Fluorescent Markers of the Endocytic Pathway in Zymoseptoria Tritici Q ⇑ S

Fungal Genetics and Biology 79 (2015) 150–157

Contents lists available at ScienceDirect

Fungal Genetics and Biology

journal homepage: www.elsevier.com/locate/yfgbi

Fluorescent markers of the endocytic pathway in Zymoseptoria tritici q ⇑ S. Kilaru, M. Schuster, M. Latz, M. Guo, G. Steinberg

Biosciences, University of Exeter, Exeter EX4 4QD, UK article info abstract

Article history: Hyphal growth in filamentous fungi is supported by the uptake (endocytosis) and recycling of mem- Received 22 January 2015 branes and associated proteins at the growing tip. An increasing body of published evidence in various Revised 12 March 2015 fungi demonstrates that this process is of essential importance for fungal growth and pathogenicity. Accepted 17 March 2015 Here, we introduce fluorescent markers to visualize the endocytic pathway in the wheat pathogen Zymoseptoria tritici. We fused enhanced green-fluorescent protein (eGFP) to the actin-binding protein fimbrin (ZtFim1), which is located in actin patches that are formed at the plasma membrane and are par- Keywords: ticipating in endocytic uptake at the cell surface. In addition, we tagged early endosomes by Endosomes eGFP-labelling a Rab5-homologue (ZtRab5) and late endosomes and vacuoles by expressing eGFP-Rab7 Actin patches Pathogenic fungi homologue (ZtRab7). Using fluorescent dyes and live cell imaging we confirmed the dynamic behavior Septoria tritici blotch and localization of these markers. This set of molecular tools enables an in-depth phenotypic analysis Mycosphaerella graminicola of Z. tritici mutant strains thereby supporting new strategies towards the goal of controlling wheat against Z. tritici. Ó 2015 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).

1. Introduction studies showed that these endosomes participate in apical recycling of receptors at the hyphal tip (Fuchs et al., 2006). Shortly Tip growth is a hallmark of filamentous fungi, used to explore thereafter, evidence for apical endocytic recycling in fungal growth soil, exploit substrates or invade host organisms during fungal and morphology was found in filamentous ascomycetes (Higuchi pathogenesis (Steinberg, 2007). Tip growth is characterized by et al., 2009; Lee et al., 2008; Araujo-Bazán et al., 2008; Upadhyay polar extension of the hyphal growth region, which requires con- and Shaw, 2008), which led to the concept of an apical recycling stant delivery of growth supplies, such as membranes and proteins, model (Shaw et al., 2011; overview in Penalva, 2010; Steinberg, but also protein complexes and cell wall-forming enzymes. It is 2014). Interestingly, early endosomes move bi-directionally along widely accepted that tip growth involves the delivery of microtubules (Wedlich-Söldner et al., 2000), a process driven by Golgi-derived secretory vesicles, which are transported to the kinesin-3 and dynein (Wedlich-Söldner et al., 2002; Lenz et al., hyphal tip and accumulate in the Spitzenkörper (Harris et al., 2006; Abenza et al., 2009; Zekert and Fischer, 2009; Zhang et al., 2005; Riquelme and Sanchez-Leon, 2014). This process involves 2010; Egan et al., 2012b; overview in Steinberg, 2014). Recent work cytoskeleton and molecular motors, which utilize ATP to transport in the corn smut fungus U. maydis has shed light on the function of the membranous cargo to the tip for polarized secretion (Egan et al., this motility. Surprisingly, it demonstrates that this motility dis- 2012a; Steinberg, 2007; Xiang and Plamann, 2003). The discovery tributes the protein translation machinery, including mRNA of endocytosis in the late 1990s added another important process (Baumann et al., 2012) and ribosomes (Higuchi et al., 2014), which to the mechanism of tip growth. It was shown firstly in Ustilago is required for extended hyphal growth. In addition, long-range maydis that early endosomes participate in fungal morphogenesis motility of early endosomes mediates communication between and hyphal tip growth (Wedlich-Söldner et al., 2000). Subsequent the invading hyphal tip and the nucleus (Bielska et al., 2014). This long-range signaling is required for production of effector proteins and, therefore, is essential for virulence of U. maydis (overview in Abbreviations: Tub2, a-tubulin; Enhanced green-fluorescent protein, eGFP; Zt, Zymoseptoria tritici; sdi1, succinate dehydrogenase 1; RB and LB, right and left Higuchi and Steinberg, 2015). border; mCherry, monomeric cherry; hph, hygromycin phosphotransferase; nptII, Early endosomes are part of the endocytic pathway. This neomycin phosphotransferase; bar, phosphinothricin acetyltransferase. begins with the uptake of membranes and fluid at the plasma q All material and protocols described here are available upon request. membrane (Fig. 1A). Endocytosis in yeasts and filamentous fungi ⇑ Corresponding author. Tel.: +44 1392 723476; fax: +44 1392 723434. involve polar-localized actin patches (Warren et al., 2002; E-mail address: [email protected] (G. Steinberg). http://dx.doi.org/10.1016/j.fgb.2015.03.019 1087-1845/Ó 2015 The Authors. Published by Elsevier Inc. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/). S. Kilaru et al. / Fungal Genetics and Biology 79 (2015) 150–157 151

A B Actin patch Fimbrin Fimbrin Z. tritici XP_003851390.1 98 A. nidulans CBF70817.1 Early 61 99 Trans-Golgi endosome Late N. crassa XP_956577.2 network endosome Rab5 S,. cerevisiae NP_010414.3 Rab7 Recycling U. maydis KIS66704.1 Degradation Vacuole Marker proteins Human NP_005023.2

Rab5 Rab7 100 Z. tritici XP_003855091.1 Z. tritici XP_003854495.1 11 S. cerevisiae NP_014732.1 A. nidulans XP_657693.1 A. nidulans 54 N. crassa XP_961487.1 98 XP_661446.1

96 N. crassa XP_964811.1 U. maydis KIS66519.1 U. maydis KIS69972.1 86 Human NP_004628.4

Human AAA74081.1 S. cerevisiae NP_013713.1

Fig. 1. Markers for the endocytic pathway in Z. tritici. (A) Schematic overview of the main endocytic membrane trafficking pathways in eukaryotes. Marker proteins for endocytic organelles are indicated in red. Note that the diagram is a highly simplified. (B) Phylogenetic trees comparing the predicted full-length amino acid sequence of homologues of the actin-binding protein fimbrin, and the endocytic small GTPases Rab5 and Rab7 in fungi and humans. The Z. tritici orthologues, used in this study, are indicated in bold and red. NCBI accession numbers are given (http://www.ncbi.nlm.nih.gov/pubmed). Maximum likelihood trees were generated using MEGA5.1 (Tamura et al., 2011). Bootstrap values are indicated at branching points.

