DOCSLIB.ORG

Additional File 1. Mass Cytometry Staining Panel. Supplemental

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Additional File 1. Mass Cytometry Staining Panel. Supplemental BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Immunother Cancer Additional File 1. Mass cytometry staining panel. Marker Metal Host Isotype Clone Company Cat.no 1 CD3e 172 Yb Hamster IgG 145-2C11 BioLegend (MaxPar-Ready) 100345 2 CD8a 168 Er Rat IgG2a 53-6.7 Fluidigm 3168003B 3 CD11b 154 Sm Rat IgG2b M1/70 Fluidigm 3154006B 4 CD19 166 Er Rat IgG2a 6D5 Fluidigm 3166015B 5 CD45 89 Y Rat IgG2b 30-F11 Fluidigm 3089005B 6 CD11c 167 Er Hamster IgG N418 BioLegend (MaxPar-Ready) 117341 7 CD115 144 Nd Rat IgG2a AFS98 Fluidigm 3144012B 8 F4/80 174 Yb Rat IgG2a, k BM8 BioLegend (MaxPar-Ready) 123143 9 Ly6G 141 Pr Rat IgG2a 1A8 Fluidigm 3141008B 10 PDL1 160 Gd Rat IgG2b, κ 10F.9G2 BioLegend 124301 11 Ly6C 165 Ho Rat IgG2c HK1.4 BioLegend (MaxPar-Ready) 128039 12 CD86 171 Yb Rat IgG2a, κ GL-1 BioLegend 105001 13 CD14 156 Gd Rat IgG2a, κ Sa14-2 Fluidigm 3156009B 14 CD38 163 Dy Rat IgG2a, κ 90 BioLegend (MaxPar-Ready) 102723 15 PD-1 159 Tb Rat IgG2a 29F.1A12 Fluidigm 3159024B 16 MHC-II 115 In Rat IgG2b M5/114.15.2 BioLegend (MaxPar-Ready) 107637 17 CD103 173 Yb Hamster IgG 2E7 BioLegend 121401 18 CD40 147 Sm Rat IgG2a, κ 3/23 BioLegend 124601 19 Clec9A 150 Nd Rat IgG1, κ 7H11 BioLegend 143502 20 CD205 169 Tm Rat IgG2a, κ NLDC-145 BioLegend 138202 21 Gr-1 152 Sm Rat IgG2b, κ RB6-8C5 BioLegend (MaxPar-Ready) 108449 22 BST2 151 Eu Rat IgG2b, κ 129C1 BioLegend 127102 23 SiglecH 153 Eu Rat IgG1, κ 551 BioLegend 129606 24 B220 176 Yb Rat IgG2a, k RA3-6B2 Fluidigm 3176002B 25 CD24 161 Dy Rat IgG2b, κ M1/69 BioLegend (MaxPar-Ready) 101829 26 CD48 162 Dy Hamster IgG HM48-1 BioLegend (MaxPar-Ready) 103433 27 CD169 170 Er Rat IgG2a, κ 3D6.112 Fluidigm 3170018B 28 CD64 158 Gd Mouse IgG1, κ X54-5/7.1 BioLegend 139301 29 PD-L2 148 Nd Rat IgG2a, k Ty25 eBioscience 14-5986-82 30 CD70 142 Nd Rat IgG2b, k FR70 eBioscience 14-0701-82 31 ICOSL 143 Nd Rat IgG2a, κ HK5.3 BioLegend 107407 32 OX40L 149 Sm Rat IgG2b, k RM134L BioLegend 108802 33 SiglecF 175 Lu Rat IgG2a, κ E50-2440 BD 552125 34 CD90.2 145 Nd Rat IgG2b, κ 30-H12 BioLegend (MaxPar-Ready) 105333 35 CD31 155 Gd Rat IgG2a, κ 390 BioLegend (MaxPar-Ready) 102425 36 CX3CR1 164 Dy Mouse IgG2a, κ SA011F11 Fluidigm 3164023B 37 CCR2 209 Bi Rat IgG2b 475301 R&D MAB55381 Beyranvand Nejad E, et al. J Immunother Cancer 2020; 8:e001326. doi: 10.1136/jitc-2020-001326 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Immunother Cancer Additional File 2. Primers of RT2 Profiler PCR Array Mouse Chemokines and receptors. Primers sequence STAT1 forward TGGTGAAATTGCAAGAGCTG STAT1 reverse CAGACTTCCGTTGGTGGATT CCL2 forward CGGAACCAAATGAGATCAGAACCTAC CCL2 reverse GCTTCAGATTTACGGGTCAACTTCAC CCL5 forward ATTGCTTGCTCTAGTCCTA