Quantitative Analysis of Metabolic Pathways in Catharanthus Roseus

Iowa State University Capstones, Theses and Graduate Theses and Dissertations Dissertations

2009 Quantitative analysis of metabolic pathways in Catharanthus roseus hairy roots metabolically engineered for terpenoid indole alkaloid overproduction Guy William Sander Iowa State University

Follow this and additional works at: https://lib.dr.iastate.edu/etd Part of the Biological Engineering Commons, and the Chemical Engineering Commons

Recommended Citation Sander, Guy William, "Quantitative analysis of metabolic pathways in Catharanthus roseus hairy roots metabolically engineered for terpenoid indole alkaloid overproduction" (2009). Graduate Theses and Dissertations. 10820. https://lib.dr.iastate.edu/etd/10820

This Dissertation is brought to you for free and open access by the Iowa State University Capstones, Theses and Dissertations at Iowa State University Digital Repository. It has been accepted for inclusion in Graduate Theses and Dissertations by an authorized administrator of Iowa State University Digital Repository. For more information, please contact [email protected]. Quantitative analysis of metabolic pathways in Catharanthus roseus hairy roots metabolically engineered for terpenoid indole alkaloid overproduction

Guy William Sander II

A dissertation submitted to the graduate faculty

in partial fulfillment of the requirements for the degree of

DOCTOR OF PHILOSOPHY

Major: Chemical Engineering

Program of Study Committee: Jacqueline V. Shanks, Major Professor Brent H. Shanks Peter J. Reilly Eve Syrkin Wurtele David J. Hannapel

Iowa State University

Ames, Iowa

2009

Dedicated to

My Parents iii

Table of Contents

Table of Contents ...... iii

List of Tables ...... xvii

Acknowledgements ...... xviii

Abstract ...... xxi

Chapter 1 - Introduction ...... 1

Thesis Organization ...... 4

Figures ...... 7

References ...... 9

Chapter 2 – Literature Review ...... 11

Metabolic Engineering of Secondary Metabolism ...... 11

Measurement of Metabolic Fluxes ...... 15

Figures ...... 17

References ...... 19

Chapter 3 - Materials and Methods ...... 22

Alkaloid Extraction from Fresh Biomass ...... 22

HPLC Analysis of Metabolites ...... 22

Alkaloid Extraction from Growth Media ...... 23

References ...... 24

Chapter 4 – Metabolite and Gene Expression Analysis of Terpenoid Indole Alkaloid Pathways in Catharanthus roseus Seedlings Treated with Methyl Jasmonic Acid ...... 25

Abstract ...... 25

Abbreviations ...... 26

Introduction ...... 27

Materials and Methods ...... 29 iv

Plant growth ...... 29 Treatment with MeJA ...... 30 Isolation of housekeeping genes ...... 30 Analysis of reference mRNA levels ...... 31 qRT-PCR analysis of TIA genes...... 32 Extraction of alkaloids and HPLC analysis ...... 33

Results ...... 34

Isolation of C. roseus reference genes ...... 34 Analysis of the expression stability of C. roseus reference genes ...... 35 Time course of TIA gene expression in response to MeJA ...... 36 Metabolite analysis of C. roseus seedlings treated with MeJA ...... 37

Discussion ...... 38

Isolation and characterization of C. roseus reference genes ...... 38 Timing of MeJA induction of TIA mRNA and metabolite levels ...... 39

Acknowledgements ...... 42

Tables ...... 43

Figures ...... 45

References ...... 49

Chapter 5 - Transient Effects of Overexpressing Anthranilate Synthase α and β Subunits in Catharanthus roseus Hairy Roots in Light and Dark Conditions ...... 52

Abstract ...... 52

Introduction ...... 53

Materials and Methods ...... 55

Chemicals ...... 55 Culture Conditions ...... 56 Induction of the Catharanthus roseus Hairy root Lines ...... 56 Harvesting Hairy Root Cultures...... 57 Alkaloid Extraction ...... 57 HPLC Analysis of Metabolites ...... 58 LC-MS Analysis of Metabolites ...... 59 Flux Modeling Methodology ...... 59 Statistical Analysis ...... 63 v

Results ...... 63

Trends in Metabolite Levels ...... 64 Minimum Metabolic Flux Model...... 70

Discussion ...... 71

Effect of Light Adaptation ...... 72 Effect of Induced Overexpression of AS α with Constitutive Overexpression of AS β ...... 73 Effect of Light Adaptation with Induced Overexpression of AS α and Constitutive Overexpression of AS β ...... 74

Conclusions ...... 75

Acknowledgements ...... 78

Figures ...... 79

References ...... 92

Chapter 6 – Transient Effects of Overexpressing 1-deoxy-D-xylulose 5-phosphate synthase in Catharanthus roseus Hairy Roots in Light and Dark Conditions ...... 97

Abstract ...... 97

Introduction ...... 98

Materials and Methods ...... 100

Chemicals ...... 100 Culture Conditions ...... 100 Induction of the Catharanthus roseus Hairy root Lines ...... 101 Sample Preparation and Analysis ...... 101 Flux Modeling Methodology ...... 101 Statistical Analysis ...... 102

Results ...... 102

Trends in Metabolite Levels ...... 102 Minimum Metabolic Flux Model...... 106

Discussion ...... 107

Effect of Light Adaptation ...... 107 vi

Effect of Induced Overexpression of DXS ...... 108 Effect of Light Adaptation and Induced Overexpression of DXS ...... 110

Conclusions ...... 111

Acknowledgements ...... 113

Figures ...... 114

References ...... 125

Chapter 7 - Transient Effects of Overexpressing Tabersonine 16-hydroxylase in Catharanthus roseus Hairy Roots in Light and Dark Conditions...... 129

Abstract ...... 129

Introduction ...... 130

Materials and Methods ...... 132

Chemicals ...... 132 Culture Conditions ...... 132 Induction of the Catharanthus roseus Hairy root Lines ...... 133 Sample Preparation and Analysis ...... 133 Flux Modeling Methodology ...... 133 Statistical Analysis ...... 134

Results ...... 134

Trends in Metabolite Levels ...... 135 Minimum Metabolic Flux Model...... 138

Discussion ...... 140

Effect of Light Adaptation ...... 140 Effect of Induced Overexpression of T16H ...... 142 Effect of Light Adaptation with Induced Overexpression of T16H ...... 143

Conclusions ...... 144

Acknowledgements ...... 146

Figures ...... 147

References ...... 158 vii

Chapter 8 - Metabolic Engineering of Catharanthus roseus Hairy Roots for Terpenoid Indole Alkaloid Production under Light and Dark Conditions ...... 161

Abstract ...... 161

Introduction ...... 162

Materials and Methods ...... 164

Culture Conditions ...... 164 Induction of Catharanthus roseus Hairy Root Lines ...... 165 Catharanthus roseus Hairy Root Lines ...... 165 Harvesting Hairy Root Cultures...... 166 Alkaloid Extraction ...... 166 HPLC Analysis of Alkaloids ...... 166

Results ...... 167

Effect of light adaptation in the AS αβ1 hairy root line ...... 167 Effect of overexpression of AS β with induced overexpression of AS α ...... 168 Effect of overexpression of AS β with induced overexpression of AS α and light- adapted growth ...... 169 Effect of light adaptation in the DXS hairy root line ...... 169 Effect of induced overexpression of DXS ...... 170 Effect of induced overexpression of DXS and light-adapted growth ...... 170 Effect of light adaptation in the T16H hairy root line ...... 170 Effect of induced overexpression of T16H ...... 171 Effect of induced overexpression of T16H and light-adapted growth ...... 171

Discussion ...... 172

Effect of Light Adaptation ...... 172 Effect of gene induction ...... 173 Effect of gene induction and light-adapted growth ...... 174

Conclusions ...... 175

Acknowledgements ...... 176

Figures ...... 176

References ...... 180

viii

Chapter 9 – Proof of Concept of Metabolic Flux Analysis of Catharanthus roseus Hairy Roots Expressing an Inducible Feedback-resistant Anthranilate Synthase α subunit by using Biosynthetically Directed Fractional 13 C-labeling and Bondomer Balancing with 13 C-labeling Introduced at the Time of Gene Induction ...... 183

Abstract ...... 183

Introduction ...... 184

Materials and Methods ...... 185

Chemicals ...... 185 Culture Conditions ...... 185 Induction of Catharanthus roseus Hairy Root Line ...... 185 Experimental scheme to introduce 13 C label at the time of induction ...... 186 Catharanthus roseus Hairy Root Line ...... 186 Harvesting Hairy Root Cultures...... 186 Protein Extraction ...... 187 Protein Dialysis ...... 187 Protein Hydrolysis ...... 187 HPLC Analysis of Sugars ...... 188

Preliminary Results ...... 188

Development of experimental scheme to introduce 13 C label at the time of induction ...... 189 Metabolic flux maps of hairy root line with induced expression of AS α ...... 190

Acknowledgements ...... 192

Figures ...... 193

References ...... 198

Chapter 10 - Conclusions, Global Perspectives, and Future Directions ...... 199

Conclusions ...... 199

Global Perspectives ...... 201

Future Directions ...... 207

Tables ...... 209

References ...... 211 ix

Appendix A – Five year maintenance of the inducible expression of anthranilate synthase in Catharanthus roseus hairy roots ...... 214

Abstract ...... 214

Introduction ...... 215

Materials and Methods ...... 216

Culture Conditions ...... 216 Genomic PCR ...... 216 Induction of AS αβ Activity and Alkaloid Extraction and Detection ...... 217 Anthranilate Synthase Enzyme Assay ...... 217

Results and Discussion ...... 218

Acknowledgments ...... 220

Appendix B - The expression of 1-deoxy-D-xylulose synthase and geraniol 10- hydroxylase or anthranilate synthase increases terpenoid indole alkaloid accumulation in Catharanthus roseus hairy roots ...... 225

Materials and Methods ...... 230

Plasmid Construction ...... 230 Generation of Hairy Root Lines ...... 231 Hairy Root Culture Conditions ...... 231 Genomic PCR Analysis ...... 232 RNA Isolation and Northern Analysis ...... 232 Induction Study and HPLC analysis ...... 233 LCMS analysis ...... 233

Results ...... 234

Discussion ...... 237

Acknowledgements ...... 240

Abbreviations ...... 240

Tables ...... 241

Figures ...... 243

References ...... 246 x

Appendix C - Ultraviolet and Mass Spectra of Catharanthus roseus Metabolites...... 251

Introduction and Discussion ...... 251

Materials and Methods ...... 252

Chemicals ...... 252 HPLC Analysis of Metabolites ...... 253 LC-MS Analysis of Metabolites ...... 254

Acknowledgements ...... 255

Figures ...... 255

References ...... 265

Appendix D - Terpenoid Indole Alkaloid Extraction and Purification from Catharanthus roseus Hairy Root Tissue ...... 267

Abstract ...... 267

Introduction ...... 268

Material and Methods ...... 270

Semi-preparative Alkaloid Extraction ...... 270 Analytical HPLC Analysis ...... 271 Analytical-scale HPLC Method with Preferential Separation of Tabersonine-like Compounds ...... 271 Semi-preparative-scale HPLC Method for Fraction Collection of Alkaloids ...... 272

Results and Discussion ...... 273

Challenges of Alkaloid Extraction Scale-up ...... 273 Challenges of HPLC Scale-up ...... 273

Acknowledgements ...... 275

Tables ...... 275

Figures ...... 276

References ...... 284

List of Figures

Figure 1.1 Structure of Vinblastine...... 7 Figure 1.2 Structure of vincristine...... 7 Figure 1.3 Structure of antineoplastic compounds derived from vinblastine...... 8 Figure 2.1 Regulation of the indole pathway in Catharanthus roseus ...... 17 Figure 2.2 Isotopomers (isotope isomers) and bondomers (bond isomers) of a three- carbon metabolite...... 18 Figure 4.1 Terpenoid indole alkaloid pathways of C. roseus ...... 45 Figure 4.2 Stability of expression of selected reference genes from C. roseus ...... 46 Figure 4.3 Expression of ORCA3-regulated genes following MeJA application...... 47 Figure 4.4 Time course of alterations in TIA levels in response to MeJA treatment...... 48 Figure 5.1 Biosynthesis of terpenoid indole alkaloids in Catharanthus roseus ...... 80 Figure 5.2 Regulation of the indole pathway in Catharanthus roseus ...... 80 Figure 5.3 Biosynthesis of tabersonine derivatives in Catharanthus roseus ...... 81 Figure 5.4 Scheme of biosynthetic reactions for the metabolic flux model...... 82 Figure 5.5 Tryptophan levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 83 Figure 5.6 Tryptamine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 83 Figure 5.7 Loganin levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 84 Figure 5.8 Secologanin levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 84 Figure 5.9 Strictosidine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 85 Figure 5.10 Catharantine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 85 Figure 5.11 Ajmalicine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 86 Figure 5.12 Serpentine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 86 Figure 5.13 The corynanthe alkaloid pool (serpentine + ajmalicine) levels over a 72- hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 87 xii

Figure 5.14 Tabersonine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 87 Figure 5.15 Lochnericine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 88 Figure 5.16 Hörhammericine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 88 Figure 5.17 The aspidosperma alkaloid pool (tabersonine + lochnericine + hörhammericine) levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 89 Figure 5.18 Total measured terpenoid indole alkaloid (strictosidine + catharanthine + serpentine + ajmalicine + tabersonine + lochnericine + hörhammericine) levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 89 Figure 5.19 The summation of the metabolite pool (tryptamine + secologanin + strictosidine) at the coalescence point of the indole and iridoid glycoside pathways over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 90 Figure 5.20 Minimum flux map for uninduced and induced dark-grown ASAB-1 cultures...... 91 Figure 5.21 Minimum flux map for uninduced and induced light-grown ASAB-1 cultures...... 92 Figure 6.1 Biosynthesis of terpenoid indole alkaloids in Catharanthus roseus ...... 115 Figure 6.2 Biosynthesis of tabersonine derivatives in Catharanthus roseus ...... 116 Figure 6.3 Scheme of biosynthetic reactions for the metabolic flux model...... 117 Figure 6.4 Loganin levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 118 Figure 6.5 Secologanin levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 118 Figure 6.6 Strictosidine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 119 Figure 6.7 Catharanthine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 119 Figure 6.8 Ajmalicine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 120 Figure 6.9 Serpentine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 120 xiii

Figure 6.10 The corynanthe alkaloid pool (serpentine + ajmalicine) levels over a 72- hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 121 Figure 6.11 Tabersonine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 121 Figure 6.12 Lochnericine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 122 Figure 6.13 Hörhammericine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 122 Figure 6.14 The aspidosperma alkaloid pool (tabersonine + lochnericine + hörhammericine) levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 123 Figure 6.15 Total measured terpenoid indole alkaloid (strictosidine + catharanthine + serpentine + ajmalicine + tabersonine + lochnericine + hörhammericine) levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 123 Figure 6.16 Minimum flux map for uninduced and induced dark-grown EHIDXS-4-1 cultures...... 124 Figure 6.17 Minimum flux map for uninduced and induced light-grown EHIDXS-4-1 cultures...... 125 Figure 7.1 Biosynthesis of terpenoid indole alkaloids in Catharanthus roseus ...... 148 Figure 7.2 Biosynthesis of tabersonine derivatives in Catharanthus roseus ...... 149 Figure 7.3 Scheme of biosynthetic reactions for the metabolic flux model...... 150 Figure 7.4 Loganin levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 151 Figure 7.5 Secologanin levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 151 Figure 7.6 Strictosidine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 152 Figure 7.7 Catharanthine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 152 Figure 7.8 Ajmalicine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 153 Figure 7.9 Serpentine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 153 xiv

Figure 7.10 The corynanthe alkaloid pool (serpentine + ajmalicine) levels over a 72- hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 154 Figure 7.11 Tabersonine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 154 Figure 7.12 Lochnericine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 155 Figure 7.13 Hörhammericine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 155 Figure 7.14 The aspidosperma alkaloid pool (tabersonine + lochnericine + hörhammericine) levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 156 Figure 7.15 Total measured terpenoid indole alkaloid (strictosidine + catharanthine + serpentine + ajmalicine + tabersonine + lochnericine + hörhammericine) levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b)...... 156 Figure 7.16 Minimum flux map for uninduced and induced dark-grown EHIT16H-34-1 cultures...... 157 Figure 7.17 Minimum flux map for uninduced and induced light-grown EHIT16H-34-1 cultures...... 158 Figure 8.1 The chemical structure of vincristine (Figure source:[22, 23, 24])...... 176 Figure 8.2 Biosynthesis of terpenoid indole alkaloids in Catharanthus roseus ...... 177 Figure 8.3 Effect of lighted growth and gene induction in AS αβ ...... 178 Figure 8.4 Effects of lighted growth and gene induction in DXS...... 179 Figure 8.5 Effects of lighted growth and gene induction in T16H...... 180 Figure 9.1 Biomass Transfer Protocol for Catharanthus roseus hairy roots...... 193 Figure 9.2 Growth Study of Biomass Transfer Protocol...... 194 13 1 Figure 9.3 2-D NMR [ C, H] HSQC spectrum of Catharanthus roseus hairy root protein hydrolysate...... 196 Figure 9.4 Flux map of primary and intermediate metabolism in C. roseus hairy roots grown on (5% U–13 C) sucrose...... 198 Figure A.1 Genomic PCR confirmation of the AS α insert in C. roseus hairy root line AS αβ -1 at 5 years...... 221 Figure A.2 Enzyme activity of anthranilate synthase (AS) 5 years after first being transferred to liquid media...... 222 xv

Figure A.3 The change in tryptophan and tryptamine concentrations over time in liquid culture...... 222 Figure A.4 The change in terpenoid indole alkaloid (TIA) concentrations over time in liquid culture...... 223 Figure B.1 Terpenoid indole alkaloid pathway...... 243 Figure B.2 Northern analysis of lines EHINC-12-1 and EHIDXS-4-1...... 244 Figure B.3 Genomic PCR of the G10H and DXS gene insert in C. roseus hairy root line G10H/DXS-1 and G10H/DXS-21...... 245 Figure B.4 Genomic PCR of the AS α and DXS gene insert in C. roseus hairy root lines ASA/DXS-1, -2, -4, -10, and -21...... 246 Figure C.1 UV spectra of tryptophan standard...... 255 Figure C.2 UV spectra of tryptamine standard...... 256 Figure C.3 UV spectra of geraniol standard...... 256 Figure C.4 UV spectra of 10-hydroxygeraniol standard...... 257 Figure C.5 UV spectra of loganin standard...... 257 Figure C.6 UV spectra of secologanin standard...... 258 Figure C.7 UV spectra of strictosidine standard...... 258 Figure C.8 UV spectra of ajmalicine standard...... 259 Figure C.9 UV spectra of serpentine standard...... 259 Figure C.10 UV spectra of catharanthine standard...... 260 Figure C.11 UV spectra of tabersonine standard...... 260 Figure C.12 UV spectra of lochnericine from a crude extract of Catharanthus roseus hairy roots...... 261 Figure C.13 UV spectra of horhammericine standard...... 261 Figure C.14 UV spectra of vindoline standard...... 262 Figure C.15 UV spectra of vinblastine standard...... 262 Figure C.16 UV spectra of vincristine standard...... 263 Figure C.17 Mass spectra of geraniol standard...... 263 Figure C.18 Mass spectra of 10-hydroxygeraniol standard...... 264 Figure C.19 Mass spectra of loganin standard...... 264 Figure C.20 Mass spectra of secologanin standard...... 265 Figure D.1 Structure of vinblastine (a) and vincristine (b)...... 276 xvi

Figure D.2 Biosynthesis of terpenoid indole alkaloids in Catharanthus roseus ...... 277 Figure D.3 Efficiency of alkaloid extraction protocols...... 277 Figure D.4 Chromatograms at 329 nm for increasing fractions of methanol in the HPLC mobile phase...... 278 Figure D.5 Chromatograms of the analytical and semi-preparative scale HPLC methods at 329 nm...... 279 Figure D.6 UV spectra of tabersonine standard...... 280 Figure D.7 UV spectra of tabersonine fraction collected...... 280 Figure D.8 UV spectra of lochnericine fraction collected...... 281 Figure D.9 UV spectra of hörhammericine fraction collected...... 281 Figure D.10 UV spectra of tabersonine-like unknown-1 fraction collected...... 282 Figure D.11 UV spectra of tabersonine-like unknown-2 fraction collected...... 282 Figure D.12 UV spectra of tabersonine-like unknown-3 fraction collected...... 283 Figure D.13 UV spectra of tabersonine-like unknown-4 fraction collected...... 283

xvii

List of Tables

Table 4.1 Isolation of C. roseus genes...... 43 Table 4.2 Primers for qRT-PCR analyses of C. roseus reference and TIA biosynthetic genes...... 44 Table 10.1 Influence of flux on the levels of corynanthe alkaloids in light-adapted hairy root cultures...... 209 Table 10.2 Influence of flux on the levels of corynanthe alkaloids in hairy roots with gene induction...... 210 Table 10.3 Influence of flux on the levels of corynanthe alkaloids in light adapted hairy roots of C. roseus with gene induction ...... 210 Table 10.4 Influence of biosynthetic gene expression on aspidosperma alkaloids in hairy roots of C. roseus...... 211 Table B.1 Tryptophan and tryptamine content of 4 different hairy root lines...... 241 Table B.2 Terpenoid indole alkaloid content of 4 different hairy root lines...... 242 Table D.1 Concentrations of hörhammericine, lochnericine, tabersonine, and tabersonine-like unknowns...... 275

xviii

Acknowledgements

I am grateful to my advisor, Dr. Jacqueline V. Shanks, for providing me with continued support and encouragement, freedom to pursue my own avenues, and invaluable guidance.

I would like to thank…

Drs. Brent H. Shanks, Peter J. Reilly, Eve S. Wurtele, and David J. Hannapel for serving on my Program of Study committee.

Dr. Ka-Yiu San for your helpful insight and ideas, and being a co-principal investigator for my research. Also, to past members of your research group for laying the groundwork and generating the Catharanthus roseus hairy root lines.

Dr. Christie A.M. Peebles for all the conversations, both in person and via email, about my research and the techniques and ideas I received from you. Also, for your collaboration on several projects.

Dr. Susan I. Gibson for your time invested into our collaboration and for being a co- principal investigator for my research.

Dr. Shu Wei for you collaboration on the MeJA seedlings paper.

Dr. Ann Perera at the W.M. Keck Metabolomics Facility for your helpful advice in using the LCMS and data analysis.

The faculty of the Chemical and Biological Engineering Department, the

Biochemistry, Biophysics, and Molecular Biology Department, and the Genetics,

Development, and Cell Biology Department at Iowa State University for the time and energy invested in teaching me in your classes. xix

Drs. Ganesh Sriram and Vidya Iyer for laying ground work in metabolic flux analysis and for the knowledge you passed on to me.

Past members of the Shanks research group, Dr. Murali Subramanian, Sarah Rollo, and Madhuresh Choudhary, for your insight during group meetings and help with techniques in the lab.

My officemates, Dr. Jong Moon Yoon and Quyen Truong, for your advice and ideas, and most importantly, procrastinating conversations.

My former officemate, Dr. Anthony Hill, for the long conversations and everything you taught me about computers and recovering data from hard drives.

Dr. Ramon Gonzalez for mentoring me while I TA’d your class and the feedback from you and your group members during group meetings.

Dr. Laura Jarboe and group members for comments on my research in group meetings.

All of my current and former undergraduate lab assistants, Christine Westgate, Omar

Gonzalez-Rivera, Ricardo Guraieb Chahín, James Douglas Vandermyde, Lee Rudebusch,

Meredith Breton, and Diane Brown, for all of your time, insight, and hard work.

Dr. Stephanie Loveland for the wonderful experience while TAing and FAing the undergraduate unit-ops labs under your guidance.

The Chemical Engineering graduate student body for the wonderful interactions, whether in class, in the lab, or off-campus. Particular thanks to Kerry Campbell, Matt

Aspelund, Ross Behling, Chris Warner, and Dr. Karl Albrecht. xx

The wonderful staff of the Chemical and Biological Engineering Department, DeAnn

Pitman, Kathye Law, Jody Danielson, Linda Edson, Christi Patterson, Wendy Ortman, and

Don Schlagel.

The National Science Foundation, the Roy J. Carver Fellowship program, and the

Graduate College of Iowa State University for funding my research, stipend, and tuition.

The many and wonderful friends I have made here at ISU and Ames. A very special

thanks to those among the inner circle .

My insightful brother for the evolving discussions and article trading.

My incredible parents, whose guidance, trust, support, and values have brought me to

where I am today. Whether or not the stars aligned or extra baking was required, I would not be here without you.

My fantastic wife, whose support, love, friendship, and companionship inspires me and keeps me going. Time is irrelevant when you have Peaches forever.

Guy William Sander II xxi

Abstract

The important anticancer pharmaceuticals, vinblastine and vincristine, are produced

by Catharanthus roseus . Given their cytotoxicity, these valuable alkaloids are produced in very small quantities within the aerial parts of the plant. The high cost of isolating the drugs has led to research efforts to increase the alkaloid content of C. roseus cell cultures, tissue cultures, and seedlings. The metabolic engineering of C. roseus strives to overcome the strict regulation of the biosynthetic pathways.

Seedlings of C. roseus were elicited with methyl jasmonate (MeJA) to induce expression of octadecanoid-responsive Catharanthus AP2-domain 3 (ORCA3), a transcription regulator of several biosynthetic genes. ORCA3 exhibited increases up to 25- fold observed 0.5 h after MeJA treatment with the transcript levels of biosynthetic genes following with variable timing. The amounts of certain terpenoid indole alkaloid (TIA) metabolites, including the important vinblastine precursors, catharanthine and vindoline, were increased significantly.

Three hairy root cultures of C. roseus were investigated. The ASAB-1 line expressing a feedback-resistant anthranilate synthase (AS) α subunit from Arabidopsis under the control of a glucocorticoid-inducible promoter and an AS β subunit from Arabidopsis under the control of the constitutive CaMV 35S promoter, the EHIDXS-4-1 line expressing

1-deoxy-D-xylulose 5-phosphate synthase (DXS) under the control of a glucocorticoid- inducible promoter, and the EHIT16H-34-1 line tabersonine 16-hydroxylase (T16H) under the control of a glucocorticoid-inducible promoter. These lines were used to investigate the regulatory nature of the biosynthetic network by quantifying the effect of light-adaptation, biosynthetic enzyme overexpression, and the combination of these two factors on the xxii

production of TIAs. Comprehensive metabolite profiling and a stoichiometric model were employed to reveal mechanisms of regulation. The results point towards controlling metabolite degradation as a potential focus for metabolic engineering efforts.

A proof of concept of a method for the introduction of 13 C-labeling at the time of

gene induction and preliminary results are presented. This method allows for the creation of

metabolic flux maps of central carbon metabolism before and after the gene has been

induced. The flux maps will reveal limitations in central carbon metabolism that affect the

production potential of secondary metabolism.

The long term stability of a transgenic C. roseus hairy root line containing the

inducible expression of a feedback-insensitive AS α is reported. After 5 years in liquid culture, the presence and inducible expression of the inserted AS gene was confirmed. This report also demonstrates that it may take as long as two years for the metabolite profile to stabilize.

Transgenic C. roseus hairy root lines were created that individually overexpress DXS and geraniol 10-hydroxylase (G10H) under the control of a glucocorticoid-inducible promoter. Double overexpression lines that overexpress DXS and AS α subunit or DXS and

G10H with both genes under control of a glucocorticoid-inducible promoter were also

created. The double overexpression lines displayed pertinent increases in TIA levels,

surpassing the single overexpression lines.

The value of ultraviolet (UV) and mass spectra in identifying compounds in

chromatographic methods is presented. The UV and mass spectra of important C. roseus

secondary metabolites are included.

A method for the isolation of important C. roseus alkaloids is presented. A biomass xxiii

extraction and analytical HPLC protocol was adapted for semi-preparative-scale in order to obtain tabersonine, lochnericine, and hörhammericine standards. Previously unidentified tabersonine-like compounds were also isoloated for future identification.

Chapter 1 - Introduction

For thousands of years we have relied on the medicinal properties of plant species.

Ancient records feature Mother Nature as the pharmaceutical provider of thousands of drugs derived from plant sources [1]. An often cited article by Farnsworth et al. (1985) details that

80% of the world’s population relies on traditional medicine for primary health care needs and, in the United States from 1959 to 1980, 25% of prescriptions filled contain active substances from plants [2]. Duke (1993) updated this figure by stating that 10% of drugs are derived from plants and 15% are synthetically or semi-synthetically produced as an alternative to the natural source of drugs where they were once derived from plants or were patterned after compounds derived from plants. The shift to synthetics is a result of proprietary economics since a natural herbal product is generally unpatentable [3]. There is a lot of money to be made in health care, especially in the United States where the per capita expenditure on pharmaceuticals in 2005 was $792 [4] and the total health spending per capita was $6714 in 2006 [5].

The rise in use of combinatorial chemistry as source material created vast libraries of molecules and directed the pharmaceutical industry away from natural products. This led to a 24-year low in the number of new active substances (NASs) as the increase of potential compounds investigated failed to produce NASs [6]. Pharmaceutical companies are now returning to natural sources for novel chemistry. Some companies are using combinatorial techniques to modify the skeletons of active natural products in effort to discover novel drugs

[6]. As reviewed in Newman and Cragg (2007), natural products are useful as a starting point for new medicines, where they found that 73% of drugs (from 1940 to 2006) used in cancer treatment were from an other-than-synthetic source [6]. This means that the drugs 2

were natural, derived from a nature product, formerly derived from a natural product but now

created synthetically, or designed to mimic a the function of natural compound from

biological data such as a compound that binds to a protein active site based on the crystal structure of the protein [7]. Drugs that were either natural or directly derived from natural products accounted for 47% [6].

The investigation of plants commonly used in folk medicine has yielded useful pharmaceutical knowledge. Catharanthus roseus was originally investigated as an oral

treatment for diabetes, as reputed by folklore. Analysis of its extracts revealed a wealth of

chemical components, including terpenoid indole alkaloids (TIAs). Two of these

components, vinblastine and vincristine (Figures 1.1 and 1.2), have antineoplastic properties

and have been used in chemotherapy since the 1960s as Velban® and Oncovin®,

respectively, by Eli Lilly (discovery is reviewed in [8]). Other alkaloids yielded from root

extracts such as ajmalicine and serpentine are used as anti-hypertensives [9].

The high pharmaceutical cost associated with vinblastine and vincristine is a result of

the very low quantities in which they are produced in planta and the isolation of these

compounds from extracts. A total of 1000 kg of leaf and stem material is required to produce

1 g and 20 mg, respectively, of product [10]. The precursors, catharanthine and vindoline,

can also be used to semi-synthesize vinblastine and vincristine [9].

A number of derivatives to vincristine or vinblastine have been created in effort to

decrease toxicity while increasing effectiveness (Figure 1.3)(reviewed in [11]). Vindesine

(Eldisine®, Eli Lilly) came on the market in 1980 [12] and has been followed by others such

as vinorelbine (Navelbine®, GlaxoSmithKline) (FDA approved 1994, [13]), and a uniquely

fluorinated derivative, Vinflunine (Javlor®, Pierre Fabre Medicament), that has reached 3

phase III clinical trials [11, 14]. The production of these drugs still relies on the C. roseus plant for the generation of the TIA precursors, vindoline and catharanthine [15].

The alkaloid biosynthesis pathway in C. roseus is very complex and produces

approximately 130 different alkaloids [12]. Biosynthetic reactions producing vincristine

occur in five different subcellular compartments, three or more different cell types [16, 17,

18], and requires the participation of at least 35 intermediates and 30 enzymes [12]. Not all

of the enzymes in the pathway are known [19] and because of this, expression in bacterial

and yeast systems cannot be used for full biosynthesis. Straight chemical synthesis is not

possible given the chemical structure complexity and stereochemistry [19] (Figures 1.1 and

1.2). Considerable efforts have been made towards the production of alkaloids by plant cell

or tissue culture. Commercial-scale plant cell cultures are economically viable for other

products such as shikonin (naphthoquinone) and berberine (alkaloid) [20] that are active

substances from plants used in Traditional Chinese Medicine. However, undifferentiated

cells of C. roseus do not produce vindoline and the alkaloid levels of tissue cultures are too

low for commercial production [12, 21]. For production to be economically feasible,

volumetric productivity (mg/l/day) and the productivity advantage over field-grown plants

must be significant to overcome the costs associated with bioreactors and raw materials [20].

However, cell and tissue cultures provide a good environment for the investigation of

metabolism, biosynthetic enzymes, control signaling, and pathway bottlenecks. This

knowledge aids in the metabolic engineering of cell and tissue cultures where enzymes are

specifically targeted for transgenic overexpression to result in higher yields.

Characterization of metabolism is important to help understand the implications of

engineering a biosynthetic pathway. Often, merely suppressing expression or overexpressing 4

an enzyme will not result in the desired outcome. Secondary metabolism has many layers of regulation, creating a complex array of outcomes. The iterative process of metabolic engineering learns from past efforts to help guide future engineering endeavors.

This research characterizes the metabolic effects of inducible overexpression of genes in the alkaloid biosynthesis pathways in C. roseus hairy root cultures. We investigate the changes to metabolite profiles and fluxes and new methods to elucidate metabolic fluxes in central carbon metabolism of transgenic lines. Towards this effort we have developed High

Performance Liquid Chromatography (HPLC) and Liquid Chromatography-Mass

Spectrometry (LC-MS) protocols to measure and identify metabolites and their fluxes, along with Nuclear Magnetic Resonance (NMR) protocols, analysis tools, and experimental designs to measure metabolic fluxes of central metabolism. Each chapter of this thesis is summarized in the following section.

Thesis Organization

This thesis is organized in the following manner.

Chapter 2 is a literature review detailing metabolic engineering efforts in secondary metabolites and metabolic flux analysis.

Chapter 3 describes the materials and methods used in this work and other methods developed along the way.

Chapter 4 is a paper in preparation for Plant Cell Reports that investigates the influence of methyl jasmonic acid elicitation on the transient transcription levels of enzymes in the terpenoid indole alkaloid pathway along with transient levels of TIAs in seedlings of

C. roseus . 5

Chapter 5 details experiments using the expression of the anthranilate synthase (AS)

α subunit under the glucocorticoid-inducible promoter system, along with the expression of

the AS β subunit under the control of the constitutive CaMV 35S promoter in C. roseus hairy

root cultures, in an effort to alter levels and fluxes of TIAs.

Chapter 6 details experiments using the expression of 1-deoxy-D-xylulose 5-

phosphate synthase (DXS) under the glucocorticoid-inducible promoter system in C. roseus

hairy root cultures, in an effort to alter levels and fluxes of TIAs.

Chapter 7 details experiments using the expression of tabersonine 16-hydroxylase

(T16H) under the glucocorticoid-inducible promoter system in C. roseus hairy root cultures, in an effort to alter levels and fluxes of TIAs.

Chapter 8 is adapted from a paper published in the Proceedings of the 37 th Annual

Biochemical Engineering Symposium . This work characterizes metabolic engineering efforts of the TIA biosynthesis pathway within hairy root cultures of C. roseus at three locations within the biosynthetic network. The transgenic lines were also light-adapted to investigate light-mediated regulation of the biosynthesis pathways.

Chapter 9 details proof of concept experiments designed to compare 13 C metabolic flux analysis performed on C. roseus hairy root cultures with inducible expression of the

AS α subunit under the glucocorticoid-inducible promoter system.

Chapter 10 discusses the conclusions of this work, examines global perspectives of the metabolic engineering of C. roseus , and outlines future directions.

Appendix A is a paper published in Biotechnology and Bioengineering that demonstrates the long-term stability of the C. roseus hairy root line that expresses the AS α 6

subunit under the glucocorticoid-inducible promoter system along with the expression of the

AS β subunit under the control of the constitutive CaMV 35S promoter.

Appendix B is a draft of a paper for Metabolic Engineering or Biotechnology and

Bioengineering investigating the expression of upstream biosynthetic enzymes under the glucocorticoid-inducible promoter system in C. roseus hairy root cultures. Enzymes are

overexpressed individually or in pair with the intention of increasing the levels of TIAs.

Appendix C describes the usefulness of ultraviolet (UV) and mass spectra in

identifying compounds during HPLC and LC-MS analysis. The UV and mass spectra of

important C. roseus metabolites are included.

Appendix D is a report on a semi-preparative-scale HPLC method for the isolation of

important C. roseus TIAs for use as standards and the isolation of other metabolites for future

identification. 7

Figures

N N H H H3CO2C

H3CO OCOCH3

N CO CH H 2 3 OH H3C

Figure 1.1 Structure of Vinblastine. (Figure adapted from: [22, 23, 24])

N N H H H3CO2C

H3CO OCOCH3

N CO CH H 2 3 O OH

Figure 1.2 Structure of vincristine. The circled area denotes structural differences from vinblastine. (Figure adapted from: [22, 23, 24]) 8

N Figure 1.3 Structure of antineoplastic compounds derived from vinblastine. Structural changes have been made to vinblastine in effort to increase the effectiveness and decrease the toxicity, N N H H resulting in vindesine (a), vinorelbine (b), and H3CO2C vinflunine (c). The circled areas denote structural differences from vinblastine. H3CO (Figure adapted from: [14, 22, 23, 24]) OH

O N H OH H3C NH2

N N H H H3CO2C

H3CO OCOCH3

N CO CH H 2 3 OH H3C

H F

N F

N N H H H3CO2C

H3CO OCOCH3

N CO CH H 2 3 OH H3C 9

References

1. Cragg, G.M. and D.J. Newman. (2005) Biodiversity: A Continuing Source of Novel Drug Leads . Pure Appl. Chem. 77 (1): 7-24. 2. Farnsworth, N.R., O. Akerele, A.S. Bingel, D.D. Soejarto, and Z. Guo. (1985) Medicinal Plants in Therapy . Bull. WHO . 63 (6): 965-981. 3. Duke, J.A. (1993) Medicinal Plants and the Pharmaceutical Industry, in New Crops : 664-669, J. Janick and J.E. Simon, Editors. Wiley: New York. 4. Pharmaceutical Pricing Policies in a Global Market , in OECD Health Policy Studies . (2008) Organisation for Economic Co-operation and Development. Accessed May 15, 2009. http://www.oecd.org/document/36/0,3343,en_2649_33929_41000996_1_1_1_37407, 00.html . 5. OECD Health Data 2008: How Does the United States Compare . (2008) Organisation for Economic Co-operation and Development. Accessed May 15, 2009. http://www.oecd.org/dataoecd/46/2/38980580.pdf . 6. Newman, D.J. and G.M. Cragg. (2007) Natural Products as Sources of New Drugs over the Last 25 Years . J. Nat. Prod. 70 (3): 461-477. 7. Newman, D.J., G.M. Cragg, and K.M. Snader. (2003) Natural Products as Sources of New Drugs over the Period 1981-2002 . J. Nat. Prod. 66 (7): 1022-1037. 8. Nobel, R.L. (1990) The Discovery of the Vinca Alkaloids--Chemotherapeutic Agents Against Cancer . Biochem. Cell Biol. 68 (12): 1344-1351. 9. Shanks, J.V., R. Bhadra, J. Morgan, S. Rijhwani, and S. Vani. (1998) Quantification of Metabolites in the Indole Alkaloid Pathways of Catharanthus roseus : Implications for Metabolic Engineering . Biotechnol. Bioeng. 58 (2 & 3): 333-338. 10. Tyler, V.E. (1988) Medicinal Plant Research: 1953-1987 . Planta Med . 54 : 95-100. 11. Fahy, J. (2001) Modifications of the "Upper" or Velbenamine Part of the Vinca Alkaloids have Major Implications of Tubulin Interacting Activities . J. Curr. Pharm. Des. 7(13): 1181-1197. 12. van der Heijden, R., D.I. Jacobs, W. Snoeijer, D. Hallard, and R. Verpoorte. (2004) The Catharanthus Alkaloids: Pharmacognosy and Biotechnology . Curr. Med. Chem. 11 (5): 607-628. 13. Vinorelbine , in Cancer Drug Guide . (2008) American Cancer Society. Accessed March 8, 2009. http://www.cancer.org/docroot/CDG/content/CDG_vinorelbine.asp . 14. Bennouna, J., J.-P. Delord, M. Campone, and L. Nguyen. (2008) Vinflunine: A New Microtubule Inhibitor Agent . Clin. Cancer Res. 14 (6): 1625-1632. 15. Levac, D., J. Murata, W.S. Kim, and V. De Luca. (2008) Application of Carborundum Abrasion for Investigating the Leaf Epidermis: Molecular Cloning of Catharanthus roseus 16-hydroxytabersonine-16-O-methyltransferase . Plant J. 53 : 225-236. 16. Facchini, P.J. and B. St-Pierre. (2005) Synthesis and trafficking of alkaloid biosynthesis enzymes . Curr Opin Plant Biol . 8: 657-666. 17. De Luca, V. and B. St-Pierre. (2000) The Cell and Developmental Biology of Alkaloid Biosynthesis . Trends Plant Sci . 5(4): 168-173. 10

18. Murata, J., J. Roepke, H. Gordon, and V. De Luca. (2008) The Leaf Epidermome of Catharanthus roseus Reveals Its Biochemical Specialization . Plant Cell . 20 : 524-542. 19. Pasquali, G., D.D. Porto, and A.G. Fett-Neto. (2006) Metabolic Engineering of Cell Cultures Versus Whole Plant Complexity in Production of Bioactive Monoterpene Indole Alkaloids: Recent Progress Related to an Old Dilemma . J. Biosci. Bioeng. 101 (4): 287-296. 20. Payne, G.F., V. Bringi, C.L. Prince, and M.L. Shuler. (1992) The Quest for Commercial Production of Chemicals from Plant Cell Culture, in Plant Cell and Tissue Culture in Liquid Systems : 2-10. John Wiley & Sons, Inc.: New York. 21. Wink, M., A.W. Alfermann, R. Franke, B. Wetterauer, M. Distl, J. Windhovel, O. Krohn, E. Fuss, H. Garden, A. Mohagheghzadeh, E. Wildi, and P. Ripplinger. (2005) Sustainable Bioproduction of Phytochemicals by Plant in vitro Cultures: Anticancer Agents . Plant Gen. Res. 3(2): 90-100. 22. Kanehisa, M. and S. Goto. (2000) KEGG: Kyoto Encyclopedia of Genes and Genomes . Nucleic Acids Res. 28 : 27-30. 23. Kanehisa, M., S. Goto, M. Hattori, K.F. Aoki-Kinoshita, M. Itoh, S. Kawashima, T. Katayama, M. Araki, and M. Hirakawa. (2006) From Genomics to Chemical Genomics: New Developments in KEGG . Nucleic Acids Res. 34 : D354-D357. 24. Kanehisa, M., M. Araki, S. Goto, M. Hattori, M. Hirakawa, M. Itoh, T. Katayama, S. Kawashima, S. Okuda, T. Tokimatsu, and Y. Yamanishi. (2008) KEGG for Linking Genomes to Life and the Environment . Nucleic Acids Res. 36 : D480-D484.

Chapter 2 – Literature Review

Metabolic Engineering of Secondary Metabolism

Beyond the primary cellular functions of cell division and growth, respiration,

storage, and reproduction [1] are the secondary metabolites. This class of phytochemicals

represents a growing population of over 100,000 different substances that are involved in a

variety of functions such as disease and pest resistance and attracting pollinators with color

and fragrance [2]. These compounds are of human interest because they possess useful

qualities such as being antibiotic, antifungal, antiviral [1], antioxidative [3], antiarrhyrhmic,

antimalarial, antitussive, and anticancer [4]. These valuable chemicals are often quite potent,

produced in very small amounts (less then 1% of total carbon), and can require special

storage within the cell [1].

The largest subgroup of secondary metabolites is the terpenoids, comprising one third

of plant chemicals [2]. Terpenoids include menthol (component of peppermint oil) [5] and

geraniol (common component of flower fragrance) [6]. Alkaloids are the second largest with

12,000 compounds and are found in 20% of plant species [7]. This group includes caffeine,

morphine, and nicotine and many other compounds that are involved with our daily lives [2].

Given that many alkaloids of great value are produced in such small quantities in

planta , great effort has been placed towards the production of these chemicals by other biotechnological means. Efforts include plant cell and tissue cultures, transgenic microorganisms, transgenic plant cell and tissue cultures, and isolated enzymes [2].

Isolated enzymes require immediate precursors and multiple steps are better performed by the plant itself. Transgenic microorganisms can express plant enzymes that can perform the required biosynthesis steps, especially when fed precursors. Saccharomyces 12

cerevisiae , expressing strictosidine synthase (STR) and strictosidine β-glucosidase (SGD) from the Catharanthus roseus , was able to produce terpenoid indole alkaloids when fed

tryptophan and an extract of Symphoricarpus albus berries, a source for secologanin [8].

This is an interesting production method but the biosynthesis of the most valuable plant

alkaloids would still require the insertion of an entire pathway of enzymes.

Most efforts for the production of alkaloids have focused on plant cell and tissue

cultures, both wild-type and transgenic. Plant cell cultures have proven successful for

several systems. Shikonin, a naphthoquinone produced by the Chinese herb Lithospermum

erythrorhizon , is used in traditional Chinese medicine (TCM). This chemical has several

biological activities including the inhibition of human immunodeficiency virus type 1 (HIV-

1) [9]. Large-scale cell culture of this species was successfully established more than twenty

years ago [2, 10]. Berberine, also used in TCM, is an antimicrobial produced by several

different plant species. Ten-fold higher yields have been reported in Coptis japonica cell

cultures [2].

Paclitaxel (Taxol®), an antitumor compound, is the most recent success story.

Paclitaxel is harvested from the slow-growing yew trees of the genus Taxus by extraction

from the leaves or bark. Cell cultures up to 70,000 liters are used to produce paclitaxel,

alleviating the demand on yew forests [4]. Interestingly, endophytic fungi have been isolated

from varieties of yew that are able to produce paclitaxel and other taxanes [11, 12]. Cell

cultures are still used to produce the paclitaxel but a variety of fungal biosynthetic enzymes

are being investigated to produce paclitaxel analogues [13]. Prospective production of

taxanes is reviewed in Frense (2007) [14]. 13

Despite some successes, cell cultures often do not produce the valuable secondary

metabolites that the whole plant does. Such cases are vincristine, morphine, and scopolamine

[4]. Tissue cultures are more successful in producing secondary metabolites. Camptothecin

is produced in very low quantities in undifferentiated cell cultures. However, hairy root

cultures of Ophiorrhiza mungos have yields similar to that of normal roots [4].

Cell cultures of C. roseus are unable to produce vindoline because the enzymes that catalyze the last three steps of vindoline synthesis, 2,3-dihydro-3-hydroxytabersonine-N- methyltransferase (NMT), desacetoxyvindoline-4-hydroxylase (D4H), and deacetylvindoline-O-acetyltransferase (DAT), are repressed [15]. D4H and DAT are light inducible; however, NMT is a thylakoid bound enzyme, requiring the presence of chloroplasts. This makes NMT the limiting enzyme. Vinblastine and vincristine have not been detected in hairy roots of C. roseus also because vindoline is not produced. Mass spectrometry (MS) evidence that is presented in [16] reveals that partial activity of NMT may have occurred. However, MS techniques were not very advanced at that time so the use of more sophisticated MS technology is required to identify these compounds. Recent studies have located the enzymatic steps of tabersonine to vindoline occurring in specific leaf epidermis cells in full plants [17, 18] along with many of the early steps of terpenoid biosynthesis [19].

Not all enzymes producing tabersonine to vindoline have been sequenced, so the pathway cannot yet be inserted into the C. roseus hairy root cultures. As promising as the

prospect of inserting all the required steps sounds, it will not be met without complication.

The expression of DAT, the final enzyme in the vindoline pathway normally located in the

leaf epidermis, in C. roseus hairy roots interferes with the sequence similar, root tip specific 14

enzyme, minovincinine-19-hydroxy-O-acetyltransferase (MAT), reducing its enzymatic

activity [20, 21].

Even though many secondary metabolites are produced in C. roseus hairy roots, the

production levels are not sufficient to compete with field-grown plants. Optimization of

culture conditions can increase rates of biomass accumulation as well as the production of

alkaloids. Media composition, growth regulators, pH, temperature, light, aeration, and

stressors such as osmotic shock and fungal elicitation can alter the levels of alkaloids that are

accumulated [22]. Precursor feeding can also increase levels and help identify metabolic

bottlenecks or limiting components [23, 24]. However, evidence of tight regulation for

alkaloid biosynthesis [25] means that the scales can only be tipped so far. Metabolic

engineering can help efforts to overcome poor production rates.

Metabolic engineering is the targeted amendment of metabolic pathways in order to

invoke a desired change, such as to increase or decrease the levels of certain metabolites. By

the transgenic expression of specific enzymes, metabolic roadblocks can be overcome.

Because of the limited knowledge of the complex alkaloid pathways, determining how to

engineer them is difficult. Continuing characterization efforts have opened doors to leading

to successful implementation. The increased feasibility of engineering plant systems for

secondary metabolite production results from the cloning of genes and pathway elucidation

[26]. This has led to multiple ways to increase levels of the tropane alkaloid, scopolamine, in

transgenic plant cultures, reviewed in [27]. There has also been success with increasing

levels of terpenoids, reviewed in [28, 29]. Engineering the indole alkaloid pathway in C.

roseus hairy roots by expressing tryptrophan decarboxylase (TDC) did not significantly alter tryptamine levels. Coupling TDC with a feedback-resistant anthranilate synthase α subunit 15

(AS α) (Figure 2.1) from Arabidopsis increased tryptamine levels; however, no significant increases of terpenoid indole alkaloids (TIAs) further downstream were observed [30]. This is a good example of how using metabolic engineering to remove pathway obstructions can reveal other levels of control on the network. For complicated pathways such TIAs, multigene expression can help to overcome pathway regulation.

For metabolic engineering, knowledge of biosynthetic pathways and their regulatory nature is imperative for success. Metabolic engineering continues to draw from a growing body of knowledge. There are efforts to coordinate genomics [31], transcriptomics, and proteomics data [32] so systemic analysis can be performed [33] and engineering efforts can be more fruitful.

Measurement of Metabolic Fluxes

In order to evaluate changes in primary central carbon metabolism due to metabolic engineering efforts, tools are required to evaluate how metabolic fluxes have been altered in response to the genetic stimuli. Powerful tools such as metabolic flux analysis (MFA) and metabolic control analysis (MCA) are used to assess the impact of pathway modification

[34]. The performance of a culture depends on fluxes of metabolites rather than on the size of their pool. Fluxes describe what the cells doing, as opposed to how they look [35].

There are many systems of MFA. Stoichiometric MFA uses the stoichiometry of biosynthetic reactions and steady-state dynamics along with rates of uptake or metabolite production to provide fluxes for primary metabolism. This system is useful but the methodology breaks down under conditions where parallel or cyclic pathways exist [36].

