BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Immunother Cancer Additional File 1. Mass cytometry staining panel. Marker Metal Host Isotype Clone Company Cat.no 1 CD3e 172 Yb Hamster IgG 145-2C11 BioLegend (MaxPar-Ready) 100345 2 CD8a 168 Er Rat IgG2a 53-6.7 Fluidigm 3168003B 3 CD11b 154 Sm Rat IgG2b M1/70 Fluidigm 3154006B 4 CD19 166 Er Rat IgG2a 6D5 Fluidigm 3166015B 5 CD45 89 Y Rat IgG2b 30-F11 Fluidigm 3089005B 6 CD11c 167 Er Hamster IgG N418 BioLegend (MaxPar-Ready) 117341 7 CD115 144 Nd Rat IgG2a AFS98 Fluidigm 3144012B 8 F4/80 174 Yb Rat IgG2a, k BM8 BioLegend (MaxPar-Ready) 123143 9 Ly6G 141 Pr Rat IgG2a 1A8 Fluidigm 3141008B 10 PDL1 160 Gd Rat IgG2b, κ 10F.9G2 BioLegend 124301 11 Ly6C 165 Ho Rat IgG2c HK1.4 BioLegend (MaxPar-Ready) 128039 12 CD86 171 Yb Rat IgG2a, κ GL-1 BioLegend 105001 13 CD14 156 Gd Rat IgG2a, κ Sa14-2 Fluidigm 3156009B 14 CD38 163 Dy Rat IgG2a, κ 90 BioLegend (MaxPar-Ready) 102723 15 PD-1 159 Tb Rat IgG2a 29F.1A12 Fluidigm 3159024B 16 MHC-II 115 In Rat IgG2b M5/114.15.2 BioLegend (MaxPar-Ready) 107637 17 CD103 173 Yb Hamster IgG 2E7 BioLegend 121401 18 CD40 147 Sm Rat IgG2a, κ 3/23 BioLegend 124601 19 Clec9A 150 Nd Rat IgG1, κ 7H11 BioLegend 143502 20 CD205 169 Tm Rat IgG2a, κ NLDC-145 BioLegend 138202 21 Gr-1 152 Sm Rat IgG2b, κ RB6-8C5 BioLegend (MaxPar-Ready) 108449 22 BST2 151 Eu Rat IgG2b, κ 129C1 BioLegend 127102 23 SiglecH 153 Eu Rat IgG1, κ 551 BioLegend 129606 24 B220 176 Yb Rat IgG2a, k RA3-6B2 Fluidigm 3176002B 25 CD24 161 Dy Rat IgG2b, κ M1/69 BioLegend (MaxPar-Ready) 101829 26 CD48 162 Dy Hamster IgG HM48-1 BioLegend (MaxPar-Ready) 103433 27 CD169 170 Er Rat IgG2a, κ 3D6.112 Fluidigm 3170018B 28 CD64 158 Gd Mouse IgG1, κ X54-5/7.1 BioLegend 139301 29 PD-L2 148 Nd Rat IgG2a, k Ty25 eBioscience 14-5986-82 30 CD70 142 Nd Rat IgG2b, k FR70 eBioscience 14-0701-82 31 ICOSL 143 Nd Rat IgG2a, κ HK5.3 BioLegend 107407 32 OX40L 149 Sm Rat IgG2b, k RM134L BioLegend 108802 33 SiglecF 175 Lu Rat IgG2a, κ E50-2440 BD 552125 34 CD90.2 145 Nd Rat IgG2b, κ 30-H12 BioLegend (MaxPar-Ready) 105333 35 CD31 155 Gd Rat IgG2a, κ 390 BioLegend (MaxPar-Ready) 102425 36 CX3CR1 164 Dy Mouse IgG2a, κ SA011F11 Fluidigm 3164023B 37 CCR2 209 Bi Rat IgG2b 475301 R&D MAB55381 Beyranvand Nejad E, et al. J Immunother Cancer 2020; 8:e001326. doi: 10.1136/jitc-2020-001326 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Immunother Cancer Additional File 2. Primers of RT2 Profiler PCR Array Mouse Chemokines and receptors. Primers sequence STAT1 forward TGGTGAAATTGCAAGAGCTG STAT1 reverse CAGACTTCCGTTGGTGGATT CCL2 forward CGGAACCAAATGAGATCAGAACCTAC CCL2 reverse GCTTCAGATTTACGGGTCAACTTCAC CCL5 forward ATTGCTTGCTCTAGTCCTA CCL5 reverse ATGCTGATTTCTTGGGTTT JAK1 forward GGCAGCGGAGAGTATACAGC JAK1 reverse CACAGTGATGATTCGGTTCG IRF1 forward ACCCTGGCTAGAGATGCAGA IRF1 reverse AGGCATCCTTGTTGATGTCC IRF3 