CCL5 reverse ATGCTGATTTCTTGGGTTT JAK1 forward GGCAGCGGAGAGTATACAGC JAK1 reverse CACAGTGATGATTCGGTTCG IRF1 forward ACCCTGGCTAGAGATGCAGA IRF1 reverse AGGCATCCTTGTTGATGTCC IRF3 forward CGG AAA GAA GTG TTG CGG IRF3 reverse TTT TCC TGG GAG TGA GGC IRF4 forward GCCTTGTTATTGCATGCCAGC IRF4 reverse AGACCAAGCTTTTCAGCCTGG IRF5 forward ATGGGGACAACACCATCTTC IRF5 reverse GCTTTTGTTAAGGGCACAGC IRF7 forward TCTCCCAGACTGCCTGTGTA IRF7 reverse CAGATCCCTACGACCGAAAT IRF8 forward ACGAGGTTACGCTGTGCTCT IRF8 reverse TCAGCTCCTCAATCTCTGAGC HPV16 E7 forward CAAGTGTGACTCTACGCTTCGG HPV16 E7 reverse GTGCCCATTAACAGGTCTTCCAA TNF forward GAACTGGCAGAAGAGGCACT TNF reverse AGGGTCTGGGCCATAGAACT MDM2 forward CTC TGG ACT CGG AAG ATT ACA GCC MDM2 reverse CCT GTC TGA TAG ACT GTC ACC CG Ccng1 forward AATGGCCTCAGAATGACTGC Ccng1 reverse CTCAGTCCAACACACCCAAG Ei24 forward CTTTCTGCAGGACCTTGGCA Ei24 reverse CTCTCTTCTGCTGGATCCGA Pidd forward TGCTGCAAGTGGAGTTTTTG Pidd reverse AGCCTGTTGAAGCTCAGGTC Mzt2 forward TCGGTGCCCATATCTCTGTC Mzt2 reverse CTGCTTCGGGAGTTGCTTTT Ptp4a2 forward AGCCCCTGTGGAGATCTCTT Beyranvand Nejad E, et al. J Immunother Cancer 2020; 8:e001326. doi: 10.1136/jitc-2020-001326 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Immunother Cancer Ptp4a2 reverse AGCATCACAAACTCGAACCA GAPDH forward GTGCTGAGTATGTCGTGGAGTCTAC GAPDH reverse GGCGGAGATGATGACCCTTTTGG Beyranvand Nejad E, et al. J Immunother Cancer 2020; 8:e001326. doi: 10.1136/jitc-2020-001326 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Immunother Cancer Beyranvand Nejad E, et al. J Immunother Cancer 2020; 8:e001326. doi: 10.1136/jitc-2020-001326 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Immunother Cancer A B VDLN TDLN IFNγ TNF IL-2 IFNγ TNF IL-2 2.0 2.0 2.0 5 5 5 ns * ns ns ns ns 4 4 4 1.5 1.5 1.5 cells cells cells cells cells cells + + + + + 3 + 3 3 1.0 1.0 1.0 2 2 2 0.5 0.5 0.5 1 1 1 within CD8 within CD8 within CD8 within CD8 % 0 % within CD8 0 % 0 % 0 % within CD8 0 % 0 stim + - + - stim + - + - stim + - + - stim + - + - stim + - + - stim + - + - prime boost prime boost prime boost prime boost prime boost prime boost C D VDLN TDLN IFNγ TNF IL-2 IFNγ TNF IL-2 2.0 2.0 2.0 2.0 0.5 0.5 ns ns ns ** ns ns 0.4 0.4 1.5 1.5 1.5 1.5 cells cells cells cells cells cells + + + + + + 0.3 0.3 1.0 1.0 1.0 1.0 0.2 0.2 0.5 0.5 0.5 0.5 within CD4 within CD4 within CD4 0.1 within CD4 0.1 % % % within CD4 % within CD4 % % 0 0 0 0 0 0 stim + - + - stim + - + - stim + - + - stim + - + - stim + - + - stim + - + - prime boost prime boost prime boost prime boost prime boost prime boost Additional File 4. T cells are still capable of producing cytokines after boost vaccine. Mice were injected with TC-1 tumor cells on day 0. Then, mice were vaccinated with prime SLP suboptimal vaccine on day 8 (prime) and were sacrificed on day 18. Another group of mice vaccinated with prime and boost SLP