, connate at the tips, glabrous outside, puberulous inside, pale lemon yellow in upper part gradually passing into white below; outer corona cupular of 5 deltoid obtuse lobes, ciliate within and along the margins, yellow, inner corona lobes 2 mm long, linear, yellow tinged with red; pollen masses ellipsoid- oblong, attached by very short caudicles to the pollen carrier. Follicles up to 15 x 0.5 cm, tapering at both ends; seeds 7 x 3 mm, compressed; comose, coma ca 2 cm long.

Fls.: July-September. & Frts.: August-October. Distribution: Pune (Khandala, Lonavla and neighboring Sakarapathar and Am- bavane range), Ratnagiri (Ambaghat), Kolhapur (Amba, Patgaon, Tambyachiwadi). Localities: Ratnagiri (Ambaghat), Kolhapur (Amba) Status: Endemic to Maharashtra, Critically Endangered. Vernacular/Local Name: Economic Importance: Tubers are edible and has some food value. Note: It grows in low forests on slopes covered by Carvia callosa Bremek. It is found at Amba-ghat in Carvi on western slopes between 400- 800 altitude. Local people eat the tubers, and this may account for its rarity. It is diﬃcult to maintain in the home gardens.

Ceropegia fantastica Sedgwick

Herbs, twining, tuberous; tuber sub-spherical, ca 2.5 cm in diam.; stem cylindrical, glabrous, 2-3 mm in diam. Leaves, membranous, petiolate, lower leaves large, lanceolate-ovate, 2.5-10 x 0.5- 5 cm broad, margin ciliate, base rounded-cordate, apex caudate-acuminate, upper leaves small, cuneate at base. Inflorescence inter- petiolar umbellate cyme, few flowered; peduncle 1.5- 2.5 cm long, hirsute. Flowers pedicellate, pedicel 0.5-2.5 cm long, filiform, glabrous; bracts and bracteoles 0.5 - 2.0 cm long, linear; calyx 5-partite, calyx lobes linear, 1.5-3.5 cm long, exceeding corolla, flattened at base, 4-nerved; corolla 0.5- 2.5 cm long, dark purple externally with white longitudinal lines and spots in fresh flowers, turning pale-yellow on drying, 5-lobed at apex, corolla lobes ca 4 x 1 mm, tips connate at apex, pubescent inside, ciliate on margins; corona double, outer corona cupular, ca 4 x 2 mm, 5- lobed, each lobe bifid at apex, obtuse, inner corona of 5 linear lobes adnate to outer corona, lobes narrowly spathulate, ca 3 mm long, with globose appendage at base;

151 pollinia yellowish, pollen masses solitary in each anther cell, yellow, waxy with pellucid layer, attached by light-brown caudicles to dark-brown corpuscle. Gynoecium bicarpellary, style short, stigma pentangular. Follicles narrow, ca 9 x 0.3 cm, ash coloured; seeds 8 x 3 mm, comose, coma ca 2 cm long, copious. Fls.: July-August. Frts.: August-September. Distribution: Kolhapur, Sindhudurg. Localities: Kolhapur (Gavase), Sindhudurg (Amboli). Status: Endemic to Goa, Karnataka, Maharashtra, Endangered Vernacular/Local Name: Economic Importance: It has curious formed and beautifully variegated corolla of great ornamental value. Note: The species grows in open shrubby forest of South Konkan. It is extremely rare species and on the verge of extinction. It is very distinct from all other Cerope- gias of India in having calyx lobes longer than the corolla. As it is restricted to very small area, it needs immediate steps for its conservation. It grows well in home gardens. Ceropegia hirsuta Wight & Arn.

Herbs, twining, tuberous; tubers 2-4 x 2-3 cm, globose, ovoid or depressed. Stem up to 1 m long, generally unbranched, terete, hirsute with spreading hairs. Leaves petiolate; petioles 0.5-1.2 cm long, deeply grooved above, pilose with a gland on either side at the base; lamina membranous, 5-6 cm long and 3.5-3.8 cm near the base of the stem, reduced upwards; the lower leaves ovate, those above the middle of the stem ovate-lanceolate, those near the upper end of the stem lanceolate, all rounded at the base, acute at the apex, pilose on both side; lateral nerves 4-5 pairs. Flowers few, in lateral umbellate cymes, peduncles 1.5-2.5 cm long, terete, hirsute; bracts 4-6 mm long, linear-subulate, with long spreading hairs; pedicels 7-10 mm long, terete, hirsute. Calyx divided to the base, sepals 8.0-1 cm long, linear subulate, very acute, hirsute with rigid hairs. Corolla greenish, blotched with purple, 2.8-6.0 cm long; tube 2-4 cm long, depressed, inflated at base, funnel-shaped above, hairy in lower part by downwardly pointed hairs, lobes 0.8-2 cm long, broadly oblong or oblong-obovate, connate at tips hairy inside and along margins. Corona biseriate, outer corona cupular, of 5 bifid, hairy lobes; inner corona of 5 linear lobes, 3 mm long, hooked at the tip. Pollinia five, pollen masses oblong, solitary in each anther cell, yellow, waxy with pellucid layer, attached by light-brown caudicles to dark- brown corpuscle. Follicles in pair, 6-12 cm long, finely pointed, glabrous. Seeds 0.8 x 0.2 cm long, narrowly oblong, coma 2.5-3 cm long. Fls.: July-November. Frts.: September onwards. Distribution: Akola, Aurangabad, Kolhapur, Mumbai, Nanded, Nasik, Pune,

152 Ratnagiri, Satara, Localities: Kolhapur (Panhala), Satara (Yavateshwar). Status: Vulnerable Vernacular/Local Name: Haamana. Economic Importance: The tubers are edible. Note: It grows in and around bushes in hilly tracts. The ﬂowers show great variations in corolla size, colour and variegation pattern of corolla. The species shows wide ecological amplitude. The tubers are edible. The ﬂowers are elegant. It is a hardy species and grows well in home gardens and earthen pots. The species shows fairly good fruit formation and seed setting. Chr. No.: 2n= 22.

Ceropegia huberi Ansari Herbs, twining, tuberous; tuber up to 4.5 x 4.0 cm, sub-globose; stem branched, glabrous, terete. Leaves petiolate; petiole up to 3.5 cm long, glabrous, grooved; lower leaves ovate-acuminate, 12.0 x 4.8 cm, upper leaves lanceolate, acuminate, 5 x 1.5 cm; lamina membranous, margin ciliolate. Inflorescence a lateral sub-umbellate many flowered cyme; peduncles hirsute, up to 16 cm long; bract small, subulate, 2-3 mm long. Flowers white, pedicellate; pedicels pubescent, up to 1.7 cm long; calyx 5-partite, ca 3 mm long, lobes 2.5 mm long; corolla up to 1.2 cm long, straight, tube 5 mm long, obtusely angled, pale pinkish and minutely scabrid along the nerves outside, glabrous, pinkish purple with dark purple longitudinal lines inside, broader in the middle, lobes 7 x 10 mm, ovate, deeply cordate, broader than long, the sides joined in the upper 2/3 part forming a circular flattened, slightly inclined, head ca 1.7 cm in diam.; corona biseriate, outer corona cupular, 5-lobed, entire, glabrous, ca 0.7 mm long, inner of 5 elongated conical creamy yellow processes, lobes about 2 mm long, arising in between outer corona lobes, densely hairy on the dorsal side only, convergent, apices obtuse, opposite and incumbent on the anthers; Pollinia five, pollen masses solitary in each anther cell, yellow, waxy with pellucid layer, attached by light-brown caudicles to dark-brown corpuscle. Gynostegium 1.5-2.0 mm long. Follicles in pairs, ca 6 cm ling, tapering at both ends, glabrous; seeds many, ca 5 x 3 mm, ovate, oblong, prominently margined, comose, coma ca 10 mm long.

Fls.: July-September. Frts.: September-October. Distribution: Kolhapur, Ratnagiri, Satara, Pune. Localities: Kolhapur (Burki), Pune (Varanda ghat) Status: Endemic to Maharashtra & Endangered. Vernacular/Local Name: Kharpudi. Economic Importance: Tubers are edible. Note: This species in some respect is unique among all Indian species of the genus because of its reduced corolla tube copying the shape of various African species.

153 It is a very elegant and fascinating species for biologists. It is of botanical and phytogeographical interest. The species grows on steep slopes of Western Ghats amongst Tripogon jacquemontii Stapf. grass between an altitude of 400 t0 1200 meters. It usually spreads on the grass. It flowers profusely and has pure white flowers, which catch the attention even in misty and cloudy environment. It is a twiner with snow-white glistening flowers having flat topped curiously formed corolla. It grows well in garden. Larvae of some insects (Diptera?) feed on the leaves. Chr. No.: 2n= 22.

Ceropegia jainii Ansari & Kulkarni

Herbs, erect, tuberous; 5-10 cm in height; tubers subglobose or depressed, 3-5 x 2-4 cm; stem usually unbranched, cylindrical, 2-3 mm in diam. Leaves sub-sessile to petiolate; petioles 1-2 mm long, hairy; lower leaves elliptic, upper elliptic-linear, 2-5 x 0.5-1.0 cm, glabrous beneath except nerves, hirsute above. Flowers solitary, arising in between petioles; pedicels 4-6 mm long, hairy; bracts small, subulate, 1-2 mm long; calyx 5-partite, calyx lobes 2-2.5 mm long, glabrous, subulate; corolla reddish above, greenish or yellow below, up to 2 cm long, curved, tube 9-10 mm long, subcylindric, pale greenish inside with longitudinal purple lies, base inflated in lower half, glabrous inside and outside, lobes 9-10 mm long, purple or reddish, linear-oblong, glabrous outside, densely hairy inside at ovate-deltoid base, acute and connate at apex; corona biseriate; outer corona cupular of 5 deeply bifid, deltoid lobes, hairy along margins, inner corona of 5 linear sub-spathulate erect lobes. Pollinia five, pollen masses solitary in each anther cell, yellow, waxy with pellucid layer, attached by light-brown caudicle wide to dark-brown corpuscle. Gynostegium short.

Fls.: August-October Frts.: October- November. Distribution: Sindhudurg, Kolhapur, Satara. Localities: Satara (Kas) Status: Endemic to Maharashtra and Critically endangered. Vernacular/Local Name: Economic Importance: Tubers are edible. It is also of ornamental value for its curiously formed corolla. Note: It grows in open rocky places and crevices of lateritic plateaus of higher altitude (1200-1400 meters). in Western Ghats of Maharashtra. Destruction of tubers by local people is a threat for the species. Although the species shows profuse ﬂowering, fruit setting is very rare. It has curiously formed and beautifully coloured ﬂowers. The species fails to set fruits and seeds. It faces problems in sex- ual reproduction probably do to disappearance of the pollinators. As the species

154 is very speciﬁc in its ecological requirements, it is diﬃcult to maintain in gardens. Therefore, it needs in-situ conservation. Chr. No.: 2n= 22.

Ceropegia juncea Roxb.

