(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2014/094799 Al 26 June 2014 (26.06.2014) W P O P C T
(51) International Patent Classification: (74) Agent: ZWICKER, Jork; ZSP Patentanwalte, Partner- C07K 16/18 (2006.01) C07K 14/555 (2006.01) schaftsgesellschaft, Radlkoferstrasse 2, 81373 Munchen A61K 47/48 (2006.01) C07K 14/47 (2006.01) (DE). C07K 14/525 (2006.01) (81) Designated States (unless otherwise indicated, for every (21) International Application Number: kind of national protection available): AE, AG, AL, AM, PCT/EP2012/005281 AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, (22) International Filing Date: DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, 19 December 2012 (19. 12.2012) HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, (25) Filing Language: English KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, (26) Publication Language: English NO, NZ, OM, PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, (71) Applicant: SCIL-PROTEINS-GMBH [DE/DE]; Hein- RW, SC, SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, rich-Damerow-Str. 1, 06120 Halle (DE). TM, TN, TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (72) Inventors: LANGE, Christian; c/o Scil Proteins GmbH, Heinrich-Damerow-Str. 1, 06120 Halle (DE). HOFF- (84) Designated States (unless otherwise indicated, for every MANN-THOMS, Stefanie; c/o Scil Proteins GmbH, kind of regional protection available): ARIPO (BW, GH, GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, SZ, TZ, Heinrich-Damerow-Str. 1, 06120 Halle (DE). RAUCH- HAUS, Una; c/o Scil Proteins GmbH, Heinrich-Damerow- UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, DK, Str. 1, 06120 Halle (DE). MEYSING, Maren; c/o Scil EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, Proteins GmbH, Heinrich-Damerow-Str. 1, 06 120 Halle MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, SM, (DE). HAUPTS, Ulrich; c/o Scil Proteins GmbH, Hein TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, GW, rich-Damerow-Str. 1, 06120 Halle (DE). ML, MR, NE, SN, TD, TG).
[Continued on nextpage]
(54) Title: UBIQUITIN MOIETIES AS A MEANS FOR PROLONGING SERUM HALF-LIFE (57) Abstract: Disclosed herein are pharmaceutically active complexes that comprise at least two ubiquitin FIG. 2 moieties. The ubiquitin moieties confer an increased ser um half-life to the complexes. The disclosure also con Molecular weight cerns polynucleotides encoding pharmaceutically active complex (kDa) fusion proteins comprising at least two ubiquitin moiet ies, vectors comprising such polynucleotides, and cells AffilirT 17.5 comprising such vectors. Further disclosed herein are complexes, polynucleotides, vectors, and cells for use in Ubi4-Affilin" 52.1 medicine, in particular for use in the treatment of cancer. Ubi6-Affilin* 69.3 Also disclosed are pharmaceutical compositions com prising these complexes and a method for extending the Ubi2-IFN 37.0 serum half- life of a pharmaceutically active moiety. Ubi2-scTNF 71.7
Ubi2-TNF 35.2
Ubi2-IL-2 34.1
Affilin ®-IFN 37.1
PEG-Ubi2-IFN 57.0
PEG-Affilin'-IFN 57.1
PEG-Affilin* 60.3 © o o w o 2014/094799 Al II 11 II I 1 I 1 II ll ll II llll II III II I II
Published. with sequence listing part of description (Rule 5.2(a)) UBIQUITIN MOIETIES AS A MEANS FOR PROLONGING SERUM HALF-LIFE
The present invention relates t o pharmaceutically active complexes that comprise at least two ubiquitin moieties. The ubiquitin moieties confer an increased serum half-life t o the complexes. The invention also concerns polynucleotides encoding pharmaceutically active fusion proteins comprising at least two ubiquitin moieties, vectors comprising such polynucleotides, and cells comprising such vectors. The invention further relates t o complexes, polynucleotides, vectors, and cells for use in medicine, in particular for use in the treatment of cancer. Also disclosed are pharmaceutical compositions comprising these complexes and a method for extending the serum half-life of a pharmaceutically active moiety.
BACKGROUND OF THE INVENTION
Extending serum half-life of pharmaceutically active moieties
Pharmaceutically active drugs have often limited value because of their
pharmacokinetic properties. In particular therapeutic or diagnostic agents of smaller size are
rapidly eliminated from the body due t o renal filtration. This affects the amount and frequency of the dosage of drugs. Administration of larger amounts of drugs often has the disadvantage of negative side effects in patients.
Some strategies for prolonging serum half-life of pharmaceutically active moieties are
known in the art (see the review by Kontermann (2001) Curr Opin Biotechnol. 22: 1-9;
Kontermann (2009) BioDrugs 23: 93-109; all of which are hereby incorporated by reference).
For example, fusion of pharmaceutically active moieties t o plasma proteins like serum
albumin and the Fc part of IgG molecules (Fc fusion molecules) result in long serum half-life of several weeks. Due t o specific receptor recycling mechanisms, serum albumin and IgG are
not degraded in the lysosome but rather redirected t o the plasma membrane where they
are released into the blood plasma. By the addition of an Fc-domain t o a therapeutic protein, the protein size increases t o be larger than 50 kDa and thus larger than the renal filtration threshold which is in the range of 40-50 kDa.
Chemical coupling of polyethylene glycol (PEG) was established more than 20 years ago to increase the hydrodynamic volume of a protein, thereby extending its serum half-life.
One or more PEG chains may be conjugated t o the protein therapeutic. Examples of pegylated drugs are interferon-alpha 2b, G-CSF, human growth hormone, and erythropoietin. More recent approaches use so-called recombinant PEG mimetics for half- life extension. For example, repetitive sequences of up to 600 residues are composed of three amino acids (proline, alanine, serine = PAS) and fused to protein therapeutics.
Other strategies to prolong serum half-life include glycoengineering techniques such as introduction of additional N-glycosylation sites by genetic engineering and chemical conjugation of carbohydrates (e.g., hydroxyethyl starch or polysialic acid).
Ubiquitin
Ubiquitin is an 8.5 kDa cytosolic protein which is present in all known eukaryotic cells from protozoans to vertebrates. Ubiquitin is highly conserved in sequence. For example, in all mammals investigated up to now ubiquitin has the identical amino acid sequence (see
SEQ ID NO: 1). The polypeptide chain of ubiquitin consists of 76 amino acids folded in an extraordinarily compact α/ β structure (Vijay-Kumar et al. (1987) J. Mol. Biol. 194(3): 531-44; the entirety of which is herein incorporated by reference).
Because of its small size, artificial preparation of ubiquitin can be carried out both by chemical synthesis and by means of biotechnological methods. Due to its favorable folding properties, ubiquitin can be produced by genetic engineering using microorganisms such as
Escherichia coli in high yields either in the cytosol or in the periplasmic space.
Specific targeting proteins based on Affilin* molecules
Affilin* (a registered trademark of Scil Proteins GmbH) molecules are artificial binding proteins on the basis of modified ubiquitin proteins (see W O 04/106368, the entirety of which is herein incorporated by reference). Affilin molecules are based on the human
Ubiquitin scaffold and engineered to generate de-novo binding affinities towards disease- related targets. Affilin* molecules are created by engineering de-novo binding sites on the surface of a dimeric form of the human serum protein Ubiquitin. On the order of 15 surface- exposed amino acids are modified in order t o engineer de novo binding sites. Dimeric Affilin binding proteins have molecular weights of about 17 kDa. Methods for identifying multimeric modified ubiquitins with newly generated binding capability t o a pre-defined ligand are described in W O 2011/073214, the entirety of which is herein incorporated by reference. The platform allows the generation of agonistic or antagonistic binding molecules and fusion t o effector molecules. Specific multimeric binding proteins based on differently modified ubiquitin monomers are described for example in W O 2011/073208, W O
2011/073209, and PCT/EP2012/061454, all of which are hereby incorporated by reference.
Compared t o antibodies and fragments thereof or other artificial binding proteins
(scaffolds), binding molecules on the basis of modified ubiquitin proteins have many advantages: high target affinity and specificity, high stability, low immunogenicity, and cost effective manufacturing in high yield. Furthermore, ubiquitin scaffolds are amenable t o genetic and chemical modifications.
TECHNICAL PROBLEMS UNDERLYING THE PRESENT INVENTION AND THEIR SOLUTION
One disadvantage of small pharmaceutically active compounds (i.e., compounds with a molecular weight of smaller than about 50 kDa) is that such compounds are cleared rather quickly from the circulation after administration. The clearance of pharmaceutically active compounds from the blood by the kidneys restricts the availability of the drug in the body for therapeutic and/or diagnostic purposes. Thus, there is only a short time-period in which such small compounds are present in the body t o exert the intended pharmaceutical activity.
Larger doses or more frequent administration are required t o reach a positive effect for therapy or in diagnosis.
Since renal clearance is inversely correlated t o the hydrodynamic volume of a compound, attempts have been made t o prolong the circulation periods in the blood by increasing the size of the pharmaceutically active compound. For example, the prior art describes the coupling of proteins or polyethylene glycol (PEG) t o the pharmaceutically active compound in order t o create compounds with increased size that exhibit a reduced renal clearance. However, PEG has some drawbacks. PEG is not biodegradable and may accumulate in the body. Moreover, PEG has t o be added t o the pharmaceutically active compound via chemical coupling in an additional production step. Other strategies used in the prior art include glycoengineering, which also has
drawbacks. For example, introduction of glycosylation sites into a pharmaceutically active
protein requires expression of the modified protein in eukaryotic expression systems, which
is more expensive and more complicated compared t o expression in prokaryotic cells.
Thus, there exists a continuous need t o develop pharmaceutically active compounds
having prolonged in vivo half-life.
It was therefore an objective of the present invention t o identify other molecules that may be added to pharmaceutically active compounds in order to prolong the circulation time of such pharmaceutically active compounds. The inventors found that the addition of at
least two ubiquitin moieties t o a pharmaceutically active compound increases the serum
half-life of the pharmaceutically active compound. The inventors further found that different
numbers of ubiquitin moieties can be added t o a pharmaceutically active compound in order t o fine-tune the desired serum half-life of the pharmaceutically active compound. Ubiquitin
provides several advantages: ubiquitin is biodegradable, has a low immunogenicity, and can
be produced by chemical synthesis or in microorganisms.
The above-described objectives are solved and the advantages are achieved by the subject-matter of the enclosed independent claims. Preferred embodiments of the invention are included in the dependent claims as well as in the following description, examples and figures.
The above overview does not necessarily describe all problems solved by the present
invention.
SUMMARY OF THE INVENTION
In a first aspect the present invention relates t o a complex comprising, essentially consisting of or consisting of:
(a) at least two ubiquitin moieties; and
(b) at least one pharmaceutically active moiety, wherein said complex exhibits an increased serum half-life as compared t o the at least one pharmaceutically active moiety alone without said at least two ubiquitin moieties. In a second aspect the present invention relates t o the complex according t o the first aspect for use in medicine.
In a third aspect the present invention relates t o the com plex according to the first aspect for use in the treatment of cancer.
In a fourth aspect the present invention relates to a pharmaceutical composition comprising the complex according to the first aspect; and further comprising a pharmaceutically acceptable carrier.
In a fifth aspect the present invention relates to a use of at least two ubiquitin moieties for extending the serum half-life of a pharmaceutically active moiety.
In a sixth aspect the present invention relates to a method for extending the serum half-life of a pharmaceutically active moiety, comprising the steps:
(a) fusing a nucleic acid encoding at least two ubiquitin moieties to a nucleic acid encoding a pharmaceutically active moiety, thereby obtaining a fused nucleic acid;
(b) introducing said fused nucleic acid into an expression vector;
(c) introducing said expression vector into a host cell;
(d) cultivating the host cell;
(e) subjecting the host cell t o culturing conditions under which a fusion protein is expressed from said vector, thereby producing a fusion protein comprising at least two ubiquitin moieties and a pharmaceutically active moiety, wherein said fusion protein has an extended serum half-life as compared to the pharmaceutically active moiety without ubiquitin moieties;
(f) optionally isolating the fusion protein produced in step (e).
In a seventh aspect the present invention relates to a nucleic acid comprising a sequence encoding the complex of the first aspect.
In an eighth aspect the present invention relates to a vector comprising the nucleic acid of the seventh aspect.
In a ninth aspect the present invention relates to a cell comprising the vector of the eighth aspect.
This summary of the invention does not necessarily describe all features of the present invention. Other embodiments will become apparent from a review of the ensuing detailed description. BRIEF DESCRIPTION OF THE DRAWINGS
FIGURE 1 shows the amino acid sequences of complexes of the invention. a) Ubi4-Affilin * (SEQ ID NO: 15), b) Ubi6-Affilin* (SEQ ID NO: 14), c) Ubi2-IFN (SEQ ID NO: 16), d) Ubi2-scTNF (SEQ ID NO: 17). The modified monomeric ubiquitin subunits of the Affilin part presented in Fig. 1A and Fig. I B are based on ubiquitin F45W, i.e., a ubiquitin mutein which differs from the wild-type sequence according t o SEQ ID NO: 1 by amino acid exchanges F45W, G75A, and G76A. The exchanges F45W, G75A, and G76A are not important for binding a target. Substitutions in the ubiquitin subunits are highlighted by using bold- type. Linker regions are underlined .