Supplementing this system with 13 C labeling experiments can overcome these obstacles. 16

Integrating a portion or all of the substrate as an isotopically labeled substrate allows

for measurements to be taken by nuclear magnetic resonance (NMR) or MS that can help

elucidate internal fluxes. Fluxes are determined by carbon skeletal rearrangements that can

be tracked with the isotopic label. The label is integrated to the metabolites and their skeletal

placement can be measured with NMR or MS. The use of designed carbon labeling

experiments (CLE) [34] and experiments utilizing uniformly labeled substrates called bond

labeling experiments (BLE) [37] has greatly expanded. BLE utilizes isotopomer balances for

global flux analysis. Our research group successfully measured fluxes in soybean cotyledons

using isotopomers [38]. Bondomers were introduced by our lab [39, 40] and van Winden et al. [41]. Bondomers are similar to isotopomers only the integrity of carbon-to-carbon bonds

are evaluated instead of individual carbon positions on a molecule (Figure 2.2). Bondomers

have been successfully used within our group for the measurement of fluxes in C. roseus

hairy roots [42]. 17

Figures

Shikimate Pathway

DXP Pathway

Chorismate Mevalonate AS Pathway Anthranilate

Iridoid Terpene Pathway Tryptophan TDC Tryptamine Secologanin

Terpenoid Indole Pathway

Figure 2.1 Regulation of the indole pathway in Catharanthus roseus . Arrows with minus signs indicate previously identified steps sensitive to feedback regulation. AS , anthranilate synthase; TDC , tryptophan decarboxylase. (Figure adapted from: [25, 43, 44])

Figure 2.2 Isotopomers (isotope isomers) and bondomers (bond isomers) of a three-carbon metabolite. All eight isotopomers (left) and all four bondomers (right) of this metabolite are shown. The isotopomers differ in the labeling state of their individual carbon atoms [ 13 C (black) versus 12 C (gray)]. They are notated using boldface for 13 C and regular font for 12 C, as illustrated. Bondomers differ in the connectivity of their carbon- carbon bonds [intact or unbroken (black) versus biosynthetic (gray)]. Two consecutive carbon atoms in a metabolite linked by an intact bond originated from the same carbon substrate molecule and the bond between them was unbroken during metabolism, whereas two consecutive carbon atoms linked by a biosynthetic bond originated from different carbon substrate molecules and were biosynthetically assembled during metabolism. Bondomers are notated using a dash (1–2) for an intact bond and no dash (1 –2) for a biosynthetic bond, as illustrated. A linear metabolite with n carbon atoms has 2 n isotopomers and 2 n-1 bondomers. For this and other reasons, a given metabolic network has fewer bondomers than isotopomers. Bondomers provide identical flux information as NMR-detectable isotopomers in an experiment using a single fractionally U-13 C labeled carbon source. Bondomers save significant flux evaluation time and are more easily interpretable than isotopomers. (Figure and caption source: [42])

References

1. Bourgard, F., A. Gravot, S. Milesi, and E. Gontier. (2001) Production of Plant Secondary Metabolites: A Historical Perspective . Plant Sci . 161 : 839-851. 2. Verpoorte, R., R. van der Heijden, H.J.G. ten Hoopen, and J. Memelink. (1999) Metabolic Engineering of Plant Secondary Metabolite Pathways for the Production of Fine Chemicals . Biotechnol Lett . 21 : 467-479. 3. Verpoorte, R., R. van der Heijden, and J. Memelink. (2000) Engineering the Plant Cell Factory of Secondary Metabolite Production . Transgenic Res . 9: 323-343. 4. Wink, M., A.W. Alfermann, R. Franke, B. Wetterauer, M. Distl, J. Windhovel, O. Krohn, E. Fuss, H. Garden, A. Mohagheghzadeh, E. Wildi, and P. Ripplinger. (2005) Sustainable Bioproduction of Phytochemicals by Plant in vitro Cultures: Anticancer Agents . Plant Gen. Res. 3(2): 90-100. 5. Rios-Estepa, R., G.W. Turner, J.M. Lee, R.B. Croteau, and B.M. Lange. (2008) A Systems Biology Approach Identifies the Biochemical Mechanisms Regulating Monoterpenoid Essential Oil Composition in Peppermint . PNAS . 105 (8): 2818-2823. 6. Iijima, Y., D.R. Gang, E. Fridman, E. Lewinsohn, and E. Pichersky. (2004) Characterization of Geraniol Synthase from the Peltate Glands of Sweet Basil . Plant Phys. 134 : 370-379. 7. Facchini, P.J. (2001) Alkaloid Biosynthesis in Plants: Biochemistry, Cell Biology, Molecular Regulation, and Metabolic Engineering Applications . Annu. Rev. Plant Physiol. Plant Mol. Biol. 52 : 29-66. 8. Geerlings, A., F.J. Redondo, A. Contin, J. Memelink, R. van der Heijden, and R. Verpoorte. (2001) Biotransformation of Tryptamine and Secologanin into Plant Terpenoid Indole Alkaloids by Transgenic Yeast . Appl. Microbiol. Biotechnol. 56 (3- 4): 420-424. 9. Chen, X., L. Yang, N. Zhang, J.A. Turpin, R.W. Buckheit, C. Osterling, J.J. Oppenhein, and O.M.J. Howard. (2003) Shikonin, a Component of Chinese Herbal Medicine, Inhibits Chemokine Receptor Function and Suppresses Human Immunodeficiency Virus Type 1 . Antimicrob Agents Chemother . 47 (9): 2810-2816. 10. Payne, G.F., V. Bringi, C.L. Prince, and M.L. Shuler. (1992) Plant Cell and Tissue Culture in Liquid Systems : John Wiley & Sons, Inc. 11. Stierle, A., G. Strobel, and D. Stierle. (1993) Taxol and Taxane Production by Taxomyces andreanae, an Endophytic Fungus of Pacific Yew . Science . 260 (5105): 214-216. 12. Zhao, K., D. Zhou, W. Ping, and J. Ge. (2004) Study on the Preparation and Regeneration of Protoplast from Taxol-producing Fungux Nodulisporium sylviforme. Nature and Science . 2(2): 52-59. 13. Fang, W.-S. and X.-T. Liang. (2005) Recent Progress in Structure Activity Relationships and Mechanistic Studies of Taxol Analogues . Mini-Rev Med Chem . 5: 1-12. 14. Frense, D. (2007) Taxanes: Perspectives for Biotechnological Production . Appl. Microbiol. Biotechnol. 73 : 1233-1240. 15. Vazquez-Flota, F., E. De Carolis, A.-M. Alarco, and V. De Luca. (1997) Molecular Cloning and Characteristics of Desacetoxyvindoline-4-hydroxylase, a 2-oxyglutarate 20

Dependent-dioxygenase Involved in the Biosynthesis of Vindoline in Catharanthus roseus (L.) G. Don . Plant Mol Biol . 34 : 935-948. 16. Bhadra, R., S. Vani, and J.V. Shanks. (1993) Production of Indole Alkaloids by Selected Hairy Root Lines of Catharanthus roseus. Biotechnol. Bioeng. 41 (5): 581- 592. 17. Murata, J. and V. De Luca. (2005) Localization of Tabersonine 16-hydroxylase and 16-OH Tabersonine-16-O-methyltransferase to Leaf Epidermal Cells Defines Them as Major Site of Precursor Biosynthesis in the Vindoline Pathway in Catharanthus roseus. Plant J. 44 : 581-594. 18. Levac, D., J. Murata, W.S. Kim, and V. De Luca. (2008) Application of Carborundum Abrasion for Investigating the Leaf Epidermis: Molecular Cloning of Catharanthus roseus 16-hydroxytabersonine-16-O-methyltransferase . Plant J. 53 : 225-236. 19. Murata, J., J. Roepke, H. Gordon, and V. De Luca. (2008) The Leaf Epidermome of Catharanthus roseus Reveals Its Biochemical Specialization . Plant Cell . 20 : 524-542. 20. Laflamme, P., B. St-Pierre, and V. De Luca. (2001) Molecular and Biochemical Analysis of a Madagascar Periwinkle Root-Specific Minovincinine-19-Hydroxy-O- Acetyltransferase . Plant Phys. 125 : 198-198. 21. Magnotta, M., J. Murata, J. Chen, and V. De Luca. (2007) Expression of Deacetylvindoline-4-O-acetyltransferase in Catharanthus roseus Hairy Roots . Phytochem . 68 : 1922-1931. 22. Moreno, P.R.H., R. van der Heijden, and R. Verpoorte. (1995) Cell and Tissue Cultures of Catharanthus roseus : A Literature Survey . Plant Cell Tiss Organ Cult . 42 : 1-25. 23. Morgan, J. and J.V. Shanks. (2000) Determination of Metabolic Rate-limitations by Precursor Feeding in Catharanthus roseus Hairy Root Cultures . J Biotechnol . 79 (2): 137-145. 24. Peebles, C.A.M., S.-B. Hong, S.I. Gibson, J.V. Shanks, and K.-Y. San. (2006) Effects of Terpenoid Precursor Feeding on Catharanthus roseus Hairy Roots Over- Expressing the Alpha or the Alpha and Beta Subunits of Anthranilate Synthase . Biotechnol. Bioeng. 93 (3): 534-540. 25. Hughes, E.H., S.-B. Hong, S.I. Gibson, J.V. Shanks, and K.-Y. San. (2004) Expression of a Feedback-resistant Anthranilate Synthase in Catharanthus roseus Hairy Roots Provides Evidence for Tight Regulation of Terpenoid Indole Alkaloid Levels . Biotechnol. Bioeng. 86 (6): 718-727. 26. Hughes, E.H. and J.V. Shanks. (2002) Metabolic Engineering of Plants for Alkaloid Production . Met. Eng. 4: 41-48. 27. Zhang, L., G.-Y. Kai, B.-B. Lu, H.-M. Zhang, K.-X. Tang, J.-H. Jiang, and W.-S. Chen. (2005) Metabolite Engineering of Tropane Alkaloid Biosynthesis in Plants . J Integr Plant Biol . 47 (2): 136-143. 28. Aharoni, A., M.A. Jongsma, T.-Y. Kim, M.-B. Ri, A.P. Giri, F.W.A. Verstappen, W. Schwab, and H.J. Bouwmeester. (2006) Metabolic Engineering of Terpenoid Biosynthesis in Plants . Phytochem Rev . 5: 49-58. 29. Aharoni, A., M.A. Jongsma, and H.J. Bouwmeester. (2005) Volatile Science? Metabolic Engineering of Terpenoids in Plants . Trends Plant Sci . 10 (12): 594-602. 21

30. Hughes, E.H., S.-B. Hong, S.I. Gibson, J.V. Shanks, and K.-Y. San. (2004) Metabolic Engineering of the Indole Pathway in Catharanthus roseus Hairy Roots and Increased Accumulation of Tryptamine and Serpentine . Met. Eng. 6: 268-276. 31. Rischer, H., M. Oresic, T. Seppanen-Laakso, M. Katajamaa, F. Lammertyn, W. Ardiles-Diaz, M.C.E. Van Montagu, D. Inze, K.-M. Oksman-Caldentey, and A. Goossens. (2006) Gene-to-metabolite Networks for Terpenoid Indole Alkaloid Biosynthesis in Catharanthus roseus Cells . PNAS . 103 (14): 5614-5619. 32. Vemuri, G.N. and A.A. Aristidou. (2005) Metabolic Engineering in the -omics Era: Elucidating and Modulating Regulatory Networks . Microbiol Mol Biol Rev . 69 (2): 197-216. 33. Kutchan, T.M. (2005) Predictive Metabolic Engineering in Plants: Still Full of Suprises . Trends Biotechnol . 23 (8): 381-394. 34. Stephanopoulos, G.N., A.A. Aristidou, and J. Nielsen. (1998) Metabolic Engineering: Principals and Methodologies . San Diego, CA: Academic Press. 35. Stephanopoulos, G. (2002) Metabolic Engineering: Perspectives of a Chemical Engineer . AIChE Journal . 48 (5): 920-926. 36. Wiechert, W. (2001) 13 C Metabolic Flux Analysis . Met. Eng. 3: 195-206. 37. Szyperski, T. (1995) Biosynthetically Directed Fractional 13 C-labeling of Proteinogenic Amino Acids . Eur. J. Biochem. 232 : 433-448. 38. Sriram, G., D.B. Fulton, V.V. Iyer, J.M. Peterson, R. Zhou, M.E. Westgate, M.H. Spalding, and J.V. Shanks. (2004) Quantification of Compartmented Metabolic Fluxes in Developing Soybean Embryos by Employing Biosynthetically Directed Fractional 13 C Labeling, Two-Dimensional [ 13 C, 1H] Nuclear Magnetic Resonance, and Comprehensive Isotopomer Balancing . Plant Phys. 136 : 3043-3057. 39. Sriram, G. and J.V. Shanks. (2001) A Mathematical Model for Carbon Bond Labeling Experiements: Analytical Solutions and Sensitivity Analysis for the Effect of Reaction Reversibilities on Estimated Fluxes in Proceedings of the 31st Annual Biochemical Engineering Symposium . L.E. Erickson, ed. September 2001. Manhattan, KS. 40. Sriram, G. and J.V. Shanks. (2004) Improvements in Metabolic Flux Analysis using Carbon Bond Labeling Experiments: Bondomer Balancing and Boolean Function Mapping . Met. Eng. 6: 116-132. 41. van Winden, W., J.J. Heijnen, and P.J.T. Verheijen. (2002) Cumulative Bondomers: A New Concept in Flux Analysis from 2D 13 C, 1H COSY NMR Data . Biotechnol. Bioeng. 80 : 731-745. 42. Sriram, G., D.B. Fulton, and J.V. Shanks. (2007) Flux Quantification in Central Carbon Metabolism of Catharanthus roseus Hairy Roots by Using 13 C Labeling and Comprehensive Bondomer Balancing . Phytochem . 68 : 2243-2257. 43. Noe, W., C. Mollenschott, and J. Berlin. (1984) Tryptophan Decarboxylase From Catharanthus roseus Cell Suspension Cultures: Purification, Molecular and Kinetic Data of the Homogenous Protein . Plant Mol Bio . 3(5): 281-288. 44. Li, J. and R.L. Last. (1996) The Arabidopsis thaliana trp5 Mutant Has a Feedback- Resistant Anthranilate Synthase and Elevated Soluble Tryptophan . Plant Phys. 110 (1): 51-59.

Chapter 3 - Materials and Methods

Alkaloid Extraction from Fresh Biomass

Excised shoot tips, including 4 true leaves, were frozen in liquid nitrogen and ground with mortar and pestle. About 500 mg of the powdered plant material was extracted with 10 ml of methanol using a sonicating probe for 10 minutes (Model VC 130PB, Sonics and

Materials, Inc.) while held on ice. The extracts were centrifuged at 4000 rpm for 12 minutes at 4 °C. The supernatant was removed and the biomass was extracted one more time in the same manner. The combined supernatants were passed through a 0.45 m nylon filter

(25mm, P.J. Cobert), dried on a nitrogen evaporator (Organomation Associates, Inc.), reconstituted in 2 ml of methanol, and passed through a 0.22 m nylon filter (13mm, P.J.

Cobert) for HPLC analysis. Extracts were stored at -25 °C.

HPLC Analysis of Metabolites

Twenty microliters of the alkaloid extract from fresh biomass was injected into a

Waters Nova-Pak C8 column (150 x 3.9 mm). The HPLC system used was a Waters high performance liquid chromatography system consisting of two 510 pumps, a 717plus

Autosampler, and a 996 Photo Diode Array (PDA) detector. For detection of bisindole alkaloids data were extracted at 254 nm to quantify vinblastine and vincristine. The TIAs vindoline, ajmalicine, catharanthine can also be detected at 254 nm. Hörhammericine and tabersonine can be detected at 329 nm. The protocol was adapted from Zhou et al. (2005)

[1]. For 40 minutes, at a flow rate of 0.8 ml/min, the mobile phase was linearly ramped from a 45:55 to a 65:35 mixture of methanol:0.1% triethylamine. The mobile phase was linearly ramped to 90:10 over the next 10 minutes. The mobile phase was then returned to 45:55 and 23

the column was allowed to re-equilibrate. Analysis was performed with Empower Pro software (Waters).

Alkaloid Extraction from Growth Media

The growth media collected during harvesting is prefiltered to remove large pieces of cellular debris and mucilaginous material from the hairy roots. Five milliliters of prefiltered growth media is filtered through a 0.45 m cellulose acetate filter (26mm, Corning) into a

15-ml centrifuge tube (Corning) that is ethyl acetate compatible. It is important to remove intact cells so the alkaloids they contain are not extracted. The media is adjusted to a pH of

7.0 with 0.05 M sodium hydroxide. This step is important because pH affects the solubility of alkaloids. Five milliliters of ethyl acetate is added to the 15-ml centrifuge tube with the five milliliters of growth media via a 10-ml glass pipet (Corning). The phase separated liquid in the 15-ml centrifuge tube is secured at a 20 ° angle and agitated at 300 rpm for 30 minutes on a shaker platform (1 in. offset, New Brunswick) to disperse the phases and aid in mass transfer. The alkaloids will transfer to the ethyl acetate phase and the sugars will stay in the aqueous phase. The 15-ml centrifuge tubes are place upright and allowed to phase separate.

A 10-ml glass serological pipet (Corning) is used to draw up both liquid phases completely.

The liquids are allowed to phase separate and the lower aqueous phase is pipetted back into the original 15-ml centrifuge tube. The upper ethyl acetate phase is pipetted into a new 15- ml centrifuge tube (Corning) and is dried on a nitrogen evaporator (Organomation). The alkaloids are reconstituted in 1 ml of methanol, filtered through a 0.22 m nylon filter (13 mm, PJ Cobert), and 40 l is injected on a Phenomenex Luna® C18(2) column (250 x 4.6 mm) and analyzed by HPLC. 24

References

1. Zhou, H., Y. Tai, C. Sun, and Y. Pan. (2005) Rapid Identification of Vinca Alkaloids by Direct-injection Electrospray Ionisation Tandem Mass Spectrometry and Confirmation by High-performance Liquid Chromatography-Mass Spectrometry . Phytochem Anal . 16 : 328-333.

Chapter 4 – Metabolite and Gene Expression Analysis of Terpenoid Indole

Alkaloid Pathways in Catharanthus roseus Seedlings Treated with Methyl

Jasmonic Acid

Draft of a paper to be submitted to Plant Cell Reports .

Shu Wei 1,3,4 , Guy W. Sander 2,5 , Jacqueline V. Shanks 2,6 , Susan I. Gibson 1,7

1Department of Plant Biology, University of Minnesota

2 Department of Chemical and Biological Engineering, Iowa State University

3Current address: Saskatoon Research Center, Agriculture & Agri-Food Canada

4Primary researcher and author

5Contibuting researcher and author

6Co-principal investigator

7Principal investigator and corresponding author

Abstract

Madagascar periwinkle ( Catharanthus roseus ) produces diverse terpenoid indole alkaloids (TIAs), including valuable pharmaceuticals such as the anti-cancer drugs vincristine and vinblastine. The TIA pathways are regulated by transcription factors, such as octadecanoid-responsive Catharanthus AP2-domains (ORCAs), and by application of jasmonic acid. In this study, the effects of methyl jasmonic acid (MeJA) treatment on TIA metabolism and gene expression in seedlings were analyzed. Several reference genes were also isolated from periwinkle. These reference genes, as well as ribosomal protein ( RSP9 ) and cyclophilin ( CYC ) genes, were characterized to determine which are most suitable for 26

use as expression profiling control genes. Our results show that TIA genes exhibit significant variation in the magnitude and timing of induction by MeJA. ORCA3 exhibited the greatest increase in transcript levels, with increases up to 25-fold observed 0.5 h after MeJA treatment. MeJA-induced increases in transcript levels occurred in the following order:

ORCA3, D4H, STR, TDC, G10H and CPR. The amounts of certain TIA metabolites, including tabersonine, ajmalicine, serpentine, catharanthine, and vindoline also increased significantly after MeJA application. Our results suggest that variations in the timing of

MeJA induced increases in TIA metabolite and transcript levels might be related to complex interactions between different transcription factors, such as ORCA3, and other factors.

Cr EF1 α and CrUBQ11 are the most stable genes out of the 8 tested under the conditions of these experiments.

Keywords Catharanthus roseus - gene expression - metabolites - methyl jasmonic acid - terpenoid indole alkaloid

Abbreviations

TIAs Terpenoid indole alkaloids

ORCAs Octadecanoid-responsive Catharanthus AP2-domains

MeJA Methyl jasmonic acid

JA Jasmonic acid

RSP9 Ribosomal protein gene

CYC Cyclophilin gene

CPR Cytochrome P-450 reductase 27

G10H Geraniol 10-hydroxylase

10HGO 10-hydroxygeraniol NADP+ oxidoreductase

SLS Secologanin synthase

TDC Tryptophan decarboxylase

STR Strictosidine synthase

SGD Strictosidine β-D-glucosidase

T16H Tabersonine 16-hydroxylase

16OMT 16-hydroxytabersonine 16-O-methyltransferase

NMT 16-methoxy-2,3-dihydro-3-hydroxytabersonine-N-methyltransferase

D4H Desacetoxyvindoline 4-hydroxylase

MAT Acetyl-CoA:minovincine-O-acetyltransferase

DAT Deacetylvindoline acetyltransferase qRT-PCR Quantitative reverse transcription polymerase chain reaction

DMSO Dimethyl sulfoxide

Introduction

The terpenoid indole alkaloid (TIA) pathways are found in only a few plant species and have in common their initial biosynthetic pathways in which shikimate-pathway derived tryptamine and plastidic nonmevalonate-pathway derived secologanin are combined to form strictosidine. From this precursor, a diverse group of TIAs are produced in various plant species. In Madagascar periwinkle, Catharanthus roseus (L) G. Don, several valuable pharmaceuticals, including the anticancer bisindole drugs vinblastine (Velbe®) and vincristine (Oncovin®) (Jordan et al. 1991; van Der Heijden et al. 2004) are produced 28

through the complex TIA pathways (Fig. 1). The TIA pathways are not only regulated tissue- specifically and developmentally (De Luca and St-Pierre 2000, Facchini 2001), but are also affected by external biotic and abiotic factors (Facchini 2001; Farmer et al. 2003; Hashimoto and Yamada 1994; Meijer et al. 1993; Zhao et al. 2005). For example, vindoline, which is condensed with catharanthine to form invaluable bisindoles, is synthesized in idioblast and laticifer cells in the aerial parts of the plant (St-Pierre et al. 1999) and its accumulation is affected by methyl jasmonic acid (MeJA) (Aerts et al. 1994). External application of jasmonic acid (JA) and MeJA is effective in inducing production of certain TIA compounds in developing seedlings (Aerts et al. 1994), in cell (Gantet et al. 1998) and hairy root cultures

(Rijhwani and Shanks 1998), and in detached leaves (El-Sayed and Verpoorte 2005). Using

C. roseus cell suspension cultures, Rischer et al. (2006) found that JA induces expression of a number of TIA biosynthetic genes, such as the genes encoding geraniol 10-hydroxylase

(G10H ), strictosidine β-D-glucosidase ( SGD ), and tryptophan decarboxylase ( TDC ), but not the genes encoding acetyl-CoA:minovincine-O-acetyltransferase ( MAT ) and deacetylvindoline acetyltransferase ( DAT ). JA activation of some or all of these genes depends on JA-activated transcriptional factors that contain octadecanoid-responsive

Catharanthus AP2-domains (ORCAs) (Fig. 1). To gain a better understanding of the regulation of flux through the TIA metabolic pathways, it is important to determine the timing with which MeJA induces expression of different TIA genes and accumulation of the corresponding metabolites in the downstream TIA pathways.

Many studies on plant gene regulation and metabolic engineering have been based on gene expression profiling, which requires quantification of specific mRNA sequences.

Currently one of the best methods for conducting these analyses is to perform quantitative 29

real time reverse transcription PCR (qRT-PCR). To obtain reliable results, the expression levels of experimental genes must be referenced to at least one internal control gene that has the least variation in its expression under the experimental conditions (Schmittgen and

Zakrajsek 2000). However, many studies have shown that internal standards, such as housekeeping genes used for the quantification of mRNA expression, can vary with the experimental conditions (Thellin et al. 1999; Warrington et al. 2000). Therefore, according to

Thellin et al. (1999) and Vandesompele et al. (2002), multiple housekeeping genes may be used as internal standards so that relatively large errors due to the use of a single gene for transcript normalization can be avoided. However, in C. roseus few sequences from housekeeping genes that can be used as internal references for qRT-PCR experiments have previously been identified.

In this study, several C. roseus housekeeping genes were isolated, partially sequenced and tested for use as internal control genes. Metabolite and gene expression analyses of TIA pathways in periwinkle seedlings treated with MeJA were then conducted to determine the timing of MeJA induction of gene expression and changes in the corresponding levels of downstream TIA metabolites.

Materials and Methods

Plant growth

Seeds of Catharanthus roseus cv. Little Bright Eye were germinated in pots containing peat:vermiculite:perlite (1:1:1, v/v) and kept in a growth room without fertilization at 26 oC under a 16-h photoperiod with a light intensity of 380 ± 25 mmol m -2s-1 generated by overhead fluorescent lamps. 20-day-old plants were used for MeJA treatments. 30

Treatment with MeJA

Three concentrations of MeJA (0.2, 1.0, 2.0 mM), each containing 0.2% dimethyl sulfoxide (DMSO), were employed to treat plants. Water with 0.2% DMSO was used as a control. The seedlings were taken out of the growth room and fine-mist sprayed in an open area on both leaf sides until liquid dripped from the leaves. The plants were then labelled and covered with a transparent plastic lid before being moved back to the growth room. Shoot tips, including 4 true leaves, from 9-11 treated plants were excised 0.5, 3, 6, 12, 24, 48, and

96 h after the MeJA treatments and combined as one biological replicate. Four biological replicates were analyzed. Fresh tissue samples were immediately frozen in liquid nitrogen and kept at -80 oC for further analyses.

Isolation of housekeeping genes

Primers for isolation of C. roseus reference genes were designed based on conserved gene sequences. These conserved sequences were identified by BLAST searches of the GenBank database using mRNA sequences from the following known reference genes as queries (Table 1): actin 2/7 ( ACT7 , AT5G09810), polyubiquitin ( UBQ11 , AT4G05050), ubiquitin extension protein ( UBQ6 , AT2G47110), 25S rRNA (AY090986) (Campbell et al.

2003), glyceraldehyde 3-phosphate dehydrogenase A subunit ( GAPA-1, AT3G26650), tubulin beta-9 chain ( TUB9, AT4G20890) and tubulin α-5 chain ( TUA5 , AT5G19780) from

Arabidopsis thaliana , as well as elongation factor 1-alpha ( EF-1-α, AB061263) from

Solanum tuberosum .

Total RNA was extracted from the shoots of 20-day-old plants grown in the growth room as described above, using a QIAGEN RNeasy kit (Qiagen Inc., Valencia, CA, USA) according to the manufacturer’s manual. DNase I was used for the on-column genomic DNA 31

digestion in order to minimize DNA contamination. First-strand cDNA was synthesized by reverse transcribing 1 g of total RNA in a final reaction volume of 20 L using random primers. Next, PCR reactions were conducted using the gene specific primers listed in Table

1 and the Promega RT-PCR kit (Promega Corp., Madison, WI, USA), according to the manufacturer’s instructions. The PCR products were resolved using a 1% agarose gel. DNA bands with expected sizes or high fluorescent intensity under UV were excised, recovered using the QIAGEN gel extraction kit (Qiagen Inc., Valencia, CA, USA) according to the manufacturer’s instructions and sequenced with the appropriate primers. The resulting sequences were then characterized by BLAST analysis against the GenBank database to determine whether the sequences show significant sequence similarity to the desired reference genes from other organisms.

Analysis of reference mRNA levels

To evaluate variation in the mRNA levels of the newly isolated reference genes as well as the induction of TIA biosynthetic genes under different MeJA treatments, primers were designed using the Primer Express 2.0 software (PE Applied Biosystems, Foster City,

CA, USA) under the default parameters. The primer sequences are given in Table 2. Total

RNA was extracted from plant samples treated with different concentrations of MeJA as described above. First-strand cDNA was synthesized as described above. The PCR mixture contained 10 l of diluted cDNA, 12.5 l of 2X SYBR Green qPCR Master Mix (Cat No.

11735-040, Invitrogen Corp., Carlsbad, CA, USA) and 200 nM of each gene-specific primer in a final volume of 25 l. Control PCR reactions with no templates were also performed for each primer pair. The real-time quantitative reverse-transcription PCR (qRT-PCR) reactions were performed employing an ABI Prism 7500 Sequence Detection System and software (PE 32

Applied Biosystems, Foster City, CA, USA). All the PCR reactions were performed under the following conditions: 2 min at 50 oC, 10 min at 95 oC, and 40 cycles of 15 s at 95 oC and 1 min at 60 oC in 96-well optical reaction plates (Applied Biosystems, Foster City, CA, USA).

The specificity of amplicons was verified by melting curve analysis (60 to 95 oC) after 40 cycles and by agarose gel electrophoresis. Two biological replicates for each treatment condition were used for real-time qRT-PCR analysis and three technical replicates were analyzed for each biological replicate. The real-time qRT-PCR efficiency was determined for each gene by measuring the number of cycles needed to pass a specific fluorescent threshold

(Walker 2002) for a serial dilution of bulked cDNA. All PCR reactions displayed efficiencies between 85 and 97%. The results of qRT-PCR analyses were subject to expression stability assay using geNorm software (Vandesompele et al. 2002). qRT-PCR analysis of TIA genes

20-day-old plants were induced by spraying with solutions containing 0, 0.2, 1.0 or

2.0 mM MeJA in 0.2% DMSO. Shoot tips were excised from the plants 0.5, 3, 6, 12, 24, 48 and 96 h after MeJA induction as described above. Total RNA and first strand cDNA were obtained as described in the previous section for reference gene isolation. Real time qRT-

PCR analyses of TIA biosynthetic gene mRNA levels were performed with the gene specific primers as described above. CrEF1 α and CrUBQ11, the two genes most stably expressed in

MeJA-treated seedlings were used as controls for further TIA gene expression analyses. All samples were assayed in triplicate from two independent biological replicates and the mean expression values of all these replicates were determined. The real-time qRT-PCR efficiency was determined for each gene as described above. All PCR reactions displayed efficiencies between 87 and 98%. 33

Extraction of alkaloids and HPLC analysis

Indole alkaloid sample preparation and HPLC-PDA quantification followed established methods for C. roseus tissues (Hughes et al. 2004a, Hughes et al. 2004b, Peebles et al. 2005) with some modification. Excised shoot tips, including 4 true leaves, were frozen in liquid nitrogen and ground with mortar and pestle. About 500 mg of the powdered plant material was extracted with 10 ml of methanol using ultrasonication for 10 minutes (Model

VC 130PB, Sonics and Materials, Inc., Newtown, CT, USA) while held on ice. The extracts were centrifuged at 4000 rpm for 12 minutes at 15 °C. The supernatant was removed and the biomass was extracted one more time in the same manner. The combined supernatants were passed through a 0.45 m nylon filter (25mm, P.J. Cobert Associates, Inc., St. Louis, MO,

USA), dried on a nitrogen evaporator (Organomation Associates, Inc., Berlin, MA, USA), reconstituted in 2 ml of methanol, and passed through a 0.22 m nylon filter (13mm, P.J.

Cobert Associates, Inc., St. Louis, MO, USA) for HPLC analysis. Extracts were stored at -

25 °C.

Twenty microliters of the alkaloid extract was injected into a Luna® C18(2) column

(250 x 4.6 mm) (Phenomenex®, Torrance, CA, USA). The Waters HPLC system (Waters,

Milford, MA, USA) consisted of two 510 pumps, a 717plus Autosampler, and a 996 Photo

Diode Array (PDA) detector. PDA data were extracted at 254 nm to quantify ajmalicine, serpentine, catharanthine, vindoline, vincristine, and vinblastine using standard curves. Data extracted at 329 nm were used to locate tabersonine, hörhammericine, and lochnericine using retention time standards. The protocol was adapted from Peebles et al. (2005) to be LC-MS compatible. For the first 5 minutes, at a flow rate of 1 ml/min, the mobile phase was a 30:70 mixture of acetonitrile:100 mM ammonium acetate (pH 7.3). The mobile phase was linearly 34

ramped to 64:36 over the next 10 minutes and maintained at that ratio for 15 minutes. The flow rate was increased to 1.4 ml/min over 5 minutes. The ratio was then increased to 80:20 during the next 5 minutes and maintained for 15 minutes. The flow rate and mobile phase ratio were then returned to 1 ml/min and 30:70 and the column was allowed to re- equilibriate. Analysis was performed with Empower Pro software (Waters, Milford, MA,

USA). Pure chemical standards including vindoline, vinblastine, and vincristine

(ChemPacific Co., Baltimore, USA), catharanthine (Qventas , Branford, Connecticut, USA), ajmalicine and serpentine (Sigma-Aldrich, St. Louis, MO, USA), and hörhammericine, lochnericine, and tabersonine (standards collected in house) were used for identification and quantification of compounds from the leaf extracts.

Results

Isolation of C. roseus reference genes

C. roseus genes that exhibit little to no alteration in transcript levels in response to

MeJA treatment were needed as controls for qRT-PCR analyses of the effects of MeJA on expression of TIA biosynthetic genes. Towards this end, BLAST analyses were conducted using the known DNA sequences of eight different reference genes from Arabidopsis or other dicotyledonous plants. These queries revealed the presence of conserved DNA sequences for these reference genes from different plant species. Primers were designed based on these conserved sequences and used for PCR isolation of the reference genes from

C. roseus (Table 1). cDNA templates for PCR cloning of the reference genes were obtained by reverse transcription of total RNA extracted from C. roseus shoots. PCR products were resolved on 1% agarose gels and DNA bands with the expected sizes were excised, recovered and sequenced. BLAST analyses of these DNA sequences against the GenBank database 35

revealed that C. roseus partial DNA sequences for genes with significant sequence similarity to six of the eight reference genes were successfully isolated. Information regarding these partial DNA sequences, including their GenBank accession numbers, the primers used to isolate them by RT-PCR, the sizes of the PCR products, the genes with greatest sequence similarity to each partial DNA sequence and the percent similarity between the partial DNA sequences and the GenBank sequences with greatest similarity are listed in Table 1.

Analysis of the expression stability of C. roseus reference genes

Based on the partial DNA sequences of the C. roseus reference genes, primers were designed to generate PCR products of approximately 150 bp (Table 2). Real time and regular

PCR reactions were conducted to verify primer specificity. PCR product dissociation curves and gel electrophoresis results indicate that these primers are specific for the genes against which they were designed (data not shown).

To evaluate the stability of expression of these newly isolated C. roseus reference genes as well as the previously identified RSP9 (ribosomal protein) and CYC (cyclophilin) genes, mRNA levels of 10-, 20-, and 30-day-old seedlings treated with different MeJA concentrations were measured. The mRNA levels of the eight potential reference genes were then analyzed using the geNorm software to identify the most stably expressed reference genes (Vandesompele et al. 2002). According to Vandesompele et al. (2002), genes with low values of average expression stability (M) are the ones most stably expressed under the experimental conditions and are, therefore, the most suitable for use as control genes. In many cases, several control genes have to be used together so that their pair-wise variation value is less than 0.15, which is the cut-off value proposed by Vandesompele et al. In this study, the two most stable genes from MeJA-treated seedlings were CrEF1 α and CrUBQ11 36

(Fig. 2), whose pair-wise variation was less than 0.15 (data not shown). These two genes were used as controls for further TIA gene expression analyses.

Time course of TIA gene expression in response to MeJA

20-day-old seedlings were sprayed with 0, 0.2, 1 or 2 mM MeJA in 0.2% dimethyl sulfoxide (DMSO). Shoot tips were excised from the seedlings 0.5, 3, 12, 24, 48 and 96 h after MeJA treatment and used for RNA extraction. Reverse transcription and qRT-PCR were conducted and the results calibrated using the CrEF1 α and CrUBQ11 reference genes.

Relative gene expression levels were obtained and compared with those of seedlings treated with water (Fig. 3). None of the MeJA treatments resulted in any significant changes in plant visual phenotypes such as leaf color or shape. Interestingly, the genes studied in these experiments respond to MeJA application with different kinetics. The CrBPF1 gene was not affected by MeJA treatment (data not shown).

ORCA3 transcript levels increase rapidly upon MeJA treatment. The highest level of

ORCA3 transcript, 24.2-fold higher than the control, appears 0.5 h after 2 mM MeJA treatment. ORCA3 mRNA levels decreased between 0.5 and 1.0 h after MeJA treatment, but remained higher than controls until 24 h after the treatments. Increasing MeJA levels appear to affect ORCA3 transcript levels only during the 0.5 h treatment period. At longer induction times there were no consistent effects of MeJA concentration on ORCA3 transcript levels

(Fig. 3). D4H transcript levels increase almost as rapidly as ORCA3 transcript levels in response to treatment with MeJA. However, the highest levels of D4H transcript were only approximately 2-fold higher than control levels 0.5 h after treatment with MeJA. Although

D4H transcript levels decreased at time points after 0.5 h, they remained higher than 0.2%

DMSO treated controls throughout the 96-h course of the experiment. STR transcript levels 37

responded to MeJA a little later than ORCA3 and D4H. Significant increases in STR transcript levels occur within 3 h of MeJA treatment and these increased transcript levels are maintained until 24 h after treatment. After 24 h the gene transcript levels decrease. There is no significant dose effect of MeJA on STR transcript levels. In contrast to the dynamic changes in expression levels observed over time for ORCA3, D4H, and STR , TDC expression levels not only increased significantly 3 h after MeJA treatment, but also remained higher than controls . G10H shows a similar pattern of induction as TDC . Unlike TDC, G10H is known not to be regulated by ORCA3 , but expression of G10H is still enhanced by MeJA

(van der Fits and Memelink 2000). Significant increases in G10H mRNA levels were first observed 6 h after MeJA treatment, later than for ORCA3, D4H, STR, and TDC . However, like TDC , G10H mRNA levels remained high during the course of the experiment. CPR transcript levels exhibit yet another pattern of induction in response to MeJA treatment, with increases in CPR transcript levels found only 48 and 96 h after the treatment. During this period of increased transcript levels, CPR transcript levels are about 11-fold higher than control levels.

Taken together, the above results indicate that transcript levels of ORCA3, D4H,

TDC, G10H, CPR and STR are all induced by MeJA, but with different induction patterns.

Significant dose effects of MeJA treatment on transcript levels were only found during limited time windows and only for ORCA3 and TDC .

Metabolite analysis of C. roseus seedlings treated with MeJA

Aliquots of shoot tip samples from the same seedlings treated with 2.0 mM MeJA that were used for the transcriptional profiling experiments were used for metabolic assays.

Leaf powder (500 mg fresh weight) was extracted with methanol, analyzed for alkaloid 38

content by HPLC and compared with pure standard compounds. Within the first 12 h after

MeJA treatment, an increase in the amount of tabersonine was detected (Fig. 4). After 48 hours, serpentine, catharanthine, ajmalicine, and vindoline also show increased levels. These four metabolites exhibited similar time courses of changing levels, each reaching their highest levels at 96 hours after treatment with MeJA. Although tabersonine was present in only very low levels (< 1.5 g/g FW) in MeJA treated plants, significant increases in tabersonine were detected from 24 h through 96 h after MeJA treatment. Tabersonine was not detected in untreated plants. Hörhammericine and lochnericine were not seen, as expected since these tabersonine-derived alkaloids are found in hairy root cultures of C. roseus (Shanks et al. 1998). The dimeric indole alkaloid compounds vincristine and vinblastine were not detected by HPLC under the conditions of this experiment.

Discussion

Isolation and characterization of C. roseus reference genes

The C. roseus TIA pathways have attracted a lot of attention not only because they produce diverse alkaloid compounds with significant pharmaceutical importance, but also because they represent a useful system for studying a complex secondary metabolic pathway in plants. However, unlike for model plants such as Arabidopsis , gene sequence data for C. roseus is very limited. Reference gene sequences are required to normalize gene transcript levels for high throughput gene expression analysis using real-time qRT-PCR. Therefore, it is necessary to isolate several reference genes and validate the expression stability of those genes under specific experimental conditions prior to using those genes for normalization. In the present work, reference genes for actin, 25S rRNA, EF1 α, β-tubulin, ubiquitin and ubiquitin extension protein, all of which are often used as reference genes, were isolated. 39

However, we failed to isolate GAPDH and α-tubulin genes from C. roseus. The failure to isolate homologs of these two genes might be the result of the C. roseus genes lacking the specific conserved regions we selected for primer design. Primers designed from other conserved regions might allow isolation of genes for GAPDH or α-tubulin from C. roseus .

Although housekeeping genes are often thought of as being stably expressed, the expression levels of a number of housekeeping vary under different conditions (Thellin et al.

1999). These results suggest that the functions of these genes may not be limited to

“housekeeping” activities (Singh and Green 1993; Ishitani et al. 1996). Interestingly, genes that are stably expressed in one species may not be stably expressed in a different species.

For example, in potato EF-1α is stably expressed in response to different biotic and abiotic stresses (Nicot et al. 2005). In contrast, a UBQ and a TUA gene are the most stably expressed of 10 genes tested from poplar (Brunner et al. 2004). These results demonstrate the importance of characterizing reference genes for each species and set of experimental conditions to be analyzed, to identify the best reference genes to use for each set of experiments. The data presented here describe the characterization of 8 reference genes for use as internal controls for gene expression studies in shoot samples representing different

MeJA treatments in C. roseus . Our results reveal that EF1 α and UBQ exhibit the most stable expression patterns of the 8 genes tested over the period of MeJA treatment. Consequently,

EF1 α and UBQ were used as reference genes in subsequent experiments.

Timing of MeJA induction of TIA mRNA and metabolite levels

It is well known that transcription factors play a key role in the coordinate transcriptional control of biosynthetic genes in plant secondary metabolism (Endt et al.

2002). ORCA3 is jasmonate-responsive transcriptional regulator of C. roseus primary and 40

secondary metabolism (van der Fits and Memelink 2000). Many TIA genes such as TDC,

STR, CPR and D4H are regulated by ORCA3, which binds and interacts with a sequence specific element in gene promoters (van der Fits and Memelink 2001). Furthermore, the activation function of ORCA probably does not rely on jasmonate-induced de novo synthesized proteins, but may occur via pre-existing ORCA protein phosphorylation (van der

Fits and Memelink 2001). Additionally, C. roseus TIA pathways are also regulated by other factors, such as the MYB type transcription factor CrBPF1, which is JA-independent (van der Fits et al. 2000), and repressors, GBF1 and GBF2 (Siberil et al. 2001) as well as zinc finger proteins (ZCT1, ZCT2 and ZCT3) (Pauw et al. 2004). Therefore, the expression patterns of MeJA-induced genes are the result of potentially complex interactions among all the known and unknown regulators. One result of these interactions could be differences in the timing of MeJA induction of different genes. In the previous report by van der Fits and

Memelink (2001), ORCA3 expression increases significantly upon the addition of 10 M

MeJA to C. roseus cell cultures. TDC expression is significantly induced approximately 3.0 h after MeJA addition whereas induction of STR expression occurred 4-8 h after MeJA addition. These results are in general agreement with the results presented here, where the expression patterns of these genes were analyzed using intact plants. However, possibly because the semi-quantitative northern blot technique employed in the previous reports could not precisely measure the exact transcript levels for these genes, quantitative differences in the timing of MeJA-induced alterations in transcript levels could not be detected in the previous studies. In the present study, the more accurate real time qRT-PCR method was employed for time course analyses of alterations in TIA biosynthetic gene mRNA levels in response to MeJA treatment. Another possible reason for the somewhat different results 41

presented in previous studies compared with the current study is the different tissues (cell cultures versus whole seedlings) characterized in these studies. Our results show that MeJA induced, dose-dependent increases in ORCA3 expression occur within half an hour after the induction treatment. Interestingly, G10H , which is not regulated by ORCA3 (van der Fits and

Memelink 2000), also exhibits a significant increase in transcript levels 6 h after the MeJA induction treatment (Fig. 3). The mRNA levels of the other ORCA3-regulated genes show different patterns of timing of induction. CPR transcript levels increase 48 h after the MeJA treatment, a significantly longer period of time than is required for induction of the other TIA biosynthetic genes analyzed in this study. This result is especially interesting because it suggests CPR expression might be regulated by other unknown regulators in addition to

ORCA3. Alternatively, some or all of the differences in the CPR expression pattern could possibly be due to differences in mRNA stability.

Accumulation of TIA metabolites following MeJA treatment is the result of changes in metabolic flux caused by alterations in the activity levels of enzymes affected by MeJA treatment. It was reported that MeJA treatment induces the activities of TDC, D4H

(Vázqyuez-Flota and De Luca 1998), SGD, and peroxidase (El-Sayed and Verpoorte 2004) in C. roseus . In this study, corresponding enzymatic activities were not analyzed. However, quantitative analyses showed that compounds derived from strictosidine via three different metabolic branches, ajmalicine, tabersonine, and catharanthine, all increase after MeJA treatment. However, the MeJA treatment causes significantly greater increases in the levels of some of these products of strictosidine than of others, with the highest increase in induction levels being observed for tabersonine followed by serpentine and vindoline.

Additionally, it is interesting to note the compounds tested increase with similar timing after 42

the MeJA treatment. Tabersonine levels increased 12 h after treatment with the rest of the measured alkaloids following 48 h after treatment. Rischer et al. (2006) reported that pronounced accumulation of tabersonine and ajmalicine was found in C. roseus cell culture within 4 h and catharanthine within 12 h after MeJA elicitation. These results indicate that the amounts of certain TIA metabolites, such as vindoline, catharanthine, and serpentine may still be enhanced even though some TIA genes are not induced by MeJA. El-Sayed and

Verpoorte (2005) reported a two-fold increase in 3’,4’-anhydrovinblastine, the precursor of vinblastine and vincristine, in detached C. roseus leaves treated with MeJA. In the present study, the bisindole alkaloids vincristine and vinblastine, which are derived from vindoline and catharanthine, were not found. These results suggest that the effects of MeJA induction on TIA pathways are complex and may not affect flux through all parts of these pathways.

Acknowledgements

The authors express their gratitude to Dr. Christie A.M. Peebles for helping to develop the LC-MS compatible protocol. This work was supported by the NSF grants BES-

0435011 (S.I.G.) and BES-0224600 (J.V.S.). 43

Tables

Table 4.1 Isolation of C. roseus genes. C. roseus BLAST Primer sequence PCR Homologous Sequence gene and query gene product gene identities accession number CrACT7 A. thaliana 5’aaaatggccgatggtgagga 581 bp A. thaliana 244/280 EF688556 ACT7 ACT7 (87%) AT5G09810 5’cggacaatttcccgttctgc AT5G09810 CrEF1 α S. tuberosum 5’tcttcctacctcaagaaggtcggtt 480 bp L. esculentum 379/433 EU007436 EF-1-α, LeEF-1 (87%) AB061263 5’caatctggccaggatggttca X14449 Unknown A. thaliana 5’ggtaggatcgggaggaactt None None None GAPA-1, AT3G26650 5’gtgcaagatgcattgctgat 25S rRNA A. thaliana 5’tcccttgcctacattgttcc 726 bp N. tabacum 567/579 EF688557 AY090986 26S rRNA (97%) 5’aactcacctgccgaatcaac AF479172 CrTUB1 A. thaliana 5’tcggttccctggtcaactaa 442 bp P. sativum 230/269 923383 TUB9 gTUB1 (85%) AT4G20890 5’tccatctcgtccattccttc X54844 Unknown A. thaliana 5’gttgatatcacagatcatttcatcc 452 bp None None TUA5 AT5G19780 5’aactgttggaggttggtagttga CrUBQ11 A. thaliana 5’cgttaagactctcaccggaaa 439 bp A. thaliana 340/405 923381 UBQ11 UBQ11 (83%) AT4G05050 5’tgtcggagctctcaacttca AT4G05050 CrUBQ6 A. thaliana 5’ccctaacggggaagacgatca 440 bp A. thaliana 436/455 EU007435 UBQ6 UBQ6 (95%) AT2G47110 5’tccacaacatccaaaaacaacttcc AT2G47110

Table 4.2 Primers for qRT-PCR analyses of C. roseus reference and TIA biosynthetic genes. C. roseus gene Primer sequence Product size (bp) 25S rRNA 5’-ccaggccccgatgagtagga-3’ 138 5’-tttcccctcttcggccttc-3’ CrUBQ6 5’-gaatcccaccggaccagcag-3’ 124 5’-cctccacggagacgaaggaca-3’ CrUBQ11 5’-ggaaggcattccaccagacca-3’ 131 5’-tacctccccggagacgaagc-3’ CrACT7 5’-tgacgaagcacaatccaagagagg-3’ 137 5’-tacctccccggagacgaagc-3’ CrTUB1 5’-tcggcgatgtttaggggaaa-3’ 146 5’-tggcaacccaactggtggaa-3’ CrEF1 α 5’-tcaggaggctcttcctggtga-3’ 115 5’-agctcccttggcagggtcat-3’ CYC 5’-gtggctcgatggcaaacacg-3’ 127 5’-gccgcagtcctcaaccacaa-3’ RPS9 5’-tgaagcccttttgaggaggatg-3’ 139 5’-tgccatcccagacttgaaaaca-3’ ORCA3 5’-cgaattcaatggcggaaagc-3’ 146 5’-ccttatctccgccgcgaact-3’ TDC 5’-tccgaaaacaagcccatcgt-3’ 126 5’-aaggagcggtttcggggata-3’ STR 5’-tgacagtcccgaaggtgtgg-3’ 122 5’-cgccgggaacatgtagctct-3’ D4H 5’-taccctgcatgccctcaacc-3’ 121 5’-ttgaaggccgccaatttgat-3’ CrBPF1 5’-ccagcgagccctgttcttgg-3’ 144 5’-tggcacctccccatctgtca-3’ G10H 5’-tgaatgcttgggcaattgga-3’ 142 5’-gcaaattcttcggccagcac-3’ CPR 5’-tgggagctcattgcctcctc-3’ 144 5’-agacgatcggcctcatttgg-3’ 45

Figures

Geraniol G10H CPR 10-hydroxygeraniol 10HGO

Tryptophan Loganin TDC SLS Tryptamine Secologanin STR

Strictosidine SGD

ORCA3 4,21-dehydrogeissoschizine

Cathenamine Stemmadenine

Ajmalicine

Serpentine Tabersonine Catharanthine T16H 16OMT

NMT Vinblastine D4H Vincristine

DAT Vindoline

Figure 4.1 Terpenoid indole alkaloid pathways of C. roseus . Genes in circles are induced by MeJA (cell cultures - Rischer et al. 2006, seedlings (D4H) - Vázqyuez-Flota and De Luca 1998) and genes in squares are known to be regulated by the ORCA3 transcription factor (cell cultures - van der Fits and Memelink 2000). CPR , cytochrome P-450 reductase; G10H , geraniol 10-hydroxylase; 10HGO , 10-hydroxygeraniol NADP+ oxidoreductase; SLS , secologanin synthase; TDC , tryptophan decarboxylase; STR , strictosidine synthase; SGD , strictosidine β-D-glucosidase; T16H , tabersonine 16- hydroxylase; 16OMT , 16-hydroxytabersonine 16-O-methyltransferase; NMT , 16-methoxy-2,3-dihydro-3- hydroxytabersonine-N-methyltransferase; D4H , desacetoxyvindoline 4-hydroxylase; DAT , deacetylvindoline acetyltransferase. 46

Figure 4.2 Stability of expression of selected reference genes from C. roseus . The expression stabilities of the indicated reference genes were characterized in 20-day-old seedlings treated with MeJA solutions (0.2, 1, or 2 mM). The two most stable genes from MeJA-treated seedlings are CrEF1 α and CrUBQ11 , both of which exhibit pair-wise variations of less than 0.15 (data not shown).

ORCA3 30 25 0 mM MeJA 20 0.2 mM MeJA 15 1 mM MeJA 10 2 mM MeJA 5 0 0.5 3 6D4H 12 24 48 96 3.0 2.5 2.0 1.5 1.0 0.5 0.0 0.5 3 6STR 12 24 48 96 8 6 4 2 0 0.5 3 6G10H 12 24 48 96 4 3 2

Relative Expression Level 1 0 0.5 3 6TDC 12 24 48 96 6 5 4 3 2 1 0 0.5 3 6CRP 12 24 48 96 14 12 10 8 6 4 2 0 0.5 3 6 12 24 48 96 Hours after MeJA Application

Figure 4.3 Expression of ORCA3-regulated genes following MeJA application. 20-day-old seedlings were sprayed with solutions of 0, 0.2, 1 or 2 mM MeJA in 0.2% dimethyl sulfoxide (DMSO). Shoot tips were excised 0.5, 3, 6, 12, 24, 48, and 96 h after MeJA treatment and used for RNA extraction. RNA levels were quantified by qRT-PCR. Relative gene expression levels were obtained and calibrated using the CrEF1 α and CrUBQ11 control genes. Bars indicate means ± SD, n = 6. 48

Vindoline 400 CK 300 MeJA 200 100 0 0 20Ajmalicine 40 60 80 100 6

0 0 20Catharanthine 40 60 80 100 400 300 200 g/g FW g/g 100

g/gFresh Weight 0 0 20Serpentine 40 60 80 100 20 15 10 5 0 0 20Tabersonine 40 60 80 100 2.0 1.5 1.0 0.5 0.0 0 20 40 60 80 100 Hours after MeJA application

Figure 4.4 Time course of alterations in TIA levels in response to MeJA treatment. 20 day-old seedlings were sprayed with 0 mM (CK) or 2 mM MeJA (MeJA) in 0.2% DMSO. Shoot tips were harvested at the indicated times after spraying. Bars indicate means ± SE. 49

References

Aerts RJ, Gisi D, De Carolis E, De Luca V, Baumann TW (1994) Methyl jasmonate vapor increases the developmentally controlled synthesis of alkaloids in Catharanthus and Cinchona seedlings. Plant J 5: 635–643.

Brunner AM, Yakovlev IA, Strauss SH (2004) Validating internal controls for quantitative plant gene expression studies. BMC Plant Biol 4: 14.

Campbell EJ, Schenk PM, Kazan K, Penninckx IAMA, Anderson JP, Maclean DJ, Cammue BPA, Ebert PR, Manners JM (2003) Pathogen-responsive expression of a putative ATP- binding cassette transporter gene conferring resistance to the diterpenoid sclareol is regulated by multiple defense signaling pathways in Arabidopsis. Plant Physiol 133: 1272– 1284.

De Luca V, St Pierre B (2000) The cell and developmental biology of alkaloid biosynthesis. Trends Plant Sci 5: 168–173.

El-Sayed M, Verpoorte R (2004) Growth, metabolic profiling and enzymes activities of Catharanthus roseus seedlings treated with plant growth regulators. Plant Growth Regul 44: 53–58.

El-Sayed M, Verpoorte R (2005) Methyljasmonate accelerates catabolism of monoterpenoid indole alkaloids in Catharanthus roseus during leaf processing. Fitoterapia. 76: 83-90.

Endt DV, Kijne JW, Memelink J (2002) Transcription factors controlling plant secondary metabolism: what regulates the regulators? Phytochemistry 61: 107–114.

Facchini PJ (2001) Alkaloid biosynthesis in plants: biochemistry, cell biology, molecular regulation, and metabolic engineering applications. Annu Rev Plant Physiol Plant Mol Biol 52: 29–66.

Farmer EE, Alméras E, Krishnamurthy V (2003) Jasmonates and related oxylipins in plant responses to pathogenesis and herbivory. Curr Opin Plant Biol 6: 372–378.

Gantet P, Imbault N, Thiersault M, Doireau P (1998) Necessity of a functional octadecanoic pathway for indole alkaloid synthesis by Catharanthus roseus cell suspensions cultured in an auxin-starved medium. Plant Cell Physiol 39: 220–225.

Hashimoto T, Yamada Y (1994) Alkaloid biogenesis: molecular aspects. Annu Rev Plant Physiol Plant Mol Biol 45: 257-285.

Hughes EH, Hong SB, Gibson SI, Shanks JV, San KY (2004a). Metabolic engineering of the indole pathway in Catharanthus roseus hairy roots and increased accumulation of tryptamine and serpentine. Metab Eng 6: 268-276.

Hughes EH, Hong SB, Gibson SI, Shanks JV, San KY (2004b). Expression of a feedback- resistant anthranilate synthase in Catharanthus roseus hairy roots provides evidence for tight regulation of terpenoid indole alkaloid levels. Biotechnol Bioeng 86: 718-727.

Ishitani R, Sunaga K, Hirano A, Saunders P, Katsube N, Chang DM (1996) Evidence that glyceraldehyde-3-phosphate dehydrogenase is involved in age-induced apoptosis in mature cerebellar neurons in culture. J Neurochem 66: 928–935.

Jordan MA, Thrower D, Wilson L (1991) Mechanism of inhibition of cell proliferation by Vinca alkaloids. Cancer Res 51: 2212-2222.

Meijer AH, Verpoorte R, Hoge JHC. (1993) Regulation of enzymes and genes involved in terpenoid indole alkaloid biosynthesis in Catharanthus roseus . J Plant Res 3: 145-164.

Nicot N, Hausman JF, Hoffmann L, Evers D (2005) Housekeeping gene selection for real- time RT-PCR normalization in potato during biotic and abiotic stress. J Exp Bot 56: 2907– 2914.

Pauw B, Hilliou FAO , Sandonis Martin V, Chatel G, de Wolf CJF, Champion A, Pré M, van Duijn B, Kijne JW, van der Fits L, Memelink J (2004) Zinc finger proteins act as transcriptional repressors of alkaloid biosynthesis genes in Catharanthus roseus. J Biol Chem 279: 52940-52948.

Peebles CAM, Hong SB, Gibson SI, Shanks JV, San KY (2005). Transient effects of overexpressing anthranilate synthase α and β subunits in Catharanthus roseus hairy roots. Biotechnol Prog 21: 1572-1576.

Rijhwani SK, Shanks JV (1998) Effect of elicitor dosage and exposure time on biosynthesis of indole alkaloids by Catharanthus roseus hairy root cultures. Biotechnol Prog 14: 442-449.

Rischer H, Oreši č M, Seppänen-Laakso T, Katajamaa M, Lammertyn Freya, Ardiles-Diaz W, Van Montagu MCE, Inzé D, Oksman-Caldentey K-M, Goossens A (2006) Gene-to- metabolite networks for terpenoid indole alkaloid biosynthesis in Catharanthus roseus cells. Proc Natl Acad Sci USA 103: 5614-5619.

Schmittgen T, Zakrajsek BA (2000) Effect of experimental treatment on housekeeping gene expression: validation by real-time, quantitative RT-PCR. J Biochem Biophys Methods 46: 69–81.

Shanks JV, Bhadra R, Morgan J, Rijhwani S, Vani S (1998) Quantification of metabolites in the indole alkaloid pathways of Catharanthus roseus : implications for metabolic engineering. Biotechnol Bioeng 58: 332–338.

Siberil Y, Benhamron S, Memelink J, Giglioli-Guivarc’h N, Thiersault M, Boisson B, Doireau P, Gantet P (2001) Catharanthus roseus G-box binding factors 1 and 2 act as 51

repressors of strictosidine synthase gene expression in cell cultures. Plant Mol Biol 45: 477– 488.

Singh R, Green MR (1993) Sequence-specific binding of transfer RNA by glyceraldehyde-3- phosphate dehydrogenase. Science 259: 365–368.

St-Pierre B, Vazquez-Flota FA, De Luca V (1999) Multicellular compartmentation of Catharanthus roseus alkaloid biosynthesis predicts intercellular translocation of a pathway intermediate. Plant Cell 11: 887–900.

Thellin O, Zorzi W, Lakaye B, De Borman B, Coumans B, Hennen G, Grisar T, Igout A, Heinen E (1999) Housekeeping genes as internal standards: use and limits. J Biotechnol 75: 291–295. van Der Heijden R, Jacobs DI, Snoeijer W, Hallard D, Verpoorte R (2004) The Catharanthus alkaloids: pharmacognosy and biotechnology. Curr Med Chem 11: 607-628.

van der Fits L, Memelink J (2000) ORCA3, a jasmonate-responsive transcriptional regulator of plant primary and secondary metabolism. Science 289: 295-297. van der Fits L, Zhang H, Menke FLH, Deneka M, Memelink J (2000) A Catharanthus roseus BPF-1 homologue interacts with an elicitor-responsive region of the secondary metabolite biosynthetic gene Str and is induced by elicitor via a JA-independent signal transduction pathway. Plant Mol Biol 44: 675–685. van der Fits L, Memelink J (2001) The jasmonate-inducible AP2/ERF-domain transcription factor ORCA3 activates gene expression via interaction with a jasmonate-responsive promoter element. Plant J 25: 43-53.

Vandesompele J, De Preter K, Pattyn F, Poppe B, Van Roy N, De Paepe A, Speleman F (2002) Accurate normalization of realtime quantitative RT-PCR data by geometric averaging of multiple internal control genes. Genome Biol 3: research0034.1-0034.11.

Vázqyuez-Flota F, De Luca V (1998) Jasmonate modulates development- and light-regulated alkaloid biosynthesis in Catharanthus roseus . Phytochemistry 49: 395–402.

Walker NJ (2002) A technique whose time has come. Science 296: 557–559.

Warrington JA, Nair A, Mahadevappa M, Tsyganskaya M (2000) Comparison of human adult and fetal expression and identification of 535 housekeeping/maintenance genes. Physiol Genomics 2: 143–147.

