Functional Analysis of the ASTE11 Gene from the Dimorphic Yeast

Home , Arxula adeninivorans, Heterokaryon

2nd International Conference on Radiation Sciences and Applications, 28/3 - 1/4/2010

Proceeding, 2nd International Conference on Radiation Sciences and Applications

28/3 – 1/4/2010 – Marsa Alam, Egypt

Functional analysis of the ASTE11 gene from the dimorphic yeast Arxula adeninivorans Ayman El Fiki1, Gamal El Metabteb1, Erik Böer2 and Gotthard Kunze2 1National Center for Radiation Research and Technology, 3 Ahmed El-Zumor St., B.O.Box 29, Nasr City, Cairo, Egypt. 2Leibniz-Institut für Pflanzengenetik und Kulturpflanzenforschung, Corrensstr. 3, D-06466 Gatersleben, Germany.

ABSTRACT Arxula adeninivorans is dimorphic yeast with unusual biochemical and physiological characteristic. It is thermo- and osmoresistance and it can use a wide range of carbon sources for growth. One kinase of the HOG pathway, the MAPKKK is encoded by ASTE11 gene which was isolated from A. adeninivorans. The aste11 mutant was achieved by gene disruption procedure. The Sck1p gene encoding MAPKKK in S. cerevisiae can copmelement with aste11 mutation. Growth rate of G1211/pAL-ALEU2m, G1211/pAL-ALEU2m- ASTE11 (over-expression transformant) and IS1 [aleu2 Δaste11::ALEU2] (aste11 mutant), the ASTE11 expression level dose not correlates with salt resistance. However, the growth rate of G1211/pAL-ALEU2m, G1211/pAL-ALEU2m-ASTE11 (over-expression transformant) and IS1 [aleu2 Δaste11::ALEU2] (aste11 mutant) and the response to thermo stress were affected in the deleted mutant, the Aste11p influenced the thermoresistance of A. adeninivorans. The MAPKKK encoding by STE11 gene from various yeast species is involved in the mating process. The mutant strains and their transformants were lost the capacity to mate. Assessment of the ASTE11 promoter activity with lacZ reporter gene confirmed its inducibility by osmolaytes.

INTRODUCTION MAP kinase cascades are common eukaryotic signaling modules that consist of MAP kinase (MAPK), a MAPK kinase (MAPKK), and a MAPKK kinase (MAPKKK) Waskiewicz and Cooper (1). In Saccharomyeces cerevisiae, two independent osmosensors regulate the common HOG (High osmolarity glycerol response) signal transduction pathway, which includes the Pbs2p MAPKK and Hog1p MAPK Maeda et al. (2-3), Boguslawski and Polazzi (4), Brewster et al. (5). The Sln1p-Ypd1p- Ssk1p MAPK two component osmosensor uses a multistep phosphorelay mechanism to regulate the redundant MAPKKKs Ssk2p or Ssk22p then phosphorylates and activates the Pbs2p MAPKK. The second osmosensor, Sho1p, contains four transmembrane segments and a COOH-terminal cytoplasmic (3) region with an SRC homology3 (SH3) domain Maeda et al. . The interaction between an NH2- terminal proline rich motif in Pbs2p and the Sho1p SH3 domain is essential for the activation of Pbs2p by Sho1p Maeda et al. (3). Arxula adeninivorans has been the subject of several recent biochemical and molecular biological studies Wartmann and Kunze (6), Wartmann et al. (7-9), Yang et al. (10). It was identified as one of the most osmo-tolerant yeast species capable of growth in media containing NaCl in concentrations as high as 3.4 M (20%; Middelhoven et al. (11-13), Gienow et al. (14), Van der Walt et al. 2nd International Conference on Radiation Sciences and Applications, 28/3 - 1/4/2010