FIGURE 2 gives an overview on the molecular weights of the complexes of this invention.
FIGURE 3 represents an SDS-PAGE of the complexes comprising four and six ubiquitin moieties, respectively, and an Affilin" (SEQ ID NO: 14; SEQ ID NO: 15) purified as described in
Example 2. Lane 1: PageRuler Unstained Broad Range Protein Ladder (Thermo Scientific);
Lanes 2 and 3: 1 g and 2 respectively, of Ubi4-Affilin * (SEQ ID NO: 15); Lane 4:
PageRuler Prestained Protein Ladder (Thermo Scientific); Lanes 5 and 6: 1 g and 2 µ , respectively, of Ubi6-Affilin * (SEQ ID NO: 14).
FIGURE 4 shows the production and PEGylation of an Affilin * (SEQ ID NO: 3).
Fig. 4A: shows an SDS-PAGE of the Affilin * purified as SUMO fusion (Lane 2) and the corresponding protein solution after SUMO cleavage (Lane 3) using SUMO Hydrolase
(Example 3, step 4). Lane 1: PageRuler Unstained Broad Range Protein Ladder (Thermo
Scientific).
Fig. 4B: represents an SDS-PAGE of the Affilin * (SEQ ID NO: 3) expressed and purified as described in Example 3. Lane 1: PageRuler Prestained Protein Ladder (Thermo Scientific);
Lanes 2 and 3: 1 µ and 2µ , respectively, of the Affilin * .
Fig. 4C: shows an SDS-PAGE of the Affilin * (SEQ ID NO: 3) N-terminally modified with a branched 40 kDa PEG moiety (Example 3, step 5). Lane 1: PageRuler* Prestained Protein Ladder (Thermo Scientific); loading of 1 g (Lane 2) and 2 g (Lane 3), respectively, of the
PEGylated Affilin" on the gel.
FIGURE 5 exemplarily shows the analysis of the affinity of Ubi6-Affilin (SEQ ID NO: 14) towards human ED-B using analytical affinity interaction chromatography as described in
Example 6. Continuous line: absorption at 280 nm (mAU), dashed line: concentration of elution buffer ( ).
FIGURE 6 shows the ELISA analysis of the binding of an Affilin" (Fig. 6A) and of the complex
Ubi4-Affilin° (Fig. 6B), respectively, t o the target domain ED-B, as described in Example 5.
Black circles (A) represent binding of the Affilin t o immobilized ED-B , black squares (B) represent Ubi4-Affilin , open triangles show absence of specific binding t o a control surface coated with human fibronectin without ED-B domain. All data points show mean values ± s.d. of measurements performed in triplicate. Solid lines represent fits of a one-site ligand binding model t o the data, with the corresponding apparent dissociation constants (KD) of 0.36 nM for binding of Affilin" and 0.11 nM for binding of Ubi4-Affilin .
FIGURE 7 (A) shows the blood concentration of radiolabeled protein variants expressed as % of injected dose per gram blood after intravenous injection at indicated time points.
Circulation half-life increases in the following order: Affilin (closed triangles), Ubi4-Affilin
(open hash mark), Ubi6-Affilin (closed circles), Ubi2-scTNF (closed squares, dotted line).
There is clear evidence for prolongation of circulation half-life with an increased number of ubiquitin-monomers attached t o the Affilin" molecule. Figure 7 (B) displays selected pharmacokinetic parameters calculated from the curves as described in Example 14.
FIGURE 8 shows percentage of intact labeled complex protein during circulation within the animals. Affilin* (closed triangles), Ubi4-Affilin (open hash mark) and Ubi6-Affilin° > (closed circles) were injected intravenously and blood samples were taken at the indicated time points. Serum was generated from these blood samples and serum samples were analyzed via SE-HPLC with respect t o protein amount and protein degradation and aggregation, respectively. Applying complexes of Affilin" and multiple ubiquitin moieties leads t o increased amount of intact protein over time in line with increasing number of ubiquitin monomers included in the complex.
FIGURE 9 summarizes the activity of the pharmaceutically active moieties within the complexes. In Table 9A results from the ED-B-binding activity analysis are listed indicating target specific activity of the pharmaceutically active moiety. Table 9B displays the effector function of the pharmaceutically active moiety comprised in the complex. In both cases activity of pharmaceutically active moiety was strongly decreased by PEG-conjugation whereas the complex comprising the pharmaceutically active moiety and ubiquitin units did not show a strong reduction of complex activity.
FIGURE 1 0 shows the analysis of TNF receptor binding by the complex Ubi2-scTNF (Fig. 10A) in comparison t o recombinant murine TNFalpha (Fig. 10B) by an ELISA assay as described in
Example 12. Circles (A) represent binding of the recombinant soluble TNF-receptor I domain
/ Fc chimera t o immobilized Ubi2-scTNF, squares (B) represent binding t o recombinant murine TNFalpha, open triangles show absence of specific binding to a control surface without any bound TNFalpha construct. All data points show mean values ± s.d. of measurements performed in triplicate, Solid lines represent fits of a one-site ligand binding model t o the data, with the corresponding apparent dissociation constants K of 0.58 nM for binding t o complex Ubi2-scTNF and 0.66 nM for binding t o recombinant murine TNFalpha control protein.
DETAILED DESCRIPTION OF THE INVENTION
Definitions
Before the present invention is described in detail below, it is t o be understood that this invention is not limited t o the particular methodology, protocols, and reagents described herein as these may vary. It is also t o be understood that the terminology used herein is for the purpose of describing particular embodiments only, and is not intended t o limit the scope of the present invention which will be limited only by the appended claims.
Unless defined otherwise, all technical and scientific terms used herein have the same meanings as commonly understood by one of ordinary skill in the art to which this invention belongs. Preferably, the terms used herein are defined as described in "A multilingual glossary of biotechnological terms: (lUPAC Recommendations)", Leuenberger, H.G.W, Nagel, B., and
Kolbl, H. eds. (1995), Helvetica Chimica Acta, CH-4010 Basel, Switzerland).
Throughout this specification and the claims which follow, unless the context requires otherwise, the word "comprise", and variations such as "comprises" and
"comprising", will be understood t o imply the inclusion of a stated integer or step or group of integers or steps but not the exclusion of any other integer or step or group of integer or step.
Several documents (for example: patents, patent applications, scientific publications, manufacturer's specifications, instructions, GenBank Accession Number sequence submissions etc.) are cited throughout the text of this specification. Nothing herein is to be construed as an admission that the invention is not entitled to antedate such disclosure by virtue of prior invention. Some of the documents cited herein are characterized as being
"incorporated by reference". In the event of a conflict between the definitions or teachings of such incorporated references and definitions or teachings recited in the present specification, the text of the present specification takes precedence.
Sequences: All sequences referred t o herein are disclosed in the attached sequence listing that, with its whole content and disclosure, is a part of this specification.
The term "about" when used in connection with a numerical value is meant to encompass numerical values within a range having a lower limit that is 10% smaller than the indicated numerical value and having an upper limit that is 10% larger than the indicated numerical value.
As used herein, the term "pharmaceutically active moiety" has to be understood in its broadest meaning as referring t o any molecule, compound, or composition of matter which mediates a pharmaceutical effect in a living organism (e.g., in a mammal, particularly in a human being). A pharmaceutical effect includes but is not limited to a prophylactic, a therapeutic, and/or a diagnostic effect. It should be noted that the term "pharmaceutically active moiety" does not encompass "ubiquitin moieties", which will be defined below.
However, the term "pharmaceutically active moiety" may encompass modified monomeric or dimeric "ubiquitin units" with specific binding properties to selected targets. The term
"ubiquitin units" (or "ubiquitin monomer") will also be defined below. Other "pharmaceutically active moieties" that can be used in the present invention include without limitation : interferon (e.g. IFN alpha), interleukin (e.g. IL-2), tumor necrosis factor (e.g.
TNFalpha), and single chain TNF (scTNF). The terms IFN, IL-2, TNFalpha, and scTN F are defined below, too. Typically, a "pharmaceutically active moiety" useable in the present invention has a molecular weight which is equal t o or less than about 70 kDa. Preferably, a
"pharmaceutically active moiety" useable in the present invention has a molecular weight in the range from about 10 kDa t o about 60 kDa, more preferably in the range from about 15 kDa t o about 55 kDa.
As used herein, a "complex" refers t o a composition of matter comprising at least two components, wherein these at least two components are held together by any kind of interaction, for example by covalent bonds, by ionic bonds, by hydrogen bonds, by van der
Waals interactions, or by hydrophobic interactions. As will be explained below in greater detail, the complex of the invention comprises at least two components, namely (i) at least two ubiquitin moieties [counted as one component] and (ii) at least one pharmaceutically active moiety. It is especially preferred that these two components of the complex are held together by a covalent bond. The following gives some examples on how t o obtain covalent complexes according t o this invention :
a) conjugation of the pharmaceutically active moiety t o ubiquitin units via lysine
residues;
b) conjugation via cysteine residues, which may be located C-terminally, or at any other
position; conjugation with maleimide containing components;
c) peptidic or proteinogenic conjugations, e.g. contiguous genetic fusions
d) peptidic or proteinogenic conjugations, e.g. via intein-based coupling of components
which are non-contiguous on the genetic level
e) "Tag"-based fusions, wherein the affinities of specific peptides located either at the
C- or N-terminus of the components forming the complex are used t o effect a linkage
between said components.
These and other methods for covalently and non-covalently attaching a protein of interest t o a support are well known in the art, and are thus not described in further detail here. The term "serum half-life" refers to the time period in which the concentration of a substance (e.g., a pharmaceutically active moiety, a fusion protein or a complex of the invention) in the serum of a subject [in vivo) is reduced by one half (50%). The half-life of a substance is increased if its physical concentration persists in vivo for a longer period than a similar molecule which has not been modified with respect to half-live extension. Typically, the half-life is increased by 10%, 20%, 30%, 40%, 50%, or more. Methods for determining the serum half-life of a given substance are detailed in the example section.
The present disclosure distinguishes between the terms (a) "ubiquitin moiety" and
(b) "ubiquitin unit" or "ubiquitin protein" or "ubiquitin monomer".
As used herein, at least two "ubiquitin moieties" are obligatory parts of the complex of the present invention. Said "ubiquitin moieties" are used to increase the size of the complex of the invention so that the pharmaceutically active moiety in the complex has an increased serum half-life. As used herein, a "ubiquitin moiety" consists of an amino acid sequence that is either based on the wild-type amino acid sequence according t o SEQ ID NO:
1 or on a pre-modified amino acid sequence according t o SEQ ID NO: 2 (F45W, G75A, G76A) or SEQ ID NO: 23 (675A, G76A). A "ubiquitin moiety" may have a limited number of amino acid insertions, deletions, and/or exchanges as compared t o the amino acid sequences according to SEQ ID NO: 1, 2, or 23. More specifically, a ubiquitin mutein is considered t o be a "ubiquitin moiety" within the meaning of the present invention, if it differs from wild-type ubiquitin according to SEQ ID NO: 1 by 0, 1, 2, or 3 amino acid exchanges (substitutions), by
0, 1, 2, or 3 amino acid deletions and/or by 0, 1, 2, or 3 amino acid insertions. Likewise, a ubiquitin mutein is considered t o be a "ubiquitin moiety" within the meaning of the present invention, if it differs from pre-modified ubiquitin according to SEQ ID NO: 2 or from pre- modified ubiquitin according to SEQ ID NO: 23 by 0, 1, 2, or 3 amino acid insertions, by 0, 1,
2, or 3 amino acid deletions and/or by 0, 1, 2, or 3 amino acid exchanges. According to an alternative definition, a "ubiquitin moiety" within the meaning of the present invention exhibits a sequence identity of at least 95% (preferably 96%, more preferably 97%, more preferably 98%, even more preferably 99% and most preferably 100%) to the amino acid sequence defined by SEQ ID NO: 1 or by SEQ ID NO: 2 or by SEQ ID NO: 23. It is particularly emphasized that said at least two "ubiquitin moieties" do not form a "pharmaceutically active moiety" within the meaning of the present invention. In contrast, a "ubiquitin protein" or a "ubiquitin unit" or "ubiquitin monomer" is not an obligatory part of the complex of the present invention. However, in some embodiments of the present invention the "pharmaceutically active moiety" comprises a modified dimeric ubiquitin protein which comprises two modified monomeric ubiquitin units. Such modified dimeric ubiquitin proteins are artificial binding proteins that are designed t o specifically bind t o a target molecule. Said modified dimeric ubiquitin based binding proteins are also referred t o as Affilin" molecules.
The term "ubiquitin unit" or "ubiquitin monomer" covers the ubiquitin in accordance with SEQ ID NO: 1, SEQ ID NO: 2 or SEQ ID NO: 23 and modifications thereof according to the following definition. Particularly preferred are ubiquitin molecules from humans.