Zhao J, Davis LC, Verpoorte R (2005) Elicitor signal transduction leading to production of plant secondary metabolites. Biotechnol Adv 23: 283-333.

Chapter 5 - Transient Effects of Overexpressing Anthranilate Synthase ααα and βββ Subunits in Catharanthus roseus Hairy Roots in Light and Dark

Conditions

Draft of paper to be submitted for publication.

Guy W. Sander 1,4 , Susan I. Gibson 2,5 , Ka-Yiu San 3,5 , and Jacqueline V. Shanks 1,6

1Department of Chemical and Biological Engineering, Iowa State University, Ames, IA

2Department of Plant Biology, University of Minnesota, St. Paul, MN

3Department of Bioengineering, Rice University, Houston, TX

4Primary researcher and author

5Co-principal investigator

6Principal investigator and corresponding author

Abstract

Hairy root cultures of Catharanthus roseus expressing a feedback-resistant anthranilate synthase (AS) α subunit from Arabidopsis under the control of a glucocorticoid- inducible promoter and an AS β subunit from Arabidopsis under the control of the constitutive CaMV 35S promoter were used to investigate the effect of light-adaptation, biosynthetic enzyme overexpression, and the combination of these two factors on the production of terpenoid indole alkaloids (TIAs). Light adaptation decreases metabolite levels by increasing flux, as determined by a stoichiometric model, out of the metabolite pools.

Induction of the AS α gene in dark-grown hairy roots caused dramatic increases in tryptophan and tryptamine, but the flux out of the TIA pools was increased, thereby depleting the levels 53

of indole alkaloids. The induction of the light-adapted hairy roots also caused increased accumulation of tryptophan and tryptamine and an increase in flux out of the TIA pools, again decreasing the levels of indole alkaloids. These results point towards controlling metabolite degradation as a potential focus for metabolic engineering efforts.

Introduction

The valuable antineoplastic alkaloids vincristine and vinblastine extracted from

Catharanthus roseus have long been a target of researchers trying to increase their production. Extensive work has shed light on the complex biosynthetic pathways (Figure

5.1). However, these complexities make engineering the terpenoid indole alkaloid (TIA) pathway difficult.

TIAs are formed from the coalescence of the indole and terpenoid pathways. The terpenoid pathway begins with geraniol that is transformed by several steps into secologanin.

Above the indole pathway, chorismate is converted to anthranilate by anthranilate synthase

(AS). From there anthranilate undergoes several reactions including the first committed step of the indole pathway, the production of tryptophan. Tryptophan is converted to tryptamine by tryptophan decarboxylase (TDC). Tryptamine combines with secologanin from the terpenoid pathway to form strictosidine. From strictosidine a variety of TIAs are produced.

Difficulty in engineering the indole pathway lies with the AS enzyme. AS is a tetramer consisting of two α subunits and two β subunits and is feedback-sensitive to both tryptophan and tryptamine (Figure 5.2) [1]. In a hairy root line engineered with a feedback- resistant AS α subunit from Arabidopsis [2] under the control of a glucocorticoid-inducible promoter system [3] , significant increases in the levels of tryptophan and tryptamine (300- and 10-fold, respectively) were observed 72 hours after induction during the late exponential 54

phase, but no significant changes in the levels of TIAs were measured [1]. In a similar hairy root line (ASAB-1) engineered with the same feedback-resistant Arabidopsis AS α subunit under control of the glucocorticoid-inducible promoter but with constitutive expression

(CaMV 35S promoter) of the Arabidopsis AS β subunit [4] significant increases in the levels of tryptophan and tryptamine (33- and 5.4-fold, respectively) again were shown along with decreased levels of lochnericine, hörhammericine, and tabersonine 72 hours after induction

[5]. A temporal study of this latter hairy root line demonstrates the transient nature of TIAs in the 4- to 72-hour time period after induction in the late exponential growth phase. The levels of tryptophan and tryptamine significantly increased and then leveled off (0.39 to 13.0

mol/g dry weight (DW) at 72 hours for tryptophan; peak concentration of 4.37 mol/g DW at 72 hours for tryptamine). Levels of ajmalicine increased after 12 hours and levels of lochnericine, hörhammericine, and tabersonine decreased. The levels of some alkaloids did not change for up to 12 hours after induction, indicating that changes in metabolism upon induction are not instantaneous [6].

In effort in gain an increased understanding of how the biosynthetic pathways react to metabolic engineering efforts, a more comprehensive profiling of metabolites have been measured and quantified in this study. Particular attention is placed at the coalescence point of the indole and terpenoid pathways, the strictosidine synthase (STR) enzyme, with the measurement of tryptamine, secologanin, and strictosidine. This branchpoint likely has an important influence on the downstream alkaloids.

We investigate the effect of light in this study to survey how both the strictosidine and the tabersonine branchpoints respond to light. Tabersonine is a crucial intermediate in the synthesis of vindoline, and the regulation involved at this branchpoint will be important 55

to future metabolic engineering efforts to produce vindoline from hairy roots. Several enzymes between tabersonine and vindoline are light dependent, and decreases in tabersonine have been seen with lighted growth of hairy roots [7]. Tabersonine 16-hydroxylase (T16H),

16-methoxy-2,3-dihydro-3-hydroxytabersonine-N-methyltransferase (NMT), desacetoxyvindoline 4-hydroxylase (D4H), and deacetylvindoline 4-O-acetyltransferase

(DAT) are light-activated (Figure 5.3). T16H and DAT are transcriptionally regulated. D4H is under several levels of developmental and light-mediated regulation, as reviewed in

Facchini (2001) and Facchini et al. (2003) [8, 9].

While levels of metabolites can reveal some information about regulation, metabolite fluxes through the biosynthetic reactions are more relevant to how the regulation is affecting the ability to produce important metabolites. A metabolic flux model was developed to investigate how fluxes through the biosynthetic pathways are affected by the overexpression of the AS enzymes.

This study reports the temporal metabolite levels and fluxes in the ASAB-1 hairy root line [5] under four conditions: light-grown and light-grown AS overexpression; and dark- grown and dark-grown AS overexpression.

Materials and Methods

Chemicals

Dexamethasone (Sigma) was dissolved in ethanol and added the culture media.

(Sigma) were dissolved in methanol and used as HPLC standards. Methanol, acetonitrile, 56

ammonium acetate, and phosphoric acid were HPLC grade (Fisher Scientific). Formic acid

(Fluka), trichloroacetic acid (Fluka), and ethanol (Pharmco-Aaper) were high purity. Growth media was prepared with sucrose (MP Biomedicals, Inc), Gamborg’s B5 salts (Sigma), and

Gamborg’s vitamins (Sigma).

Culture Conditions

The hairy root cultures were grown in filter-sterilized (0.22 m filter, Nalgene) media containing 30 g/l sucrose (MP Biomedicals, Inc), half-strength Gamborg’s B5 salts (Sigma), and full-strength Gamborg’s vitamins (Sigma) with the pH adjusted to 5.7. Hairy root cultures are started with five, 5 cm long root tips in 50 ml of culture media in a 250-ml

Erlenmeyer flask. The flask was stoppered with a foam plug (Jaece Industries). Dark grown cultures were maintained in incubator shakers at 26°C and 100 rpm. Light grown cultures were also subjected to 24-hour fluorescent lighting (24-36 mol m -2 s-1). Light grown cultures were light adapted for 9 subculture cycles before the experiment took place. The hairy root cultures were subcultured at intervals of 21 days for the light-grown cultures and

28 days for the dark grown cultures. Subculturing was performed by cutting five root tips from a mature culture and transferring them to 50 mL of fresh media.

Induction of the Catharanthus roseus Hairy root Lines

The volume of the remaining culture media was measured by drawing the media up into a 50-ml serological pipet (Corning). The average media volume of the cultures to be induced was calculated. Based on this average, the appropriate amount of a 0.5 mM dexamethasone stock in ethanol was added to the cultures for a final concentration of 0.2 M dexamethasone in the culture media. The induction level of 0.2 M dexamethasone, which is 57

an 80% induction as compared to 3 M dexamethasone [10, 11], is used to reduce browning.

An equal amount of ethanol was added to the uninduced controls.

Harvesting Hairy Root Cultures

To determine the fresh weight of the hairy root cultures, the hairy roots were removed from the shake flasks and rinsed with deionized water. They were then blotted with low-lint tissues (Kimberly-Clark) to remove excess moisture, placed into tared 50-mL centrifuge tubes (Corning), and weighed. The tubes of biomass were then frozen at minus 80 °C. Dry weight was determined after freeze drying (Labconco). Tissue was ground to a fine powder using a mortar and pestle.

The remaining growth media in the shake flask was quantified by drawing it up into a

50-ml serological pipet (Corning). A sample of the media was put into a 15-ml centrifuge tube (Corning) and frozen at minus 80°C.

Alkaloid Extraction

About 50 mg of freeze-dried and ground hairy roots were added to a 50-ml centrifuge tube and extracted with 10 ml of methanol using a sonicating probe for 10 minutes while held on ice. The extracts were centrifuged at 4000 rpm for 12 minutes at 15 °C. The supernatant was removed and the biomass was extracted one more time in the same manner. The combined supernatants were passed through a 0.45 m nylon filter (25mm, PJ Cobert), dried on a nitrogen evaporator (Organomation), reconstituted in 2 ml of methanol, and passed through a 0.22 m nylon filter (13mm, PJ Cobert) for HPLC analysis. Extracts were stored at minus 25 °C. 58

HPLC Analysis of Metabolites

Twenty microliters of the alkaloid extract was injected into a Phenomenex Luna®

C18(2) column (250 x 4.6 mm) using three solvent systems. The Waters high performance liquid chromatography system consisted of two 510 pumps, a 717plus Autosampler, and a

996 Photo Diode Array (PDA) detector. To detect tryptophan and tryptamine, UV detection at 218 nm was used [1, 12]. Quantification was performed by comparison to standard curves.

For the first 12 minutes, a 15:85 mixture of acetonitrile:100 mM phosphoric acid (pH 2) was maintained at a flow rate of 1 ml/min. The column was then washed by ramping to an 85:15 mixture over 15 minutes. The flow was then returned to 15:85 and allowed to re-equilibrate.

For the detection of terpenoid indole alkaloids a second solvent system was used.

Data extracted at 254 nm were used to quantify strictosidine, ajmalicine, serpentine, catharanthine, and vindoline using standard curves. Data extracted at 329 nm were used to quantify tabersonine, hörhammericine, and lochnericine using retention time standards, LC-

MS, and a comparison to a tabersonine standard curve [1, 13]. The protocol was adapted from Peebles et al. (2005) to use LC-MS compatible solvents [6]. For the first 5 minutes, at a flow rate of 1 ml/min, the mobile phase was a 30:70 mixture of acetonitrile:100 mM ammonium acetate (pH 7.3). The mobile phase was linearly ramped to 64:36 over the next

10 minutes and maintained at that ratio for 15 minutes. The flow rate was increased to 1.4 ml/min over 5 minutes. The ratio was then increased to 80:20 during the next 5 minutes and maintained for 15 minutes. The flow rate and mobile phase ratio were then returned to 1 ml/min and 30:70 and the column was allowed to re-equilibrate.

For detection of iridoid glycosides a third solvent system was used. Data extracted at

235 nm was used to quantify loganin and secologanin. The protocol was adapted from 59

Dagnino et al. (1996) and Yamamoto et al. (1999) [14, 15]. For 30 minutes, at a flow rate of

1 ml/min, the mobile phase was linearly ramped from a 90:10 to a 75:25 mixture of 1% formic acid (v/v)/0.25% trichloroacetic acid (w/v):acetonitrile. The ratio was returned to

90:10 and the column was allowed to re-equilibrate.

Five microliters of the alkaloid extract was injected into a Waters Nova-Pak® C18 column (150 x 2.1 mm). For detection of iridoids data was extracted at 200 nm to quantify geraniol and 10-hydroxygeraniol. The protocol was adapted from Collu et al. (1999) [16].

Isocratic elution was achieve using a mobile phase of 50:50 methanol:water maintained at a flow rate of 0.2 ml/min for 60 minutes. Analysis was performed with Empower Pro software

(Waters).

LC-MS Analysis of Metabolites

The Agilent Technologies 1100 series liquid chromatography (LC) system with a binary pump, a temperature-controlled autosampler, and a diode-array detector mated with an

Agilent MSD model SL ion trap mass spectrometer (MS). Chromatography was conducted using the same methods and columns as the HPLC methods. The mass spectrometer was operated in positive ion mode and full scan data was collected between 50 and 1000 m/z.

Analysis was performed with ChemStation software (Agilent Technologies). The LC-MS analysis was performed at the W. M. Keck Metabolomics Research Laboratory.

Flux Modeling Methodology

The fluxes of the metabolites were calculated based on the total metabolite productivity of the hairy root cultures [17]. The dynamic mass balance for the metabolites is written as 60

d(C X ) i = Xr − kC (5.1) dt i i where C is the specific yield of a metabolite ( mol g DW -1), X is the biomass (g DW), t is the time (h), r is the net rate of synthesis of a metabolite ( mol g DW -1 h-1), k is the linear growth rate constant (g DW h -1), and i represents each alkaloid. The net rate of synthesis is written in terms of the stoichiometric coefficients and fluxes

J ri = ∑ g ji v j (5.2) j=1 where gji is the stoichiometric coefficient of metabolite i in reaction j (value is positive for reactions that create the metabolite i and negative for those that consume metabolite i) and vj is the flux of reaction j (mol g DW -1 h-1).

Following the reaction scheme laid out in Model A (Figure 5.4a), the metabolite balances would then be written as

d(C X ) tryptophan = X ()v − v − kC (5.3) dt 0 1 tryptophan

d(C X ) tryptamine = X ()v − v − kC (5.4) dt 1 4 tryptamine

d(C X ) loganin = X ()v − v − kC (5.5) dt 2 3 loganin

d(C X ) secologani n = X ()v − v − kC (5.6) dt 3 4 secologani n

d(C X ) strictosid ine = X ()v − v − kC (5.7) dt 4 5 strictosid ine

d(C X ) ajmalicine = X ()v − v − kC (5.8) dt 6 7 ajmalicine 61

d(C X ) serpentine = X ()v − kC (5.9) dt 7 serpentine

d(C X ) catharanth ine = X ()v − kC (5.10) dt 9 catharanth ine

d(C X ) tabersonin e = X ()v − v − kC (5.11) dt 10 11 tabersonin e

d(C X ) lochnerici ne = X ()v − v − kC (5.12) dt 11 12 lochnerici ne

d(C X ) hörhammerici ne = X ()v − kC (5.13) dt 12 hörhammerici ne

X (v5 ) = X (v6 + v8 ) and X (v8 ) = X (v9 + v10 ) (5.14)

-1 In this determined system, the Xv j values (flux productivity) ( mol h ) can be solved for using the averaged alkaloid concentration and biomass measurements for triplicate cultures at each of the transient time points. These values were numerically integrated over the period from 4 to 72 hours resulting in values for total metabolite accumulation ( mol (68 h) -1) and total reaction flux productivity ( mol (68 h) -1) for the entire transient experiment.

A problem associated with solving this system as described in Model A is several of the pathways dead end. If a metabolite decreases in level, the system will yield a negative flux value for the proceeding reaction or reactions if the value is large enough. These biosynthetic reactions are not reversible reactions. The addition of a reaction as an outlet for decreasing metabolite levels, whether associated with flux to an unmeasured metabolite, flux to a degradation pathway, or flux of the metabolite out of the cell, causes the system to be underdetermined, resulting in infinite solutions unless more measurements or assumptions are made. 62

The addition of outlet reactions for serpentine, hörhammericine, and catharanthine, as shown in Figure 5.4b, makes the system underdetermined and requires assumptions to compensate. The first assumption is metabolites other than serpentine, hörhammericine, and catharanthine do not have significant outlet reactions. The second assumption is flux resulting from a decreasing metabolite level goes downstream. The third assumption is branch points in the pathways are rigid nodes, where the ratio of the split pathways remains the same in the induced cultures as the uninduced cultures. This is used to distribute flux coming downstream from decreasing metabolite pool levels.

Solving the system as the determined Model A and then recalculating for the additional assumptions of underdetermined Model B results in several reaction fluxes having the value of zero, due to forcing metabolites downstream. It is unlikely that these biosynthetic reactions would have a flux of zero given the non-homogeneity of the biomass growth in the culture flask [17]. Model C breaks the dilution and accumulation parts of the dynamic balance into two models (Equations 5.15 and 16) where the assumptions are applied and then the total reaction fluxes of each of the models are added together (Equation 5.17).

d(C X )  J  i =  X g v  (5.15) dt  ∑ ji j   j=1 accumulati on

 J  kC =  X g v  (5.16) i  ∑ ji j   j=1 dilution

Xv + Xv = Xv (5.17) ( j )dilution ( j )accumulati on ( j )minimum flux

The resulting total metabolite accumulations of the summed models, Model C, are the same as Model B. The total reaction fluxes are different between the two models as the instances of changes in metabolite accumulation resulting in negative flux values for the 63

dilution and accumulation terms are different. The fluxes of Model C are termed minimum total flux productivities. The minimum qualifier is used because the system is underdetermined and additional flux into the biosynthetic network would only result in proportionally increased flux out of the network.

Statistical Analysis

Data were analyzed using the Students t-test for unequal sample size and unequal variance. A few data were removed as outliers following Peirce’s criterion.

Results

To investigate the transient levels of TIAs over a period of time after gene induction in dark- and light-grown cultures, we used the previously generated C. roseus hairy root line

[5] that has a feedback-resistant AS α subunit from Arabidopsis expressed under the control of a glucocorticoid-inducible promoter and an AS β subunit from Arabidopsis under the control of the constitutive CaMV 35S promoter. This hairy root line has high constitutive levels of AS β expression but has high expression of the feedback-resistant AS α only in the presence of a glucocorticoid, such as dexamethasone [6]. The advantage of the inducible promoter system is that we can investigate the effects of altered expression within the same genetic line, thereby minimizing clonal variation.

As in the previous study, hairy root cultures in the late exponential growth phase (21 days after subculturing) were induced and harvested at 4, 8, 12, 24, 36, 48, 60, and 72 hours after induction. The induced cultures were given dexamethasone in ethanol from a stock solution so the concentration of dexamethasone in the culture media was 0.2 M. The uninduced cultures were given an equal volume of ethanol. 64

Trends in Metabolite Levels

Upon induction, the levels of tryptophan and tryptamine increase dramatically. In the dark-grown induced cultures, tryptophan levels increased significantly from 4 to 60 hours where they leveled off (p<0.05) (Figure 5.5a). The peak concentration of tryptophan was

26.8 mol/g DW, a more than 92-fold significant increase from the basal level of 0.29

mol/g DW in the dark-grown roots (p<0.05). From 4 hours to 60 hours, tryptophan increased at a rate of 0.473 mol/g DW per hour. The light-grown roots also had a significant (p<0.05) but less dramatic increase (Figure 5.5b). Tryptophan levels peaked at 36 hours at a concentration of 11.66 mol/g DW, a 13.5-fold significant increase from the basal levels of 0.86 mol/g DW (p<0.05). From 4 hours to 36 hours, tryptophan increased at a rate of 0.34 mol/g DW per hour. The basal level of tryptophan was 3-fold higher in the light- grown roots, but the final induced concentration in the dark-grown roots was more that 2-fold higher. It is interesting to note that the linearity of the increase in tryptophan production and its similar slope for the light- and dark-grown induced cultures. With no change in the reaction velocity over a large range of reaction product concentrations, this suggests that the

AS enzyme is functioning as a nearly unrestricted reaction step in vivo with large potential as a carbon gateway for TIA production.

The tryptamine levels between the induced light- and dark-grown cultures trend similarly. The tryptamine levels in the induced dark-grown roots starts to level off at 24 hours where the induced light-grown roots level off at 36 hours (Figure 5.6a). The induced dark-grown roots peak at 8.79 mol/g DW, a 11.7-fold significant increase over the basal level of 0.75 mol/g DW (p<0.1) and the induced light-grown roots (Figure 5.6b) peaked at 65

10.49 mol/g DW, a 10.4-fold significant increase over the basal level of 1.01 mol/g DW

(p<0.05). Similar to tryptophan, the initial rate of tryptamine production is similar for the light- and dark-grown induced cultures (0.235 mol/g DW per hour from 4 to 36 hours and

0.227 mol/g DW per hour from 4 to 24 hours, respectively).

The levels of the iridoids geraniol and 10-hydroxygeraniol were not detectable by

HPLC. The inability to detect these iridoids is likely because the biomass samples were prepared by freeze drying. Given the vapor pressure of geraniol and that it is a common component of leaf and flower volatile essential oils, including C. roseus [18], it would have easily evaporated during lyophilization.

The levels of loganin were very stable for the dark-grown roots (Figure 5.7a). The levels for the induced and uninduced dark-grown roots are nearly the same. The light-grown roots (Figure 5.7b) show a sharp decrease in level in the first 12 hours after the administration of either the inducer or ethanol control, after which the levels of the induced and uninduced light-grown roots are nearly the same and also similar to the dark-grown roots. This suggests an enzyme near loganin as important point of regulation in TIA production [11].

Secologanin levels for uninduced dark-grown roots (Figure 5.8a) vary substantially but remain around 6-7 mol/g DW. With induction, levels decreased significantly from 4 to

24 hours (p<0.05) and remained at significantly lower levels compared to the uninduced dark-grown roots (p<0.1). Levels for uninduced and induced light-grown roots (Figure 5.8b) decrease sharply after the administration of either the inducer or ethanol control, similar to the behavior of loganin in the light-grown roots. The levels of both the induced and 66

uninduced light-grown roots are then variable. The uninduced light-grown levels are significantly lower than the uninduced dark-grown levels at 48 and 60 hours (p<0.1).

Investigating with the chromatographic method for loganin and secologanin by LC-

MS, intermediates from the iridoid glycoside pathway [19] were not detected by searching for estimated primary peaks in the mass spectra. Loganin (235.6 nm λ-max, [M+Na] + 413.2

(35), [M+H] + 391.2 (4), [M+H-Glu] + 229.1 (100)); secologanin (235.6 nm λ-max, [M+Na]+

411.2 (65), [M+H] + 389.1 (8), [M+H-Glu] + 227.1 (100)). Similar fragmentation was seen in

[20]. Estimated UV and mass spectra: 7-deoxyloganic acid (235.6 nm λ-max, [M+Na] +

383.1, [M+H] + 361.2, [M+H-Glu] + 199.1); loganic acid (235.6 nm λ-max, [M+Na] + 399.1,

[M+H] + 377.2, [M+H-Glu] + 215.1); 7-deoxyloganin (235.6 nm λ-max, [M+Na] + 397.1,

[M+H] + 375.2, [M+H-Glu] + 213.1).

The levels of eight TIAs were evaluated in this study including strictosidine, ajmalicine and serpentine from the corynanthe family, catharanthine from the iboga family, and tabersonine, hörhammericine, lochnericine, and vindoline from the aspidoperma family

[6, 21]. Vindoline, also considered a plumeran family alkaloid [22], was not detected as hairy roots of C. roseus only accumulate the vindoline precursor, tabersonine. The final steps of vindoline biosynthesis are performed in aerial parts of the whole C. roseus plant [5,

23, 24]. With no vindoline present, the bisindole alkaloids of interest with antineoplastic properties, vinblastine and vincristine, are also not produced.

The levels of strictosidine in uninduced dark-grown roots (Figure 5.9a) increased at

36 hours to 3.20 mol/g DW and then slowly decline to 2.15 mol/g DW, a similar level to the 8- and 12-hour time point. The induced dark-grown roots continued a significant gradual 67

decline from 12 to 72 hours to a final level of 1.29 mol/g DW (p<0.05). In the light-grown roots (Figure 5.9b) induction had no effect on final strictosidine levels.

For catharanthine levels, the uninduced dark-grown roots (Figure 5.10a) are similar to the induced dark-grown roots. The uninduced light-grown roots (Figure 5.10b) significantly decreased from 4 to 24 hours where they stabilized (p<0.05). The induced light-grown roots had a significantly increased catharanthine concentration at 72 hours (p<0.1) compared to the uninduced light-grown roots. Although the induced light-grown roots peaked at 1.96 mol/g

DW at 60 hours, the uninduced light-grown roots actually started near the same value at 2.01

mol/g DW before decreasing to 1.04 mol/g DW at 24 hours.

Ajmalicine levels trended similarly for the uninduced and induced dark-grown roots

(Figure 5.11a). For the light-grown cultures (Figure 5.11b), the ajmalicine levels in the uninduced cultures decreased significantly from 8 to 36 hours (p<0.05). The induced light- grown cultures had levels that significantly increased, peaking at 3.41 mol/g DW at 60 hours (p<0.05), a significant 1.4-fold increase over the uninduced light-grown roots at 2.40

mol/g DW (p<0.05).

The serpentine levels in the dark-grown roots (Figure 5.12a) were very similar for the uninduced and induced cultures. Levels at 72 hours for the induced and uninduced were 1.33

mol/g DW and 1.19 mol/g DW, respectively. The light-grown roots (Figure 5.12b) had significantly increased levels of serpentine compared to the dark-grown (p<0.05). The induced and uninduced light-grown roots also trended together peaking at 72 hours at levels of 2.22 mol/g DW and 2.00 mol/g DW, respectively. 68

The corynanthe pool (Figure 5.13a and b), consisting of ajmalicine and serpentine, had relatively similar trends except for the induced light-grown roots. The induced light- grown roots had a significant increase at 60 hours to 5.53 mol/g DW (p<0.05). The corynanthe pool levels for the uninduced light-grown cultures are significantly increased over the uninduced dark-grown cultures levels (p<0.05).

Tabersonine levels in uninduced dark-grown cultures (Figure 5.14a) start at 1.91

mol/g DW at 12 hours and then significantly decrease to 1.01 mol/g DW at 48 hours

(p<0.05) before significantly increasing to 1.63 mol/g DW at 72 hours (p<0.1). The induced dark-grown culture displayed a significant decrease from 1.45 mol/g DW at 8 hours to 0.03 mol/g DW at 72 hours (p<0.05), a 97.7% decrease. The uninduced light- grown levels (Figure 5.14b) were significantly lower than the uninduced dark-grown levels

(p<0.05) and quite variable. The induced light-grown levels decreased similarly to the induced dark-grown cultures. Levels decreased from 0.36 mol/g DW at 24 hours to 0.01

mol/g DW at 72 hours, a 98.4% decrease.

Lochnericine levels in uninduced dark-grown cultures (Figure 5.15a) were relatively stable. The levels of the induced dark-grown cultures significantly decline from 4.54 mol/g

DW at 4 hours to 0.44 mol/g DW at 72 hours (p<0.05), a 90.4% decrease. The uninduced light-grown levels (Figure 5.15b) had a significant decrease in level from 12 to 24 hours

(p<0.1), and then remained stable. The induced light-grown levels significantly decreased from 1.26 mol/g DW at 24 hours to 0.32 mol/g DW at 72 hours (p<0.05), a 74.3% decrease. 69

Hörhammericine levels in uninduced dark-grown cultures (Figure 5.16a) were relatively stable. The induced dark-grown cultures significantly decreased from 1.62 mol/g

DW at 4 hours to 0.18 mol/g DW at 72 hours (p<0.05), an 88.6% decrease. The uninduced light-grown levels (Figure 5.16b) significantly decrease in level from 8 to 24 hours (

82.9% decrease. Hörhammericine is the only aspidosperma alkaloid that has higher levels in light-grown than dark-grown cultures. Tabersonine and lochnericine both have significantly higher levels in dark-grown cultures (p<0.05).

Comparing levels for uninduced dark-grown aspidosperma TIAs, there is a small decrease in lochnericine that is compensated for by a small increase in hörhammericine. This small compensation is outdone by the large dip in tabersonine levels resulting in an overall decrease in the aspidosperma pool (tabersonine + lochnericine + hörhammericine) (Figure

5.17a). In the induced dark-grown cultures, all the aspidosperma alkaloids significantly decrease upon induction, resulting in a reduction of pool levels from 7.62 mol/g DW at 4 hours to 0.66 mol/g DW at 72 hours (p<0.05), a 91.4% decrease that is extrapolated to keep falling. The uninduced light-grown levels for the aspidosperma pool (Figure 5.17b) decrease significantly from 12 to 24 hours (p<0.05) and then level off. The induced light-grown pool levels decrease from 3.88 mol/g DW at 4 hours to 0.72 mol/g DW at 72 hours (p<0.05), an

81.5% decrease that is also extrapolated to keep falling. 70

Upon investigation with LC-MS, intermediates from tabersonine to vindoline were not detected in the chromatographic method by searching for molecular ions in the MS spectra.

The level of total measured terpenoid indole alkaloids (strictosidine + ajmalicine + serpentine + catharanthine + tabersonine + lochnericine + hörhammericine) is relatively constant for the uninduced dark-grown cultures (Figure 5.18a). The induced dark-grown cultures sharply decrease and then continue to decrease to 72 hours for an overall 56.3% significant decrease in total measured TIAs (p<0.05). The uninduced light-grown cultures

(Figure 5.18b) drop off significantly in the first 24 hours (p<0.05), a decrease that is seen across all TIAs, and then slowly has a significant increase (p<0.05). The induced light- grown cultures had variable levels of TIAs but had similar levels to the uninduced cultures.

The highest total measured TIAs were seen in the uninduced dark-grown cultures.

Minimum Metabolic Flux Model

The minimum metabolic flux map for the uninduced dark-grown cultures (Figure

5.20a) shows that during the transient experiment the minimum total flux productivity

(MTFP) of the terpenoid pathway is more than the indole pathway. This is because the terpenoid pathway is accumulating more metabolites. All of the TIAs have positive total accumulations with the strictosidine and the aspidosperma pool accounting for the largest accumulations.

The induced dark-grown cultures (Figure 5.20b) have significantly altered MTFPs compared to the uninduced dark-grown roots. The MTFP for the indole pathway is sharply increased with most of the increase going towards accumulation of indoles. The terpenoid pathway has significantly decreased production; however, the flux through the STR 71

branchpoint is increased due to the negative accumulation in iridoid glycoside pools. All of the TIAs have negative accumulations with large MTFPs out of the aspidosperma pool.

The uninduced light-grown cultures (Figure 5.21a) have a similar MTFP for the indole pathway as the uninduced dark-grown roots, but the terpenoid pathway has a lower

MTFP because of the negative total accumulation of iridoid glycosides. The MTFP into STR is also similar but many of the TIAs have negative total accumulations so there is significant flux out of the TIA pathways. The MTFP out of the corynanthe pool accounts for most of the outgoing flux.

The induced light-grown cultures (Figure 5.21b) also have significantly altered

MTFPs compared to the uninduced light-grown roots. The MTFPs into the indole and terpenoid pathways are higher than the induced dark-grown cultures. However, the indole pathway is accumulating less indoles and the terpenoid pathways has an increased negative total accumulation of iridoid glycosides, causing a MTFP towards STR to be more than double the amount of the induced dark-grown roots. All the TIAs except for ajmalicine have negative accumulations with large MTFPs out of the corynanthe and aspidosperma pools.

Discussion

This study measures effects of light and AS αβ overexpression on the levels of eleven metabolites. The levels of two indole alkaloids (tryptophan and tryptamine), two iridoid glycosides (loganin and secologanin), and seven terpenoid indole alkaloids (strictosidine, catharanthine, ajmalicine, serpentine, tabersonine, lochnericine, and hörhammericine) were quantified. Geraniol, 10-hydroxygeraniol, and vindoline were not detected. The effects of lighted growth, gene induction, and lighted growth with gene induction had varying and interesting effects. 72

Effect of Light Adaptation

The effect of lighted growth on alkaloid levels was investigated to see how the strictosidine and tabersonine branchpoints respond. Tryptophan levels were significantly elevated in the uninduced light-grown cultures compared to the uninduced dark-grown ones,

0.57 mol/g DW to 0.30 mol/g DW, respectively (p<0.1). However, these levels are minuscule compared to the induced light- and dark-grown cultures. Tryptamine levels were very similar between the uninduced light- and dark-grown cultures.

There was a difference in how lighted growth affected the iridoid glycosides, loganin and secologanin. Loganin had very similar levels between uninduced light- and dark-grown conditions whereas secologanin trended differently under the light-grown conditions.

The first TIA, strictosidine, had significantly increased levels in the uninduced dark- grown roots from 48 to 60 hours but returned to levels similar to the uninduced light-grown roots (48 h, p<0.1; 60 h, p<0.05). Strictosidine is produced at the coalescence point of the indole and iridoid glycoside pathways. Examining the combined levels of tryptamine, secologanin, and strictosidine shows the levels of this metabolite pool are significantly decreased in uninduced light-grown cultures (p<0.05) (Figure 5.19a and b).

Catharanthine levels were nearly the same for uninduced light- and dark-grown cultures from 12 to 72 hours. Lighted conditions significantly increased the levels of ajmalicine and serpentine in uninduced cultures (p<0.05). Similar behaviors were seen for wild-type hairy root cultures adapted to a 12-hour photoperiod [7].

Tabersonine and lochnericine had dramatically and significantly lower levels in uninduced light-grown cultures compared to uninduced dark-grown ones (p<0.1). This was also shown by Bhadra et al . (1998). Hörhammericine had significantly increased levels in 73

uninduced light-grown roots at 4 and 8 hours (p<0.05), but where not significantly increased thereafter. Levels of hörhammericine were unchanged for Bhadra et al . (1998). The decreases in tabersonine and lochnericine caused an overall significant decrease of alkaloids in the aspidosperma pool (p<0.05). Examining the pool of all measured TIAs shows an overall significant decrease in TIAs for the uninduced light-grown cultures compared to uninduced dark-grown cultures (p<0.05).

Light adaptation had interesting effects on reaction fluxes. The MTFP for the indole pathway is nearly the same in the uninduced dark- and light-grown cultures. However, the

MTFP for the terpenoid pathway is decreased in the light-grown cultures and has negative total accumulations for the iridoid glycosides. The MTFP into STR is slightly increased but many of the TIAs have negative accumulations, resulting in significant MTFPs out of the

TIA pathways. The corynanthe outlet accounts for most of the MTFP out of TIA pathway.

This pathway may be a primary route for C. roseus hairy roots to purge alkaloids upon changes in regulatory status. The increases seen in ajmalicine and serpentine levels in this study and previous work [7] may be accounted for by the greatly increased flux through the pathway.

Effect of Induced Overexpression of AS α with Constitutive Overexpression of AS β

As expected, overexpression of the AS α subunit along with the constitutive overexpression of the AS β subunit in dark-grown cultures produced extremely high amounts of tryptophan and tryptamine, more than 2-fold higher than previously report with this line at

72 hours after induction [6, 11] and similar to results reported later for 48 hours after induction [5], as a result of the stabilizing metabolite profile [25]. 74

Loganin levels were very similar for uninduced and induced dark-grown roots.

Induction caused a significant decline in the levels of secologanin in the first 24 hours

(p<0.05). Levels were significantly lower than the uninduced cultures after that (p<0.1).

Strictosidine had a significant decline in the induced cultures (p<0.05). The combined levels of tryptamine, secologanin, and strictosidine were very similar for induced and uninduced dark-grown cultures. Catharanthine had similar levels between induced and uninduced.

Induction caused no significant changes for the levels ajmalicine while serpentine. Induction caused a significant sharp decline in levels for all the measured aspidosperma alkaloids for dark-grown cultures (p<0.05). Tabersonine was nearly depleted in 72 hours.

Upon induction the MTFP into the indole pathway is greatly increased and the MTFP into the terpenoid pathway is decreased. The abundance of accumulating indoles appears to cause a regulatory shift and dramatic negative accumulation of iridoid glycosides and TIAs.

This results in large MTFPs out of the TIA pathways.

Effect of Light Adaptation with Induced Overexpression of AS α and Constitutive

Overexpression of AS β

Lighted growth with gene induction reduced the level of tryptophan achieved compared to the induced dark-grown culture but there was still a significant increase compared to the uninduced light-grown roots (p<0.05). Induced light-grown tryptamine levels were similar to the induced dark-grown cultures and there was a significant increase compared to the uninduced light-grown roots (p<0.05).

Loganin levels are very similar for the induced and uninduced light-grown roots.

Secologanin has a sharp decline in the first 12 hours and then had variable levels for both in induced and uninduced cultures. Strictosidine levels are similar for induced and uninduced 75

light-grown roots. The summated pool of tryptamine, secologanin, and strictosidine has a significant increase for the induced light-grown cultures compared to the uninduced light- grown cultures (p<0.05).

Induction saw small changes in catharanthine and serpentine levels for light-grown cultures. Ajmalicine had significant increase with induction from 8 to 60 hours (p<0.05).

Tabersonine and lochnericine levels decrease upon induction for light-grown roots, similar to the dark-grown roots but much less substantial given their already reduced levels for light- grown cultures (p<0.05 for lochnericine). Hörhammericine declined significantly upon induction (p<0.05). The aspidosperma alkaloid pool showed an overall significant decrease upon induction for light-grown roots (p<0.05). Summating the levels of all TIAs reveals similar levels between the induced and uninduced light-grown cultures.

The MTFPs into the indole and terpenoid pathways for the induced light-grown cultures achieved even higher levels than the induced dark-grown roots. These increased

MTFPs did not translate into increased TIA accumulation, but instead increased MTFPs out of the TIA pathways. As with the induced dark-grown roots, the abundance of indoles results in the purging of the iridoid glycoside and TIA pools and large MTFPs out of the TIA pathways. The MTFP out the corynanthe pathway is particularly increased.

Conclusions

This work investigates the use of light, induced gene overexpression, and these in combination to see how the alkaloid profiles and fluxes of C. roseus hairy roots are altered.

Using metabolic engineering techniques we would like to see increased carbon flux to the pathways of our TIAs of interest. However, the multiple levels of regulation that occur in the

C. roseus system are of great hindrance in making substantial changes. In this study, the 76

engineering of the indole pathway causes the accumulation of large amounts of indole alkaloids, but increased fluxes out of the TIA pools depleted the levels significantly. The reduction of alkaloids with light adaptation or with gene induction could partially be explained by metabolites moving down the pathway towards other metabolites, such as tabersonine to vindoline, where light is a limiting factor [26]. However, the enzymatic steps of tabersonine to vindoline normally occur in the aerial parts of the plant and are unlikely to have occurred here [27, 28]. No new substantial peaks were found in the chromatograms to account for the large decreases seen in aspidosperma levels. The metabolites could also be exported from the cell or directed towards a degradation pathway. Preliminary results of alkaloid extractions from the remaining growth media indicated that alkaloids in the media account for a very small fraction of alkaloids in the biomass. Inhibitor studies suggest that lochnericine and hörhammericine turnover during growth [29] and interference with the activity of minvincinine-19-O-acetyltransferase (MAT), the enzyme that converts hörhammericine into 19-acetoxyhörhammericine, increases the level of hörhammericine, even though 19-acetoxyhörhammericine is not normally accumulated [30]. This leaves metabolite degradation pathways as a potentially interesting point for metabolic engineering, provided these pathways can be elucidated.

The metabolites that had the most significant response to the gene induction, outside of the large accumulations of tryptophan and tryptamine, were secologanin, tabersonine, lochnericine, and hörhammericine. These four metabolites had significantly decreased levels upon induction. All four also responded quickly to the induction, within 8 hours. While the increased levels of indoles led to the depletion of secologanin by STR, it is hypothesized that the indole levels did not directly stimulate the depletion of the aspidosperma alkaloids. The 77

level of secologanin is thought to relate to the level of tabersonine, as also seen in Chapter 6 with the 1-deoxy-D-xylulose 5-phosphate synthase (DXS) C. roseus hairy root line

(EHIDXS-4-1) where the levels of tryptophan and tryptamine are very low. As secologanin is depleted, the activity of secologanin synthase (SLS) increases to produce more secologanin. The activity of tabersonine-6,7-epoxidase (T6,7E), the enzyme converting tabersonine to lochnericine, increases to manage the increased flux related to the increased consumption of secologanin. With the extreme levels of tryptophan and tryptamine present, an increase in flux through STR, and a decreased flux from loganin, the levels of secologanin cannot be restored and T6,7E continues to consume tabersonine, even reducing the level of strictosidine when secologanin levels stabilize at the much reduced level.

This leads to a hypothesis that a single regulation mechanism exerts control over two separate parts of the biosynthetic pathway. While secologanin and tabersonine are separated by a number of enzymatic reactions, all these steps occur within the same cell type of C. roseus leaves, the epidermal cells [19, 20, 27, 28]. Although SLS has been proposed to occur in the vacuole of epidermal cells [31, 32], along with STR [28], the enzyme has not been specifically located there. A proposed action for the regulation mechanism is the increased activity of a cytochrome P450 reductase isoform [33]. Both SLS and T6,7E are cytochrome

P450-dependent oxygenases [23, 34]. The increased activity of a cytochrome P450 reductase isoform would increase the activity of the cytochrome P450-dependant enzymes SLS and

T6,7E, similar to the association of cytochrome P450-dependent geraniol 10-hydroxylase

(G10H) and cytochrome P450 reductase (CPR), where CPR is required for the activity of

G10H in the presence of a crude lipid fraction [35], as reviewed by Oudin et al. (2007) [36].

CPR is encoded by one gene in C. roseus [37] and the differential levels of CPR and 78

cytochrome P450 reductase isoforms would allow for fine control of the TIA biosynthetic pathways. The post-translational modification of the CPR into cytochrome P450 reductase isoforms could allow for subcellular targeting and interaction with specific P450 enzymes

[33]. To investigate the cytochrome P450 reductase isoforms, a method to distinguish between the isoforms would be necessary [33] and an understanding of how post-translation modifications relate to subcellular targeting and possibly to enzyme activity.

Acknowledgements

The authors express their gratitude to Dr. Christie A.M. Peebles for helping to develop the LC-MS compatible protocol and to Dr. Sarah E. O’Connor for the gift of strictosidine. We acknowledge the W. M. Keck Metabolomics Research Laboratory for acquisition of the LC-MS data. Funding was provided by the National Science Foundation

(CBET-0729753 (JVS), CBET-0729622 (K-YS), and CBET-0729625 (SIG)) and the Roy J.

Carver Graduate Research Training Fellowship in Molecular Biophysics (GWS).

Figures

Shikimate Pathway DXP Pathway

PEP + E4P Pyruvate + GA-3P DXS 1-Deoxy-D-xylulose-5-phosphate DXR 2-C-Methyl-D-erythritol-4-phosphate

Mevalonate IPP DMAPP

Chorismate AS GPP Anthranilate Geraniol CPR G10H 10-hydroxygeraniol

Tryptophan 10-oxogeraniol TDC Tryptamine 7-deoxyloganetic acid

7-deoxyloganic acid

7-deoxyloganin Loganic acid

STR LAMT Loganin SLS Strictosidine SGD Secologanin

4,21-dehydrogeissoschizine Vinblastine Vincristine Cathenamine Stemmadenine

Ajmalicine Catharanthine

T16H 16OMT NMT D4H DAT Serpentine Tabersonine Vindoline T6,7E

Lochnericine 6,7-dehydrominovincinine MAT Hörhammericine 6,7-dehydroechitovenine MAT 19-acetoxyhörhammericine 80

Figure 5.1 Biosynthesis of terpenoid indole alkaloids in Catharanthus roseus .

DXS , 1-deoxy-D-xylulose 5-phosphate synthase; DXR , 1-deoxy-D-xylulose 5-phosphate reductoisomerase; G10H , geraniol 10-hydroxylase; CPR , NADPH:cytochrome P450 reductase; LAMT , loganic acid-O- methyltransferase; SLS , secologanin synthase; AS , anthranilate synthase; TDC , tryptophan decarboxylase; STR , strictosidine synthase; SGD , strictosidine β-D-glucosidase; T16H , tabersonine 16-hydroxylase; 16OMT , 16-hydroxytabersonine-16-O-methyltransferase; NMT , 16-methoxy-2,3-dihydro-3-hydroxytabersonine-N- methyltransferase; D4H , desacetoxyvindoline-4-hydroxylase; DAT , deacetylvindoline-4-O-acetyltransferase; T6,7E , tabersonine-6,7-epoxidase; MAT , minvincinine-19-O-acetyltransferase. (Figure adapted from: [6, 19, 20, 21, 23, 24, 38, 39, 40, 41, 42, 43, 44, 45, 46, 47, 48, 49, 50]) ______

Shikimate Pathway

DXP Pathway

Chorismate Mevalonate AS Pathway Anthranilate

Iridoid Terpene Pathway Tryptophan TDC Tryptamine Secologanin

Terpenoid Indole Pathway

Figure 5.2 Regulation of the indole pathway in Catharanthus roseus . Arrows with minus signs indicate previously identified steps sensitive to feedback regulation. AS , anthranilate synthase; TDC , tryptophan decarboxylase. (Figure adapted from: [1, 2, 51])

N H N H

NMT H3CO H3CO

16-methoxy-2,3-dihydro- N CO CH Desacetoxyvindoline N CO CH 3-hydroxytabersonine H H 2 3 H 2 3 OH H3C OH D4H

N H N H

H CO H CO 3 3 OH 16-methoxytabersonine N Deacetylvindoline N CO CH H CO CH H 2 3 2 3 H3C OH 16OMT DAT

N H N H

HO H3CO OCOCH3 16-hydroxytabersonine N Vindoline N CO CH H CO CH H 2 3 2 3 H3C OH T16H

N H N H

OH H N 6,7-dehydrominovincinine N Tabersonine H H CO2CH3 CO2CH3 T6,7E MAT

N O H N H

OCOCH3 H Lochnericine N 6,7-dehydroechitovenine N H H CO2CH3 CO2CH3

O O N H N H MAT OH OCOCH3 H H Hörhammericine N 19-acetoxyhörhammericine N H H CO2CH3 CO2CH3 Figure 5.3 Biosynthesis of tabersonine derivatives in Catharanthus roseus . T16H , tabersonine 16-hydroxylase; 16OMT , 16-hydroxytabersonine-16-O-methyltransferase; NMT , 16- methoxy-2,3-dihydro-3-hydroxytabersonine-N-methyltransferase; D4H , desacetoxyvindoline-4-hydroxylase; DAT , deacetylvindoline-4-O-acetyltransferase; T6,7E , tabersonine-6,7-epoxidase; MAT , minvincinine-19-O- acetyltransferase. (Figure adapted from:[23, 24, 46, 47, 48, 49, 50]) 82

a X v0 X v2 b X v0 X v2

Tryptophan Loganin Tryptophan Loganin

X v1 X v3 X v1 X v3

Tryptamine Secologanin Tryptamine Secologanin

X v4 X v4

Strictosidine Strictosidine

X v5 X v5 X v6 X v Ajmalicine Ajmalicine 6 X v8 X v8 X v7 X v7 X v9 X v9 Catharanthine Catharanthine Serpentine Serpentine X v10 X v 10 X v15 X v14 Tabersonine Tabersonine

X v11 X v11

Lochnericine Lochnericine

X v12 X v12

Hörhammericine Hörhammericine

X v13

Figure 5.4 Scheme of biosynthetic reactions for the metabolic flux model.

The boxes represent pools for metabolite accumulation and the Xv j terms represent flux productivities for each reaction in the determined model (a) and the underdetermined model (b).

Tryptophan 40 40 a ** b 35 ** 35 30 30 25 ** 25 20 20

15 15 ** weight g/gDry mol/gweight Dry

** ** ** 10 10 ** ** ** 5 ** 5 * * 0 0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h)

Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 5.5 Tryptophan levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Cultures were induced with dexamethasone to a final concentration of 0.2 M. Uninduced cultures were given a similar amount of ethanol. The cultures were induced in the late exponential growth phase and harvested at 4, 8, 12, 24, 36, 48, 60, and 72 hours after induction. Metabolite levels were determined by HPLC analysis of crude extracts. Light-grown cultures were grown in 24-hour light. Data represents mean of triplicate cultures . Error bars represent standard deviation. “*” and “ ** ” indicate significant results, p<0.1 and p<0.05, respectively, between the induced and ininduced data at that time point.

Tryptamine 14 14 a b 12 * 12 ** ** ** 10 10 ** **

8 8 ** ** 6 ** 6 ** g/g Dry weight g/gDry mol/gweight Dry 4 ** 4 2 * 2

0 0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h) Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 5.6 Tryptamine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 5.5. 84

Loganin 3.5 3.5 a b 3.0 3.0

2.5 2.5

2.0 2.0

1.5 1.5 g/g Dry weight g/g Dry mol/gweight Dry 1.0 1.0 ** 0.5 0.5

0.0 0.0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h)

Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 5.7 Loganin levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 5.5.

Secologanin 10 10 a b 9 9

8 8

7 7

6 6

5 5

4 4 g/gweight Dry mol/gweight Dry * 3 ** * ** 3 ** 2 ** * 2 1 1 ** 0 0 * 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h)

Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 5.8 Secologanin levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 5.5. 85

Strictosidine 5.0 5.0 a b 4.5 4.5

4.0 4.0

3.5 3.5

3.0 ** 3.0

2.5 2.5

2.0 2.0 g/g Dry weight g/g Dry mol/gweight Dry 1.5 1.5

1.0 1.0 * 0.5 * 0.5 0.0 0.0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h)

Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 5.9 Strictosidine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 5.5.

Catharanthine 3.0 3.0 a b

2.5 2.5

2.0 2.0 *

1.5 1.5 g/gweight Dry mol/gweight Dry 1.0 1.0

0.5 0.5 *

0.0 0.0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h) Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 5.10 Catharantine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 5.5.

Ajmalicine 4.0 4.0 a b 3.5 3.5 ** ** 3.0 3.0 * * 2.5 2.5 *

2.0 * 2.0 **

1.5 1.5 g/gweight Dry mol/gweight Dry 1.0 1.0

0.5 0.5

0.0 0.0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h) Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 5.11 Ajmalicine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 5.5.

Serpentine 2.5 2.5 a b * 2.0 2.0

1.5 1.5

1.0 1.0 g/gweight Dry mol/gweight Dry

0.5 0.5

0.0 0.0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h)

Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 5.12 Serpentine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 5.5.

Serpentine + Ajmalicine 6.0 6.0 a b ** ** 5.0 5.0 **

4.0 * 4.0

3.0 ** 3.0

g/g Dry weight g/g Dry ** mol/gweight Dry 2.0 2.0

1.0 1.0

0.0 0.0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h) Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 5.13 The corynanthe alkaloid pool (serpentine + ajmalicine) levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 5.5.

Tabersonine 3.0 3.0 a b

2.5 2.5

2.0 2.0

1.5 1.5 g/g Dry weight g/g Dry mol/g weight Dry 1.0 1.0

0.5 ** 0.5 ** ** 0.0 ** ** ** 0.0 * 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h) ** Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 5.14 Tabersonine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 5.5.

Lochnericine 6.0 6.0 a b

5.0 5.0

4.0 4.0

3.0 3.0

* g/gweight Dry mol/g Dry weight mol/g Dry 2.0 ** 2.0 ** 1.0 ** 1.0 * * ** 0.0 0.0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h) Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 5.15 Lochnericine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 5.5.

Hörhammericine 3.0 3.0 a b

2.5 2.5

2.0 2.0 ** 1.5 1.5 ** g/g Dry weight g/gDry mol/gweight Dry 1.0 1.0 ** ** ** 0.5 ** 0.5 ** ** ** 0.0 0.0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h) Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 5.16 Hörhammericine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 5.5.

Tabersonine + Lochnericine + Hörhammericine 10 10 a b 9 9

8 8

7 7

6 6 5 * 5 4 ** 4 g/g weight Dry mol/g weight Dry 3 ** 3 * 2 ** 2 ** ** ** 1 ** ** 1 ** 0 0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h) Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 5.17 The aspidosperma alkaloid pool (tabersonine + lochnericine + hörhammericine) levels over a 72- hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 5.5.

Total Measured TIAs 16 16 a b 14 14 ** 12 12 10 ** * ** 10 ** 8 ** ** 8 ** *

6 weight g/g Dry 6 mol/gweight Dry 4 4

2 2

0 0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h) Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 5.18 Total measured terpenoid indole alkaloid (strictosidine + catharanthine + serpentine + ajmalicine + tabersonine + lochnericine + hörhammericine) levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 5.5.

Tryptamine + Secologanin + Strictosidine 18 18 a b 16 16 ** ** 14 14 ** 12 12 ** 10 10

8 8 ** g/gweight Dry mol/gweight Dry 6 6

* 4 4

2 2

0 0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h)

Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 5.19 The summation of the metabolite pool (tryptamine + secologanin + strictosidine) at the coalescence point of the indole and iridoid glycoside pathways over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 5.5.

2.10 3.01 9.39 0.386 a b 0.0389 0.256 5.55 -0.129 2.06 2.75 3.84 0.515

0.164 0.853 1.54 -1.78

1.90 2.30

0.414 -0.549 1.48 2.85 0.403 1.26 0.201 -0.0458 1.08 1.59 0.202 1.31 0.192 0.747 0.192 -0.112 0.202 0.887 0.00 -0.0146 0.840 0.859 0.00 1.32 0.157 -0.429 0.735 1.27

0.437 -1.27 0.297 2.54

0.297 -0.448 0.00 2.99

Figure 5.20 Minimum flux map for uninduced and induced dark-grown ASAB-1 cultures. The values in boxes represent the total metabolite accumulation ( mol (68 hrs) -1) and values near the arrows represent minimum total flux productivity (mol (68 hrs) -1) during the transient experiment for the uninduced dark-grown cultures (a) and the induced dark-grown cultures (b). Metabolites and reactions are described in Figure 5.4. 92

2.03 0.593 10.1 1.02 a b 0.0332 -0.248 2.98 -0.686 2.03 0.846 7.15 1.70

-0.0334 -1.22 2.69 -2.75

2.07 4.46

-0.0976 -0.904 2.16 5.36 1.98 4.45 -0.0611 0.0353 0.178 0.913 2.04 4.41 0.0469 0.241 -0.207 -0.292 0.223 0.131 0.253 -0.221 0.673 0.533 1.82 4.63 -0.0637 -0.197 0.195 0.870

-0.142 -0.526 0.336 1.40

0.176 -1.06 0.160 2.45

Figure 5.21 Minimum flux map for uninduced and induced light-grown ASAB-1 cultures. The values in boxes represent the total metabolite accumulation ( mol (68 hrs) -1) and values near the arrows represent minimum total flux productivity ( mol (68 hrs) -1) during the transient experiment for the uninduced light-grown cultures (a) and the induced light-grown cultures (b). Metabolites and reactions are described in Figure 5.4.