Herbs, twining or prostrate, succulent tuberous; when prostrate rooting at nodes; tubers much reduced, small ca 1 cm in diam.; stem with distinct nodes and internodes, internodes 5-12 cm long, 3-5 mm in diam., thick, fleshy, green, glabrous. Leaves scale-like, glabrous, 0.5-1 x 0.2 mm or absent. Inflorescence few (2-3) flowered lateral umbellate cyme; peduncle 1.5- 2.5 cm long, stout, terete, glabrous. Flowers yellow blotched with purple, pedicellate; pedicel ca 0.5-0.8 cm long, glabrous; calyx 5-partite, calyx lobes 3-4 mm long, lanceolate, acute, glabrous; corolla 3.5-4.5 cm long, strikingly coloured yellow, blotched with purple, tube 2.5 cm long, inflated at base, funnel shaped above, curved at middle, variegated with purple dots outside, dark purple inside, hairy inside at base, corolla lobes linear, ca 2 cm long, greenish yellow, hairy within above, from deltoid base, connate at tip; corona biseriate, outer corona of 5-bidentate deltoid ciliate lobes, 4 mm in diam., inner corona of linear erect hooked lobes, ca 3.5 mm long. Pollinia five, pollen masses solitary in each anther cell, yellow, waxy with pellucid layer, attached by light-brown caudicles to dark-brown corpuscle. Gynostegium short. Follicles in pairs, 4-7 cm long, tapering at apex; seeds comose, coma ca 2 cm long.

Fls.: July-November. Frts.: September-October. Distribution: Satara, Sangali Localities: Sangali (Tasgaon) Status: Very rare, Endemic to Peninsular India. Vernacular/Local Name: Kanvel. Economic Importance: The species is succulent and produce strikingly yellow flowers blotched with purple of beautiful architecture. Ceropegia with Ornamental Potential. Note: It is an extremely rare in Maharashtra. It grows in rocky places along streams in dry region. The stem is succulent, photosynthetic and the leaves are reduced to scales. The species is adapted to extremely xeric conditions. Crassulacean acid metabolism is reported in the species (Gaikwad et. al. 1989). This is the only Indian Ceropegia species with reduced leaves or leaves are absent. Such type of Ceropegias with reduced leaves or without leaves and succulent stem are found in Africa. Similarly it is of botanical interest in understanding physiological and morphological adaptations in Ceropegias and their evolution and diversification. It is under cultivation in number of gardens for its curiously formed flowers and as a succulent. It performs very well under cultivation. The juice of the plant serves as tranquilliser. Chr. No. : 2n=66.

155 Ceropegia lawii Hook.f.

Herbs, erect, tuberous; tuber 5-12 cm in diam. Stems unbranched, terete, pubescent above. Leaves petiolate, petioles 0.7-1.2 cm long, deeply grooved on the upper side, pubescent with a gland on either side at the base in place of stipules; lamina 3.5-6 cm long and 1.5-3 cm broad, ovate acute or lanceolate acuminate, rounded at the base, hispidulous, ciliate on the margins, with numerous glands at the base of the midnerve on the upper side; lateral nerves 4-5 pairs. Flowers in lateral umbellate cymes umbels many-flowered; peduncles 1.2-2.8 cm long, arising from between the petioles of opposite leaves, terete, hispidulous, pinkish in colour; bracts 3-5 mm long and 1 mm broad, linear acute, glabrous. Corolla 3-3.5 cm long; tube 2.8 cm long, inside a ring of hairs at the bottom of inflated base; lobes 6-7 mm long, ovate-cordate, hairy or glabrous within. Corona biseriate, outer corona cupular of 10 obtuse lobes, hairy; inner linear, erect, 3-4 times as long as outer. Pollinia five, pollen masses solitary in each anther cell, yellow, waxy with pellucid layer, attached by light-brown caudicle to dark-brown corpuscle. Follicles in pairs, erect, up to 15 cm long and 0.5 cm broad, terete, lanceolate. Seeds 6 mm long, 3 mm broad, ovate-oblong, prominently margined; coma 1-2 cm long.

Fls.: August-September. Frts.: September onwards. Distribution: Ahmednagar, Kolhapur, Pune, Satara, Ratnagiri. Localities: Ahmednagar (Harischandragarh) Kolhapur (Gaganbavada), Pune- Sinhagad, Purandhar, Satara (Mahabaleshwar). Status: Endemic to Maharashtra & Endangered. Vernacular/Local Name: Kharpudi, Tilori. Economic Importance: The tubers are edible. Note: It is an erect species growing on steep slopes in inaccessible places of higher altitudes of about 1400 meters. It is closely allied to C. sahyadrica. Very few individuals are found in its places of occurrence. The major threat to the species is destruction of habitats and human interference. It is of botanical interest. It needs immediate focus for its survival and conservation.

Ceropegia maccannii Ansari

Herbs, erect, tuberous, 30-100 cm high; stems ﬁrm, terete, pubescent above. Leaves 9-12 x 4-6 cm, ovate to lanceolate, acute or acuminate, base mostly acute, sometimes rounded, hairy above glabrous beneath except nerves, petiole 1-2 cm long, hairy and grooved above. Flowers 6-10 in lateral umbellate cymes; peduncles up to 3.5 cm long, hirsute; bracts 3-4 mm long; pedicels 6-10 mm long, hairy. Calyx 4-5 mm long, hairy on the dorsal side. Corolla 1.7-2.3 cm long; tube 1.5-2 cm long, base largely inﬂated with a ring of hairs at the bottom within, above narrow, cylindrical;

156 lobes 2-3 x 2 mm, obovate, apex acute. Outer corona cupular, of 5 shortly biﬁd, hairy lobes; inner sub-spathulate hairy. Pollinia ﬁve, pollen masses solitary in each anther cell, yellow, waxy ca 259.2 x 144 µm, with pellucid layer, attached by light- brown caudicles ca 32 µm long, ca 60 µm wide to dark-brown corpuscle ca 129.6 µm long and ca 28.8 µm wide. Seeds small, comose.

Fls.: July-August. Frts.: September-October. Distribution: Ahmednagar, Pune Localities: Pune (Sinhagad hill, Purandhar) Status: Endemic to Maharashtra & Endangered. Vernacular/Local Name: Kharpudi. Economic Importance: Tubers are edible. Note: It is found growing on slopes of Sahyadris at an altitude from 600 to 1200 meters. Flowers are small, it has very narrow range of distribution and it could be eliminated in few decades if appropriate steps are not taken towards its conservation. Chr. No.: 2n= 22.

Ceropegia mahabalei Hemadri & Ansari

Herbs, erect, tuberous; 20-65 cm in height. Stem unbranched terete, hairy. Leaves 3-15 x 0.3-1 cm, opposite, sessile-subsessile, linear to linear-lanceolate, subsessile, hairy above. Inflorescence uniflowered cymes; peduncle 0.1-0.3 cm long, terete, hairy; bracts 0.5-1.5 cm long, subulate; pedicels 0.5-1 cm long, reaching up to 1.5 cm in fruit, hairy. Calyx 5-partite, lobes ca 2 cm long, dorsally hairy on the mid nerve. Corolla 5.5-10 cm long; straight or slightly curved; tube 3.5-6.5 cm long, base largely inflated externally pale green, brownish-purple above, base broadly inflated, conical-ovoid ellipsoid in outline, green with longitudinal purple lines inside the inflated part and brownish-purple above, base broadly inflated, conical-ovoid ellipsoid on outline, green with longitudinal purple lines inside the inflated part and brownish-purple above, glabrous within and without; lobes 1.75-3.5 cm long always shorter than the tube and folded lengthwise on the back forming a narrow beak, dark green with brownish-yellow patches at the base, inner surface clothed by minute hya- line hairs. Corona biseriate; outer corona cupular, lobes 5, bidentate, glabrous; inner linear, erect, non-divergent at apex, yellowish with purple base, glabrous. Pollinia 5, pollen masses erect, minute, yellow. Gynostegium ca 0.3 cm long. Follicles in pairs, ca 4 cm long, terete, narrow at apex, glabrous. Seeds many ca 0.5 x 0.25 cm, ovoid, flat, marginate; coma ca 0.6 cm long, white.

Fls.: August-September. Frts.: September onwards. Distribution: Pune Localities: Pune (Ralegaon hill and Bhivade khurd hill near Junnar)

157 Status: Endemic to Maharashtra & Critically Endangered. Vernacular/Local Name: Gauti Kharpudi. Economic Importance: Note: It is an erect species with elegant flowers. It is found growing on steep slopes of Ralegaon hill about 10 km west of Junnar. It grows at an altitude of about 750-1000 meters. It has longest flower among Indian species of Ceropegia and is very closely allied to the little known African C. campanulata - C. insignis - C. turricula group (Bruyns, 1997). It is of ornamental, botanical and phytogeographical significance. It needs immediate steps for its conservation.

Ceropegia media (Huber) Ansari

Herbs, twining, tuberous. Stem unbranched, terete, dull purple, glabrous. Leaves opposite, petiolate, 5-15 x 1-5 cm, sub-coriaceous, linear-lanceolate or lanceolate, acute or acuminate, hispidulous above, glabrous or nearly so beneath; lateral nerves 4-6 pairs; petioles 1.5-2.0 cm long, glabrous grooved on upper side. Flowers 2-4 in lateral umbellate cymes, peduncles arising from in between the petioles, 1-2 cm long, terete, pubescent, bracts and bracteoles 1-4 m long, linear-lanceolate or subulate, acute glabrous; pedicels up to 10 mm long, terete, hairy. Calyx lobes ca 4 mm long. Corolla ca 2.8 cm long, slightly curved; tube ca 2 cm long, glabrous inside and outside, pale green to white outside, green to greenish purple inside near the base, inflated base depressed in shape; lobes linear-spathulate, 8 x 2.5 mm, glabrous, greenish-white to white, faintly purplish above, margins reflexed above, connate at the tips forming an obovoid head. Corona biseriate, outer corona cupular, sub- quadrate in outline, 2-2.5 mm long, fleshy, dark purple, usually glabrous outside, hairy inside, lobes emarginate, inner corona of 5 linear thin lobes. Pollinia five, pollen masses solitary in each anther cell, yellow, waxy with pellucid layer, attached by light-brown caudicles to dark-brown corpuscle. Fls.: July-September. Frts.: September-October. Distribution: Pune, Satara, Ahmednagar. Localities: Satara (Thoseghar), Ahmednagar- (Kalsubai). Status: Endemic to Maharashtra & Vulnerable. Vernacular/Local Name: Economic Importance: Tubers are edible Note: Grows along forest borders of higher elevations of Sahyadris and stem has power to regenerate and form new plants from stem cuttings. It grows around the bushes, shrubs and in grasses on steep slopes. It shows fairly good fruit and seed setting. The flowers are delicate and of ornamental value. The plants are very sparsely distributed in a stretch of about 100 k.m. from Junnar to Satara in main

158 ranges of Sahyadris. It is diﬃcult to maintain in Gardens and in-situ conservation is essential. Chr. No.: 2n= 22.