Additionally, ubiquitin from any other eukaryotic source can be used. For instance, ubiquitin of yeast differs only in three amino acids from the sequence of SEQ ID NO: 1. Generally, the ubiquitin proteins covered by the term "ubiquitin unit" or "ubiquitin monomer" show an amino acid identity of at least 80% (preferably at least 85%, more preferably at least 90%, or at least 94% to SEQ D NO: 1 or to SEQ ID NO: 2 or t o SEQ ID NO: 23).
The term "a modified ubiquitin unit" or "a modified ubiquitin monomer" refers to modifications of the ubiquitin protein, any one of substitutions, insertions or deletions of amino acids or a combination thereof, while substitutions are the most preferred modifications which may be supplemented by any one of the modifications described above.
The number of modifications is strictly limited as said modified ubiquitin units (monomers) have an amino acid identity t o SEQ ID NO: 1 or to SEQ ID NO: 2 or to SEQ ID NO: 23 of at least 80% (preferably at least 85%, more preferably at least 90%, or up to at least 94%). At the most, the overall number of substitutions in a monomeric unit is, therefore, limited to 15 amino acids corresponding to 80% amino acid identity. At minimum, the overall number of substitutions in a ubiquitin unit (monomer) for generating a binding property is 5 amino acids corresponding to 94% amino acid identity. The total maximum number of modified amino acids in the hetero-dimeric ubiquitin molecule is 30 amino acids corresponding t o
20% amino acid modifications based on the hetero-dimeric protein. Preferably, the number of modified amino acids in a hetero-dimeric ubiquitin for generating a binding property is at least 10 amino acids, most preferred between 10 and 16 amino acids. Most preferred are substitutions. The amino acid identity of the dimeric modified ubiquitin protein compared t o a dimeric unmodified ubiquitin protein with a basic monomeric sequence of SEQ ID NO: 1 or SEQ ID NO: 2 is selected from one of the group consisting of at least 80%, at least 83%, at least 84%, at least 85%, at least 86%, at least 87%, at least 88%, at least 89%, and at least
90%. Preferred are substitutions in regions 2-8, 12-16, 41-45 and 62-71 of SEQ ID NO: 1, 2, or 23. More preferred are substitutions in regions 2-8 and 62-68 of SEQ ID NO: 1, 2, or 23.
Preferred positions for substitutions are selected from amino acids 2, 4, 6, 8, 61, 62, 63, 64,
65, 66, 68.
For determining the extent of sequence identity between two amino acid sequences, for example, the SIM Local similarity program (Xiaoquin Huang and Webb Miller (1991), Adv
Appl Math., 12: 337-357) or ClustalW can be used (Thompson et al. (1994), Nucleic Acids
Res., 22(22): 4673-4680). In particular, the sequence identity percentage between a derivative of ubiquitin and the amino acid sequence of SEQ ID NO: 1 (or SEQ ID NO: 2 or SEQ
ID NO: 23) can be determined with either of these programs. Preferably, the default parameters of the SIM Local similarity program or of ClustalW are used, when calculating sequence identity percentages. Preferably, the extent of the sequence identity of the modified protein t o SEQ ID NO: 1 (or SEQ ID NO: 2 or SEQ ID NO: 23) is determined relative t o the complete sequence of SEQ ID NO: 1 (or SEQ ID NO: 2 or SEQ ID NO: 23, respectively).
In the context of the present invention, the extent of sequence identity between a modified sequence and the sequence from which it is derived (also termed: "parent sequence") is generally calculated with respect t o the total length of the unmodified sequence, if not explicitly stated otherwise.
A "dimer" is considered as a protein in this invention which comprises two monomeric ubiquitin units (also referred t o herein as two ubiquitin monomers). If the dimer comprises two differently modified monomers, it is called a "heteromeric dimer" or "hetero- dimer". Thus, the "hetero-dimer" of the invention is considered as a fusion of two differently modified monomeric ubiquitin units exhibiting a combined binding property (binding domain or targeting domain) for its specific target molecule (e.g., a tumor antigens such as extra- domain B of fibronectin referred t o as ED-B or any other antigens).
According t o the present invention, the two monomeric modified ubiquitin units are not linked together after having screened the most potent binding ubiquitin molecules, but the screening process is performed in the presence of the hetero-dimeric ubiquitins. After having received the sequence information on the most potent binding ubiquitin molecules, these molecules may be obtained by any other method, e.g. by chemical synthesis or by genetic engineering methods, e.g. by linking the two already identified monomeric ubiquitin units together.
According t o the invention, the two differently modified ubiquitin monomers which bind to one ligand are to be linked by head-to-tail fusion t o each other using e.g. genetic methods. The differently modified fused ubiquitin monomers are only effective when acting together.
A "head to-tail fusion" is to be understood as fusing the C-terminus of the first protein to the N-terminus of the second protein. In a head-to-tail fusion, monomers may be connected directly without any linker, i.e., by a direct peptide bond. Alternatively, the fusion of ubiquitin monomers can be performed via linkers.
As used herein, the term "linker" generally refers t o a molecule that joins at least two other molecules either covalently or non-covalently, e.g., through hydrogen bonds, ionic, or van der Waals interactions, e.g., a nucleic acid molecule that hybridizes t o one complementary sequence at the 5' end and t o another complementary sequence at the 3' end, thus joining two non-complementary sequences.
In typical embodiments of the present invention, a "linker" is to be understood as a moiety that connects a first polypeptide with at least one further polypeptide. The second polypeptide may be the same as the first polypeptide or it may be different. Preferred in these typical embodiments are peptide linkers. This means that the peptide linker is an amino acid sequence that connects a first polypeptide with a second polypeptide. The peptide linker is connected to the first polypeptide and to the second polypeptide by a peptide bond. Typically, a peptide linker has a length of between 1 and 20 amino acids; e.g.,
1, 2, 3, 4, 5, 6, 7, 8, 9, 10, 11, 12, 13, 14, 15, 16, 17, 18, 19, or 20 amino acids. It is preferred that the amino acid sequence of the peptide linker is not immunogenic t o human beings.
For example, a linker having at least the amino acid sequence SG or any other linker, for example SGGGG [SEQ ID NO: 4], SGGGGSGGGG [SEQ ID NO: 5], GGGSGGGSGGGS [SEQ ID
NO: 6], GGGGSGGGGSGGGGS [SEQ ID NO: 7], GIG [SEQ ID NO: 8], SGGGGIG [SEQ ID NO: 9],
SGGGGSGGGGIG [SEQ ID NO: 10], GGGGS [SEQ ID NO: 11], (GGGS) n (i.e., n repetitions of SEQ
ID NO: 12, wherein n is between 1 and 10 (e.g., n may be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10)), or
(SGGG )n (i.e., n repetitions of SEQ ID NO: 13, wherein n is between 1 and 10 (e.g., n may be
1, 2, 3, 4, 5, 6, 7, 8, 9, or 10)), or (PAS) wherein n is between 1 and 10 (e.g., n may be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10) or any other peptide linker can be used. Other linkers for the genetic fusion of two ubiquitin monomers are also known in the art and can be used.
As used herein, the term "PAS linker" refers t o a peptide linker composed of the three amino acids proline (P), alanine (A), and serine (S), in which the tripeptide PAS occurs between once and ten times. In other words, the term "PAS linker" can be defined by the sequence (PAS)n, wherein n is between 1 and 10 (e.g., n can be 1, 2, 3, 4, 5, 6, 7, 8, 9, or 10).
In accordance with the invention, a "dissociation constant" (abbreviated as "Kd" or alternatively as " KD" ) defines the specific binding affinity which is in accordance with the invention in the range of 10~7 - 10 12 M . A value of 10 M and below can be considered as a quantifiable binding affinity. Depending on the application a value of 10 7 M t o 10 11 M is preferred for e.g., chromatographic applications or 10 9 t o 10 12 for e.g., diagnostic or therapeutic applications. Further preferred binding affinities are in the range of 10 7 t o 10 0
M, preferably t o 10 11 M. The methods for determining the binding affinities are known t o the skilled person and can be selected for instance from the following methods: ELISA,
Surface Plasmon Resonance (SPR) based technology (offered for instance by Biacore"), affinity interaction chromatography, fluorescence spectroscopy, isothermal titration calorimetry (ITC), analytical ultracentrifugation, or fluorescence activated cell sorting (FACS).
Preferred "target molecules" when practicing the present invention are proteins and more specifically antigenic epitopes present on proteins. More preferred "target molecules" are tumor antigens, such as proteins or epitopes that are present on the outside of a tumor cell but that are absent on normal cells of the same tissue-type or which are present in tumor tissue but absent on normal tissue from the same tissue type. Tumor antigens are also termed "tumor target molecules" in the present specification. A particularly preferred
"target molecule" in the context of the present invention is extra-domain B of fibronectin.
The term "extra-domain B of fibronectin" (or briefly designated as "ED-B") comprises all proteins which show a sequence identity t o SEQ ID NO: 25 of at least 70%, optionally 75%, further optionally at least 80%, 85%, 90%, 95%, 96%, or 97% or most preferably showing a sequence identity t o SEQ ID NO: 25 of 100% and having the functionality of ED-B defined herein (see in particular the section below entitled "Extra-domain B of fibronectin as tumor specific protein").
As used herein, the term "IFN" encompasses interferon alpha (IFN-a) and interferon beta (IFN-β ), including all subtypes thereof. The term " I F" relates t o IFN-a and IFN- β from any mammalian organism. However, it is preferred when practicing the present invention t o use human IFN-ct or human IFN-β . More specifically, the term "IFN" used herein includes
IFN-a 2a, IFN-ct 2b, IFN-a 2c, IFN-a 6, IFN-a 14, IFN-a 4, IFN-a 5, IFN-β and biologically active muteins of any of these; especially human IFN-a 2a (SEQ ID NO: 27), human IFN-a 2b (SEQ ID
NO: 28), human IFN-a 2c (SEQ ID NO: 29), human IFN-a 6 (SEQ ID NO: 30), human IFN-a 14
(SEQ ID NO: 31), human IFN-a 4 (SEQ ID NO: 32), human IFN-a 5 (SEQ ID NO: 33), human
IFN-β (SEQ ID NO: 43) and biologically active muteins of any of these. The amino acid sequences shown in SEQ ID NOs: 27, 28, 29, 30, 31, 32, 33, and 43 correspond t o the sequences of mature native interferon molecules after cleavage of the signal peptide.
However, as used herein, the term "IFN" also covers amino acid sequences in which a start methionine or leader sequences or tags or other amino acids are added t o the amino terminus of SEQ ID NOs: 27, 28, 29, 30, 31, 32, 33, 43.
As used herein, the term "biologically active IFN" encompasses polypeptides that are sequence variants (muteins) of SEQ ID NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30,
SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, or SEQ ID NO: 43 and exhibit the same biological functions as the naturally occurring IFN molecules according t o SEQ ID NO: 27, SEQ
ID NO: 28, SEQ ID NO: 29, SEQ ID NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, or
SEQ ID NO: 43. Such "biologically active IFN" molecules can occur in nature or can be artificially created polypeptides. In the context of the present application, the term
"biologically active IFN" especially refers t o polypeptides that exhibit at least 90% sequence identity (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least
96%, at least 97%, at least 98%, or at least 99%) to the amino acid sequence set forth in SEQ
ID NO: 28 and exhibit a similar physiological activity, as does naturally occurring human IFN-
α 2b. A sequence variant (mutein) of SEQ D NO: 27, SEQ ID NO: 28, SEQ ID NO: 29, SEQ ID
NO: 30, SEQ ID NO: 31, SEQ ID NO: 32, SEQ ID NO: 33, or SEQ ID NO: 43 is considered t o be a
"biologically active IFN" polypeptide for the purposes of the present invention, if said sequence variant exhibits at least 90% of the gene inducing activity of human IFN-a 2b having the amino acid sequence according t o SEQ ID NO: 28, as determined by the ISRE-
Reporter Gene Assay described in Example 9.
The term "scTN F" (or "scTN Falpha") refers t o at least three (e.g., three, six, or nine)
TNFalpha monomers that are joined by linkers, thereby forming a single chain (sc) TNFalpha (scTNF or scTN Falpha) molecule. A trimeric structure is required t o be able t o bind t o specific
TNF receptors and induce the formation of ligand/receptor complexes. Connecting linkers between the TNFalpha monomers are preferably peptide linkers.
The term "TNFalpha" (or spelling variants thereof such as "TNF-alpha", "TNFa", or
"TN F alpha") covers TNFalpha molecules in accordance with SEQ ID NO: 34 (human; uniprot accession number P01375; see: http://www.uniprot.org/uniprot/P01375), SEQ ID NO: 35
(mouse; uniprot accession number P06804; http://www.uniprot.org/uniprot/P06804), SEQ
ID NO: 36 (rat), or any other homologous sequences. Human TNFalpha shows 79% sequence identity t o mouse TNFalpha. The amino acid sequences shown in SEQ D NO: 34, 35, and 36 correspond t o the sequences of mature native TNFalpha monomers in the respective species after cleavage of the signal peptide. However, as used herein, the term "TN Falpha" also covers amino acid sequences in which a start methionine or leader sequences or tags or other amino acids are added t o the amino terminus of SEQ ID NO: 34, SEQ ID NO: 35, or SEQ
ID NO: 36.