Araujo-Bazán et al., 2008; Basu et al., 2014). The actin-binding pro- as recipient strain for the genetic transformation experiments. tein fimbrin localizes to these actin patches (Wu et al., 2001; The isolate was inoculated from stocks stored in glycerol (NSY Castillo-Lluva et al., 2007; Delgado-Alvarez et al., 2010; glycerol; nutrient broth, 8 g/l; yeast extract, 1 g/l; sucrose, 5 g/l; Upadhyay and Shaw, 2008) and performs essential roles in the for- glycerol, 700 ml/l) at 80 °C onto solid YPD agar (yeast extract, mation of endocytic vesicles at the plasma membrane (Shaw et al., 10 g/l; peptone, 20 g/l; glucose, 20 g/l; agar, 20 g/l) and grown at 2011; Skau and Kovar, 2010). Endocytic vesicles deliver their cargo 18 °C for 4–5 days. to early endosomes, which in animals and fungi carry the small GTPase Rab5 (Fig. 1A; Fuchs et al., 2006; Abenza et al., 2009; 2.2. Identification of Z. tritici homologues and bioinformatics Chavrier et al., 1990; Seidel et al., 2013; Zerial and McBride, 2001). Rab5-positive early endosomes mature to late endosomes, To identify homologues of the chosen marker proteins, we which in animals and fungi carry the small GTPase Rab7 (Abenza screened the published sequence of Z. tritici strain IPO323 et al., 2012; Chavrier et al., 1990; Higuchi et al., 2014). This com- (http://genome.jgi.doe.gov/Mycgr3/Mycgr3.home.html), using the partment is an intermediate before endocytosed material is deliv- provided BLASP function and the U. maydis proteins sequences of ered to the vacuole for degradation. Fim1 (NCBI accession number: XP_760915.1), Rab5a (NCBI acces- In this study, we introduce fluorescent marker proteins for visu- sion number: XP_757052.1) and Rab7 (NCBI accession number: alization of the endocytic pathway in the ascomycete Zymoseptoria 761658.1). Sequences were obtained from the NCBI server tritici. This fungus is a major pathogen on wheat, causing signifi- (http://www.ncbi.nlm.nih.gov/pubmed) and comparison was done cant economic damage in the European Union (Gurr and Fones, using CLUSTAL W (http://www.ebi.ac.uk/Tools/msa/clustalw2/) 2015) and, consequently, is considered amongst the most devastat- and EMBOSS Needle (http://www.ebi.ac.uk/Tools/psa/emboss_ ing plant pathogenic fungi (Dean et al., 2012). We confirm the needle/) and domain structures were analyzed in PFAM (http:// specific localization of all markers using dual-color live cell pfam.xfam.org/search/sequence). Finally, phylogenetic trees were imaging, pharmacological experiments and in vivo analysis of their generated in MEGA5.2, using a Maximum likelihood algorithm, fol- cellular dynamics. We also describe 6 vectors, carrying 2 different lowed by 1000 bootstrap cycles (http://www.megasoftware.net/; resistance cassettes, to enable phenotypic analyses of morpholog- (Tamura et al., 2011). ical Z. tritici mutants or in-depth mode of action studies on novel anti-fungal chemistries. 2.3. Molecular cloning

2. Materials and methods All the vectors used in this study were generated by in vivo recombination in the yeast Saccharomyces cerevisiae DS94 (MATa, 2.1. Bacterial and fungal strains and growth conditions ura3-52, trp1-1, leu2-3, his3-111, and lys2-801 (Tang et al., 1996) following published procedures (Raymond et al., 1999). PCR reac- Escherichia coli strain DH5a was used for the maintenance of tions and other molecular techniques followed standard protocols plasmids. Agrobacterium tumefaciens strain EHA105 (Hood et al., (Sambrook and Russell, 2001). All restriction enzymes and reagents 1993) was used for maintenance of plasmids and subsequently were obtained from New England Biolabs Inc (NEB, Herts, UK). for A. tumefaciens-mediated transformation of Z. tritici. E. coli and Vector pHFim1eGFP contains egfp fused to the full-length ztﬁm1 A. tumefaciens were grown in DYT media (tryptone, 16 g/l; yeast under the control of constitutive zttub2 promoter and terminator extract, 10 g/l; NaCl, 5 g/l; with 20 g/l agar added for preparing sequences for random ectopic integration into the genome of Z. the plates) at 37 °C and 28 °C respectively. The fully sequenced Z. tritici using hygromycin B as selection agent. A 13,159 bp fragment tritici wild-type isolate IPO323 (Goodwin et al., 2011) was used of pHeGFPTub2 (see Schuster et al., 2015; digested with BsrGI), 152 S. Kilaru et al. / Fungal Genetics and Biology 79 (2015) 150–157

Table 1 Bioinformatics of putative Z. tritici endocytic marker proteins.

Lengtha Domainsb Identityc (%) Referenced Fim1 Z. tritici U. maydis Z. tritici U. maydis 61.7 Castillo-Lluva et al. (2007) 658 615 Calponin homology (1.2e14) Calponin homology (9.6e17) Calponin homology (4e16) Calponin homology (5e20) Calponin homology (5.9e16) Calponin homology (2.2e14) Calponin homology (7.7e09) Calponin homology (2.6e11) Rab5 Z. tritici U. maydis Z. tritici U. maydis 54.0 Fuchs and Steinberg (2005) 252 280 Ras (7.8e57) Ras (4e54) Rab7 Z. tritici U. maydis Z. tritici U. maydis 78 Fuchs and Steinberg (2005) 205 205 Ras (5.4e56) Ras (1.4e56)

a Given in amino acids. b Determined in PFAM (http://pfam.xfam.org/search/sequence) with error probability in brackets. c Determined in EMBOSS Needle (http://www.ebi.ac.uk/Tools/psa/emboss_needle/). d Reference for comparison.

Table 2 Primers used in this study.