Ceropegia noorjahaniae Ansari

Herbs, erect or twining, tuberous; 15-40 cm high with a sub-globose tuberous root. Stem terete, minutely pubescent in the upper, glabrous in lower region. Leaves opposite, sub-sessile or petiolate; petiole 4-7 mm long, glabrous; linear leaves 9 x 0.3 cm linear-lanceolate or lanceolate 7 x 1.5 cm, acute at apex, tapering at base, hairy on the upper side, glabrous beneath except along mid-ribs, margins minutely hairy. Flowers usually 3, in axillary or extra-axillary umbellate cymes; peduncles 3-4 mm long, glabrescent to glabrous; bracts subulate, 2-2.5 mm long; pedicels 6- 7 mm long, glabrescent to glabrous. Calyx 5-partite, lobes 4 mm long, glabrous. Corolla 2-2.7 cm long, slightly curved; tube 1.2-1.4 cm long, inflated at base, in lower 1/2 - 2/3 part, externally pale green in lower 3/4 part, pale to dark purplish- brown in the upper 1/4 part up to basal part of the corolla lobes, inside green with longitudinal purple lines, completely glabrous; lobes 0.9-1.3 cm long, nearly equal to the tube, linear oblong with acute apex and deltoid base, greenish above, pale to dark-purplish-brown near the base, margins partly reflexed all along, completely glabrous (without any purple hairs at base) connate at tips, forming an ovoid head. Corona biseriate; outer corona cupular, of 5 bifid or deeply emarginated lobes ca 1.25 mm long, 3 mm across, purple, glabrous outside and along the margins; inner of 5 erect, pale-purple, processes, 3 mm long, glabrous, straight at tips (inner convergent not hooked). Pollen masses minute, yellow, attached to brown pollen carriers by very short caudicles. Pistil ca 1.5 mm long. Follicles in pair, 9 x 0.4 cm long, tapering at both ends, glabrous. Seeds many, ca 3.5 x 2.5 mm, ovate, margined; coma 20 mm long.

Fls.: July-August. Frts.: August-October. Distribution: Satara Localities: Satara (Kartikswami) Status: Endemic to Maharashtra & Endangered. Vernacular/Local Name: Economic Importance: Tubers are edible. Note: Grows in grasslands on slopes of hills in eastern part of Sahyadris. The species has elegant delicate ﬂowers of great ornamental value. It grows well in- home gardens and earthen pots. It shows profuse fruiting and seed setting. The pollinarium germinate in-situ (personal observation) and probably selﬁng operates in the absence of pollinators. As it is restricted to few localities, it needs immediate steps for its conservation. Although the species shows erect habit but sometimes it shows twining habit also.

159 Ceropegia oculata Hook.

Herbs, twining, tuberous; tubers spherical, subspherical, depressed, 3-5 cm in diam. stem usually unbranched, terete, glabrous. Leaves petiolate, 8-12 x 5-7 cm broadly ovate or ovate-oblong, acute, rounded or cordate at base, sparsely hairy above, glabrous beneath; petioles 3-4 cm long, glabrous, grooved on upper side. Flowers in lateral umbellate cymes, umbel few-flowered; peduncles arising from between the petioles, terete, hairy; bracts 6-8 mm long, lanceolate or linear-subulate, glabrous; pedicels 1.5-2 cm long, terete, glabrous. Calyx divided to the base; sepals 0.8-1 cm long, linear-subulate, glabrous. Corolla ca 6.5 cm long; much dilated at base, tube 4-5 cm long, base inflated, narrowed in the neck, mouth funnel-shaped, glabrous inside, dilated portion faintly purple inside, white outside, tube dark purple inside, lobes 1.5-2 cm long, connate at tips to form beak, linear obtuse glabrous outside, pubescent inside, ciliate on margins, green above, greenish-yellow below, curiously variegated. Corona biseriate, outer corona cupular of 5 bifid lobes, glabrous; inner corona lobes 3 mm long, erect, linear-clavate, erect, glabrous. Pollinia five, pollen masses solitary in each anther cell, yellow, waxy with pellucid layer, attached by light-brown caudicles wide to dark-brown corpuscle. Follicles in pairs, 10-13 cm long, tapering at apex, glabrous, striped with purple lines. Seeds many, 6 x 4 mm, margined, comose, coma 1.5-3 cm long, white.

Fls.: July-August. Frts.: September-October. Distribution: Ahmednagar, Amaravati, Mumbai, Kolhapur, Pune, Raigad, Rat- nagiri, Satara, Sindhudurg. Localities: Kolhapur (Dajipur, Barki, Gaganbavada, Radhanagari), Satara- Yavtesh- war. Status: Endemic to Kerala, Tamil Nadu, Maharashtra. Low Risk. Vernacular/Local Name: Economic Importance: Tubers are edible. Note: Grows in bushes, has curiously variegated flowers of great ornamental value. The species has striking flowers. It grows in Sahyadri ranges and Konkan region of Maharashtra at an altitude of 1200 meters. The plants are sparsely distributed. The tubers are edible and the flowers are very curious and of great ornamental values. It shows great variations in the form of corolla, it’s colour and variegation pattern. It performs well in garden and deserves place in any home garden for its flowers. Chr. No.: 2n= 22.

Ceropegia panchganiensis Blatter & McCann

Herbs, erect, tuberous, up to 50 cm high; stems pubescent above. Leaves opposite, petiolate, 5-9 x 3.5-4.5 cm, ovate, rounded or sub-cordate at base, acute

160 at apex, puberulous above. Flowers 2-4 in cymes; peduncles 5-15 mm long, hairy and pedicels 8-15 mm long, hairy; bracts many, 2-3 mm long. Calyx 5-7 mm long. Corolla 2.5-3.5 cm long; tube 2.2-2.8 cm long, base inflated, inside a ring of hairs at the bottom, above narrow cylindrical; lobes ca 6 mm long, yellowish within, elliptic- ovate or obovate, glabrous. Corona biseriate, outer corona ca 1 mm long, shortly bifid, hairy lobes; inner ca 2 mm long, erect, clavate, hairy. Pollinia five, pollen masses solitary in each anther cell, yellow, waxy with pellucid layer, attached by light-brown caudicles to dark-brown corpuscle.

Fls.: July-August. Frts.: September-October. Distribution: Satara, Ahmednagar Localities: Satara (Mahabaleshwar Kate’s point), Ahmednagar (Harischandra- gad) Status: Endemic to Maharashtra & Critically Endangered Vernacular/Local Name: Kharpudi, Khartundi. Economic Importance: Note: It is known only from Mahabaleshwar range in Satara district Harischan- dragad in Ahmednagar district. It is an erect species, which grows on steep slopes of highest peaks of an altitude of about 1200 meters. It is restricted to very small area and there are few individuals. In nature, it has been observed that some insect larvae (Diptera?) feed on leaves of the species. There is an urgent need for its conservation and survival.

Ceropegia rollae Hemadri Herbs, erect, tuberous. Stem fleshy pubescent, unbranched. Leaves opposite, occasionally 3 at each node, petiolate; petioles up to 1.5 cm long, broadly ovate, apex acute, puberulous above. Flowers few to many in subumbellate cymes, sub- axillary or terminal, peduncles and pedicels (0.4-1 cm long) hirsute. Calyx divided to base, 3-5 mm long, linear lanceolate to sparsely hairy. Corolla 2.3-2.5 cm long; tube 1.5-2.5 cm long, base slightly inflated, inside a ring of hairs at its bottom, rest glabrous; lobes 8-13 x 2.5 m, linear-oblong, glabrous. Corona bi-seriate, outer corona of 5 short, entire or notched lobes, ciliate; inner erect, sub-clavate. Pollinia five, pollen masses solitary in each anther cell, yellow, waxy with pellucid layer, attached by light-brown caudicles to dark-brown corpuscle. Follicles linear, terete, tapering at the ends, 4.5-6 cm long. Seeds many, ovoid, comose. Fls.: July-September. Frts.: September-October. Distribution: Ahmednagar, Pune Localities: Ahmednagar (Harischandragarh), Pune (Durga khilla and Dhaka khilla near Junnar) Status: Endemic to Maharashtra & Critically endangered.

161 Vernacular/Local Name: Kharpudi. Economic Importance: Tubers are edible. Note: Erect species grows at high altitude of about 1200-1300 meters. Fruit setting is rare. It is diﬃcult to maintain in gardens. As it is restricted to a very small area of about 2 acres with countable number of individuals (ca 50-75), it may be wiped of any time and therefore needs immediate measures for its conservation and survival.

Ceropegia sahyadrica Ansari & Kulkarni

Herbs, erect, tuberous, 30-100 cm high. Stems 1-5 from the same tuber unbranched pubescent, cylindrical. Leaves opposite, variable, lower ovate, rounded or cordate, at base, upper ovate-lanceolate 4-11 x 2-8 cm, hispidulous on top, glabrous beneath; lateral nerves 4-5 pairs; petiolate; petioles 2-3 cm long. Flowers few to many in lateral umbellate cymes; peduncle ca 5.5 cm long, hairy, pedicels ca 2 cm long, hairy; bracts 5-7 x 1 mm, linear. Calyx 5-7 mm long, glabrous, rarely hairy on the midnerve. Corolla 3.5-5.5 cm long, tube up to 4.4 cm long, ash-coloured to white externally with 10 distinct veins, inside dark purple in the lower 2/3 part, minutely hairy at the base of the inﬂated part and white or ashy-grey in the upper 1/3 part, glabrous, broadening upward to funnel shape, lobes up to 11 x 8 mm, inter-

nally pale-orange to olive-green in the upper ú part only, the rest ash-grey coloured, ovate-cordate in shape, completely glabrous, connate at tips, forming an obovate or obconic head up to 1.7 cm across in the broadest part. Outer corona saucer-shaped, 1.5 – 1.75 mm long ca 3 mm across, broadly or obtusely 5-lobed, creamy-yellow, hairy along the margins; inner corona of 5 erect, slender, terete, yellow processes, 5-6 mm long slightly hairy near the base, straight at apex. Pollen masses erect, minutely yellow. Gynostegium 2-2.5 mm long. Follicles in pairs, up to 15 x 5 mm terete, tapering at both ends. Seeds many, with coma.

Fls.: July-September. Frts.: August-October. Distribution: Nasik, Kolhapur, Pune, Ratnagiri, Satara, Sindhudurg. Localities: Kolhapur (Gaganbavada), Sindhudurg (Ambolighat). Status: Endemic to Maharashtra &Vulnerable. Vernacular/Local Name: Economic Importance: Tubers are edible. Note: An erect, robust species grows on inaccessible steep slopes of an altitude of about 700-1000 meters in Sahyadris. . Although it shows profuse ﬂowering, fruit setting is rare. Slides of land and destruction of tubers by cowboys are two major threats to the species. Similarly failure of seed setting (probably failure of pollination in absence of pollinators) seems to be major reason for its rarity. It is

162 erect, robust species, which performs well in gardens. Insect larvae (Diptera?) feed on the leaves. Chr. No.: 2n= 22.