The term "biologically active TNFalpha" encompasses polypeptides that are sequence variants (muteins) of SEQ ID NO: 34, SEQ ID NO: 35, or SEQ ID NO: 36 and exhibit the same biological functions as the naturally occurring TNFalpha molecules according t o SEQ ID NO:
34, SEQ ID NO: 35, or SEQ ID NO: 36. Such "biologically active TNFalpha" molecules can occur in nature or can be artificially created polypeptides. In the context of the present application, the term "biologically active TNFalpha" especially refers to polypeptides that exhibit at least 90% sequence identity (e.g., at least 91%, at least 92%, at least 93%, at least
94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) t o the amino acid sequence set forth in SEQ ID NO: 34 and that exhibit an apoptotic activity, as does naturally occurring TNFalpha. A sequence variant of SEQ ID NO: 34, SEQ ID NO: 35, or SEQ ID NO: 36 is considered t o be a "biologically active TNFalpha" polypeptide for the purposes of the present invention, if said sequence variant exhibits at least 90% of the apoptotic activity of human TNFalpha having the amino acid sequence according t o SEQ ID NO: 34. The apoptotic activity can be determined by the L929 cytotoxicity assay described by Flick et al. (1984, J
Immunol Methods, 68: 167-175, which is herewith incorporated by reference in its entirety).
The terms "biologically active single-chain TNFalpha", "biologically active scTNFalpha", or "biologically active scTN F" refers t o at least three (e.g., three, six, or nine) monomers of biologically active TNFalpha, wherein the term "biologically active TNFalpha" is defined as above, and wherein these monomers are joined by linkers so that a biologically active single chain (sc) TNFalpha (scTN Falpha or scTN F) molecule is formed.
The term "interleukin 2" (or the abbreviation "IL-2") covers interleukin-2 molecules in accordance with SEQ ID NO: 47 (human; uniprot accession number P60568; see: http://www.uniprot.org/uniprot/P60568), SEQ ID NO: 48 (mouse; uniprot accession number
P04351; see: http://www.uniprot.org/uniprot/P04351) or any other homologous sequence.
The amino acid sequences shown in SEQ ID NO: 47 and 48 correspond to the sequences of mature native interleukin 2 in the respective species after cleavage of the signal peptide. The signal peptide has a length of 20 amino acids both in human IL-2 and in murine IL-2.
However, as used herein, the term "interleukin 2" also covers amino acid sequences in which a start methionine or leader sequences or tags or other amino acids are added t o the amino terminus of SEQ ID NO: 47 and SEQ ID NO: 48.
The term "biologically active interleukin 2" encompasses polypeptides that are sequence variants (muteins) of SEQ D NO: 47 or SEQ ID NO: 48 and exhibit the same biological functions as the naturally occurring IL-2 molecules according t o SEQ ID NO: 47 or
SEQ ID NO: 48. Such "biologically active interleukin 2" molecules can occur in nature or can be artificially created polypeptides. In the context of the present application, the term
"biologically active interleukin 2" especially refers t o polypeptides that exhibit at least 90% sequence identity (e.g., at least 91%, at least 92%, at least 93%, at least 94%, at least 95%, at least 96%, at least 97%, at least 98%, or at least 99%) to the amino acid sequence set forth in
SEQ ID NO: 47 and that exhibit a binding activity t o the IL-2 receptor, as does naturally occurring IL-2. A sequence variant of SEQ D NO: 47 or SEQ ID NO: 48 is considered t o be a
"biologically active interleukin 2" polypeptide for the purposes of the present invention, if said sequence variant exhibits a dissociation constant KD t o the IL-2 receptor, which is at most twice as high as the dissociation constant K of human interleukin 2 having the amino acid sequence according t o SEQ ID NO: 47 t o the IL-2 receptor.
A "pharmaceutical composition" according t o the invention may be present in the form of a composition, wherein the different active ingredients and diluents and/or carriers are admixed with each other, or may take the form of a combined preparation, where the active ingredients are present in partially or totally distinct form. An example for such a combination or combined preparation is a kit-of-parts. An "effective amount" or "therapeutically effective amount" is an amount of a therapeutic agent sufficient t o achieve the intended purpose. The effective amount of a given therapeutic agent will vary with factors such as the nature of the agent, the route of administration, the size and species of the animal t o receive the therapeutic agent, and the purpose of the administration. The effective amount in each individual case may be determined empirically by a skilled artisan according t o established methods in the art.
Embodiments of the Invention
The present invention will now be further described. In the following passages different aspects of the invention are defined in more detail. Each aspect so defined may be combined with any other aspect or aspects unless clearly indicated t o the contrary. In particular, any feature indicated as being preferred or advantageous may be combined with any other feature or features indicated as being preferred or advantageous, unless clearly indicated t o the contrary.
In a first aspect the present invention is directed t o a complex comprising, essentially consisting of, or consisting of: (a) at least two ubiquitin moieties; and (b) at least one pharmaceutically active moiety; wherein said complex exhibits an increased serum half-life as compared t o the at least one pharmaceutically active moiety without said at least two ubiquitin moieties.
In preferred embodiments of the first aspect, said complex has a molecular weight of at least 20 kDa, preferably at least 30 kDa, more preferably at least 40 kDa, more preferably at least 50 kDa. In particularly preferred embodiments, the complex of the present invention has a molecular weight of between about 30 kDa and about 200 kDa (more preferably between about 40 kDa and about 110 kDa).
In preferred embodiments of the first aspect, the complex comprises between 2 and
10 ubiquitin moieties, preferably between 2 and 8 ubiquitin moieties, more preferably 2, 3,
4, 5, 6, 7, or 8 ubiquitin moieties. In preferred embodiments of the first aspect, each one of the at least two ubiquitin moieties consists, independently from any other ubiquitin moiety, of:
- an amino acid sequence according t o SEQ ID NO: 1;
- an amino acid sequence according t o SEQ ID NO: 2;
- an amino acid sequence according t o SEQ ID NO: 23;
- an amino acid sequence exhibiting at least 95% sequence identity t o SEQ ID NO: 1;
- an amino acid sequence exhibiting at least 95% sequence identity t o SEQ ID NO: 2; or
- an amino acid sequence exhibiting at least 95% sequence identity t o SEQ ID NO: 23.
In some embodiments of the first aspect, the at least two ubiquitin moieties are connected t o each other
via a direct covalent bond, such as a peptide bond or a disulfide bond; or
- via a linker, such as a peptide linker (e.g., SGGGG [SEQ ID NO: 4], SGGGGSGGGG [SEQ ID
NO: 5], GGGSGGGSGGGS [SEQ ID NO: 6], GGGGSGGGGSGGGGS [SEQ ID NO: 7], GIG [SEQ
ID NO: 8], SGGGGIG [SEQ ID NO: 9], SGGGGSGGGGIG [SEQ ID NO: 10], GGGGS [SEQ ID
NO: 11], the dipeptide SG, or a PAS linker).
In particularly preferred embodiments of the first aspect, the at least two ubiquitin moieties are directly connected t o each other via a peptide bond, i.e., without any linker.
In preferred embodiments of the first aspect, the at least two ubiquitin moieties are
- directly connected to the pharmaceutically active moiety via a covalent bond, such as a
peptide bond or a disulfide bond; or
connected t o the pharmaceutically active moiety via a linker, such as a maleimide moiety
or a peptide linker (e.g., GGGGS [SEQ ID NO: 11], SGGGG [SEQ ID NO: 4], SGGGGSGGGG
[SEQ ID NO: 5], GGGSGGGSGGGS [SEQ ID NO: 6], GGGGSGGGGSGGGGS [SEQ ID NO: 7],
GIG [SEQ ID NO: 8], SGGGGIG [SEQ ID NO: 9], SGGGGSGGGGIG [SEQ ID NO: 10], the
dipeptide SG, or a PAS linker).
In particularly preferred embodiments of the first aspect, the at least two ubiquitin moieties are connected t o the pharmaceutically active moiety via the peptide linker SGGG
[SEQ ID NO: 4], the peptide linker GGGGSGGGGSGGGGS [SEQ ID NO: 7], or the peptide linker
GGGGS [SEQ ID NO: 11]. In some embodiments of the first aspect, the complex further comprises linear or branched polyethylene glycol (PEG), preferably with a molecular weight in the range of
20 kDa to 40 kDa. The PEG may be linked t o one of the ubiquitin moieties of the complex or t o the pharmaceutically active moiety. Said linkage is preferably a covalent linkage and may be a direct linkage or a linkage via a linker, such as a maleimide moiety or a peptide linker.
In preferred embodiments of the first aspect, the pharmaceutically active moiety is a therapeutic or diagnostic moiety. Diagnostic moieties include fluorescent labels and radionuclides. A radionuclide as pharmaceutically active moiety is selected either from the group of gamma-emitting isotopes, preferably 9 Tc, 2 l, ln, or from the group of positron emitters, preferably F, Cu, Ga, 8 Y, 1 l, or from the group of beta-emitter, preferably
3 l, 90Y, 177 Lu, 7Cu, or from the group of alpha-emitter, preferably 3Bi, 1 At. A fluorescent label as pharmaceutically active moiety is selected from the group of Alexa Fluor or Cy dyes
(Berlier et al., J Histochem Cytochem. (2003), 51 (12): 1699-1712). Therapeutic moieties include proteins, small molecules, radionuclides, and toxins, e.g., selected from the group of a photosensitizer; a pro-coagulant factor, preferably tissue factor (e.g., tTF truncated tissue factor); an enzyme for pro-drug activation, preferably an enzyme selected from the group consisting of carboxy-peptidases, glucuronidases and glucosidases; and/or a functional Fc domain, preferably a human functional Fc domain. A toxic compound as pharmaceutically active moiety is preferably a small organic compound or a polypeptide, optionally selected from the group consisting of saporin, truncated Pseudomonas exotoxin A, recombinant gelonin, Ricin-A chain, calicheamicin, neocarzinostatin, esperamicin, dynemicin, kedarcidin, maduropeptin, doxorubicin, daunorubicin, auristatin, cholera toxin, modeccin, or diphtheria toxin.
In preferred embodiments of the first aspect, the pharmaceutically active moiety is a pharmaceutically active protein. In these embodiments, it is particularly preferred that the complex of the invention is a fusion protein, i.e., the fusion protein comprises at least two ubiquitin moieties and at least one pharmaceutically active protein (plus optional peptide linker sequences) which can all be encoded by one single nucleic acid molecule. However, it is also envisioned within the context of the present invention that the at least two ubiquitin moieties and the at least one pharmaceutically active protein are encoded by different nucleic acid molecules and are subsequently linked t o each other, for example by a disulfide bond or by a non-peptide linker.
In some embodiments of the first aspect, the at least two ubiquitin moieties are connected t o the N-terminus of the pharmaceutically active protein. In some other embodiments of the first aspect, the at least two ubiquitin moieties are connected t o the C- terminus of the pharmaceutically active protein. In yet other embodiments of the first aspect, at least one ubiquitin moiety of the at least two ubiquitin moieties is connected t o the N-terminus of the pharmaceutically active protein, and at least one ubiquitin moiety of the at least two ubiquitin moieties is connected t o the C-terminus of the pharmaceutically active protein. In these latter embodiments in which at least one ubiquitin moiety is connected t o the N-terminus and at least one ubiquitin is connected t o the C-terminus, it is not required that the same number of ubiquitin moieties is positioned on both sides of the pharmaceutically active protein. For example, if four ubiquitin moieties are present, it is possible t o arrange the parts of the complex as follows: U-U-U-U-P; P-U-U-U-U; U-U-U-P-U;
U-U-P-U-U; or U-P-U-U-U (wherein U denotes one ubiquitin moiety, P denotes one pharmaceutically active protein, and the above arrangement of the parts of the resulting fusion protein is shown from the N-terminus t o the C-terminus).
In preferred embodiments of the first aspect, said pharmaceutically active protein comprises, essentially consists of, or consists of at least one functional domain of at least one protein selected from the group consisting of an antibody mimetic, a cytokine (such as an interleukin, an interferon or a TNF), antibody fragments, a receptor fragment, and a peptide hormone. More preferably, said pharmaceutically active protein comprises, essentially consists of, or consists of at least one protein selected from the group consisting of an antibody mimetic, a cytokine (such as an interleukin, an interferon or a TNF), antibody fragments, a receptor fragment, and a peptide hormone.
In especially preferred embodiments of the first aspect, said pharmaceutically active protein is selected from the group consisting of biologically active IFN, biologically active IL-
2, biologically active TNFalpha, and biologically active single-chain TNFalpha. The terms
"biologically active IFN", "biologically active IL-2", "biologically active TNFalpha", and
"biologically active single-chain TNFalpha" are defined above.