Primer name Direction Sequence (50 to 30)a SK-Sep-14 Sense CATTTGCGGCTGTCTCGAAATCGACGGAAGGCAGTCGACGCCAGATGATGG SK-Sep-16 Sense ATGGTGAGCAAGGGCGAGGAG SK-Sep-42 Antisense CCACAAGATCCTGTCCTCGTCCGTCGTCGCTTACTTGTACAGCTCGTCCATGC SK-Sep-47 Antisense GGCGATGGTGGTATGCGGATG SK-Sep-61 Sense ATCACTCTCGGCATGGACGAGCTGTACAAGATGGCCGACGCCTCAGCTCCA SK-Sep-62 Antisense CCACAAGATCCTGTCCTCGTCCGTCGTCGCTCAACAAGCACATCCCTCCTTCG SK-Sep-63 Sense ATCACTCTCGGCATGGACGAGCTGTACAAGATGTCATCCAGAAAGAAGATCCTTT SK-Sep-64 Antisense CCACAAGATCCTGTCCTCGTCCGTCGTCGCCTAGCACGAGCAGCCTTGCTC SK-Sep-128 Sense CTCTCATAAGAGCTTGGCTGTCGACTCCTCGAATTCGAGCTCGGTACCCAACT SK-Sep-129 Antisense CTTTTCTCTTAGGTTTACCCGCGTTGAAGTGCGTTAACACTAGTCAGATCTACC SK-Sep-240 Sense CATCACTCACATCCGCATACCACCATCGCCATGAACGTGCTCAAGCTGCAGAAG SK-Sep-241 Antisense GGTGAACAGCTCCTCGCCCTTGCTCACCATACCCATCTTCTCCGACGCCGCC

a Italics indicate part of the primer that is complementary with another DNA fragment, to be ligated by homologous recombination in S. cerevisiae.

1149 bp zttub2 promoter (amplified with SK-Sep-14 and terminator sequences for ectopic random integration by using SK-Sep-47; Table 2) 2073 bp full length ztfim1 gene without stop hygromycin B as selection agent. A 14,343 bp fragment of codon (amplified with SK-Sep-240 and SK-Sep-241; Table 2) and pCeGFPRab5 (Fig. 2E; digested with BamHI and BglII) and 1510 720 bp egfp (amplified with SK-Sep-16 and SK-Sep-42; Table 2) hygromycin resistance cassette (amplified with SK-Sep-128 and were recombined in yeast S. cerevisiae to obtain the vector SK-Sep-129; Table 2) were recombined in yeast S. cerevisiae to pHFim1eGFP (Fig. 2A) Note that this vector was derived obtain the vector pHeGFPRab5 (Fig. 2B). Note that this vector pHeGFPTub2, which a derivative of carboxin resistance conferring was derived from carboxin resistance conferring vector vector and as such it contain part of the succinate dehydrogenase pCeGFPRab5 and as such it contains part of the succinate gene, carrying the mutation H267L and succinate dehydrogenase dehydrogenase gene, carrying the mutation H267L and succinate terminator. However, these fragments are of no significance. dehydrogenase terminator. However, these fragments are of no The vector pCFim1eGFP contains egfp fused to the full-length significance. ztfim1 under the control of constitutive zttub2 promoter and termi- The vector pCeGFPRab7 contains egfp fused to the full-length nator sequences for targeted integration into the sdi1 locus of Z. ztrab7 under the control of constitutive zttub2 promoter and termi- tritici by using carboxin as selection agent. A 12,530 bp fragment nator sequences for targeted integration into the sdi1 locus of Z. of pCeGFPTub2 (Schuster et al., 2015; digested with BsrGI), tritici by using carboxin as selection agent. A 14,907 bp fragment 1149 bp Z. tritici a-tubulin promoter (amplified with SK-Sep-14 of pCeGFPTub2 (see Schuster et al., 2015; digested with XhoI) and SK-Sep-47; Table 2), 2073 bp full-length ztfim1 gene without and 815 bp full-length ztrab7 gene (amplified with SK-Sep-63 stop codon (amplified with SK-Sep-240 and SK-Sep-241; Table 2) and SK-Sep-64; Table 2) were recombined in yeast S. cerevisiae to and 717 bp egfp (amplified with SK-Sep-16 and SK-Sep-42; obtain the vector pCeGFPRab7 (Fig. 2D). Table 2) were recombined in yeast S. cerevisiae to obtain the vector The vector pHeGFPRab7 contains egfp fused to the full-length pCeGFPRab5 (Fig. 2C). ztrab7 under the control of constitutive zttub2 promoter and termi- The vector pCeGFPRab5 contains egfp fused to the full-length nator sequences for ectopic random integration by using hygromy- ztrab5 under the control of constitutive zttub2 promoter and termi- cin B as selection agent. A 14,655 bp fragment of pCeGFPRab7 nator sequences for targeted integration into the sdi1 locus of Z. (Fig. 2E; digested with BglII) and 1510 hygromycin resistance cas- tritici by using carboxin as selection agent. A 14,907 bp fragment sette (amplified with SK-Sep-128 and SK-Sep-129; Table 2) were of pCeGFPTub2 (see Schuster et al., 2015; digested with XhoI) recombined in yeast S. cerevisiae to obtain the vector and 812 bp full-length ztrab5 gene (amplified with SK-Sep-61 pHeGFPRab7 (Fig. 2B). Note that this vector was derived from car- and SK-Sep-62; Table 2) were recombined in yeast S. cerevisiae to boxin resistance conferring vector pCeGFPRab7 and as such it con- obtain the vector pCeGFPRab5 (Fig. 2D). tains part of the succinate dehydrogenase gene, carrying the Plasmid pHeGFPRab5 contains egfp fused to the full-length mutation H267L and succinate dehydrogenase terminator. ztrab5 under the control of constitutive zttub2 promoter and However, these fragments are of no significance. Further details S. Kilaru et al. / Fungal Genetics and Biology 79 (2015) 150–157 153