Ceropegia santapaui Wadhwa & Ansari

Herbs, twining, tuberous. Stem glabrous, sparingly hairy, terete, usually unbranched, about 1-1.5 mm in length. Leaves opposite, petiolate; petioles up to 3.5 cm long, glabrous, grooved on upper side with a minute gland on either side at the base; lower leaves ovate-acuminate, 6.5-8.5 x 2.5-4 cm; upper leaves ovate-acuminate, 4-5 x 1-1.5 cm; lamina sub-coriaceous with bulbous based hairs; margin ciliolate, gland dotted; lateral nerves 3-5 pairs. Flowers few to many in lateral subumbellate cymes; greenish white to white; peduncles hirsute, 2-5 cm long, terete; bracts 2-3 mm long, subulate; pedicels up to 1 cm long, terete, pubescent or hirsute. Calyx 5-partite, 3.5 mm long; lobes 3 mm long, 3-nerved, lateral ones very faint, ciliate on mid nerve on dorsal side. Corolla up to 1.5 cm long; straight or slightly curved; tube ca 1 cm long, faintly angular, glabrous within and minutely scabrous along nerves outside, inflated at the base, pale purple tinged within near the base; lobes about 1/3 the length of the corolla, up to 5 mm long, orbicular, inflexed and connate at tips forming a subglobose head, broader than long. Corona uniseriate, of 5 erect, elongated-conical pale yellow processes, lobes 2 mm long, hairy outside, convergent at apex, jointed near the base, obtuse, opposite and incumbent on anthers. Pollinia five, erect, minute, pollen masses ellipsoid, solitary in each anther cell, yellow, waxy with pellucid layer, attached by light-brown caudicles to reddish-brown corpuscle. Gynostegium 1.5-2 mm long. Follicles in pair, up to 8 cm long, tapering at both the ends. Seeds many, ca 7 x 3 mm, ovate, oblong, prominently margined; coma ca 1.5 cm long.

Fls.: July-September. Frts.: August-October. Distribution: Satara Localities: Satara (Mahad ghat, Kumbharli ghat) Status: Endemic to Maharashtra & Endangered. Vernacular/Local Name: Kharpudi, Khartundi. Economic Importance: Tubers are edible. Note: Slender twiner with small white ﬂowers. It grows among grasses on the unstable rocks on roadsides in Mahabaleshwar- Mahad ghat and Kumbharli ghat at an altitude of about 1150 meters. As the species is restricted to a very narrow area and grows on unstable rocks on slopes along roads in ghat area, it faces high risk of extinction due to landslides and road repairs and roadside clearing. It is of botanical signiﬁcance (Wadhwa and Ansari, 1968). It needs careful steps towards in-situ and ex-situ conservation. Chr. No.: 2n= 22.

163 Ceropegia vincaefolia Hook. Herbs, twining, tuberous. Stem branched, terete, glabrous, slightly swollen at nodes. Leaves petiolate, 18 x 10 cm. ovate to ovate-lanceolate, acute or acuminate at apex, cordate at base, puberulous above, glabrous beneath. Flowers few to many in lateral umbellate cymes; peduncle 7-11 cm long, terete, hirsute; pedicels 2-2.5 cm glabrous. Calyx ca 2 cm long, linear-subulate. Corolla 3-8 cm long; straight or slightly curved; tube 1.6-4.5 cm long, base inflated, abruptly narrowed above, funnel- shaped at mouth; lobes 1.5-3.5 cm long, linear-oblong above from ovate-deltoid base, pubescent inside and hairy on margins. Corona biseriate, outer corona of 5 lobes, entire, emarginated or shortly bifid, hairy; inner compressed, ligulate, oblanceolate, or lanceolate-rhomboidal, glabrous. Pollinia five, ovoid, pollen masses solitary in each anther cell, yellow, waxy with pellucid layer, attached by light-brown caudicles to dark-brown corpuscle. Follicles ca 1.5 x 0.5 cm cylindrical, tapering towards blunt apex, glabrous. Seeds ca 7 x 4 mm ovate-oblong, flattened with broad margin; coma ca 3 cm long.

Fls.: July-September. Frts.: September-December. Distribution: Dhule, Kolhapur, Mumbai, Pune, Raigad, Satara, Thane, Sind- hudurg districts. Localities: Kolhapur (Kondoshi, Patgaon), Pune (Sinhagad), Satara- Chalke- wadi, Kas plateau. Status: Endemic to Maharashtra & Endangered. Vernacular/Local Name: Kharpudi, Khapar-khutti Economic Importance: Ceropegia with beautiful and curiously formed flowers. It grows well in gardens and is easy to maintain. Note: Twining species grows along forest borders of higher altitudes ranging from 500 to 1,500 meters. It is sparsely distributed in almost entire range of Western Ghats. It shows great variations with reference to size, colouring pattern and shape of flower. The flower has distinct kind of light window of translucent ring and small circular pore like areas in inflated bottom. Chromosome No.: 2n= 22.

164 Appendix 2

Descriptions of Caralluma and Boucerosia used in this study

Source: Dr. S. Karuppusamy (Personal communication) Caralluma adscendens var. attenuata (Wight) Grav. & Mayur. Stem quadrangular, angles rounded, pale purple streaks or uniform purple colouration on the angles, tip obviously attenuate, branched at the tip many times occasionally. Flowers only on attenuated portion, dark purple petals with marginate purple ﬁmbrias, both the corona series purple. Fruits pale purple or streaked with purple lines on the follicle.

Caralluma adscendens var. adscendens (Roxb.) Haw. Stem quadrangular, angles rounded, pale purple streaks or uniform purple colouration on the angles, tip gradually attenuate, Flowers near tip portion, lobes dark purple without marginate ﬁmbrias, basal part of the petal concentric purple lines alternate with yellow rings, both the corona series purple. Fruits pale purple or streaked with purple lines on the follicle.

Caralluma adscendens var. ﬁmbriata (Wall.) Grav. & Mayur. Stem quadrangular, angles rounded, purple streaks or uniform purple colouration throughout the stem, tip not attenuate. Flowers arise axial of the scale leaves, pendulous, dark purple, ﬁmbria numerous on the margin of the petal. Follicle uniform pale purple colour, not streaked.

Caralluma adscendens var. carinata Grav. & Mayur. Stem quadrangular, angles acute, uniform green colour on the angles, tip attenuate, elongate, not branched. Flowers more or less typical attenuata but each axial arise two or three ﬂowers, pendulous. Follicle somewhat large and long, uniform creamish white colour.

Caralluma adscendens var. gracilis Grav. & Mayur. Stem quadrangular, angles acute, pale purple streaks or uniform purple colouration on the angles, tip slightly attenuate, not branched. Flowers small when compared to all above varieties, greenish background in the central portion, yellowish green bands alternate with purple bands, lobe of the petals in varied colours (Purple to cream).

Caralluma sarkariae Lavranos & Frandsen Stem quadrangular, angles rounded, uniform colour on the stem, tip attenuate and branched. Flowers greenish background with shiny purple lines on the petals. Corolla glabrous. Fruits pale cream coloured.

165 Caralluma stalagmifera Fischer Stem quadrangular, angles rounded, uniform colour on the stem or sometimes some intermediate purple lines are common, tip attenuate and branched occasionally. Flowers dark purple to biscuit colours, few stalagmite ﬁmbrias only at the tip of the petals. Fruit pinkish white coloured.

Caralluma bhupindriana Sarkaria Stem quadrangular, angles rounded, uniform pinkish colour on the stem, tip attenuate and not branched. Flowers paired or sometimes 3 or 4 from each axial near the tip, brown to green purple petals, very shiny, short hairs along the margins. Fruit whitish when matured.

Boucerosia umbellata (Roxb.) Haw. Stem thick, quadrangular, angles acute, leaf scar protruded spine like along the angles, growth diﬀuse, growing on both rock and sandy areas. Flowers on umbels, umbel 20-40 ﬂowered, peduncle persistent, glabrous, purple colour with various pat- ters of concentric rings. Fruits creamish white.

Boucerosia lasiantha (Wight.) N.E.Br. Stem more thick when compare to B. umbellata, angles acute, leaf scars spine like, growth erect, found only on rocks. Flowers on umbels, umbel 30-60 ﬂowered, peduncle branched and persistent, hairy, uniform deep purple colour inner side. Fruit similar to B. umbellata.

Boucerosia indica N.E.Br. Stems fleshy, branched, branches quadrangular, tapering towards base. Intern- odes small (2-6mm), glabrous. Latex watery. Leaves small (1.5 x 1 mm). Flowers terminal, umbellate cymes, few (about 5) flowered. Calyx five-lobed, divided up to the base. Corolla rotate, about 1.5 cm across, corolla lobes 5 x 4.5 mm, ovate, apex acute. Corolla greenish yellow with long scattered hairs all the inner surface, glabrous without. Corona staminal, biseriate, outer five lobed with with horn like structures (yellow) widely separated from each other. Follicles single, apex cute, glabrous, brown.

Boucerosia pauciﬂora (Wight.) N.E.Br. Stem delicate, thin, quadrangular, leaf curved backwards, uniform green colour when young, if matured pinkish uniformly, never streaked. Flower mostly single on the tip, hairy petals with coalescent concentric purple lines. Fruit creamish white.

166 Appendix 3

Photo credits for Figure 6.4

Fig. 6.4(a) oki tokyo http://www.flickr.com/photos/oki tokyo/ Fig. 6.4(b) Martin Hegian http://www.flickr.com/photos/martin heigan/ Fig. 6.4(c) fracass.be http://www.flickr.com/photos/fracass-be/ Fig. 6.4(d) lisabatty http://www.flickr.com/photos/ljb/ Fig. 6.4(e) sheephead http://www.flickr.com/photos/sheephead/ Fig. 6.4(f) Aqua-marina http://www.flickr.com/photos/aqua-marina/

167 Bibliography

Akaike, H. (1981). Likelihood of a model and information criteria. Journal of Econo- metrics, 16, 3–14.

Alam, M.I. and Gomes, A. (1998). Adjuvant eﬀects and antiserum action potentia- tion by a (herbal) compound 2-hydroxy-4-methoxy benzoic acid isolated from the root extract of the Indian medicinal plant ‘sarsaparilla’ (Hemidesmus indicus R. Br.). Toxicon, 36, 1423–1431.

Albers, F. (1983). Cytotaxonomic studies in African Asclepiadaceae. In D.J.B. Kil- lick, ed., In: Proceedings of the Xth AETFAT Congress, Pretoria, 1982. Bothalia, 795–798, AETFAT.

Albers, F. and Meve, U. (2001). A Karyological Survey of Asclepiadoideae, Periplo- coideae, and Secamonoideae, and evolutionary considerations within Apocynaceae s.l. Annals of the Missouri Botanical Garden, 88, 624–656.

Ali, M. and Gupta, J. (1999). New pentacyclic triterpenic esters from the roots of Calotropis gigantea. Indian journal of chemistry. Sect. B: Organic chemistry, including medical chemistry, 38, 877–881.

Ali, M., Ansari, S.H. and Qadry, J.S. (1991). Rare phenanthroindolizidine alkaloids and a substituted phenanthrene, Tyloindane, from Tylophora indica. Journal of Natural Products, 54, 1271–1278.

Ali, M., Gupta, J., Neguerulea, M.V. and Perez-Alonso, M.J. (1998). New ursan-type triterpenic esters from the roots of Calotropis gigantea. Pharmazie, 53, 718–721.