In some embodiments of the present invention, the complex comprises two or more pharmaceutically active moieties, which may be the same or different. For example, the complex of the present invention may be a fusion protein comprising two different pharmaceutically active proteins, such as a cytokine and an antibody mimetic (e.g., an
Affilin*). In these embodiments, it is possible that one or more ubiquitin moieties of the at least two ubiquitin moieties are positioned between the two pharmaceutically active proteins. For example, if four ubiquitin moieties are present, it is possible to arrange the parts of the complex as follows: U-U-U-U-P1-P2; P1-P2-U-U-U-U; U-U-U-P1-P2-U; U-U-P1-P2-
U-U; or U-P1-P2-U-U-U; P1-U-U-U-U-P2; P1-U-P2-U-U-U; P1-U-U-P2-U-U; P1-U-U-U-P2-U
(wherein U denotes one ubiquitin moiety, PI denotes one pharmaceutically active protein
(for example a cytokine), P2 denotes another pharmaceutically active protein (for example
Affilin), and the above arrangement of the parts of the resulting fusion protein is shown from the N-terminus to the C-terminus).
In further preferred embodiments, the antibody mimetic is selected from the group consisting of Affilin* molecules, Anticalin" molecules, DARPin® molecules (designed ankyrin repeat proteins), Affibody" molecules, Fynomers, Nanobodies*, Maxybodies, Avimers (avidity multimers), Nanofitins, Monobody (Adnectins) or others (for a review see: Binz H.K. et al.
(2005) Nat. Biotechnol. 23(10): 1257-1268; the entirety of which is herein incorporated by reference). It is further preferred that the antibody mimetic is capable of binding to a target
7 molecule with a specific binding affinity t o the target molecule of KD < 10 M, preferably < 10 8 M, more preferably < 10 9 M, even more preferably < 10 0 M, and most preferably < 10
11 M .
In further preferred embodiments, the antibody mimetic is a modified dimeric ubiquitin protein (Affilin*) that is capable of binding t o a target molecule with a specific
7 ~8 binding affinity to the target molecule of KD < 10 M, preferably < 10 M, more preferably < 10 9 M, even more preferably < 10 10 M, and most preferably < 10 1 M .
In some embodiments of the present invention, the two ubiquitin units (monomers) of said modified dimeric ubiquitin protein have the identical amino acid sequence, i.e., the targeting domain consists of a modified homo-dimeric ubiquitin protein. However, in most embodiments of the present invention the two ubiquitin units have been differently modified so that the targeting domain consists of a modified hetero-dimeric ubiquitin protein. Thus, it is further preferred that the modified ubiquitin protein is a hetero-dimeric ubiquitin comprising two monomeric ubiquitin units linked together in a head-to-tail arrangement, wherein each monomeric ubiquitin unit in said modified hetero-dimeric ubiquitin protein is modified independently from the modifications in the other monomeric ubiquitin unit. It is further preferred that each modified monomeric ubiquitin unit exhibits an amino acid sequence identity of at least 80% and at most 94% to the amino acid sequence defined by SEQ ID NO: 1 [= wild-type ubiquitin] or to the amino acid sequence defined by SEQ ID NO: 2 [= ubiquitin mutein (F45W, G75A, G76A)] or to the amino acid sequence defined by SEQ ID NO: 23 [= ubiquitin mutein (G75A, G76A)].
In some embodiments, these two monomeric ubiquitin units are directly linked, i.e., without a linker. Alternatively, these two monomeric ubiquitin units may be linked by a linker sequence, e.g., by the linker sequences shown in SEQ ID NOs: 4, 5, 6, 7, 8, 9, 10, 11, or by the dipeptide linker SG.
As noted above, in some embodiments of the first aspect, the pharmaceutically active moiety comprises, essentially consists of, or consists of an antibody mimetic
(preferably an Affilin*) which is capable of binding to a target molecule with a specific
≤ 8 binding affinity t o the target molecule of KD 10 M, preferably < 10 M, more preferably < 10 9 M, even more preferably < 10 0 M, and most preferably < 10 11 M . In further preferred embodiments, the target molecule is a tumor target molecule, preferably extra-domain B
(ED-B) of fibronectin.
In some embodiments of the first aspect, the pharmaceutically active moiety is an
Affilin. In preferred embodiments, the Affilin protein is comprising at least one modified ubiquitin unit having an amino acid sequence identity to the amino acid sequence of SEQ ID
NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 23 of at least 80%, wherein amino acids in positions 2,
4, 6, 8, 62, 63, 64, 65, 66, and 68 of SEQ ID NO: 1 or SEQ ID NO: 2 or SEQ ID NO: 23 are modified by substitution in order to obtain a modified ubiquitin protein with a detectable binding to a target with a specific binding affinity of Kd = 10 s - 10 12 M . In preferred embodiments, the ubiquitin monomers of the Affilin protein are differently modified by substitutions of at least 5 amino acids in positions 2, 4, 6, 8, 62, 63, 64, 65, 66, and 68 of SEQ
ID NO: 1 or SEQ ID NO: 2 or SEQ D NO: 23, wherein said substitutions comprise substitutions at least in amino acid positions 63, 64, 65, and 66. For example, substitutions might comprise in the first monomeric unit at least amino acid positions 2, 4, 6, 62, 63, 64, 65, and 66; and in the second monomeric unit substitutions at least in amino acid positions 6, 8, 62, 63, 64, 65, and 66. For example, substitutions might comprise in the first monomeric unit at least amino acid positions 6, 8, 62, 63, 64, 65, and 66; and in the second monomeric unit at least in amino acid positions 2, 4, 6, 62, 63, 64, 65, and 66. For example, substitutions might comprise in the first monomeric unit at least amino acid positions 6, 8, 62, 63, 64, 65, and
66; and in the second monomeric unit at least in amino acid positions 6, 8, 62, 63, 64, 65, and 66. Other combinations are possible.
In preferred embodiments of the first aspect, the modified hetero-dimeric ubiquitin protein comprises an amino acid sequence selected from the group consisting of:
SEQ ID NO: 3 and an amino acid sequence that exhibits at least 90% sequence identity t o the amino acid sequence according to SEQ ID NO: 3.
In a second aspect the present invention is directed to the complex of the first aspect for use in medicine.
In a third aspect the present invention is directed t o the complex of the first aspect for use in the treatment of cancer.
The third aspect of the present invention can alternatively be worded as follows: In a third aspect the present invention is directed to a method for treating cancer, comprising the step: administering a therapeutic amount of the complex according to the first aspect t o a subject in need thereof.
In preferred embodiments of the third aspect, the cancer is selected from the group consisting of breast cancer, colorectal cancer, hepatocellular cancer, follicular lymphoma, melanoma, osteosacroma, pancreas, prostate, lung cancer, renal cell cancer, leukaemia, multiple myeloma, cutaneous T cell lymphoma, carcinoid tumor, glioblastoma multiforme
(brain), mesothelioma, squamous cell carcinoma, cell carcinoma, and Hodgkin lymphoma.
In a fourth aspect the present invention is directed t o a pharmaceutical composition comprising a complex as defined in the first aspect; and further comprising a pharmaceutically acceptable carrier. The pharmaceutical composition can be in the form of a liquid preparation, a cream, a lotion for topical application, an aerosol, in the form of powders, granules, tablets, suppositories, or capsules, in the form of an emulsion or a liposomal preparation. The pharmaceutical composition is preferably sterile, non-pyrogenic, and isotonic and contains the pharmaceutically conventional and acceptable additives known per se. Additionally, reference is made to the regulations of the U.S. Pharmacopoeia or Remington's
Pharmaceutical Sciences, Mac Publishing Company (1990).
In the field of human and veterinary medical therapy and prophylaxis pharmaceutically effective medicaments containing at least a complex in accordance with the invention can be prepared by methods known per se. Depending on the galenic preparation, these compositions can be administered parenterally by injection or infusion, systemically, rectally, intraperitoneal^, intramuscularly, subcutaneously, transdermally, or by other conventionally employed methods of application. The type of pharmaceutical preparation depends on the type of disease to be treated, the severity of the disease, the patient to be treated and other factors known to those skilled in the art of medicine.
In a fifth aspect the present invention is directed to a use of at least two ubiquitin moieties for extending the serum half-life of a pharmaceutically active moiety.
In a sixth aspect the present invention is directed t o a method for extending the serum half-life of a pharmaceutically active moiety, comprising the steps:
(a) fusing a nucleic acid encoding at least two ubiquitin moieties to a nucleic acid encoding a pharmaceutically active moiety, thereby obtaining a fused nucleic acid;
(b) introducing said fused nucleic acid into an expression vector;
(c) introducing said expression vector into a host cell;
(d) cultivating the host cell;
(e) subjecting the host cell t o culturing conditions under which a fusion protein is expressed from said vector, thereby producing a fusion protein comprising at least two ubiquitin moieties and a pharmaceutically active moiety, wherein said fusion protein has an extended serum half-life as compared to the pharmaceutically active moiety without ubiquitin moieties;
(f) optionally isolating the fusion protein produced in step (e). In a seventh aspect the present invention is directed to a nucleic acid comprising a sequence encoding the complex of the first aspect. In other words, the seventh aspect of the present invention is directed to a nucleic acid comprising a sequence encoding a fusion protein, wherein said fusion protein is defined as above, when describing embodiments of the first aspect of the invention.
In a further embodiment of the seventh aspect, the polynucleotide is for use in medicine, preferably for use in the treatment of cancer. This embodiment can alternatively be worded as follows: the present invention pertains to a method for treating cancer, comprising the step: administering a therapeutic amount of the polynucleotide according t o the seventh aspect to a subject in need thereof. The cancer t o be treated in accordance with the seventh aspect is preferably selected from the same list of cancers as defined above for the third aspect.
In an eighth aspect the present invention is directed to a vector comprising the nucleic acid of the seventh aspect. In a further embodiment of the eighth aspect, the vector is for use in medicine, e.g., for use in the treatment of cancer. This embodiment can alternatively be worded as follows: the present invention pertains t o a method for treating cancer, comprising the step: administering a therapeutic amount of the vector according t o the eighth aspect to a subject in need thereof. The cancer to be treated in accordance with the eighth aspect is preferably selected from the same list of cancers as defined above for the third aspect.
In a ninth aspect the present invention is directed t o a cell comprising the vector of the eighth aspect. In a further embodiment of the ninth aspect, the cell is for use in medicine, e.g., for use in the treatment of cancer. This embodiment can alternatively be worded as follows: the present invention pertains to a method for treating cancer, comprising the step: administering a therapeutic amount of the cell according to the ninth aspect to a subject in need thereof. The cancer t o be treated in accordance with the ninth aspect is preferably selected from the same list of cancers as defined above for the third aspect. In a tenth aspect the present invention is directed t o a complex com prising (a) at least two ubiquitin moieties; and (b) a pharmaceutically active moiety, wherein said complex has a molecular weight of at least 20 kDa, preferably at least 30 kDa, more preferably at least 40 kDa, even more preferably at least 50 kDa. In particularly preferred embodiments of the tenth aspect, the complex has a molecular weight of between about 30 kDa and 200 kDa; more preferably between 40 kDa and 110 kDa.
In preferred embodiments of the tenth aspect, said complex exhibits an increased serum half-life as compared t o the at least one pharmaceutically active moiety alone without said at least two ubiquitin moieties.
All preferred embodiments described above for the first aspect apply in a fully analogous manner t o the tenth aspect.
Likewise, the present invention is also directed t o the complex of the tenth aspect for use in medicine, preferably for use in the treatment of cancer. This aspect of the present invention can alternatively be worded as follows: the present invention is directed t o a method for treating cancer, comprising the step: administering a therapeutic amount of the complex according t o the tenth aspect t o a subject in need thereof. The cancer t o be treated in accordance with the tenth aspect is preferably selected from the same list of cancers as defined above for the third aspect.
In a further aspect, the present invention is directed t o a pharmaceutical composition comprising a complex as defined in the tenth aspect; and further comprising a pharmaceutically acceptable carrier. The information on different forms of pharmaceutical compositions presented above with reference t o the fourth aspect applies identically t o pharmaceutical compositions comprising a complex as defined in the tenth aspect.
Furthermore, the seventh, eighth, and ninth aspect of the invention have been defined above with reference t o the complex of the first aspect. In analogous manner, the present invention is also directed to variations of the seventh, eighth, and ninth aspect that relate t o the complex of the tenth aspect.