References

1. Hughes, E.H., S.-B. Hong, S.I. Gibson, J.V. Shanks, and K.-Y. San. (2004) Expression of a Feedback-resistant Anthranilate Synthase in Catharanthus roseus Hairy Roots Provides Evidence for Tight Regulation of Terpenoid Indole Alkaloid Levels . Biotechnol. Bioeng. 86 (6): 718-727. 2. Li, J. and R.L. Last. (1996) The Arabidopsis thaliana trp5 Mutant Has a Feedback- Resistant Anthranilate Synthase and Elevated Soluble Tryptophan . Plant Phys. 110 (1): 51-59. 3. Aoyama, T. and N.-H. Chua. (1997) A Glucocorticoid-mediated Transcriptional Induction System in Transgenic Plants . Plant J. 11 (3): 605-612. 4. Niyogi, K.K., R.L. Last, G.R. Fink, and B. Keith. (1993) Suppressors of trp1 Fluorescence Identify a New Arabidopsis Gene, TRP4 , Encoding the Anthranilate Synthase β Subunit . Plant Cell . 5(1011-1027). 5. Hong, S.-B., C.A.M. Peebles, J.V. Shanks, K.-Y. San, and S.I. Gibson. (2006) Expression of the Arabidopsis Feedback-insensitive Anthranilate Synthase 93

Holoenzyme and Tryptophan Decarboxylase Genes in Catharanthus roseus Hairy Roots . J. Biotechnol. 122 : 28-38. 6. Peebles, C.A.M., S.-B. Hong, S.I. Gibson, J.V. Shanks, and K.-Y. San. (2005) Transient Effects of Overexpressing Anthranilate Synthase α and β Subunits in Catharanthus roseus Hairy Roots . Biotechnol. Prog. 21 : 1572-1578. 7. Bhadra, R., J.A. Morgan, and J.V. Shanks. (1998) Transient Studies of Light-Adapted Cultures of Hairy Roots of Catharanthus roseus : Growth and Indole Alkaloid Accumulation . Biotechnol. Bioeng. 60 (6): 670-678. 8. Facchini, P.J. (2001) Alkaloid Biosynthesis in Plants: Biochemistry, Cell Biology, Molecular Regulation, and Metabolic Engineering Applications . Annu. Rev. Plant Physiol. Plant Mol. Biol. 52 : 29-66. 9. Facchini, P.J., D.A. Bird, B.P. MacLeod, S.-U. Park, and N. Samanani. (2003) Multiple Levels of Control in the Regulation of Alkaloid Biosynthesis . Rec Adv Phytochem . 37 : 143-180. 10. Hughes, E.H., S.-B. Hong, J.V. Shanks, K.-Y. San, and S.I. Gibson. (2002) Characterization of an Inducible Promoter System in Catharanthus roseus Hairy Roots . Biotechnol. Prog. 18 : 1183-1186. 11. Peebles, C.A.M., S.-B. Hong, S.I. Gibson, J.V. Shanks, and K.-Y. San. (2006) Effects of Terpenoid Precursor Feeding on Catharanthus roseus Hairy Roots Over- Expressing the Alpha or the Alpha and Beta Subunits of Anthranilate Synthase . Biotechnol. Bioeng. 93 (3): 534-540. 12. Tikhomiroff, C. and M. Jolicoeur. (2002) Screening of Catharanthus roseus Secondary Metabolites by High-Performance Liquid Chromatography . J Chrom A . 955 : 87-93. 13. Morgan, J.A., C.S. Barney, A.H. Penn, and J.V. Shanks. (2000) Effects of Buffered Media Upon Growth and Alkaloid Production of Catharanthus roseus Hairy Roots . Appl. Microbiol. Biotechnol. 53 : 262-265. 14. Dagnino, D., J. Schripsema, and R. Verpoorte. (1996) Analysis of Several Iridoid and Indole Precursers of Terpenoid Indole Alkaloids with a Single HPLC run . Planta Med . 62 : 278-280. 15. Yamamoto, H., N. Katano, A. Ooi, and K. Inoue. (1999) Transformation of Loganin and 7-deoxyloganin into Secologanin by Lonicera japonica Cell Suspension Cultures . Phytochem . 50 : 417-422. 16. Collu, G., H.H.J. Bink, P.R.H. Moreno, R. van der Heijden, and R. Verpoorte. (1999) Determination of the Activity of the Cytochrome p450 Enzyme Geraniol 10- Hydroxylase in Plants by High-performance Liquid Chromatography . Phytochem. Anal. 10 : 314-318. 17. Morgan, J.A. and J.V. Shanks. (2002) Quantification of Metabolic Flux in Plant Secondary Metabolism by a Biogenetic Organizational Approach . Met. Eng. 4: 257- 262. 18. Pandey-Rai, S., G.R. Mallavarapu, A.A. Naqvi, A. Yadav, S.K. Rai, S. Srivastava, D. Singh, R. Mishra, and S. Kumar. (2006) Volatile Components of Leaves and Flowers of Periwinkle Catharanthus roseus (L.) G. Don from New Delhi . Flavour Frag. J. 21 (3): 427-430. 94

19. Murata, J., J. Roepke, H. Gordon, and V. De Luca. (2008) The Leaf Epidermome of Catharanthus roseus Reveals Its Biochemical Specialization . Plant Cell . 20 : 524-542. 20. Irmler, S., G. Schroder, B. St-Pierre, N.P. Crouch, M. Hotze, J. Schmidt, D. Strack, U. Matern, and J. Schroder. (2000) Indole Alkaloid Biosynthesis in Catharanthus roseus : New Enzyme Activities and Identification of Cytochrome P450 CYP72A1 as Secologanin Synthase . Plant J. 24 (6): 797-804. 21. O'Connor, S.E. and J.J. Maresh. (2006) Chemistry and Biology of Monoterpene Indole Alkaloid Biosynthesis . Nat. Prod. Rep. 23 : 532-547. 22. van der Heijden, R., D.I. Jacobs, W. Snoeijer, D. Hallard, and R. Verpoorte. (2004) The Catharanthus Alkaloids: Pharmacognosy and Biotechnology . Curr. Med. Chem. 11 (5): 607-628. 23. Rodriguez, S., V. Compagnon, N.P. Crouch, B. St-Pierre, and V. De Luca. (2003) Jasmonate-induced Epoxidation of Tabersonine by a Cytochrome P-450 in Hairy Root Cultures of Catharanthus roseus. Phytochem . 64 : 401-409. 24. Laflamme, P., B. St-Pierre, and V. De Luca. (2001) Molecular and Biochemical Analysis of a Madagascar Periwinkle Root-Specific Minovincinine-19-Hydroxy-O- Acetyltransferase . Plant Phys. 125 : 198-198. 25. Peebles, C.A.M., G.W. Sander, M. Li, J.V. Shanks, and K.-Y. San. (2009) Five Year Maintenance of the Inducible Expression of Anthranilate Synthase in Catharanthus roseus Hairy Roots . Biotechnol. Bioeng. 102 (5): 1521-1525. 26. Balsevich, J., V. DeLuca, and W.G.W. Kurz. (1986) Altered Alkaloid Pattern in Dark Grown Seedlings of Catharanthus roseus . The Isolation and Characterization of 4- desacetoxyvindoline: A Novel Indole Alkaloid and Proposed Precursor of Vindoline . Heterocycles . 24 (9): 2415-2421. 27. Murata, J. and V. De Luca. (2005) Localization of Tabersonine 16-hydroxylase and 16-OH Tabersonine-16-O-methyltransferase to Leaf Epidermal Cells Defines Them as Major Site of Precursor Biosynthesis in the Vindoline Pathway in Catharanthus roseus. Plant J. 44 : 581-594. 28. St-Pierre, B., F. Vazquez-Flota, and V. De Luca. (1999) Multicellular Compartmentation of Catharanthus roseus Alkaloid Biosynthesis Predicts Intercellular Translocation of a Pathway Intermediate . Plant Cell . 11 : 887-900. 29. Morgan, J.A. and J.V. Shanks. (1999) Inhibitor Studies of Tabersonine Metabolism in C. roseus Hairy Roots . Phytochem . 51 : 61-68. 30. Magnotta, M., J. Murata, J. Chen, and V. De Luca. (2007) Expression of Deacetylvindoline-4-O-acetyltransferase in Catharanthus roseus Hairy Roots . Phytochem . 68 : 1922-1931. 31. Contin, A., R. van der Heijden, and R. Verpoorte. (1999) Localization of Secologanin in Catharanthus roseus Cells . Acta Bot. Gallica . 146 (1): 105-110. 32. Contin, A., R. van der Heijden, and R. Verpoorte. (1999) Accumulation of Loganin and Secologanin in Vacuoles from Suspension Cultured Catharnthus roseus Cells . Plant Sci . 147 : 177-183. 33. Canto-Canche, B.B. and V.M. Loyola-Vargas. (2001) Multiple Forms of NADPH- cytochrome P450 Oxidoreductases in the Madagascar Periwinkle Catharanthus roseus. In Vitro Cell. Dev. Biol.--Plant . 37 : 622-628. 95

34. Yamamoto, H., N. Katano, A. Ooi, and K. Inoue. (2000) Secologanin synthase which Catalyzes the Oxidative Cleavage of Loganin into Secologanin is a Cytochrome P450 . Phytochem . 53 : 7-12. 35. Madyastha, K.M. and C.J. Coscia. (1979) Detergent-solubilized NADPH- Cytochrome c (P-450) Reductase from the Higher Plant, Catharanthus roseus. J Biol Chem . 254 (7): 2419-2427. 36. Oudin, A., M. Courtois, M. Rideau, and M. Clastre. (2007) The Iridoid Pathway in Catharanthus roseus Alkaloid Biosynthesis . Phytochem Rev . 6: 259-276. 37. Meijer, A.H., M.I.L. Cardoso, J.T. Voskullen, A. de Waal, R. Verpoorte, and J.H. Hoge. (1993) Isolation and Characterization of a cDNA Clone from Catharanthus roseus Encoding NADPH:cytochrome P-450 reductase, an Enzyme Essential for Reactions Catalyzed by Cytochrome P-450 Mono-oxygenases in Plants . Plant J. 4(1): 47-60. 38. Lange, B.M., T. Rujan, W. Martin, and R. Croteau. (2000) Isoprenoid Biosynthesis: The Evolution of Two Ancient and Distinct Pathways Across Genomes . PNAS . 97 (24): 13172-13177. 39. Kanehisa, M., M. Araki, S. Goto, M. Hattori, M. Hirakawa, M. Itoh, T. Katayama, S. Kawashima, S. Okuda, T. Tokimatsu, and Y. Yamanishi. (2008) KEGG for Linking Genomes to Life and the Environment . Nucleic Acids Res. 36 : D480-D484. 40. Kanehisa, M., S. Goto, M. Hattori, K.F. Aoki-Kinoshita, M. Itoh, S. Kawashima, T. Katayama, M. Araki, and M. Hirakawa. (2006) From Genomics to Chemical Genomics: New Developments in KEGG . Nucleic Acids Res. 34 : D354-D357. 41. Kanehisa, M. and S. Goto. (2000) KEGG: Kyoto Encyclopedia of Genes and Genomes . Nucleic Acids Res. 28 : 27-30. 42. Collu, G., N. Unver, A.M.G. Peltenburg-Looman, R. van der Heijden, R. Verpoorte, and J. Memelink. (2001) Geraniol 10-hydroxylase, a Cytochrome P450 Enzyme Involved in Terpenoid Indole Alkaloid Biosynthesis . FEBS Lett . 508 : 215-220. 43. Cardoso, M.I.L., A.H. Meijer, S. Rueb, J.Q. Machado, J. Memelink, and J.H. Hoge. (1997) A Promoter Region that Controls Basal and Elicitor-inducible Expression Levels of the NADPH:Cytochrome P450 Reductase Gene ( Cpr ) from Catharanthus roseus Binds Nuclear Factor GT-1. Mol Gen Genet . 256 (6): 674-681. 44. Pasquali, G., O.J. Goddijn, A. de Waal, R. Verpoorte, R.A. Schilperoort, J.H. Hoge, and J. Memelink. (1992) Coordinated Regulation of Two Indole Alkaloid Biosynthetic Genes from Catharanthus roseus by Auxin and Elicitors . Plant Mol Biol . 18 (6): 1121-1131. 45. Geerlings, A., M.M.-L. Ibanez, J. Memelink, R. van der Heijden, and R. Verpoorte. (2000) Molecular Cloning and Analysis of Strictosidine β-D-Glucosidase, an Enzyme in Terpenoid Indole Alkaloid Biosynthesis in Catharanthus roseus. JBC . 275 (5): 3061-3056. 46. Schroder, G., E. Unterbusch, M. Kaltenbach, J. Schmidt, D. Strack, V. De Luca, and J. Schroder. (1999) Light-induced Cytochrome P450-dependent Enzyme in Indole Alkaloid Biosynthesis: Tabersonine 16-hydroxylase . FEBS Lett . 458 : 97-102. 47. Levac, D., J. Murata, W.S. Kim, and V. De Luca. (2008) Application of Carborundum Abrasion for Investigating the Leaf Epidermis: Molecular Cloning of 96

Catharanthus roseus 16-hydroxytabersonine-16-O-methyltransferase . Plant J. 53 : 225-236. 48. De Luca, V., J. Balsevich, R.T. Tyler, and W.G.W. Kurz. (1987) Characterization of a Novel N-methyltransferase (NMT) from Catharanthus roseus Plants. Detection of NMT and Other Enzymes of the Indole Alkaloid Biosynthetic Pathway in Different Cell Suspension Culture Systems . Plant Cell Rep . 6(6): 458-461. 49. Vazquez-Flota, F., E. De Carolis, A.-M. Alarco, and V. De Luca. (1997) Molecular Cloning and Characteristics of Desacetoxyvindoline-4-hydroxylase, a 2-oxyglutarate Dependent-dioxygenase Involved in the Biosynthesis of Vindoline in Catharanthus roseus (L.) G. Don . Plant Mol Biol . 34 : 935-948. 50. St-Pierre, B., P. Laflamme, A.-M. Alarco, and V. De Luca. (1998) The Terminal O- acetyltransferase Involved in Vindoline Biosynthesis Defines a New Class of Proteins Responsible for Coenzyme A-dependent Acyl Transferase . Plant J. 14 (6): 703-713. 51. Noe, W., C. Mollenschott, and J. Berlin. (1984) Tryptophan Decarboxylase From Catharanthus roseus Cell Suspension Cultures: Purification, Molecular and Kinetic Data of the Homogenous Protein . Plant Mol Bio . 3(5): 281-288.

Chapter 6 – Transient Effects of Overexpressing 1-deoxy-D-xylulose 5- phosphate synthase in Catharanthus roseus Hairy Roots in Light and Dark

Conditions

Draft of paper to be submitted for publication.

Guy W. Sander 1,4 , Susan I. Gibson 2,5 , Ka-Yiu San 3,5 , and Jacqueline V. Shanks 1,6

1Department of Chemical and Biological Engineering, Iowa State University, Ames, IA

2Department of Plant Biology, University of Minnesota, St. Paul, MN

3Department of Bioengineering, Rice University, Houston, TX

4Primary researcher and author

5Co-principal investigator

6Principal investigator and corresponding author

Abstract

Hairy root cultures of Catharanthus roseus expressing 1-deoxy-D-xylulose 5- phosphate synthase (DXS) under the control of a glucocorticoid-inducible promoter were used to investigate the effect of light-adaptation, biosynthetic enzyme overexpression, and the combination of these two factors on the production of terpenoid indole alkaloids (TIAs).

Light adaptation increased flux, as determined by a stoichiometric model, to the biosynthetic pathways but also decreased the levels of tabersonine, lochnericine, and hörhammericine.

Induction of the DXS gene led to increases in loganin but increased the flux out of the tabersonine pathway. The effect of light adaptation with induction of the DXS gene reduced fluxes out of the TIA pathways, but the overall level of TIAs was still much lower. The 98

results of this study reveal metabolite turnover as an important consideration in the metabolic engineering of C. roseus hairy roots.

Introduction

Catharanthus roseus is well known for its valuable bisindole alkaloids, vincristine and vinblastine, that are used in chemotherapy. The very low quantity these pharmacologically active compounds occur in C. roseus and the intricate extraction process that is required accounts for the associated high cost of these drugs [1]. The structural complexity of the compounds prevents synthetic methods from being viable [2] and the long biosynthetic pathway and unidentified biosynthetic enzymes prevents production in yeast or bacteria. Given these difficulties, the metabolic engineering of this pathway for the production of these alkaloids must occur in plant cell cultures and hairy root cultures of C. roseus [3].

The terpenoid indole alkaloids (TIAs) that are the coalescing precursors to the important bisindole alkaloids are also products of the coalescence of the indole and terpenoid pathways (see Figure 5.1). Chorismate and anthranilate of the shikimate pathway lead to the indole alkaloids tryptophan and tryptamine. Above the terpenoid pathway is the non- mevalonate pathway, a more recent addition to the biosynthetic topology [4, 5]. The first enzyme in the non-mevalonate pathway is 1-deoxy-D-xylulose 5-phosphate synthase (DXS) that metabolizes pyruvate and glyceraldehyde 3-phosphate. The non-mevalonate pathway leads to the terpenoid pathway, eventually producing secologanin, which coalesces with tryptamine from the indole pathway to produce the TIA strictosidine. From strictosidine, the biosynthetic pathway branches into many TIAs. Among them are catharanthine and vindoline that coalesce and through several more steps lead to vinblastine and vincristine. 99

As with previous work involving anthranilate synthase (AS) as an entrance point into

TIA production [3, 6, 7], this study examines DXS as another entrance and possible funneling point for directing carbon flux towards TIAs from central metabolism. Previous studies with the overexpression of AS suggest that terpenoid pathway may be limiting [3] and show overexpression of AS subunits with feeding of precursors from the non-mevalonate and terpenoid pathways can increase TIA production [6].

In effort in gain an increased understanding of how the biosynthetic pathways react to metabolic engineering efforts, a more comprehensive profiling of metabolites has been measured and quantified in this study. Particular attention is placed on the terpenoid pathway with the measurement of loganin and secologanin, as well as strictosidine, the first

TIA. The availability of these precursor metabolites influences the accumulation of the downstream alkaloids.

We investigate the effect of light in this study to survey the response of the tabersonine branchpoint. Tabersonine is a crucial intermediate in the synthesis of vindoline and the regulation involved at this branchpoint will be important to metabolic engineering efforts to produce vindoline from hairy roots (Figure 5.3). Several enzymes between tabersonine and vindoline are light-dependent and decreases in tabersonine have been seen with lighted growth of hairy roots [8]. Regulation of the vindoline pathway is reviewed in

Facchini (2001) and Facchini et al. (2003) [9, 10].

investigate how fluxes through the biosynthetic pathways are affected by the overexpression of the DXS enzyme.

This study investigates transient metabolite levels in the EHIDXS-4-1 hairy root line expressing DXS from Arabidopsis under the control of a glucocorticoid-inducible promoter

[11]. With the measurement of additional metabolites, we look to explore the effects DXS overexpression and light adaptation of cultures and how they affect metabolite levels and fluxes.

Materials and Methods

Chemicals

Dexamethasone (Sigma) was dissolved in ethanol and added the culture media.

Geraniol (Aldrich), 10-hydroxygeraniol (Aldrich), loganin (Fluka), secologanin (Fluka), strictosidine (gift), serpentine (Aldrich), ajmalicine (Fluka), catharanthine (Qventas), hörhammericine, tabersonine, tryptophan (Sigma), and tryptamine (Sigma) were dissolved in methanol and used as HPLC standards. Methanol, acetonitrile, ammonium acetate, and phosphoric acid were HPLC grade (Fisher Scientific). Formic acid (Fluka), trichloroacetic acid (Fluka), ethanol (Pharmco-Aaper), and sulfuric acid (LabChem) were high purity.

Growth media was prepared with sucrose (MP Biomedicals), Gamborg’s B5 salts (Sigma), and Gamborg’s vitamins (Sigma).

Culture Conditions

Growth media was prepared as detailed in Chapter 5. Dark grown cultures were maintained in foam-stoppered (Jaece Industries) 250-ml Erlenmeyer flasks in incubator shakers at 26 °C and 100 rpm. Light grown cultures were also subjected to 24-hour fluorescent lighting (24-36 mol m -2 s-1). Light grown cultures were light adapted for 14 101

subculture cycles before the experiment took place. The hairy root cultures were subcultured at intervals of 14 days for the light-grown cultures and 21 days for the dark grown cultures.

Subculturing was performed by cutting five root tips from a mature culture and transferring them to 50 ml of fresh media.

Induction of the Catharanthus roseus Hairy root Lines

The volume of the remaining culture media was measured by drawing the media up into a 50-ml serological pipet (Corning). The average media volume of the cultures to be induced was calculated. Based on this average, the appropriate amount of a 5 mM dexamethasone stock in ethanol was added to the cultures for a final concentration of 3 M dexamethasone in the culture media. An equal amount of ethanol was added to the uninduced controls.

Sample Preparation and Analysis

Culture harvesting, alkaloid extractions, metabolite measurements by HPLC, and metabolite analysis by LC-MS were performed as described in Chapter 5. The LC-MS analysis was performed at the W. M. Keck Metabolomics Research Laboratory.

Flux Modeling Methodology

The fluxes of the metabolites were calculated based on the total metabolite productivity of the hairy root cultures [12]. The flux modeling methods were performed as

-1 described in Chapter 5. The flux productivities ( Xv j) ( mol hr ), where X is the biomass (g

-1 -1 DW) and vj is the flux of reaction j (mol g DW hr ) were numerically integrated over the period from 4 to 72 hours resulting in values for total metabolite accumulation ( mol (68 hours) -1) and total reaction flux productivity ( mol (68 hours) -1) for the entire transient experiment. The reaction scheme is laid out in Figure 6.3. The fluxes of the model are 102

termed minimum total flux productivities. The minimum qualifier is used because the system is underdetermined and additional flux into the biosynthetic network would only result in proportionally increased flux out of the network.

Statistical Analysis

Data were analyzed using the Students t-test for unequal sample size and unequal variance. A few data were removed as outliers following Peirce’s criterion.

Results

To investigate the transient levels of TIAs over a period of time after gene induction in dark- and light-grown cultures, we used the previously generated C. roseus hairy root line

[11] that expresses DXS from Arabidopsis under the control of a glucocorticoid-inducible promoter. High expression of the Arabidopsis DXS only occurs in the presence of a glucocorticoid, such as dexamethasone [3]. The advantage of the inducible promoter system is that we can investigate the effects of altered expression within the same genetic line, thereby minimizing clonal variation.

Hairy root cultures in the late exponential growth phase (21 days after subculturing) were induced and harvested at 4, 8, 12, 24, 36, 48, 60, and 72 hours after induction. The induced cultures were given dexamethasone in ethanol from a stock solution so the concentration of dexamethasone in the culture media was 3 M. The uninduced cultures were given an equal volume of ethanol.

Trends in Metabolite Levels

Levels of tryptophan and tryptamine (data not shown) were quite low, and often co- eluting compounds interfered with their analysis. Levels of tryptophan and tryptamine are estimated to be less than 0.2 mol/g dry weight (DW). 103

The levels of the iridoids geraniol and 10-hydroxygeraniol were not detectable by

HPLC or LC-MS, using both UV spectra and MS spectra. Geraniol (199.2 nm λ-max,

[M+Na] + 177.1 m/z (57), [M]+ 154.2 m/z (6), [M-OH] + 137.2 m/z (100)); 10- hydroxygeraniol (199.2 nm λ-max, [M+Na] + 193.1 m/z (100), [M] + 170.2 m/z (15), [M-OH] +

+ 153.2 m/z (33), [M-OH-H2O] 135.2 m/z (76)). The inability to detect these iridoids is likely because the biomass samples were prepared by freeze drying. Given the vapor pressure of geraniol and that it is a common component of leaf and flower volatile essential oils, including C. roseus [13], it would have easily evaporated during lyophilization.

In the induced dark-grown cultures, levels of the iridoid glycoside loganin were significantly increased compared to the uninduced dark-grown roots (p<0.1) (Figure 6.4a).

Levels peaked at 1.66 mol/g DW at 60 hours, a significant 2.3-fold increase over the uninduced dark grow levels at the same time point, 0.71 mol/g DW (p<0.05). Uninduced and induced light-grown cultures had variable levels but had similar values at 72 hours

(Figure 6.4b).

Levels of secologanin decreased significantly for both uninduced and induced dark- grown roots throughout the experiment, a more than 2-fold decrease (p<0.1) (Figure 6.5a).

Levels in the uninduced and induced light-grown cultures were stable and similar to each other (Figure 6.5b). Light-grown levels were initially significantly lower than those of the dark-grown cultures (p<0.1).

Strictosidine levels were stable and similar for uninduced and induced dark-grown roots (Figure 6.6a). Uninduced and induced light-grown roots had high variability throughout the experiment (Figure 6.6b). 104

Levels of catharanthine in uninduced and induced dark-grown roots were similar

(Figure 6.7a). The uninduced and induced light-grown cultures also had similar levels to each other (Figure 6.7b). Levels for the light-grown cultures were significantly lower than the dark-grown (p<0.1).

Ajmalicine levels were similar from 4 to 12 hours between the uninduced and induced dark-grown roots (Figure 6.8a). The induced roots increased after that, peaking at

4.23 mol/g DW at 72 hours, a significant 66.7% increase over the uninduced roots (p<0.05).

The induced light-grown cultures had similar levels compared to the uninduced light-grown cultures (Figure 6.8b).

Levels of serpentine were significantly increased in the induced compared to the uninduced dark-grown from 36 to 60 hours (p<0.1) (Figure 6.9a). The induced and uninduced light-grown roots had similar levels (Figure 6.9b). The uninduced light-grown roots had serpentine levels significantly higher than the uninduced dark-grown roots (p<0.1).

The corynanthe pool (ajmalicine + serpentine) is significantly increased upon induction in dark-grown roots, as dictated by ajmalicine levels (p<0.1) (Figure 6.10a). In light-grown cultures, the induced levels were similar to uninduced levels (Figure 6.10b).

Levels of tabersonine had a significant decrease of 44.8% from 4 to 72 hours in uninduced dark-grown cultures (p<0.1) (Figure 6.11a). The induced dark-grown cultures also significantly decreased but more substantially, showing an 87.2% decrease from 4 to 48 hours (p<0.05). Uninduced light-grown cultures levels dropped significantly from 4 to 8 hours (p<0.1) (Figure 6.11b). The induced light-grown cultures had similar levels as the uninduced light-grown cultures. 105

Lochnericine levels increased upon induction in dark-grown roots compared to uninduced dark-grown roots, peaking at 3.25 mol/g DW at 60 hours, a significant 58.1% increase (p<0.05) (Figure 6.12a). In light-grown cultures, induced roots had slightly increased levels compared to uninduced (Figure 6.12b). Light-grown roots had significantly lower levels than the dark-grown roots (p<0.05).

Levels of hörhammericine significantly decreased with induction for dark-grown roots (p<0.1) (Figure 6.13a). From 4 to 48 hours levels declined 50.3%. Induced light- grown cultures had similar levels to uninduced light-grown cultures (Figure 6.13b). Light- grown cultures had significantly lower levels than dark-grown cultures (p<0.1).

The level of the aspidosperma alkaloid pool (tabersonine + lochnericine + hörhammericine) did not change with induction in the dark-grown roots (Figure 6.14a). The light-grown roots similarly showed no difference between induced and uninduced roots

(Figure 6.14b). The light-grown roots had levels significantly lower than the dark-grown roots (p<0.05).

The level of total measured terpenoid indole alkaloids (strictosidine + ajmalicine + serpentine + catharanthine + tabersonine + lochnericine + hörhammericine) significantly increased from 24 to 60 hours for induced dark-grown cultures compared to uninduced dark- grown cultures (p<0.05) (Figure 6.15a). The 72-hour points for the induced and uninduced roots are very similar. The total measured TIAs for induced light-grown roots had significantly increased levels at some time points compared to uninduced roots (p<0.1)

(Figure 6.15b). The levels of uninduced light-grown cultures were significantly less than those of dark-grown cultures from 8 to 72 hours (p<0.05). 106

Minimum Metabolic Flux Model

The minimum metabolic flux map for the uninduced dark-grown cultures (Figure

6.16a) shows the minimum total flux productivity (MTFP) of the indole pathway is larger than the terpenoid pathway because secologanin has a negative accumulation. Most of the

TIAs have small accumulations and most of the MTFP into the TIA pathway is diverted out of the corynanthe pool.

In the induced dark-grown cultures (Figure 6.16b), loganin accumulates more but secologanin has a more negative accumulation compared to the uninduced dark-grown cultures. This increases the flux into the TIA pathway. Ajmalicine increases its accumulation and a substantial portion of the MTFP into the TIA pathway is diverted to the corynanthe pathway. Lochnericine accumulates more but tabersonine and hörhammericine have large negative accumulations, so even though the MTFP into the aspidosperma pool is small, the MTFP out of the pool is large.

Many of the metabolites in the uninduced light-grown cultures (Figure 6.17a) have negative accumulations, resulting in large fluxes out of the TIA pathways. The corynanthe pool receives most of the TIA flux and the exiting MTFP pulls more out of the pool. The

MTFP out of the aspidosperma pool is more that twice as large as the MTFP in. The MTFP into the biosynthetic network for the uninduced light-grown roots is more the 2-fold higher than the uninduced dark-grown cultures, but the MTFP out is also much greater.

The induced light-grown cultures (Figure 6.17b) had increased flux in the terpenoid branch because of the accumulation of loganin. As with the induced dark-grown cultures, most of the MTFP to the TIA pathway is diverted to the corynanthe pool, except for the light- grown cultures accumulate the MTFP as ajmalicine and serpentine. The aspidosperma pool 107

receives a small amount of flux, but because of the large negative accumulation of hörhammericine there is a large MTFP out of the pathway.

The iboga pool received small MTFPs and had small positive or negative accumulations in all cases studied.

Discussion

This study measures effects of light and DXS overexpression on the levels and fluxes of nine metabolites. The levels of two indole alkaloids, tryptophan and tryptamine, were very low (data not shown) and the iridoids, geraniol and 10-hydroxygeraniol, were not detected. Two iridoid glycosides (loganin and secologanin) and seven terpenoid indole alkaloids (strictosidine, catharanthine, ajmalicine, serpentine, tabersonine, lochnericine, and hörhammericine) were quantified.

Effect of Light Adaptation

The levels of loganin were similar in the uninduced light-grown cultures compared to the uninduced dark-grown cultures. For secologanin, levels were consistent across the harvesting times for uninduced light-grown roots, where the uninduced dark-grown roots started much higher and significantly decreased (p<0.1) to a level similar to the light-grown roots. The levels of loganin trended similarly in dark- and light-grown cultures indicating similar control in light and dark conditions. The change in level trends seen in secologanin indicates a change in regulation in the light-grown cultures.

Strictosidine had high variability in uninduced light-grown roots compared to dark- grown roots. Catharanthine had significantly decreased levels (p<0.1) in uninduced light- grown roots compared to dark-grown roots. Ajmalicine had similar levels and serpentine had significantly increased levels (p<0.1) in light-grown roots. Wild-type hairy root cultures 108

adapted to a 12-hour photoperiod saw increases in both ajmalicine and serpentine for lighted conditions [8].

The aspidosperma alkaloids all had significantly decreased levels in uninduced light- grown roots compared to dark-grown roots (p<0.1). This large decrease dictates the overall significant decrease in the total measured TIAs in uninduced light-grown roots compared to uninduced dark-grown roots (p<0.05).

Similar to the uninduced light-grown ASAB-1 cultures in Chapter 5, many of the metabolites in the uninduced light-grown cultures have negative accumulations. In addition to the large MTFPs into the indole and terpenoid pathways, this results in large fluxes out of the TIA pathways. The MTFPs out the TIA pathways are higher than the MTFP in at strictosidine in the uninduced light-grown cultures, whereas the uninduced dark-grown cultures accumulate TIAs. It is unclear why light adaptation would increase flux through the pathways and decrease the accumulation of alkaloids.

Effect of Induced Overexpression of DXS

Upon induction, loganin showed a significant increase in level compared to the uninduced dark-grown cultures (p<0.1). However, secologanin levels were relatively the same for induced and uninduced dark-grown roots.

Strictosidine and catharanthine had little change with induction, whereas serpentine had a small increase and ajmalicine had a large significant increase (p<0.05) compared to uninduced dark-grown roots.

For the aspidosperma alkaloids, hörhammericine and tabersonine had significant decreases (p<0.1) upon induction and lochnericine had a significant increase (p<0.05) compared to the uninduced dark-grown roots. The level of the aspidosperma pool was 109

similar for induced and uninduced dark-grown roots. Overall, induced overexpression of the

DXS gene caused a significant increase in the level of the measured TIAs compared to uninduced dark-grown roots from 24 to 60 hours (p<0.05). The increase in ajmalicine is responsible for most of the increase.

The DXS line is engineered to direct carbon flux through the non-mevalonate pathway towards terpenoid indole alkaloid biosynthesis. Precursor feeding studies on the

LBE-6-1 (wildtype) and AS αβ1 hairy root lines show increases in tabersonine and lochnericine, demonstrating the non-mevalonate and terpenoid pathways have possible bottlenecks for TIA production [6, 14]. The induction of DXS increases levels of ajmalicine and serpentine. Lochnericine increased but was offset by decreases in hörhammericine and tabersonine levels. This is similar to what was previously reported with DXS induction [11] but contrary to the precursor feeding studies [6, 14].

In the induced dark-grown cultures, the more negative accumulation of secologanin compared to the uninduced dark-grown cultures caused an increase in flux to the TIA pathway. This may be a result of regulation due to the increased accumulation of loganin.

Although ajmalicine and lochnericine have increased accumulation, the negative accumulation of tabersonine and hörhammericine led to the MTFP out the TIA pathways to be more than the MTFP in, resulting in an overall negative accumulation of TIAs.

The increased accumulation of ajmalicine may be a result of C. roseus hairy roots increasing the flux towards the corynanthe pool as a pathway to metabolite degradation.

Similar results were seen for the ASAB-1 hairy root line in Chapter 5. 110

Effect of Light Adaptation and Induced Overexpression of DXS

The levels of loganin achieved in induced light-grown cultures were lower than the induced dark-grown cultures. Secologanin and had relatively no change in level upon induction for light-grown cultures, similar to dark-grown cultures.

Strictosidine, catharanthine, ajmalicine, and serpentine levels for induced light-grown cultures were not substantially different than the uninduced light-grown cultures.

Lochnericine had a small increase with induction for light-grown cultures; however, the light-grown levels are significantly lower compared to the dark-grown levels (p<0.05).

Tabersonine and lochnericine had similar levels for induced and uninduced light-grown cultures. The aspidosperma pool showed no substantial change upon induction for light- grown roots.

Overall, induced overexpression of the DXS gene in lighted conditions did not cause a substantial change in the summed total of the measured TIAs at some time points. The levels are significantly lower than the induced dark-grown total measured TIA levels

(p<0.05).

The induced light-grown cultures had increased accumulation of loganin and secologanin. This is the only condition where secologanin has positive accumulation. As with the induced dark-grown cultures, there is accumulation in the corynanthe pool and negative accumulation in the aspidosperma pool. The induced light-grown conditions also have a larger MTFP coming into strictosidine than the MTFP out of the TIA pathways. This results in an accumulation of TIAs, however the accumulation occurs in the corynanthe pool, rather than the more ideal aspidosperma pool. 111

Conclusions

This work investigates the effect of light adaptation, induced gene overexpression, and the combination of these to factors on the levels and fluxes of metabolites in C. roseus hairy roots. Metabolic engineering efforts in the secondary metabolite pathways of C. roseus are often met with strict regulation. The elucidation of these bottlenecks aids in determining future metabolic efforts. The metabolic engineering of the non-mevalonate pathways leading to the terpenoid pathway caused increases in the levels of loganin upon induction of the DXS gene. This would seem a step in the right direction but reactionary decreases in other metabolites, especial aspidosperma family TIAs, prove otherwise. The effect of light adaptation increases flux through the biosynthetic pathways but also dramatically lowers the levels of aspidosperma TIAs. The effect of light adaptation with induction of the DXS gene resulted in improved fluxes compared to the induced dark-grown cultures, but the overall level of TIAs were still much lower.

The tight regulatory nature of C. roseus hairy roots often leads to large decreases in alkaloids levels as shown in the DXS line in this study and the ASAB-1 line in Chapter 5.

The turnover of secondary metabolites has been suggested previously [15, 16] and the minimum total flux productivities, as modeled in this chapter and in Chapter 5, demonstrate the high rates that secondary metabolites are removed from their corresponding pools. The elucidation of enzymatic pathways for TIA degradation could provide an additional scheme for increasing TIA levels. Along with focusing metabolite flux towards the pathways of interest, the pathways would be metabolically engineered to reduce metabolite turnover, preventing flux out of the alkaloid pools and increasing accumulation. 112

The uninduced levels of secologanin and tabersonine decrease in a very similarly to each other throughout the experiment. There also was a short, but significant response to induction seen in secologanin, tabersonine, and hörhammericine. These three metabolites had similar levels for the uninduced and induced dark-grown cultures from 4 to 24 hours.

The induced levels for all three metabolites at 36 and 48 hours were significantly lower than the uninduced levels at 36 and 48 hours and then again at 72 hours. This concerted response lends further evidence to a common regulation strategy for secologanin synthase (SLS) and tabersonine-6,7-epoxidase (T6,7E), the enzyme converting tabersonine to lochnericine. A similar connection between secologanin and tabersonine was seen in the ASAB-1 C. roseus hairy root line described in Chapter 5.

Both SLS and T6,7E are expressed in epidermal cells of C. roseus leaves [17, 18, 19,

20] so it is plausible that these enzymes from separate pathways have a mutual regulator.

Since both SLS and T6,7E are cytochrome P450-dependent enzymes [21, 22], it is hypothesized that a cytochrome P450 reductase isoform [23] is responsible for controlling the activity of the enzymes. If the activity of cytochrome P450 reductase isoform is increased, the activity of the P450-dependent enzymes will also increase. The subcellular localization and enzymatic targeting of P450-dependent enzymes could occur through post- translational modification [23]. To investigate the cytochrome P450 reductase isoforms, a method to distinguish between the isoforms would be necessary [23] and an understanding of how post-translation modifications relate to subcellular targeting and possibly to enzyme activity. Distinguishing between the isoforms will be difficult because the molecular weights will be very similar since they are modifications of single enzyme as cytochrome P450 reductase (CPR) is encoded by one gene in C. roseus [24]. 113

Acknowledgements

(CBET-0729753 (JVS), CBET-0729622 (K-YS), and CBET-0729625 (SIG)) and the Roy J.

Carver Graduate Research Training Fellowship in Molecular Biophysics (GWS). 114

Figures

Shikimate Pathway DXP Pathway

PEP + E4P Pyruvate + GA-3P DXS 1-Deoxy-D-xylulose-5-phosphate DXR 2-C-Methyl-D-erythritol-4-phosphate

Mevalonate IPP DMAPP

Chorismate AS GPP Anthranilate Geraniol CPR G10H 10-hydroxygeraniol

Tryptophan 10-oxogeraniol TDC Tryptamine 7-deoxyloganetic acid

7-deoxyloganic acid

7-deoxyloganin Loganic acid

STR LAMT Loganin SLS Strictosidine SGD Secologanin

4,21-dehydrogeissoschizine Vinblastine Vincristine Cathenamine Stemmadenine

Ajmalicine Catharanthine

T16H 16OMT NMT D4H DAT Serpentine Tabersonine Vindoline T6,7E

Lochnericine 6,7-dehydrominovincinine MAT Hörhammericine 6,7-dehydroechitovenine MAT 19-acetoxyhörhammericine 115

Figure 6.1 Biosynthesis of terpenoid indole alkaloids in Catharanthus roseus .

DXS , 1-deoxy-D-xylulose 5-phosphate synthase; DXR , 1-deoxy-D-xylulose 5-phosphate reductoisomerase; G10H , geraniol 10-hydroxylase; CPR , NADPH:cytochrome P450 reductase; LAMT , loganic acid-O- methyltransferase; SLS , secologanin synthase; AS , anthranilate synthase; TDC , tryptophan decarboxylase; STR , strictosidine synthase; SGD , strictosidine β-D-glucosidase; T16H , tabersonine 16-hydroxylase; 16OMT , 16-hydroxytabersonine-16-O-methyltransferase; NMT , 16-methoxy-2,3-dihydro-3-hydroxytabersonine-N- methyltransferase; D4H , desacetoxyvindoline-4-hydroxylase; DAT , deacetylvindoline-4-O-acetyltransferase; T6,7E , tabersonine-6,7-epoxidase; MAT , minvincinine-19-O-acetyltransferase. (Figure adapted from: [3, 18, 20, 21, 25, 26, 27, 28, 29, 30, 31, 32, 33, 34, 35, 36, 37, 38, 39]) ______116

N H N H

NMT H3CO H3CO

16-methoxy-2,3-dihydro- N CO CH Desacetoxyvindoline N CO CH 3-hydroxytabersonine H H 2 3 H 2 3 OH H3C OH D4H

N H N H

H CO H CO 3 3 OH 16-methoxytabersonine N Deacetylvindoline N CO CH H CO CH H 2 3 2 3 H3C OH 16OMT DAT

N H N H

HO H3CO OCOCH3 16-hydroxytabersonine N Vindoline N CO CH H CO CH H 2 3 2 3 H3C OH T16H

N H N H

OH H N 6,7-dehydrominovincinine N Tabersonine H H CO2CH3 CO2CH3 T6,7E MAT

N O H N H

OCOCH3 H Lochnericine N 6,7-dehydroechitovenine N H H CO2CH3 CO2CH3

O O N H N H MAT OH OCOCH3 H H Hörhammericine N 19-acetoxyhörhammericine N H H CO2CH3 CO2CH3 Figure 6.2 Biosynthesis of tabersonine derivatives in Catharanthus roseus . T16H , tabersonine 16-hydroxylase; 16OMT , 16-hydroxytabersonine-16-O-methyltransferase; NMT , 16- methoxy-2,3-dihydro-3-hydroxytabersonine-N-methyltransferase; D4H , desacetoxyvindoline-4-hydroxylase; DAT , deacetylvindoline-4-O-acetyltransferase; T6,7E , tabersonine-6,7-epoxidase; MAT , minvincinine-19-O- acetyltransferase. (Figure adapted from:[21, 33, 34, 35, 36, 37, 38]) 117

X v0 X v2

Tryptophan Loganin

X v1 X v3

Tryptamine Secologanin

X v4

Strictosidine

X v5 X v Ajmalicine 6 X v8 X v7 X v9 Catharanthine Serpentine X v 10 X v15 X v14 Tabersonine

X v11

Lochnericine

X v12

Hörhammericine

X v13

Figure 6.3 Scheme of biosynthetic reactions for the metabolic flux model.

The boxes represent pools for metabolite accumulation and the Xv j terms represent flux productivities for each reaction in the underdetermined model.

118

Loganin 2.0 2.0 a b 1.8 ** 1.8 1.6 ** 1.6 1.4 * 1.4 * 1.2 ** 1.2 ** 1.0 1.0

0.8 0.8 g/g Dry weight Dry g/g mol/g Dry weight Dry mol/g 0.6 0.6 * 0.4 0.4

0.2 0.2

0.0 0.0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h)

Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 6.4 Loganin levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Cultures were induced with dexamethasone to a final concentration of 3 M. Uninduced cultures were given a similar amount of ethanol. The cultures were induced in the late exponential growth phase and harvested at 4, 8, 12, 24, 36, 48, 60, and 72 hours after induction. Metabolite levels were determined by HPLC analysis of crude extracts. Light-grown cultures were grown in 24-hour light. Data represents mean of triplicate cultures (n=3) . Error bars represent standard deviation. “*” and “ ** ” indicate significant results, p<0.1 and p<0.05, respectively, between the uninduced and induced data at that time point.

Secologanin 4.5 4.5 a b 4.0 4.0

3.5 3.5

3.0 3.0

2.5 2.5

2.0 2.0 g/g Dry weight Dry g/g mol/g Dry weight Dry mol/g 1.5 1.5

1.0 1.0 0.5 ** * 0.5 ** 0.0 0.0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h)

Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 6.5 Secologanin levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 6.4. 119

Strictosidine 0.9 0.9 a b 0.8 0.8

0.7 0.7

0.6 0.6

0.5 0.5

0.4 0.4 g/g Dry weight g/g Dry mol/g weight Dry 0.3 0.3

0.2 0.2

0.1 0.1

0 0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h)

Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 6.6 Strictosidine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 6.4.

Catharanthine 1.2 1 a b 0.9 1.0 0.8

0.7 0.8 0.6 * 0.6 0.5 0.4 ** g/gweight Dry mol/gweight Dry 0.4 0.3

0.2 0.2 0.1

0.0 0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h)

Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 6.7 Catharanthine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 6.4. 120

Ajmalicine 5.0 5.0 a * ** b 4.5 ** ** 4.5 4.0 ** 4.0

3.5 3.5 ** 3.0 3.0 * 2.5 2.5 * 2.0 2.0 g/g weight Dry mol/g weight Dry 1.5 1.5

1.0 1.0

0.5 0.5

0.0 0.0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h)

Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 6.8 Ajmalicine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 6.4.

Serpentine 2.5 2.5 a b

2.0 2.0

1.5 1.5

1.0 1.0

* g/gweight Dry mol/gweight Dry * **

0.5 0.5

0.0 0.0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h)

Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 6.9 Serpentine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 6.4. 121

Serpentine + Ajmalicine 6 6 a ** b * 5 ** ** ** 5 ** * * 4 4

3 3 g/gweight Dry mol/gweight Dry 2 2

1 1

0 0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h) Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Tabersonine 1.4 1.4 a b 1.2 1.2

1 1

0.8 0.8

0.6 0.6 g/gweight Dry mol/g weight Dry 0.4 0.4

0.2 0.2 * ** 0 ** * 0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h) Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 6.11 Tabersonine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 6.4.

122

Lochnericine 4.0 4.0 a ** b 3.5 3.5 ** * 3.0 ** ** 3.0

2.5 2.5

2.0 2.0

1.5

1.5 g/gweight Dry mol/g weight Dry 1.0 1.0 ** 0.5 0.5 **

0.0 0.0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h) Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 6.12 Lochnericine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 6.4.

Hörhammericine 4.0 4.0 a b 3.5 3.5

3.0 3.0

2.5 2.5

2.0 2.0

1.5 1.5 * g/gweight Dry mol/gweight Dry 1.0 ** 1.0 ** 0.5 0.5 *

0.0 0.0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h)

Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 6.13 Hörhammericine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 6.4. 123

Tabersonine + Lochnericine + Hörhammericine 8 8 a b 7 7

6 * ** 6

5 5

4 4 *

3 g/gweight Dry 3 mol/gweight Dry 2 2 * **

1 1

0 0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h) Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 6.14 The aspidosperma alkaloid pool (tabersonine + lochnericine + hörhammericine) levels over a 72- hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 6.4.

Total Measured TIAs 13 13 a b 12 ** ** 12 11 ** ** 11 10 10 9 9 8 8 ** * ** 7 7 6 6 * 5 5 g/gweight Dry mol/gweight Dry 4 4 3 3 2 2 1 1 0 0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h) Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 6.15 Total measured terpenoid indole alkaloid (strictosidine + catharanthine + serpentine + ajmalicine + tabersonine + lochnericine + hörhammericine) levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 6.4. 124

a 0.364 0.184 b 0.505 0.173 0 0.0482 0 0.114 0.364 0.136 0.505 0.0293

0 -0.228 0 -0.475

0.364 0.505

0.0229 -0.00653 0.349 0.511 0.277 0.418 0.0358 0.261 0.0718 0.0929 0.241 0.157 0.00742 0.0533 -0.00002 0.0302 0.0214 0.0643 0.00744 0.0116 0.0396 0.0231 0.220 0.145 -0.0674 -0.198 0.132 0.237

-0.0204 0.117 0.152 0.120 0.0791 -0.315 0.0730 0.435

Figure 6.16 Minimum flux map for uninduced and induced dark-grown EHIDXS-4-1 cultures. The values in boxes represent the total metabolite accumulation ( mol (68 hrs) -1) and values near the arrows represent minimum total flux productivity ( mol (68 hrs) -1) during the transient experiment for the uninduced dark-grown cultures (a) and the induced dark-grown cultures (b). Metabolites and reactions are described in Figure 6.3.

125

0.732 0.549 0.454 0.791 a b 0 -0.110 0 0.274 0.732 0.659 0.454 0.517

0 -0.0732 0 0.0632

0.732 0.454

-0.0270 -0.113 0.759 0.567 0.488 0.474 -0.135 0.368 0.271 0.0931 0.622 0.106 0.0407 0.00959 -0.0425 0.00241 0.123 0.230 0.0832 0.106 0.0835 0.00718 0.499 0.00 -0.226 -0.0425 0.456 0.126

-0.105 0.0966 0.561 00294

-0.00735 -0.345 0.569 0.374

Figure 6.17 Minimum flux map for uninduced and induced light-grown EHIDXS-4-1 cultures. The values in boxes represent the total metabolite accumulation ( mol (68 hrs) -1) and values near the arrows represent minimum total flux productivity ( mol (68 hrs) -1) during the transient experiment for the uninduced light-grown cultures (a) and the induced light-grown cultures (b). Metabolites and reactions are described in Figure 6.3.

References

1. Tyler, V.E. (1988) Medicinal Plant Research: 1953-1987 . Planta Med . 54 : 95-100. 2. Pasquali, G., D.D. Porto, and A.G. Fett-Neto. (2006) Metabolic Engineering of Cell Cultures Versus Whole Plant Complexity in Production of Bioactive Monoterpene Indole Alkaloids: Recent Progress Related to an Old Dilemma . J. Biosci. Bioeng. 101 (4): 287-296. 3. Peebles, C.A.M., S.-B. Hong, S.I. Gibson, J.V. Shanks, and K.-Y. San. (2005) Transient Effects of Overexpressing Anthranilate Synthase α and β Subunits in Catharanthus roseus Hairy Roots . Biotechnol. Prog. 21 : 1572-1578. 4. Lichtenthaler, H.K. (1999) The 1-deoxy-D-xylulose-5-phosphate Pathway of Isoprenoid Biosynthesis in Plants . Annu. Rev. Plant Physiol. Plant Mol. Biol. 50 : 47- 65. 5. Contin, A., R. van der Heijden, A.W.M. Lefeber, and R. Verpoorte. (1998) The Iridoid Glucoside Secologanin is Derived From the Novel Triose Phosphate/Pyruvate Pathway in a Catharanthus roseus Cell Culture . FEBS Lett . 434: 413-416. 126

6. Peebles, C.A.M., S.-B. Hong, S.I. Gibson, J.V. Shanks, and K.-Y. San. (2006) Effects of Terpenoid Precursor Feeding on Catharanthus roseus Hairy Roots Over- Expressing the Alpha or the Alpha and Beta Subunits of Anthranilate Synthase . Biotechnol. Bioeng. 93 (3): 534-540. 7. Hong, S.-B., C.A.M. Peebles, J.V. Shanks, K.-Y. San, and S.I. Gibson. (2006) Expression of the Arabidopsis Feedback-insensitive Anthranilate Synthase Holoenzyme and Tryptophan Decarboxylase Genes in Catharanthus roseus Hairy Roots . J. Biotechnol. 122 : 28-38. 8. Bhadra, R., J.A. Morgan, and J.V. Shanks. (1998) Transient Studies of Light-Adapted Cultures of Hairy Roots of Catharanthus roseus : Growth and Indole Alkaloid Accumulation . Biotechnol. Bioeng. 60 (6): 670-678. 9. Facchini, P.J. (2001) Alkaloid Biosynthesis in Plants: Biochemistry, Cell Biology, Molecular Regulation, and Metabolic Engineering Applications . Annu. Rev. Plant Physiol. Plant Mol. Biol. 52 : 29-66. 10. Facchini, P.J., D.A. Bird, B.P. MacLeod, S.-U. Park, and N. Samanani. (2003) Multiple Levels of Control in the Regulation of Alkaloid Biosynthesis . Rec Adv Phytochem . 37 : 143-180. 11. Hughes, E.H. (2003) Metabolic Engineering of Catharanthus roseus Hairy Roots Using an Inducible Promoter System . Rice University: Houston, TX. 12. Morgan, J.A. and J.V. Shanks. (2002) Quantification of Metabolic Flux in Plant Secondary Metabolism by a Biogenetic Organizational Approach . Met. Eng. 4: 257- 262. 13. Pandey-Rai, S., G.R. Mallavarapu, A.A. Naqvi, A. Yadav, S.K. Rai, S. Srivastava, D. Singh, R. Mishra, and S. Kumar. (2006) Volatile Components of Leaves and Flowers of Periwinkle Catharanthus roseus (L.) G. Don from New Delhi . Flavour Frag. J. 21 (3): 427-430. 14. Hong, S.-B., E.H. Hughes, J.V. Shanks, K.-Y. San, and S.I. Gibson. (2003) Role of the Non-Mevalonate Pathway in Indole Alkaloid Production by Catharanthus roseus Hairy Roots . Biotechnol. Prog. 19 : 1105-1108. 15. Morgan, J.A. and J.V. Shanks. (1999) Inhibitor Studies of Tabersonine Metabolism in C. roseus Hairy Roots . Phytochem . 51 : 61-68. 16. Magnotta, M., J. Murata, J. Chen, and V. De Luca. (2007) Expression of Deacetylvindoline-4-O-acetyltransferase in Catharanthus roseus Hairy Roots . Phytochem . 68 : 1922-1931. 17. St-Pierre, B., F. Vazquez-Flota, and V. De Luca. (1999) Multicellular Compartmentation of Catharanthus roseus Alkaloid Biosynthesis Predicts Intercellular Translocation of a Pathway Intermediate . Plant Cell . 11 : 887-900. 18. Irmler, S., G. Schroder, B. St-Pierre, N.P. Crouch, M. Hotze, J. Schmidt, D. Strack, U. Matern, and J. Schroder. (2000) Indole Alkaloid Biosynthesis in Catharanthus roseus : New Enzyme Activities and Identification of Cytochrome P450 CYP72A1 as Secologanin Synthase . Plant J. 24 (6): 797-804. 19. Murata, J. and V. De Luca. (2005) Localization of Tabersonine 16-hydroxylase and 16-OH Tabersonine-16-O-methyltransferase to Leaf Epidermal Cells Defines Them as Major Site of Precursor Biosynthesis in the Vindoline Pathway in Catharanthus roseus. Plant J. 44 : 581-594. 127

20. Murata, J., J. Roepke, H. Gordon, and V. De Luca. (2008) The Leaf Epidermome of Catharanthus roseus Reveals Its Biochemical Specialization . Plant Cell . 20 : 524-542. 21. Rodriguez, S., V. Compagnon, N.P. Crouch, B. St-Pierre, and V. De Luca. (2003) Jasmonate-induced Epoxidation of Tabersonine by a Cytochrome P-450 in Hairy Root Cultures of Catharanthus roseus. Phytochem . 64 : 401-409. 22. Yamamoto, H., N. Katano, A. Ooi, and K. Inoue. (2000) Secologanin synthase which Catalyzes the Oxidative Cleavage of Loganin into Secologanin is a Cytochrome P450 . Phytochem . 53 : 7-12. 23. Canto-Canche, B.B. and V.M. Loyola-Vargas. (2001) Multiple Forms of NADPH- cytochrome P450 Oxidoreductases in the Madagascar Periwinkle Catharanthus roseus. In Vitro Cell. Dev. Biol.--Plant . 37 : 622-628. 24. Meijer, A.H., M.I.L. Cardoso, J.T. Voskullen, A. de Waal, R. Verpoorte, and J.H. Hoge. (1993) Isolation and Characterization of a cDNA Clone from Catharanthus roseus Encoding NADPH:cytochrome P-450 reductase, an Enzyme Essential for Reactions Catalyzed by Cytochrome P-450 Mono-oxygenases in Plants . Plant J. 4(1): 47-60. 25. Lange, B.M., T. Rujan, W. Martin, and R. Croteau. (2000) Isoprenoid Biosynthesis: The Evolution of Two Ancient and Distinct Pathways Across Genomes . PNAS . 97 (24): 13172-13177. 26. Kanehisa, M., M. Araki, S. Goto, M. Hattori, M. Hirakawa, M. Itoh, T. Katayama, S. Kawashima, S. Okuda, T. Tokimatsu, and Y. Yamanishi. (2008) KEGG for Linking Genomes to Life and the Environment . Nucleic Acids Res. 36 : D480-D484. 27. Kanehisa, M., S. Goto, M. Hattori, K.F. Aoki-Kinoshita, M. Itoh, S. Kawashima, T. Katayama, M. Araki, and M. Hirakawa. (2006) From Genomics to Chemical Genomics: New Developments in KEGG . Nucleic Acids Res. 34 : D354-D357. 28. Kanehisa, M. and S. Goto. (2000) KEGG: Kyoto Encyclopedia of Genes and Genomes . Nucleic Acids Res. 28 : 27-30. 29. Collu, G., N. Unver, A.M.G. Peltenburg-Looman, R. van der Heijden, R. Verpoorte, and J. Memelink. (2001) Geraniol 10-hydroxylase, a Cytochrome P450 Enzyme Involved in Terpenoid Indole Alkaloid Biosynthesis . FEBS Lett . 508 : 215-220. 30. Cardoso, M.I.L., A.H. Meijer, S. Rueb, J.Q. Machado, J. Memelink, and J.H. Hoge. (1997) A Promoter Region that Controls Basal and Elicitor-inducible Expression Levels of the NADPH:Cytochrome P450 Reductase Gene ( Cpr ) from Catharanthus roseus Binds Nuclear Factor GT-1. Mol Gen Genet . 256 (6): 674-681. 31. Pasquali, G., O.J. Goddijn, A. de Waal, R. Verpoorte, R.A. Schilperoort, J.H. Hoge, and J. Memelink. (1992) Coordinated Regulation of Two Indole Alkaloid Biosynthetic Genes from Catharanthus roseus by Auxin and Elicitors . Plant Mol Biol . 18 (6): 1121-1131. 32. Geerlings, A., M.M.-L. Ibanez, J. Memelink, R. van der Heijden, and R. Verpoorte. (2000) Molecular Cloning and Analysis of Strictosidine β-D-Glucosidase, an Enzyme in Terpenoid Indole Alkaloid Biosynthesis in Catharanthus roseus. JBC . 275 (5): 3061-3056. 33. Schroder, G., E. Unterbusch, M. Kaltenbach, J. Schmidt, D. Strack, V. De Luca, and J. Schroder. (1999) Light-induced Cytochrome P450-dependent Enzyme in Indole Alkaloid Biosynthesis: Tabersonine 16-hydroxylase . FEBS Lett . 458 : 97-102. 128

34. Levac, D., J. Murata, W.S. Kim, and V. De Luca. (2008) Application of Carborundum Abrasion for Investigating the Leaf Epidermis: Molecular Cloning of Catharanthus roseus 16-hydroxytabersonine-16-O-methyltransferase . Plant J. 53 : 225-236. 35. De Luca, V., J. Balsevich, R.T. Tyler, and W.G.W. Kurz. (1987) Characterization of a Novel N-methyltransferase (NMT) from Catharanthus roseus Plants. Detection of NMT and Other Enzymes of the Indole Alkaloid Biosynthetic Pathway in Different Cell Suspension Culture Systems . Plant Cell Rep . 6(6): 458-461. 36. Vazquez-Flota, F., E. De Carolis, A.-M. Alarco, and V. De Luca. (1997) Molecular Cloning and Characteristics of Desacetoxyvindoline-4-hydroxylase, a 2-oxyglutarate Dependent-dioxygenase Involved in the Biosynthesis of Vindoline in Catharanthus roseus (L.) G. Don . Plant Mol Biol . 34 : 935-948. 37. St-Pierre, B., P. Laflamme, A.-M. Alarco, and V. De Luca. (1998) The Terminal O- acetyltransferase Involved in Vindoline Biosynthesis Defines a New Class of Proteins Responsible for Coenzyme A-dependent Acyl Transferase . Plant J. 14 (6): 703-713. 38. Laflamme, P., B. St-Pierre, and V. De Luca. (2001) Molecular and Biochemical Analysis of a Madagascar Periwinkle Root-Specific Minovincinine-19-Hydroxy-O- Acetyltransferase . Plant Phys. 125 : 198-198. 39. O'Connor, S.E. and J.J. Maresh. (2006) Chemistry and Biology of Monoterpene Indole Alkaloid Biosynthesis . Nat. Prod. Rep. 23 : 532-547.