Fig. 2. Vectors to investigate the endocytic pathway in Z. tritici. (A and B) Vectors for random ectopic integration of endocytic marker constructs into the genome of Z. tritici. The vectors pHFim1eGFP, pHeGFPRab5 and pHeGFPRab7 confer hygromycin resistance and are designed for random ectopic integration of GFP-marker fusion proteins into the genome of Z. tritici. Note that these vectors were derived from carboxin resistance conferring vectors. As such they contain part of the succinate dehydrogenase gene, carrying the mutation H267L and succinate dehydrogenase terminator. However, these fragments are of no significance. (C and D) Vectors for targeted integration of endocytic marker constructs into the sdi1 locus of Z. tritici. The vectors pCFim1eGFP, pCeGFPRab5 and pCeGFPRab7 contain the H267L point mutation in a stretch of sdi1 sequence, which confers carboxin resistance and allows targeted integration into the sdi1 locus of Z. tritici (for more information see Kilaru et al., 2015). Note that fragments are not drawn to scale. For more accurate information on fragment sizes see main text. on vector construction and yeast recombination-based cloning is generated by using a objective piezo (Piezosystem jena GmbH, provided in Kilaru and Steinberg (2015). Jena, Germany). Synchronized observation of red and green fluorescence was performed using an dual imager (Dual-View 2 2.4. Z. tritici transformation Multichannel Imaging System; Photometrics, Tucson, USA) equipped with a dual-line beam splitter (z491/561; Chroma The vectors pHFim1eGFP, pHeGFPRab5 and pHeGFPRab7 were Technology Corp., Bellows Falls, USA) with an emission beam split- transformed into A. tumefaciens strain EHA105 by heat shock ter (565 DCXR; Chroma Technology Corp., Bellows Falls, USA), an method (Holsters et al., 1978) and A. tumefaciens mediated trans- ET-Band pass 525/50 (Chroma Technology Corp., Bellows Falls, formation of Z. tritici was performed as described previously by USA), and a single band pass filter (BrightLine HC 617/73; (Zwiers and De Waard, 2001) with the slight modifications. Semrock, New York, USA). Images were captured using a Further details on this method are provided in Kilaru et al. (2015). CoolSNAP HQ2 camera (Photometrics/Roper Scientific, Tucson, USA) and kymographs were generated using MetaMorph 2.5. Epi-fluorescence microscopy (Molecular Devices, Wokingham, UK). All parts of the system were under the control of the software package MetaMorph (Molecular Fluorescence microscopy was performed as previously Devices, Wokingham, UK). described (Schuster et al., 2011a). Fungal cells were grown in YG Actin patches were disrupted by incubating the cells in YG media media either at 18 °C with 200 rpm (for yeast-like cells) or at containing 10 lM Latrunculin A (Molecular Probes/Invitrogen, 24 °C with 100 rpm (for hyphal cells) for 24 h. After placing onto Paisley, UK) for 30 min at 18 °C with 200 rpm. Treated cells were a 2% agar cushion, cells were observed using a motorized inverted placed onto a 2% agar cushion containing 10 lM Latrunculin A, fol- microscope (IX81; Olympus, Hamburg, Germany), equipped with lowed by microscopic observation, using an exposure time of a PlanApo 100/1.45 Oil TIRF (Olympus, Hamburg, Germany). 150 ms and a 488 nm laser at 75% output power. Fluorescent tags and dyes were exited using a VS-LMS4 Laser To co-localize EE with the endocytic marker dye FM4-64 Merge System with solid-state lasers (488 nm/50 mW or 75 mW (Molecular Probes/Invitrogen, Paisley, UK), cells were incubated and 561 nm/50 mW or 75 mW; Visitron Systems, Puchheim, in YG media containing 1 lM FM4-64 for 15 min 18 °C with Germany). CMAC (Molecular Probes/Invitrogen, Paisley, UK) was 200 rpm. The cells were washed by centrifugation for 5 min at visualized using a standard mercury burner. Z stacks were 5000 rpm and suspended in fresh YG media. Cells were placed onto 154 S. Kilaru et al. / Fungal Genetics and Biology 79 (2015) 150–157 a 2% agar cushion and directly observed using the dual-line beam dehydrogenase, H267; carboxin-resistant; see Kilaru and splitter. Images series of 100 planes were acquired, using the Steinberg, 2015 for more details). In addition, all four vectors com- 488 nm laser at 100% output power and an exposure time of 150. prise a ‘‘yeast recombination cassette’’, consisting of URA3 and 2l To examine the effect of the absence of MT on EE motility, cells ori, which enables yeast recombination-based cloning (for more were incubated in YG media containing 300 lM benomyl details see Kilaru and Steinberg, 2015). It needs to be noted that (Sigma–Aldrich Chemie Gmbh, Munich, Germany) for 45 min at all the above four vectors contain the sdi1 downstream sequence 18 °C with 200 rpm. Treated cells were observed on 2% agar cush- (sdi1 left flank and terminator, Fig. 2A and B). This sequence is a ion containing 300 lM benomyl. remnant of the cloning procedure and has no functional Late endosomes and vacuoles labelled with eGFP-Rab7 were significance. counterstained in YG media containing 100 lM vacuolar marker CellTracker Blue CMCA (Molecular Probes/Invitrogen, Paisley, UK) 3.3. Visualization of fluorescently-labelled endocytic compartments in for 15 min at 18 °C with 200 rpm The cells were washed by cen- Z. tritici trifugation for 5 min at 5000 rpm and re-suspended in fresh YG media followed by taking single images in the DAPI and GFP chan- In order to visualize actin patches, early endosomes, late endo- nel using the mercury burner and an exposure time of 20 ms and somes and vacuoles, the vectors pHFim1eGFP, pHeGFPRab5 and 100 ms respectively. Movie of 100 planes in the GFP channel with pHeGFPRab7 were transformed into Z. tritici strain IPO323 (Kema the 488 nm laser at 100% and an exposure time of 150 ms were and van Silfhout, 1997) using A. tumefaciens-mediated transforma- taken