suboptimal vaccine on day 8 and 22 were sacrificed at the time of relapse on day 39 (boost).A-B) The percentage of IFNγ, TNF and IL-2 producing CD8+ T cells in vaccine draining lymph node (VDLN) (A) and tumor draining lymph node (TDLN) (B) of SLP suboptimal-vaccinated mice. C-D) The percentage of IFNγ, TNF and IL-2 producing CD4+ T cells in VDLN (C) and (TDLN) (D) of SLP suboptimal-vaccinated mice. Data represents mean values ± SEM (n = 5-9 mice per group). Data are representative of two independent experiments. Data presented are mean ± SEM, and statistical analysis was performed using Mann-Whitney test. *, P < 0.05; **, P < 0.01; ***, P < 0.001. Beyranvand Nejad E, et al. J Immunother Cancer 2020; 8:e001326. doi: 10.1136/jitc-2020-001326 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Immunother Cancer Beyranvand Nejad E, et al. J Immunother Cancer 2020; 8:e001326. doi: 10.1136/jitc-2020-001326 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Immunother Cancer Additional File 5. Classical immune escape mechanisms do not contribute to recurrence. A) Expression level of E7 oncogene in relapsed TC-1 tumor cells. In brief, the relapsed tumors from the mice (mouse 1-7) were harvested and sorted for CD45- cells. In vitro cultured TC-1 tumor cells and B16 tumor cells have been used as positive and negative controls, respectively. RNA expression level of E7 has been measured by qPCR. B) Expression levels H2Db on CD45-TC-1 tumor cells from untreated mice and SLP suboptimal-vaccinated mice at the time of regression (day 18) and relapse (day 39) measured by flow cytometry. C) The percentage of cytotoxicity in a 51Cr-release CTL assay. Shown is the percentage of tumor cells from untreated or relapsed tumors (target cells) killed by splenocytes isolated from SLP suboptimal-vaccinated or naïve mice as control (effector cells) at different ratios as measured by CTL assay as described in materials and methods. D) Expression of PD-1, Tim-3 and LAG-3 on intratumoral CD8 T cells in untreated and regressed tumor at day 18. E) t-distributed stochastic neighbor embedding (tSNE) plots of all intratumoral CD45+ cells of the untreated and regressed tumors after SLP suboptimal vaccination as analyzed by mass cytometry followed by non-supervised clustering (viSNE) in Cytobank. Monocytes (Mono) and tumor associated macrophages (TAM) were gated based CD11b+Ly6C+CCR2+ and CD11b+F4/80+Ly6C-, respectively. F) Percentage of IFNγ+, TNF+ and IL-2+ cells within CD8+ T cells in tumor of untreated and regressed tumors at day 18. G) Percentage of Ki67+ cells within CD45- tumor cells in tumor of untreated and regressed tumors at day 18. Data are representative of at least two independent experiments. Data presented in B, F and G are mean ± SEM, and statistical analysis was performed using Mann- Whitney test. *, P < 0.05; **, P < 0.01; ***, P < 0.001.