(15), Wartmann and Kunze (6). When exposed to high osmolarity conditions, Arxula adeninivorans cells react by producing and accumulating glycerol and erytrithol as compatible solutes Yang et al. (10). The production of different compatible solutes is regulated by different signal transduction pathways involving members of the mitogen-activated protein (MAP) kinse family. One of these pathways is the high osmolarity glycerol (HOG) response pathway, which is well characterized in yeast S. cerevisiae Brewster et al. (5), Hohmann (16). The most important component of this pathway is Hog1p, a MAP kinase, which is activated by the MAP kinase kinase Pbs2p. Activation of Pbs2p can occur via the membrane- residing protein Sln1p and Sho1p Maeda et al. (3), Posas et al. (17), Posas and Saito (18), Raitt et al.(19), which in turn act independently through different MAP kinase kinase kinase (MAPKKKs). Sln1p acts through Ssk2p and Ssk22p, whereas Sho1p regulates the action of Hog1p via Ste11p (MAPKKK). Phosphorylation of Hog1p leads to its transfer into the nucleus and the activation of a number of target genes. One result of this reaction is an accumulation of compatible solutes inside the cells. In the present study, the morphological and biochemical of ASTE11 gene from osmoresistance yeast Arxula adeninivorans were characterized. In the present study, Arxula adeninivorans ASTE11 gene was characterized morphologically and biochemically. MATERIALS AND METHODS Strains and cultivation conditions

E. coli TOP 10 [F- mcrA (mrr-hsdRMS-mcrBC) 80lacZM15 lacX74 recA1 araD139 (ara leu) 7697 galU galK rspL (StrR) endA1 nupG] from Invitrogen (USA), served as the host strain for bacterial transformation and plasmid isolation. The strain was grown in LB medium supplemented with ampicillin (50 µg mL-1; AppliChem, Germany) when required for selection. In this investigation, wild type strain A. adeninivorans LS3 isolated from wood hydrolysates in Siberia (Russia) and the isogenic auxotrophic mutant A. adeninivorans G1211 [aleu2] have been used Kunze and Kunze (20); Samsonova et al. (21); Wartmann et al. (7). All strains were grown up to 168 h at 30 °C under non-selective conditions in a complex medium (YEPD) or under selective conditions in a yeast minimal medium supplemented with 2% (w/v) of a selected carbon source Tanaka et al. (22); Rose et al. (23). Saccharomyces cerevisiae YSH818 (MATa leu2-3/112 ura3-1 trp1-1 his3-11/15 ade2-1 can1- 100 GAL SUC2 hog1∆::LEU2) described by Albertyn et al. (24) was used for the expression of the ASTE11 gene in the S. cerevisiae system. Strain of S.cerevisiae Y05271 (BY4741 MATa his 3 1 leu2 0 met15 0 ura3 0 YLR362w::kanMX4) and Y15271 (BY4742 MATα his 3 1 leu2 0 lys2 0 ura3 0 YLR362w::kanMX4) were used in mating assay. Strains were grown under selective conditions at 30°C using minimal salt medium (SD medium) with 2% glucose as carbon source and the appropriate amino acids, as described by Rose et al. (23). Solid media plates were prepared by adding 1.6% (w/v) agar to the liquid media. Transformation procedure and isolation of nucleic acids E. coli strains were transformed according to procedure Hanahan (25) and A. adeninivorans cells according to Rösel and Kunze (26). Plasmid DNA and restriction fragment isolation were carried out as described by Wartmann et al. (8).

2nd International Conference on Radiation Sciences and Applications, 28/3 - 1/4/2010

Disruption of ASTE11 gene To create aste11 mutants the whole vector PCR was used. For this purpose the DNA fragment with ASTE11 promoter – ASTE11 gene – ASTE11 terminator was inserted into the vector pCR 2.1. By the first PCR the ASTE11 gene was deleted. The ALEU2 gene fragment was inserted into the obtained ASTE11 promoter – ASTE11 terminator fragment which also acts as selection marker. In the next PCR experiment the ASTE11 promoter – ALEU2 gene – ASTE11 terminator fragment was amplified, purified and transformed into A. adeninivorans G1211 [aleu2] (Fig. 1).