forward CGG AAA GAA GTG TTG CGG IRF3 reverse TTT TCC TGG GAG TGA GGC IRF4 forward GCCTTGTTATTGCATGCCAGC IRF4 reverse AGACCAAGCTTTTCAGCCTGG IRF5 forward ATGGGGACAACACCATCTTC IRF5 reverse GCTTTTGTTAAGGGCACAGC IRF7 forward TCTCCCAGACTGCCTGTGTA IRF7 reverse CAGATCCCTACGACCGAAAT IRF8 forward ACGAGGTTACGCTGTGCTCT IRF8 reverse TCAGCTCCTCAATCTCTGAGC HPV16 E7 forward CAAGTGTGACTCTACGCTTCGG HPV16 E7 reverse GTGCCCATTAACAGGTCTTCCAA TNF forward GAACTGGCAGAAGAGGCACT TNF reverse AGGGTCTGGGCCATAGAACT MDM2 forward CTC TGG ACT CGG AAG ATT ACA GCC MDM2 reverse CCT GTC TGA TAG ACT GTC ACC CG Ccng1 forward AATGGCCTCAGAATGACTGC Ccng1 reverse CTCAGTCCAACACACCCAAG Ei24 forward CTTTCTGCAGGACCTTGGCA Ei24 reverse CTCTCTTCTGCTGGATCCGA Pidd forward TGCTGCAAGTGGAGTTTTTG Pidd reverse AGCCTGTTGAAGCTCAGGTC Mzt2 forward TCGGTGCCCATATCTCTGTC Mzt2 reverse CTGCTTCGGGAGTTGCTTTT Ptp4a2 forward AGCCCCTGTGGAGATCTCTT Beyranvand Nejad E, et al. J Immunother Cancer 2020; 8:e001326. doi: 10.1136/jitc-2020-001326 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Immunother Cancer Ptp4a2 reverse AGCATCACAAACTCGAACCA GAPDH forward GTGCTGAGTATGTCGTGGAGTCTAC GAPDH reverse GGCGGAGATGATGACCCTTTTGG Beyranvand Nejad E, et al. J Immunother Cancer 2020; 8:e001326. doi: 10.1136/jitc-2020-001326 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Immunother Cancer Beyranvand Nejad E, et al. J Immunother Cancer 2020; 8:e001326. doi: 10.1136/jitc-2020-001326 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Immunother Cancer A B VDLN TDLN IFNγ TNF IL-2 IFNγ TNF IL-2 2.0 2.0 2.0 5 5 5 ns * ns ns ns ns 4 4 4 1.5 1.5 1.5 cells cells cells cells cells cells + + + + + 3 + 3 3 1.0 1.0 1.0 2 2 2 0.5 0.5 0.5 1 1 1 within CD8 within CD8 within CD8 within CD8 % 0 % within CD8 0 % 0 % 0 % within CD8 0 % 0 stim + - + - stim + - + - stim + - + - stim + - + - stim + - + - stim + - + - prime boost prime boost prime boost prime boost prime boost prime boost C D VDLN TDLN IFNγ TNF IL-2 IFNγ TNF IL-2 2.0 2.0 2.0 2.0 0.5 0.5 ns ns ns ** ns ns 0.4 0.4 1.5 1.5 1.5 1.5 cells cells cells cells cells cells + + + + + + 0.3 0.3 1.0 1.0 1.0 1.0 0.2 0.2 0.5 0.5 0.5 0.5 within CD4 within CD4 within CD4 0.1 within CD4 0.1 % % % within CD4 % within CD4 % % 0 0 0 0 0 0 stim + - + - stim + - + - stim + - + - stim + - + - stim + - + - stim + - + - prime boost prime boost prime boost prime boost prime boost prime boost Additional File 4. T cells are still capable of producing cytokines after boost vaccine. Mice were injected with TC-1 tumor cells on day 0. Then, mice were vaccinated with prime SLP suboptimal vaccine on day 8 (prime) and were sacrificed on day 18. Another group of mice vaccinated with prime and boost SLP suboptimal vaccine on day 8 and 22 were sacrificed at the time of relapse on day 39 (boost).A-B) The percentage of IFNγ, TNF and IL-2 producing CD8+ T cells in vaccine