Ananthan, R., Latha, M., Ramkumar, K.M., Pari, L., Baskar, C. and Narmatha Bai, V. (2004). Modulatory eﬀects of Gymnema montanum leaf extract on alloxan- induced oxidative stress in wistar rats. Nutrition, 20, 280–285.

Andrade, P.B., Seabra, R.M., Valent˜ao, P. and Areias, F. (1998). Simultaneous determination of ﬂavonoids, phenolic acids, and coumarins in even medicinal species by HPLC/DIODE-Array Detector. Journal of Liquid Chromatography & Related Technologies, 21, 2813–2820.

Ansari, N.M., Houlihan, L., Hussain, B. and Pieroni, A. (2005). Antioxidant activity of ﬁve vegetables traditionally consumed by South-Asian migrants in Bradford, Yorkshire, UK. Phytotherapy Research, 19, 907–911.

Auddy, B., Ferreira, M., Blasina, F., Lafon, L., Arredondo, F., Dajas, F., Tripathi, P.C., Seal, T. and Mukherjee, B. (2003). Screening of antioxidant activity of three

168 Indian medicinal plants, traditionally used for the management of neurodegenerative diseases. Journal of Ethnopharmacology, 84, 131–138.

Beal, M.F. (1995). Aging, energy, and oxidative stress in neurodegenerative diseases. Annals of Neurology, 38, 357–366.

Bentham, G. and Hooker, J.D. (1876). Genera plantarum, vol. 2, pt. 2. Lovell Reeve, London.

Benzie, I.F.F. and Strain, J.J. (1996). The ferric reducing ability of plasma (FRAP) as a measure of “antioxidant power”: the FRAP assay. Analytical Biochemistry, 239, 70–76.

Boonjaras, T. and Thaithong, O. (2003). Ceropegia hirsuta(Asclepiadaceae), a new record for Thailand. Thai Forest Bulletin (Botany), 31, 1–6.

Brahma, S.K. and Debnath, P.K. (2003). Therapeutic importance of Rasayana drugs with special reference to their multi-dimensional actions. Aryavaidyan, 16, 160– 163.

Brand-Williams, W., Cuvelier, M.E. and Berset, C. (1995). Use of a free radical method to evaluate antioxidant activity. Lebensmittel Wissenschaft Technologie, 28, 25–30.

Bravo, L. (1998). Polyphenols: Chemistry, dietary sources, metabolism, and nutritional signiﬁcance. Nutrition Reviews, 56, 317–333.

Bray, T.M. (1999). Antioxidants and oxidative stress in health and disease: Intro- duction.

Brown, N.E. (1892). Caralluma campanulata NE Br. Garden Chronicles, 12, 369– 370.

Brown, R. (1810). On the Asclepiadaeae, a natural order of plants separated from the Apocineae of Jussieu. Memoires of the Wernerian Natural History Society, 1, 12–78.

Bruyns, P.V. (1983). Resurrection of the genus Quaqua N.E.Br. Bradleya, 1, 33–78.

Bruyns, P.V. (1988). Studies in the ﬂora of Arabia XXIV: The genus Ceropegia in Arabia. Notes of Royal Botanical Garden Edinburgh, 45, 287–326.

Bruyns, P.V. (1997). A note on Ceropegia L.(Asclepiadaceae) of Silent Valley, Ker- ala, India. Rheedea, 7, 107–114.

Bruyns, P.V. (1999a). Subtribes and genera of Asclepiadeae. A Response to Liede. Taxon, 48, 23–26.

Bruyns, P.V. (1999b). The Relationships of Huerniopsis and Piaranthus (Apocynaceae-Asclepiadoideae). Systematic Botany, 24, 379–397.

Bruyns, P.V. (1999c). The systematic position of Eustegia R.Br. Bot. Jahrb. Syst., 121, 19–44.

169 Bruyns, P.V. (2000a). Baynesia, a new genus of Stapeliad from the Northwestern- Most corner of Namibia (Apocynaceae). Novon, 10, 354–358.

Bruyns, P.V. (2000b). New combinations in the genus Orbea. Aloe, 37, 72–76.

Bruyns, P.V. (2000c). Phylogeny and Biogeography of the Stapeliads, 2. Biogeogra- phy. Plant Systematics and Evolution, 221, 199–226.

Bruyns, P.V. (2002). The Southern African genera of the Stapeliads. Aloe, 39, 52– 63.

Bruyns, P.V. (2003). The new species of Apocynaceae (Asclepiadoideae) from southern Africa. Kew Bulletin, 58, 427–435.

Bruyns, P.V. and Forster, P.I. (1991). Recircumscription of the Stapelieae (Asclepi- adaceae). Taxon, 40, 381–391.

Bruyns, P.V. and Miller, A.G. (2002). Socotrella, a new genus of Stapeliad (Apocynaceae-Asclepiadoideae) from the Island of Socotra. Novon, 12, 330–333.

Buenz, E.J., Schnepple, D.J., Bauer, B.A., Elkin, P.L., Riddle, J.M. and Motley, T.J. (2004). Techniques: bioprospecting historical herbal texts by hunting for new leads in old tomes. Trends in Pharmacological Sciences, 25, 494–498.

Cai, Y.Z., Sun, M. and Corke, H. (2003). Antioxidant activity of betalains from plants of the Amaranthaceae. Journal of Agricultural and Food Chemistry, 51, 2288–2294.

Cai, Y.Z., Luo, Q., Sun, M. and Corke, H. (2004). Antioxidant activity and phenolic compounds of 112 traditional Chinese medicinal plants associated with anticancer. Life Sciences, 74, 2157–84.

Cantino, P.D. and de Queiroz, K. (2000). PhyloCode: A Phylogenetic Code of Biological Nomenclature. http://www.ohiou.edu/phylocode.

Cao, G., Alessio, H.M. and Cutler, R.G. (1993). Oxygen-radical absorbance capacity assay for antioxidants. Free Radical Biology and Medicine, 14, 303–311.

Chandra, R., Deepak, D. and Khare, A. (1994). Pregnane glycosides from Hemidesmus indicus. Phytochemistry, 35, 1545–1548.

Chanwitheesuk, A., Teerawutgulrag, A. and Rakariyatham, N. (2005). Screening of antioxidant activity and antioxidant compounds of some edible plants of Thailand. Food Chemistry, 92, 491–497.

Chaturvedi, S.K. (1993a). Modes of pollination in some Indian Ceropegias (As- clepiadaceae). In U. Shanker and Ganeshaiah, eds., Proceedings of International Symposium of Pollination in the Tropics, 160–164, International Union for the Study of Social Insects Indian Chapter.

Chaturvedi, S.K. (1993b). Signiﬁcance of light windows in the pollination of some Indian Ceropegias (Asclepiadaceae). Cactus and Succulent Journal, 65, 148–151.

170 Chitme, H.R., Chandra, R. and Kaushik, S. (2005). Evaluation of antipyretic activity of Calotropis gigantea (Asclepiadaceae) in experimental animals. Phytotherapy Research, 19, 454–456.

Chun, O.K., Kim, D.O. and Lee, C.Y. (2003). Superoxide radical scavenging activity of the major polyphenols in fresh plums. Journal of Agricultural and Food Chemistry, 51, 8067–8072.

CITES (2007). Proposals resulting from reviews by the Plants Committees- Prop.11.01 . http://www.cites.org/eng/cop/11/prop/01.pdf (accessed on Aug 10, 2007).

Civeyrel, L., Le Thomas, A., Ferguson, K. and Chase, M.W. (1998). Critical reexam- ination of palynological characters used to delimit Asclepiadaceae in comparison to the molecular phylogeny obtained from plastid matK sequences. Molecular Phylogenetics and Evolution, 9, 517–527.

Cook, N.C. and Samman, S. (1996). Flavonoids - Chemistry, metabolism, cardio- protective eﬀects, and dietary sources. The Journal of Nutritional Biochemistry, 7, 66–76.

Davis, C.C., Latvis, M., Nickrent, D.L., Wurdack, K.J. and Baum, D.A. (2007). Floral gigantism in Raﬄesiaceae. Science, 315, 1812.

De Kruif, A.P.M. (1983). Part XI. A revision of Motandra A. DC. (Apocynaceae). In A.J.M. Leeuwenberg, ed., Series of Revisions of Apocynaceae. Parts XI-XIII , 1–20, Meded. Landbouwhoogeschool. de Queiroz, K. and Gauthier, J. (1992). Phylogenetic Taxonomy. Annual Review of Ecology and Systematics, 23, 449–480.

Deepak, D., Srivastava, S. and Khare, A. (1997). Pregnane glycosides from Hemidesmus indicus. Phytochemistry, 44, 145–151.

Dorman, H.J., Bachmayer, O., Kosar, M. and Hiltunen, R. (2004). Antioxidant properties of aqueous extracts from selected lamiaceae species grown in Turkey. Journal of Agricultural and Food Chemistry, 52, 762–770.

Downie, S.R. and Palmer, J.D. (1992). Restriction site mapping of the chloroplast DNA inverted repeat: a molecular phylogeny of the Asteridae. Annals of the Missouri Botanical Garden, 79, 266–283.

Doyle, J.J. and Doyle, J.L. (1987). A rapid DNA isolation procedure for small quan- tities of fresh leaf tissue. Phytochemical Bulletin, 19, 11–15.

Dragland, S., Senoo, H., Wake, K., Holte, K. and Blomhoﬀ, R. (2002). Several Culinary and Medicinal Herbs Are Important Sources of Dietary Antioxidants. Journal of Nutrition, 133, 1286–1290.

Dreher, D. and Junod, A.F. (1996). Role of Oxygen Free Radicals in Cancer Devel- opment. European Journal of Cancer, 32, 30–38.

171 Dyer, R.A. (1983). Ceropegia, Brachystelma and Riocreuxia in southern Africa. AA Balkema, Rotterdam.

Endress, M.E. and Bruyns, P.V. (2000). A revised classiﬁcation of the Apocynaceae sl. Botanical Review, 66, 1–56.

Endress, M.E. and Stevens, W.D. (2001). The renaissance of the Apocynaceae s.l.: Recent advances in systematics, phylogeny, and evolution: Introduction. Annals of the Missouri Botanical Garden, 88, 517–522.

Endress, M.E., Sennblad, B., Nilsson, S., Civeyrel, L., Chase, M.W., Huysmans, S., Grafstr¨om, E. and Bremer, B. (1996). A phylogenetic analysis of Apocynaceae s. str. and some related taxa in Gentianales: a multidisciplinary approach. Opera Botanica Belgica, 7, 59–102.

Endress, M.E., Liede, S. and Meve, U. (2007). Advances in Apoycnaceae: The enlightenment, an introduction. Annals of the Missouri Botanical Garden, 94, 259–267.

Endress, P.K. (1994). Diversity and evolutionary biology of tropical ﬂowers. Cam- bridge University Press.

Fabricant, D.S. and Farnsworth, N.R. (2001). The value of plants used in traditional medicine for drug discovery. Environmental Health Perspectives, 109, 69–75.