Load more

Recommended publications
  • Mouse CD163 Deficiency Strongly Enhances Experimental Collagen-Induced Arthritis
    www.nature.com/scientificreports OPEN Mouse CD163 defciency strongly enhances experimental collagen‑induced arthritis Pia Svendsen1,2, Anders Etzerodt 3, Bent W. Deleuran3,4 & Søren K. Moestrup1,2,5* The scavenger receptor CD163 is highly expressed in macrophages in sites of chronic infammation where it has a not yet defned role. Here we have investigated development of collagen‑induced arthritis (CIA) and collagen antibody‑induced arthritis (CAIA) in CD163‑defcient C57BL/6 mice. Compared to wild‑type mice, the CIA in CD163‑defcient mice had a several‑fold higher arthritis score with early onset, prolonged disease and strongly enhanced progression. Further, the serum anti‑ collagen antibody isotypes as well as the cytokine profles and T cell markers in the infamed joints revealed that CD163‑defcient mice after 52 days had a predominant Th2 response in opposition to a predominant Th1 response in CD163+/+ mice. Less diference in disease severity between the CD163+/+ and CD163−/− mice was seen in the CAIA model that to a large extent induces arthritis independently of T‑cell response and endogenous Th1/Th2 balance. In conclusion, the present set of data points on a novel strong anti‑infammatory role of CD163. Te scavenger receptor CD163 is expressed exclusively in cells of monocytic origin with a high expression in M2-type macrophages where it has an established role in scavenging hemoglobin (Hb) released into plasma 1. Te receptor and its function have been most intensively studied in human systems, but the selective myelomonocytic expression of CD163 with a high upregulation in the M2-type macrophages is also seen in animals including rodents2,3.
    [Show full text]
  • Differentiation and Bone Resorption Role of CX3CL1/Fractalkine In
    Role of CX3CL1/Fractalkine in Osteoclast Differentiation and Bone Resorption Keiichi Koizumi, Yurika Saitoh, Takayuki Minami, Nobuhiro Takeno, Koichi Tsuneyama, Tatsuro Miyahara, This information is current as Takashi Nakayama, Hiroaki Sakurai, Yasuo Takano, Miyuki of September 29, 2021. Nishimura, Toshio Imai, Osamu Yoshie and Ikuo Saiki J Immunol published online 18 November 2009 http://www.jimmunol.org/content/early/2009/11/18/jimmuno l.0803627.citation Downloaded from Why The JI? Submit online. http://www.jimmunol.org/ • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average by guest on September 29, 2021 Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published November 18, 2009, doi:10.4049/jimmunol.0803627 The Journal of Immunology Role of CX3CL1/Fractalkine in Osteoclast Differentiation and Bone Resorption1 Keiichi Koizumi,2* Yurika Saitoh,* Takayuki Minami,* Nobuhiro Takeno,* Koichi Tsuneyama,†‡ Tatsuro Miyahara,§ Takashi Nakayama,¶ Hiroaki Sakurai,*† Yasuo Takano,‡ Miyuki Nishimura,ʈ Toshio Imai,ʈ Osamu Yoshie,¶ and Ikuo Saiki*† The recruitment of osteoclast precursors toward osteoblasts and subsequent cell-cell interactions are critical for osteoclast dif- ferentiation.
    [Show full text]
  • Ccl9 Induced by Tgf-Β Signaling in Myeloid Cells Enhances Tumor Cell Survival in the Premetastatic Lung
    CCL9 INDUCED BY TGF-β SIGNALING IN MYELOID CELLS ENHANCES TUMOR CELL SURVIVAL IN THE PREMETASTATIC LUNG by Hangyi Yan A dissertation submitted to Johns Hopkins University in conformity with the requirements for the degree of Doctor of Philosophy Baltimore, Maryland March, 2015 ABSTRACT The majority of cancer patients die from metastasis. To achieve metastasis, tumor cells must first survive and then proliferate to form colonies. Compelling data have shown the indispensable participation of host microenvironment for metastasis. Bone marrow derived myeloid cells sculpt a tumor-promoting microenvironment in the premetastatic organs prior to tumor cell arrival. However, the molecular mechanisms for this “seed and soil” hypothesis are unclear. Here we report that CCL9 was significantly produced and secreted by Gr-1+CD11b+ cells when co-cultured with tumor cells, and in the premetastatic lung. CCL9 knockdown (KD) in myeloid cells decreased metastasis, and this process signaled through its sole receptor CCR1. Overexpression of CCR1 lost the metastasis-promoting function in the context of CCL9 KD. CCL9 enhanced tumor cell survival in the premetastatic organs. The underlying molecular mechanisms included activation of cell survival factors phosphorylated AKT and BCL-2, as well as inhibition of Poly (ADP-ribose) polymerase (PARP)-dependent apoptosis pathway. Additionally, CCL9/CCR1 had autocrine effects, which enhanced CCL9 secretion and the survival of Gr-1+CD11b+ cells. We found that CCL9 was a key effector of myeloid transforming growth factor β (TGF-β) pathway that promotes metastasis. Decreased metastasis in mice with myeloid specific TGF-β receptor II deletion (Tgfbr2MyeKO) correlated with lower CCL9 expression in TGF-β deficient myeloid cells.