SalI (446) E coRI (228 3)

E coRI (262) Kpn2I (1139) AS TE11 E coRI (2628 ) SalI (3278 ) SalI (2) ALE U2-ORF E coRV (218 5)

ASTE11 ALEU2m@1 rc 3822 bp 218 7 bp

PCR (ASTE11-3, ASTE11-4) PCR (ALEU2-T1, ALEU2-T2) PCR (ASTE11-1, ASTE11-2)

SalI (446) Kpn2I (1139)

E coRI (262) aste11-1 aste11-2 SalI (178 9) Kpn2I (2) ALE U2-ORF Kpn2I (218 3)

aste11-Deletion ALEU2m-Kpn2I 2333 bp 218 7 bp

Kpn2I

SalI (446) Kpn 2I (1139) Kpn 2I (3320) aste11-2 E coRI (262) aste11-1 ALE U2m SalI (3970)

aste11-ALEU2m 4514 bp Fig. 1. Construction scheme of the aste11-ALEU2m fragment as basis for the construction of aste11 mutants. Plasmids for promoter analysis An ASTE11 prmoter-lacZ gene fusion was used for analysis promoter strength and regulation. For this purpose the ASTE11 promoter fragment was amplified by PCR using oligonucleotide primers 5`AAGCTTCGTGCCATCTTCACCCTTAC 3` (nucleotide position 1-20, HindIII restriction site in bold type) and 3`CCCGGGATCACGGGGAAATCGCTTTG 5` (nucleotide position 309-328, SmaI restriction site in bold type) and chromosomal DNA of A. adeninivorans LS3 as template. The HindIII-SmaI fragment with the ASTE11 promoter was inserted in front of the lacZ gene of the plasmid pBS-lacZ-PHO5. As the previous construct the expression cassette ASTE11 promoter-lacZ- PHO5 terminator was inserted into the plasmid pAL-ALEU2m-ASTE11-lacZ was used to transform A. adeninivorans strain G1211 Wartmann et al. (9).

2nd International Conference on Radiation Sciences and Applications, 28/3 - 1/4/2010

ß-Galactosidase assays For the determination of ß -galactosidase activity, crude extracts were prepared by breaking yeast cells with glass beads. Activity was assayed by the o-nitrophenyl ß -galactopyranoside method Guarente (27). Units of ß -galactosidase activity are defined according to Miller (28). The presented values are averaged from least three independent transformants assayed in duplicate. Stress assays Different stress conditions were tested on YMM media. Cells were grown in liquid medium at 30 °C until the stationary phase was reached. Cells were collected and washed with sterile distilled water by centrifugation. Different cell numbers, 104, 105, 106 and 107 were spotted on agar plates containing different additions. Plates were incubated for 48-72 h at 30 °C and the growth was scored. Mating assay The mating assay of A. adeninvorans in liquid medium (YMM) was conducted as described by Barth and Gaillardin (29). The conjugation time was prolonged to 17 days.

RESUITS

Construction of aste11 mutants The PCR vector was used in aste11 mutants construction. This fragment is able to integrate into the homologous region of chromosomal DNA by homologous recombination. The obtained transformants complement with the aleu2 mutation. Because recombination is a relatively rare event, an additional screening step to aste11 mutants was included. By using chromosomal DNA of the transformants the ASTE11 promoter – ALEU2m gene – ASTE11 terminator as well as the ASTE11 promoter – ASTE11 gene – ASTE11 terminator were amplified. In this case the ASTE11 promoter – ALEU2m gene – ASTE11 terminator fragment is integrated by homologous recombination only the first PCR product which differed in its molecular weight from the second product can be detected. On this kind four aste11 mutants (A. adeninivorans IS1 [aleu2 aste11::ALEU2]) were selected (Fig. 1). Analysis of the ASTE11 promoter The ASTE11 promoter activity was assessed by fusing of the element to an E. coli-derived lacZ reporter gene. For this purpose, an expression vector harbouring the expression cassette was inserted into Arxula basis plasmid pAL-ALEU2m and the resulting plasmid pAL-ALEU2m-ASTE11- lacZ transformed in A. adeninivorans G1211 (Fig. 2). The transgenic strain was cultured in YMM with glucose supplemented with NaCl and inspected -galactosidase. The analysis of yeast transformants showed that the recombinant - galactosidase is accumulated intracellular. However, this concentration was very weak.