Faria, A., Oliveira, J., Neves, P., Gameiro, P., Santos-Buelga, C., Freitas, V. and Mateus, N. (2005). Antioxidant properties of prepared blueberry (Vaccinium myr- tillus) extracts. Journal of Agricultural and Food Chemistry, 53, 6896–6902.

Felsenstein, J. (1981). Evolutionary trees from DNA sequences: A maximum likelihood approach. Journal of Molecular Evolution, 17, 368–376.

Fern´andez, F.A., Miller, A.N., Huhndorf, S.M., Lutzoni, F.M. and Zoller, S. (2006). Systematics of the genus Chaetosphaeria and its allied genera: morphological and phylogenetic diversity in north temperate and neotropical taxa. Mycologia, 98, 121–130.

Forest, F., Grenyer, R., Rouget, M., Davies, T.J., Cowling, R.M., Faith, D.P., Balm- ford, A., Manning, J.C., Proches, S., van der Bank, M. et al. (2007). Preserving the evolutionary potential of ﬂoras in biodiversity hotspots. Nature, 445, 757–760.

FRLHT (2007). Frlht database. http://envis.frlht.org.in/database.htm (accessed on Sep 17, 2007).

Gaikwad, D.K., Supate, A.R., , Yadav, S.R. and Chavan, P.D. (1989). Occurence of Crassulacean Acid Metabolism in stem tissues of Ceropegia juncea Roxb. Photo- synthetica, 23, 216–220.

Gamble, J.S. (1916). Flora of the presidency of Madras. (reprint 1957, Botanical Survey of India).

Gao, X.M., Xu, Z.M. and Li, Z.W. (2000). Traditional Chinese Medicines. Beijing: Peoples Health Publishing House.

172 Gilbert, M.G. (1990). A review of Caralluma R. Br. and its segregates. Bradleya, 8, 1–32.

Glade, M.J. (1999). Food, nutrition, and the prevention of cancer: a global perspective. American Institute for Cancer Research/World Cancer Research Fund, American Institute for Cancer Research, 1997. Nutrition, 15, 523–526.

Godyer, D., Nicholas, A. and Liede-Schumann, S. (2007). Phylogenetic relationships in subtribe Asclepiadinae (Apocynaceae: Asclepiadoideae). Annals of the Missouri Botanical Garden, 94, 423–434.

Good, R. (1952). An atlas of the Asclepiadaceae. New Phytologist, 51, 198–209.

Govindarajan, R., Vijayakumar, M. and Pushpangadan, P. (2005). Antioxidant approach to disease management and the role of’Rasayana’herbs of Ayurveda. Jour- nal of Ethnopharmacology, 99, 165–178.

Hall, T. (1999). BioEdit: a user-friendly biological sequence alignment editor and analysis program for Windows 95/98/NT. Nucleic Acids Symposium Series, 41, 95–98.

Halliwell, B. and Gutteridge, J.M. (1995). The deﬁnition and measurement of antioxidants in biological systems. Free Radical Biology and Medicine, 18, 125–126.

Halliwell, B. and Gutteridge, J.M.C. (1999). Free Radicals in Biology and Medicine, 3rd edition. Oxford: Clarendon Press.

Hamed, A.I., Sheded, M.G., Shaheen, A.S., Hamada, F.A., Pizza, C. and Piacente, S. (2004). Polyhydroxypregnane glycosides from Oxystelma esculentum var. alpini. Phytochemistry, 65, 975–980.

Hamed, A.I., Plaza, A., Balestrieri, M.L., Mahalel, U.A., Springuel, I.V., Oleszek, W., Pizza, C. and Piacente, S. (2006). Cardenolide glycosides from Pergularia tomentosa and their proapoptotic activity in Kaposi’s sarcoma cells. Journal of Natural Products, 69, 1319–1322.

Harish, R., Divakar, S., Srivastava, A. and Shivanandappa, T. (2005). Isolation of antioxidant compounds from the methanolic extract of the roots of Decalepis hamiltonii (Wight and Arn.). Journal of Agricultural and Food Chemistry, 53, 7709–7714.

Hasegawa, M., Kishino, H. and Yano, T. (1985). Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. Journal of Molecular Evolution, 22, 160–174.

Heneidak, S., Grayer, R.J., Kite, G.C. and Simmonds, M.S.J. (2006). Flavonoid glycosides from Egyptian species of the tribe Asclepiadeae(Apocynaceae, subfamily Asclepiadoideae). Biochemical Systematics and Ecology, 34, 575–584.

Huber, H. (1957). Revision der Gattung Ceropegia. [Instituto Botnico da Universi- dade de Coimbra].

173 Ionta, G.M. and Judd, W.S. (2007). Phylogenetic relationships in Periplocoideae (Apocynaceae s.l) and insights into the origins of pollinia. Annals of the Missouri Botanical Garden, 94, 360–375.

Jadav, H.R. and Bhutani, K.K. (2002). Antioxidant properties of Indian medicinal plants. Phytotherapy Research, 16, 771–773.

Jadeja, B.A., Bhatt, D.C. and Odedra, N.K. (2004). Ethnobotanical signiﬁcance of Asclepiadaceae in Barda hills of Gujarat, India. Plant Archives, 4, 459–461.

Jagtap, A.P. and Singh, N.P. (1999). Fascicles of Flora of India: Fascicle 24 (As- clepiadaceae and Periplocaceae). Botanical Survey of India, Calcutta.

Jirovetz, L., Buchbauer, G., Hoferl, M., Shaﬁ, M.P. and Sagaran, P.G. (2002). Essen- tial oil analysis of Hemidesmus indicus R. Br. roots from Southern India. Journal of Essential Oil Research, 14, 437–438.

Jussieu, A.L. (1789). Genera Plantarum. Herrisant, Paris.

K¨ahk¨onen, M.P., Hopia, A.I., Vuorela, H.J., Rauha, J.P., Pihlaja, K., Kujala, T.S. and Heinonen, M. (1999). Antioxidant activity of plant extracts containing phenolic compounds. Journal of Agricultural and Food Chemistry, 47, 3954–62.

Kamble, M.Y. (2007). Taxonomical studies on Asclepiadaceae and Periplocaceae of Maharashtra. Ph.D. Thesis, Shivaji University, Kolhapur.

Khanbabaee, K. and van Ree, T. (2001). Tannins: classiﬁcation and deﬁnition. Natural Product Reports, 18, 641–649.

Khare, N.K., Kumar, R., Khare, M.P. and Khare, A. (1987). A novel pregnane derivative from Sarcostemma brevistigma. Journal of Natural Products, 50, 600– 603.

Kimura, I. (2006). Medical Beneﬁts of Using Natural Compounds and Their Deriva- tives Having Multiple Pharmacological Actions. Yakugaku Zasshi, 126, 133–143.

Kirtikar, K.R. and Basu, B.D. (1975). Indian Medicinal Plants, Vol. III . Bishen Singh Mahendra Pal Singh, Dehradun, India.

Kishino, H. and Hasegawa, M. (1989). Evaluation of the maximum likelihood es- timate of the evolutionary tree topologies from DNA sequence data, and the branching order in hominoidea. Journal of Molecular Evolution, 29, 170–179.

Klackenberg, J. (1992a). Taxonomy of Secamone (Asclepiadaceae) in Asia and Aus- tralia. Kew Bulletin, 47, 595–612.

Klackenberg, J. (1992b). Taxonomy of Secamone s. lat.(Asclepiadaceae) in the Madagascar region, vol. 112. Council for Nordic Publications in Botany.

Klackenberg, J. (1995). Taxonomy and phylogeny of the SE Asian genus Genianthus (Asclepiadaceae). Bot. Jahrb. Syst., 117, 401–467.

Klak, C., Reeves, G. and Hedderson, T. (2004). Unmatched tempo of evolution in Southern African semi-desert ice plants. Nature (London), 427, 63–65.

174 Kress, W.J., Wurdack, K.J., Zimmer, E.A., Weigt, L.A. and Janzen, D.H. (2005). Use of DNA barcodes to identify ﬂowering plants. Proceedings of the National Academy of Sciences, USA, 102, 8369–8374.

Kris-Etherton, P.M., Hecker, K.D., Bonanome, A., Coval, S.M., Binkoski, A.E., Hilpert, K., Griel, A.E. and Etherton, T.D. (2002). Bioactive compounds in foods: their role in the prevention of cardiovascular disease and cancer. The American Journal of Medicine, 113, 71–88.

Kronauer, D.J.C., Schoening, C., Vilhelmsen, L.B. and Boomsma, J.J. (2007). A molecular phylogeny of Dorylus army ants provides evidence for multiple evolutionary transitions in foraging niche. BMC Evolutionary Biology, 7, 56.

Kunze, H., Meve, U. and Liede, S. (1994). Cibirhiza albersiana, a new species of Asclepiadaceae, and establishment of the tribe Fockeeae. Taxon, 43, 367–376.

Laden, G. and Wrangham, R. (2005). The rise of the hominids as an adaptive shift in fallback foods: Plant underground storage organs (USOs) and australopith origins. Journal of Human Evolution, 49, 482–498.

Lahaye, R., Klackenberg, J., K¨allersj¨o, M., Van Campo, E. and Civeyrel, L. (2007). Phylogenetic relationships between derived derived Apocynaceae s.l. and within Secamonoideae based on chloroplast sequences. Annals of the Missouri Botanical Garden, 94, 376–391.

Larson, R.A. (1988). The antioxidants of higher plants. Phytochemistry, 27, 969– 978.

Latha, M. and Pari, L. (2003). Preventive eﬀects of Cassia auriculata L. ﬂowers on brain lipid peroxidation in rats treated with streptozotocin. Molecular and Cellular Biochemistry, 243, 23–28.

Lhinhatrakool, T. and Sutthivaiyakit, S. (2006). 19-Nor-and 18, 20-Epoxy- cardenolides from the leaves of Calotropis gigantea. Journal of Natural Products, 69, 1249–1251.

Li, P.T., Gilbert, M.G. and Stevens, W.D. (1995). Asclepiadaceae. Flora of China, 16, 189–270.

Liede, S. (1997). Subtribes and genera of the tribe Asclepiadeae (Apocynaceae, Asclepiadoideae). A Synopsis. Taxon, 46, 233–247.

Liede, S. (2001). Subtribe Astephaninae (Apocynaceae-Asclepiadoideae) reconsid- ered: New evidence based on cpDNA spacers. Annals of the Missouri Botanical Garden, 88, 657–668.

Liede, S. and Albers, F. (1994). Tribal disposition of genera in the Asclepiadaceae. Taxon, 43, 201–231.

LihJeng, J., Shuenn-Jyi, S. and TaChen, L. (2004). Determination of hydrolyz- able tannins in the fruit of Terminalia chebula Retz. by high-performance liquid chromatography and capillary electrophoresis. Journal of Separation Science, 27, 718–724.

175 Lin, L.C., Yang, L.L. and Chou, C.J. (2003). Cytotoxic naphthoquinones and plumbagic acid glucosides from Plumbago zeylanica. Phytochemistry, 62, 619–622.

Lin, T.A.C., Nonaka, G.I., Nishioka, I. and Ho, F.C. (1990). Tannins and related- compounds. 102. Structures of terchebulin, an ellagitannin having a novel tetraphenylcarboxylic acid (terchebulic acid) moiety, and biogenetically related tannins from Terminalia chebula Retz. Chemical and pharmaceutical bulletin, 38, 3004–3008.