    [Show full text]
  • US7572600.Pdf
    US007572600B2 (12) United States Patent (10) Patent No.: US 7,572,600 B2 Berahovich et al. (45) Date of Patent: Aug. 11, 2009 (54) ENZYMATIC ACTIVITIES IN WO WO90, 13332 11, 1990 CHEMOKNE-MEDIATED INFLAMMATION WO WO 91/12779 9, 1991 WO WO 91f17271 11, 1991 (75) WO WO91, 1898O 12/1991 Inventors: Robert D. Berahovich, Berkeley, CA WO WO92fO1047 1, 1992 (US); Zhenhua Miao, San Jose, CA WO WO93,06121 4f1993 (US); Brett Premack, San Francisco, WO WO93, 17706 9, 1993 CA (US); Thomas J. Schall, Palo Alto, WO WO93/24640 12/1993 CA (US) WO WO94,08051 4f1994 WO WO94/20142 9, 1994 (73) Assignee: Chemocentryx, Inc., Mt. View, CA (US) WO WO95/12608 5, 1995 WO WO95/30642 11, 1995 (*) Notice: Subject to any disclaimer, the term of this WO WO95/35503 12/1995 patent is extended or adjusted under 35 WO WO 98.04554 2, 1998 U.S.C. 154(b) by 486 days. OTHER PUBLICATIONS (21) Appl. No.: 11/198,935 Al-Obeidi (1998), Mol. Biotechnol. 9:205-223. Aoyama, Y. et al. (2001), Bioorg Med. Chem. Lett. 11: 1691-4. (22) Filed: Aug. 4, 2005 Amour, A., et al. (1998), J. Pharm. Pharmacol. 50:593-600. Berger, M.S. etal (1993), DNA Cell Biol 12:839-847. (65) Prior Publication Data Bao, L., et al. (1992), Genomics 13:437-40. US 2006/OO63223 A1 Mar. 23, 2006 Berman et al. (1988), Immunol. Invest. 17: 625-677. Baici, A. (1993), Biochem. Pharmacol. 46:1545-9. Bae, Y.-S. et al. (2004) J Immunol. 173:607-614.
    [Show full text]
  • Responses During Sepsis Interactions Exacerbate Innate Immune CCR1
    The Journal of Immunology CCR1 and CC Chemokine Ligand 5 Interactions Exacerbate Innate Immune Responses during Sepsis1 Traci L. Ness,* Kristin J. Carpenter,* Jillian L. Ewing,* Craig J. Gerard,† Cory M. Hogaboam,2* and Steven L. Kunkel* CCR1 has previously been shown to play important roles in leukocyte trafficking, pathogen clearance, and the type 1/type 2 cytokine balance, although very little is known about its role in the host response during sepsis. In a cecal ligation and puncture model of septic peritonitis, CCR1-deficient (CCR1؊/؊) mice were significantly protected from the lethal effects of sepsis when compared with wild-type (WT) controls. The peritoneal and systemic cytokine profile in CCR1؊/؊ mice was characterized by a robust, but short-lived and regulated antibacterial response. CCR1 expression was not required for leu- -kocyte recruitment, suggesting critical differences extant in the activation of WT and CCR1؊/؊ resident or recruited peri toneal cells during sepsis. Peritoneal macrophages isolated from naive CCR1؊/؊ mice clearly demonstrated enhanced cytokine/chemokine generation and antibacterial responses compared with similarly treated WT macrophages. CCR1 and CCL5 interactions markedly altered the inflammatory response in vivo and in vitro. Administration of CCL5 increased sepsis-induced lethality in WT mice, whereas neutralization of CCL5 improved survival. CCL5 acted in a CCR1-dependent manner to augment production of IFN-␥ and MIP-2 to damaging levels. These data illustrate that the interaction between CCR1 and CCL5 modulates the innate immune response during sepsis, and both represent potential targets for therapeutic intervention. The Journal of Immunology, 2004, 173: 6938–6948. epsis is the most common cause of death in noncoronary mune response to sepsis (7, 8).