129

Chapter 7 - Transient Effects of Overexpressing Tabersonine 16- hydroxylase in Catharanthus roseus Hairy Roots in Light and Dark

Conditions

Draft of paper to be submitted for publication.

Guy W. Sander 1,4 , Susan I. Gibson 2,5 , Ka-Yiu San 3,5 , and Jacqueline V. Shanks 1,6

1Department of Chemical and Biological Engineering, Iowa State University, Ames, IA

2Department of Plant Biology, University of Minnesota, St. Paul, MN

3Department of Bioengineering, Rice University, Houston, TX

4Primary researcher and author

5Co-principal investigator

6Principal investigator and corresponding author

Abstract

Hairy root cultures of Catharanthus roseus expressing tabersonine 16-hydroxylase

(T16H) under the control of a glucocorticoid-inducible promoter were used to investigate the effect of light-adaptation, biosynthetic enzyme overexpression, and the combination of these two factors on the production of terpenoid indole alkaloids (TIAs). Light adaptation decreased metabolite levels by decreasing flux, as determined by a stoichiometric model, into the metabolite pools. Light adaptation also decreased flux out of the TIA pathways, limiting metabolite turnover. Induction of the T16H gene in dark-grown hairy roots increased the flux out of the TIA pools, thereby reducing the levels of alkaloids. The decreasing levels of tabersonine upon induction of T16H in dark-grown cultures were reversed by an unknown 130

regulation pathway 36 hours after induction occurred. The induction of the light-adapted hairy roots required 60 hours for changes in the levels of tabersonine, lochnericine, and hörhammericine to occur, as compared to uninduced light-adapted cultures. Results of this study indicate new levels of biosynthetic regulation in C. roseus .

Introduction

Catharanthus roseus is well known for its production of the anticancer compounds vinblastine and vincristine. The low levels these alkaloids occur in the leaves [1] has resulted in researchers targeting this biosynthetic network for metabolic engineering. The extensive biosynthetic complexity and strict regulation had made engineering progress difficult (Figure

7.1).

Terpenoid indole alkaloids (TIAs) are produced at the convergence of the indole and terpenoid pathways (Figure 7.1). Strictosidine is the first TIA and many others are generated from this base structure. Two of these TIAs, catharanthine and vindoline, converge to form the bisindole alkaloid, vinblastine.

Cell and tissue cultures of C. roseus are often used in studies investigating the production of TIAs. Cell cultures are unable to produce significant amounts of secondary metabolites because the cells are undifferentiated [2]. Differentiated cells, such as hairy root cultures, produce secondary metabolites at levels similar to in planta . However, hairy roots of C. roseus still do not accumulate vinblastine or vincristine because the enzymes from tabersonine to vindoline normally occur in aerial parts of the plant [3, 4] (Figure 7.2).

At this time, the production levels of TIAs in C. roseus hairy roots are not sufficient to overcome economic barriers as compared to field grown plants. Nevertheless, there is still interest in producing vindoline in vitro for the benefit of elucidating more of the regulation in 131

the TIA pathway. Not all of enzymes from tabersonine to vindoline have been sequenced, so the pathway cannot yet be inserted into the C. roseus hairy root cultures. However, as promising as the prospect of inserting all the required steps sounds, it will not be met without encountering the tight regulation of the TIA biosynthetic network [5]. The expression of deacetylvindoline-O-acetyltransferase (DAT), the final enzyme in the vindoline pathway normally located in the leaf epidermis, in C. roseus hairy roots was interfered with by the sequence similar, root tip specific enzyme, minovincinine-19-hydroxy-O-acetyltransferase

(MAT), reducing the enzymatic activity of DAT [6, 7] (Figure 7.2).

This study investigates the first enzyme in the tabersonine-to-vindoline pathway, tabersonine 16-hydroxylase (T16H). Its substrate, tabersonine, is also diverted to the other root specific TIAs, such as lochnericine and hörhammericine, that accumulate in hairy roots

(Figure 7.2). Tabersonine is an important branchpoint in vindoline production. To better understand how the biosynthetic pathways react to metabolic engineering efforts of this branchpoint, their metabolites have been more comprehensively measured and quantified in this study.

We investigate the effect of light adaptation in this study to survey how the tabersonine branchpoint responds to light. Regulation involved at this branchpoint will be important to future metabolic engineering efforts to produce vindoline from hairy roots.

Several enzymes between tabersonine and vindoline are light-dependent and decreases in tabersonine have been seen with lighted growth of hairy roots [8]. The transcriptional, developmental, and light-mediated regulation of the vindoline pathway is reviewed in

Facchini (2001) and Facchini et al. (2003) [9, 10]. 132

This study reports the temporal metabolite levels and fluxes in the EHIT16H-34-1 hairy root line [11] expressing T16H under the control of a glucocorticoid-inducible promoter under four conditions: light-grown and light-grown T16H overexpression; and dark-grown and dark-grown T16H overexpression.

Materials and Methods

Chemicals

Dexamethasone (Sigma) was dissolved in ethanol and added the culture media.

Geraniol (Aldrich), 10-hydroxygeraniol (Aldrich), loganin (Fluka), secologanin (Fluka), strictosidine (gift), serpentine (Aldrich), ajmalicine (Fluka), catharanthine (Qventas), hörhammericine, tabersonine, tryptophan (Sigma), and tryptamine (Sigma) were dissolved in methanol and used as HPLC standards. Methanol, acetonitrile, ammonium acetate, and phosphoric acid were HPLC grade (Fisher Scientific). Formic acid (Fluka), trichloroacetic acid (Fluka), and ethanol (Pharmco-Aaper) were high purity. Growth media was prepared with sucrose (MP Biomedicals), Gamborg’s B5 salts (Sigma), and Gamborg’s vitamins

(Sigma).

Culture Conditions

Growth media was prepared as detailed in Chapter 5. Dark grown cultures were maintained in foam-stoppered (Jaece Industries) 250-ml Erlenmeyer flasks in incubator 133

shakers at 26 °C and 100 rpm. Light grown cultures were also subjected to 24-hour fluorescent lighting (24-36 mol m -2 s-1). Light-grown cultures were light adapted for 5 subculture cycles before the experiment took place. The hairy root cultures were subcultured at intervals of 21 days for the light-grown cultures and 28 days for the dark grown cultures.

Subculturing was performed by cutting five root tips from a mature culture and transferring them to 50 ml of fresh media.

Induction of the Catharanthus roseus Hairy root Lines

The volume of the remaining culture media was measured by drawing the media up into a 50-ml serological pipet (Corning). The average media volume of the cultures to be induced was calculated. Based on this average, the appropriate amount of a 5 mM dexamethasone stock in ethanol was added to the cultures for a final concentration of 3 M dexamethasone in the culture media. An equal amount of ethanol was added to the uninduced controls.

Sample Preparation and Analysis

Culture harvesting, alkaloid extractions, and metabolite measurements by HPLC were performed as described in Chapter 5.

Flux Modeling Methodology

The fluxes of the metabolites were calculated based on the total metabolite productivity of the hairy root cultures [12]. The flux modeling methods were performed as

-1 described in Chapter 5. The flux productivities ( Xv j) ( mol hr ), where X is the biomass (g

-1 -1 DW) and vj is the flux of reaction j (mol g DW hr ) were numerically integrated over the period from 4 to 72 hours resulting in values for total metabolite accumulation ( mol (68 134

hours) -1) and total reaction flux productivity ( mol (68 hours) -1) for the entire transient experiment. The reaction scheme is laid out in Figure 7.3. The fluxes of the model are termed minimum total flux productivities. The minimum qualifier is used because the system is underdetermined and additional flux into the biosynthetic network would only result in proportionally increased flux out of the network.

Statistical Analysis

Data were analyzed using the Students t-test for unequal sample size and unequal variance. A few data were removed as outliers following Peirce’s criterion.

Results

To investigate the transient levels of TIAs over a period of time after gene induction in dark- and light-grown cultures, we used the previously generated C. roseus hairy root line

EHIT16H-34-1 [11] expressing T16H under the control of a glucocorticoid-inducible promoter. The advantage of the inducible promoter system is that we can investigate the effects of altered expression within the same genetic line, thereby minimizing clonal variation.

As in the previous temporal studies, hairy root cultures in the late exponential growth phase (21 days after subculturing) were induced and harvested at 4, 8, 12, 24, 36, 48, 60, and

72 hours after induction. The induced cultures were given dexamethasone in ethanol from a stock solution so the concentration of dexamethasone in the culture media was 3 M. The uninduced cultures were given an equal volume of ethanol. 135

Trends in Metabolite Levels

Levels of tryptophan were near detection limits by the chromatographic method.

Tryptamine levels where also low and had interference from co-eluting compounds. Levels of tryptophan and tryptamine could not be accurately estimated.

The levels of the iridoids geraniol and 10-hydroxygeraniol were not detectable by

HPLC. The inability to detect these iridoids is likely because the biomass samples were prepared by freeze drying. Given the vapor pressure of geraniol and that it is a common component of leaf and flower volatile essential oils, including C. roseus [13], it would have easily evaporated during lyophilization.

In the uninduced dark-grown cultures, levels of the iridoid glycoside, loganin, significantly decrease throughout the investigated time period (p<0.05), decreasing 50.6% from 4 to 60 hours (Figure 7.4a). Levels of loganin in the induced dark-grown cultures perform similarly significantly decreasing 68.0% from 4 to 48 hours (p<0.1). The loganin levels in the uninduced light-grown cultures were also similar to the induced light-grown levels (Figure 7.4b). The loganin levels in the induced and uninduced light-grown cultures were initially significantly lower than the dark-grown cultures (p<0.05) and maintained a relatively similar level throughout the experiment.

Secologanin levels in dark-grown roots acted similar to loganin levels. Levels of secologanin in uninduced dark-grown roots significantly decreased 48.4% from 4 to 72 hours

(p<0.05) while the levels in induced dark-grown roots significantly decreased 71.0% from 4 to 36 hours (p<0.05) (Figure 7.5a). Uninduced light-grown cultures had stable levels of secologanin while the induced light-grown cultures had a significant 66.0% decrease from 4 136

to 72 hours (p<0.05) (Figure 7.5b). The levels of secologanin in light-grown cultures were initially significantly lower than dark-grown cultures (p<0.05).

Strictosidine levels also showed substantial decreases as the iridoid glycosides did.

The uninduced dark-grown levels significantly decreased 56.6% from 4 to 48 hours (p<0.05)

(Figure 7.6a). The induced dark-grown levels significantly decreased 53.2% from 4 to 36 hours (p<0.1). The induced dark-grown cultures decreased faster than the uninduced cultures before leveling off. Strictosidine levels in uninduced light-grown cultures were relatively stable (Figure 7.6b). The induced light-grown cultures significantly decreased 38.0% from 4 to 36 hours (p<0.05) to significantly lower levels than the uninduced light-grown roots

(p<0.1).

For the iboga alkaloid, catharanthine, levels significantly decreased from 12 to 60 hours for uninduced dark-grown cultures (Figure 7.7a). The induced dark-grown cultures significantly decreased from 12 to 36 hours (p<0.05) then significantly increased from 36 to

72 hours (p<0.05), regaining most of the loss. The levels of catharanthine in light-grown cultures were the same for uninduced and induced cultures and both significantly decrase from 24 to 72 hours (p<0.05) (Figure 7.7b). The levels of the light-grown cultures were significantly lower than the dark-grown roots (p<0.05).

In uninduced dark-grown cultures the level of ajmalicine decreased significantly from

4 to 48 hours (p<0.05) (Figure 7.8a). Levels of ajmalicine in induced dark-grown roots significantly decreased (p<0.05) even further and then significantly increased (p<0.1) to near-initial values. The uninduced and induced light-grown cultures performed nearly identically and had significantly lower levels than the dark-grown cultures (p<0.1) (Figure

7.8b). 137

Serpentine levels trended similar to ajmalicine although at much lower levels.

Uninduced dark-grown levels of serpentine significantly decreased from 12 to 48 hours

(p<0.05) (Figure 7.9a). The induced dark-grown had varying levels but significantly decreased from 36 to 60 hours (p<0.1), then significantly increased to initial levels at 72 hours (p<0.05). The levels of uninduced and induced light-grown roots were very similar and did not change much over the experiment (Figure 7.9b). Levels in light-grown cultures were initially significantly lower than dark-grown cultures (p<0.05).

The corynanthe pool (ajmalicine + serpentine) levels were dominated by the trends of ajmalicine for all four cases studied (Figure 7.10a and b).

Tabersonine levels in uninduced dark-grown cultures significantly decreased from 4 to 48 hours (p<0.05) (Figure 7.11a). The induced dark-grown levels significantly decreased from 4 to 36 hours (p<0.05) and then significantly increased from 36 to 72 hours (p<0.05) to levels similar to the uninduced dark-grown cultures. The levels of the uninduced and induced light-grown cultures were variable throughout the experiment (Figure 7.12b). At 72 hours the induced light-grown cultures had levels significantly higher than the uninduced light-grown roots (p<0.05).

Levels of lochnericine significantly decreased in uninduced dark-grown roots from 4 to 48 hours (p<0.1) (Figure 7.12a). The induced dark-grown levels significantly decreased from 12 to 36 hours (p<0.05), then significantly increased from 36 to 48 hours (p<0.1). The light-grown levels in uninduced and induced cultures trended similarly until 48 hours were where they diverge (Figure 7.12b). The final induced level is a significant 2.4-fold higher than the uninduced light-grown roots (p<0.1). The light-grown cultures initially had significantly lower levels than the dark-grown (p<0.1). 138

Hörhammericine levels significantly decreased from 24 to 60 hours in uninduced dark-grown cultures (p<0.05) (Figure 7.13a). The induced dark-grown levels significantly decreased from 4 to 36 hours (p<0.05), then significantly increased from 36 to 48 hours

(p<0.05), and then leveled off. The light-grown cultures initially had significantly lower levels than the dark-grown cultures (p<0.05) (Figure 7.13b). Both the uninduced and induced light-grown roots behaved similarly.

The aspidosperma pool levels (tabersonine + lochnericine + hörhammericine) had a significant decrease for the uninduced dark-grown cultures from 24 to 60 hours (p<0.05)

(Figure 7.14a). The induced dark-grown cultures had a significant decrease in levels from 12 to 36 hours (p<0.05) followed by a significant increase from 36 to 48 hours (p<0.05). The uninduced and induced light-grown cultures trended together until 48 hours where diverge

(Figure 7.14b).

The level of total measured terpenoid indole alkaloids (strictosidine + ajmalicine + serpentine + catharanthine + tabersonine + lochnericine + hörhammericine) significantly decreased from 12 to 48 hours (p<0.05) (Figure 7.15a). TIA levels in the induced dark- grown cultures significantly decreased from 8 to 36 hours (p<0.05) and then significantly increased from 36 to 48 hours (p<0.05). The uninduced and induced light-grown total measured TIA levels trended together with no change in level. The light-grown cultures had significantly lower levels of total measured TIAs compared to the dark-grown cultures from

4 to 36 hours (p<0.05).

Minimum Metabolic Flux Model

The minimum metabolic flux map for the uninduced dark-grown cultures (Figure

7.16a) shows the minimum total flux productivity (MTFP) of the indole pathway is larger 139

than the terpenoid pathway because both loganin and secologanin have negative accumulation. Along with the negative accumulation of strictosidine, there is a large flux towards the other TIAs. The aspidosperma alkaloids accumulate lochnericine and hörhammericine with a moderate MTFP out of the pathway. The largest portion of the TIA flux is diverted through the corynanthe pool where there is an accumulation of serpentine and a large accumulation of ajmalicine. There is also a large MTFP out of this pathway.

For the induced dark-grown cultures (Figure 7.16b) the MTFP into the indole pathway is decreased compared to the uninduced dark-grown roots. The MTFP into the terpenoid pathway is much lower due to the substantial negative accumulations of loganin and secologanin. With the negative accumulation of strictosidine, the MTFP into the other

TIAs is similar to the uninduced dark-grown cultures. However, ajmalicine and hörhammericine have negative accumulations and the accumulations of serpentine and lochnericine are decreased compared to uninduced dark-grown roots. This results significantly increased MTFPs out of the TIA pathways. The MTFPs for the corynanthe, aspidosperma, and iboga pathways are increased 2.5-, 3.2-, and 2.9-fold, respectively, compared to uninduced dark-grown cultures.

The MTFP into the terpenoid pathway is larger than the indole pathway for uninduced light-grown cultures (Figure 7.17a) due to the large accumulations of loganin and secologanin. The MTFP into the TIA pathways is split relatively evenly between the corynanthe and aspidosperma pools where it is all accumulated. Ajmalicine, serpentine, lochnericine, and hörhammericine all have significant accumulations. There is a small flux out of the iboga pathway. 140

The MTFP into the indole and terpenoid pathways are much lower in the induced light-grown cultures (Figure 7.17b) compared to the uninduced light-grown cultures. There is a small accumulation of loganin and large negative accumulation of secologanin. A portion of the TIA flux is diverted to the corynanthe pool for the accumulation of ajmalicine.

Most of the TIA flux is focused towards the aspidosperma pool for the accumulation of lochnericine. Each of the pathways out of the TIAs has a small MTFP.

Discussion

This study measures effects of light adaptation and T16H overexpression on the levels of nine metabolites. The levels of two indole alkaloids, tryptophan and tryptamine, were low (data not shown) and the iridoids, geraniol and 10-hydroxygeraniol, were not detected. Two iridoid glycosides (loganin and secologanin) and seven terpenoid indole alkaloids (strictosidine, catharanthine, ajmalicine, serpentine, tabersonine, lochnericine, and hörhammericine) were quantified.

Effect of Light Adaptation

Levels of strictosidine had a similar declining trend during the experiment in both light- and dark-grown uninduced cultures. Loganin, secologanin, and catharanthine all had lower levels in the uninduced light-grown roots compared to the uninduced dark-grown roots. Catharanthine has a baseline shift in level where the level decreases in the light adapted roots but the trend is similar to the dark-grown roots. The level trends for loganin and secologanin are different in the uninduced light- and dark-grown cultures, indicating a change in regulation.

Ajmalicine and serpentine both had significantly lower levels in uninduced light- grown cultures than the uninduced dark-grown (p<0.05). They also had a slight trend 141

upwards in level where the dark-grown roots trended downward. The decrease seen in ajmalicine and serpentine with light adaptation is contrary to a previous study using wild- type hairy root cultures adapted to a 12-hour photoperiod [8].

Tabersonine levels were variable in uninduced-light grown cultures but were of similar level to the uninduced dark-grown cultures. Lochnericine and hörhammericine both had reduced levels in light-grown roots. Lochnericine appears to have a baseline shift downwards whereas hörhammericine trends much different, indicating a change in regulation. Overall, the aspidosperma pool had lower levels in uninduced light-grown roots compared to uninduced dark-grown.

The levels of the total measured TIAs were lower in the uninduced light-grown cultures compared to the uninduced dark-grown cultures and trend differently.

The total accumulation of loganin and secologanin was very different between the uninduced light-grown and uninduced dark-grown roots. The light-grown cultures accumulated large amounts of these metabolites whereas the dark-grown cultures had large negative accumulations. This also indicates a change in regulation as the trends in levels does.

The MTFP into the TIA pathways of the light-grown roots is half of the value for the dark-grown roots but still has a significant total accumulation of ajmalicine, serpentine, lochnericine, and hörhammericine. This is because the dark-grown roots have large MTFPs out of the TIA pathways and the light-grown roots have either no flux or a small MTFP out of the pathway. This is a significant change in regulation between light- and dark-grown cultures. Although the uninduced dark-grown cultures accumulate more TIAs than the 142

uninduced light-grown cultures, the light-grown cultures accumulate 98.3% of the flux into the TIA pathway whereas the dark-grown roots only accumulate 58.3% of the flux.

Effect of Induced Overexpression of T16H

The levels of loganin, secologanin, strictosidine, catharanthine, ajmalicine, and serpentine all trended similarly for induced dark-grown versus uninduced dark-grown cultures. Although there are some areas with differences in levels between the uninduced and induced dark-grown cultures, the similar trends in levels indicate similar regulation strategies.

Tabersonine levels decrease upon induction and then increase to levels similar to the uninduced dark-grown roots. Induced lochnericine levels trend with the uninduced levels until 36 hours and then increase dramatically. Hörhammericine levels decline quickly with induction, faster than the uninduced dark-grown cultures. The overall levels of the aspidosperma pool largely trended the induced and uninduced dark-grown cultures together, except for the 36 hour time point.

The 36 hour time point seems an anomaly in the data, except that for some metabolites this point falls in line with the rest of the data. Levels of tabersonine decrease upon induction of the T16H overexpression. Tabersonine is a substrate for this enzyme so the decrease seen is no surprise. Examining the HPLC chromatograms reveals new peaks eluting early in the method in the induced samples. These peaks have tabersonine-like UV spectra and further investigation is ongoing to identify them. After 36 hours, levels of tabersonine increase to the levels of the uninduced dark-grown roots. This may indicate a control point was reached and the regulation of tabersonine changed. This is also reflected in the levels of the total measured TIAs where induced dark-grown cultures decreased more 143

rapidly than the uninduced cultures until 36 hours. Then the induced levels increase to similar levels as the uninduced roots.

The negative accumulation of loganin and secologanin was larger in the induced dark-grown roots, but the MTFP past strictosidine was similar between the induced and uninduced dark-grown roots. The most significant changes in TIA accumulation were seen with ajmalicine, serpentine, and hörhammericine. The uninduced roots accumulated these metabolites where the induced roots had negative accumulation or was nearly even in the case of serpentine. This results in increased MTFPs out of the TIA pathways causing the total MTFP out to be larger than the MTFP in for an overall negative accumulation of TIAs.

Effect of Light Adaptation with Induced Overexpression of T16H

The levels of loganin in induced light-grown roots trended similarly to the uninduced light-grown roots. Secologanin and strictosidine had decreasing levels upon induction indicating a change in regulation. Catharanthine, ajmalicine, and serpentine in induced light- grown roots trended very similarly with similar levels as the uninduced light-grown roots.

Induction of the T16H gene appeared to have no impact on these metabolites in the light.

Tabersonine levels in induced light-grown roots trend with the uninduced light-grown levels until 60 hours where the levels diverge. Lochnericine also trends similarly for induced and uninduced light-grown cultures until 60 hours where they diverge. Hörhammericine trends similarly but has an opposite outcome at 72 hours. This change in trend late in the experiment indicates a change in regulation for the aspidosperma alkaloids and can be seen clearly in Figure 7.14.

The levels of the total measured TIAs did not change significantly with induction in the light-grown cultures. 144

The MTFPs into the terpenoid pathway was significantly lower in the induced light- grown cultures compared the uninduced cultures. Loganin had much lower accumulation and secologanin had a large negative accumulation whereas in the uninduced light-grown cultures there was a large positive accumulation. This again points to a change in regulation.

The MTFP into the TIA pathway in the induced light-grown cultures is half the

MTFP in the uninduced light-grown cultures. Most of this flux is diverted to the aspidosperma pathway, where in the uninduced cultures half went to the corynanthe pool and half to the aspidosperma pool. This is different from the uninduced and induced dark-grown where the ratio of flux to the corynanthe and aspidosperma pathways were similar. Similar to the uninduced light-grown cultures, the induced light-grown cultures have small MTFPs out of the TIA pathways and accumulated most of the flux.

Conclusions

This work investigates the effect of light adaptation, induced T16H overexpression, and the combination of these to factors on the levels and fluxes of metabolites in C. roseus hairy roots. The strict regulation of secondary metabolism in C. roseus often prevents successful outcomes with metabolic engineering efforts. Light adaptation and overexpression of T16H did not result in large positive changes in metabolite levels. The investigation did elucidate interesting changes in regulation by using a more comprehensive profiling of metabolites.

Light-adaptation saw a decrease in ajmalicine and serpentine levels, which is contrary to previous results [8]. Lighted conditions are assumed to increase levels of ajmalicine and serpentine. The change in level and trend of these metabolites indicates that the regulation of the corynanthe pool may not directly depend on light, but rather the effect of light on the 145

regulation of other parts of the pathway. Light-adaptation affected each of the aspidosperma alkaloids differently. The levels of these alkaloids are often interrelated but this study demonstrates they can also be regulated separately. Light-adaptation also prevented the loss of metabolites out of the TIA pathways by having low MTFPs for these pathways and thereby having a more efficient accumulation of TIAs.

With induction of the overexpression of T16H, aspidosperma alkaloids were subjected to regulatory control. After 36 hours, the decreasing level of tabersonine was suddenly reversed. This regulatory change was echoed in lochnericine and hörhammericine and is a point of interest for future metabolic engineering efforts for the expression of enzymes in the vindoline pathway.

In Chapters 5 and 6 it is hypothesized there is a regulatory connection between secologanin and tabersonine via the cytochrome P450-dependent enzymes secologanin synthase (SLS) and tabersonine-6,7-epoxidase (T6,7E) [14, 15]. While secologanin and tabersonine have similar trends with induction, as in Chapters 5 and 6, so do several other metabolites, indicating that another regulatory mechanism is acting alone or in concert with the proposed cytochrome P450 reductase isoform hypothesized to regulated SLS and T6,7E.

Interestingly, T16H is also a cytochrome P450-dependent enzyme [16]. T16H would also be reliant on cytochrome P450 reductase (CPR) or a cytochrome P450 reductase isoform for activity.

Strictosidine saw a change in regulation with light adaptation, but with light adaptation and overexpression of T16H, the trends of metabolite were similar to the uninduced and induced dark-grown cultures indicating a return to the previous mode of regulation. 146

The induced light-grown cultures demonstrated a change in regulation at 60 hours after induction. A previous report with this inducible promoter system showed that metabolite levels may take 12 hours to change [17] and the data presented in Chapters 5 and

6 show 12 to 24 hours may pass before the effects of induction are seen. The long delayed change in metabolite levels, especially for TIAs closely associated with the overexpressed enzyme, represents an interesting level of control.

And finally, as suggested in Chapters 5 and 6 and [18], the flux of metabolites out of the TIA pathways, as seen by the MTFPs in the dark-grown cultures, provides a new goal for metabolic engineering to prevent the turnover of TIAs and increase the efficiency of their accumulation.

Acknowledgements

The authors express their gratitude to Dr. Christie A.M. Peebles for helping to develop the LC-MS compatible protocol and to Dr. Sarah E. O’Connor for the gift of strictosidine. Funding was provided by the National Science Foundation (CBET-0729753

(JVS), CBET-0729622 (K-YS), and CBET-0729625 (SIG)) and the Roy J. Carver Graduate

Research Training Fellowship in Molecular Biophysics (GWS).

147

Figures

Shikimate Pathway DXP Pathway

PEP + E4P Pyruvate + GA-3P DXS 1-Deoxy-D-xylulose-5-phosphate DXR 2-C-Methyl-D-erythritol-4-phosphate

Mevalonate IPP DMAPP

Chorismate AS GPP Anthranilate Geraniol CPR G10H 10-hydroxygeraniol

Tryptophan 10-oxogeraniol TDC Tryptamine 7-deoxyloganetic acid

7-deoxyloganic acid

7-deoxyloganin Loganic acid

STR LAMT Loganin SLS Strictosidine SGD Secologanin

4,21-dehydrogeissoschizine Vinblastine Vincristine Cathenamine Stemmadenine

Ajmalicine Catharanthine

T16H 16OMT NMT D4H DAT Serpentine Tabersonine Vindoline T6,7E

Lochnericine 6,7-dehydrominovincinine MAT Hörhammericine 6,7-dehydroechitovenine MAT 19-acetoxyhörhammericine 148

Figure 7.1 Biosynthesis of terpenoid indole alkaloids in Catharanthus roseus .

DXS , 1-deoxy-D-xylulose 5-phosphate synthase; DXR , 1-deoxy-D-xylulose 5-phosphate reductoisomerase; G10H , geraniol 10-hydroxylase; CPR , NADPH:cytochrome P450 reductase; LAMT , loganic acid-O- methyltransferase; SLS , secologanin synthase; AS , anthranilate synthase; TDC , tryptophan decarboxylase; STR , strictosidine synthase; SGD , strictosidine β-D-glucosidase; T16H , tabersonine 16-hydroxylase; 16OMT , 16-hydroxytabersonine-16-O-methyltransferase; NMT , 16-methoxy-2,3-dihydro-3-hydroxytabersonine-N- methyltransferase; D4H , desacetoxyvindoline-4-hydroxylase; DAT , deacetylvindoline-4-O-acetyltransferase; T6,7E , tabersonine-6,7-epoxidase; MAT , minvincinine-19-O-acetyltransferase. (Figure adapted from: [4, 6, 15, 16, 17, 19, 20, 21, 22, 23, 24, 25, 26, 27, 28, 29, 30, 31, 32]) ______

149

N H N H

NMT H3CO H3CO

16-methoxy-2,3-dihydro- N CO CH Desacetoxyvindoline N CO CH 3-hydroxytabersonine H H 2 3 H 2 3 OH H3C OH D4H

N H N H

H CO H CO 3 3 OH 16-methoxytabersonine N Deacetylvindoline N CO CH H CO CH H 2 3 2 3 H3C OH 16OMT DAT

N H N H

HO H3CO OCOCH3 16-hydroxytabersonine N Vindoline N CO CH H CO CH H 2 3 2 3 H3C OH T16H

N H N H

OH H N 6,7-dehydrominovincinine N Tabersonine H H CO2CH3 CO2CH3 T6,7E MAT

N O H N H

OCOCH3 H Lochnericine N 6,7-dehydroechitovenine N H H CO2CH3 CO2CH3

O O N H N H MAT OH OCOCH3 H H Hörhammericine N 19-acetoxyhörhammericine N H H CO2CH3 CO2CH3 Figure 7.2 Biosynthesis of tabersonine derivatives in Catharanthus roseus . T16H , tabersonine 16-hydroxylase; 16OMT , 16-hydroxytabersonine-16-O-methyltransferase; NMT , 16- methoxy-2,3-dihydro-3-hydroxytabersonine-N-methyltransferase; D4H , desacetoxyvindoline-4-hydroxylase; DAT , deacetylvindoline-4-O-acetyltransferase; T6,7E , tabersonine-6,7-epoxidase; MAT , minvincinine-19-O- acetyltransferase. (Figure adapted from:[4, 6, 15, 16, 29, 30, 31]) 150

X v0 X v2

Tryptophan Loganin

X v1 X v3

Tryptamine Secologanin

X v4

Strictosidine

X v5 X v Ajmalicine 6 X v8 X v7 X v9 Catharanthine Serpentine X v 10 X v15 X v14 Tabersonine

X v11

Lochnericine

X v12

Hörhammericine

X v13

Figure 7.3 Scheme of biosynthetic reactions for the metabolic flux model.

The boxes represent pools for metabolite accumulation and the Xv j terms represent flux productivities for each reaction in the underdetermined model. 151

Loganin 4.0 4 a b 3.5 3.5

3.0 3

2.5 2.5

2.0 2

1.5 1.5 g/g weight Dry mol/gweight Dry 1.0 1 * * 0.5 0.5 ** ** 0.0 0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h)

Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 7.4 Loganin levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Cultures were induced with dexamethasone to a final concentration of 3 M. Uninduced cultures were given a similar amount of ethanol. The cultures were induced in the late exponential growth phase and harvested at 4, 8, 12, 24, 36, 48, 60, and 72 hours after induction. Metabolite levels were determined by HPLC analysis of crude extracts. Light-grown cultures were grown in 24-hour light. Data represents mean of triplicate cultures . Error bars represent standard deviation. “*” and “ ** ” indicate significant results, p<0.1 and p<0.05, respectively, between the uninduced and induced data at that time point.

Secologanin 9 9 a b 8 8

7 7

6 6

5 5

4 4 g/g Dry weight g/g Dry mol/g weight Dry 3 3 2 ** 2 ** ** 1 1 ** ** 0 ** 0 ** ** 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h)

Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 7.5 Secologanin levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 7.4. 152

Strictosidine 6 6 a b

5 5

4 4

3 3 g/g Dry weight g/g Dry mol/g weight Dry 2 2

1 1 ** ** * ** 0 ** 0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h)

Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 7.6 Strictosidine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 7.4.

Catharanthine 1.2 1.2 a b

1.0 1.0

0.8 0.8

0.6 0.6 g/g Dry weight g/gDry

mol/gweight Dry 0.4 0.4

0.2 ** 0.2

0.0 0.0 0 20 40 60 80 0 20 40 60 80 Time (hrs) Time (hrs)

Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 7.7 Catharanthine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 7.4.

153

Ajmalicine 8 8 a b 7 7

6 6

5 5

4 4

g/g Dry weight g/g Dry 3 mol/gweight Dry 2 2

1 1

0 0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h)

Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 7.8 Ajmalicine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 7.4.

Serpentine 2.0 2 a b 1.8 1.8

1.6 1.6

1.4 1.4

1.2 1.2

1.0 1

0.8 0.8 g/gweight Dry mol/gweight Dry 0.6 0.6

0.4 0.4

0.2 0.2

0.0 0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h)

Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 7.9 Serpentine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 7.4.

154

Serpentine + Ajmalicine 9 9 a b 8 8 7 * 7 6 6

5 5

4 4 g/gweight Dry mol/gweight Dry 3 3

2 2

1 1

0 0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h) Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Tabersonine 1.2 1.2 a b

1.0 1.0 **

0.8 0.8

0.6 0.6 g/g Dry weight g/gDry mol/gweight Dry 0.4 0.4

0.2 0.2 ** * * 0.0 ** ** 0.0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h) Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 7.11 Tabersonine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 7.4.

155

Lochnericine 5.0 5.0 a b 4.5 * 4.5 4.0 4.0 * 3.5 ** 3.5 3.0 3.0

2.5 2.5

2.0 2.0 g/gweight Dry mol/gweight Dry 1.5 1.5

1.0 1.0

0.5 0.5 **

0.0 0.0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h)

Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 7.12 Lochnericine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 7.4.

Hörhammericine 2.0 2.0 a b 1.8 1.8

1.6 1.6

1.4 1.4

1.2 1.2

1.0 1.0

0.8 0.8 g/gweight Dry mol/gweight Dry 0.6 0.6

0.4 0.4 0.2 ** 0.2

0.0 * 0.0 * 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h) Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 7.13 Hörhammericine levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 7.4.

156

Tabersonine + Lochnericine + Hörhammericine 7 7 a b 6 6

5 5 *

4 4

3 3 g/g Dry weight g/g Dry mol/gweight Dry 2 2 ** ** 1 1

0 0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h) Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 7.14 The aspidosperma alkaloid pool (tabersonine + lochnericine + hörhammericine) levels over a 72- hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 7.4.

Total Measured TIAs 20 20 a b 18 18

16 16 14 * 14 12 12

10 10

8 8 * g/g Dry weight g/g Dry mol/gweight Dry 6 * 6 4 4 * ** * 2 2

0 0 0 20 40 60 80 0 20 40 60 80 Time (h) Time (h)

Uninduced Dark Grow n Induced Dark Grow n Uninduced Light Grow n Induced Light Grow n

Figure 7.15 Total measured terpenoid indole alkaloid (strictosidine + catharanthine + serpentine + ajmalicine + tabersonine + lochnericine + hörhammericine) levels over a 72-hour induction period for cultures grown in dark conditions (a) and lighted conditions (b). Conditions are further detailed in the caption of Figure 7.4.

157

1.93 1.42 1.56 0.324 a b 0 -0.328 0 -0.402 1.93 1.74 1.56 0.726

0 -0.186 0 -0.838

1.93 1.56

-0.126 -0.299 2.06 1.86 1.27 1.22 0.562 -0.170 0.789 0.640 0.706 1.39 0.174 0.171 0.0976 -0.0490 0.167 0.615 0.0765 0.0215 0.469 0.220 0.539 1.37 0.00793 -0.0521 0.607 0.521

0.272 0.151 0.335 0.371

0.147 -0.236 0.188 0.606

Figure 7.16 Minimum flux map for uninduced and induced dark-grown EHIT16H-34-1 cultures. The values in boxes represent the total metabolite accumulation ( mol (68 hrs) -1) and values near the arrows represent minimum total flux productivity ( mol (68 hrs) -1) during the transient experiment for the uninduced dark-grown cultures (a) and the induced dark-grown cultures (b). Metabolites and reactions are described in Figure 7.3. 158

1.01 1.72 0.516 0.152 a b 0 0.315 0 0.0465 1.01 1.41 0.516 0.106

0 0.392 0 -0.411

1.01 0.516

0.0626 -0.137 0.952 0.654 0.483 0.190 0.332 0.118 0.469 0.464 0.151 0.0724 0.00556 0.00110 -0.0116 -0.0151 0.151 0.464 0.0172 0.0363 0.463 0.0162 0.00 0.0362 0.0340 0.0533 0.430 0.409

0.244 0.352 0.185 0.0577

0.185 -0.0400 0.00 0.0977

Figure 7.17 Minimum flux map for uninduced and induced light-grown EHIT16H-34-1 cultures. The values in boxes represent the total metabolite accumulation ( mol (68 hrs) -1) and values near the arrows represent minimum total flux productivity ( mol (68 hrs) -1) during the transient experiment for the uninduced light-grown cultures (a) and the induced light-grown cultures (b). Metabolites and reactions are described in Figure 7.3.

References

1. Tyler, V.E. (1988) Medicinal Plant Research: 1953-1987 . Planta Med . 54 : 95-100. 2. Wink, M., A.W. Alfermann, R. Franke, B. Wetterauer, M. Distl, J. Windhovel, O. Krohn, E. Fuss, H. Garden, A. Mohagheghzadeh, E. Wildi, and P. Ripplinger. (2005) Sustainable Bioproduction of Phytochemicals by Plant in vitro Cultures: Anticancer Agents . Plant Gen. Res. 3(2): 90-100. 3. Murata, J. and V. De Luca. (2005) Localization of Tabersonine 16-hydroxylase and 16-OH Tabersonine-16-O-methyltransferase to Leaf Epidermal Cells Defines Them as Major Site of Precursor Biosynthesis in the Vindoline Pathway in Catharanthus roseus. Plant J. 44 : 581-594. 4. Levac, D., J. Murata, W.S. Kim, and V. De Luca. (2008) Application of Carborundum Abrasion for Investigating the Leaf Epidermis: Molecular Cloning of Catharanthus roseus 16-hydroxytabersonine-16-O-methyltransferase . Plant J. 53 : 225-236. 159

5. Hughes, E.H., S.-B. Hong, S.I. Gibson, J.V. Shanks, and K.-Y. San. (2004) Expression of a Feedback-resistant Anthranilate Synthase in Catharanthus roseus Hairy Roots Provides Evidence for Tight Regulation of Terpenoid Indole Alkaloid Levels . Biotechnol. Bioeng. 86 (6): 718-727. 6. Laflamme, P., B. St-Pierre, and V. De Luca. (2001) Molecular and Biochemical Analysis of a Madagascar Periwinkle Root-Specific Minovincinine-19-Hydroxy-O- Acetyltransferase . Plant Phys. 125 : 198-198. 7. Magnotta, M., J. Murata, J. Chen, and V. De Luca. (2007) Expression of Deacetylvindoline-4-O-acetyltransferase in Catharanthus roseus Hairy Roots . Phytochem . 68 : 1922-1931. 8. Bhadra, R., J.A. Morgan, and J.V. Shanks. (1998) Transient Studies of Light-Adapted Cultures of Hairy Roots of Catharanthus roseus : Growth and Indole Alkaloid Accumulation . Biotechnol. Bioeng. 60 (6): 670-678. 9. Facchini, P.J. (2001) Alkaloid Biosynthesis in Plants: Biochemistry, Cell Biology, Molecular Regulation, and Metabolic Engineering Applications . Annu. Rev. Plant Physiol. Plant Mol. Biol. 52 : 29-66. 10. Facchini, P.J., D.A. Bird, B.P. MacLeod, S.-U. Park, and N. Samanani. (2003) Multiple Levels of Control in the Regulation of Alkaloid Biosynthesis . Rec Adv Phytochem . 37 : 143-180. 11. Hughes, E.H. (2003) Metabolic Engineering of Catharanthus roseus Hairy Roots Using an Inducible Promoter System . Rice University: Houston, TX. 12. Morgan, J.A. and J.V. Shanks. (2002) Quantification of Metabolic Flux in Plant Secondary Metabolism by a Biogenetic Organizational Approach . Met. Eng. 4: 257- 262. 13. Pandey-Rai, S., G.R. Mallavarapu, A.A. Naqvi, A. Yadav, S.K. Rai, S. Srivastava, D. Singh, R. Mishra, and S. Kumar. (2006) Volatile Components of Leaves and Flowers of Periwinkle Catharanthus roseus (L.) G. Don from New Delhi . Flavour Frag. J. 21 (3): 427-430. 14. Yamamoto, H., N. Katano, A. Ooi, and K. Inoue. (2000) Secologanin synthase which Catalyzes the Oxidative Cleavage of Loganin into Secologanin is a Cytochrome P450 . Phytochem . 53 : 7-12. 15. Rodriguez, S., V. Compagnon, N.P. Crouch, B. St-Pierre, and V. De Luca. (2003) Jasmonate-induced Epoxidation of Tabersonine by a Cytochrome P-450 in Hairy Root Cultures of Catharanthus roseus. Phytochem . 64 : 401-409. 16. Schroder, G., E. Unterbusch, M. Kaltenbach, J. Schmidt, D. Strack, V. De Luca, and J. Schroder. (1999) Light-induced Cytochrome P450-dependent Enzyme in Indole Alkaloid Biosynthesis: Tabersonine 16-hydroxylase . FEBS Lett . 458 : 97-102. 17. Peebles, C.A.M., S.-B. Hong, S.I. Gibson, J.V. Shanks, and K.-Y. San. (2005) Transient Effects of Overexpressing Anthranilate Synthase α and β Subunits in Catharanthus roseus Hairy Roots . Biotechnol. Prog. 21 : 1572-1578. 18. Morgan, J.A. and J.V. Shanks. (1999) Inhibitor Studies of Tabersonine Metabolism in C. roseus Hairy Roots . Phytochem . 51 : 61-68. 19. Lange, B.M., T. Rujan, W. Martin, and R. Croteau. (2000) Isoprenoid Biosynthesis: The Evolution of Two Ancient and Distinct Pathways Across Genomes . PNAS . 97 (24): 13172-13177. 160

20. Kanehisa, M., M. Araki, S. Goto, M. Hattori, M. Hirakawa, M. Itoh, T. Katayama, S. Kawashima, S. Okuda, T. Tokimatsu, and Y. Yamanishi. (2008) KEGG for Linking Genomes to Life and the Environment . Nucleic Acids Res. 36 : D480-D484. 21. Kanehisa, M., S. Goto, M. Hattori, K.F. Aoki-Kinoshita, M. Itoh, S. Kawashima, T. Katayama, M. Araki, and M. Hirakawa. (2006) From Genomics to Chemical Genomics: New Developments in KEGG . Nucleic Acids Res. 34 : D354-D357. 22. Kanehisa, M. and S. Goto. (2000) KEGG: Kyoto Encyclopedia of Genes and Genomes . Nucleic Acids Res. 28 : 27-30. 23. Collu, G., N. Unver, A.M.G. Peltenburg-Looman, R. van der Heijden, R. Verpoorte, and J. Memelink. (2001) Geraniol 10-hydroxylase, a Cytochrome P450 Enzyme Involved in Terpenoid Indole Alkaloid Biosynthesis . FEBS Lett . 508 : 215-220. 24. Cardoso, M.I.L., A.H. Meijer, S. Rueb, J.Q. Machado, J. Memelink, and J.H. Hoge. (1997) A Promoter Region that Controls Basal and Elicitor-inducible Expression Levels of the NADPH:Cytochrome P450 Reductase Gene ( Cpr ) from Catharanthus roseus Binds Nuclear Factor GT-1. Mol Gen Genet . 256 (6): 674-681. 25. Murata, J., J. Roepke, H. Gordon, and V. De Luca. (2008) The Leaf Epidermome of Catharanthus roseus Reveals Its Biochemical Specialization . Plant Cell . 20 : 524-542. 26. Irmler, S., G. Schroder, B. St-Pierre, N.P. Crouch, M. Hotze, J. Schmidt, D. Strack, U. Matern, and J. Schroder. (2000) Indole Alkaloid Biosynthesis in Catharanthus roseus : New Enzyme Activities and Identification of Cytochrome P450 CYP72A1 as Secologanin Synthase . Plant J. 24 (6): 797-804. 27. Pasquali, G., O.J. Goddijn, A. de Waal, R. Verpoorte, R.A. Schilperoort, J.H. Hoge, and J. Memelink. (1992) Coordinated Regulation of Two Indole Alkaloid Biosynthetic Genes from Catharanthus roseus by Auxin and Elicitors . Plant Mol Biol . 18 (6): 1121-1131. 28. Geerlings, A., M.M.-L. Ibanez, J. Memelink, R. van der Heijden, and R. Verpoorte. (2000) Molecular Cloning and Analysis of Strictosidine β-D-Glucosidase, an Enzyme in Terpenoid Indole Alkaloid Biosynthesis in Catharanthus roseus. JBC . 275 (5): 3061-3056. 29. De Luca, V., J. Balsevich, R.T. Tyler, and W.G.W. Kurz. (1987) Characterization of a Novel N-methyltransferase (NMT) from Catharanthus roseus Plants. Detection of NMT and Other Enzymes of the Indole Alkaloid Biosynthetic Pathway in Different Cell Suspension Culture Systems . Plant Cell Rep . 6(6): 458-461. 30. Vazquez-Flota, F., E. De Carolis, A.-M. Alarco, and V. De Luca. (1997) Molecular Cloning and Characteristics of Desacetoxyvindoline-4-hydroxylase, a 2-oxyglutarate Dependent-dioxygenase Involved in the Biosynthesis of Vindoline in Catharanthus roseus (L.) G. Don . Plant Mol Biol . 34 : 935-948. 31. St-Pierre, B., P. Laflamme, A.-M. Alarco, and V. De Luca. (1998) The Terminal O- acetyltransferase Involved in Vindoline Biosynthesis Defines a New Class of Proteins Responsible for Coenzyme A-dependent Acyl Transferase . Plant J. 14 (6): 703-713. 32. O'Connor, S.E. and J.J. Maresh. (2006) Chemistry and Biology of Monoterpene Indole Alkaloid Biosynthesis . Nat. Prod. Rep. 23 : 532-547.

161

Chapter 8 - Metabolic Engineering of Catharanthus roseus Hairy Roots for

Terpenoid Indole Alkaloid Production under Light and Dark Conditions

Adapted from a paper published in the Proceedings of the 37 th Annual Biochemical

Engineering Symposium (37 : 39-51).

Guy W. Sander 1,4 , Susan I. Gibson 2,5 , Ka-Yiu San 3,5 , and Jacqueline V. Shanks 1,6

1Department of Chemical and Biological Engineering, Iowa State University, Ames, IA

2Department of Plant Biology, University of Minnesota, St. Paul, MN

3Department of Bioengineering, Rice University, Houston, TX

4Primary researcher and author

5Co-principal investigator

6Principal investigator and corresponding author

Abstract

The valuable antineoplastic alkaloids vincristine and vinblastine extracted from

Catharanthus roseus have seen significant research effort towards increasing their production. Extensive work has shed light on the complex biosynthetic pathways and the strict multilevel regulation that control metabolite levels and flux. Several enzymes in the later part of the pathway are also light-dependent and may be up- or down-regulated with light exposure. All of this complexity results in a challenging model for plant metabolic engineering.

This work characterizes metabolic engineering efforts of the terpenoid indole alkaloid biosynthetic pathway within hairy root cultures of C. roseus at three locations: the indole 162

alkaloid pathway entrance, the non-mevalonate/terpenoid alkaloid pathway entrance, and in the terpenoid indole alkaloid (TIA) pathway. The gene overexpression is controlled under a glucocorticoid-inducible promoter system and characterization is performed with metabolite measurements made 72 hours after gene induction. The transgenic lines were also light- adapted to investigate light-mediated regulation of the biosynthesis pathways. Results from this study reveal the levels of regulation in TIA synthesis and will guide further efforts in metabolic engineering.

Introduction

Plants produce a wide variety of secondary metabolites for purposes as varied as defense and reproduction. Many of these diverse compounds are of interest given their bioactivities, especially pharmacological activity. However problems lie in that secondary metabolites are generally produced in very small quantities (<1% DW) and many of these compounds are also too structurally complex to be chemically synthesized.

Extracts of Catharanthus roseus yield a wealth of chemical components, including terpenoid indole alkaloids (TIAs). Two of these components are the valuable anticancer alkaloids, vincristine and vinblastine. Other alkaloids yielded from root extracts such as ajmalicine and serpentine are used as anti-hypertensives [1].

C. roseus has long been a target of researchers trying to increase the production of its

TIAs. The alkaloid biosynthetic pathway in C. roseus is very complex and produces approximately 130 different alkaloids [2]. Biosynthetic reactions producing vincristine occur in five different subcellular compartments and three different cell types [3] and requires the participation of at least 35 intermediates and 30 enzymes [2]. Not all of the enzymes in the 163

pathway are known [4] and because of this, expression in bacterial and yeast systems cannot be used for full biosynthesis. Straight chemical synthesis is not possible given the chemical structure complexity and stereochemistry [4] (see Fig 8.1). These biosynthetic complexities along with strict regulatory control make engineering the TIA pathway challenging.

Although hairy root cultures of C. roseus do not produce vincristine and vinblastine, as these compounds are produced in the leaves, and the levels of alkaloids produced cannot economically compete with field-grown plants [5], the hairy root cultures provide a good environment for the investigation of metabolism, biosynthetic enzymes, control signaling, pathway bottlenecks. This knowledge aids in metabolic engineering where enzymes are specifically targeted for transgenic overexpression to result in higher yields.

TIAs are formed from the coalescence of the indole and terpenoid pathways (see Fig

8.2). Difficulty in engineering the indole pathway lies with the anthranilate synthase (AS) enzyme, a tetramer consisting of two α subunits and two β subunits, that is feedback- sensitive to both tryptophan and tryptamine. In effort to engineer increased alkaloid production, a hairy root line was developed using the expression of a feedback-resistant AS α subunit from Arabidopsis under the glucocorticoid-inducible promoter system along with the expression of an AS β subunit from Arabidopsis under the control of the constitutive CaMV

35S promoter [6]. This line demonstrated significant increases in the levels of tryptophan and tryptamine along with decreased lochnericine, hörhammericine, and tabersonine. The line also showed transient levels of TIAs in the 4 to 72 hour time period after induction in the late exponential growth phase. The levels of some alkaloids were did not change for up to 12 hours after induction, indicating that changes in metabolism are not instantaneous [6]. 164

Efforts to increase flux through the terpenoid pathway via 1-deoxy-D-xylulose 5- phosphate synthase (DXS), the first step towards terpenoid production, with DXS under the glucocorticoid-inducible promoter system, were also met with strict regulation, preventing significant increases in TIA levels [7]. In the DXS line, light proved to have a greater influence on metabolite levels than the induction of the enzyme, although the influence of light did not always lead to desired changes.

Another effort to increase TIA levels was through the TIA enzyme, tabersonine 16- hydroxylase (T16H), under the glucocorticoid-inducible promoter system [7]. The T16H line shows increases in TIAs under induction and light with induction.

We investigate the effect of light in this study because several of the enzymes involved in vindoline biosynthesis have shown light dependency. Tabersonine 16- hydroxylase (T16H), 2,3-dihydro-3-hydroxytabersonine-N-methyltransferase (NMT), desacetoxyvindoline 4-hydroxylase (D4H), and deacetylvindoline acetyltransferase (DAT) are light activated. T16H and DAT are transcriptionally regulated. D4H is under several levels of developmental and light-mediated regulation, as reviewed in [8, 9].

Materials and Methods

Culture Conditions

The hairy root cultures were grown in filter-sterilized (0.22 m filter, Nalgene) media containing 30 g/l sucrose (MP Biomedicals), half-strength Gamborg’s B5 salts (Sigma), and full-strength Gamborg’s vitamins (Sigma) with the pH adjusted to 5.7. Hairy root cultures are started with five, 5 cm long root tips in 50 ml of culture media in a 250-ml Erlenmeyer flask. The flask was stoppered with a foam plug (Jaece Industries). Dark grown cultures were maintained in incubator shakers at 26 °C and 100 rpm. Light-grown cultures were also 165

subjected to 24-hour fluorescent light. The hairy root cultures were subcultured at intervals of 14, 21, or 28 days depending on the growth characteristics of the hairy root line.

Subculturing was performed by cutting 5 root tips from a mature culture and transferring them to 50 ml of fresh media.

Induction of Catharanthus roseus Hairy Root Lines

The volume of the remaining culture media was measured by drawing the media up into a 50-ml pipet. The average media volume of the cultures to be induced was calculated.

Based on this average, the appropriate amount of a 5 mM dexamethasone stock in ethanol was added to the cultures. An equal amount of ethanol was added to the uninduced controls.

The EHIDXS-4-1 and EHIT16H-34-1 lines are induced with 3 M dexamethasone. The

AS αβ 1 line is induced with 0.2 M dexamethasone, which is an 80% induction as compared to 3 M dexamethasone [10, 11]. This is done to reduce browning.

Catharanthus roseus Hairy Root Lines

The generation of the AS αβ 1 line has been previously described [12]. This hairy root line expresses a feedback-resistant anthranilate synthase α subunit (AS α) from Arabidopsis under the control of a glucocorticoid-inducible promoter and an anthranilate synthase β subunit (AS β) from Arabidopsis under the control of the constitutive CaMV 35S promoter

[6].

The generation of the EHIDXS-4-1 line has been previously described [7]. This hairy root line expresses 1-deoxy-D-xylulose 5-phosphate synthase (DXS) from Arabidopsis under the control of a glucocorticoid-inducible promoter. 166

The generation of the EHIT16H-34-1 line has been previously described [7]. This hairy root line expresses tabersonine 16-hydroxylase (T16H) under the control of a glucocorticoid-inducible promoter.