Extra-domain Bof fibronectin as tumor specific protein The extra-domain B (ED-B) of fibronectin is a small domain inserted by alternative splicing of the primary RNA transcript into fibronectin. Fibronectins are high molecular weight extracellular matrix glycoproteins abundantly expressed in healthy tissues and body fluids. ED-B represents one of the most selective markers associated with angiogenesis and tissue remodeling. It is abundantly expressed around new blood vessels, but undetectable in virtually all normal adult tissues. ED-B is known t o be involved primarily in cancer. High levels of ED-B expression were detected in primary lesions as well as metastatic sites of many human solid cancer entities. In solid cancer tissues, ED-B is either detected surrounding pro- angiogenic vessels or in a mixed mode of perivascular and stromal expression (Menrad and
Menssen (2005), Expert Opin Ther Targets, 9: 491-500, the entirety of which is herein incorporated by reference). Furthermore, ED-B can be bound t o diagnostic agents and used as diagnostic tool. One example is its use in molecular imaging of atherosclerotic plaques and detection of cancer, for example by immunoscintigraphy of cancer patients. Plenty of additional diagnostic uses are conceivable.
The amino acid sequence of human extra-domain B (ED-B, 91 residues) of fibronectin is shown in SE ID NO: 25. For expression of the protein, a start methionine has t o be added.
ED-B is detected in mammals, e.g., in rodents, cattle, primates, carnivore, human etc.
Examples of animals in which there is a 100% sequence identity t o human ED-B are Rattus norvegicus, Bos taurus, Mus musculus, Equus caballus, Macaco mulatto, Canis lupus familiaris, and Pan troglodytes.
ED-B specifically accumulates in neo-vascular structures and represents a target for molecular intervention in cancer. A number of antibodies or antibody fragments t o the ED-B domain of fibronectin are known in the art as potential therapeutics for cancer and other indications (see, for example, WO 97/45544, WO 07/054120, WO 99/58570, WO 01/62800, all of which are hereby incorporated by reference). Furthermore, conjugates comprising an anti-ED-B antibody or an anti-ED-B antibody fragment with IL-12, IL-2, IL-10, IL-15, IL-24, or
GM-CSF have been described for targeting drugs for inhibiting diseases such as cancer, angiogenesis, or neoplastic growth (see, for example, WO 06/119897, W0 07/128563, WO
01/62298, all of which are hereby incorporated by reference).
WO 2011/073208 and WO 2011/073209 (all of which are hereby incorporated by reference) disclose multimeric proteins based on modified ubiquitin with high affinity binding t o the target ED-B. The applications describe anti-ED-B binding molecules showing a highly efficient targeting of tumor vasculature.
Interferon
Interferon alpha (abbreviations: IFN-alpha or IFN-a) is a cytokine. More than 10 different subtypes encoded by different genes exist in human. All IFN-alpha subtypes, together with IFN-beta, bind t o the IFN-alpha receptor (IFNAR), which is composed of two subunits, IFNAR1 and IFNAR2. IFNAR molecules are present on most cell types, making them responsive t o IFN-alpha signals. Interactions between IFN-alpha and its receptor are highly species specific. For uses in medicine, especially interferons IFN-alpha 2a and IFN-alpha 2b are of interest. Both interferons show high affinity t o the IFN-alpha receptor.
The role of interferon alpha in cancer has been studied. Medicaments containing IFN- alpha 2a or 2b were used initially for indications like Hairy cell leukemia and chronic myelogenous leukemia. IFN-alpha is still used in the treatment of renal cell carcinoma and cutaneous lymphoma but other therapies show improved efficacies compared t o IFN-alpha.
In order t o obtain therapeutic responses, high doses of IFN-alpha have t o be used, leading t o high toxicity. IFN-alpha has many cellular effects including an anti-cancer activity and anti¬ viral activity. IFN-alpha therapy often has t o be applied for many months in order t o achieve a therapeutic result. Nevertheless, IFN-alpha is one of the very few cancer therapies that have the potential t o have a curative effect on metastatic tumors in humans.
Single chain TNFalpha (scTNF)
In the prior art, single chain (sc) TNFalpha proteins of at least three monomers connected by peptide linkers are described generally. For example, Krippner-Heidenreich et al. (2008, J Immunol., 180 (12): 8176-8183; the entirety of which is herein incorporated by reference) describe polypeptides which consist of at least three monomers of a TNF family ligand which are connected by peptide linkers. Importantly, it was shown that although this construct is less toxic than wild-type TNFalpha, it shows the same bioactivity as native TNF.
EXAMPLES The following examples are put forth so as t o provide those of ordinary skill in the art with a complete disclosure and description of how t o make and use the methods and compositions of the invention, and are not intended t o limit the scope of what the inventors regard as their invention. Efforts have been made t o ensure accuracy with respect t o numbers used but some experimental errors and deviations should be accounted for. Unless indicated otherwise, molecular weight is average molecular weight, temperature is in degrees centigrade, and pressure is at or near atmospheric.
Example 1. Production of complexes comprising four or six ubiquitin moieties and an
Affilin as pharmaceutically active moiety
The complexes of the invention comprise at least two ubiquitin moieties and a pharmaceutically active moiety. As pharmaceutically active moiety, in this Example, a modified hetero-dimeric ubiquitin (Affilin ) is comprised, which is connected t o the preceding four or six ubiquitin moieties via a short peptide linker with the amino acid sequence GGGGS (SEQ ID NO:ll). The complexes were produced as soluble proteins in a suitable host, namely E. coli, and purified from the cytoplasmic fraction as described in
Examples 1-3. By way of characterization, the obtained fusion protein preparations were analyzed for purity and homogeneity. Additionally, the in vitro affinity for target protein
ED-B was tested as described in Examples 4-6.
Step 1: Production of vectors for cloning of ubi4-Affilin and ubi6—Affilin complexes of the invention
As vector for cloning of fusion proteins, proprietary expression vectors (Scil Proteins GmbH, pSCIL008b, see WO 05/061716, the entirety of which is herein incorporated by reference) or commercially available vectors (e.g., pET20b by Invitrogen) were modified by insertion of coding sequences for four or six wild-type Ubiquitin moieties, respectively, which were previously amplified by PCR using standard methods known t o somebody skilled in the art.
Unique restriction sites were introduced into all resulting expression plasmids in order t o facilitate the insertion of modified ubiquitin sequences.
ubi6-Affilin: Vector pET20b was modified by insertion of six wild-type ubiquitin moieties. Affilin ® (SEQ ID
NO: 3) was amplified by PCR (annealing temperature 59°C, 30 cycles) and ligated into the 6 ubiquitin (ubi6) containing vector pET20b via BamH\/Xho\ restriction sites. The following primers were used :
SPW-mri-fw-BamH GCAGGGATCCATGCGTATCTGGGTG CACACCCTGACC (SEQ D NO: 21)
SPF-AA-Stop-Xho TGCAGCCATCTCGAGTCATTAGGCCG CACGTAAACGAAGAACTAA (SEQ ID
NO: 22)
Ubi4-Affilin:
Affilin and Ubi4 were amplified separately via PCR, ligated with each other via HI restriction site and as fusion cloned into pET20b via Nde\/Xho\ restriction sites.
Primer for the amplification of Affilin :
SPW-mri-fw-Bam H GCAGGGATCCATGCGTATCTGGGTGCACACCCTGACC (SEQ ID NO: 21)
SPF-AA-Stop-Xho TGCAGCCATCTCGAGTCATTAGGCCG CACGTAAACGAAGAACTAA (SEQ ID
NO: 22)
PCR conditions: Annealing temp 59°C, 25 cycles
Primer for the amplification of Ubi4 (four ubiquitin monomers)
Ubil-fw-Nde GGAGATATACATATGCAGATCTTTG (SEQ ID NO: 24)
Ubi4-G4S-rev-BamH CTG CG GATCCACCGCCACCTGCGGCACGTAACCGCAGG (SEQ ID NO: 38)
PCR conditions: Annealing temp 55°C, 25 cycles
Step 2: Cloning of ubi4-Affilin-complexes and ubi6—Affilin- complexes
For the production of the complexes of the invention, the sequence of interest was amplified from a plasmid template by PCR according t o standard procedures and inserted into the expression plasmids as described in Step 1. DNA sequence analyses confirmed the correct sequences of the expression vectors encoding the fusion proteins.
Step 3: Expression of Ubi4-Affilin-complexes and Ubi6-Affilin-complexes
Complexes were produced in E. coli and isolated from cytoplasm. For expression of the complexes, the corresponding clones were cultivated and grown by batch or fed-batch fermentation in complex media containing the appropriate antibiotics corresponding t o the
respective resistance gene encoded on the expression vectors. Expression was induced by
adding IPTG. After 4 h of induction, microbial cells were harvested, suspended, and disrupted by high pressure dispersion in a French press. The expressed fusion proteins were
purified from the soluble fraction obtained after centrifugation of the cell lysate.
Example 2: Purification of Ubi4-Affilin-complexes and Ubi6-Affilin-complexes
For purification of Ubi4-Affilin and Ubi6-Affilin complexes as fusion proteins, up t o three chromatographic steps were required. These chromatographic steps included
hydrophobic interaction chromatography (HIC) on e.g., Butyl 650M, ion exchange
chromatography on, e.g., SP Sepharose HP and size exclusion chromatography on, e.g.,
Superdex gel filtration medium. In all cases, fractions were analyzed by SDS-PAGE with
respect t o their purity. Suitable fractions were pooled and analyzed for homogeneity and
activity by a series of methods including, e.g., rpHPLC, SE-HPLC combined with light
scattering detection, analytical affinity interaction chromatography, and surface plasmon
resonance-based interaction analysis. For fusion protein comprising four wild-type ubiquitin
moieties (Ubi4) linked t o an Affilin" (SEQ ID NO: 15, MW = 52.1 kDa), yields of up t o 34 mg
pure and active fusion protein per liter expression culture were obtained. The yield obtained
for the complex comprising six ubiquitin moieties (Ubi6) and an Affilin (SEQ ID No: 14; MW
= 69.3 kDa) was in a similar range.
Example 3: Preparation of a heteromeric binding protein based on modified ubiquitin
dimers (Affilin ®)
Step 1: Production of vectors for cloning
As vector for cloning of Affilin (SEQ ID NO: 3), a commercially available vector
(pET SUMO, Invitrogen) was modified by insertion of an oligonucleotide encompassing
unique restriction sites as described in the literature (Bosse-Doenecke et al. (2008), Protein
Expr Purif. 58: 114-121, the entirety of which is herein incorporated by reference).
Additional unique restriction sites were introduced, in order t o facilitate the subsequent
insertion of modified ubiquitin (Affilin*) sequences as described in Example 3, step 2. Step 2: Cloning of Affilin molecules (modified hetero-dimeric ubiquitin-based binding proteins)
For the production of an Affilin* fused t o Small Ubiquitin-like Modifier (SUMO), the sequence coding for an Affilin" (SEQ ID NO: 3) was amplified from a plasmid template by PCR according t o standard procedures.
The following primers were used:
1071C12-mwi-fw-Bsa TTTTGGTCTCATGGTATGTGGATCTGGGTGCACACCCTGACC (SEQ ID NO: 45) HUBI-AA-SUMO-rev AAAAGGATCCTCATTAGGCCGCACGTAAACGAAGAACTA (SEQ ID NO: 46)
The amplified sequence was ligated into pET-SUMOadapt (already containing SUMO) via the restriction sites Bsal/BamHI.
DNA sequence analyses confirmed the correct sequences of the expression vectors encoding the SUMO-Affilin*- fusion proteins.
Step 3: Expression of SUMO-Affilin -fusion proteins
SU M O fusion proteins were produced in E. coli and isolated from cytoplasm. For expression of the fusion proteins, the clones were cultivated and grown by batch or fed- batch fermentation in complex media containing the appropriate antibiotics corresponding t o the respective resistance gene encoded on the expression vectors. Expression was induced by adding isopropyl^-D-l-thiogalactopyranoside (IPTG). After 4 h of induction, microbial cells were harvested, suspended, and disrupted by high pressure dispersion in a
French press. The expressed proteins were purified from the soluble fraction obtained after centrifugation of the cell lysate.
Step 4: Purification of Affilin* proteins
Specific binding proteins (Affilin*) were produced as cleavable SUMO fusion proteins as described in Example 3, Step 3 by a series of chromatographic steps including Immobilized
Metal ion Affinity Chromatography (IMAC) on Ni-NTA Superflow and size exclusion chromatography on Superdex gel filtration medium. Before the final chromatographic purification step, the SUMO domain was removed from the Affilin* protein by cleavage with a specific SUMO hydrolase under appropriate conditions (Fig. 4A). Fractions were analyzed by SDS-PAGE t o check for purity and suitable fractions were pooled. Analytical methods including rpHPLC, SE-HPLC combined with multi-angle light scattering detection, analytical affinity interaction chromatography, and surface plasmon resonance-based interaction analysis were used t o analyze the protein pool with respect t o homogeneity and activity. For the Affilin" (SEQ ID NO: 3), yields of up t o 500 mg active protein per liter expression culture from fed-batch fermentation were obtained.
Step 5: Modification of Affilin* proteins with Polyethylene Glycol (PEG)
Pharmaceutically active moieties prepared according t o Examples 3 and 8 (SEQ ID
NO: 3; SEQ ID NO: 16 and 19) were N-terminally modified with a mono-functionally activated polyethylene glycol (PEG) moiety by reductive alkylation, pursuant t o established protocols.