    [Show full text]
  • Retinoid X Receptor Α Controls Innate Inflammatory Responses Through The
    Retinoid X receptor α controls innate inflammatory responses through the up-regulation of chemokine expression Vanessa Núñeza,1, Daniel Alamedaa,1, Daniel Ricoa,2, Rubén Motab, Pilar Gonzalob, Marta Cedenillaa, Thierry Fischerc, Lisardo Boscád, Christopher K. Glasse, Alicia G. Arroyob, and Mercedes Ricotea,3 Departments of aRegenerative Cardiology and bVascular Biology and Inflammation, Centro Nacional de Investigaciones Cardiovasculares, Madrid 28029, Spain; cDepartment of Immunology and Oncology, Centro Nacional de Biotecnología, Madrid 28049, Spain; dInstituto de Investigaciones Biomédicas “Alberto Sols” (CSIC-UAM), Madrid 28029, Spain; and eDepartment of Medicine, Department of Cellular and Molecular Medicine, University of California, La Jolla, CA 92093 Edited* by Daniel Steinberg, University of California, La Jolla, CA, and approved April 19, 2010 (received for review November 25, 2009) The retinoid X receptor α (RXRα) plays a central role in the regulation Chemokines and their receptors have been implicated in the of many intracellular receptor signaling pathways and can mediate modulation of leukocyte trafficking, immune/inflammatory respon- ligand-dependent transcription by forming homodimers or hetero- ses, sepsis, and multiorgan failure (18, 19). Clinical studies have also dimers with other nuclear receptors. Although several members of identified elevated levels of chemokines associated with human the nuclear hormone receptor superfamily have emerged as impor- sepsis and acute lung injury (20). tant regulators of macrophage gene expression, the existence in vivo We have examined the role of RXRα in the innate immune of an RXR signaling pathway in macrophages has not been estab- system by conditionally disrupting RXRα in myeloid cells. We lished. Here, we provide evidence that RXRα regulates the transcrip- show that chemokines Ccl6 and Ccl9 are novel target genes for tion of the chemokines Ccl6 and Ccl9 in macrophages independently RXRα in primary peritoneal macrophages.
    [Show full text]
  • CCL9 Is Secreted by the Follicle-Associated Epithelium and Recruits Dome Region Peyer's Patch Cd11b+ Dendritic Cells
    CCL9 Is Secreted by the Follicle-Associated Epithelium and Recruits Dome Region Peyer's Patch CD11b+ Dendritic Cells This information is current as Xinyan Zhao, Ayuko Sato, Charles S. Dela Cruz, Melissa of October 1, 2021. Linehan, Andreas Luegering, Torsten Kucharzik, Aiko-Konno Shirakawa, Gabriel Marquez, Joshua M. Farber, Ifor Williams and Akiko Iwasaki J Immunol 2003; 171:2797-2803; ; doi: 10.4049/jimmunol.171.6.2797 http://www.jimmunol.org/content/171/6/2797 Downloaded from References This article cites 32 articles, 19 of which you can access for free at: http://www.jimmunol.org/content/171/6/2797.full#ref-list-1 http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on October 1, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts Errata An erratum has been published regarding this article. Please see next page or: /content/172/11/7220.2.full.pdf The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2003 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology CCL9 Is Secreted by the Follicle-Associated Epithelium and Recruits Dome Region Peyer’s Patch CD11b؉ Dendritic Cells1 Xinyan Zhao,2* Ayuko Sato,* Charles S.