to visualize late endosome motility. tion (Zwiers and De Waard, 2001). Transformants were visualized microscopically for the presence of green fluorescence, and positive strains were named IPO323_HFim1eGFP, IPO323_HeGFPRab5 3. Results and discussion and IPO323_HeGFPRab7 respectively. We next analyzed the localization of all markers by fluorescent 3.1. Identification of ZtFim1, ZtRab5 and ZtRab7 microscopy. Fimbrin localizes to actin patches at the growing hyphal tip of filamentous ascomycetes Aspergillus nidulans (Araujo-Bazán In this study, we set out to establish fluorescent marker pro- et al., 2008; Upadhyay and Shaw, 2008) and Neurospora crassa teins for the endocytic pathway in Z. tritici. We choose the (Delgado-Alvarez et al., 2010) and the growth region of the basid- actin-binding protein fimbrin (Fig. 1A; Fim1) and the small iomycete U. maydis (Castillo-Lluva et al., 2007). Consistent with GTPases Rab5 and Rab7. The latter are located to early endosomes, these reports, ZtFim1-eGFP localize in patchy signals in the apical late endosomes and vacuoles (Fig. 1A). We identified homologues region of hyphae (Fig. 3A). This localization was abolished when in Z. tritici by screening the published genome sequence F-actin was disrupted with the drug Latrunculin A (Fig. 3B; Spector (Goodwin et al., 2011; see materials and methods), using the U. et al., 1983), which was shown to disassemble actin patches in fungi maydis fimbrin, Fim1 (Castillo-Lluva et al., 2007), and the endocytic (Berepiki et al., 2010). Fimbrin is an F-actin-binding protein Rab-GTPases Rab5a and Rab7 (Fuchs and Steinberg, 2005). This (Bretscher, 1981) and the dependency of the apical localization of revealed the putative ZtFim1 (protein ID 72868; NCBI accession ZtFim1-eGFP on F-actin confirms the correct localization of the mar- number: XP_003851390), and the putative GTPases ZtRab5 (pro- ker in actin patches. Furthermore, live cell imaging of ZtFim1-eGFP tein ID: 66333; NCBI accession number: XP_003857299), and demonstrated that the fluorescent patches are dynamic (Fig. 3C), ZtRab7 (protein ID 99493; NCBI accession number: with individual signals disappearing (Fig. 3C, open arrowhead) and XP_003854495). All predicted Z. tritici proteins showed high appearing (Fig. 3C, closed arrowheads) during the course of observa- sequence similarity with their published orthologues in other fungi tion. This behavior is reminiscent of actin patches (Berepiki et al., (Fig. 1B, Table 1) and shared similar domain structures (Table 1). 2010; Delgado-Alvarez et al., 2010; Kaksonen et al., 2003) overview The translational start and the stop of each open reading frame in (Berepiki et al., 2011; Kovar et al., 2011), again arguing that were confirmed by comparison with homologous proteins. ZtFim1-eGFP is a suitable marker for visualizing the plasma membrane sites of endocytic uptake. 3.2. Vectors for random ectopic integration of Fim1-GFP, eGFP-Rab5 The small GTPase Rab5 is located on rapidly moving fungal early and eGFP-Rab7 fusion constructs endosomes (Fuchs and Steinberg, 2005; Abenza et al., 2009; Seidel et al., 2013). In hyphal cells of Z. tritici, the putative marker protein In order to visualize actin patches and early, late and recycling eGFP-ZtRab5 concentrates in cytoplasmic spots (Fig. 3D). These were endosomes in Z. tritici, we constructed the vectors pHFim1eGFP, evenly-distributed and moved bidirectionally at 2.18 ± 0.51 lm/s pHeGFPRab5 and pHeGFPRab7 (Fig. 2A and B). These vectors con- (n = 31; anterograde) and 2.36 ± 0.50 lm/s (n = 29; retrograde). This tain the enhanced green-fluorescent protein (eGFP) fused to velocities are not significantly different from those measured for early ZtFim1, ZtRab5 and ZtRab7. Integration of these vectors into the endosome motility in U. maydis (P = 0.6589, Student t-test; Schuster genome allows the expression of Fim1-eGFP, eGFP-Rab5 and et al., 2011b), suggesting that the eGFP-ZtRab5 signals are, indeed, eGFP-Rab7 fusion proteins under the control of constitutive early endosomes. We tested this further by labelling the endocytic Z. tritici a-tubulin promoter (Fig. 2A and B; Ptub2). The vectors were pathway of IPO323_HeGFPRab5 cells with the dye FM4-64. This mar- built on the Agrobacterium binary vector pCAMBIA0380 (CAMBIA, ker is a useful tool to visualize the endocytic pathway in fungi Canberra, Australia), which enables A. tumefaciens-based transfor- (Fischer-Parton et al., 2000). After short exposure to the cells, the mation into Z. tritici, based on the 25 bp imperfect directional dye inserts into the plasma membrane and, after internalization, repeat sequences of the T-DNA borders (right and left border, RB passes through the early endosomes (Wedlich-Söldner et al., 2000). and LB; Fig. 2A and B). The vectors also carry a kanamycin resis- We performed similar experiments using IPO323_HeGFPRab5 cells. tance gene and origins of replication for amplification in E. coli Indeed, FM4-64 co-localizes with the motile eGFP-ZtRab5-positive and A. tumefaciens. We designed these vectors for random ectopic organelles (Fig. 3E). Finally, we tested if the motility of these putative integration into the genome of Z. tritici, using hygromycin B as early endosomes depends on microtubules, which was previously selection agent. These vectors can also be used in combination with shown for U. maydis (Lenz et al., 2006; Wedlich-Söldner et al., other resistance cassette, such as nptII (neomycin phosphotrans- 2000), A. nidulans (Abenza et al., 2009)andN. crassa (Seidel et al., ferase; G418-resistant) or bar (phosphinothricin acetyltransferase; 2013). Indeed, motility of the eGFP-ZtRab5 labelled structures was Basta-resistant) or sdi1R (mutated allele of succinate abolishedwhenmicrotubulesweredepolymerisedwiththe S. Kilaru et al. / Fungal Genetics and Biology 79 (2015) 150–157 155