2nd International Conference on Radiation Sciences and Applications, 28/3 - 1/4/2010

ASTE11-pro

Fig. 2. Gene and restriction map of plasmid pAL-ALEU2m-ASTE11-lacZ. Influence of Aste11p on salt resistance

A. adeninivorans G1211/pAL-ALEU2m, G1211/pAL-ALEU2m-ASTE11 (over-expression transformant) and IS1 [aleu2 Δaste11::ALEU2] (aste11 mutant) were analysed concerning the salt resistance. For this purpose all strains were cultured on YMM with 2% glucose. The cultured cells dropped on YMM agar containing 2% glucose and supplemented with 0, 5, 7, 7.5, 8, 10, 12, 15 or 20 % NaCl. All tested strains formed colonies up to 15% NaCl. Only the addition of 20% NaCl to the agar inhibited the growth behaviour completely. These results demonstrated that the ASTE11 expression level does not correlate with the salt resistance. Here a second gene encoding a MAPKKK like Ssk1p in S. cerevisiae can complement the Δaste11mutation (Fig. 3). 1 2 3 4 5 6

0% NaCl

5.0 % NaCl

7.0 % NaCl

7.5% NaCl

8.0 % NaCl

10% NaCl

12% NaCl

15% NaCl

20% NaCl

Fig. 3. Influence of Aste11p on salt resistance of (1) A. adeninivorans G1211/pAL-ALEU2m (control), (2) G1211/pAL-ALEU2m-ASTE11 (over-expression transformant) and (3-6) IS1 [aleu2 Δaste11::ALEU2] (aste11 mutant). Yeast cultures (103 cells) growing in YMM-glucose without NaCl were spotted onto solid agar plates of YMM-glucose supplemented with 0, 5, 7, 7.5, 8, 10, 12, 15 and 20% NaCl. The plates were incubated for 3 days at 30 °C before photographs were taken.

2nd International Conference on Radiation Sciences and Applications, 28/3 - 1/4/2010

Influence of Aste11p on thermoresistance

In addition A. adeninivorans G1211/pAL-ALEU2m, G1211/pAL-ALEU2m-ASTE11 (over- expression transformant) and IS1 [aleu2 Δaste11::ALEU2] (aste11 mutant) were analysed concerning the thermoresistance. For this purpose all strains were cultured on YMM with 2% glucose at 30 °C. The cultured cells were dropped on YMM agar plus 2% glucose and incubated at 30 ºC, 37 ºC, 45 ºC, 46 ºC or 48 ºC. All tested strains formed colonies up to a cultivation temperature of 37 °C. Further increasing of the temperature, however, inhibited the growth of A. adeninivorans IS1 mutants completely. Only A. adeninivorans G1211/pAL-ALEU2m and G1211/pAL-ALEU2m-ASTE11 (over- expression transformant) were able to grow up to a temperature of 46 °C. These results demonstrated that Aste11p influenced the thermoresistance of A. adeninivorans (Fig. 4). 1 2 3 4 5 6

30 °C

37 °C

45 °C

46 °C

48 °C

Fig. 4 Influence of Aste11p on thermoresistance of (1) A. adeninivorans G1211/pAL-ALEU2m (control), (2) G1211/pAL-ALEU2m-ASTE11 (over-expression transformant) and (3-6) IS1 [aleu2 Δaste11::ALEU2] (aste11 mutant). Yeast cultures (103 cells) growing in YMM-glucose at 30 °C were spotted onto solid agar plates of YMM-glucose. The plates were incubated for 3 days at various temperatures before photographs were taken. Mating assay The MAPKKK encoded by STE11 genes from various yeast species is involved in the mating process. Since A. adeninivorans is characterized as imperfect yeast these tests were made in the S. cerevisiae system. For this purpose the plasmid pAL-ALEU2m-ASTE11 (Fig. 5) with the TEF1 promoter – ASTE11 gene – PHO5 terminator expression cassette was transformed in S.cerevisiae Y05271 (BY4741 MATa his 3 .1 leu2 .0 met15 .0 ura3 .0 YLR362w::kanMX4) and Y15271 (BY4742 MATα his 3 .1 leu2 .0 lys2 .0 ura3 .0 YLR362w::kanMX4). Both strains with opposite mating types are ste11 mutants and not able to mate. We performed mating assays between strains S. cerevisiae Y05271 x S. cerevisiae SEY6210 (MATα STE11), S. cerevisiae Y15271 x S. cerevisiae SEY6211 (MATa STE11), and S. cerevisiae SEY6210 (MATα STE11) x S. cerevisiae SEY6211 (MATa STE11) as control. Results demonstrated that only the control strains with STE11 from S. cerevisiae are able to mate. This shows that the ASTE11gene is indispensable for mating.