Harvesting Hairy Root Cultures

(Corning), and weighed. The tubes were then frozen at -80 °C. Dry weight was determined after freeze drying. Tissue was ground to a fine powder using a mortar and pestle.

Alkaloid Extraction

About 50 mg of freeze-dried and ground hairy roots were added to a 50-ml centrifuge tube and extracted with 10 ml of methanol using a sonicating probe for 10 minutes while held on ice. The extracts were centrifuged at 4000 rpm for 12 minutes at 15 °C. The supernatant was removed and the biomass was extracted one more time in the same manner. The combined supernatants were passed through a 0.45 m nylon filter (25mm, PJ Colbert), dried on a nitrogen evaporator (Organomation), reconstituted in 2 ml of methanol, and passed through a 0.22 mm nylon filter (13mm, PJ Colbert) for HPLC analysis. Extracts were stored at -25 °C.

HPLC Analysis of Alkaloids

Twenty microliters of the alkaloid extract was injected into a Phenomenex Luna®

C18(2) HPLC column (250 x 4.6 mm) using two solvent systems. The HPLC system used was a Waters HPLC system consisting of two 510 pumps, a 717plus Autosampler, and a 996

Photo Diode Array (PDA) detector. To detect tryptophan and tryptamine, UV detection at 167

218 nm was used [13, 14]. Quantification was performed by comparison to standard curves.

For the first 12 minutes, a 15:85 mixture of MeCN:100 mM phosphoric acid (pH 2) was maintained at a flow rate of 1 mL/min. The column was then washed by ramping to an 85:15 mixture over 15 minutes. The flow was then returned to 15:85 and allowed to re- equilibrated.

For the detection of terpenoid indole alkaloids another solvent system was used. Data extracted at 254 nm were used to quantify ajmalicine, serpentine, catharanthine, and vindoline using standard curves. Data extracted at 329 nm were used to quantify tabersonine, hörhammericine, and lochnericine using retention time standards, LC-MS, and a comparison to a tabersonine standard curve [14, 15]. The protocol was adapted to accommodate a larger column diameter [16]. For the first 5 minutes, at a flow rate of 1 ml/min, the mobile phase was a 30:70 mixture of acetonitrile (MeCN):100 mM ammonium acetate (pH 7.3). The mobile phase was linearly ramped to 64:36 over the next 10 minutes and maintained at that ratio for 15 minutes. The flow rate was increased to 1.4 ml/min over 5 minutes. The ratio was then increased to 80:20 during the next 5 minutes and maintained for 15 minutes. The flow rate and mobile phase ratio were then returned to 1 ml/min and 30:70 and the column was allowed to re-equilibrate. Analysis was performed with Empower Pro software

(Waters).

Results

Effect of light adaptation in the AS αβ1 hairy root line

The hairy root culture overexpressing AS β and with inducible expression of AS α was adapted to a 24-hour photoperiod. The light-adapted AS αβ1 (LtAS αβ 1) line had been grown under constant light (24-36 mol m -2 s-1) for 9 culture cycles at the time of the 168

experiment. Comparing metabolite levels in the uninduced LtAS αβ 1 cultures to uninduced dark-grown AS αβ 1 (uninduced AS αβ 1) cultures 72 hours after receiving an ethanol control shows a shift from tryptamine to tryptophan in the indole pool, accounting for no overall change (see Fig 8.3a). There were increases in both corynanthe alkaloids, ajmalicine and serpentine, and no change with catharanthine. Hörhammericine showed some increase but that is offset by significant decreases in tabersonine and lochnericine, resulting in a decrease in the pool of these three aspidosperma metabolites and an overall decrease in TIA levels.

Effect of overexpression of AS β with induced overexpression of AS α

The AS αβ 1 hairy root culture overexpressing AS β and with inducible expression of

AS α was induced with 0.2 M dexamethasone. Metabolites were measured 72 hours after induction with dexamethasone or a control volume of ethanol. The induced AS αβ 1 cultures compared to the uninduced AS αβ 1 cultures had very significant increases in tryptophan and tryptamine of 86.6- and 8.l-fold, respectively (see Fig 8.3b). There was a 29.4-fold increase in the indole pool. Ajmalicine and serpentine both showed increases with the corynanthe pool increasing 1.4-fold. However the rest of the metabolites saw a decline in level.

Catharanthine decreased and the aspidosperma pool had a 11.1-fold decrease that includes a very large 48.9-fold decrease in tabersonine level down to 11 g/g Dry Weight (DW).

Despite the large increases in the indole pool, it did not translate down the pathway and the overall the TIA pool decreased 2.2-fold. 169

Effect of overexpression of AS β with induced overexpression of AS α and light-adapted growth

The LtAS αβ 1 hairy root culture overexpressing AS β and with inducible expression of AS α was induced with 0.2 M dexamethasone. Metabolites were measured 72 hours after induction with dexamethasone or a control volume of ethanol. The induced LtAS αβ 1 cultures compared to the uninduced LtAS αβ 1 cultures had very significant increases in tryptophan and tryptamine of 20.0- and 17.2-fold, respectively (see Fig 8.3c). Ajmalicine and serpentine both increased with the corynanthe pool increasing 1.3-fold as did catharanthine by 1.4-fold. There was a substantial decrease in the aspidosperma pool of 4.4- fold with tabersonine decreasing 22.7-fold down to 2.0 g/g DW. As a whole, the measured

TIA pool had a slight decrease of 1.1-fold.

Effect of light adaptation in the DXS hairy root line

The hairy root culture with inducible expression of DXS was adapted to a 24-hour photoperiod. The light-grown EHIDXS-4-1 (LtDXS) line had been grown in lighted conditions (24-36 mol m -2 s-1) for 14 culture cycles at the time of the experiment.

Tryptophan and tryptamine were only found in very small quantities. Comparing metabolite levels in the uninduced LtDXS cultures to uninduced dark-grown EHIDXS-4-1 (uninduced

DXS) cultures 72 hours after receiving an ethanol control shows an increase in the corynanthe pool (see Fig 8.4a). However all other measured alkaloids decreased substantially. Lochnericine levels decreased from 648 g/g DW to 112 g/g DW. The result was a 1.5-fold overall decrease of measured TIAs. 170

Effect of induced overexpression of DXS

The DXS hairy root culture with inducible expression of DXS was fully induced with

3 M dexamethasone. Metabolites were measured 72 hours after induction with dexamethasone or a control volume of ethanol. Tryptophan and tryptamine were only found in very small quantities. The induced DXS cultures compared to the uninduced DXS cultures showed increase in ajmalicine from 893 g/g DW to 1489 g/g DW along with a smaller increase in serpentine (see Fig 8.4b). Catharanthine showed a small increase. The increase in lochnericine was offset by significant decreases in tabersonine and hörhammericine resulting in a 1.2-fold decrease in the aspidosperma pool. Overall, there was a small 1.1-fold increase in TIAs measured.

Effect of induced overexpression of DXS and light-adapted growth

The LtDXS hairy root culture with inducible expression of DXS was fully induced with 3 M dexamethasone. Metabolites were measured 72 hours after induction with dexamethasone or a control volume of ethanol. The induced LtDXS cultures compared to the uninduced LtDXS cultures had small increases in ajmalicine, serpentine, and catharanthine (see Fig 8.4c). An increase in lochnericine was offset by a decrease in hörhammericine resulting in no change for the aspidosperma pool. Overall, there was a small

1.1-fold increase in TIAs measured.

Effect of light adaptation in the T16H hairy root line

The T16H hairy root culture with inducible expression of T16H was adapted to a 24- hour photoperiod. The light-grown EHIT16H-34-1 (LtT16H) line had been grown in lighted conditions (24-36 mol m -2 s-1) for 5 culture cycles at the time of the experiment.

Tryptophan and tryptamine were only found in very small quantities. Comparing metabolite 171

levels in the uninduced LtT16H cultures to uninduced dark-grown EHIT16H-34-1

(uninduced T16H) cultures 72 hours after receiving an ethanol control shows that tabersonine was the only TIA to show an increase (see Fig 8.5a). All other measured metabolites displayed some level of decrease, especially catharanthine, which decreased from 240 g/g

DW to 12.4 g/g DW. Overall there was a 2-fold decrease in TIAs measured.

Effect of induced overexpression of T16H

The T16H hairy root culture with inducible expression of T16H was fully induced with 3 M dexamethasone. Metabolites were measured 72 hours after induction with dexamethasone or a control volume of ethanol. Tryptophan and tryptamine were only found in very small quantities. The induced T16H cultures compared to the uninduced T16H cultures showed increases in ajmalicine and serpentine (see Fig 8.5b). Catharanthine showed no change. The decrease in lochnericine was offset by increases in tabersonine and hörhammericine resulting in no change in the aspidosperma pool. Overall, there was a small

1.1-fold increase in TIAs measured.

Effect of induced overexpression of T16H and light-adapted growth

The LtT16H hairy root culture with inducible expression of T16H was fully induced with 3 M dexamethasone. Metabolites were measured 72 hours after induction with dexamethasone or a control volume of ethanol. The induced LtT16H cultures compared to the uninduced LtT16H cultures had a small increase in ajmalicine that is offset by a decrease in serpentine, resulting in no change for the corynanthe pool (see Fig 8.5c). Catharanthine showed an increase, as did tabersonine and lochnericine. Hörhammericine decreased 1.9- fold from 275 g/g DW to 148 g/g DW. There was a 1.8-fold increase in the aspidosperma pool. Overall, there was a small 1.4-fold increase in TIAs measured. 172

Discussion

Effect of Light Adaptation

The effect of lighted growth on alkaloid levels was investigated because several TIA genes leading to vindoline synthesis have light-mediated regulation. Overall, light adaptation of the hairy root cultures had a negative effect on the levels of alkaloids measured. The uninduced LtAS αβ 1 line had shift from tryptamine to tryptophan, with no change to the indole alkaloid pool, compared to the uninduced AS αβ 1 cultures. The uninduced LtDXS and LtT16H lines both had only very small levels of tryptophan and tryptamine. The uninduced LtAS αβ1 and LtDXS lines showed increased levels of both ajmalicine and serpentine, similar to Bhadra el al . (1998) where the wild-type C. roseus hairy root line LBE-

6-1 was adapted to a 12-hour photoperiod [17, 18]. The uninduced LtT16H line had a substantial decrease in both these alkaloids. The aspidosperma pool levels were decreased in all three cases investigated here. If one of the alkaloids had an increase, it was significantly outweighed by the decrease of the other two. This was also similar to Bhadra et al . (1998) where there was a decrease in tabersonine and lochnericine levels and no change in hörhammericine levels [17]. Catharanthine varied from no change in LtAS αβ to a very large decrease in the LtT16H line.

Overall, light adaptation of these lines has negative consequences for alkaloid levels, with the exception of ajmalicine and serpentine. However, the decreases in the aspidosperma alkaloids may indicate a metabolite flux towards to vindoline or other alkaloids pools. Dark- grown C. roseus seedlings accumulate tabersonine whereas in seedlings transferred to a lighted environment after germination will direct tabersonine towards vindoline synthesis

[19]. 173

Effect of gene induction

The three C. roseus hairy root lines examined here have been metabolically engineered in effort to focus carbon flux towards the TIAs of interest. The AS αβ1 line is engineered to direct carbon flux through the indole pathway. Initial studies of this line demonstrated large increases in tryptophan and tryptamine upon induction [6]. This is also seen here but at 2-fold higher levels than previously reported. This is a result of the metabolite profile stabilizing over time [20]. Even though some of the metabolite levels have changed, the relative changes to metabolite levels made by the induction of the AS α gene are very similar. The very high amount of the indole alkaloids does not direct carbon towards the later parts of the pathway. Besides the increase in the corynanthe alkaloids, the rest of the TIAs are dramatically reduced.

The DXS line is engineered to direct carbon flux through the non-mevalonate pathway towards terpenoid synthesis. Precursor feeding studies on LBE-6-1 and AS αβ1 show increases in tabersonine and lochnericine, demonstrating the non-mevalonate and terpenoid pathways have possible bottlenecks for TIA production [11, 21]. The induction of

DXS increases levels of ajmalicine, serpentine, and catharanthine. Lochnericine increased but was offset by decreases in hörhammericine and tabersonine levels. This is similar to what was previously reported with DXS induction [7] but contrary to the precursor feeding studies [11, 21].

The T16H line is engineered to direct carbon flux towards vindoline synthesis. The induction of T16H causes a small increase in the corynanthe alkaloids and no change in catharanthine levels or the aspidosperma pool. These results are contrary to the previously reported data showing a significant decrease in aspidosperma alkaloids upon induction [7]. 174

Perhaps the change in the metabolite level response is due to the metabolite profile stabilizing over time [20].

There is a wide range of response seen from the metabolic engineering efforts presented here. The engineering of the indole pathway causes the accumulation of large amounts of indoles, but depletes the lower TIA biosynthetic pathway of metabolites. The engineering of the non-mevalonate pathway demonstrates increases in the upper TIA pathway with only small decreases to the lower pathway. The engineering of the lower biosynthetic pathway generally produced no significant changes to metabolite levels.

Effect of gene induction and light-adapted growth

The induced LtAS αβ 1 cultures performed similarly to the induced AS αβ 1 cultures, but with a less substantial, but still significant increase in tryptophan and tryptamine. The induced LtAS αβ 1 cultures compared to the uninduced LtAS αβ 1 cultures had an increase in corynanthe alkaloids and a large decrease in aspidosperma alkaloids, similar to the dark- grown, induced. One change is the increase in catharanthine levels compared to the decrease seen in the dark-grown, induced cultures.

The induced LtDXS cultures compared to the uninduced LtDXS cultures performed similarly to the induced DXS cultures compared to the uninduced DXS cultures. The level of

TIAs increased for the corynanthe and catharanthine pools and was even for the aspidosperma pool. This is the same as the DXS cultures except for tabersonine. Although the general changes that occur upon gene induction were similar for the LtDXS and DXS, the induced DXS cultures generally had higher levels of metabolites compared to induced

LtDXS cultures. 175

The induced LtT16H cultures compared to uninduced LtT16H cultures showed no change in the corynanthe pool. Increases are seen in catharanthine and the aspidosperma pool. These increases upon induction are countered by the significantly reduced levels of

TIAs in the LtT16H compared to T16H.

Conclusions

This work investigates the use of light adaptation, gene overexpression, and the combination of the two to see if alkaloid profiles of C. roseus hairy roots can be altered in a significant manner. The changes we are looking for are to use the combination of induced genes and light-adapted growth to help carbon flux through the pathway towards our alkaloids of interest. However, any changes we can make to the balance or level of metabolite pools can increase our knowledge of this complex pathway. The multiple levels of regulation that occur in the C. roseus system are of great hindrance in making substantial changes. Many times the alterations only cause the metabolites to shift within their respective alkaloid pools and find a new balance point. Changes in one alkaloid may cause changes in alkaloids several steps above or below in the biosynthesis pathway. The reduction of alkaloids with light adaptation or with gene induction could partially be explained by metabolites moving down the pathway towards vindoline, however the large reduction of TIAs seen in certain examples shown here point more towards layers of regulation preventing the accumulation of these terpenoid indole alkaloids.

The knowledge of the topography of the TIA biosynthetic pathway gained here will be used in metabolically engineering C. roseus hairy roots lines with multiple genes under induced control. 176

Acknowledgements

Funding was provided by the National Science Foundation (CBET-0729753 (JVS),

CBET-0729622 (K-YS), and CBET-0729625 (SIG)) and the Roy J. Carver Graduate

Research Training Fellowship in Molecular Biophysics (GWS). We acknowledge the W. M.

Keck Metabolomics Research Laboratory for acquisition of the LCMS data.

Figures

N N H H H3CO2C

H3CO OCOCH3

N CO CH H 2 3 O OH

Figure 8.1 The chemical structure of vincristine (Figure source:[22, 23, 24]).

177

Figure 8.2 Biosynthesis of terpenoid indole alkaloids in Catharanthus roseus . DXS , 1-deoxy-D-xylulose 5-phosphate synthase; DXR , 1-deoxy-D-xylulose 5-phosphate reductoisomerase; GPPS , geranyl pyrophosphate synthase; G10H , geraniol 10-hydroxylase; AS , anthranilate synthase; TDC , tryptophan decarboxylase; STR , strictosidine synthase; SGD , strictosidine β-D-glucosidase; T16H , tabersonine 16-hydroxylase; D4H , desacetoxyvindoline 4-hydroxylase; DAT , deacetylvindoline acetyltransferase. (Figure source: [6]) 178

a Catharanthine Even Even Shikimate Vinblastine Tryptophan Tryptamine Tabersonine Vindoline Pathway 1.9-fold 1.7-fold 12.3-fold Vincristine

Non- Ajmalicine Mevalonate Terpenoid 1.5-fold Lochnericine Horhammericine 4.6-fold 1.4-fold Pathway Pathway Serpentine 2.2-fold 1.7-fold Green – increase Red - decrease 1.6-fold 1.3-fold

b Catharanthine 29.4-fold 1.7-fold Shikimate Vinblastine Tryptophan Vindoline Tryptamine Tabersonine Vincristine Pathway 86.6-fold 8.1-fold 48.9-fold

Non- Ajmalicine Terpenoid Mevalonate 1.6-fold Lochnericine Horhammericine 9.1-fold 9.2-fold Pathway Pathway Serpentine 11.1-fold 1.1-fold

1.4-fold 2.2-fold

c Catharanthine 18.7-fold 1.4-fold Shikimate Vinblastine Tryptophan Tryptamine Tabersonine Vindoline Pathway 20-fold 17.2-fold 22.7-fold Vincristine

Non- Ajmalicine Mevalonate Terpenoid 1.5-fold Lochnericine Horhammericine 2.6-fold 6.0-fold Pathway Pathway Serpentine 4.7-fold 1.1-fold

1.3-fold 1.1-fold Figure 8.3 Effect of lighted growth and gene induction in AS αβ . (a) Comparison of light-grown, uninduced cultures to dark-grown, uninduced cultures. (b) Comparison of dark- grown, induced cultures to dark-grown, uninduced cultures. (c) Comparison of light-grown, induced cultures to light-grown, uninduced cultures.

179

a Catharanthine 2.2-fold Shikimate Vinblastine Tryptophan Tryptamine Tabersonine Vindoline Pathway 2.4-fold Vincristine

Non- Ajmalicine Mevalonate Terpenoid 1.1-fold Lochnericine Horhammericine 5.8-fold 2.5-fold Pathway Pathway Serpentine 3.1-fold 1.7-fold Green – increase Red - decrease 1.2-fold 1.5-fold

b Catharanthine 1.1-fold Shikimate Vinblastine Tryptophan Vindoline Tryptamine Tabersonine Vincristine Pathway 3-fold

Non- Ajmalicine Terpenoid Mevalonate 1.7-fold Lochnericine Horhammericine 1.5-fold 2.2-fold Pathway Pathway Serpentine 1.2-fold 1.1-fold

1.5-fold 1.1-fold

c Catharanthine 1.1-fold Shikimate Vinblastine Tryptophan Tryptamine Tabersonine Vindoline Pathway Even Vincristine

Non- Ajmalicine Mevalonate Terpenoid 1.2-fold Lochnericine Horhammericine 1.6-fold 1.3-fold Pathway Pathway Serpentine Even 1.2-fold

1.2-fold 1.1-fold

Figure 8.4 Effects of lighted growth and gene induction in DXS. (a) Comparison of light-grown, uninduced cultures to dark-grown, uninduced cultures. (b) Comparison of dark- grown, induced cultures to dark-grown, uninduced cultures. (c) Comparison of light-grown, induced cultures to light-grown, uninduced cultures.

180

a Catharanthine 19.3-fold Shikimate Vinblastine Tryptophan Tryptamine Tabersonine Vindoline Pathway 1.1-fold Vincristine

Non- Ajmalicine Mevalonate Terpenoid 2.5-fold Lochnericine Horhammericine 2.0-fold 1.6-fold Pathway Pathway Serpentine 1.7-fold 1.1-fold Green – increase Red - decrease 2.6-fold 2.0-fold

b Catharanthine Even Shikimate Vinblastine Tryptophan Vindoline Tryptamine Tabersonine Vincristine Pathway 1.2-fold

Non- Ajmalicine Terpenoid Mevalonate 1.2-fold Lochnericine Horhammericine 1.3-fold 1.9-fold Pathway Pathway Serpentine Even 1.2-fold

1.2-fold 1.1-fold

c Catharanthine 1.5-fold Shikimate Vinblastine Tryptophan Tryptamine Tabersonine Vindoline Pathway 2.7-fold Vincristine

Non- Ajmalicine Mevalonate Terpenoid 1.1-fold Lochnericine Horhammericine 2.4-fold 1.9-fold Pathway Pathway Serpentine 1.8-fold 1.2-fold

Even 1.4-fold

Figure 8.5 Effects of lighted growth and gene induction in T16H. (a) Comparison of light-grown, uninduced cultures to dark-grown, uninduced cultures. (b) Comparison of dark- grown, induced cultures to dark-grown, uninduced cultures. (c) Comparison of light-grown, induced cultures to light-grown, uninduced cultures.

References

1. Shanks, J.V., R. Bhadra, J. Morgan, S. Rijhwani, and S. Vani. (1998) Quantification of Metabolites in the Indole Alkaloid Pathways of Catharanthus roseus : Implications for Metabolic Engineering . Biotechnol. Bioeng. 58 (2 & 3): 333-338. 181

2. van der Heijden, R., D.I. Jacobs, W. Snoeijer, D. Hallard, and R. Verpoorte. (2004) The Catharanthus Alkaloids: Pharmacognosy and Biotechnology . Curr. Med. Chem. 11 (5): 607-628. 3. Facchini, P.J. and B. St-Pierre. (2005) Synthesis and trafficking of alkaloid biosynthesis enzymes . Curr Opin Plant Biol . 8: 657-666. 4. Pasquali, G., D.D. Porto, and A.G. Fett-Neto. (2006) Metabolic Engineering of Cell Cultures Versus Whole Plant Complexity in Production of Bioactive Monoterpene Indole Alkaloids: Recent Progress Related to an Old Dilemma . J. Biosci. Bioeng. 101 (4): 287-296. 5. Payne, G.F., V. Bringi, C.L. Prince, and M.L. Shuler. (1992) The Quest for Commercial Production of Chemicals from Plant Cell Culture, in Plant Cell and Tissue Culture in Liquid Systems : 2-10. John Wiley & Sons, Inc.: New York. 6. Peebles, C.A.M., S.-B. Hong, S.I. Gibson, J.V. Shanks, and K.-Y. San. (2005) Transient Effects of Overexpressing Anthranilate Synthase α and β Subunits in Catharanthus roseus Hairy Roots . Biotechnol. Prog. 21 : 1572-1578. 7. Hughes, E.H. (2003) Metabolic Engineering of Catharanthus roseus Hairy Roots Using an Inducible Promoter System . Rice University: Houston, TX. 8. Facchini, P.J. (2001) Alkaloid Biosynthesis in Plants: Biochemistry, Cell Biology, Molecular Regulation, and Metabolic Engineering Applications . Annu. Rev. Plant Physiol. Plant Mol. Biol. 52 : 29-66. 9. Facchini, P.J., D.A. Bird, B.P. MacLeod, S.-U. Park, and N. Samanani. (2003) Multiple Levels of Control in the Regulation of Alkaloid Biosynthesis . Rec Adv Phytochem . 37 : 143-180. 10. Hughes, E.H., S.-B. Hong, J.V. Shanks, K.-Y. San, and S.I. Gibson. (2002) Characterization of an Inducible Promoter System in Catharanthus roseus Hairy Roots . Biotechnol. Prog. 18 : 1183-1186. 11. Peebles, C.A.M., S.-B. Hong, S.I. Gibson, J.V. Shanks, and K.-Y. San. (2006) Effects of Terpenoid Precursor Feeding on Catharanthus roseus Hairy Roots Over- Expressing the Alpha or the Alpha and Beta Subunits of Anthranilate Synthase . Biotechnol. Bioeng. 93 (3): 534-540. 12. Hong, S.-B., C.A.M. Peebles, J.V. Shanks, K.-Y. San, and S.I. Gibson. (2006) Expression of the Arabidopsis Feedback-insensitive Anthranilate Synthase Holoenzyme and Tryptophan Decarboxylase Genes in Catharanthus roseus Hairy Roots . J. Biotechnol. 122 : 28-38. 13. Tikhomiroff, C. and M. Jolicoeur. (2002) Screening of Catharanthus roseus Secondary Metabolites by High-Performance Liquid Chromatography . J Chrom A . 955 : 87-93. 14. Hughes, E.H., S.-B. Hong, S.I. Gibson, J.V. Shanks, and K.-Y. San. (2004) Expression of a Feedback-resistant Anthranilate Synthase in Catharanthus roseus Hairy Roots Provides Evidence for Tight Regulation of Terpenoid Indole Alkaloid Levels . Biotechnol. Bioeng. 86 (6): 718-727. 15. Morgan, J.A., C.S. Barney, A.H. Penn, and J.V. Shanks. (2000) Effects of Buffered Media Upon Growth and Alkaloid Production of Catharanthus roseus Hairy Roots . Appl. Microbiol. Biotechnol. 53 : 262-265. 182

16. Peebles, C.A.M., J.V. Shanks, and K.-Y. San. (2009) Transcriptional Response of the Terpenoid Indole Alkaloid Pathway to the Overexpression of ORCA3 Along with Jasmonic Acid Elicitation of Catharanthus roseus Hairy Roots Over Time . Met. Eng. 11 : 76-86. 17. Bhadra, R., J.A. Morgan, and J.V. Shanks. (1998) Transient Studies of Light-Adapted Cultures of Hairy Roots of Catharanthus roseus : Growth and Indole Alkaloid Accumulation . Biotechnol. Bioeng. 60 (6): 670-678. 18. Bhadra, R., S. Vani, and J.V. Shanks. (1993) Production of Indole Alkaloids by Selected Hairy Root Lines of Catharanthus roseus. Biotechnol. Bioeng. 41 (5): 581- 592. 19. Balsevich, J., V. DeLuca, and W.G.W. Kurz. (1986) Altered Alkaloid Pattern in Dark Grown Seedlings of Catharanthus roseus . The Isolation and Characterization of 4- desacetoxyvindoline: A Novel Indole Alkaloid and Proposed Precursor of Vindoline . Heterocycles . 24 (9): 2415-2421. 20. Peebles, C.A.M., G.W. Sander, M. Li, J.V. Shanks, and K.-Y. San. (2009) Five Year Maintenance of the Inducible Expression of Anthranilate Synthase in Catharanthus roseus Hairy Roots . Biotechnol. Bioeng. 102 (5): 1521-1525. 21. Hong, S.-B., E.H. Hughes, J.V. Shanks, K.-Y. San, and S.I. Gibson. (2003) Role of the Non-Mevalonate Pathway in Indole Alkaloid Production by Catharanthus roseus Hairy Roots . Biotechnol. Prog. 19 : 1105-1108. 22. Kanehisa, M. and S. Goto. (2000) KEGG: Kyoto Encyclopedia of Genes and Genomes . Nucleic Acids Res. 28 : 27-30. 23. Kanehisa, M., S. Goto, M. Hattori, K.F. Aoki-Kinoshita, M. Itoh, S. Kawashima, T. Katayama, M. Araki, and M. Hirakawa. (2006) From Genomics to Chemical Genomics: New Developments in KEGG . Nucleic Acids Res. 34 : D354-D357. 24. Kanehisa, M., M. Araki, S. Goto, M. Hattori, M. Hirakawa, M. Itoh, T. Katayama, S. Kawashima, S. Okuda, T. Tokimatsu, and Y. Yamanishi. (2008) KEGG for Linking Genomes to Life and the Environment . Nucleic Acids Res. 36 : D480-D484.

183

Chapter 9 – Proof of Concept of Metabolic Flux Analysis of Catharanthus roseus Hairy Roots Expressing an Inducible Feedback-resistant

Anthranilate Synthase ααα subunit by using Biosynthetically Directed

Fractional 13 C-labeling and Bondomer Balancing with 13 C-labeling

Introduced at the Time of Gene Induction

This chapter presents preliminary results as a proof of concept.

Guy W. Sander 1,4 , Susan I. Gibson 2,5 , Ka-Yiu San 3,5 , and Jacqueline V. Shanks 1,6

1Department of Chemical and Biological Engineering, Iowa State University, Ames, IA

2Department of Plant Biology, University of Minnesota, St. Paul, MN

3Department of Bioengineering, Rice University, Houston, TX

4Primary researcher and author

5Co-principal investigator

6Principal investigator and corresponding author

Abstract

The influence of the overproduction of secondary metabolites on central carbon metabolism is an important aspect to consider with metabolic engineering. This work presents preliminary results as a proof of concept for a method to introduce 13 C-labeling at the time of gene induction. This allows the creation of metabolic flux maps of central carbon metabolism before and after the gene has been induced. The study is performed with a

Catharanthus roseus hairy root line with glucocorticoid-inducible overexpression of a feedback-resistant anthranilate synthase (AS) α subunit from Arabidopsis . The 184

overexpression of AS α causes large increases in the levels of tryptophan and tryptamine, potentially straining central carbon metabolism.

Introduction

This work looks to expand previous work with 13 C metabolic flux analysis (MFA) [1] and investigate the changes that occur in the metabolic fluxes of central carbon metabolism when a gene has been overexpressed. Central carbon metabolism provides all the precursors for secondary metabolites. For successful overproduction of these downstream products, upstream pathways will need to be engineered to supply enough precursors. An example of this is in Farmer and Liao (2001) where the pyruvate node is engineered to direct carbon flux towards the heterologous overproduction of lycopene in Escherichia coli [2].

Methods have been developed for creating metabolic flux maps from 13 C cultures [1], but to facilitate the investigation of an inducible system, these methods had to be expanded.

In order to perform the 13 C MFA we developed an experimental scheme to introduce 13 C label at the time of gene induction without significantly altering the level of sugars, vitamins, salts, or other extracellular metabolites. The work is a proof of concept that use of this method allows investigation of the effects of the overexpression of a feedback-resistant anthranilate synthase α subunit (AS α) from Arabidopsis and subsequent tryptophan and tryptamine overproduction on metabolic fluxes of central carbon metabolism, before and after the AS α gene is expressed. The influence of the overexpressed AS α gene is significant because a previous study showed an increase in tryptophan from below detection limits to

1700 g/g DW and an increase in tryptamine from 81 to 350 g/g DW [3]. This substantial change in carbon flux likely will alter primary metabolism. 185

Materials and Methods

Chemicals

Dexamethasone (Sigma) was dissolved in ethanol (Pharmco-Aaper) and added the culture media. The phosphate buffer used in protein extraction and dialysis was ACS grade

(Fisher Scientific). Growth media was prepared with sucrose (MP Biomedicals), Gamborg’s

B5 salts (Sigma), and Gamborg’s vitamins (Sigma). Labeled growth media contained U-

13 C12 labeled sucrose (Isotec). Protein was hydrolyzed in hydrochloric acid (Pierce).

Culture Conditions

Induction of Catharanthus roseus Hairy Root Line

The volume of the remaining culture media was measured by drawing the media up into a 50-ml pipet (Corning). The average media volume of the cultures to be induced was calculated. Based on this average, the appropriate amount of a 5 mM dexamethasone stock in ethanol was added to the cultures to a final amount of 3 M dexamethasone. An equal amount of ethanol was added to the uninduced controls. 186

Experimental scheme to introduce 13 C label at the time of induction

Two sets of transgenic hairy roots containing a gene with inducible expression are grown. One set is grown in naturally abundant media and the other is grown in media where

13 5% of the sucrose is U- C12 labeled sucrose. The remaining sugar is naturally labeled. The hairy roots are grown in their respective media until they reach the late exponential growth phase (21 days). At this time, the hairy roots grown in the labeled media are harvested. The hairy roots grown in the normal media are then transferred to the remaining labeled media

(Figure 9.1). If the culture is going to be induced, then the appropriate amount of dexamethasone in ethanol is added. Uninduced cultures are given a similar volume of ethanol. The hairy roots continue to grow and now incorporate the sucrose label. The hairy root cultures are grown for 3 or 6 more days and then are harvested. The protein extracted from the harvested hairy roots is hydrolyzed and analyzed using 2-D NMR.

Catharanthus roseus Hairy Root Line

The generation of the EHIASA-1 line has been previously described [4]. This hairy root line expresses a feedback-resistant AS α subunit from Arabidopsis under the control of a glucocorticoid-inducible promoter.

Harvesting Hairy Root Cultures

(Corning), and weighed. The tubes were then frozen at -80 °C. Dry weight was determined after freeze drying (Labconco). Tissue was ground to a fine powder using a mortar and pestle. 187

The remaining growth media in the shake flask was quantified by drawing it up into a serological pipette (Corning). A sample of the media was put into a 15-ml centrifuge tube

(Corning) and frozen at -80 °C.

Protein Extraction

Protein was extracted from up to 100 mg of freeze-dried and ground hairy roots with

1 ml of 200 mM phosphate buffer (pH 7.2) held on ice for 15 minutes in a microcentrifuge tube. The supernatant was drawn off after centrifugation at 8 °C and full rotor speed for 15 minutes, and placed in a tared vial. The volume of supernatant was determined gravimetrically. The extraction was repeated four times and the combined supernatant was assayed for protein using a standard Bradford test (Pierce).

Protein Dialysis

Supernatant from the protein extraction was concentrated by freeze drying and then reconstituted in 6 ml of deionized water. The protein solution was injected into 12 ml Slide-

A-Lyser 2,000 MWCO Dialysis Cassettes (Pierce). The sample was first dialyzed in 200 mM phosphate buffer (pH 7.2) for 2 hours. The buffer was then changed to 10 mM phosphate buffer (pH 7.2) and dialyzed for 2 hours. The buffer was changed again and the sample was allowed to dialyze for 12 hours. The dialyzed protein sample was then freeze dried in preparation for protein hydrolysis.

Protein Hydrolysis

Protein hydrolysis was performed in hydrolysis tubes (Pierce). The protein extract was freeze dried and reconstituted in 1 ml of deionized water and added to the hydrolysis tube. To hydrolyze the protein, 6 N hydrochloric acid (Pierce) was added to the hydrolysis tube in the ratio of 1 ml 6 N HCl: 1600 g of protein. To remove oxygen from the hydrolysis 188

tube, the tube was evacuated of air by vacuum, vortexed to aid in degassing, flushed with nitrogen, and evacuated again. This was repeated three to four times to ensure efficient removal of oxygen. The evacuated tubes were placed in a heating block for 4 hours at

145 °C. The acid in the hydrolysate was evaporated in a Rapidvap evaporator (Labconco).

The hydrolyzed protein was reconstituted in 2 ml of deionized water and a small sample was analyzed for amino acids by HPLC (Applied Biosystems, ISU Protein Facility). The remaining protein was freeze dried and reconstituted in deuterium oxide for NMR analysis

(ISU Biomolecular NMR Facility).

HPLC Analysis of Sugars

Remaining culture media was passed through a 0.22 m nylon filter (13 mm, PJ

Colbert) for HPLC analysis. Twenty-five microliters of culture media was injected into a

BioRad Aminex® HPX-87H Organic Acid Analysis Column (300 x 7.8 mm). The HPLC system was a Waters system consisting of a 1525 Binary pump, a 717plus Autosampler, and a 2410 Refractive Index (RI) detector. The mobile phase of 5 mM sulfuric acid was maintained at 0.6 ml/min for 20 minutes. Sucrose, glucose, and fructose were quantified by comparison to standard curves. Analysis was performed with Empower Pro software

(Waters).

Preliminary Results

This work is a proof of concept to investigate the effects of the overproduction of tryptophan and tryptamine on the metabolic fluxes in central carbon metabolism using a C. roseus hairy root line containing a feedback-resistant ASα subunit under the control of a glucocorticoid-inducible promoter. The addition of a dexamethasone, a glucocorticoid, in the late exponential phase induces gene expression. 189

13 Using a mixture of uniformly labeled sucrose (U- C12 sucrose) and naturally abundant sucrose, use of the labeling patterns in amino acids as resolved by NMR can determine the flux of carbon through primary metabolic pathways. In order to create

13 metabolic flux maps describing the changes in central carbon metabolism, the U- C12 sucrose needs to be introduced at the time of induction. Simply adding labeled sucrose is not acceptable because the altered sugar level will affect metabolism. We devised method that allows us to introduce labeled sucrose without significantly altering the levels of sugars, salts, vitamins, or excreted metabolites.

Development of experimental scheme to introduce 13 C label at the time of induction

As described in Materials and Methods, the biomass transfer protocol involves growing two sets of hairy roots. One set is grown in naturally abundant media and the other

13 in media where 5% of the sucrose has been replaced with U- C12 labeled sucrose. The roots are grown to the late exponential phase (21 days) where the labeled roots are harvested and analyzed by NMR. The roots grown in the normal media are transferred to the remaining labeled media. Half of these transferred cultures are induced and the other half are uninduced. If the culture is going to be induced, the appropriate amount of dexamethasone dissolved in ethanol is added. Uninduced cultures are given a similar volume of ethanol.

Assuming that the hairy root cultures have grown similarly, the amount of nutritive elements remaining in the media are comparable.

The hairy roots transferred to the labeled media continue to grow and now incorporate the sucrose label. The culture is allowed to grow for 3 or 6 more days and then is harvested and analyzed by NMR. As a proof of concept, this method allows us to create metabolic flux maps before induction, after induction, and with no induction. These maps 190

will help us to see how altering metabolism with gene overexpression affects upstream central carbon metabolism. Figure 9.1 visually depicts this biomass transfer protocol.

A growth study (Figure 9.2) was performed to see if the biomass transfer protocol had a significant effect on growth. At six days after transferring, the uninduced/transferred, ethanol control/not transferred, and ethanol control/transferred cultures were not significantly different than the uninduced/not transferred culture. The induced cultures were significantly different (induced/not transferred and induced/transferred). This is expected as the overexpression diverts cellular duties from growth to metabolite production. Data was analyzed using the Student’s t-test ( α<0.05).

A dialysis protocol was developed to desalt the protein extracts. Because of the low extractable protein content of C. roseus hairy roots (3-4%), biomass samples are combined to meet the minimum requirements for amino acid concentration in the NMR sample. When the

30+ ml of extraction buffer was concentrated to 0.5 ml for the NMR sample, precipitates were formed. The dialysis protocol was developed to remove the salts so the NMR sample would be free of solids.

Metabolic flux maps of hairy root line with induced expression of AS α

Using the biomass transfer protocol, a study was performed to compare the metabolic fluxes of central carbon metabolism in hairy root cultures with inducible overexpression of a tryptophan feedback-resistant AS α subunit from Arabidopsis . As a proof of concept, the biomass transfer protocol allows the comparison of central carbon metabolism in induced and uninduced hairy root cultures.

Two set of the EHIASA-1 hairy root line with glucocorticoid-inducible expression of feedback-resistant AS α were grown to the late exponential phase (21 days). At this time 191

point, roots grown in the labeled media were harvested and the roots grown in normal media were transferred into the remaining labeled media per the biomass transfer protocol. Half of the cultures received the dexamethasone inducer dissolved in ethanol. The other half received the same volume of ethanol. The cultures were then allowed to grow and incorporate the labeled media into their biomass for 3 or 6 days, at which time they were harvested. The samples that were collected are as follows:

• Not transferred, Not induced, 21-day old cultures

• Transferred, Not induced, 24-day old cultures

• Transferred, Induced, 24-day old cultures

• Transferred, Not induced, 27-day old cultures

• Transferred, Induced, 27-day old cultures

• Not Transferred, Not induced, 27-day old cultures

These samples will allows us to create metabolic flux maps before induction, after induction, and with no induction, at two different time points after induction. Enough samples were collected to have biological replicates of the metabolic flux maps.

The harvested biomass was freeze-dried and ground. The protein was extracted with phosphate buffer and then concentrated by freeze-drying. The reconstituted extract was desalted by dialysis, concentrated, acid hydrolyzed, and prepared for NMR analysis. The 2-

D NMR [ 13 C, 1H] heteronuclear single quantum correlation (HSQC) spectrum from a transferred, induced, 27-day old culture is shown in Figure 9.3 as a proof of concept. Data were collected on a Bruker Avance DRX 500 MHz NMR spectrometer at the ISU

Biomolecular NMR Facility. 192

Data collected from the NMR analysis of the hydrolyzed protein from each sample will be processed and information about 13 C label incorporation into the amino acids will be quantified. This data along with other measurements, such as sugar uptake rate, along with the reaction network of central carbon metabolism in C. roseus are input to the NMR2FLUX computer program [1, 5, 6] to develop the metabolic flux maps similar to Figure 9.4.

Acknowledgements

Thanks to Vidya Iyer for help in rendering the HSQC spectrum in Figure 9.3. NMR data was collected at the ISU Biomolecular NMR Facility with the help of Bruce Fulton.

Funding was provided by the National Science Foundation (CBET-0729753 (JVS), CBET-

0729622 (K-YS), and CBET-0729625 (SIG)) and the Roy J. Carver Graduate Research

Training Fellowship in Molecular Biophysics (GWS). 193

Figures

Figure 9.1 Biomass Transfer Protocol for Catharanthus roseus hairy roots. When the cultures reach the late exponential phase (21 days), the labeled cultures are harvested and the biomass from the unlabeled cultures is transferred to the remaining media of the labeled culture. The inducer in ethanol is added and the cultures are grown on the labeled media for 3 or 6 days before harvesting. For the control cultures a similar volume of ethanol is added, and the cultures are grown on the labeled media for 3 or 6 days before harvesting. 194

0.6

0.5

0.4 * * 0.3

0.2 Dry Weight (g)

0.1

0 6 days after induction Uninduced/Not Transferred Uninduced/Transferred Induced/Not Transferred Induced, Transferred Ethanol Control/Not Transferred Ethanol Control/Transferred

Figure 9.2 Growth Study of Biomass Transfer Protocol. Transferred cultures harvested six days after induction were not significantly different than cultures that were not transferred. Cultures that were induced (both transferred and not transferred) had significantly different growth ( α = 0.05). (n=5) 195

Ala α Asp α

Leu α Ile δ Glx α

Ile γ2 Thr α Ala β

Val γ2 Val γ1

Thr γ2 Pro α Ser β

Leu δ2 Leu δ1 Pro γ Lys γ

Glu β Ile γ1

Thr β Lys δ LVA #2

Lys β

C frequency (ppm) frequency C Glu γ LVA #5 13

Asp β Tyr β Phe β

LVA #3 Lys ε Gly α Arg α

Pro δ

1H frequency (ppm)

196

Figure 9.3 2-D NMR [ 13 C, 1H] HSQC spectrum of Catharanthus roseus hairy root protein hydrolysate. The hydrolyzed protein was isolated from C. roseus hairy roots cultured on normal media for 21 days and then 13 transferred to the remaining media of another culture grown on 5% U- C12 sucrose for 21 days. The transferred hairy roots were then induced with 3 M of dexamethasone and harvested after 6 more days (day 27). Circled peaks represent carbon atoms of hydrosylate constituents such as proteinogenic amino acids and levulinic acid. ______197

198

Figure 9.4 Flux map of primary and intermediate metabolism in C. roseus hairy roots grown on (5% U–13 C) sucrose. Intracellular metabolites are shown in white ovals, and gray ovals show sink metabolites (e.g. proteinogenic amino acids, polysaccharides) that are components of biomass. Metabolic pathways are color-coded as follows: dark red (glycolysis and sucrose metabolism), pale blue (pentose phosphate pathway), orange (TCA cycle), blue-gray (pyruvate dehydrogenase link), mauve (anaplerotic fluxes), dark yellow (glyoxylate shunt), green (glutamate metabolism, GABA shunt, and associated intercompartmental transport fluxes), gray (fluxes towards biomass synthesis), and black (all intercompartmental transport fluxes except those involved in Gln metabolism and GABA shunt). F6P and T3P appear at two different locations each in the cytosol and the plastid to reduce intersections of lines. Each flux is assigned a short name based on the name of the gene encoding one of the metabolic reactions represented by it. Intracellular metabolites and fluxes with a superscript are located in specific subcellular compartments: c (cytosol), p (plastid), m (mitochondrion). If a flux is has no superscript, its compartmentation could not be unambiguously determined (such as gap , eno and pyk , and some fluxes toward biosynthesis). Intracellular metabolite abbreviations: Suc (sucrose), G6P (glucose-6-phosphate), F6P (fructose- 6-phosphate), T3P (triose-3-phosphate), P5P (pentose-5-phosphate), S7P (sedoheptulose-7-phosphate), E4P (erythrose-4-phosphate), 3PG (3-phosphoglycerate), PEP (phospho enol pyruvate), Pyr (pyruvate), acetCoA (acetyl CoA), iCit (isocitrate), aKG ( α-ketoglutarate), Scn (succinate), Mal (malate), OAA (oxaloacetate), GABA ( γ-aminobutyric acid), SSA (succinic semi-aldehyde), GOx (glyoxylate). Sink metabolite abbreviations: PSac (glucose polysaccharides/ β-glucans), Nuc (carbon skeleton of nucleotides), Sta (starch). Asp and Asn are denoted together as Asx. Glu and Gln are denoted together as Glx. (Figure and caption source: [1]) ______

References

1. Sriram, G., D.B. Fulton, and J.V. Shanks. (2007) Flux Quantification in Central Carbon Metabolism of Catharanthus roseus Hairy Roots by Using 13 C Labeling and Comprehensive Bondomer Balancing . Phytochem . 68 : 2243-2257. 2. Farmer, W.R. and J.C. Liao. (2001) Precursor Balancing for Metabolic Engineering of Lycopene Production in Escherichia coli. Biotechnol. Prog. 17 (57-61). 3. Hong, S.-B., C.A.M. Peebles, J.V. Shanks, K.-Y. San, and S.I. Gibson. (2006) Expression of the Arabidopsis Feedback-insensitive Anthranilate Synthase Holoenzyme and Tryptophan Decarboxylase Genes in Catharanthus roseus Hairy Roots . J. Biotechnol. 122 : 28-38. 4. Hughes, E.H., S.-B. Hong, S.I. Gibson, J.V. Shanks, and K.-Y. San. (2004) Expression of a Feedback-resistant Anthranilate Synthase in Catharanthus roseus Hairy Roots Provides Evidence for Tight Regulation of Terpenoid Indole Alkaloid Levels . Biotechnol. Bioeng. 86 (6): 718-727. 5. Sriram, G. (2004) Flux Analysis in Central Carbon Metabolism in Plants: 13 C NMR Experiments and Analysis . Iowa State University: Ames, IA. 6. Sriram, G., D.B. Fulton, V.V. Iyer, J.M. Peterson, R. Zhou, M.E. Westgate, M.H. Spalding, and J.V. Shanks. (2004) Quantification of Compartmented Metabolic Fluxes in Developing Soybean Embryos by Employing Biosynthetically Directed Fractional 13 C Labeling, Two-Dimensional [ 13 C, 1H] Nuclear Magnetic Resonance, and Comprehensive Isotopomer Balancing . Plant Phys. 136 : 3043-3057.

199

Chapter 10 - Conclusions, Global Perspectives, and Future Directions

Conclusions

The terpenoid indole alkaloid (TIA) biosynthetic pathways in Catharanthus roseus are a useful system for studying the complexities of secondary metabolism. Secondary metabolism is diverse in both the alkaloids it produces and the regulatory networks that control it. Elucidating the nature of the regulatory systems often reveals additional layers of intricacy. The octadecanoid-responsive Catharanthus AP2-domain 3 (ORCA3) is a transcriptional regulator of several biosynthetic TIA genes. ORCA3 expression can be elicited by methyl jasmonic acid (MeJA); however, more genes are regulated in this case than if ORCA3 expression was induced by itself. This includes cytochrome P-450 reductase

(CPR) that is one of the regulators for another gene, geraniol 10-hydroxylase (G10H). Also, the influence of ORCA3 is dependent on the culture system, whether seedlings, cell cultures, or hairy root cultures of C. roseus [1]. Therefore, if a regulation pathway is elucidated, that control may only be exerted under specific conditions.

Light is a known regulator of the genes in the pathway from tabersonine to vindoline, as reviewed in Facchini (2001) and Facchini et al. (2003) [2, 3]. Previously, decreases in tabersonine have been seen in wild-type hairy roots adapted to a 12-hour photoperiod [4], and was seen in the ASAB-1 and EHIDXS-4-1 lines adapted to a 24-hour photoperiod. The

EHIT16H-34-1 line had similar tabersonine levels in dark- and light-grown cultures. Light does not consistently affect the levels of tabersonine or the levels of the other aspidosperma alkaloids, lochnericine and hörhammericine.

The effect of light also reaches beyond the genes with exclusive expression in plant aerials. The ASAB-1 and EHIDXS-4-1 lines had small increases in ajmalicine and larger 200

increases in serpentine. Bhadra et al. (1998) also had an increase in ajmalicine and serpentine in wild-type hairy roots. The EHIT16H-34-1 line had decreases in both these

TIAs. The effect of light also does not have a consistent affect on the other metabolites.

Some increase in one line and decrease in another, or vise versa. Some changes are baseline level shifts in one line and a change in trend in another. Light-adaptation increased flux out of the TIA pathways, as determined by stoichiometric model, for the ASAB-1 and EHIDXS-

4-1 lines, but it was decreased in the EHIT16H-34-1 line. Although light definitely has a significant effect on the levels and fluxes of metabolites in C. roseus hairy roots, the mechanisms by which it affects the cultures remains elusive.

Attempts to overcome the regulatory bottlenecks in C. roseus hairy roots were directed from three areas in the biosynthetic network: the indole branch, the non-mevalonate- terpenoid pathway, and in the TIA pathway leading to vindoline. Additional metabolites were profiled to aid in elucidating these regulation mechanisms. Upon induction of these genes some positive effects were seen, such as increased levels of tryptophan and tryptamine in ASAB-1 and increased levels of loganin in EHIDXS-4-1. Some negative effects were also seen, such as the depletion of the aspidosperma pool in ASAB-1. EHIT16H-34-1 had decreasing levels of tabersonine but then an unknown regulation mechanism reversed the tabersonine consumption. Metabolic engineering efforts target key enzymes believed to regulatory holdups in biosynthesis. Single gene overexpression to overcome these regulatory points is often met with another point of regulation. Multiple gene overexpression has shown promise, where in G10H/DXS-21 the overexpression of two genes along the same pathway saw increased TIAs and in ASA/DXS-2 where overexpression of genes in parallel pathways saw significant increases of the key aspidosperma TIAs. 201

The fluxes of biosynthetic reactions, calculated as minimum total flux productivities

(MTFPs) by a stoichiometric model, demonstrated that making changes to how the hairy root cultures are regulated can have significant effects on the turnover of metabolites. Whether or not the regulatory effect was positive or negative, the notion of metabolite turnover is of great importance. Secondary metabolites are often thought of as endpoints in a biosynthetic network as enzymes in the pathways perform irreversible biosynthetic steps. Analysis of the metabolite fluxes reveals that these pathways are not dead ends. Decreases in some metabolite levels are not correlated with an increase in another measured metabolite. There also was no appearance of new peaks in the HPLC chromatograms to indicate new metabolites similar to the consumed metabolites. Preliminary results from alkaloid extraction of remaining growth media reveal the metabolites are not being exported from the cell. These results suggest that metabolites are being funneled into degradation pathways.

The stoichiometric model reveals that metabolite turnover under normal growth conditions and that altering regulation by inducing gene overexpression can lead to the degradation of large amounts of metabolites. The elucidation of these metabolite degradation pathways will be an important achievement towards metabolic engineering efforts of secondary metabolism in C. roseus . Preventing flux out of the TIA pathways is just as important as increasing flux towards the TIA pathways. In concert, these strategies have a great potential for increasing metabolite levels.

Global Perspectives

With data available for numerous different genetic lines of C. roseus , observations can be made about how the lines did or did not perform similarly. These observations can be used to infer regulation patterns and levels of control on the TIA pathways. 202

Bhadra et al. (1998) had an increase in ajmalicine and serpentine in wild-type hairy roots adapted to a 12-hour photoperiod. The ASAB-1 and EHIDXS-4-1 lines also had small increases in ajmalicine and larger increases in serpentine comparing the uninduced light- grown roots (24-hour photoperiod) to uninduced dark-grown roots. However the EHIT16H-

34-1 line had decreases in both these TIAs, especially ajmalicine, in the light-adapted roots.

This indicates that the influence light has on the levels of ajmalicine and serpentine is not directly associated with light, but on how light affects other parts of the pathway.

It was also seen that the flux to the corynanthe pool increased with light adaptation for the ASAB-1 and EHIDXS-4-1 lines with a large portion of this flux leaving the corynanthe pathway. The EHIT16H-34-1 line saw a decrease in flux to the corynanthe pool with light adaptation with a dramatic reduction in flux out of the pathway. Combining these observations with the changes in levels of the corynanthe alkaloids with light adaptation indicates that the levels of ajmalicine and serpentine are correlated with the alkaloid flux through the pathway as influenced by lighted growth conditions (Table 10.1). A correlation of alkaloid levels was not seen with flux changes due to induction (Table 10.2) or induction in light-grown cultures (Table 10.3).

The aspidosperma pool is of particular interest in C. roseus , representing a carbon sink on the way to vindoline. The TIAs tabersonine, lochnericine, and hörhammericine are very closely related metabolites but regulatory influences on them cause unpredictable changes in their levels (Table 10.4). In the EHIASA-1 line with inducible overexpression of anthranilate synthase α (AS α), induction caused increases in lochnericine and decreases in tabersonine and hörhammericine [5]. In the ASAB-1 line with inducible overexpression of

AS α and constitutive expression of anthranilate synthase β (AS β), induction caused 203

decreases in all three metabolites. In the EHIORCA3-4-1 line with inducible overexpression of the transcriptional regulator ORCA3, induction also caused the decrease of the three metabolites [1]. In the EHIDXS-4-1 line with inducible overexpression of 1-deoxy-D- xylulose 5-phosphate synthase (DXS), induction caused increases in lochnericine and decreases in tabersonine and hörhammericine similar to the EHIASA-1 line. In the

G10H/DXS-21 line with inducible overexpression of geraniol 10-hydroxylase (G10H) and

DXS, inductions caused increases in tabersonine and lochnericine and a no change in hörhammericine. In the ASA/DXS-2 line with inducible overexpression of AS α and DXS, induction caused an increase in all three alkaloids. All these hairy root lines of C. roseus overexpress biosynthetic genes that are far removed from the aspidosperma pool, yet the influence of overexpression of these genes has significant and inconsistent effect on these alkaloids. Individually, the overexpression of AS α and DXS in lines EHIASA-1 and

EHIDXS-4-1, respectively, caused only the increase of lochnericine and the decrease of tabersonine and hörhammericine. The overexpression of both genes, as in ASA/DXS-2, caused an increase in all three alkaloids. This exemplifies the complexity of the regulation in the aspidosperma pathway.

In leaves of C. roseus , the biosynthetic pathway has multicellular and subcellular localization. The early steps of terpenoid biosynthesis are located in the internal phloem associated parenchyma (IPAP), including DXS, 1-deoxy-D-xylulose 5-phosphate reductoisomerase (DXR), 2C-methyl-D-erythritol 2,4-cyclodiphosphate synthase (MECS), hydroxymethylbutenyl diphosphate synthase (HDS), and G10H [6, 7]. G10H was also associated with epidermal cells, along with secologanin synthase (SLS), tryptophan decarboxylase (TDC), strictosidine synthase (STR), strictosidine β-glucosidase (SGD), 204

tabersonine 16-hydroxylase (T16H), and 16-hydroxytabersonine-16-O-methyltransferase

(16OMT) [8]. The last two steps of vindoline synthesis, desacetoxyvindoline-4-hydroxylase

(D4H) and deacetylvindoline-4-O-acetyltransferase (DAT), are associated with laticifer and idioblast cells [9].