The molecular weight of the linear or branched PEG-aldehyde molecules used for protein modification was in the range of 20 t o 40 kDa. Mono-PEGylated proteins were separated from unmodified and poly-PEGylated species, respectively, according t o the isoelectric point of the complexes (Fig. 4B and 4C). Due t o the modification described the molecular weight of the Affilin was increased t o approx. 60 kDa. The molecular weight of Affilin * -IFN (SEQ ID NO:
19) and Ubi2-IFN (SEQ ID NO: 16), respectively, was raised t o approx. 57 kDa.
Example 4: Biacore assays to determine the affinity of the Affilin fusion proteins towards human or mouse ED-B
ED-B binding activity of the complexes comprising four or six ubiquitin moieties and an Affilin (SEQ ID NO: 15 and SEQ ID NO: 14) as well as of the PEGylated proteins containing an Affilin * (SEQ ID NO: 3 and SEQ ID NO: 19) was investigated using the surface plasmon resonance-based Biacore technique. Different concentrations of the proteins were analyzed
(0-200 nM) for binding t o human or mouse ED-B immobilized on Biacore sensor surfaces according t o established methods. The obtained data were processed via Biaevaluation software and l:l-Langmuir-fitting. For the complexes, the resulting dissociation constants
(KD) as well as corresponding microscopic rate constants koff and kon are summarized in Table
1. _ _
Table 1. Affinity of the complexes to human ED-B
Complex microscopic rate of microscopic rate of Binding affinity of the
association dissociation complex
1 kon [M s ] [K value] Affilin* 2.8 106 5.1-10 4 0.182 nM
Ubi4- Affilin* 2.12 106 5.64-10 4 0.263 nM
Ubi6- Affilin* 1.45-10 6 3.85-10 4 0.265 nM
PEG- Affilin* 3.42-10 5 1.54-10 3 4.5 nM
PEG-Affilin*-IFN 5.02 105 8.35-10 4 1.66 nM
Example 5: Analysis of the ED-B-binding activity of the complexes bv enzvme-linked immunosorbent assay
The target binding activity of the complexes comprising a hetero-dimeric ubiquitin- based Affilin* (SEQ ID NO: 3) were analyzed by an ED-B-binding ELISA. For this purpose, a recombinant protein construct containing the human fibronectin exodomains 6, 7, B, 8, and
9 was coated t o Nunc Medisorp microwell plates in a concentration of 100 ng/ml. Another recombinant construct containing only domains 6, 7, 8, and 9 was coated t o control surfaces in an equimolar concentration (80 µ η Ι). Unspecific binding sites were blocked with 3% BSA dissolved in PBST buffer (137 m M sodium chloride, 2.7 mM potassium chloride, 8 m M disodium hydrogen phosphate and 2 m M potassium dihydrogen phosphate, supplemented with 0.1 %(w/v) polyoxyethylene(20) sorbitan monolaurate). After washing the wells with
PBST buffer, the complexes were applied in appropriate concentration series and incubated for 1 h. The wells were again washed with PBST. For detection of the bound fusion proteins, a POD-conjugate of a ubiquitin-specific recombinant Fab fragment (AbD SeroTec) was applied in a dilution of 1:6500. Specific binding of the fusion proteins t o the immobilized ED-
B domain was monitored by the POD-catalyzed colorimetric reaction of the substrate
3,3',5,5'-tetramethylbenzidin according t o the manufacturer's (KEM-EN-Tec) instructions.
Reactions were stopped by adding 0.2 M H2S0 4. The ELISA plates were read out using the
TECAN Sunrise ELISA-Reader. The photometric absorbance measurements were done at 450 nm using 620 nm as a reference wavelength. Fig. 6 compares the results of an ED-B binding ELISA performed with Affilin" (SEQ ID
NO: 3) and complex Ubi4-Affilin (SEQ ID NO: 15). The results for a number of complexes containing the Affilin" directed against ED-B as pharmaceutically active moiety are summarized in the Table shown in Fig. 9A.
Example 6 : Binding analysis of the Ubi4-Affilin-complex and Ubi6-Affilin-complex (fusion proteins) to human ED-B by analytical affinity interaction chromatography
The affinity of the complexes of invention toward human ED-B was also investigated using analytical affinity interaction chromatography. For that purpose, a chromatographic affinity matrix was prepared by covalently coupling a construct containing human ED-B domain t o Sulfolink™ resin (Pierce). Ubi4-Affilin or Ubi6-Affilin was applied t o the column containing the ED-B affinity matrix (200 µg complex per ml affinity resin). Binding was performed in physiological buffer (phosphate-buffered saline (PBS)), while elution of bound protein was induced by pH shift t o pH 2.5. From the ratio of bound t o unbound species the fraction of active protein in the preparations could be estimated. Fig. 5 represents the affinity interaction chromatography analysis performed with complex Ubi6-Affilin (SEQ ID
NO: 14); results obtained with a series of complexes (SEQ ID NO: 3, SEQ ID NO: 14; SEQ ID
NO: 15) are summarized in a Table shown in Fig. 9A.
Example 7. Complex composed of two ubiquitins moieties (Ubi2) and interferon-alpha as pharmaceutically active moiety
Production of the complex Ubi2-IFIM
The complex protein described consists of two ubiquitin monomers (SEQ ID NO: 2) linked by a GIG peptide linker (SEQ ID NO: 8), an SG4-linker (SEQ ID NO: 4), and interferon- alpha 2b (SEQ ID NO: 28) as pharmaceutically active moiety. The complex was produced as inclusion bodies in f . coli and purified after in vitro refolding. By way of characterization, the obtained complex was analyzed for purity and homogeneity. The activity of the pharmaceutically active moiety IFN-alpha 2b was tested in vitro (cell culture).
Step 1: Cloning of an Ubi2-IFN complex Two ubiquitin monomers (Ubi2) and interferon IFN alpha 2b (IFN) were amplified separately via PCR.
Primers for Ubi2:
Ub2(7)-fw-EcoR GCAGGAATTCATGCAGATCTTCGTGAAAACC(SEQ ID NO: 39)
Ub2(7)-rev-Bsa GCACGGTCTCCAACGAAGAACTAAATGTAAGG (SEQ ID NO: 40)
PCR conditions: Annealing temperature 55°C, 24 cycles
Primers for IFN :
Hubi-SG4-fw-Bsa GCACGGTCTCCCGTTTACGTGCAGCAAGCGG (SEQ ID NO: 41)
IFN-rev-Pst GCTG CCTGCAGTCATTATTCTTTGCTACGC (SEQ ID NO: 42)
PCR conditions: Annealing temperature 54°C, 24 cycles
Ubi2 and IFN were ligated with each other by the restriction site Bsa\. The fusion of
Ubi2 and IFN was inserted into the expression vector pSCIL008b (Scil Proteins, W O
05/061716) by the restriction sites EcoR\/Pst\. Standard methods known t o somebody skilled in the art were applied.
Step 2. Expression of Ubi2-IFN complex
The complex was produced in E. coli and isolated in the form of inclusion bodies. For expression of the complex, the clones were cultivated and grown by fed-batch fermentation in complex medium containing the appropriate antibiotics corresponding t o the respective expression vectors. Expression was induced by adding IPTG. After 2-4 h of induction, microbial cells were harvested, suspended, and disrupted by high pressure dispersion in a
French press. The insoluble fraction was collected and inclusion bodies containing the expressed proteins were isolated by standard washing protocols.
Example 8: In vitro refolding and purification of Ubi2-IFN complex
Active complex was prepared by in vitro refolding at a temperature of 4 degrees centigrade after rapid dilution of inclusion body material solubilized in 6 M guanidinium chloride, and purified by a series of chromatographic steps. These chromatographic steps included at least one ion exchange chromatography on Q Sepharose HP. In all cases, fractions were analyzed by SDS-PAGE and analytical HPLC with respect t o their purity.
Suitable fractions were pooled and analyzed for homogeneity and activity by a series of methods including rpHPLC and SE-HPLC. For the complex, yields of up t o 690 mg active protein per liter expression culture from fed-batch fermentation were obtained.
Example 9: Activity assay of the effector domain of Ubi2-IFN complex
To analyze the physiological IFN-alpha activity of the Ubi2-I FN complex, an ISRE-
Reporter Gene Assay was established. IFN-alpha is capable of inducing interferon-stimulated genes (ISGs), for example ISG54. ISG54 contains a c/'s-acting element (TAGTTTCAC 1I CCC,
SEQ ID NO: 26) in its promoter region, which is responsible for the inducible expression of the gene. This element is referred t o as ISRE-element (IFN-stimulated response element).
Five tandem copies of the ISRE element were inserted upstream of the basic promoter element (TATA box) and luciferase gene of pGL4.27-Luc2 plasmid (Promega). Hela-cells, a cervix carcinoma cell line, were transfected and a cell pool was sustained by selection with
Hygromycin. To monitor the IFN-alpha activity of the Ubi2-IFN complex, the reporter cells were used for an ISRE-Reporter Gene Assay.
The cells were resuspended in suitable medium containing 10% fetal calf serum (FCS).
A cell suspension with a density of 3xl0 5 cells/ml in medium containing 5% FCS was seeded into a white 96 well cell culture plate. After 24 h, the cells were treated with different concentrations of fusion proteins (e.g., in the range of 3xl0 10 t o 4.6xl0 14 M). The metabolic activity was measured by ONE-Glo™ Luciferase substrate (Promega). Each testing of complex of the invention was paralleled by testing a dose range of recombinant human IFN-alpha 2b
(Biomol) t o validate the assay. The quantitative evaluation is based on the relative potency against an IFN-alpha 2b standard by parallel line method with PLA2.0 software. Potency was determined in triplicates. The complex has a potency of 38 - 41%. The potency of IFN-alpha
2b should be in a range of 100% +/-20% (see Table in Fig. 9B). 40n
Example 10: Production of a complex composed of two ubiquitin moieties and pharmaceutically active single-chain murine TNFalpha
Production of the complex Ubi2-scTNF
The ubi2-scTN F complex protein (SEQ ID NO 17) consists of two ubiquitin moieties
(SEQ ID NO: 2) linked by a GIG peptide linker (SEQ ID NO: 8), and single-chain murine tumor necrosis factor-alpha (scTNF; SEQ ID NO: 37) as pharmaceutically active moiety, linked by a
(G4S)3 linker (SEQ ID NO: 7). The complex was produced as inclusion bodies in E.coli and purified after in vitro refolding. By way of characterization, the obtained complex was analyzed for purity and homogeneity. The structural integrity of the pharmaceutically active scTN F moiety was tested by a receptor-binding ELISA, and its preserved biological activity was demonstrated by an in vitro cell culture assay.
Step 1: Production of a vector for cloning of the Ubi2-scTNF complex
The TNFalpha sequence was amplified via PCR using standard methods known t o somebody skilled in the art. pSCIL008b was modified by insertion of the coding sequences for three murine TNFalpha subunits genetically fused head-to-tail by two (G3S)3 peptide linkers, thereby obtaining plasmid pSCIL008b-mscTN Fa. Unique restriction sites were introduced into the resulting expression plasmids in order t o facilitate an insertion of the sequence coding for the ubiquitin moieties.
Step 2: Cloning of Ubi2-scTNF
For the production of the complex of two ubiquitin moieties and murine single-chain
TNFalpha, the sequence coding for two ubiquitin moieties was amplified from a plasmid template by PCR according t o standard procedures, and inserted into the expression plasmids pSCIL008b-mscTNFa described in step 1. DNA sequence analyses confirmed the correct sequences of the expression vectors encoding the complex.
Ubi2 (two ubiquitin monomers) were amplified via PCR using standard procedures.
Primers used:
Ub2(7)-fw-EcoR GCAGGAATTCATGCAGATCTTCGTGAAAACC (SEQ ID NO: 39)
SPF-AA-rev2-Bsa GCAGGGTCTCACACCCGCGGCACGTAAACGAAGAAC(SEQ ID NO: 44) The PCR was performed using an annealing temperature of 52°C and 28 cycles. The amplified Ubi2 was ligated into pSCIL008b-mscTNFa using restriction sites EcoR\/Bsa\.
Step 3. Expression of Ubi2-scTNF
The complex was produced in suitable E. coli host strains and isolated in the form of inclusion bodies. For expression of the complex, the clones were cultivated and grown by fed-batch fermentation in complex medium containing the appropriate antibiotics corresponding t o the respective expression vectors. Expression was induced by adding IPTG.
After 4 h of induction, microbial cells were harvested, suspended, and disrupted by high pressure dispersion in a French press. The insoluble fraction was collected and inclusion bodies containing the expressed proteins were isolated by standard washing protocols.
Example 11: In vitro refolding and purification of Ubi2-scTNF complex
Active complex was prepared by in vitro refolding at a temperature of 4 degrees centigrade after rapid dilution of inclusion body material solubilized in 6 M guanidinium chloride into phosphate-buffered saline (PBS) t o a final protein concentration of 0.15 mg/ml, and purified by a series of chromatographic steps. These chromatographic steps included a capture step on a hydrophobic charge interaction matrix (MEP Hypercel, Pall), an intermediate anion exchange chromatography on Q . Sepharose HP (GE Healthcare) and a final size exclusion step on a Superdex 200 column (GE Healthcare). In all cases, fractions were analyzed by SDS-PAGE and analytical HPLC with respect to their purity. Suitable fractions were pooled and analyzed for homogeneity and activity by rpHPLC and SE-HPLC.