2nd International Conference on Radiation Sciences and Applications, 28/3 - 1/4/2010

Fig. 5. Physical map of the A. adeninivorans plasmid pAL-ALEU2m-ASTE11-PHO5

DISCUSSION In fungi, two main signal transduction pathways have been related to dimorphism: the MAPK and protein kinase A (PKA) pathways (reviewed in Banuett, (30), Lengeler et al. (31). It is known that in S. cerevisiae responses to osmotic stress, pheromone and invasive growth, physical interactions with Ste11p, the adaptor protein Ste5p and kinase Ste20p are indispensable, all of them playing a critical role in the output of each pathway. Also, in the pheromone response, an interaction with the scaffold Ste5 protein must exist Bardwell, (32). Similarly, in Sch. Pmbe Byr2p/Ste8 (MAPKKK), the regulatory domain is necessary and sufficient for bridging the interaction with Ste4p and Ras1p Tu et al. (33). The behavior of aste11 mutants demonstrates that the missing function of the gene did not compromise basic cellular programs such as growth capacity or cell wall integrity. It is interesting to recall that in S. cerevisiae, expression of FKS2 (a gene encoding a -1,3- glucan synthase) is under control of STE11, and its levels are reduced two- to three fold in ste11 mutants Lee and Elion, (34). Additionally, these authors found that FKS2 expression increased 44-fold in an STE11-4 strain that exoresses a constitutively activated form of ste11p Lee and Elion, (34). These results suggest a role of STE11 in S. cerevisiae cell wall integrity, through regulation of -1,3-glucan synthase Leon et al. (35). Growth of aste11 mutants was also unaffected by cultivation in media containing high concentration of NaCl. In S. cerevisiae, the Hog pathway (involved in osmotic stress protection) is activated not only by Ste11p, but also by Ssk2p and Ssk22p redundant kinases reviewed in Saito and Tatebayashi, (36). Probably in Arxula adeninivorans as in S. cerevisiae, other MAPKKK may be involved in the response to osmotic stress. A developmental program in which fungal MAKKK proteins are known to participate is the regulation of the response to pheromones. These induce important morphological changes in sexually compatible strains that culminate in mating Elion, (37), Bardwell, (32). The results were obtained agree with the behavior of Sch. Pmbe byr2/ste8 mutants, the STE11 homolog Styrkarsdottir et al. (38), Cr. Neoformans Clarke et al. (39) and S. cerevisiae aste11 mutants Chaleff and Tatchell, (40), which are also completely sterile. In A. nidulans Wei et