The metabolite data presented in the ASAB-1 and EHIDXS-4-1 chapters suggests that the level of secologanin is related to the level of tabersonine. With the induction of either gene, the levels of secologanin and tabersonine trend very close together. This leads to a hypothesis that a single regulation mechanism exerts control over two separate parts of the biosynthetic pathway. As secologanin levels decrease in response to gene induction, the activity of SLS is increased to produce more secologanin. The activity of tabersonine-6,7- epoxidase (T6,7E), the enzyme converting tabersonine to lochnericine, is increased to manage the increased flux related to the increased consumption of secologanin. While secologanin and tabersonine are separated by a number of enzymatic reactions, as previously stated, all these steps occur within the epidermal cells of C. roseus leaves [8, 9, 10, 11].

Although SLS has been proposed to occur in the vacuole of epidermal cells [12, 13], along with STR [9], the enzyme has not been specifically located there.

If the regulation of enzyme activity is intended for the multicellular and subcellular compartmentation of vindoline synthesis in the leaves of C. roseus , it can be hypothesized that the same or similar enzymatic regulation occurs in the hairy roots of C. roseus .

Although different responses to jasmonic acid can be seen between undifferentiated cell cultures [14], seedlings (Chapter 4), and hairy roots of C. roseus [1], other research shows a similar spatial layout of enzymes in root tissue. The expression of TDC and STR was found in protodermal and cortical cells in C. roseus root tips and minovincinine-19-hydroxy-O- 205

acetyltransferase (MAT) was located to cortex and epidermis of the tips of C. roseus hairy roots [9, 15]. The co-localized expression patterns suggest that this portion of the biosynthetic pathways occurs within the same root cortical cells [15].

A hypothetical action for the regulation mechanism is the increased activity of a cytochrome P450 reductase isoform [16]. Both SLS and T6,7E are cytochrome P450- dependent oxygenases [17, 18]. The increased activity of a cytochrome P450 reductase isoform would increase the activity of the cytochrome P450-dependant enzymes SLS and

T6,7E, similar to the association of cytochrome P450-dependent geraniol 10-hydroxylase

(G10H) and cytochrome P450 reductase (CPR), where CPR is required for the activity of

G10H in the presence of a crude lipid fraction [19], as reviewed by Oudin et al. (2007) [7].

CPR is encoded by one gene in C. roseus [20] and the differential levels of CPR and cytochrome P450 reductase isoforms would allow for fine control of the TIA biosynthetic pathways. The post-translational modification of the CPR into cytochrome P450 reductase isoforms could allow for subcellular targeting and interaction with specific P450 enzymes

[16]. This post-translational control would be dissimilar from the early steps of terpenoid biosynthesis that are post-transcriptionally regulated, as shown in Arabidopsis [21, 22, 23]

Distinguishing between the isoforms is difficult because the molecular weights are very similar since they are modifications of a single CPR enzyme [20]. By immunoblot analysis, Canto-Canche and Loyola-Vargas (2001) found two sets of two isoforms with different expression in root, stem, leaf, and flower tissues. Since tissue samples were utilized, it is possible there are more isoforms that occur in specific cell types and even specific subcellular localizations that were diluted by the entirety of the tissue sample. To investigate and identify more isoforms in specific cell types, techniques like carborundum 206

abrasion [11] or laser-capture microdissection [8] could be employed. For subcellular localization, organelles can be separated by cell fractionation and vesicles, such as vacuoles, can be separated by digestion and centrifugation [12, 13]. Subcellular fractions also could be taken from the samples of enriched cell types. The accurate measurement of the molecular weight of the isoforms could help to understand how post-translation modifications relate to subcellular targeting and possibly to enzyme activity.

The iboga alkaloid catharanthine usually occurs at low levels in hairy roots and generally does not respond to the overexpression of biosynthetic genes. The levels of catharanthine in EHIASA-1 [5], ASAB-1, EHIORCA3-4-1 [1], EHIDXS-4-1, EHIT16H-34-

1, G10H/DXS-21, and ASA/DXS-2 does not change significantly upon the induction of their respective gene(s) for dark-grown cultures. Levels of catharanthine did not significantly change in induced light-grown EHIDXS-4-1 and EHIT16H-34-1, but levels did increase for induced light-grown ASAB-1. Levels of catharanthine in uninduced light-grown cultures were also increased from the levels of the uninduced dark-grown cultures in ASAB-1.

Levels decreased with light-adaptation in EHIDXS-4-1 and EHIT16H-34-1. Elicitation with jasmonic acid increased catharanthine levels in both induced and uninduced dark-grown

EHIORCA3-4-1 [1]. Elicitation of C. roseus seedlings with MeJA also increased levels catharanthine, along with vindoline. Catharanthine is the counterpart to vindoline in the production of vinblastine and vincristine. Understanding the regulation of these alkaloids by light or elicitation will be important to future metabolic engineering efforts.

Although the overexpression of biosynthetic genes can lead to increases or decreases in individual TIA levels, often the level of total measured TIAs does not significantly change.

Of all the lines discussed here, only the G10H/DXS-21 and ASA/DXS-2 lines had a 207

significant increase in total TIAs measured. The EHIDXS-4-1 dark-grown line had a significant increase from 24 to 60 hours, but not at 72 hours. The ASAB-1 dark-grown roots had a significant decrease in total measured TIAs. These results lead to the notion that to accomplish significant increases in TIA levels the overexpression of select multiple genes will be required and that DXS will is one of those genes.

Future Directions

Light takes part in transcriptional regulation of biosynthetic genes in C. roseus , particularly in the reaction steps from tabersonine to vindoline. Adaptation to a 24-hour photoperiod in this study caused a vast array of influences by light; levels of metabolites increased, decreased, and changed trends, indicating altered regulation. A thorough investigation into what genes and how genes are affected by light will assist in future metabolic engineering efforts, whether to manipulate lines to remove light dependence or to find ways to work with lighted culture growth. Adapting hairy root cultures to 16:8 or 12:12 diurnal cycles and comparing alkaloid and transcription data, collected with frequency during the investigation, for the dark-grown cultures, light-grown cultures, and diurnal-grown cultures will shed light on its influence of TIA biosynthetic pathways.

Previous reports of the EHIDXS-4-1 and EHIT16H-34-1 lines [24] discuss the presence of new unknown peaks in HPLC chromatograms that arrive with the induction of their respective genes. In this work, new peaks were seen with the induction of the T16H gene. These peaks have tabersonine-like UV spectra and further investigation is ongoing to identify them. New peaks were not observed in the DXS line. The induction of the

EHIT16H-34-1 line displays a decrease in tabersonine until 36 hours where regulation steps in. Presumably the tabersonine was converted by T16H to 16-hydroxytabersonine, and 208

possibly 16-methoxytabersonine by 16OMT if it is present natively. The presence of these

TIAs is important to the production of vindoline and isolation of these compounds for use as

HPLC standards and precursor feeding studies will be vital to future studies. The appearance of these compounds may also be elucidated by the precursor feeding of tabersonine to induced EHIT16H-34-1 cultures.

As a hairy root culture ages, the oldest tissue in the culture is generally centered in the culture flask as the new growth fills in at the edges of the flask bottom. The older tissue will eventually start to callus, whether due to age, depleting nutrients, reduced media due to evaporation, or phytohormones. Occasionally, for no apparent reason such as contamination, a culture will prematurely callus. The callusing will consume the old and new hairy root tissue alike. If the callused tissue is placed into a normally growing culture, it will cause that culture to callus both old and new tissue and the callusing response is dependent on how much callused material is added to the culture (unpublished results). Callused biomass

‘greens’ more readily in light-adapted roots (unpublished results) indicating the metabolism to this tissue may be altered. Previous studies have shown that the alkaloid profile and enzyme transcription levels change according to the age of the tissue, moving from new cells at the root tip to more mature cells farther from the tip [25]. Adding callused biomass to hairy root cultures, or the isolated hormone responsible for the callus response, may be a new way to elicit a response in alkaloid levels.

The isolation and identification of additional alkaloid standards is a vital goal for the metabolic engineering of C. roseus . Only some the alkaloids produced by C. roseus are accumulated in measurable quantities. However, the overexpression of biosynthetic genes may reveal bottlenecks where intermediate alkaloids may then accumulate undetected. The 209

ability to measure these minor alkaloids by a more thorough profiling of C. roseus alkaloids will lend to a further understanding of regulatory mechanisms.

The further understanding of regulatory mechanisms in C. roseus is also inhibited by a lack of sequenced enzymes. Several steps in the long biosynthetic pathway of vinblastine and vincristine are catalyzed by unknown enzymes. Along with biosynthetic enzymes, transcriptional regulators have an important role in managing alkaloid levels. Expression profiling would be a valuable tool that could help isolate regulating genes, biosynthetic genes, and catabolic genes that direct the turnover of alkaloids in response to environmental stimuli. Coupling extensive transcription data with metabolite profiling will lead to significant progress in the metabolic engineering of Catharanthus roseus .

Tables

Table 10.1 Influence of flux on the levels of corynanthe alkaloids in light-adapted hairy root cultures. The positive or negative change is the difference between the uninduced light-grown cultures and the uninduced dark-grown cultures. Zeros denote no significant change. The metabolite levels are the absolute levels measured by HPLC. The minimum total flux productivity (MTFP) is the integrated flux of a reaction over the experiment. The total accumulation is the total yield of a metabolite over the experiment. C. roseus hairy Terpenoid Change in level Change in MTFP Change in total root line indole with light of proceeding accumulation of alkaloid adaptation reaction with light culture with adaptation light adaptation ASAB-1 Ajmalicine + + - ASAB-1 Serpentine + + 0 EHIDXS-4-1 Ajmalicine + + - EHIDXS-4-1 Serpentine + + + EHIT16H-34-1 Ajmalicine - - - EHIT16H-34-1 Serpentine - - 0

210

Table 10.2 Influence of flux on the levels of corynanthe alkaloids in hairy roots with gene induction. The positive or negative change is the difference between the induced dark-grown cultures and the uninduced dark-grown cultures. Zeros denote no significant change. The metabolite levels are the absolute levels measured by HPLC. The minimum total flux productivity (MTFP) is the integrated flux of a reaction over the experiment. The total accumulation is the total yield of a metabolite over the experiment. C. roseus hairy Terpenoid Change in level Change in MTFP Change in total root line indole with gene of proceeding accumulation of alkaloid induction reaction with culture with gene induction gene induction ASAB-1 Ajmalicine + + - ASAB-1 Serpentine 0 + - EHIDXS-4-1 Ajmalicine + + + EHIDXS-4-1 Serpentine 0 - 0 EHIT16H-34-1 Ajmalicine 0 0 - EHIT16H-34-1 Serpentine 0 + -

Table 10.3 Influence of flux on the levels of corynanthe alkaloids in light adapted hairy roots of C. roseus with gene induction The positive or negative change is the difference between the induced light-grown cultures and the uninduced light-grown cultures. Zeros denote no significant change. The metabolite levels are the absolute levels measured by HPLC. The minimum total flux productivity (MTFP) is the integrated flux of a reaction over the experiment. The total accumulation is the total yield of a metabolite over the experiment. C. roseus hairy Terpenoid Change in level Change in MTFP Change in total root line indole with gene of proceeding accumulation of alkaloid induction in reaction with culture with lighted growth gene induction in gene induction lighted growth in lighted growth ASAB-1 Ajmalicine + + + ASAB-1 Serpentine 0 + - EHIDXS-4-1 Ajmalicine + 0 + EHIDXS-4-1 Serpentine 0 - 0 EHIT16H-34-1 Ajmalicine 0 - - EHIT16H-34-1 Serpentine 0 - -

211

Table 10.4 Influence of biosynthetic gene expression on aspidosperma alkaloids in hairy roots of C. roseus . The positive or negative change is the difference between the induced dark-grown cultures and the uninduced dark-grown cultures. Zeros denote no significant change. “*” data taken from Peebles et al. (2006) [5]. “ #” data taken from Peebles et al. (2009) [1]. C. roseus hairy Tabersonine Lochnericine Hörhammericine root line EHIASA-1* - + - ASAB-1 - - - EHIORCA3-4-1# - - - EHIDXS-4-1 - + - G10H/DXS-21 + + 0 ASA/DXS-2 + + +

References

1. Peebles, C.A.M., J.V. Shanks, and K.-Y. San. (2009) Transcriptional Response of the Terpenoid Indole Alkaloid Pathway to the Overexpression of ORCA3 Along with Jasmonic Acid Elicitation of Catharanthus roseus Hairy Roots Over Time . Met. Eng. 11 : 76-86. 2. Facchini, P.J. (2001) Alkaloid Biosynthesis in Plants: Biochemistry, Cell Biology, Molecular Regulation, and Metabolic Engineering Applications . Annu. Rev. Plant Physiol. Plant Mol. Biol. 52 : 29-66. 3. Facchini, P.J., D.A. Bird, B.P. MacLeod, S.-U. Park, and N. Samanani. (2003) Multiple Levels of Control in the Regulation of Alkaloid Biosynthesis . Rec Adv Phytochem . 37 : 143-180. 4. Bhadra, R., J.A. Morgan, and J.V. Shanks. (1998) Transient Studies of Light-Adapted Cultures of Hairy Roots of Catharanthus roseus : Growth and Indole Alkaloid Accumulation . Biotechnol. Bioeng. 60 (6): 670-678. 5. Peebles, C.A.M., S.-B. Hong, S.I. Gibson, J.V. Shanks, and K.-Y. San. (2006) Effects of Terpenoid Precursor Feeding on Catharanthus roseus Hairy Roots Over- Expressing the Alpha or the Alpha and Beta Subunits of Anthranilate Synthase . Biotechnol. Bioeng. 93 (3): 534-540. 6. Burlat, V., A. Oudin, M. Courtois, M. Rideau, and B. St-Pierre. (2004) Co-expression of three MEP pathway genes and geraniol 10-hydroxylase in Internal Phloem Parenchyma of Catharanthus roseus Implicates Multicellular Translocation of Intermediates During the Biosynthesis of Monoterpene Indole Alkaloids and Isoprenoid-derived Primary Metabolites . Plant J. 38 : 131-141. 7. Oudin, A., M. Courtois, M. Rideau, and M. Clastre. (2007) The Iridoid Pathway in Catharanthus roseus Alkaloid Biosynthesis . Phytochem Rev . 6: 259-276. 8. Murata, J. and V. De Luca. (2005) Localization of Tabersonine 16-hydroxylase and 16-OH Tabersonine-16-O-methyltransferase to Leaf Epidermal Cells Defines Them as Major Site of Precursor Biosynthesis in the Vindoline Pathway in Catharanthus roseus. Plant J. 44 : 581-594. 212

9. St-Pierre, B., F. Vazquez-Flota, and V. De Luca. (1999) Multicellular Compartmentation of Catharanthus roseus Alkaloid Biosynthesis Predicts Intercellular Translocation of a Pathway Intermediate . Plant Cell . 11 : 887-900. 10. Irmler, S., G. Schroder, B. St-Pierre, N.P. Crouch, M. Hotze, J. Schmidt, D. Strack, U. Matern, and J. Schroder. (2000) Indole Alkaloid Biosynthesis in Catharanthus roseus : New Enzyme Activities and Identification of Cytochrome P450 CYP72A1 as Secologanin Synthase . Plant J. 24 (6): 797-804. 11. Murata, J., J. Roepke, H. Gordon, and V. De Luca. (2008) The Leaf Epidermome of Catharanthus roseus Reveals Its Biochemical Specialization . Plant Cell . 20 : 524-542. 12. Contin, A., R. van der Heijden, and R. Verpoorte. (1999) Localization of Secologanin in Catharanthus roseus Cells . Acta Bot. Gallica . 146 (1): 105-110. 13. Contin, A., R. van der Heijden, and R. Verpoorte. (1999) Accumulation of Loganin and Secologanin in Vacuoles from Suspension Cultured Catharnthus roseus Cells . Plant Sci . 147 : 177-183. 14. van der Fits, L. and J. Memelink. (2000) ORCA3, a Jasmonate-Responsive Transcriptional Regulator of Plant Primary and Secondary Metabolism . Science . 289 (5477): 295-297. 15. Laflamme, P., B. St-Pierre, and V. De Luca. (2001) Molecular and Biochemical Analysis of a Madagascar Periwinkle Root-Specific Minovincinine-19-Hydroxy-O- Acetyltransferase . Plant Phys. 125 : 198-198. 16. Canto-Canche, B.B. and V.M. Loyola-Vargas. (2001) Multiple Forms of NADPH- cytochrome P450 Oxidoreductases in the Madagascar Periwinkle Catharanthus roseus. In Vitro Cell. Dev. Biol.--Plant . 37 : 622-628. 17. Yamamoto, H., N. Katano, A. Ooi, and K. Inoue. (2000) Secologanin synthase which Catalyzes the Oxidative Cleavage of Loganin into Secologanin is a Cytochrome P450 . Phytochem . 53 : 7-12. 18. Rodriguez, S., V. Compagnon, N.P. Crouch, B. St-Pierre, and V. De Luca. (2003) Jasmonate-induced Epoxidation of Tabersonine by a Cytochrome P-450 in Hairy Root Cultures of Catharanthus roseus. Phytochem . 64 : 401-409. 19. Madyastha, K.M. and C.J. Coscia. (1979) Detergent-solubilized NADPH- Cytochrome c (P-450) Reductase from the Higher Plant, Catharanthus roseus. J Biol Chem . 254 (7): 2419-2427. 20. Meijer, A.H., M.I.L. Cardoso, J.T. Voskullen, A. de Waal, R. Verpoorte, and J.H. Hoge. (1993) Isolation and Characterization of a cDNA Clone from Catharanthus roseus Encoding NADPH:cytochrome P-450 reductase, an Enzyme Essential for Reactions Catalyzed by Cytochrome P-450 Mono-oxygenases in Plants . Plant J. 4(1): 47-60. 21. Guevara-Garcia, A., C. San Roman, A. Arroyo, M.E. Cortes, M. de la Luz Gutierrez- Nava, and P. Leon. (2005) Characterization of the Arabidopsis clb6 Mutant Illustrates the Importance of Posttransciptional Regulation of the Methyl-D-Erythritol 4- Phosphate Pathway . Plant Cell . 17 (2): 628-643. 22. Rodriguez-Concepcion, M. (2006) Early Steps in Isoprenoid Biosynthesis: Multilevel Regulation of the Supply of Common Precursors in Plant Cells . Phytochem Rev . 5: 1- 15. 213

23. Sauret-Gueto, S., P. Botella-Pavia, U. Florez-Perez, J.F. Martinez-Garcia, C. San Roman, P. Leon, A. Boronat, and M. Rodriguez-Concepcion. (2006) Plastid Cues Posttransciptionally Regulate the Accumulation of Key Enzymes of the Methylerythritol Phosphate Pathway in Arabidopsis. Plant Physiol. 141 (1): 75-84. 24. Hughes, E.H. (2003) Metabolic Engineering of Catharanthus roseus Hairy Roots Using an Inducible Promoter System . Rice University: Houston, TX. 25. Magnotta, M., J. Murata, J. Chen, and V. De Luca. (2007) Expression of Deacetylvindoline-4-O-acetyltransferase in Catharanthus roseus Hairy Roots . Phytochem . 68 : 1922-1931.

214

Appendix A – Five year maintenance of the inducible expression of anthranilate synthase in Catharanthus roseus hairy roots

Adapted from a paper published in Biotechnology and Bioengineering (Biotechnol Bioeng ,

2009, 102 (5): 1521-1525).

Christie A.M. Peebles 1,4, Guy W. Sander 2,5 , Mai Li 1,6 , Jacqueline V. Shanks 2,7 , and Ka-Yiu

San 1,3,8

1Department of Bioengineering, Rice University, Houston, Texas

2 Department of Chemical and Biological Engineering, Iowa State University, Ames, Iowa

3Department of Chemical and Biomolecular Engineering, Houston, TX

4Primary researcher and author

5Contibuting researcher and author

6Contributing researcher

7Co-principal investigator

8Principal investigator and corresponding author

Abstract

Transgenic hairy root cultures have the potential to be an industrial production platform for a variety of chemicals. This report demonstrates the long term stability of a transgenic Catharanthus roseus hairy root line containing the inducible expression of a feedback-insensitive anthranilate synthase (AS). After 5 years in liquid culture, the presence of the inserted AS gene was confirmed by genomic PCR. The inducible expression of AS 215

was confirmed by enzyme assay and by changes in terpenoid indole alkaloid concentrations.

This report also demonstrates that it may take as long as two years for the metabolite profile to stabilize.

Key Words: plant metabolic engineering, inducible promoter, terpenoid indole alkaloid, cell factories

Introduction

It is well established that plants produce numerous metabolites that have economical value in a wide variety of industries ranging from fuels and lubricants to pharmaceuticals and human health. The complexity of many of these metabolites limits their production to plant systems. This coupled with low yields leads to the engineering of plant systems for increased productivity and yield. Plants can also be engineered to produce novel compounds from the introduction of non-native pathways or through the engineering of enzymes to increase metabolite diversity. While traditional agriculture has been primarily used for production of these metabolites, the use of plant cell and tissue culture is becoming a feasible production alternative (Georgiev et al. 2007; Guillon et al. 2006a; Guillon et al. 2006b; Sivakumar 2006;

Srivastava and Srivastava 2007). In particular, hairy root cultures are an attractive platform because they produce many metabolites on the same order of magnitude as the whole plant.

To be a viable industrial production platform, the long-term stability of transgenic hairy root cultures needs to be established. In this paper, transgenic hairy root cultures are defined as cultures containing an inserted gene of interest in addition to the genes required for hairy root formation. In a recent report, it was shown that after 4.5 years a Catharanthus roseus hairy root line transgenic for inducible GFP expression maintained inducible expression of GFP without selective pressure (Peebles et al. 2007). This paper builds upon that work by 216

tracking the terpenoid indole alkaloid metabolite levels in response to the inducible expression of a pathway gene, anthranilate synthase (AS), in C. roseus hairy roots at different time points over 5 years. These results show that it can take up to 2 years for the metabolite profiles to stabilize.

Materials and Methods

Culture Conditions

The creation of the hairy root line AS αβ -1 has been previously described (Hong et al.

2006). The line contains an AS α feedback insensitive subunit under the control of a glucocorticoid inducible promoter system along with the constitutive expression of the AS β subunit. Hairy root cultures of AS αβ -1 were initiated by placing five root tips approximately

3 cm long in 50 mL of culture media in a 250 mL Erlenmeyer flask. The culture media consisted of a filter-sterilized (0.22 µm filter) solution of 30 g/L sucrose (Sigma), half- strength Gamborg’s B5 salts (Sigma), and full-strength Gamborg’s vitamins (Sigma) with the pH adjusted to 5.7. These cultures were grown in the dark at 26 °C at 100 rpm and were maintained by serial sub-culturing every 3 weeks. This line was maintained in parallel cultures by two different research groups starting at 2.25 years after liquid adaptation.

Genomic PCR

Genomic DNA was extracted from hairy root cultures of AS αβ -1 using the GenElute

Plant Genomic DNA Miniprep Kit (Sigma) according to the manufacturer’s instructions.

One primer specific to the inducible promoter region outside the gene and one primer specific to a region inside the gene were used to confirm the insertion of AS α into the genome: 5’-AGCTTGCATGCCGGTCGACTCTAGAGGATCC-3’ and 5’-

TCACAAATGCAGATTCAGCCAAGTCGATGGCTCGAG-3’. The expected PCR band 217

size is ~2.1 kb. Taq polymerase was used to perform the PCR with the following conditions:

95 °C for 1 min followed by 30 cycles of 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 2 min with a final extension time of 10 min at 72 °C.

Induction of AS αβ Activity and Alkaloid Extraction and Detection

Triplicate cultures of AS αβ -1 were treated with 0.2 µM dexamethasone (induced cultures) or with an equal volume of ethanol (un-induced cultures). Cultures were fed on day

18 and harvested 72 hrs later on day 21. The cultures were then frozen at -80 °C until they were lyophilized. Approximately 50 mg dry weight of the ground tissue was extracted in 30 mL of methanol by ultrasonication for 10 min (Model W-225, Heat Systems. Ultrasonics

Inc., USA). The extracts were clarified by centrifugation at 1,300 g for 15 min at 4 °C. The supernatants were concentrated to 2 mL using a vortex evaporator and passed through a 0.22

m nylon filter (13 mm). 10 L of each samples was analyzed for the following terpenoid indole alkaloids: tryptophan, tryptamine, ajmalicine, serpentine, catharanthine, hörhammericine, lochnericine, and tabersonine on a HPLC as previously described (Peebles et al. 2005).

Anthranilate Synthase Enzyme Assay

Anthranilate synthase enzyme assay was performed as previously reported (Li and

Last 1996). After a 72 hr induction with dexamethasone or ethanol, 1 gm of fresh weight tissue was ground in 3 mL of grinding buffer (200 mM Tris-HCl (pH 7.5), 0.2 mM EDTA, 8 mM MgCl 2, 0.2 mM DTT, and 60% glycerol). The supernatant was clarified by centrifugation and desalted on a Bio-Rad (Hercules, CA) Econo-Pac l0DG column pre- equilibrated in column buffer (50 mM Tris-HCl pH 7.5, 0.05 mM EDTA, 2 mM MgCl 2, 0.05 mM DTT, 5% glycerol). The crude protein concentration for each sample was determined by 218

a Bradford assay (Sigma). Anthranilate synthase activity was measured in a 2 mL reaction with 1 mL column buffer plus 0.05 mM chorismic acid, 10 mM glutamine, 1 mM MgC12, and 12.5 mM Tris-HCl (pH 8), and 20 µg crude protein. To test the inhibitory effects of tryptophan, 0, 1, 3, 10, or 30 µM tryptophan was added to each reaction. The reaction was terminated after 30 min at 30 ºC by adding 0.2 mL 1 M HCl. Anthranilate was extracted in

3.5 mL of ethyl acetate and the fluorescence of each sample was determined on a Shimadzu

RF-10AXL fluorescence detector with the excitation set at 340 nm and the emission set at

400 nm. A standard curve for anthranilate was produced following the above reaction procedure without crude protein.

Results and Discussion

The C. roseus hairy root line AS αβ -1 has been continuously maintained by transferring five root tips into fresh liquid media every three weeks for the past five years as previously described (Hong et al. 2006). This line was maintained in parallel cultures by two separate research groups starting 2.25 years after liquid adaptation. Five years after being transferred to liquid media, the presence of the inserted AS α gene under the control of the glucocorticoid inducible promoter was confirmed in AS αβ -1 using genomic PCR (Figure

A.1). The primers were designed so that the 5’ primer is specific to the inducible promoter region and the 3’ primer is specific to the AS α gene. This primer design ensures that only the inserted AS α gene is amplified and not the native gene.

The AS enzyme activity was also determined for both the un-induced and induced

(overexpressing AS α) conditions at 5 yrs. Figure A.2 shows that AS αβ -1 exhibits inducible expression of AS and that the induced state exhibits an increase in feedback insensitive AS α.

The original report of AS activity for AS αβ -1 was 0.77 nmole min -1 mg -1 for the un-induced 219

state and 1.7 nmole min -1 mg -1 for the induced state, a 2 fold difference (Hong et al. 2006).

After five years, the AS activity is 2.2 nmole min -1 mg -1 for the un-induced state and 26.2 nmole min -1 mg -1 for the induced state, a 12 fold difference.

An induction study was performed at various time points over the 5 year period to track the effect of overexpressing AS on the terpenoid indole alkaloid concentrations

(Figures A.3 and A.4). The indole precursor’s tryptophan and tryptamine were analyzed along with the following alkaloids: ajmalicine and serpentine from the Corynanthe family, catharanthine from the Iboga family, and tabersonine, hörhammericine, and lochnericine from the Aspidosperma family. Vindoline, an important precursor to the anticancer drugs vinblastine and vincristine, has not been detected within these hairy root cultures (Shanks et al. 1998). The initial results on the line were discussed by Hong et al. (2006). The first two time points, at 14 and 16 months after transfer to liquid media, have been previously reported

(Peebles et al. 2005; Peebles et al. 2006). The 3.6 year time point was independently determined. Figures A.3 and A.4 suggest that the cell line may take up to 2 years for the metabolite profile to stabilize. While the response may be transient over time, the overall trends were consistent at each time point showing that it is not necessary to wait for the line to stabilize before determining the general effect of overexpressing a gene of interest.

Practically this means if you want to test the line under a variety of conditions and compare the results, it is best to do it all at once or wait until the line stabilizes. The parallel cultivation of the AS αβ -1 line starting at 2.25 years after liquid adaptation and the stabilized metabolite profile from 2-5 years provides additional evidence that the line has become stable and is insensitive to differences in sub-culturing techniques. The increase in enzyme activity reported at 5 years may explain why there is an observed change in metabolite levels 220

over the first two years (Figures A.3 and A.4). These results also suggest that the AS αβ -1 line maintains the inducible feedback resistant expression of AS over the 5 year time period.

The initial transient profile may arise from the way in which the hairy root line was generated. Initially a number of hairy roots grow from one site of infection on the plant. It is possible that each hairy root represents a different infection event and thus contains a different genetic or metabolic background. We have found that selecting for the whole mass of hairy roots from the infection site is more successful in generating hairy root cultures than selecting for each individual hairy root. Once on the selection plate, the faster growing hairy roots are further adapted to solid culture and subsequently liquid media. At this point, a mixture of hairy roots containing different backgrounds may still exist. Over time as the five best growing hairy root tips are chosen for sub-culturing, we maybe selecting for a faster growing, more homogeneous culture. We are currently using a modified procedure in which each selection is based on a single root tip from the infected plant. This should reduce the time for a stable hairy root culture to emerge.

This study shows that a transgenic hairy root line can be stably maintained for 5 years while retaining the inducible feedback resistant expression of an inserted gene. It also indicates that the hairy root cultures may go through an initial transient stage before the metabolite profile reaches a stabilized state. These observations have important implications for the future use of transgenic hairy roots in industrial applications.

Acknowledgments

This work was supported by the National Science Foundation (BES-0420840 and CBET-

0729622). 221

Figures

Figure A.1 Genomic PCR confirmation of the AS α insert in C. roseus hairy root line AS αβ -1 at 5 years. The left lane is a 1 kb DNA ladder (Promega). Lanes A and B are the PCR product from the genomic DNA extraction. Lane C is a control reaction using PCR product from the original plasmid construct containing AS αβ .

222

Figure A.2 Enzyme activity of anthranilate synthase (AS) 5 years after first being transferred to liquid media. Triplicate cultures were induced with 0.2 µM dexamethasone (I) or an equal volume of ethanol (UI) and harvested 72 hrs later. (a.) reports the AS enzyme activity (nmole*min -1*mg -1) while (b.) reports the % of initial enzyme activity seen as tryptophan concentrations increase. Error bars represent the standard deviation of triplicate samples.

Figure A.3 The change in tryptophan and tryptamine concentrations over time in liquid culture. Each data point represents the results of a 72 hr induction study performed in triplicate. (*) have been adapted from (Peebles et al. 2005; Peebles et al. 2006).

223

Figure A.4 The change in terpenoid indole alkaloid (TIA) concentrations over time in liquid culture. Each data point represents the results of a 72 hr induction study performed in triplicate. (*) have been adapted from (Peebles et al. 2005; Peebles et al. 2006). 224

References

Georgiev MI, Pavlov AI, Bley T. 2007. Hairy root type plant in vitro systems as sources of bioactive substances. Appl. Microbiol. Biotechnol. 74:1175-1185.

Guillon S, Tremouillaux-Guiller J, Pati PK, Rideau M, Gantet P. 2006a. Hairy root research: recent scenario and exciting prospects. Curr. Opin. Plant Biol. 9:341-346.

Guillon S, Tremouillaux-Guiller J, Pati PK, Rideau M, Gantet P. 2006b. Harnessing the potential of hairy roots: dawn of a new era. Trends Biotech. 24(9):403-409.

Hong SB, Peebles CAM, Shanks JV, San KY, Gibson SI. 2006. Expression of the Arabidopsis feedback-insensitive anthranilate synthase holoenzyme and tryptophan decarboxylase genes in Catharanthus roseus hairy roots. J. Biotechnol. 122(1):28-38.

Li J, Last RL. 1996. The Arabidopsis thaliana trp 5 mutant has a feedback-resistant anthranilate synthase and elevated soluble tryptophan. Plant Physiol. 110:51-59.

Peebles CA, Gibson SI, Shanks JV, San KY. 2007. Long-term maintenance of a transgenic Catharanthus roseus hairy root line. Biotechnol Prog 23:1517-1518.

Peebles CAM, Hong SB, Gibson SI, Shanks JV, San KY. 2005. Transient effects of overexpressing anthranilate synthase α and β subunits in Catharanthus roseus hairy roots. Biotechnol. Prog. 21:1572-1576.

Peebles CAM, Hong SB, Gibson SI, Shanks JV, San KY. 2006. Effects of terpenoid precursor feeding on Catharanthus roseus hairy roots overexpressing the alpha or alpha and beta subunits of anthranilate synthase. Biotechnol. Bioeng. 93(3):534-540.

Shanks JV, Bhadra R, Morgan J, Rijhwani SK, Vani S. 1998. Quantification of metabolites in the indole alkaloid pathways of Catharanthus roseus : Implications for metabolic engineering. Biotechnol. Bioeng. 58(2 & 3):333-338.

Sivakumar G. 2006. Bioreactor technology: A novel industrial tool for high-tech production of bioactive molecules and biopharmaceuticals from plant roots. Biotechnol. J. 1:1419-1427.

Srivastava S, Srivastava AK. 2007. Hairy root culture for mass-production of high-value secondary metabolites. Crit. Rev. Biotechnol. 27(1):29-43.

225

Appendix B - The expression of 1-deoxy-D-xylulose synthase and geraniol

10-hydroxylase or anthranilate synthase increases terpenoid indole alkaloid accumulation in Catharanthus roseus hairy roots

Draft of a paper to be submitted to Metabolic Engineering or Biotechnology and

Bioengineering .

Christie A.M. Peebles 1,4 , Guy W. Sander 2,5 , Erik H. Hughes 3,5 , Ryan Peacock 1,5 , Jacqueline

V. Shanks 2,6 , Ka-Yiu San 1,3,7

1Department of Bioengineering, Rice University, Houston, TX

2Department of Chemical and Biological Engineering, Iowa State University, IA

3Department of Chemical and Bimolecular Engineering, Rice University, Houston, TX

4Primary researcher and author

5Researcher

6Co-principal investigator

7Principal investigator and corresponding author

Abstract

Vinblastine and vincristine are important anticancer drugs produced in Catharanthus roseus in small quantities. Researchers are actively pursuing ways to increase the yield of the drugs within C. roseus . Transgenic hairy root lines were created that individually overexpressed 1-deoxy-D-xylulose synthase (DXS) and geraniol 10-hydroxylase (G10H) under the control of a glucocorticoid-inducible promoter. We also created double overexpression lines that overexpressed DXS and anthranilate synthase α subunit (ASA) or 226

DXS and G10H with both genes under control of a glucocorticoid-inducible promoter. DXS overexpression resulted in an increase in ajmalicine and lochnericine and a decrease in tabersonine and hörhammericine. Double overexpression of DXS and G10H caused an increase in ajmalicine, lochnericine, and tabersonine concentrations. Likewise, DXS and

ASA overexpression displayed an increase in hörhammericine, lochnericine, and tabersonine.

The results indicate that increased expression of multiple genes may be needed to increase product production.

Key Words: plant metabolic engineering, Madagascar periwinkle, tissue culture, methylerythritol phosphate pathway

Introduction

Since their discovery in the late 1950s (Pearce and Miller 2005), vinblastine and vincristine are used as powerful anticancer drugs for a variety of cancer treatments. These compounds are classified as terpenoid indole alkaloids and were discovered during a screening for novel anti-diabetic drugs in Catharanthus roseus (van der Heijden et al. 2004).

Vinblastine and vincristine are produced in small quantities within the leaves of the plant. It takes approximately 500 kg of dried leaves to produce 1 gm of vinblastine (Noble 1990). For commercial production, a semi-synthetic route has been used to couple vindoline and catharanthine; both compounds are present in higher concentrations within the leaves (van der Heijden et al. 2004). The importance of these anticancer drugs has lead researchers to study the biosynthesis and regulation of the terpenoid indole alkaloid pathway and to explore ways to engineer the increased production of these metabolites. 227

The terpenoid indole alkaloids (TIAs) are produced through the combination of two pathways: the indole and terpenoid pathway (Figure B.1). The shikimate pathway provides chorismate, a precursor to the indole pathway, through a series of reactions starting with the condensation of phosphoenolpyruvate and erthrose-4-phosphate. Chorismate is converted into anthranilate through anthranilate synthase (AS). This is the first committed step in the synthesis of the indole moiety tryptophan. Tryptophan is converted to tryptamine through tryptophan decarboxylase (TDC).

In plants, there are two major pathways that lead to the production of the terpenoid precursors isopentenyl diphosphate (IPP) and dimethylallyl diphosphate (DMAPP). One pathway is the mevalonate pathway, which is active in the cytosol. The other is the methylerythritol phosphate (MEP) pathway, which is active in the plastid. While there is evidence for the diffusion of IPP between the two compartments, the MEP pathway is mainly responsible for the production of the monoterpenoids (Hong et al. 2003). The first step of the

MEP pathway is the condensation of pyruvate and glyceraldehyde 3-phosphate by 1-deoxy-

D-xylulose 5-phosphate synthase (DXS) to 1-deoxy-D-xylulose 5-phosphate (DXP). A series of reaction convert DXP to IPP and DMAPP. Geranyl diphosphate synthase (GPPS) converts IPP and DMAPP to the monoterpenoid geranyl diphosphate. Geraniol is converted to 10-hydroxygeraniol by geraniol 10-hydroxylase (G10H). After several steps 10- hydroxygeraniol is converted to secologanin. The TIAs are formed by the condensation of tryptamine and secologanin by strictosidine synthase (STR) to form strictosidine.

Strictosidine is then converted to a variety of TIAs.

Throughout the TIA pathway there are a number of key enzymes that regulate the flux through the pathway. AS catalyzes the first committed step in the synthesis of 228

tryptophan and is subjected to feedback inhibition by tryptophan (Li and Last 1996). AS is a tetramer composed of two α subunits (AS α) and two β subunits (AS β). The α subunit catalyzes the aromatization of chorismate while the β subunit donates the amino subunit.

The inhibition by tryptophan can be overcome by expressing a feedback insensitive AS α.

This technique has been successfully used to increase tryptophan content in rice, soybean, and C. roseus (Dubouzet et al. 2007; Hong et al. 2006b; Hughes et al. 2004a; Inaba et al.

2007). In C. roseus hairy roots, the overexpression of a feedback insensitive AS α caused an increase in tryptophan and tryptamine concentrations but only led to the increase of one TIA, lochnericine (Hughes et al. 2004a). The conversion of tryptophan to tryptamine is another branch point in the pathway and potential control step. When TDC was overexpressed in C. roseus hairy roots, tryptamine did not increase but serpentine showed a significant increase

(Hughes et al. 2004b). The overexpression of both AS α and TDC in C. roseus hairy roots caused a 6-fold increase in tryptamine levels while the TIAs levels did not increase (Hughes et al. 2004b).

DXS catalyzes the first step in the MEP pathway and is hypothesized to be an important control step within the MEP pathway. The following examples highlight the role of the DXS pathway in plants. In Arabidopsis the overexpression of DXS led to an increase in terpenoid concentrations while the repression of DXS decreased terpenoid concentrations

(Estevez et al. 2001). DXS expression pattern followed the accumulation pattern of carotenoids during fruit development in tomato (Lois et al. 2000). Deoxyxylulose feeding caused an increase in the accumulation of two indole alkaloids, lochnericine and tabersonine, in C. roseus hairy roots (Hong et al. 2003). In C. roseus cell suspension cultures, G10H is considered to be an important limiting enzyme in the production of TIAs (Collu et al. 2002; 229

Collu et al. 2001; Dagnino et al. 1995; Schiel et al. 1987). In native roots high levels of

G10H activity have been reported (Meijer et al. 1993) highlighting a potential difference between root and cell culture. DXS and G10H mRNA levels are up-regulated by a number of signaling molecules including jasmonic acid, ethylene, and cytokinin (Collu et al. 2001;

Papon et al. 2005; van der Fits and Memelink 2000).

The use of feeding studies can help us to determine potential limiting steps within a pathway. For the TIA pathway, there are conflicting reports as to whether the terpenoid or indole pathway is the limiting pathway in the production of TIAs. In cell suspension cultures, it has been shown that tryptophan feeding (indole pathway) has resulted in increased serpentine levels in one study, in reduced alkaloid levels in another, and in no effect in another (Kargi and Ganapathi 1991; Knobloch and Berlin 1980; Zenk et al. 1977). Cell cultures that overexpressed TDC exhibited an increase in tryptophan accumulation but no change in TIA accumulation (Canel et al. 1998). Loganin or secologanin feeding (terpenoid pathway) increases TIAs in cell suspension cultures (Mérillon et al. 1989; Moreno et al.

1993) and increases TIAs in cells overexpressing STR or TDC (Whitmer et al. 2002a;

Whitmer et al. 2002b). The timing of precursor feeding may affect which pathway is limiting in hairy roots. In the exponential growth phase, tryptophan feeding significantly increased the production of TIAs but the feeding of geraniol, 10-hydroxygeraniol, and loganin had no significant effect. In early stationary growth phase, feeding geraniol, 10- hydroxygeraniol, or loganin increased the amount of tabersonine that accumulated, while the addition of tryptophan had no effect (Morgan and Shanks 2000). These reports suggest that both pathways may be limiting. It is likely that when the limitation of one pathway is overcome, the other pathway becomes limiting. 230

This paper explores the effect of overexpressing several important TIA pathway genes alone and in concert with other genes. Specifically, the single effects of overexpressing DXS, G10H, and previously published ASA (Hughes et al. 2004a) are explored. The mixed results of single gene overexpression lead us to explore the effect of overexpressing two genes at a time. The effect of expressing DXS and G10H or DXS and

ASA resulted in an increase in several TIA metabolites. These results indicate that expression of multiple key enzymes maybe necessary to overcome the native regulation and increase

TIA metabolite accumulation.

Materials and Methods

Plasmid Construction

The Arabidopsis DXS gene, ClaI, was provided as a cDNA clone in pBluescript by

Dr. Patricia Leon. G10H was amplified from cDNA prepared from RNA purified from C. roseus hairy roots using polyT primers and M-MLV reverse transcriptase according to manufacturer’s instructions (Promega). The primers used for G10H amplification were 5’-

ACTTCCATTCCATGGATTACCTTACCA-3’ and 5’-

TTAAAGGGTGCTTGGTACAGCAC-3’. The sequence from the resulting gene matched the published sequence for G10H. G10H was moved from pCR2.1-TOPO (Invitrogen) into pBluescript as an EcoRV/SpeI fragment. G10H and DXS were then removed as an

XhoI/SpeI fragment and ligated into the glucocorticoid inducible plasmid pTA7002 to form p7002DXS and p7002G10H. The construction of p7002ASA was previously described

(Hughes et al. 2004a). The XhoI/SpeI DXS gene fragment was also ligated into the

XhoI/SpeI site of pUCGALA (Hughes et al. 2004b) to form pUCGALADXS. The Sse8387I

(SdaI) restriction site was used to move DXS along with the GAL4-UAS promoter from 231

pUCGALADXS into the Sse8387I (SdaI) restriction site of p7002ASA and p7002G10H to form p7002ASA/DXS and p7002G10H/DXS. These plasmids carry 2 genes under the control of a glucocorticoid-inducible promoter.

Generation of Hairy Root Lines

The plasmids p7002DXS, p7002G10H and p7002ASA/DXS were electroporated into

Agrobacterium rhizogenes 15834. Transformed colonies from YEM plates (1 g/L Yeast

Extract, 0.2 g/L NaCl, 0.2 g/L MgSO 4•7H 20, 4 mg/L FeCl 3, 0.66 g/L K 2HPO 4•3H 20, 10 g/L mannitol, 15 g/L agar) including kanamycin (50 mg/L) were analyzed for the presence of the respective plasmid by restriction digest. The plasmid p7002G10H/DXS was electroporated into Agrobacterium tumefaciens strain GV3101 carrying the plasmid pPZPROL containing the rolABC genes (Hong et al. 2006a). Transformed colonies were screened on LB plates including spectinomycin (100 mg/L) and kanamycin (50 mg/L). Restriction digest was used to analyze the presence of the p7002G10H/DXS. A single colony was then used to start a 5 mL culture grown at 28 oC and 200 rpm for 36 hours in liquid media. Scissors were dipped in the culture and used to infect aseptically grown plants as previously described (Bhadra et al. 1993). After six weeks, hairy roots were excised from the plants and selected on solid and liquid media as described except that 30 mg/L hygromycin was added to the first solid subculture to select for clones carrying the transgenes of interest.

Hairy Root Culture Conditions

Hairy roots were grown in a filter-sterilized solution of 30 g/L sucrose (Sigma), half strength Gamborg’s B5 salts (Sigma), and full strength Gamborg’s vitamins (Sigma) adjusted to a pH of 5.7. Cultures were initiated by placing five tips into a 250 mL Erlenmeyer flask with 50 mL of media. The cultures were grown at 26 oC at 100 rpm in the dark. Solid media 232

plates were made from 30 g/L sucrose, half strength Gamborg’s B5 salts, full strength

Gamborg’s vitamins (pH 5.7), and 6 g/L agar (Sigma).

Genomic PCR Analysis

Genomic DNA was extracted from hairy root cultures using the GenElute Plant

Genomic DNA Miniprep Kit (Sigma) according to the manufacturer’s instructions. One primer specific to the inducible promoter region outside the gene and one primer specific to a region inside the gene were used to confirm the insertion of each gene into the genome.

ConfGAL1 is specific to the inducible promoter region: 5’-

AGCTTGCATGCCGGTCGACTCTAGAGGATCC-3’. ConfASA is specific to AS α: 5’-

TCACAAATGCAGATTCAGCCAAGTCGATGGCTCGAG-3’. ConfDXS is specific to

DXS: 5’-TCAAAACAGAGCTTCCCTTGGTGCAC-3’. ConfG10H is specific to G10H: 5’-

CACAGTCCTTAGTGCCAATGGCAACC-3’. The expected PCR band size is ~2.1 kb for

AS α, ~1.7 kb for G10H, and ~2.5 kb for DXS. Taq polymerase was used to perform the

PCR with the following conditions: 95 °C for 1 min followed by 30 cycles of 94 °C for 1 min, 55 °C for 1 min, and 72 °C for 2 min with a final extension time of 10 min at 72 °C.

RNA Isolation and Northern Analysis

Hairy root flask cultures that were approximately four weeks old were used for transcriptional induction studies. A 5 mM stock solution of dexamethasone was used to induce each cell line with ethanol added to the uninduced controls. Isolation of total RNA from hairy roots was performed using Trizol (Invitrogen) according to manufacturer’s instructions. RNA was quantified by spectrophotometer according to absorbance at 260 nm and an ethidium bromide stained test gel used to verify the quality of RNA. 12 g of total

RNA were loaded per well, and northerns were performed according to a reference protocol 233

(Brown and Mackey 1997). All genes to be tested had been cloned into plasmids, and the relevant section was removed by restriction digest and gel-purified with a Qiagen QIAEX II kit. Probes were then made using Stratagene Prime-It II kit.

Induction Study and HPLC analysis

Hairy root cultures were treated with 3 M dexamethasone (induced cultures) or with an equal volume ethanol (uninduced cultures) as a negative control during late exponential growth phase and harvested 72 hrs later (Hughes et al. 2004a). The fresh weight of the harvested hairy root cultures were measured after cultures were blotted to remove excess media. The cultures were then frozen at -80 °C. The dry weight was recorded after lyphoilization. Approximately 50 mg dry weight of the ground tissue was extracted in 25 mL of methanol by ultrasonication for 10 min (Model W-225, Heat Systems. Ultrasonics Inc.,

USA). The extracts were clarified by centrifugation at 1,300g for 15 min at 4 °C. The supernatants were concentrated to 2 mL using a vortex evaporator, and passed through a 0.22

m nylon filter (13 mm). 10 L of each samples was analyzed for the following metabolites: tryptophan, tryptamine, ajmalicine, serpentine, catharanthine, hörhammericine, lochnericine, and tabersonine on the HPLC as previously described (Peebles et al. 2005).

LCMS analysis

LCMS analysis was performed at the Mass Spectrometry Consortium for the Life

Sciences facility at the University of Minnesota. The positive ion electrospray mass spectra were obtained using the Phenomenex Luna 5  C18(2) HPLC column (250x4.6 mm) with a

Thermo Finnigan LCQ ion trap mass spectrometer and a 20 L injection. The system was also outfitted with a TSP UV6000 for PDA analysis. Two solvents at a flow rate of 0.7 mL/min were used: A (95% H 2O/ 5% MeCN/ 0.2% acetic acid) and B (MeCN/0.2 % acetic 234

acid). From 0 to 10 minutes, the ratio was 84:16. From 10 to 25 minutes, it was changed to

62:38. From 25 to 40 minutes, it was linearly changed to 10:90 where it was maintained for

20 minutes. The conditions were returned to the starting ratio and the column equilibrated.

150 L/min were sent to the MS for analysis.

Results

Hairy root cultures were generated by infecting C. roseus seedlings with A. rhizogenes strain ATCC 15834 carrying the Ri plasmid and p7002DXS, p7002G10H, or p7002ASA/DXS or A. tumefaciens strain GV3101 carrying the plasmid pPZPROL containing the rolABC genes (Hong et al. 2006a) and p7002G10H/DXS. The resulting hairy roots were screened on hygromycin selection plates and adapted to liquid media for several generations. The pTA7002 plasmid contains a glucocorticoid-inducible promoter system which uses the constitutive CaMV35S promoter to drive the expression of a glucocorticoid- inducible transcription factor (GVG). This promoter system has previously been used to induce the expression of several genes within C. roseus hairy roots (Hong et al. 2006b;

Hughes et al. 2004a; Hughes et al. 2004b; Hughes et al. 2002). Each gene introduced into C. roseus in this study is under control of this glucocorticoid-inducible promoter system. The p7002DXS plasmid contains a fully characterized Arabidopsis DXS gene (Estevez et al.

2001; Estevez et al. 2000). The p7002G10H plasmid contains the C. roseus G10H gene

(Collu et al. 2001). The p7002ASA plasmid contains an Arabidopsis AS α gene with a point mutation to confer feedback resistance to tryptophan (Hughes et al. 2004a; Li and Last 1996).

The p7002ASA/DXS and p7002G10H/DXS plasmids contain two genes that are individually controlled by the same glucocorticoid-inducible promoter. 235

As described earlier, the use of precursor feeding studies to determine limiting steps within the TIA pathway has lead to mixed results suggesting that both the indole and terpenoid pathways could potentially limit the flux toward TIA metabolite production. To explore in greater detail which pathway limits these fluxes and how to overcome these limitations, a series of hairy root lines expressing known or potential rate limiting genes was created. Hairy root line EHIASA-1 was previously shown to have inducible expression of a feedback insensitive ASA (Hughes et al. 2004a) from the indole pathway. While the increase in feedback insensitive ASA lead to increased pools of the TIA precursors, tryptophan and tryptamine (Table B.1), this did not result in a significant increase (p<0.05) in TIA metabolites (Table B.2). In fact, two TIA metabolites, tabersonine and hörhammericine, exhibited a significant decrease (p<0.05) in concentrations.

A fast growing hairy root line, EHIDXS-4-1, which showed strong induction of the terpenoid gene DXS, was chosen for further analysis. Northern blot analysis of EHIDXS-4-1 showed the inducible expression of DXS upon treatment with dexamethasone (Figure B.2).

Ubiquitin 3 was used as the loading control for both the un-induced and induced clones.

These results were compared to the results from our previously reported negative control line

EHINC-12-1 (Hughes et al. 2004a). Significant browning of the culture and media was observed on induction. This browning may be due to nonspecific elicitation. The effect of overexpression of DXS on TIA metabolites was mixed with a significant increase (p<0.05) in ajmalicine and lochnericine concentrations and a significant decrease (p<0.05) in tabersonine and hörhammericine concentrations (Table B.2).

Numerous attempts at generating a hairy root line capable of overexpressing the terpenoid gene G10H under control of a glucocorticoid-inducible promoter failed. While the 236

integration of both GVG and G10H could be demonstrated, an increase in G10H mRNA levels could not be seen upon induction. As a control, an increase in GVG transcripts could be seen upon induction (data not shown). High levels of G10H naturally occur within the roots and young leaves of C. roseus plants (Burlat et al. 2004). The native level of G10H expression may be highly regulated and thus an increase in the inducible expression of G10H might be balanced by a decrease in native G10H expression. The regulation mechanism of

G10H is relatively unknown although recently 3 sites for binding of unknown transcriptional enhancers were discovered within the promoter region (Suttipanta et al. 2007).

The individual overexpression of the terpenoid genes DXS and G10H resulted in mixed results in regards to the accumulation of TIA metabolite pools. Considering their location with respect to the IPP/DMAPP branch point (Figure B.1), the precursors for the various classes of terpenoid compounds, it is conceivable that the overexpression of one gene alone is unable to overcome the regulation around this branch point while the overexpression of two genes may act in concert to push and pull the flux toward the TIA metabolites. The presence of an inducible G10H and DXS was confirmed by genomic PCR in the best performing hairy root line G10H/DXS-21 (Figure B.3). The inducible overexpression of

G10H and DXS lead to a significant increase (p<0.1) in the concentrations of ajmalicine, tabersonine, lochnericine, and total TIAs (Table B.2). The overexpression of both G10H and

DXS alleviates the negative impact that DXS overexpression had on some of the TIA metabolites.

The large increase in tryptophan and tryptamine pools that occurred upon the overexpression of ASA (Table B.1) along with a previously published precursor feeding study which showed that AS overexpression coupled with terpenoid feeding resulted in an 237

increase in TIA metabolites (Peebles et al. 2006) lead us to explore the effects of overexpressing the indole gene ASA with the terpenoid gene DXS. The presence of inducible ASA and DXS was confirmed by genomic PCR (Figure B.4). Metabolite analysis of the resulting lines showed that line ASA/DXS-2 exhibited the largest changes in TIA concentrations. This line was chosen for further study. Upon induction of ASA and DXS overexpression, a significant increase (p<0.1) in tabersonine, lochnericine, and hörhammericine was observed (Table B.2). These results differ from the single overexpression lines which show a decrease in several TIA metabolites. The large accumulation in tryptophan and tryptamine seen when overexpressing ASA disappears when both ASA and DXS are overexpressed (Table B.1).

Discussion

DXS overexpression in hairy roots showed mixed results in TIA profiles. Two metabolites, ajmalicine and serpentine, exhibited an increase in concentration while 3 others, tabersonine, lochnericine, and hörhammericine, showed a decrease in concentration upon the overexpression of DXS (Table B.2). These differences make it hard to generalize the overall effect of DXS on TIAs. Another puzzling result is the difference seen in TIA metabolites between DXS overexpression and deoxyxylulose feeding in hairy roots. When deoxyxylulose was fed to hairy roots during late exponential growth phase, tabersonine and lochnericine significantly (p<0.05) increased by 56 and 33%, respectively (Hong et al. 2003).

This differs from the dramatic decrease seen in tabersonine and lochnericine when DXS is overexpressed in hairy roots (Table B.2). One possible explanation for the difference is that

DXS overexpression may have un-intended consequences such that it puts significant stress on central metabolism as it pulls on the pyruvate pools. DXS may also be feedback- 238

inhibited, reducing the flux downstream. A study looking at the role of the MEP pathway in the production of isoprene in Eucalyptus globules provides evidence that DXS may be feedback-inhibited by high levels of DMAPP or DXP (Wolfertz et al. 2004).

These results highlight some of the difficulties of engineering plants. In particular the manipulation of single enzymes to increase flux through the pathway can display mixed results. Single gene manipulations tend to target slow kinetic steps within the pathway or to target irreversible reaction steps that may act as key regulation steps within the pathway. The overexpression of single genes may lead to unintended consequences within the system. For example, phytoene synthase was constitutively expressed in tomato to increase lycopene content. Instead of increasing lycopene, lower levels were observed along with dwarf plants.

Upon closer examination, it was discovered that the increase in phytoene synthase caused a decrease in the flux through the gibberellin pathway, a competing pathway and an important plant hormone (Fray et al. 1995). Thus the increase in phytoene synthase disrupted the hormone balance of the transgenic tomato plant, causing unintended consequences. In contrast, correct targeting of phytoene synthase for expression in canola seeds led to a significant increase in carotenoid concentrations (Shewmaker et al. 1999).