Liu, M., Li, X.Q., Weber, C., Lee, C.Y., Brown, J. and Liu, R.H. (2002). Antioxidant and antiproliferative activities of raspberries. Journal of Agricultural and Food Chemistry, 50, 2926–2930.

Liu, X., Ye, W., Yu, B., Zhao, S., Wu, H. and Che, C. (2004). Two new ﬂavonol glycosides from Gymnema sylvestre and Euphorbia ebracteolata. Carbohydrate Re- search, 339, 891–895.

Livshultz, T., Middleton, D.J., Endress, M.E. and Williams, J.K. (2007). Phylogeny of the Apocynoideae and the APSA clade (Apocynaceae s.l.). Annals of the Mis- souri Botanical Garden, 94, 324–359.

Mabberley, D.J. (1997). The Plant Book. University Press, Cambridge, UK.

MacLean, D.B. and Luo, L.G. (2004). Increased ATP content/production in the hy- pothalamus may be a signal for energy-sensing of satiety: studies of the anorectic mechanism of a plant steroidal glycoside. Brain Research, 1020, 1–11.

Malpure, N.V., Kamble, M.Y. and Yadav, S.R. (2006). A new species of Cerope- gia L.(Asclepiadaceae) from the Western Ghats of India with a note on series Attenuatae Huber. Current Science, 91, 1142.

Mary, N.K., Achuthan, C.R., Babu, B.H. and Padikkala, J. (2003). In vitro antioxidant and antithrombotic activity of Hemidesmus indicus (L) R. Br. Journal of Ethnopharmacology, 87, 187–191.

Maxwell, S.R. (1995). Prospects for the use of antioxidant therapies. Drugs, 49, 345–61.

McCann, C. (1943). Light windows in certain ﬂowers. Journal of the Bombay Natural History Society, 44, 182–184.

Meve, U. (1997). The Genus Duvalia (Stapelieae): Stem-succulents between the Cape and Arabia. Plant Systematics and Evolution. Supplement 10.

Meve, U. (2002a). Ceropegia. In F. Albers and U. Meve, eds., Illustrated handbook of succulent plants: Asclepiadaceae, 63–106, Springer.

Meve, U. (2002b). Species numbers and progress in asclepiad taxonomy. Kew bulletin, 57, 459–464.

Meve, U. and Liede, S. (2002). A molecular phylogeny and generic rearrangement of the stapelioid Ceropegieae (Apocynaceae-Asclepiadoideae). Plant Systematics and Evolution, 234, 171–209.

176 Meve, U. and Liede, S. (2004). Subtribal division of Ceropegieae (Apocynaceae- Asclepiadoideae). Taxon, 53, 61–72.

Meve, U. and Liede-Schumann, S. (2007). Ceropegia (Apocynaceae, Ceropegieae, Stapeliinae): Paraphyletic but still taxonomically sound. Annals of the Missouri Botanical Garden, 94, 392–406.

Miller, N.J., Rice-Evans, C., Davies, M.J., Gopinathan, V. and Milner, A. (1993). A novel method for measuring antioxidant capacity and its application to monitoring the antioxidant status in premature neonates. Clinical Science, 84, 407–412.

Mukhopadhyay, B. and Field, R.A. (2006). Convergent synthesis of a trisaccharide as its 2-(trimethylsilyl) ethyl glycoside related to the ﬂavonoid triglycoside from Gymnema sylvestre. Carbohydrate Research, 341, 1697–1701.

M¨uller, B. and Albers, F. (2002). Caralluma. In F. Albers and U. Meve, eds., Illus- trated handbook of succulent plants: Asclepiadaceae, 45–63, Springer.

Myers, N., Mittermeier, R.A., Mittermeier, C.G., da Fonseca, G.A.B. and Kent, J. (2000). Biodiversity hotspots for conservation priorities. Nature, 403, 853–858.

Nagao, A., Seki, M. and Kobayashi, H. (1999). Inhibition of xanthine oxidase by ﬂavonoids. Bioscience, Biotechnology, and Biochemistry, 63, 1787–1790.

Nagarajan, S. and Rao, L.J.M. (2003). Determination of 2-Hydroxy-4- Methoxybenzaldehyde in roots of Decalepis hamiltonii (Wight & Arn.) and Hemidesmus indicus R. Br. Journal of AOAC International, 86, 564–567.

Naik, G.H., Priyadarsini, K.I., Satav, J.G., Banavalikar, M.M., Sohoni, D.P., Biyani, M.K. and Mohan, H. (2003). Comparative antioxidant activity of individual herbal components used in Ayurvedic medicine. Phytochemistry, 63, 97–104.

Noor, F., Ahmed, A., Imtiazuddin, S.M. and Khan, B. (1993). A triterpenoid from Lepetadenia pyrotechnica. Phytochemistry, 32, 211–212.

Nordal, I. and Stedje, B. (2005). Paraphyletic taxa should be accepted. Taxon, 54, 5–6.

Noro, T., Oda, Y., Miyase, T., Ueno, A. and Fukushima, S. (1983). Inhibitors of xanthine oxidase from the ﬂowers and buds of Daphne genkwa. Chemical and Pharmaceutical Bulletin, 31, 3984–3987.

Nylander, J.A. (2004). MrModeltest, version 2.2. Uppsala University, Uppsala.

Olmstead, R.G., Bremer, B., Scott, K.M. and Palmer, J.D. (1993). A Parsimony analysis of the Asteridae sensu lato based on rbcL Sequences. Annals of the Mis- souri Botanical Garden, 80, 700–722.

Page, R.D.M. (2001). TreeView, Version 1.6.6. Glasgow: University of Glasgow.

Park, E.J. and Pezzuto, J.M. (2002). Botanicals in cancer chemoprevention. Cancer and Metastasis Reviews, 21, 231–255.

177 Patil, V.N. (1997). Morphotaxonomical studies in Asclepiadaceae: Genus Ceropegia L. and Brachystelma R. Br.. M.Phil. Dissertation, Shivaji University, Kolhapur.

Peng, S.L., Zhu, X.M., Wang, M.K. and Ding, L.S. (2005). A novel triterpenic acid from Gymnema sylvestre. Chinese Chemical Letters, 16, 223–224.

Percival, M.S. (1965). Floral Biology. Pergamon press: Oxford.

Plowes, D.C.H. (1995). A reclassiﬁcation of Caralluma R. Brown (Stapelieae: As- clepiadaceae). Haseltonia, 3, 49–70.

Potgieter, K. and Albert, V.A. (2001). Phylogenetic relationships within Apocy- naceae s.l. based on trnL intron and trnL-F spacer sequences and propagule characters. Annals of the Missouri Botanical Garden, 88, 523–549.

Poulsen, H.E., Prieme, H. and Loft, S. (1998). Role of oxidative DNA damage in cancer initiation and promotion. European Journal of Cancer Prevention, 7, 9–16.

Rao, K.V., Wilson, R.A. and Cummings, B. (1971). Alkaloids of Tylophora. 3. New alkaloids of Tylophora indica (Burm) Merrill and Tylophora dalzellii Hook. f. Jour- nal of Pharmaceutical Sciences, 60, 1725–1726.

Ravishankara, M.N., Shrivastava, N., Padh, H. and Rajani, M. (2002). Evaluation of antioxidant properties of root bark of Hemidesmus indicus R. Br.(Anantmul). Phytomedicine, 9, 153–160.

Re, R., Pellegrini, N., Proteggente, A., Pannala, A., Yang, M. and Rice-Evans, C. (1999). Antioxidant activity applying an improved ABTS radical cation decol- orization assay. Free Radical Biology and Medicine, 26, 1231–1237.

Reddy, B.M., Byahatti, V.V., Appa Rao, A.V.N. and Ramesh, M. (1996). Anti- inﬂammatory activity of Stapelia nobilis and Caralluma stalagmifera. Fitoterapia, 67, 545–547.

Reddy, M.V.B., Reddy, M.K., Gunasekar, D., Murthy, M.M., Caux, C. and Bodo, B. (2003). A new sesquiterpene lactone from Bombax malabaricum. Chemical & Pharmaceutical bulletin, 51, 458–459.

Reddy, V.L.N., Ravikanth, V., Reddy, A.V., Prabhakar Rao, T. and Venkateswarlu, Y. (2002). An unusual novel triterpenoid ether, multiﬂor-7-en-12, 13-ether and a new multiﬂor-7-en-12alpha-ol from Wattakaka volubilis. Tetrahedron Letters, 43, 1307–1311.

Reveal, J.L. (1999). Selected families of angiosperms: Asteridae: Asclepi- adaceae. http://www.life.umd.edu/emeritus/reveal/pbio/pb450/aste03.html (accessed on Oct 10, 2007).

Rice-Evans, C.A., Miller, N.J. and Paganga, G. (1996). Structure-antioxidant activity relationships of ﬂavonoids and phenolic acids. Free Radical Biology and Medicine, 20, 933–956.

Ronquist, F. and Huelsenbeck, J.P. (2003). MrBayes 3: Bayesian phylogenetic inference under mixed models. Bioinformatics, 19, 1572–1574.

178 Roy, S., Sehgal, R., Padhy, B.M. and Kumar, V.L. (2005). Antioxidant and protective effect of latex of Calotropis procera against alloxan-induced diabetes in rats. Journal of Ethnopharmacology, 102, 470–473. Sahu, N.P., Mahato, S.B., Sarkar, S.K. and Poddar, G. (1996). Triterpenoid saponins from Gymnema sylvestre. Phytochemistry, 41, 1181–1185. Sakakibara, H., Honda, Y., Nakagawa, S., Ashida, H. and Kanazawa, K. (2003). Si- multaneous determination of all polyphenols in vegetables, fruits, and teas. Jour- nal of Agricultural and Food Chemistry, 51, 571–581. Sang, T., Crawford, D.J. and Stuessy, T.F. (1995). Documentation of reticulate evolution in Peonies (Paeonia) using internal transcribed spacer sequences of nuclear ribosomal DNA: Implications for biogeography and concerted evolution. Proceed- ings of the National Academy of Sciences USA, 92, 6813–6817. Santos-Buelga, C. and Williamson, G. (2003). Methods in polyphenol analysis. Royal Society of Chemistry Cambridge. Sarkaria, J.S. (1980). In search of the Frerea indica Dalz. Asclepiadaceae, 221, 29– 34. Scartezzini, P. and Speroni, E. (2000). Review on some plants of Indian traditional medicine with antioxidant activity. Journal of Ethnopharmacology, 71, 23–43. Schumann, K. (1895). Asclepiadaceae. In A. Engler and K. Prantl, eds., Die Natürlichen Pflanzenfamilien, vol. 4, 189–306, Engelmann, Leipzig. Schuppan, D., Jia, J.D., Brinkhaus, B. and Hahn, E.G. (1999). Herbal products for liver diseases: a therapeutic challenge for the new millennium. Hepatology, 30, 1099–104. Sen, S., Sahu, N.P. and Mahato, S.B. (1992). Flavonol glycosides from Calotropis gigantea. Phytochemistry, 31, 2919–2921. Sennblad, B. and Bremer, B. (1996). The familial and subfamilial relationships of Apocynaceae and Asclepiadaceae evaluated with rbcL data. Plant Systematics and Evolution, 202, 153–175. Sennblad, B. and Bremer, B. (2002). Classification of Apocynaceae s.l. according to a new approach combining Linnaean and phylogenetic taxonomy. Systematic Biology, 51, 389–409. Sennblad, B., Endress, M.E. and Bremer, B. (1998). Morphology and molecular data in phylogenetic fraternity: the tribe Wrightieae (Apocynaceae) revisited. American Journal of Botany, 85, 1143–1143. Sethi, A., Srivastav, S.S. and Srivastav, S. (2006). Pregnane glycoside from Hemidesmus indicus R. Br. Indian Journal of Heterocyclic Chemistry, 16, 191– 192. Shahat, A.A., Hassan, R.A., Nazif, N.M., Miert, S., Pieters, L., Hammuda, F.M. and Vlietinck, A.J. (2003). Isolation of mangiferin from Bombax malabaricum and structure revision of shamimin. Planta Medica, 69, 1068–1070.