2nd International Conference on Radiation Sciences and Applications, 28/3 - 1/4/2010 al.(41) and U. maydis Muller et al. (42), only crosses between two sexually compatible mutant strains are sterile. Arxula cells can be cultivated at temperature up to 48 ºC in media containing as much as 20% NaCl. This yeast is also to utilize a single energy and carbon source from a range of compounds, including adenine, uric acid, starch and others Kunze and Kunze (43), Wartmann and Kunze (6). The temperature dependent dimorphism of Arxula adeninivorans is of particular interest. Wartmann et al. (44) discovered that culturing this yeast at elevated temperature (higher than 42 ºC) induces a gene expression pattern that results in a morphological transition from budding to mycelial form. Acknowledgment We are grateful to Dr. I. Kunze for helpful discussion and critical reading of the manuscript. We also thank I. Schmeling and H. Bohlmann for excellent technical assistance. The research work was supported by grants from the “Ministry of Science and Research”, Sachsen/Anhalt (Grant No. 2067A, 0025, “Ministry of Economic”, Nordrhein-Westfalen (TPW-9910v08) and by funds of Chemical Industry (GK). REFERENCES (1) Waskiewicz, A. J. and Cooper, J. A. (1995). Curr. Opin. Cell Biol. 7: 798 (2) Maeda, T., Wurgler-Murphy, S. M., and Saito, H. (1994). Nature, 369: 242 (3) Maeda, T., Takekawa, M. and Saito, H. (1995). Science, 269: 554 (4) Boguslawski, G. and Polazzi, J. O. (1987). Proc. Natl. Acad. Sci. USA. 84: 5848 (5) Brewster, J. L., de Valoir, T., Dwyer, N. D., Winter, E. and Gustin, M. C. (1993). An osmosensing signal transduction pathway in yeast. Science, 259: 1760-1763 (6) Wartmann, T. and Kunze, G. (2000). Genetic transformation and biotechnological application of the yeast Arxula adeninivorans. Appl. Microbiol. Biotechnol. 54: 619–624 (7) Wartmann, T., Erdmann, J., Kunze, I. and Kunze, G. (2000). Morphologyrelated effects on gene expression and protein accumulation of the yeast Arxula adeninivorans LS3. Arch. Microbiol. 173: 253–261 (8) Wartmann, T., Boer, E., Huarto-Pico, A., Sieber, H., Bartelsen, O., Gellissen, G. and Kunze, G. (2002). High-level production and secretion of recombinant proteins by the dimorphic yeast Arxula adeninivorans. FEMS. Yeast Res. 2: 363–369 (9) Wartmann, T., Stoltenburg, R., Böer, E., Sieber, H., Bartelsen, O., Gellissen, G.and Kunze, G. (2003). The ALEU2 gene – a new component for an Arxula adeninivorans-based expression platform. FEMS. Yeast Res. 3:223-232 (10) Yang, X.X., Wartmann, T., Stoltenburg, R. and Kunze, G. (2000). Halotolerance of the yeast Arxula adeninivorans LS3. Antonie van Leeuwenhoek 77: 303–311. (11) Middelhoven, J. W., Hoogkamer-Te Niet, M. C. and Kreger van Rij, N. J. W. (1984). Trichosporon adeninovorans sp. nov., a yeast species utilizing adenine, xanthine, uric acid, putrescine and primary nalkylamines as the sole source of carbon, nitrogen and energy. Antonie van Leeuwenhoek 50:369–387

2nd International Conference on Radiation Sciences and Applications, 28/3 - 1/4/2010

(12) Middelhoven, W. J., Jonge, I. M. de. and Winter, M. (1991). Arxula adeninivorans, a yeast assimilating many nitrogenous and aromatic compounds. Antonie van Leeuwenhoek 60:129– 137 (13) Middelhoven, W. J., Coenen, A., Kraakman, B.and Gelpke, M. D. S. (1992). Degradation of some phenols and hydroxybenzoates by the imperfect ascomycetous yeasts Candida parapsilosis and Arxula adeninivorans: evidence for an operative gentisate pathway. Antonie van Leeuwenhoek 62:181–187 (14) Gienow, U., Kunze, G., Schauer, F., Bode, R. and Hofemeister, J. (1990). The yeast genus Trichosporon spec. LS3; molecular characterization of genomic complexity. Zbl. Mikrobiol. 145: 3–12. (15) Van der Walt, J.P., Smith, M.T. and Yamada, Y. (1990). Arxula gen. nov. (Candidaceae), a new anamorphic, arthroconidial yeast genus. Antonie van Leeuwenhoek 57: 59–61. (16) Hohmann, S. (2002). Osmotic stress signaling and osmoadaptation in yeasts. Microbiol. Mol. Biol. Rev. 66:300–372 (17) Posas, F., Wurgler-Murphy, S. M., Maeda, T., Witten, E. A., Thai, T. C. and Saito, H. (1996). Yeast HOG1 MAP kinase cascade is regulated by multistep phosphorelay mechanism in the SLN1-YPD1- SSK1 „two-component‟ osmosensor. Cell 86:865–875 (18) Posas, F. and Saito, H. (1997). Osmotic adaptation of the HOG MAPK pathway via Ste11p MAPKKK: scaffold role of Pbs2 MAPKK. Science, 276: 1702-1705 (19) Raitt, D. C., Posas, F. and Saito, H. (2000). Yeast Cdc42 GTPase and Ste20 PAK-like kinase regulate Sho1-dependent activation of the Hog1 MAP kinase pathway. EMBO J 19:4623– 4631 (20) Kunze, G. and Kunze, I. (1994). Characterization of Arxula adeninivorans strains from different habitats. Antonie van Leeuwenhoek 65:29-34 (21) Samsonova, I. A., Kunze, G., Bode, R. and Böttcher, F. (1996). A set of genetic markers for the chromosomes of the imperfect yeast Arxula adeninivorans. Yeast 12:1209-1217 (22) Tanaka, A., Ohnishi, N. and Fukui, S. (1967). Studies on the formation of vitamins and their function in hydrocarbon fermentation. Production of vitamin B6 by Candida albicans in hydrocarbon medium. J. Ferment. Technol 45:617-623 (23) Rose, M. D., Winston, F. and Hieter, P. (1990). Methods in yeast genetics. A laboratory manual. Cold Spring Harbor Laboratory, Cold Spring Harbor, New York (24) Albertyn, J., Hohmann, S., Thevelein, J. M. and Prior, B. A. (1994). GPD1, which encodes glycerol-3-phosphate dehydrogenase, is essential for growth under osmotic stress in Saccharomyces cerevisiae, and its expression is regulated by the high-osmolarity glycerol response pathway. Mol. Cell. Biol. 14:4135–4144 (25) Hanahan, D. (1983). Studies on transformation of E. coli with plasmids. J Mol Biol 166:557-580 (27) Guarente, L. (1983). Yeast promoters and lacZ fusions designed to study expression of cloned genes in yeast. Methods Enzymol. 101: 181-191 (26) Rösel, H. and Kunze, G. (1998). Integrative transformation of the dimorphic yeast Arxula adeninivorans LS3 based on Hygromycin B resistance. Curr Genet 33:157-163