    [Show full text]
  • Myelin-Specific CD8 T Cells Exacerbate Brain Inflammation in CNS Autoimmunity
    Myelin-specific CD8 T cells exacerbate brain inflammation in CNS autoimmunity Catriona A. Wagner, … , Denny Liggitt, Joan M. Goverman J Clin Invest. 2019. https://doi.org/10.1172/JCI132531. Research In-Press Preview Autoimmunity Graphical abstract Find the latest version: https://jci.me/132531/pdf Myelin-specific CD8 T cells exacerbate brain inflammation in CNS autoimmunity Catriona A. Wagner1, Pamela J. Roqué1, Trevor R. Mileur1, Denny Liggitt2, and Joan M. Goverman1* 1Departments of Immunology and 2Comparative Medicine, University of Washington, Seattle, WA, USA *Corresponding author: Dr. Joan M. Goverman Department of Immunology, University of Washington Box 358059 750 Republican St, Seattle, WA 98109 Tel: +1 206-685-7604 Fax: +1 206-616-4561 Email: [email protected] The authors declare no competing financial interests. Abstract Multiple sclerosis (MS) is an inflammatory, demyelinating disease of the CNS. Although CD4 T cells are implicated in MS pathogenesis and have been the main focus of MS research using the animal model experimental autoimmune encephalomyelitis (EAE), substantial evidence from patients with MS points to a role for CD8 T cells in disease pathogenesis. We previously showed that an MHC class I-restricted epitope of myelin basic protein (MBP) is presented in the CNS during CD4 T cell-initiated EAE. Here, we investigated whether naïve MBP-specific CD8 T cells recruited to the CNS during CD4 T cell-initiated EAE engaged in determinant-spreading and influenced disease. We found that the MBP-specific CD8 T cells exacerbated brain but not spinal cord inflammation. We show that a higher frequency of monocytes and monocyte-derived cells presented the MHC class I-restricted MBP ligand in the brain compared to the spinal cord.
    [Show full text]
  • Chemokine Signatures of Pathogen-Specific T Cells II: Memory T Cells in Acute and Chronic Infection
    Chemokine Signatures of Pathogen-Specific T Cells II: Memory T Cells in Acute and Chronic Infection This information is current as Bennett Davenport, Jens Eberlein, Tom T. Nguyen, of September 24, 2021. Francisco Victorino, Verena van der Heide, Maxim Kuleshov, Avi Ma'ayan, Ross Kedl and Dirk Homann J Immunol published online 18 September 2020 http://www.jimmunol.org/content/early/2020/09/17/jimmun ol.2000254 Downloaded from Supplementary http://www.jimmunol.org/content/suppl/2020/09/17/jimmunol.200025 Material 4.DCSupplemental http://www.jimmunol.org/ Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication by guest on September 24, 2021 *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2020 by The American Association of Immunologists, Inc. All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. Published September 18, 2020, doi:10.4049/jimmunol.2000254 The Journal of Immunology Chemokine Signatures of Pathogen-Specific T Cells II: Memory T Cells in Acute and Chronic Infection Bennett Davenport,*,†,‡,x,{ Jens Eberlein,*,† Tom T. Nguyen,*,‡ Francisco Victorino,*,†,‡ Verena van der Heide,x,{ Maxim Kuleshov,‖,# Avi Ma’ayan,‖,# Ross Kedl,† and Dirk Homann*,†,‡,x,{ Pathogen-specific memory T cells (TM) contribute to enhanced immune protection under conditions of reinfection, and their effective recruitment into a recall response relies, in part, on cues imparted by chemokines that coordinate their spatiotemporal positioning.
    [Show full text]
  • NF-Κb Dependent Chemokine Signaling in Pancreatic Cancer
    cancers Review NF-κB Dependent Chemokine Signaling in Pancreatic Cancer Claudia Geismann 1, Heiner Schäfer 1,2 , Jan-Paul Gundlach 3, Charlotte Hauser 3 , Jan-Hendrik Egberts 3, Günter Schneider 4 and Alexander Arlt 1,* 1 Laboratory of Molecular Gastroenterology & Hepatology, Department of Internal Medicine I, UKSH-Campus Kiel, 24105 Kiel, Germany; [email protected] (C.G.); [email protected] (H.S.) 2 Institute of Experimental Cancer Research, UKSH Campus Kiel, 24105 Kiel, Germany 3 Department of Surgery, UKSH-Campus Kiel, 24105 Kiel, Germany; [email protected] (J.-P.G.); [email protected] (C.H.); [email protected] (J.-H.E.) 4 Technische Universität München, Klinikum rechts der Isar, II. Medizinische Klinik, 81675 Munich, Germany; [email protected] * Correspondence: [email protected]; Tel.: +49-431-5002-2210 Received: 30 August 2019; Accepted: 24 September 2019; Published: 26 September 2019 Abstract: Pancreatic cancer is one of the carcinomas with the worst prognoses, as shown by its five-year survival rate of 9%. Although there have been new therapeutic innovations, the effectiveness of these therapies is still limited, resulting in pancreatic ductal adenocarcinoma (PDAC) becoming the second leading cause of cancer-related death in 2020 in the US. In addition to tumor cell intrinsic resistance mechanisms, this disease exhibits a complex stroma consisting of fibroblasts, immune cells, neuronal and vascular cells, along with extracellular matrix, all conferring therapeutic resistance by several mechanisms. The NF-κB pathway is involved in both the tumor cell-intrinsic and microenvironment-mediated therapeutic resistance by regulating the transcription of a plethora of target genes.