Fim1 (actin patches) Fim1 (actin patches) A Fim1 B +LatA C Time 3 2

Distance

Rab5 (early endosomes) F 10 3 10

Rab5 (early endosomes) E FM4-64 D DMSO

Rab5

Rab5 Time 3 Merge 3 2 Benomyl 5 Distance

Fig. 3. Compartments of the early endocytic pathway in Z. tritici. (A) Hyphal cells expressing Fim1-eGFP, after ectopic integration of pHFim1eGFP. The actin-binding protein concentrates in patches at the growth region (see inset). This localization is typical for actin patches in fungi. Bars represent 10 lm and 3 lm. (B) Fim1-eGFP in the presence of the actin-disrupting drug Latrunculin A (incubated at 10 lM for 30 min). Actin-patches disappeared and the fluorescent fusion protein locates in the cytoplasm. Bar represents 10 lm. (C) Kymograph showing motility of Fim1-eGFP signals in Z. tritici. Signals remain stationary, but start random lateral movement before they disappear (open arrowhead). Note that several Fim1-eGFP signals appear during the course of observation (filled arrowheads). This motility behavior is consistent with that of fungal actin patches. Bars represent 3 s and 2 lm. (D) Localization of the early endosome marker protein eGFP-Rab5, expressed after ectopic integration of pHeGFPRab5, in a hyphal cell of Z. tritici. Bar represents 5 lm. (E) Co-visualization of eGFP-Rab5 (green in overlay) and the endocytic marker dye FM4-64 (red in overlay) in Z. tritici. The dye is concentrated in the plasma membrane, from where it is taken up into early endosomes. These organelles co-localize with eGFP-Rab5 (yellow) in overlay. This confirms that the marker labels an early endocytic compartment. Bar represents 3 lm. (F) Kymograph showing motility of eGFP-Rab5-labelled early endosomes. Moving signals are represented by diagonal lines, whereas stationary signals are provide vertical lines. Note that treatment with the microtubule-inhibitor benomyl (300 lM, 45 min) abolishes motility. This is consistent with a microtubule-based transport of early endosomes, reported in other fungal systems. Bars represent 3 s and 2 lm.