2nd International Conference on Radiation Sciences and Applications, 28/3 - 1/4/2010

(28) Miller, J. H. (1972). Experiments in molecular genetics. Cold Spring Harbor Laboratory, Cold Spring Harbor, N. Y. (29) Barth, G. and Gaillardin, C. (1996). Yarrowia lipolytica. Nonconventional Yeast in Biotechnology (Wolf K, ed.), pp. 313-388. Springer, Berlin. (30) Banuett, F. (1998). Signaling in the yeasts: an informational cascade with links to the filamentous fungi. Microbiol. Mol. Biol. Rev. 62: 249-274 (31) Lengeler, K. B., Davidson, R. C., D‟Souza, C., Harashima, T., Shen, W. C., Wang, P., Pan, X., Waugh, M. And Heitman, J. (2000). Signal transduction cascades regulating fungal development and virulence. Microbiol. Mol. Biol. Rev. 64: 746-785 (32) Bardwell, L. (2005). A walk-through of the yeast mating pheromone response pathway. Peptides, 26: 339-350 (33) Tu, H., Barr, M., Dong, D. L. and Wigler, M. (1997). Multiple regulatory domains on the Byr2 protein kinase. Mol. Cell Biol. 17: 5876-5887 (34) Lee, B. N. and Elion, E. A. (1999). The MAPKKK Ste11 regulates vegetative growth through a kinase cascade of shared signaling components. Proc. Natl. Acad. Sci. USA. 96: 12679-12684 (35) Leon, M., Sentandreu, R. and Zueco, J. (2002). A single FKS homologue in Yarrowia lipolytica is essencial for viability. Yeast, 19:1003-1014 (36) Saito, H. and Tatebayashi, K. (2004). Regulation of the osmoregulatory HOG MAPK cascade in yeast J. Biochem. (Tokyo) 136: 267-272 (37) Elion, E. A. (2000). Pheromone response, mating and cell biology. Curr. Opin. Microbiol. 3: 573- 581 (38) Styrkarsdottir, U., Egel, R. and Nielsen, O. (1992). Functional conservation between Schizosaccharomyces pombr ste8 and Saccharomyces cerevisiae STE11 protein kinase in yeast signal transduction. Mol. Gen. Genet. 235: 122-130 (39) Clarke, D. L., Woodlee, C. M. and McClelland, T. S. (2001). The Crypyococcus neoformans STE11α gene is similar to other fungal mitogen-activated protein kinasekinasekinase (MAPKKK) genes but is mating type specific. Mol. Microbiol. 40(1): 200-213 (40) Chaleff, D. T. and Tatchell, K. (1985). Molecular cloning and characterization of the STE7 and STE11 genes of Saccharomyces cerevisiae. Mol. Cell Biol. 5: 1878-1886 (41) Wei, H., Requena, N. and Fisher, R. (2003). The MAPKK kinase SteC regulates conidiophore morphology and is essential for heterokaryon formation and sexual development in the homothallic fungus Aspergillus nidulans. Mol. Microbiol. 47: 15577-1588 (42) Muller, P., Weinzierl, G., Brachmann, A., Feldbrugge, M. And Kahmann, R. (2003). Mating and pathogenic development of the smut fungus Ustilago maydis are regulated by one mitogen- activated protein kinase cascade. Eukaryot. Cell, 2: 1187-1199 (43) Kunze, G. and Kunze, I. (1996). Arxula adeninivorans. In: Wolf K (ed) Nonconventinal yeast. Springer, Berlin Heidelberg New York, pp 389-409 (44) Wartmann, T., Kruger, A., Bui, M. D., Kunze, I. And Kunze, G. (1995). Temperature dependent dimorphism of the yeast Arxula adeninivorans LS3. Antonie van Leeuwenheok, 68: 215-223