179 Shan, B., Cai, Y.Z., Sun, M. and Corke, H. (2005). Antioxidant capacity of 26 spice extracts and characterization of their phenolic constituents. Journal of Agricul- tural and Food Chemistry, 53, 7749–7759. Sharma, H.M., Hanna, A.N., Kauffman, E.M. and Newman, H.A. (1992). Inhibi- tion of human low-density lipoprotein oxidation in vitro by Maharishi Ayur-Veda herbal mixtures. Pharmacology Biochemistry and Behaviour, 43, 1175–82. Sharma, P. (1983). Chikithsasthana. In: Charaka Samhita. Chaukhamba Orientalia, Varanasi. Sigler, P., Saksena, R., Deepak, D. and Khare, A. (2000). C21 steroidal glycosides from Hemidesmus indicus. Phytochemistry, 54, 983–987. Song, Y.C., Huang, W.Y., Sun, C., Wang, F.W. and Tan, R.X. (2005). Characteriza- tion of Graphislactone A as the antioxidant and free radical-scavenging substance from the culture of Cephalosporium sp. IFB-E001, an endophytic fungus in Tra- chelospermum jasminoides. Biological & Pharmaceutical Bulletin, 28, 506–509. Soobrattee, M.A., Bahorun, T. and Aruoma, O.I. (2006). Chemopreventive actions of polyphenolic compounds in cancer. BioFactors, 27, 19–35. Sosef, M. (1997). Hierarchical Models, Reticulate Evolution and the Inevitability of Paraphyletic Supraspecific Taxa. Taxon, 46, 75–85. Spera, D., Siciliano, T., De Tommasi, N., Braca, A. and Vessières, A. (2007). An- tiproliferative cardenolides from Periploca graeca. Planta Medica, 73, 384–387. Srivastava, S., Khare, M.P. and Khare, A. (1993). Cardenolide diglycosides from Oxystelma esculentum. Phytochemistry, 32, 1019–1021. Srivatsav, S., Deepak, D. and Khare, A. (1994). Three novel pregnane glycosides from Leptadenia reticulata Wight and Arn. Tetrahedron(Oxford. Print), 50, 789– 798. Stanner, S.A., Hughes, J., Kelly, C.N.M. and Buttriss, J. (2007). A review of the epidemiological evidence for the antioxidant hypothesis. Public Health and Nutrition, 7, 407–422. Strack, D. (1997). Phenolic metabolism. Plant Biochemistry, 1, 387–416. Struwe, L., Albert, V.A. and Bremer, B. (1994). Cladistics and family level classification of the Gentianales. Cladistics, 10, 175–206. Subbarayappa, B.V. (1997). Siddha medicine: an overview. Lancet, 350, 1841–1884. Sultana, S., Khan, N., Sharma, S. and Alam, A. (2003). Modulation of biochemical parameters by Hemidesmus indicus in cumene hydroperoxide-induced murine skin: possible role in protection against free radicals-induced cutaneous oxidative stress and tumor promotion. Journal of Ethnopharmacology, 85, 33–41. Supate, A.R., Gaikwad, D.K., Yadav, S.R. and Chavan, P.D. (1990). Crassulacean Acid Metabolism features occur in leafy forms of Ceropegia also. Photosynthetica, 24, 53–55.

180 Surh, Y.J. (2003). Cancer chemoprevention with dietary phytochemicals. Nature Reviews Cancer, 3, 768–780.

Surveswaran, S., Cai, Y.Z., Corke, H. and Sun, M. (2007). Systematic evaluation of natural phenolic antioxidants from 133 Indian medicinal plants. Food Chemistry, 102, 938–953.

Swarupanandan, K., Mangaly, J.K., Sonny, T.K., Kishorekumar, K. and Chand Basha, S. (1996). The subfamilial and tribal classiﬁcation of the family Asclepiadaceae. Botanical Journal of the Linnean Society, 120, 327–369.

Swoﬀord, D.L. (2002). PAUP*: Phylogenetic analysis using parsimony (and other methods) 4.0 Beta. Sunderland (MA): Sinauer Associates.

Taberlet, P., Gielly, L., Pautou, G. and Bouvet, J. (1991). Universal primers for ampliﬁcation of three non-coding regions of chloroplast DNA. Plant Molecular Biology, 17, 1105–1109.

Takhtajan, A.L. (1997). Diversity and classiﬁcation of ﬂowering plants. Columbia University Press, New York, USA.

Tavare, S. (1986). Some probabilistic and statistical problems on the analysis of DNA sequences. Lectures on Mathematics in the Life Sciences, 17, 57–86.

Thompson, J.D., Higgins, D.G., Gibson, T.J. et al. (1994). CLUSTAL W: improv- ing the sensitivity of progressive multiple sequence alignment through sequence weighting, position-speciﬁc gap penalties and weight matrix choice. Nucleic Acids Research, 22, 4673–4680.

Thyagarajan, S.P., Jayaram, S., Gopalakrishnan, V., Hari, R., Jeyakumar, P. and Sripathi, M. (2002). Herbal medicines for liver diseases in India. Journal of Gas- troenterology and Hepatology, 17, S370–S376.

Trosko, J.E. and Chang, C.C. (2001). Mechanism of up-regulated gap junctional intercellular communication during chemoprevention and chemotherapy of cancer. Mutation research, 480, 219–229.

Upadhyay, S.N. (1997). Plant products as immune response modulators. Proceed- ings of the International Ayurveda Conference-97, Sanjay Gandhi Post Graduate Institute of Medical Sciences, Lucknow.

Velioglu, Y.S., Mazza, G., Gao, L. and Oomah, B.D. (1998). Antioxidant activity and total phenolics in selected fruits, vegetables, and grain products. Journal of Agricultural and Food Chemistry, 46, 4113–4117.

Verhoeven, R.L., Liede, S. and Endress, M.E. (2003). The tribal position of Fockea and Cibirhiza (Apocynaceae: Asclepiadoideae): evidence from pollinium structure and cpDNA sequence data. Grana, 42, 70–81.

Vleggaar, R., Van Heerden, F.R., Anderson, L.A.P. and Erasmus, G.L. (1993). Toxic constituents of the Asclepiadaceae. Structure elucidation of Sarcovimiside A–C, pregnane glycosides of Sarcostemma viminale. Journal of the Chemical Society. Perkin transactions. I , 1, 483–487.

181 Wagenitz, G. (1992). The Asteridae: Evolution of a Concept and its Present Status. Annals of the Missouri Botanical Garden, 79, 209–217.

Wanntorp, L., Kocyan, A., van Donkelaar, R. and Renner, S.S. (2006). Towards a monophyletic Hoya (Marsdenieae, Apocynaceae): Inferences from the chloroplast trnL region and the rbcL-atpB spacer. Systematic Botany, 31, 586–596.

Warashina, T. and Noro, T. (2006). Glycosides of 14, 15-seco and 13, 14: 14, 15-disecopregnanes from the roots of Cynanchum sublanceolatum. Chemical and Pharmaceutical Bulletin, 54, 1551–1560.

Warrier, P.K., Nambiar, V.P.K. and Ramankutty, C. (1993). Indian medicinal plants: a compendium of 500 species. Orient Longman, Madras.

White, A. and Sloane, B.L. (1937). The Stapelieae 1-3 . Abbey Press, Pasadena, USA.

White, T.J., Bruns, T., Lee, S., Taylor, J. et al. (1990). Ampliﬁcation and direct sequencing of fungal ribosomal RNA genes for phylogenetics. In M. Innis, D. Gelfand, J. Sninsky and T. White, eds., PCR Protocols: A Guide to Methods and Applications, 315–322, Academic Press, San Diego.

Wolfe, K.L. and Liu, R.H. (2007). Cellular antioxidant activity(caa) assay for assessing antioxidants, foods, and dietary supplements. Journal of Agricultural and Food Chemistry, 55, 8896–8907.

Xiao, C.H., Yang, S.S. and Hong, X.K. (2000). The chemistry of traditional Chinese medicines. Shanghai Publishing House of Science and Technology, Shanghai.

Yadav, S.R. (1996). Fly trap ﬂowers of the Western Ghats. Hornbill, 1, 2–7.

Yadav, S.R. (2005). The genus Ceropegia L. (Asclepiadaceae) in Northern Western Ghats. Unpublished.

Yokozawa, T., Chen, C.P., Dong, E., Tanaka, T., Nonaka, G.I. and Nishioka, I. (1998). Study on the inhibitory eﬀect of tannins and ﬂavonoids against the 1, 1-Diphenyl-2-picrylhydrazyl radical. Biochemical Pharmacology, 56, 213–222.

Youdim, K.A., Spencer, J.P.E., Schroeter, H. and Rice-Evans, C. (2002). Dietary ﬂavonoids as potential neuroprotectants. Biological Chemistry, 383, 503–519.

Young, I.S. and Woodside, J.V. (2001). Antioxidants in health and disease. Journal of Clinical Pathology, 54, 176–186.

Zharkikh, A. (1994). Estimation of evolutionary distances between nucleotide sequences. Journal of Molecular Evolution, 39, 315–329.

Zhen, Y.Y., Huang, X.S., Yu, D.Q. and Yu, S.S. (2002). Antitumor alkaloids isolated from Tylophora ovata. Acta Botanica Sinica - Chinese edition, 44, 349–353.

Zheng, W. and Wang, S.Y. (2001). Antioxidant activity and phenolic compounds in selected herbs. Journal of Agricultural and Food Chemistry, 49, 5165–70.

182 Ziegler, H., Batanouny, K.H., Sankhla, N., Vyas, O.P. and Stichler, W. (1981). The photosynthetic pathway types of some desert plants from India, Saudi Arabia, Egypt, and Iraq. Oecologia, 48, 93–99.

Zwickl, D.J. (2006). GARLI (Genetic Algorithm for Rapid Likelihood Inference). Software available at http://www.bio.utexas.edu/faculty/antisense/garli/Garli.html (accessed on Oct 22, 2007).

183

View publication stats