A Rab7 (late endosome and vacuole) C D 1

1 Rab7

Time 3 1 5 1 Rab7 CMAC Distance Rab7 (late endosome and vacuole) B Rab7 CMAC Merge

Fig. 4. Compartments of the late endocytic in Z. tritici. (A) Localization of the late endosome marker protein eGFP-Rab7, expressed after ectopic integration of pHeGFPRab5, in a hyphal cell of Z. tritici. Bar represents 5 lm. (B) Co-localization of the late endocytic marker eGFP-Rab7 (green in overlay) and CellTracker Blue CMAC-labelled vacuoles (blue in overlay) in growing macropycnidiospores of Z. tritici. Similar to hyphal cells, eGFP-Rab7 localizes predominantly to vacuoles. Bar represents 10 lm. (C) Co-localization of the late endosome marker protein eGFP-Rab7 and the vacuole marker dye CellTracker Blue CMAC. The dye labels the lumen of the Rab7-positive organelles, indicating that they are vacuoles. In addition, unlabelled Rab7-positive signals were found (arrowheads). These were associated with vacuoles (closed arrowhead, lower left) or independent of vacuoles (open arrowhead, right panel). Bars represent 1 lm. (D) Kymograph showing motility of a small eGFP-Rab7-labelled late endosome. Moving signals are represented by diagonal lines, whereas stationary signals are provide vertical lines. Only vacuole-independent Rab7-positive signals showed directed motility. Bars represent 3 s and 1 lm. 156 S. Kilaru et al. / Fungal Genetics and Biology 79 (2015) 150–157 anti-fungal drug benomyl (Fig. 3F). Thus, eGFP-ZtRab5-marked orga- Acknowledgements nelles show early endosome specific features, including bi-directional motility at 2 lm/s, co-localization with FM4-64 and a dependency The authors are grateful for funding for this work from the of their motility on microtubules. We conclude that eGFP-ZtRab5 is Biotechnology & Biological Sciences Research Council (BBSRC, a suitable marker for this endocytic compartment in Z. tritici. BB/I025956/1). We are grateful to Prof. S.J. Gurr for improving Finally, we investigated the localization of the Rab7 homologue the manuscript. ZtRab7. The small GTPase Rab7 is located on late endosomes in mammalian cells (Chavrier et al., 1990) and late endosomes and the fungal vacuole (Abenza et al., 2012; Higuchi et al., 2014). In References Z. tritici, eGFP-ZtRab7 was mainly localized to the membrane of Abenza, J.F., Pantazopoulou, A., Rodriguez, J.M., Galindo, A., Penalva, M.A., 2009. large compartments that were distributed within the hyphal cell Long-distance movement of Aspergillus nidulans early endosomes on (Fig. 4A) and on budding macropycnidia (Fig. 4B). We microtubule tracks. Traffic 10, 57–75. co-visualized these compartments with the dye CellTracker blue Abenza, J.F., Galindo, A., Pinar, M., Pantazopoulou, A., de los Rios, V., Penalva, M.A., 2012. Endosomal maturation by Rab conversion in Aspergillus nidulans is CMAC (Fig. 4B and C). This showed that the eGFP-ZtRab7-positive coupled to dynein-mediated basipetal movement. Mol. Biol. Cell 23, 1889– structures are vacuoles. This finding is in agreement with the local- 1901. ization of Rab7 in A. nidulans (Abenza et al., 2012). In addition, the Araujo-Bazán, L., Peñalva, M.A., Espeso, E.A., 2008. Preferential localization of the endocytic internalization machinery to hyphal tips underlies polarization of the marker concentrated at vacuole-associated organelles and a few actin cytoskeleton in Aspergillus nidulans. Mol. Microbiol. 67, 891–905. small vesicles (Fig. 4C, arrowheads). These vesicles showed Basu, R., Munteanu, E.L., Chang, F., 2014. Role of turgor pressure in endocytosis in short-range motility at 2.1 ± 0.67 lm/s (Fig. 4D, a kymograph fission yeast. Mol. Biol. Cell 25, 679–687. Baumann, S., Pohlmann, T., Jungbluth, M., Brachmann, A., Feldbrügge, M., 2012. shows motility as a diagonal line; arrowhead). Again, such small Kinesin-3 and dynein mediate microtubule-dependent co-transport of mRNPs Rab7-positive structures were described in A. nidulans (Abenza and endosomes. J. Cell Sci. 125, 2740–2752. et al., 2012). In summary, eGFP-ZtRab7 shows a localization pat- Berepiki, A., Lichius, A., Shoji, J.Y., Tilsner, J., Read, N.D., 2010. F-actin dynamics in Neurospora crassa. Eukaryot. Cell 9, 547–557. tern that is almost identical to that of its homologue in A. nidulans. Berepiki, A., Lichius, A., Read, N.D., 2011. Actin organization and dynamics in filamentous fungi. Nat. Rev. Microbiol. 9, 876–887. Bielska, E., Higuchi, Y., Schuster, M., Steinberg, N., Kilaru, S., Talbot, N.J., Steinberg, 3.4. Vectors for targeted ectopic integration of Fim1-GFP, eGFP-Rab5 G., 2014. Long-distance endosome trafficking drives fungal effector production during plant infection. Nat. Commun. 5, 5097. and eGFP-Rab7 fusion constructs Bretscher, A., 1981. Fimbrin is a cytoskeletal protein that crosslinks F-actin in vitro. Proc. Natl. Acad. Sci. USA 78, 6849–6853. As part of the molecular tool set for Z. tritici, we constructed Castillo-Lluva, S., Alvarez-Tabares, I., Weber, I., Steinberg, G., Perez-Martin, J., 2007. Sustained cell polarity and virulence in the phytopathogenic fungus Ustilago another set of vectors, pCFim1eGFP, pCeGFPRab5 and maydis depends on an essential cyclin-dependent kinase from the Cdk5/Pho85 pCeGFPRab7 (Fig. 2Cand D). These plasmids allow targeted integra- family. J. Cell Sci. 120, 1584–1595. tion of the fluorescent marker into the sdi1 locus, thereby Chavrier, P., Parton, R.G., Hauri, H.P., Simons, K., Zerial, M., 1990. Localization of low molecular weight GTP binding proteins to exocytic and endocytic conferring resistance against the fungicide carboxin. Targeted compartments. Cell 62, 317–329. integration into the genomic sdi1 locus of Z. tritici is achieved by Dean, R., Van Kan, J.A., Pretorius, Z.A., Hammond-Kosack, K.E., Di Pietro, A., Spanu, a mutated downstream stretch of the sdi1 sequence, carrying a P.D., Rudd, J.J., Dickman, M., Kahmann, R., Ellis, J., Foster, G.D., 2012. The top 10 carboxin resistance conferring point mutation (H267L; fungal pathogens in molecular plant pathology. Mol. Plant Pathol. 13, 414–430. Delgado-Alvarez, D.L., Callejas-Negrete, O.A., Gomez, N., Freitag, M., Roberson, R.W., Fig. 2C and D, left flank), and a sequence stretch downstream of Smith, L.G., Mourino-Perez, R.R., 2010. Visualization of F-actin localization and sdi1 (Fig. 2C and 2D, right flank of sdi1). Incorporation by homolo- dynamics with live cell markers in Neurospora crassa. Fungal Genet. Biol., FG & B gous recombination mutates the sdi1 gene and integrates single 47, 573–586. Egan, M.J., McClintock, M.A., Reck-Peterson, S.L., 2012a. Microtubule-based copies of Fim1-eGFP, eGFP-Rab5, and eGFP-Rab7 constructs into transport in filamentous fungi. Curr. Opin. Microbiol. 15, 637–645. the sdi1 locus, construct without affecting other Z. tritici genes. Egan, M.J., Tan, K., Reck-Peterson, S.L., 2012b. Lis1 is an initiation factor for dynein- Again, these vectors enable A. tumefaciens-based transformation driven organelle transport. J. Cell Biol. 197, 971–982. Fischer-Parton, S., Parton, R.M., Hickey, P.C., Dijksterhuis, J., Atkinson, H.A., Read, and yeast recombination-based cloning (see Kilaru and Steinberg, N.D., 2000. Confocal microscopy of FM4-64 as a tool for analysing endocytosis 2015). The vectors are useful for integration into strains that and vesicle trafficking in living fungal hyphae. J. Microsc. 198, 246–259. already contain other dominant selectable marker. Fuchs, U., Steinberg, G., 2005. Endocytosis in the plant-pathogenic fungus Ustilago maydis. Protoplasma 226, 75–80. Fuchs, U., Hause, G., Schuchardt, I., Steinberg, G., 2006. Endocytosis is essential for pathogenic development in the corn smut fungus Ustilago maydis. Plant Cell 18, 4. Conclusion 2066–2081. Goodwin, S.B., M’Barek, S.B., Dhillon, B., Wittenberg, A.H., Crane, C.F., Hane, J.K., et al., 2011. Finished genome of the fungal wheat pathogen Mycosphaerella In fungi, endocytosis is an important process that supports graminicola reveals dispensome structure, chromosome plasticity, and stealth hyphal growth (Penalva, 2010; Steinberg, 2014). Invasion of pathogenesis. PLoS Genet. 7, e1002070. Gurr, S.J., Fones, H., 2015. The impact of Septoria tritici Blotch disease on wheat: an wheat by Z. tritici is based on hyphal growth (Mehrabi et al., EU perspective. Fungal Genet. Biol. 79, 3–7. 2006; Motteram et al., 2011; overview in Steinberg, 2015). Harris, S.D., Read, N.D., Roberson, R.W., Shaw, B., Seiler, S., Plamann, M., Momany, Therefore, proteins of the endocytic pathway provide putative M., 2005. Polarisome meets spitzenkorper, microscopy, genetics, and genomics converge. Eukaryot. Cell 4, 225–229. targets for novel anti-fungals. Here, we establish fluorescent Higuchi, Y., Steinberg, G., 2015. Early endosomes motility in filamentous fungi, How markers that label all endocytic compartments. We confirm their and why they move. Fungal Biol. Rev. http://dx.doi.org/10.1016/j.fbr.2015.02. identity and specificity of their localization by bioinformatics, 002. pharmaceutical experiments, live cell imaging of their dynamics Higuchi, Y., Shoji, J.Y., Arioka, M., Kitamoto, K., 2009. Endocytosis is crucial for cell polarity and apical membrane recycling in the filamentous fungus Aspergillus and co-staining with established cellular dyes. Moreover, we oryzae. Eukaryot. Cell 8, 37–46. show that the cellular localization of all markers corresponds Higuchi, Y., Ashwin, P., Roger, Y., Steinberg, G., 2014. Early endosome motility to published data in other filamentous ascomycete fungi. Thus, spatially organizes polysome distribution. J. Cell Biol. 204, 343–357. Holsters, M., de Waele, D., Depicker, A., Messens, E., van Montagu, M., Schell, J., we conclude that this set of fluorescent proteins is suitable to 1978. Transfection and transformation of Agrobacterium tumefaciens. Mol. Gen. visualize the organization and dynamic behavior of endocytic Genet. 163, 181–187. compartments in Z. tritici. Using these molecular tools will help Hood, E., Gelvin, S.B., Melchers, L., Hoekema, A., 1993. New Agrobacterium helper plasmids for gene transfer to plants. Transgen. Res. 2, 208–218. phenotypic analysis of mutants, but also will support Kaksonen, M., Sun, Y., Drubin, D.G., 2003. A pathway for association of receptors, mode-of-action studies of novel fungicides. adaptors, and actin during endocytic internalization. Cell 115, 475–487. S. Kilaru et al. / Fungal Genetics and Biology 79 (2015) 150–157 157