المؤتمر الدولي الثاني للعلوم اإلشعاعية وتطبيقاتها

انتحهيم انىظيفً نجين ال ASTE11 فً األركسىال أدينينيفىرانس ثنائية انشكم انمظهري

أيمن انفق1ً و جمال انمتبتب1 و Gotthard Kunze2 and Erik Böer2

1 انًشكض انقىيً نبحىد وحكُىنىجيا االشؼاع – يذيُت َصش- انقاهشة- يصش Eibniz-Institut für Pflanzengenetik und Kulturpflanzenforschung, Corrensstr. 3, D-06466 Gatersleben, 2 Germany.

حؼخبش خًيشة األسكسىال أديُيُيفىساَس رُائيت انشكم انًظهشي رو صفاث كيًاويت و فسيىنىجيت غيش ػاديت فهً يقاويت نهظشوف األسًىصيت و انحشاسة ونذيها انقذسة ػهً اسخخذاو يصادس يخؼذدة يٍ انكشبىٌ فً انًُى. احذي انكايُيض فً يساس HOG هى انًاب كيُيض كيُيض كيُيض انًسخُسخ يٍ جيٍ ASTE11 و انزي حى ػضنه يٍ األسكسىال أديُيُيفىساَس. فطافشة aste11 قذ حى انحصىل ػهيها بطشيقت انجيٍ Disruption، فقذ وجذ أٌ بشوحيٍ جيٍ Sck1p انزي يسخُسخ انًاب كيُيض كيُيض كيُيض فً خًيشة انسكاسوييسس سيشفيضيا يًكُها انخكايم يغ طافشة aste11. وقذ وجذ أٌ يسخىي انخؼبيش انجيًُ ASTE11 نؼًذل انًُى ل -G1211/pAL ALEU2m, G1211/pAL-ALEU2m-ASTE11 (over-expression transformant) and IS1 [aleu2 (Δaste11::ALEU2] (aste11 mutant نيس نها اسحباط بانًقاويت نهًهىحت ، أيا يؼذل انًُى واألسخجابت نالجهاد انحشاسي G1211/pAL-ALEU2m, G1211/pAL-ALEU2m-ASTE11 (over-expression transformant) and IS1 (aleu2 Δaste11::ALEU2] (aste11 mutant] قذ حأرش فً انسالنت انطافشة حيذ أٌ بشوحيٍ Aste11 كاٌ نه حأريش فً انًقاويت نذسجاث انحشاسة انؼانيت فً األسكسىال أديُيُيفىساَس، أيا انًاب كيُيض كيُيض كيُيض انًسخُسخ يٍ جيٍ STE11 يٍ أَىاع خًائش يخخهفت كاٌ نه دوس فً ػًهيت انخضاوج فانسالالث انطافشة و انًحىسة يُها قذ فقذث انقذسة ػهً انخضاوج. أيا حقييى َشاط باديء جيٍ ASTE11 يغ جيٍ LacZ reporter أكذ أَه يسخحذ ححج انظشوف األسًىصيت.