Another potential problem with overexpressing single enzymes that may act as key regulation steps is the potential for feedback inhibition. In some cases feedback inhibition can be overcome by engineering the enzyme to be insensitive to the feedback signal. For example, anthranilate synthase (AS) is feedback-inhibited by tryptophan (Li and Last 1996).

When a feedback-insensitive AS was overexpressed in rice, soybean, and C. roseus , an increase in the concentration of tryptophan within the plant was observed (Dubouzet et al.

2007; Hong et al. 2006b; Hughes et al. 2004a; Inaba et al. 2007). 239

While the overexpression of single genes may increase flux through the pathway, the overexpression of multiple genes may be necessary to achieve significant gains in product accumulation. This may especially be true in highly branched pathways in which precursors can be channeled into a variety of metabolites away from the desired product. These pathways may have complicated feedback and feed-forward regulation mechanisms. In the terpenoid pathway, IPP and DMAPP can be converted into a large array of different metabolites. The overexpression of one of the genes upstream of IPP and DMAPP such as

DXS may increase flux toward all terpenoid metabolites, resulting in little or no gain in the desired product.

Overexpressing enzymes upstream and downstream of a branch point may act as a push-pull mechanism in which flux is pushed toward the branch point and then pulled toward the desired product. For example, overexpressing DXS can push the flux toward IPP and

DMAPP while overexpressing G10H pulls the flux toward the monoterpenoids. C. roseus hairy root line G10H/DXS-21 which overexpresses both DXS and G10H, shows a positive gain in TIA metabolites (Table B.2) compared to the mixed results of overexpressing DXS alone.

This push-pull effect may also be working with the hairy root line overexpressing

AS α and DXS. This time the pull effect could come from an abundant supply of the indole precursor tryptamine which combines with the terpenoid precursor secologanin. The quicker turnover of secologanin could pull the terpenoid flux toward secologanin. This effect could be responsible for increasing the metabolite concentrations of tabersonine, lochnericine, and hörhammericine (Table B.2). The double construct of AS α and DXS performs better than 240

hairy root lines overexpressing either single construct where AS α alone only increases lochnericine and DXS displays mixed results (Table B.2).

Acknowledgements

The authors would like to thank Dr. Nam-Hai Chua at the Rockefeller University for providing the inducible promoter plasmid (pTA7002), Dr. Eugene Nester at the University of

Washington for providing the A. rhizogenes 15834 strain used, Dr. Johan Memelink at the

University of Leiden for providing us with the geraniol 10-hydroxylase sequence prior to publication, and Dr. Patricia Leon from the Universidad Nacional Autonoma de Mexico for providing the cDNA clone of Arabidopsis DXS. This work was supported by funding from the National Science Foundation (Grant Numbers BES-0003730, BES-9906978,

BES0224593, BES0224600, BES0420840, and CBET0729622). Erik Hughes was supported by a training grant from the National Institutes of Health (T32-GM08362). Christie Peebles was supported by the NSF Graduate Fellowship.

Abbreviations

16-OMT - 16-hydroxytabersonine-16-O-methyltransferase

AS − Anthranilate synthase

CPR - Cytochrome P450 reductase

D4H - Desacetoxyvindoline 4-hydroxylase

DAT - Deacetylvindoline acetyltransferase

DMAPP - Dimethylallyl diphosphate

DXP - 1-deoxy-D-xylulose 5-phosphate

DXS - 1-deoxy-D-xylulose 5-phosphate synthase

E4P - Erthrose-4-phosphate 241

G10H - Geraniol 10-hydroxylase

G3P - Glyceraldehydes 3-phosphate

IPP - Isopentenyl diphosphate

PEP - Phosphoenolpyruvate

PRX - Class III Peroxidase

SGD - Strictosidine β-D-glucosidase

SLS - Secologanin synthase

STR - Strictosidine synthase

T16H - Tabersonine 16-hydroxylase

TDC - Tryptophan decarboxylase

TIA - Terpenoid indole alkaloid

Tables

Table B.1 Tryptophan and tryptamine content of 4 different hairy root lines. Cultures were induced with 3 µM dexamethasone (I) or fed with an equivalent volume of ethanol (UI) during exponential growth phase and harvested 72 hrs later. “*” is taken from (Peebles et al. 2006). # indicates significant results (p<0.05) between the UI and I cultures. ## indicates significant results (p<0.1) between the UI and I cultures. Data represent the mean of triplicate cultures ± standard deviation. Tryptophan Tryptamine

(µg/g DW) (µg/g DW) UI 241 ± 20 117 ± 1 EHIASA-1* I 1895 ± 174 # 524 ± 57 # UI 23 ± 16 14 ± 9 EHIDXS-4-1 I 33 ± 15 7 ± 2 UI G10H/DXS-21 I UI 174 ± 1 169 ± 5 ASA/DXS-2 I 162 ± 7 # 219 ± 18 #

242

Table B.2 Terpenoid indole alkaloid content of 4 different hairy root lines. Cultures were induced with 3 µM dexamethasone (I) or fed with an equivalent volume of ethanol (UI) during exponential growth phase and harvested 72 hrs later. “*” is taken from (Peebles et al. 2006). # indicates significant results (p<0.05) between the UI and I cultures. ## indicates significant results (p<0.1) between the UI and I cultures. Data represent the mean of triplicate cultures ± standard deviation.

Ajmalicine Serpentine Catharanthine

(µg/g DW) (µg/g DW) (µg/g DW)

UI 1090 ± 770 837 ± 399 230 ± 77 EHIASA-1* I 1060 ± 140 680 ± 62 274 ± 28 UI 893 ± 77 255 ± 20 212 ± 26 EHIDXS-4-1 I 1489 ± 215 # 284 ± 14 ## 236 ± 104 UI 764 ± 72 337 ± 29 769 ± 66 G10H/DXS-21 I 884 ± 34 # 327 ± 23 761 ± 106 UI 1609 ± 465 1419 ± 204 1047 ± 16 ASA/DXS-2 I 1377 ± 89 1493 ± 111 1171 ± 226

Tabersonine Lochnericine Hörhammericine Total TIA

(µg/g DW) (µg/g DW) (µg/g DW) (µg/g DW)

* UI 1215 ± 291 1962 ± 326 768 ± 168 6102 ± 816 EHIASA-1 I 343 ± 32 # 2507 ± 429 ## 465 ± 121 # 5329 ± 560 UI 169 ± 59 648 ± 94 954 ± 116 3131 ± 154 EHIDXS-4-1 I 57 ± 17 # 965 ± 154 # 440 ± 32 # 3471 ± 448 UI 696 ± 71 1276 ± 157 1524 ± 198 5366 ± 305 G10H/DXS-21 I 912 ± 67 # 1446 ± 71 ## 1557 ± 70 5887 ± 103 # UI 1262 ± 137 1564 ± 133 843 ± 71 7744 ± 1026 ASA/DXS-2 I 1694 ± 53 ## 1983 ± 105 # 1095 ± 221 ## 8814 ± 592

243

Figures

Indole Pathway Monoterpenoid Pathway PEP + E4P pyruvate + G3P DXS 1-Deoxy-D-Xylose-5-phosphate chorismate AS DMAPP IPP anthranilate geraniol CPR G10H 10-hydroxygeraniol tryptophan loganin TDC SLS tryptamine secologanin STR strictosidine SGD 4,21-dehydrogeissoschizine

ajmalicine stemmadenine

serpentine tabersonine catharanthine T16H 16-OMT lochnericine D4H PRX DAT hörhammericine vinblastine vindoline vincristine

19-O-acetyl- hörhammericine

Figure B.1 Terpenoid indole alkaloid pathway. PEP , phosphoenolpyruvate; E4P , erthrose-4-phosphate; AS , anthranilate synthase; TDC , tryptophan decarboxylase; G3P , glyceraldehyde 3-phosphate; DXS , 1-deoxy-D-xylulose 5-phosphate synthase; IPP , isopentenyl diphosphate; DMAPP , dimethylallyl diphosphate; G10H , geraniol 10-hydroxylase; CPR , cytochrome P450 reductase; SLS , secologanin synthase; STR , strictosidine synthase; SGD , strictosidine β-D- glucosidase; T16H , tabersonine 16-hydroxylase; 16-OMT , 16-hydroxytabersonine-16-O-methyltransferase; D4H , desacetoxyvindoline 4-hydroxylase; DAT , deacetylvindoline acetyltransferase; PRX , Peroxidase 244

Figure B.2 Northern analysis of lines EHINC-12-1 and EHIDXS-4-1. EHINC-12-1 is a negative control line containing the element of the glucocorticoid inducible promoter but no gene. EHIDXS-4-1 contains DXS under the control of the glucocorticoid inducible promoter. Lines were induced (I) at 3 M for 72 hours and RNA prepared with ethanol similarly added to uninduced (U) controls. 12 g RNA was loaded and blotting performed. Probes were made for Arabidopsis deoxyxylulose-5-phosphate synthase (DXS), the glucocorticoid transcription factor (GVG), and Ubiquitin 3 (UBQ3).

245

DXS G10H p7002DXS G10H/DXS-1 G10H/DXS-21 ladder kbDNA 1 p7002G10H G10H/DXS-1 G10H/DXS-21

Figure B.3 Genomic PCR of the G10H and DXS gene insert in C. roseus hairy root line G10H/DXS-1 and G10H/DXS-21. One primer used was specific to the inducible promoter region. The second primer used was specific to the gene of interest. The first 3 lanes used primers confGAL1 and confDXS to check for DXS insertion. The last 3 lanes used primers confGAL1 and confG10H to check for G10H insertion. Lanes 1 and 5 are control reactions while lane 4 is a 1 kb DNA ladder (Promega).

246

A. AS α B. DXS Lambda/HIII ASA/DXS-1 ASA/DXS-2 ASA/DXS-4 ASA/DXS-10 ASA/DXS-21 Lambda/HIII ASA/DXS-1 ASA/DXS-2 ASA/DXS-4 ASA/DXS-21 Lambda/HIII ASA/DXS-10

Figure B.4 Genomic PCR of the AS α and DXS gene insert in C. roseus hairy root lines ASA/DXS-1, -2, -4, - 10, and -21. One primer used was specific to the inducible promoter region. The second primer used was specific to the gene of interest. (A.) The first 2 gels used primers confGAL1 and confASA to check for AS α insertion. (B.) The last gel used primers confGAL1 and confDXS to check for DXS insertion. The DNA ladder is Lambda DNA cut with HindIII.

References

Bhadra R, Vani S, Shanks JV. 1993. Production of indole alkaloids by selected hairy root lines of Catharanthus roseus . Biotechnol. Bioeng. 41:581-592.

Brown T, Mackey K. 1997. Northern hybridization of RNA fractionated by agarose- formaldehyde gel electrophoresis. In: Ausubel FM, Brent R, Kingston RE, Moore DD, Seidman JG, Smith JA, Struhl K, editors. Current Protocols in Molecular Biology. New York: John Wiley and Sons. p 4.9.1-4.9.16.

Burlat V, Oudin A, Courtois M, Rideau M, Saint-Pierre B. 2004. Co-expression of three MEP pathway genes and geraniol 10-hydroxylase in internal phloem parenchyma of Catharanthus roseus implicates multicellular translocation of intermediates during the biosynthesis of monoterpene indole alkaloids and isoprenoid-derived primary metabolites. Plant J. 38:131-141. 247

Canel C, Lopes-Cardoso MI, Whitmer S, van der Fits L, Pasquali G, van der Heijden R, Hoge JH, Verpoorte R. 1998. Effects of over-expression of strictosidine synthase and tryptophan decarboxylase on alkaloid production by cell cultures of Catharanthus roseus . Planta 205(3):414-419.

Collu G, Garcia AA, van Der Heijden R, Verpoorte R. 2002. Activity of the cytochrome P450 enzyme geraniol 10-hydroxylase and alkaloid production in plant cell cultures. Plant Sci. 162:165-172.

Collu G, Unver N, Peltenburg-Looman AM, van der Heijden R, Verpoorte R, Memelink J. 2001. Geraniol 10-hydroxylase, a cytochrome P450 enzyme involved in terpenoid indole alkaloid biosynthesis. FEBS Letters 508(2):215-220.

Dagnino D, Schripsema J, Verpoorte R. 1995. Terpenoid indole alkaloid biosynthesis and enzyme activities in two cell lines of Tabernaemontana divaricata . Phytochemistry 39:341-349.

Dubouzet JG, Ishihara A, Matsuda F, Miyagawa H, Iwata H, Wakasa K. 2007. Integrated metabolomic and transcriptomic analyses of high-tryptophan rice expressing a mutant anthranilate synthase alpha subunit. J. Expt. Bot. 58(12):3309-3321.

Estevez JM, Cantero A, Reindl A, Reichler S, Leon P. 2001. 1-deoxy-D-xylulose-5- phosphate synthase, a limiting enzyme for plastidic isoprenoid biosynthesis in plants. J. Biol. Chem. 276:22901-22909.

Estevez JM, Cantero A, Romero C, Kawaide H, Jimenez LF, Kuzuyama T, Seto H, Kamiya Y, Leon P. 2000. Analysis of the expression of Cla1 , a gene that encodes the 1- deoxyxylulose-5-phosphate synthase of the 2-C-methyl-D-erythritol-4-phosphate pathway in Arabidopsis . Plant Physiol. 124:95-103.

Fray RG, Wallace A, Fraser PD, Valero D, Hedden P, Bramley PM, Grierson D. 1995. Constitutive expression of a fruit phytoene synthase gene in transgenic tomatoes causes dwarfism by redirecting metabolites from the gibberellin pathway Plant J. 8:693-701.

Hong SB, Hughes EH, Shanks JV, San KY, Gibson SI. 2003. Role of the non-mevalonate pathway in indole alkaloid production by Catharanthus roseus hairy roots. Biotechnol. Prog. 19(3):1105-1108.

Hong SB, Peebles CA, Shanks JV, San KY, Gibson SI. 2006a. Terpenoid indole alkaloid production by Catharanthus roseus hairy roots induced by Agrobacterium tumefaciens harboring rol ABC genes. Biotechnol. Bioeng. 93(2):386-390.

Hong SB, Peebles CAM, Shanks JV, San KY, Gibson SI. 2006b. Expression of the Arabidopsis feedback-insensitive anthranilate synthase holoenzyme and tryptophan decarboxylase genes in Catharanthus roseus hairy roots. J. Biotechnol. 122(1):28-38. 248

Hughes EH, Hong SB, Gibson SI, Shanks JV, San KY. 2004a. Expression of a feedback- resistant anthranilate synthase in Catharanthus roseus hairy roots provides evidence for tight regulation of terpenoid indole alkaloid levels. Biotechnol. Bioeng. 86(6):718-727.

Hughes EH, Hong SB, Gibson SI, Shanks JV, San KY. 2004b. Metabolic engineering of the indole pathway in Catharanthus roseus hairy roots and increased accumulation of tryptamine and serpentine. Metab. Eng. 6:268-276.

Hughes EH, Hong SB, Shanks JV, San KY, Gibson SI. 2002. Characterization of an inducible promoter system in Catharanthus roseus hairy roots. Biotechnol. Prog. 18(6):1183-1186.

Inaba Y, Brotherton JE, Ulanov A, Widholm JM. 2007. Expression of a feedback insensitive anthranilate synthase gene from tobacco increases free tryptophan in soybean plants. Plant Cell Rep. 26(10):1763-1771.

Kargi F, Ganapathi B. 1991. Effects of precursors and stimulating agents on formation of indole alkaloids by C. roseus in a biofilm reactor. Enzyme Microb. Tech. 13:643-647.

Knobloch KH, Berlin J. 1980. Influence of medium compostition of the formation of secondary compounds in cell suspension cultures of Catharanthus roseus (L.) G. Don. Z . Naturforsch 35c:551-556.

Li J, Last RL. 1996. The Arabidopsis thaliana trp 5 mutant has a feedback-resistant anthranilate synthase and elevated soluble tryptophan. Plant Physiol. 110:51-59.

Lois LM, Rodriguez-Concepcion M, Gallego F, Campos N, Boronat A. 2000. Carotenoid biosynthesis during tomato fruit development: Regulatory role of 1-deoxy-D- xylulose-5-phosphate synthase. Plant J. 22:503-513.

Meijer AH, Verpoorte R, Hoge JHC. 1993. Regulation of enzymes and genes involved in terpenoid indole alkaloid biosynthesis in Catharanthus roseus . J. Plant Res. 2:145- 164.

Mérillon JM, Ouelhazi L, Soireau P, Chenieux JC, Rideau M. 1989. Metabolic changes and alkaloid production in habituated and non-habituated cells of Catharanthus roseus grown in hormone-free medium. Comparing hormone-deprived non-habituated cells with habituated cells. J. Plant. Physiol. 134:54-60.

Moreno PRH, van Der Heijden R, Verpoorte R. 1993. Effect of terpenoid precursor feeding and elicitation on formation of indole alkaloids in cell suspension cultures of Catharanthus roseus . Plant Cell Rep. 12:702-705.

Morgan JA, Shanks JV. 2000. Determination of metabolic rate-limitations by precursor feeding in Catharanthus roseus hairy root cultures. J. Biotechnol. 79(2):137-145. 249

Noble RL. 1990. The discovery of the vinca alkaloids--chemotherapeutic agents against cancer. Biochem. Cell Biol. 68(12):1344-51.

Papon N, Bremer J, Vansiri A, Andreu F, Rideau M, Creche J. 2005. Cytokinin and ethylene control indole alkaloid production at the level of the MEP/terpenoid pathway in Catharanthus roseus suspension cells. Planta Med 71(6):572-574.

Pearce HL, Miller MA. 2005. The evolution of cancer research and drug discovery at Lilly Research Laboratories. Advan. Enzyme Regul. 45:229-255.

Schiel O, Witte L, Berlin J. 1987. Geraniol 10-hydroxylase activity and its realtion to monoterpene indole alkaloid accumulation in cell suspension cultures of Catharanthus roseus . Z. Naturforsch 42:1075-1081.

Shewmaker CK, Sheehy JA, Daley M, Colburn S, Ke DY. 1999. Seed-specific overexpression of phytoene synthase: increase in carotenoids and other metabolic effects Plant J. 20(4):401-412.

Suttipanta N, Pattanaik S, Gunjan S, Xie CH, Littleton J, Yuan L. 2007. Promoter analysis of the Catharanthus roseus geraniol 10-hydroxylase gene involved in terpenoid indole alkaloid biosynthesis. Biochim. Biophys. Acta 1769(2):139-148. van der Fits L, Memelink J. 2000. ORCA3, a jasmonate-responsive transcriptional regulator of plant primary and secondary metabolism. Science 289(5477):295-297. van der Heijden R, Jacobs DI, Snoeijer W, Hallard D, Verpoorte R. 2004. The Catharanthus alkaloids: pharmacognosy and biotechnology. Curr. Med. Chem. 11(5):607-628.

Whitmer S, van der Heijden R, Verpoorte R. 2002a. Effect of precursor feeding on alkaloid accumulation by a tryptophan decarboxylase over-expressing transgenic cell line T22 of Catharanthus roseus . J. Biotechnol. 96(2):193-203.

Whitmer S, van Der Heijden R, Verpoorte R. 2002b. Effect of precursor feeding on alkaloid accumulation by strictosidine synthase over-expressing transgenic cell line S1 of Catharanthus roseus . Plant Cell Tiss. Org. 69:85-93.

Wolfertz M, Sharkey TD, Boland W, Kuhnemann F. 2004. Rapid regulation of the methylerythritol 4-phosphate pathway during isoprene synthesis. Plant Physiol 135(4):1939-1945. 250

Zenk MH, El-Shagi H, Arens H, Stockigt J, Weiler EW, Dues B. 1977. Formation of indole alkaloids serpentine and ajmalicine in cell suspension cultures of C. roseus . In: Barz W, Reinhard E, Zenk MH, editors. Plant tissue culture and its biotechnological applications. Berlin: Springer-Verlag. p 27-44.

251

Appendix C - Ultraviolet and Mass Spectra of Catharanthus roseus

Metabolites

Introduction and Discussion

The ultraviolet absorption spectra (UV spectra) of a metabolite is a useful tool in the identification of metabolites from a crude plant extract. The crude methanolic extract of

Catharanthus roseus contains hundreds of compounds, many of which have absorption peaks in similar ranges. The high concentration of many compounds in the extract can also alter the retention time for a particular metabolite as compared to its standard. When there are many peaks eluting in proximity to your compound of interest, it is vital to confirm the identity of the peak.

The UV spectra of a metabolite can act as a fingerprint for the molecule and can be used to differentiate it from other compounds. Similar metabolites with simple structures can be difficult to differentiate, such as tryptophan (Figure C.1) and tryptamine (Figure C.2), and geraniol (Figure C.3) and 10-hydroxygeraniol (Figure C.4). The enzymatic addition of chemical moieties causes slight changes in the UV spectra. More complex metabolites are easier to differentiate, even when they are very similar, such as strictosidine (Figure C.7) and ajmalicine (Figure C.8). The differences in these two spectra can be seen in the location of the peak absorption wavelengths and the slopes of the peaks. Both of these spectra have a distinct fingerprint at 286 nm where there is a cleft in the spectra. The cleft comes from the precursor metabolite tryptamine and can be seen in additional similar metabolites such as catharanthine (Figure C.10). If an unknown metabolite is found, distinct features like this can help to identify what part of the biosynthetic pathway the molecule originates from. 252

By comparing the UV spectra of a metabolite standard to the metabolite in a crude extract, co-eluting compounds can be detected by new absorption peaks, shifts in maximum absorption, or changes in peak slope. This is useful for detecting co-elution when the co- eluting peak of a metabolite is totally encompassed by the peak of the metabolite of interest, since no peak shoulders or changes in peak slope will be seen in a single wavelength chromatogram.

The mass spectra of a metabolite provides further evidence of its identity. This is especially true amongst related metabolites with very similar UV spectra. Fractioning patterns of the metabolite can reveal structural hints towards identification or classification.

This can be seen in geraniol and 10-hydroxygeraniol with the fractioning of hydroxyl groups

(Figures C.17 and 18) and in loganin and secologanin with the fractioning of the glucose moiety (Figures C.19 and 20). Geraniol ([M+Na] + 177.1 m/z, [M] + 154.2 m/z, [M-OH] +

137.2 m/z); 10-hydroxygeraniol ([M+Na] + 193.1 m/z, [M] + 170.2 m/z, [M-OH] + 153.2 m/z,

+ + + + [M-OH-H2O] 135.2 m/z); loganin ([M+Na] 413.2, [M+H] 391.2, [M+H-Glu] 229.1); secologanin ([M+Na] + 411.2, [M+H] + 389.1, [M+H-Glu] + 227.1). Similar fragmentation for loganin and secologanin was seen in [1].

Materials and Methods

Chemicals

Geraniol (Aldrich), 10-hydroxygeraniol (Aldrich), loganin (Fluka), secologanin

(Fluka), strictosidine (gift), serpentine (Aldrich), ajmalicine (Fluka), catharanthine (Qventas), vindoline (ChemPacific), hörhammericine, tabersonine, vincristine (Sigma), vinblastine

(Sigma), tryptophan (Sigma), and tryptamine (Sigma) were dissolved in methanol and used as HPLC standards. Methanol, acetonitrile, ammonium acetate, and phosphoric acid were 253

HPLC grade (Fisher Scientific). Formic acid (Fluka) and trichloroacetic acid (Fluka) were high purity.

HPLC Analysis of Metabolites

Twenty microliters of the alkaloid standard was injected into a Phenomenex Luna®

C18(2) column (250 x 4.6 mm) using three solvent systems. The Waters high performance liquid chromatography system consisted of two 510 pumps, a 717plus Autosampler, and a

996 Photo Diode Array (PDA) detector. To locate tryptophan and tryptamine peaks, UV detection at 218 nm was used [2, 3]. UV spectra was recorded from 200 to 400 nm with a resolution of 1.2 nm. For the first 12 minutes, a 15:85 mixture of acetonitrile:100 mM phosphoric acid (pH 2) was maintained at a flow rate of 1 ml/min. The column was then washed by ramping to an 85:15 mixture over 15 minutes. The flow was then returned to

15:85 and allowed to re-equilibrate.

For the detection of terpenoid indole alkaloids a second solvent system was used.

Data extracted at 254 nm were used to locate peaks belonging to strictosidine, ajmalicine, serpentine, catharanthine, vindoline, vinblastine, and vincristine. Data extracted at 329 nm were used to locate tabersonine, hörhammericine, and lochnericine. Because we do not have a standard for lochnericine, the UV spectra was recorded from an alkaloid extract of C. roseus and the molecular weight and mass spectra was confirmed by LC-MS. UV spectra were recorded from 200 to 400 nm with a resolution of 1.2 nm. The protocol was adapted from literature to use LC-MS compatible solvents [4]. For the first 5 minutes, at a flow rate of 1 ml/min, the mobile phase was a 30:70 mixture of acetonitrile:100 mM ammonium acetate (pH 7.3). The mobile phase was linearly ramped to 64:36 over the next 10 minutes and maintained at that ratio for 15 minutes. The flow rate was increased to 1.4 ml/min over 5 254

minutes. The ratio was then increased to 80:20 during the next 5 minutes and maintained for

15 minutes. The flow rate and mobile phase ratio were then returned to 1 ml/min and 30:70 and the column was allowed to re-equilibrate.

For detection of iridoid glycosides a third solvent system was used. Data extracted at

235 nm were used to locate loganin and secologanin. UV spectra were recorded from 200 to

400 nm with a resolution of 1.2 nm. The protocol was adapted from [5, 6]. For 30 minutes, at a flow rate of 1 ml/min, the mobile phase was linearly ramped from a 90:10 to a 75:25 mixture of 1% formic acid (v/v)/0.25% trichloroacetic acid (w/v):acetonitrile. The ratio was returned to 90:10 and the column was allowed to re-equilibrate.

Five microliters of the iridoid standard was injected into a Waters Nova-Pak® C18 column (150x2.1 mm). Data extracted at 235 nm were used to locate geraniol and 10- hydroxygeraniol. The protocol was adapted from [7]. UV spectra were recorded from 190 to

400 nm with a resolution of 1.2 nm. Isocratic elution was achieve using a mobile phase of

50:50 methanol:water maintained at a flow rate of 0.2 ml/min for 60 minutes . Analysis was performed with Empower Pro software (Waters).

LC-MS Analysis of Metabolites

The Agilent Technologies 1100 series liquid chromatography (LC) system with a binary pump, a temperature-controlled autosampler, and a diode-array detector mated with an

Analysis was performed with ChemStation software (Agilent Technologies). The LC-MS analysis was performed at the W. M. Keck Metabolomics Research Laboratory. 255

Acknowledgements

(CBET-0729753 (JVS), CBET-0729622 (K-YS), and CBET-0729625 (SIG)) and the Roy J.

Carver Graduate Research Training Fellowship in Molecular Biophysics (GWS).

Figures

218.0 1.80

1.60

1.40

1.20

1.00 AU 0.80

0.60 277.5

0.40

0.20

0.00

220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm

Figure C.1 UV spectra of tryptophan standard. 256

218.0

1.40

1.20

1.00

0.80 AU

0.60

0.40 277.5

0.20

0.00

220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm

Figure C.2 UV spectra of tryptamine standard.

0.140 199.1 0.130

0.120

0.110

0.100

0.090

0.080

0.070 AU 0.060

0.050

0.040

0.030

0.020

0.010

0.000

200.00 220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm

Figure C.3 UV spectra of geraniol standard. 257

0.22 199.1

0.20

0.18

0.16

0.14

0.12

AU 0.10

0.08

0.06

0.04

0.02

0.00

200.00 220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm

Figure C.4 UV spectra of 10-hydroxygeraniol standard.

240.5 0.70

0.60

0.50

0.40 AU

0.30 222.8

0.20

0.10

0.00

220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm

Figure C.5 UV spectra of loganin standard. 258

0.24 239.4 0.22

0.20

0.18

0.16

0.14

0.12 AU 221.6 0.10

0.08

0.06

0.04

0.02

0.00

220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm

Figure C.6 UV spectra of secologanin standard.

221.6 0.80

0.70

0.60

0.50

AU 0.40

0.30

0.20

0.10

0.00

220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm

Figure C.7 UV spectra of strictosidine standard. 259

225.1 2.00

1.80

1.60

1.40

1.20

AU 1.00

0.80

0.60 278.7 0.40

0.20

0.00

220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm

Figure C.8 UV spectra of ajmalicine standard.

1.10 247.7

1.00

0.90

0.80

0.70 208.5 305.0 0.60 AU 0.50

0.40

0.30

0.20 362.7 0.10

0.00 220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm

Figure C.9 UV spectra of serpentine standard. 260

2.00 225.1

1.80

1.60

1.40

1.20

1.00 AU

0.80 281.1 0.60

0.40

0.20

0.00

220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm

Figure C.10 UV spectra of catharanthine standard.

326.6 0.28 0.26 0.24 0.22 297.8 0.20 223.9 0.18 0.16

AU 0.14 0.12 0.10 0.08 0.06 0.04 0.02 0.00

220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm

Figure C.11 UV spectra of tabersonine standard. 261

0.110 326.6 0.100

0.090

0.080 297.8 0.070 225.1 0.060

AU 0.050

0.040

0.030

0.020

0.010

0.000

220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm

Figure C.12 UV spectra of lochnericine from a crude extract of Catharanthus roseus hairy roots.

0.130 325.4

0.120

0.110

0.100

0.090 297.8

0.080 225.1 0.070

AU 0.060

0.050

0.040

0.030

0.020

0.010

0.000

220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm

Figure C.13 UV spectra of horhammericine standard. 262

1.40 215.6 1.30

1.20

1.10

1.00

0.90

0.80

0.70 AU 0.60 251.2

0.50 303.8 0.40

0.30

0.20

0.10

0.00

220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm

Figure C.14 UV spectra of vindoline standard.

215.6 0.35

0.30

0.25

0.20 AU

0.15 265.5

0.10

0.05

0.00

220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm

Figure C.15 UV spectra of vinblastine standard. 263

0.90 220.4

0.80

0.70

0.60

0.50

AU 0.40

253.6 295.4 0.30

0.20

0.10

0.00

220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm

Figure C.16 UV spectra of vincristine standard.

Geraniol Full Scan intensity 1000000.0

900000.0 137.2 800000.0

700000.0 600000.0 177.1 500000.0 400000.0 300000.0 102.3 200000.0 81.3 100000.0 154.2 0.0 50 100 150 200 m/z

Figure C.17 Mass spectra of geraniol standard. 264

10-hydroxygeraniol Full Scan intensity 7000000.0 193.1

6000000.0

135.2 5000000.0

4000000.0

3000000.0 153.2 2000000.0 107.2 123.2 170.2 1000000.0 93.3

0.0 50 100 150 200 m/z

Figure C.18 Mass spectra of 10-hydroxygeraniol standard.

Loganin Full Scan intensity

180000.0 229.1

160000.0

140000.0

120000.0 179.1 157.1 100000.0 282.9 284.9 116.1 80000.0 134.1 413.2 60000.0 139.1 211.1 303.0 98.2 196.0 259.9 40000.0 320.9 352.4 20000.0 391.2 0.0 50 100 150 200 250 300 350 400 450 m/z

Figure C.19 Mass spectra of loganin standard. 265

Secloganin Full Scan intensity

180000.0

160000.0

140000.0 165.1 227.1 120000.0

100000.0 157.1 209.1 411.2 80000.0 283.0 284.9 181.1 60000.0 107.2 139.1 195.1 303.0 116.1 40000.0 318.9 352.4 20000.0 389.1

0.0 50 100 150 200 250 300 350 400 450 m/z

Figure C.20 Mass spectra of secologanin standard.

References

1. Irmler, S., G. Schroder, B. St-Pierre, N.P. Crouch, M. Hotze, J. Schmidt, D. Strack, U. Matern, and J. Schroder. (2000) Indole Alkaloid Biosynthesis in Catharanthus roseus : New Enzyme Activities and Identification of Cytochrome P450 CYP72A1 as Secologanin Synthase . Plant J. 24 (6): 797-804. 2. Tikhomiroff, C. and M. Jolicoeur. (2002) Screening of Catharanthus roseus Secondary Metabolites by High-Performance Liquid Chromatography . J Chrom A . 955 : 87-93. 3. Hughes, E.H., S.-B. Hong, S.I. Gibson, J.V. Shanks, and K.-Y. San. (2004) Expression of a Feedback-resistant Anthranilate Synthase in Catharanthus roseus Hairy Roots Provides Evidence for Tight Regulation of Terpenoid Indole Alkaloid Levels . Biotechnol. Bioeng. 86 (6): 718-727. 4. Peebles, C.A.M., S.-B. Hong, S.I. Gibson, J.V. Shanks, and K.-Y. San. (2005) Transient Effects of Overexpressing Anthranilate Synthase α and β Subunits in Catharanthus roseus Hairy Roots . Biotechnol. Prog. 21 : 1572-1578. 5. Yamamoto, H., N. Katano, A. Ooi, and K. Inoue. (1999) Transformation of Loganin and 7-deoxyloganin into Secologanin by Lonicera japonica Cell Suspension Cultures . Phytochem . 50 : 417-422. 6. Dagnino, D., J. Schripsema, and R. Verpoorte. (1996) Analysis of Several Iridoid and Indole Precursers of Terpenoid Indole Alkaloids with a Single HPLC run . Planta Med . 62 : 278-280. 266

7. Collu, G., H.H.J. Bink, P.R.H. Moreno, R. van der Heijden, and R. Verpoorte. (1999) Determination of the Activity of the Cytochrome p450 Enzyme Geraniol 10- Hydroxylase in Plants by High-performance Liquid Chromatography . Phytochem. Anal. 10 : 314-318.

267

Appendix D - Terpenoid Indole Alkaloid Extraction and Purification from

Catharanthus roseus Hairy Root Tissue

Adapted from a report submitted as completion of honors project.

Diane C. Brown 1,2 , Guy W. Sander 1,3 , and Jacqueline V. Shanks 1,4

1Department of Chemical and Biological Engineering, Iowa State University, Ames, IA

2Primary researcher and author

3Researcher and author

4Principal investigator

Abstract

Plant metabolic engineering of Catharanthus roseus may provide improved ways of producing vincristine (Oncovin®) and vinblastine (Velbe®) which are used in the treatment of cancer. The tabersonine branch point is very important for the synthesis of vindoline, which is a key precursor to vincristine and vinblastine. Genetically modified C. roseus hairy root lines are used to analyze the flux of metabolites at the tabersonine branch point. Genes inserted by recombinant DNA techniques can amplify or suppress flux through existing metabolic pathways and can create new metabolic pathways for desired products that are not expressed in the wild-type line. By suppressing flux to undesired products like hörhammericine, tabersonine flux can be diverted to the vindoline-vinblastine-vincristine pathway. One of the current research challenges is the lack of commercially available standards to quantify low-level metabolites at the tabersonine branch point. A biomass extraction and analytical HPLC protocol was adapted for semi-preparative scale in order to 268

obtain tabersonine, lochnericine, and hörhammericine standards from C. roseus hairy root tissue. Standards will enable improved study of the metabolic pathways originating at the tabersonine branch point and will allow for the determination of previously unidentified tabersonine-like compounds.

Keywords: Catharanthus roseus , hairy roots, alkaloid standards, semi-preparative

Introduction

Catharanthus roseus produces anti-cancer compounds vincristine (Oncovin®) and vinblastine (Velbe®) in small quantities (Figure D.1). Plant metabolic engineering may offer methods for improved production of these alkaloids and other pharmaceutical compounds.

Natural compounds are an important source material for pharmaceuticals. Of 1184 New

Chemical Entities introduced from January 1981 to June 2006, only 30% were completely synthetic, and of 175 anticancer drugs introduced from the 1940s to July 2006, only 24% were completely synthetic (Newman and Cragg, 2007). Therefore, plant metabolic engineering may have widespread application in improving the production of pharmaceutical compounds.

Plant metabolic engineering can be used to improve yield and productivity, create pathways to generate compounds not generally produced by the cell, or increase the tolerance of the organism to inhibitory conditions. While both plant metabolic engineering and genetic engineering use recombinant DNA techniques, plant metabolic engineering is characterized by a specific biochemical goal achieved through an iterative process of DNA modification and metabolic flux analysis (Bailey, 1991). Plant metabolic engineering has been used 269

successfully to increase unsaturated, long-chain fatty acid production by oilseed rape

(Brassica napus ) and flavonoid production by tomatoes (Capell and Christou, 2004). An important tool of metabolic engineering is changing the flux at branch points in the metabolic pathway (Stephanopoulos, 1991). Researchers manipulate metabolic pathways to maximize flux to desired products while suppressing flux to undesired products. However, the complexity of living organisms presents a challenge to researchers because in vivo enzymes operate in complex pathways with layers of regulation rather than a single rate-limiting step

(Stephanopoulos, 1998).

Hairy root tissue is a useful model system for metabolic engineering (Shanks and

Morgan, 1999). Hairy root tissue is created by infection of seedlings of C. roseus by

Agrobacterium rhizogenes and can be maintained in hormone-free liquid media (Bhadra et al. , 1993) for many generations with genetic and biochemical stability (Peebles et al. , 2007).

However, vincristine and vinblastine are not produced in the hairy root tissue (Hughes and

Shanks, 2002).

The lack of commercially available alkaloids to quantify low-level metabolites presents a significant research challenge (Hisiger and Jolicoeur, 2007). Plant metabolic engineering requires an understanding of the metabolic pathways, and alkaloid standards are necessary to identify and quantify compounds in the pathways. Standards will enable improved study of the metabolic pathways originating at the tabersonine branch point (Figure

D.2) and will allow for the determination of previously unidentified co-eluting tabersonine- like compounds.

In this paper, an analytical biomass extraction and high performance liquid chromatography (HPLC) protocol was adapted for semi-preparative scale in order to obtain 270

tabersonine, lochnericine, and hörhammericine standards from C. roseus hairy root tissue. A significant protocol development challenge was minimizing acetonitrile use due to a global shortage. While the demand for acetonitrile by thousands of researchers for HPLC is healthy and growing, production has been in decline. Acetonitrile is produced as a coproduct during acrylonitrile synthesis used to make acrylic fibers and resins used in cars, electronic housings, and small appliances. Supply has also declined at the only two plants in the United

States that produce acetonitrile as a result of production outages due to lightning, hurricane

Ike, and a planned shutdown (Tullo, 2008).

The terpenoid indole alkaloid standards and tabersonine-like unknowns were quantified using an analytical HPLC protocol; Ultraviolet (UV) spectra and chromatograms were collected for all fractions collected. Liquid chromatography and mass spectrometry

(LC-MS) of the alkaloid standards and the tabersonine-like unknowns will provide additional characterization of the compounds as well as a measure of purity.

Material and Methods

Semi-preparative Alkaloid Extraction

Dried biomass from hairy root cultures was ground by mortar and pestle and 100 mg dry weight was extracted with 10 ml of methanol with a sonicating probe (Model VC 130PB,

Sonics and Materials, Inc.) for 5 minutes. After 12 minutes in the centrifuge at 4000 rpm at

4°C, the supernatant was extracted. The supernatants from 2 samples were combined, filtered using a 0.45 m nylon filter (25 mm, P.J. Cobert) and dried using a rotary evaporator

(RapidVap, Labconco) at 30°C, 170 mbar, and 40 rpm. The dried samples were reconstituted in 3 ml of methanol, combined, and again dried using a rotary evaporator to further concentrate the samples. The dried samples were reconstituted in 1 ml and filtered using a 271

0.22 m nylon filter (13 mm, P.J. Cobert).

Analytical HPLC Analysis

Forty microliters of the alkaloid extract was injected into a Phenomenex Luna®

C18(2) column (250 x 4.6 mm). The Waters high performance liquid chromatography system consisted of two 510 pumps, a 717plus Autosampler, and a 996 PDA detector. Data extracted at 329 nm were used to identify tabersonine, hörhammericine, lochnericine, and tabersonine-like unknowns using retention time standards and comparison to a tabersonine standard curve (Peebles et al. , 2005; Morgan et al. , 2000). The protocol was adapted from

Peebles et al. (2005) to use LC-MS compatible solvents. For the first 5 minutes, at a flow rate of 1 ml/min, the mobile phase was a 30:70 mixture of acetonitrile:100 mM ammonium acetate (pH 7.3). The mobile phase was linearly ramped to 64:36 over the next 10 minutes and maintained at that ratio for 15 minutes. The flow rate was increased to 1.4 ml/min over 5 minutes. The ratio was then increased to 80:20 during the next 5 minutes and maintained for

15 minutes. The flow rate and mobile phase ratio were then returned to 1 ml/min and 30:70 and the column was allowed to re-equilibrate.

Analytical-scale HPLC Method with Preferential Separation of Tabersonine-like Compounds

Ten microliters of the semi-preparative alkaloid extract was injected into a

Phenomenex Luna® C18(2) column (250 x 4.6 mm). The same HPLC system used for the analytical method was used. For the detection of terpenoid indole alkaloids data extracted at

254 nm were used to locate strictosidine, ajmalicine, serpentine, and catharanthine as compared to standards. Data extracted at 329 nm were used to locate tabersonine, hörhammericine, and lochnericine using retention time standards. The protocol was adapted from Peebles et al. (2005) to be LC-MS compatible and to use methanol rather than 272

acetonitrile. For the first minute, at a flow rate of 1 ml/min, the mobile phase was a 30:70 mixture of methanol:100 mM ammonium acetate (pH 7.3). The mobile phase was linearly ramped to 64:36 over the next 10 minutes and maintained at that ratio for 24 minutes. The ratio was then linearly ramped to 80:20 during the next 6 minutes and maintained for 22 minutes. The mobile phase ratio was then returned to 30:70 and the column was allowed to re-equilibrate.

Semi-preparative-scale HPLC Method for Fraction Collection of Alkaloids

250 microliters of the semi-preparative alkaloid extract was injected into a

Phenomenex Luna® C18(2) column (250 x 21.2 mm). The same HPLC system as the analytical method was used with the addition of a Waters Fraction Collector. For the detection of terpenoid indole alkaloids, data extracted at 254 nm were used to locate strictosidine, ajmalicine, serpentine, and catharanthine as compared to standards. Data extracted at 329 nm were used to locate tabersonine, hörhammericine, and lochnericine using retention time standards, along with other tabersonine-like compounds. The protocol was scaled up from the analytical-scale method designed for the selection of tabersonine-like compounds. For the first 1.4 minutes, at a flow rate of 12 ml/min, the mobile phase was a

30:70 mixture of methanol:100 mM ammonium acetate (pH 7.3). The mobile phase was linearly ramped to 64:36 over the next 14.2 minutes and maintained at that ratio for 34 minutes. The ratio was then linearly ramped to 80:20 during the next 8.5 minutes and maintained for 31.5 minutes. The mobile phase ratio was then returned to 30:70 and the column was allowed to re-equilibrate for 16.5 minutes. 273

The collected fractions were dried on a rotary evaporator (RapidVap, Labconco), reconstituted in 1 ml of methanol, filtered using a 0.22 m nylon filter (13 mm, P.J. Cobert), and analyzed by the analytical HPLC method.

Results and Discussion

An analytical biomass extraction and HPLC protocol was adapted for semi- preparative scale in order to obtain tabersonine, lochnericine, and hörhammericine standards from C. roseus hairy root tissue. The protocol was developed to maximize the purity and yield of the alkaloids and to minimize the volume of solvent used and the time needed to prepare the standards. A discussion of the challenges of scale-up follows below.

Challenges of Alkaloid Extraction Scale-up

While biomass is readily available, solvent and time are not. The alkaloid extraction protocol designed to minimize time and solvent was determined using an experiment to compare the effects of extracted biomass weight (50 mg or 100 mg), length of extraction time

(5, 10, or 20 min), and the number of extractions (1 or 2). The micrograms of alkaloid collected per gram of dry weight were determined using the analytical HPLC protocol. The alkaloid yields for each extraction method were compared with the analytical extraction protocol (50 mg, 10 min, 2 extractions). The protocol that minimized solvent and time used

100 mg dry weight of biomass, 5 minutes of sonication time with the sonicating probe, and a single extraction. When compared with the analytical protocol, this protocol can extract 60% of the mass of alkaloid but requires only ¼ the volume of methanol solvent, ¼ the sonication time, and ½ the time for centrifugation as the analytical protocol.

Challenges of HPLC Scale-up

The analytical HPLC protocol was modified and then scaled-up for semi-preparative 274

use. The first challenge in modifying the protocol was an urgent need to minimize acetonitrile used in the mobile phase due to a global shortage (Tullo, 2008). The impact of replacing 100% acetonitrile with methanol was evaluated by running analytical scale HPLC for volume ratios ranging from 100% acetonitrile to 100% methanol in 10% intervals (Figure

D.4). The impact of changing the composition of the solvent was evaluated at 11 volume ratios in order to determine the presence of compounds that would co-elute with tabersonine, lochnericine, and hörhammericine. Switching the solvent increased the retention times for tabersonine, lochnericine, and hörhammericine (tabersonine increased from 38 to 49 minutes); however, a high peak resolution was maintained for all three alkaloids of interest and several unknown tabersonine-like compounds.

The pumps were a limiting factor during the scale-up. While the analytical scale protocol included ramping flow rates to reduce the duration of the protocol, the pumps would not be able to maintain increased flow rates at the semi-preparative scale. Changes were also made to the length of time for the solvent gradients; the length of the 30:70 and 80:20 methanol:100 mM ammonium acetate solvent ratios was decreased in order to shorten protocol length without any observable loss in peak resolution for tabersonine, lochnericine, and hörhammericine. The length of the 64:36 methanol:100 mM ammonium acetate solvent ratios was increased in order to maximize peak separation of the lochnericine and ajmalicine peaks.

The HPLC protocol was scaled-up from an analytical scale flow rate of 1 ml/min to a semi-preparative scale flow rate of 12 ml/min (Figure D.5). Collection times were determined to maximize the alkaloid collected and minimize impurities. The time on the fraction collector clock demonstrated a linear deviation from the computer clock; therefore, 275

collection times were modified using a linear correlation to correct the error. Fractions were collected for tabersonine (Figure D.7), lochnericine (Figure D.8), and hörhammericine

(Figure D.9) as well as 4 compounds with UV spectra similar to tabersonine that were collected for future study and identification (Figures D.10 through 13). The UV spectra of a tabersonine standard (Figure D.6) is provided for comparison.

The fractions were dried using a rotary evaporator and each alkaloid was combined and reconstituted in 1 ml of methanol. The alkaloids and tabersonine-like unknowns were quantified using the analytical HPLC protocol and a tabersonine standard (Table D.1). The

UV spectra and chromatograms were determined for all the collected fractions in order to verify the purity of the alkaloid standards and characterize the unknowns for future study.

The alkaloids and tabersonine-like unknowns will be analyzed with LC-MS to provide an additional measure of purity and for identification.

Acknowledgements

The authors express their gratitude to Dr. Christie A.M. Peebles for helping to develop the LC-MS compatible analytical HPLC protocol.

Tables

Table D.1 Concentrations of hörhammericine, lochnericine, tabersonine, and tabersonine-like unknowns. Fractions collected from a single 250 l injection. Concentration calculated using a tabersonine standard curve. Alkaloid Concen tration (µg/ml) Hörhammericine 22.9 Lochnericine 2.09 Tabersonine 9.25 Unknown-1 17.5 Unknown-2 0.537 Unknown-3 33.9 Unknown-4 3.34 276

Figures

OH a

N N H H H3CO2C

H3CO OCOCH3

N CO CH H 2 3 OH H3C

OH b

N N H H H3CO2C

H3CO OCOCH3

N CO CH H 2 3 O OH

Figure D.1 Structure of vinblastine (a) and vincristine (b). (Figure adapted from: Kanehisa and Gota (2000), Kanehisa et al. (2006), and Kanehisa et al. (2008))

277

4,21-dehydrogeissoschizine Vinblastine Vincristine Cathenamine Stemmadenine

Ajmalicine Catharanthine

T16H 16OMT NMT D4H DAT Serpentine Tabersonine Vindoline T6,7E

Lochnericine 6,7-dehydrominovincinine MAT Hörhammericine 6,7-dehydroechitovenine MAT 19-acetoxyhörhammericine Figure D.2 Biosynthesis of terpenoid indole alkaloids in Catharanthus roseus . T16H , tabersonine 16-hydroxylase; 16OMT , 16-hydroxytabersonine-16-O-methyltransferase; NMT , 16- methoxy-2,3-dihydro-3-hydroxytabersonine-N-methyltransferase; D4H , desacetoxyvindoline-4-hydroxylase; DAT , deacetylvindoline-4-O-acetyltransferase; T6,7E , tabersonine-6,7-epoxidase; MAT , minvincinine-19-O- acetyltransferase.

1 0.8 0.6 0.4 0.2 0 Loc Hor Tab Loc Hor Tab Loc Hor Tab Loc Hor Tab

100Loc mgHor DW Tab 50 Loc mg Hor DW Tab 100 mg DW 50 mg DW 100 mg DW 50 mg DW 100 mg DW 50 mg DW 100 mg DW 50 mg DW 100 mg DW 50 mg DW

5 min 10 min 20 min

Ratio of μg/g DW to Max μg/g μg/g Max to DW DWofμg/g Ratio Extraction Protocol

1 extraction 2 extractions

Figure D.3 Efficiency of alkaloid extraction protocols. (Loc, lochnericine; Hor, hörhammericine; Tab, tabersonine; DW, dry weight; max g/g, yield for analytical protocol of 50 mg, 10 min, 2 extractions) 278

0.04 100% methanol

A U 0.02 Hor Loc Tab 0.00

0.04 50% acetonitrile

A U 0.02 50% methanol Hor Loc Tab 0.00 0.10 100% acetonitrile

A U 0.05 Hor Loc Tab

0.00 5.00 10.00 15.00 20.00 25.00 30.00 35.00 40.00 45.00 50.00 Minutes Figure D.4 Chromatograms at 329 nm for increasing fractions of methanol in the HPLC mobile phase. These chromatograms demonstrate that changing the HPLC solvent from 100% acetonitrile to 100% methanol increases the retention times of hörhammericine, lochnericine, and tabersonine and broadens the peaks.

279

0.050 Analytical

0.040

0.030

AU Hor Loc Tab 0.020

0.010

0.000

5.00 10.00 15.00 20.00 25.00 30.00 35.00 40.00 45.00 50.00 55.00 Minutes Semi-Prep 0.020

0.015

AU 0.010 Hor Loc Tab

0.005

0.000

10.00 20.00 30.00 40.00 50.00 60.00 70.00 80.00 Minutes Figure D.5 Chromatograms of the analytical and semi-preparative scale HPLC methods at 329 nm. The preparative scale method performed similar to the analytical scale method. Note the difference in time scales.

280

326.6 0.28 0.26 0.24 0.22 297.8 0.20 223.9 0.18 0.16

AU 0.14 0.12 0.10 0.08 0.06 0.04 0.02 0.00

220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm Figure D.6 UV spectra of tabersonine standard.

0.050 326.6

0.045

0.040

0.035 223.9

0.030

0.025 AU

0.020

0.015

0.010

0.005

0.000

200.00 220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm Figure D.7 UV spectra of tabersonine fraction collected. 281

325.4 0.16

0.14

0.12 225.1 0.10

AU 0.08

0.06

0.04

0.02

0.00

200.00 220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm Figure D.8 UV spectra of lochnericine fraction collected.

325.4 0.35

0.30

0.25 225.1 0.20 AU 0.15

0.10

0.05

0.00

200.00 220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm Figure D.9 UV spectra of hörhammericine fraction collected.

282

0.12 326.6 225.1 0.10 200.2 293.0

0.08

0.06 AU

0.04

0.02

0.00

200.00 220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm Figure D.10 UV spectra of tabersonine-like unknown-1 fraction collected.

0.006 193.2

0.005

0.004 223.9 325.4 295.4 0.003

0.002

0.001 AU 0.000

-0.001

-0.002

-0.003

-0.004

-0.005 200.00 220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm Figure D.11 UV spectra of tabersonine-like unknown-2 fraction collected.

283

326.6 0.060

0.050

0.040 225.1

AU 0.030

0.020

0.010

0.000

200.00 220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm Figure D.12 UV spectra of tabersonine-like unknown-3 fraction collected.

326.6 0.016

0.014

0.012

0.010 226.3

AU 0.008

0.006

0.004

0.002

0.000

200.00 220.00 240.00 260.00 280.00 300.00 320.00 340.00 360.00 380.00 nm Figure D.13 UV spectra of tabersonine-like unknown-4 fraction collected.

284

References

Bailey JE. 21 June 1991. Toward a science of metabolic engineering. Science 252 (5013): 1668.

Bhadra R, Vani S, Shanks JV. 1993. Production of Indole Alkaloids by Selected Hairy Root Lines of Catharanthus roseus. Biotechnol Bioeng 41 (5): 581–592.

Capell T, Christou P. Progress in plant metabolic engineering. Curr Opin in Biotech 15 :148- 154.

Hisiger S, Jolicoeur M.2007. Analysis of Catharanthus roseus alkaloids by HPLC. Phytochem Rev 6:207–234.

Hughes, EH, Hong S-B, Gibson SI, Shanks JV, San K-Y. 2004. Expression of a feedback- resistant anthranilate synthase in Catharanthus roseus hairy roots provides evidence for tight regulation of terpenoid indole alkaloid levels . Biotechnol Bioeng 86 (6): 718- 727.

Hughes, EH, Shanks, JV. 2002. Metabolic Engineering of Plants for Alkaloid Production. Metab Eng 4:41-48.

Kanehisa M and Goto S. (2000) KEGG: Kyoto Encyclopedia of Genes and Genomes . Nucleic Acids Res. 28 : 27-30.

Kanehisa M, Goto S, Hattori M, Aoki-Kinoshita KF, Itoh M, Kawashima S, Katayama T, Araki M, and Hirakawa M. (2006) From genomics to chemical genomics: new developments in KEGG . Nucleic Acids Res. 34 : D354-D357.

Kanehisa M, Araki M, Goto S, Hattori M, Hirakawa M, Itoh M, Katayama T, Kawashima S, Okuda S, Tokimatsu T, and Yamanishi Y. (2008) KEGG for linking genomes to life and the environment . Nucleic Acids Res. 36 : D480-D484.

Liu DH, Jin HB, Chen YH, Cui LJ, Ren WW, Gong YF, Tang KX 2007. Terpenoid indole alkaloids biosynthesis and metabolic engineering in Catharanthus roseus. J Integr Plant Biol 49 (7):961–974.

Newman DJ, Cragg GM. 2007. Natural Products as Sources of New Drugs over the Last 25 Years. J Nat Prod 70 (3): 461-477.

Morgan JA, Barney CS, Penn AH, and Shanks JV. 2000. Effects of buffered media upon growth and alkaloid production of Catharanthus roseus hairy roots . Appl Microbiol Biotechnol 53 : 262-265.

Peebles CAM, Gibson SI, Shanks JV, San K. 2007. Long-Term Maintenance of a Transgenic Catharanthus roseus Hairy Root Line. Biotechnol Prog 23 :1517-1518. 285

Peebles CAM, Hong S-B, Gibson SI, Shanks JV, and San K-Y. 2005. Transient Effects of Overexpressing Anthranilate Synthase α and β Subunits in Catharanthus roseus Hairy Roots . Biotechnol Prog 21 : 1572-1578.

Shanks, JV. 2005. Phytochemical Engineering: Combining Chemical Reaction Engineering with Plant Science. AIChE Jour 51 (1): 2-7.

Shanks JV, Morgan J. 1999. Plant ‘hairy root’ culture. Curr Opin in Biotech 10 :151–155.

Stephanopoulos G. 21 Jun 1991. Network Rigidity and Metabolic Engineering in Metabolite Overproduction. Science 252(5013): 1675-1681.

Stephanopoulos G. 1998. Metabolic Engineering editorial. Biotechnol Bioeng 58 : 119–120.

Tullo A. 24 Nov 2008. A Solvent Dries Up: Acetonitrile is in short supply, and chemists are concerned. Chem & Eng News 86(47): 27. van der Heijden R, Jacobs DI, Snoeijer W, Hallard D, Verpoote R. 2004. The Catharanthus alkaloids: Pharmacognosy and biotechnology. Curr Med Chem 11 (5): 607-628.