Kema, G.H.J., van Silfhout, C.H., 1997. Genetic variation for virulence and resistance Skau, C.T., Kovar, D.R., 2010. Fimbrin and tropomyosin competition regulates in the wheat-Mycosphaerella graminicola pathosystem. III. Comparative seedling endocytosis and cytokinesis kinetics in fission yeast. Curr. Biol., CB 20, 1415– and adult plant experiments. Phytopathology 87, 266–272. 1422. Kilaru, S., Steinberg, G., 2015. Yeast recombination-based cloning as an efficient Spector, I., Shochet, N.R., Kashman, Y., Groweiss, A., 1983. Latrunculins, novel way of constructing vectors for Zymoseptoria tritici. Fungal Genet. Biol. 79, marine toxins that disrupt microfilament organization in cultured cells. Science 76–83. 219, 493–495. Kilaru, S., Schuster, M., Latz, M., Das Gupta, S., Steinberg, N., Fones, H., Gurr, S., Steinberg, G., 2007. Hyphal growth, a tale of motors, lipids, and the Spitzenkörper. Talbot, N.J., Steinberg, G., 2015. A gene locus for targeted ectopic gene Eukaryot. Cell 6, 351–360. integration in Zymoseptoria tritici. Fungal Genet. Biol. 79, 118–124. Steinberg, G., 2014. Endocytosis and early endosome motility in filamentous fungi. Kovar, D.R., Sirotkin, V., Lord, M., 2011. Three’s company, the fission yeast actin Curr. Opin. Microbiol. 20, 10–18. cytoskeleton. Trend Cell Biol. 21, 177–187. Steinberg, G., 2015. Cell biology of Zymoseptoria tritici: Pathogen cell organization Lee, S.C., Schmidtke, S.N., Dangott, L.J., Shaw, B.D., 2008. Aspergillus nidulans ArfB and wheat infection. Fungal Genet. Biol. 79, 17–23. plays a role in endocytosis and polarized growth. Eukaryot. Cell 7, 1278–1288. Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., Kumar, S., 2011. MEGA5, Lenz, J.H., Schuchardt, I., Straube, A., Steinberg, G., 2006. A dynein loading zone for molecular evolutionary genetics analysis using maximum likelihood, retrograde endosome motility at microtubule plus-ends. EMBO J. 25, 2275– evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2286. 2731–2739. Mehrabi, R., Zwiers, L.H., de Waard, M.A., Kema, G.H., 2006. MgHog1 regulates Tang, X., Halleck, M.S., Schlegel, R.A., Williamson, P., 1996. A subfamily of P-type dimorphism and pathogenicity in the fungal wheat pathogen Mycosphaerella ATPases with aminophospholipid transporting activity. Science 272, 1495–1497. graminicola. Mol. Plant Microb. Interact. 19, 1262–1269. Upadhyay, S., Shaw, B.D., 2008. The role of actin, fimbrin and endocytosis in growth Motteram, J., Lovegrove, A., Pirie, E., Marsh, J., Devonshire, J., van de Meene, A., of hyphae in Aspergillus nidulans. Mol. Microbiol. 68, 690–705. Hammond-Kosack, K., Rudd, J.J., 2011. Aberrant protein N-glycosylation impacts Warren, D.T., Andrews, P.D., Gourlay, C.W., Ayscough, K.R., 2002. Sla1p couples the upon infection-related growth transitions of the haploid plant-pathogenic yeast endocytic machinery to proteins regulating actin dynamics. J. Cell Sci. 115, fungus Mycosphaerella graminicola. Mol. Microbiol. 81, 415–433. 1703–1715. Penalva, M.A., 2010. Endocytosis in filamentous fungi, Cinderella gets her reward. Wedlich-Söldner, R., Bölker, M., Kahmann, R., Steinberg, G., 2000. A putative Curr. Opin. Microbiol. 13, 684–692. endosomal t-SNARE links exo- and endocytosis in the phytopathogenic fungus Raymond, C.K., Pownder, T.A., Sexson, S.L., 1999. General method for plasmid Ustilago maydis. EMBO J. 19, 1974–1986. construction using homologous recombination. Biotechniques 26, 134–141. Wedlich-Söldner, R., Straube, A., Friedrich, M.W., Steinberg, G., 2002. A balance of Riquelme, M., Sanchez-Leon, E., 2014. The Spitzenkörper, a choreographer of fungal KIF1A-like kinesin and dynein organizes early endosomes in the fungus Ustilago growth and morphogenesis. Curr. Opin. Microbiol. 20, 27–33. maydis. EMBO J. 21, 2946–2957. Sambrook, J., Russell, D.W., 2001. Molecular Cloning. Cold Spring Harbor Laboratory Wu, J.Q., Bähler, J., Pringle, J.R., 2001. Roles of a fimbrin and an alpha-actinin-like Press, Cold Spring Harbor. protein in fission yeast cell polarization and cytokinesis. Mol. Biol. Cell 12, Schuster, M., Kilaru, S., Ashwin, P., Lin, C., Severs, N.J., Steinberg, G., 2011a. 1061–1077. Controlled and stochastic retention concentrates dynein at microtubule ends to Xiang, X., Plamann, M., 2003. Cytoskeleton and motor proteins in filamentous fungi. keep endosomes on track. EMBO J. 30, 652–664. Curr. Opin. Microbiol. 6, 628–633. Schuster, M., Lipowsky, R., Assmann, M.A., Lenz, P., Steinberg, G., 2011b. Transient Zekert, N., Fischer, R., 2009. The Aspergillus nidulans kinesin-3 UncA motor moves binding of dynein controls bidirectional long-range motility of early vesicles along a subpopulation of microtubules. Mol. Biol. Cell 20, 673–684. endosomes. Proc. Natl. Acad. Sci. USA 108, 3618–3623. Zerial, M., McBride, H., 2001. Rab proteins as membrane organizers. Nat. Rev. Mol. Schuster, M., Kilaru, S., Latz, M., Steinberg, G., 2015. Fluorescent markers of the Cell Biol. 2, 107–117. microtubule cytoskeleton in Zymoseptoria tritici. Fungal Genet. Biol. http:// Zhang, J., Zhuang, L., Lee, Y., Abenza, J.F., Penalva, M.A., Xiang, X., 2010. The dx.doi.org/10.1016/j.fgb.2015.03.005. microtubule plus-end localization of Aspergillus dynein is important for dynein- Seidel, C., Moreno-Velasquez, S.D., Riquelme, M., Fischer, R., 2013. Neurospora crassa early-endosome interaction but not for dynein ATPase activation. J. Cell Sci. 123, NKIN2, a kinesin-3 motor, transports early endosomes and is required for 3596–3604. polarized growth. Eukaryot. Cell 12, 1020–1032. Zwiers, L.H., De Waard, M.A., 2001. Efficient Agrobacterium tumefaciens-mediated Shaw, B.D., Chung, D.W., Wang, C.L., Quintanilla, L.A., Upadhyay, S., 2011. A role for gene disruption in the phytopathogen Mycosphaerella graminicola. Curr. Genet. endocytic recycling in hyphal growth. Fungal Biol. 115, 541–546. 39, 388–393.