    [Show full text]
  • Inflammation in Lafora Disease: Evolution with Disease Progression in Laforin and Malin Knock-Out Mouse Models
    HHS Public Access Author manuscript Author ManuscriptAuthor Manuscript Author Mol Neurobiol Manuscript Author . Author Manuscript manuscript; Author available in PMC 2017 July 01. Published in final edited form as: Mol Neurobiol. 2017 July ; 54(5): 3119–3130. doi:10.1007/s12035-016-9884-4. Inflammation in Lafora Disease: evolution with disease progression in laforin and malin knock-out mouse models Irene López-González, MSc1,#, Rosa Viana, PhD4,#, Pascual Sanz, PhD4,5,CA, and Isidre Ferrer, MD, PhD1,2,3,CA 1Institute of Neuropathology, Bellvitge University Hospital, Idibell, Hospitalet de Llobregat, Barcelona, Spain 2University of Barcelona, Hospitalet de Llobregat, Barcelona, Spain 3CIBERNED (Centro de Investigación Biomédica en Red de Enfermedades Neurodegenerativas), Ministry of Science and Innovation, Institute Carlos III, Spain 4Instituto de Biomedicina de Valencia, Consejo Superior de Investigaciones Científicas; Valencia, Spain 5CIBERER (Centro de Investigación Biomédica en Red de Enfermedades Raras), Institute Carlos III, Spain Abstract Lafora progressive myoclonus epilepsy (Lafora disease, LD) is a fatal rare autosomal recessive neurodegenerative disorder characterized by the accumulation of insoluble ubiquitinated polyglucosan inclusions in the cytoplasm of neurons, which is most commonly associated with mutations in two genes: EPM2A, encoding the glucan phosphatase laforin, and EPM2B, encoding the E3-ubiquitin ligase malin. The present study analyzes possible inflammatory responses in the mouse lines Epm2a−/− (laforin knock-out) and Epm2b−/− (malin knock-out) with disease progression. Increased numbers of reactive astrocytes (expressing the GFAP marker) and microglia (expressing the Iba1 marker) together with increased expression of genes encoding cytokines and mediators of the inflammatory response occur in both mouse lines although with marked genotype differences.
    [Show full text]
  • Lineage-Specific Functions of Bcl-6 in Immunity and Inflammation Are Mediated by Distinct Biochemical Mechanisms
    ARTICLES Lineage-specific functions of Bcl-6 in immunity and inflammation are mediated by distinct biochemical mechanisms Chuanxin Huang, Katerina Hatzi & Ari Melnick The transcription factor Bcl-6 orchestrates germinal center (GC) reactions through its actions in B cells and T cells and regulates inflammatory signaling in macrophages. Here we found that genetic replacement with mutated Bcl6 encoding Bcl-6 that cannot bind corepressors to its BTB domain resulted in disruption of the formation of GCs and affinity maturation of immunoglobulins due to a defect in the proliferation and survival of B cells. In contrast, loss of function of the BTB domain had no effect on the differentiation and function of follicular helper T cells or that of other helper T cell subsets. Bcl6-null mice had a lethal inflammatory phenotype, whereas mice with a mutant BTB domain had normal healthy lives with no inflammation. The repression of inflammatory responses by Bcl-6 in macrophages was accordingly independent of the repressor function of the BTB domain. Bcl-6 thus mediates its actions through lineage-specific biochemical functions. Bcl-6 is a transcriptional repressor originally identified as being Bcl-6 is a member of the BTB–zinc finger family of proteins. Its BTB encoded by a locus frequently translocated in diffuse large B cell lym- domain forms an obligate homodimer and it contains C2H2 zinc fin- phomas (DLBCLs)1. During normal development, Bcl-6 has critical gers that bind to DNA. The interface between monomers of the Bcl-6 functions in various cell types of the adaptive and innate compart- BTB domain creates two symmetrical extended lateral grooves that ments of the immune system.
    [Show full text]