draining lymph node (VDLN) (A) and tumor draining lymph node (TDLN) (B) of SLP suboptimal-vaccinated mice. C-D) The percentage of IFNγ, TNF and IL-2 producing CD4+ T cells in VDLN (C) and (TDLN) (D) of SLP suboptimal-vaccinated mice. Data represents mean values ± SEM (n = 5-9 mice per group). Data are representative of two independent experiments. Data presented are mean ± SEM, and statistical analysis was performed using Mann-Whitney test. *, P < 0.05; **, P < 0.01; ***, P < 0.001. Beyranvand Nejad E, et al. J Immunother Cancer 2020; 8:e001326. doi: 10.1136/jitc-2020-001326 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Immunother Cancer Beyranvand Nejad E, et al. J Immunother Cancer 2020; 8:e001326. doi: 10.1136/jitc-2020-001326 BMJ Publishing Group Limited (BMJ) disclaims all liability and responsibility arising from any reliance Supplemental material placed on this supplemental material which has been supplied by the author(s) J Immunother Cancer Additional File 5. Classical immune escape mechanisms do not contribute to recurrence. A) Expression level of E7 oncogene in relapsed TC-1 tumor cells. In brief, the relapsed tumors from the mice (mouse 1-7) were harvested and sorted for CD45- cells. In vitro cultured TC-1 tumor cells and B16 tumor cells have been used as positive and negative controls, respectively. RNA expression level of E7 has been measured by qPCR. B) Expression levels H2Db on CD45-TC-1 tumor cells from untreated mice and SLP suboptimal-vaccinated mice at the time of regression (day 18) and relapse (day 39) measured by flow cytometry. C) The percentage of cytotoxicity in a 51Cr-release CTL assay. Shown is the percentage of tumor cells from untreated or relapsed tumors (target cells) killed by splenocytes isolated from SLP suboptimal-vaccinated or naïve mice as control (effector cells) at different ratios as measured by CTL assay as described in materials and methods. D) Expression of PD-1, Tim-3 and LAG-3 on intratumoral CD8 T cells in untreated and regressed tumor at day 18. E) t-distributed stochastic neighbor embedding (tSNE) plots of all intratumoral CD45+ cells of the untreated and regressed tumors after SLP suboptimal vaccination as analyzed by mass cytometry followed by non-supervised clustering (viSNE) in Cytobank. Monocytes (Mono) and tumor associated macrophages (TAM) were gated based CD11b+Ly6C+CCR2+ and CD11b+F4/80+Ly6C-, respectively. F) Percentage of IFNγ+, TNF+ and IL-2+ cells within CD8+ T cells in tumor of untreated and regressed tumors at day 18. G) Percentage of Ki67+ cells within CD45- tumor cells in tumor of untreated and regressed tumors at day 18. Data are representative of at least two independent experiments. Data presented in B, F and G are mean ± SEM, and statistical analysis was performed using Mann- Whitney test. *, P < 0.05; **, P < 0.01; ***, P < 0.001.