Yields of up t o 50 mg purified Ubi2-scTNF complex per liter expression culture from fed- batch fermentation were obtained.
Example 12: ELISA of specific TNF-receptor binding by Ubi2-scTNF complex
In order t o test the structural integrity of the pharmaceutically active scTNF moiety, binding of a TNF receptor I domain t o the Ubi2-scTNF complex was analyzed in an ELISA setup. For this purpose, Nunc microwell plates were coated with a commercially available polyclonal anti-TNF antiserum (PeproTech) in a concentration of 1 g/ml. Unspecific binding sites were blocked with bovine serum albumin (BSA) blocking solution in PBS. After washing the wells with PBST buffer, Ubi2-scTNF, was applied in a concentration of 1 / η Ι, while recombinant murine TNFalpha serving as control was applied in an equimolar concentration of 0.73 g/ ml. The wells were again washed with PBST. For analysis of the receptor binding activity of the TNF moieties in the immobilized complex and the immobilized recombinant
TNFalpha, respectively, a commercially available construct comprising the soluble TNF- binding domain of murine TNF receptor I and the Fc portion of human IgG (R&D systems) was employed. This chimera was applied t o the wells in concentration series of 0-200 nM.
After incubation and an additional washing step, a POD-conjugate of a polyclonal Fc-specific anti human IgG antibody from goat (AbD SeroTec) was applied in a dilution of 1:50000, in order t o detect bound TNF receptor chimera. Specific binding of the receptor chimera t o the immobilized fusion proteins was monitored by a POD-catalyzed colorimetric reaction using the substrate 3 3',5,5'-tetramethylbenzidin (KEM-EN-Tec) according t o the manufacturer's instructions. Reactions were stopped by adding 0.2 M H2S0 . The ELISA plates were read out using a TECAN Sunrise ELISA-Reader. The photometric absorbance measurements were done at 450 nm using 620 nm as a reference wavelength.
In this assay, the TNF receptor binding activity of Ubi2-scTNF was found t o be comparable t o TNFalpha, as shown in Fig. 10, indicating that the structure of the TNF moiety in the complex was fully intact.
Example 13: Activity assay of the effector domain of Ubi2-scTNF complex
The physiological TNF-alpha-activity of a complex according t o the invention, consisting of two ubiquitin moieties genetically fused via a (G4S)3-linker (SEQ ID NO: 7) t o murine single-chain TNFalpha, was determined using the L929 apoptosis assay (Flick et al.(1984), J Immunol Methods. 68: 167-175, the entirety of which is herein incorporated by reference). In this assay, the effector part of the complex efficiently stimulates cell death in actinomycin D sensitized cells at EC 0 values in the picomolar range. Cells were resuspended in suitable medium containing fetal bovine serum and antibiotics. A cell suspension with a density of 3.5xl0 5 cells/ml was seeded into the wells of
96 well standard cell culture plates. After incubation, the culture medium was removed and medium containing fetal bovine serum (FBS), Actinomycin D and antibiotics was added t o each well. After incubation, the complex of the invention or recombinant TNFalpha (cf. below) were added at appropriate concentration ranges (10 and 10 18 M). After further incubation, the metabolic activity as a measure of cell survival was determined using WST-1 reagent (Roche). At least three independent experiments were conducted, each of them in triplicates. Each test of the complex according t o the invention was accompanied by testing a dose range of human recombinant TNF-alpha as control.
The complex was found t o have a potency of 156 ± 68 % compared t o the TNF-alpha control (see Table in Fig. 9B). The biological activity of the scTNF moiety in the complex was thus fully preserved.
Example 14: In vivo pharmacokinetic study in healthy mice using fusion proteins of the invention
To determine pharmacokinetic parameters of half-life prolonged fusion proteins of the invention, healthy mice were treated with a single administration of these variants after lodine-125 labeling. For treatment, groups of n=9 mice (CD-I strain) were intravenously injected into the tail vein in a total applied volume of 4.2 ml/kg. Doses of 11.4 nmol/kg unmodified affilin-equivalent were administered. Three mice per blood sampling time point were used.
Step 1: Measurement of blood and serum radioactivity levels
At the time points indicated, the blood samples were collected from saphenous vein of un-anaesthetized mouse. Each blood sample was collected in pre-weighed Microvette tubes with clotting activator (Sarstedt). The tubes were weighed and the radioactivity was measured in an automatic gamma counter (Wallace Wizard 2470 - Perkin Elmer) calibrated for lodine-125 radionuclide (efficiency: 74%). The results of this counter are expressed as cpm and the conversion in µ is realized as described below:
Radioactivity in µ = Radioactivity in cpm / 0.74 / 60 / 37 000
Explanation of this calculation: cpm / detector efficiency (0.74) = dpm dpm / 60 = disintegration per second = value in Bq (a Becquerel equals one radioactive disintegration per second)
Bq are then divided by 37000 t o convert it t o µ (Ι µ = 37 000 Bq). The concentration of radioactivity in blood is expressed as percentage of the injected dose and equivalent quantity of protein per g.
Step 2: Calculation of blood pharmacokinetic parameters
The pharmacokinetic parameters were assessed using data expressed as activity per mL of blood (µ / η ί ). These data were analyzed using a macro on Excel™ software. The half- life of blood activity was calculated using two-phase exponential decay equations, which produced distribution (Ti/ 2 alpha) and elimination (Ti/ 2 beta) half-lives. The blood clearance and the area under curve (AUC) were also calculated. AUC and blood half-life (Ti/ 2 alpha and
Ti/ 2 beta) are directly calculated by the program of the macro. The blood clearance is calculated from the AUC using the following equation:
Clearance = injected dose / AUC
As shown in Fig. 7 there is a clear evidence for prolongation of circulation half-life with an increased number of ubiquitin-monomers attached t o the Affilin molecule.
Step 3 : SE-HPLC analyses t o investigate serum stability
SE-HPLC analyses of serum samples (pooled samples from three mice each time point) were conducted on a Superdex G200 10/300 GL column eluted with PBS at a flow rate of 0.8 mL/min. Between the injection of each serum sample, an injection of 70 µί. of 0.1 N
NaOH followed by an injection of 70 µ of water were performed as washing steps. A total volume of 30-100 µΐ undiluted serum sample was injected. Prior t o injection, serum samples were filtered with a pore diameter of 0.45 µηι.
Activity loaded onto the column was determined by calculation from the amount of the loaded radioactive protein. Eluted fractions were collected and radioactivity of each fraction was measured using a gamma counter in order t o plot radio chromatogram profiles.
Radioactivity of peaks corresponding t o the mature protein was used for calculation of the percentage of intact labeled protein. As displayed in Fig. 8 in line with increasing numbers of ubiquitin monomers included in the complex the amount of intact protein over time in serum increases too. SEQUENCE LISTING - FREE TEXT INFORMATION
The sequences according t o SEQ ID NOs: 1, 25, 27 t o 36, 43, 47, and 48 shown in the attached sequence listing do not contain any free text information. Nevertheless, short explanations are presented below also for these sequences.
SEQ ID NO: 1 wild-type ubiquitin SEQ ID NO: 2 ubiquitin mutein (F45W/G75A/G76A), start sequence for mutagenesis SEQ ID NO: 3 Affilin SEQ ID NO: 4 peptide linker SEQ ID NO: 5 peptide linker SEQ ID NO: 6 peptide linker SEQ ID NO: 7 peptide linker SEQ ID NO: 8 peptide linker SEQ ID NO: 9 peptide linker SEQ ID NO: 10: peptide linker SEQ ID NO: 11 peptide linker SEQ ID NO: 12: basic linker sequence SEQ ID NO: 13: basic linker sequence SEQ ID NO: 14: Ubi6-Affilin SEQ ID NO: 15: Ubi4-Affilin SEQ ID NO: 16: Ubi2-IFN SEQ ID NO: 17: Ubi2-scTN F SEQ ID NO: 18: Ubi2-TNF SEQ ID NO: 19: Affilin-IFN SEQ ID NO: 20: SUMO-Affilin SEQ ID NO: 21: PCR primer SEQ ID NO: 22: PCR primer SEQ ID NO: 23: ubiquitin mutein (G75A/G76A), a ubiquitin moiety used for increasing serum half-life SEQ ID NO: 24: PCR primer SEQ ID NO: 25: extra-domain B (ED-B) of fibronectin SEQ ID NO: 26 c/s-acting element SEQ ID NO: 27: human IFN-a 2a SEQ ID NO: 28: human IFN-a 2b SEQ ID NO: 29: human IFN-a 2c SEQ ID NO: 30: human IFN-a 6 SEQ ID NO: 31: human IFN-a 14 SEQ ID NO: 32: human IFN-a 4 SEQ ID NO: 33: human IFN-a 5 SEQ ID NO: 34: human TNF alpha SEQ ID NO: 35: murine TNF alpha SEQ ID NO: 36: rat TNF alpha SEQ ID NO: 37: scTN F, murine SEQ ID NO: 38: PCR primer SEQ ID NO: 39: PCR primer SEQ ID NO: 40: PCR primer . 46
SEQ ID NO: 41: PCR primer SEQ ID NO: 42: PCR primer SEQ ID NO: 43: human IFN-β SEQ ID NO: 44: PCR primer SEQ ID NO: 45: PCR primer SEQ ID NO: 46 PCR primer SEQ ID NO: 47: human IL-2 SEQ ID NO: 48: murine IL-2 A complex comprising
(a) at least two ubiquitin moieties; and
(b) at least one pharmaceutically active moiety, wherein said complex exhibits an increased serum half-life as compared t o the at least one pharmaceutically active moiety alone without said at least two ubiquitin moieties.
The complex according to claim 1, wherein said complex has a molecular weight of at least 20 kDa.
The complex according to claim 1 or 2, comprising between 2 and 10 ubiquitin moieties.
The complex according to any one of claims 1 to 3, wherein each one of the at least two ubiquitin moieties consists, independently from any other ubiquitin moiety, of:
- an amino acid sequence according t o SEQ ID NO: 1;
- an amino acid sequence according to SEQ ID NO: 2;
- an amino acid sequence according t o SEQ ID NO: 23;
- an amino acid sequence exhibiting at least 95% sequence identity t o SEQ ID NO:
1;
- an amino acid sequence exhibiting at least 95% sequence identity t o SEQ ID NO:
2; or
- an amino acid sequence exhibiting at least 95% sequence identity t o SEQ ID NO:
23.
The complex according to any one of claims 1 t o 4, wherein the at least two ubiquitin
moieties are connected to each other via a direct covalent bond or via a linker. 6. The complex according t o any one of claims 1 t o 5, wherein the at least two ubiquitin
moieties are directly connected t o the pharmaceutically active moiety via a covalent
bond or connected t o the pharmaceutically active moiety via a linker.
7. The complex according t o any one of claims 1 t o 6, wherein said complex further
comprises polyethylene glycol (PEG).
8 . The complex according t o any one of claims 1 t o 7, wherein the pharmaceutically
active moiety is a therapeutic or diagnostic moiety.
9. The complex according t o any one of claims 1 t o 8, wherein the pharmaceutically
active moiety is a protein.
10. The complex according t o claim 9, wherein the at least two ubiquitin moieties are
connected t o the N-terminus of the pharmaceutically active moiety.
11. The complex according t o claim 9, wherein the at least two ubiquitin moieties are
connected t o the C-terminus of the pharmaceutically active moiety.
12. The complex according to claim 9,
wherein at least one ubiquitin moiety of the at least two ubiquitin moieties is
connected t o the N-terminus of the pharmaceutically active moiety, and
wherein at least one ubiquitin moiety of the at least two ubiquitin moieties is
connected t o the C-terminus of the pharmaceutically active moiety.
13. The complex according to any one of claims 9 t o 12, wherein said protein comprises
at least one functional domain of at least one protein selected from the group
consisting of an antibody mimetic, a cytokine, a antibody fragment, a receptor
fragment, and a peptide hormone.
14. The complex according t o claim 13, wherein the antibody mimetic is selected from
the group consisting of Affilin" molecules, Anticalin* molecules, DARPin® molecules, Affibody molecules, Fynomers, Nanobodies , Maxybodies, Adnectins, Avimers
(avidity multimers), or Nanofitins ®.
15. The complex according t o claim 14, wherein the Affilin* molecule is a modified
dimeric ubiquitin protein that is capable of binding t o a target molecule with a
≤ 7 specific binding affinity t o the target molecule of KD 10 M.
16. The complex according t o claim 15, wherein the modified ubiquitin protein is a
hetero-dimeric ubiquitin comprising two monomeric ubiquitin units linked together
in a head-to-tail arrangement, wherein each monomeric ubiquitin unit in said
modified hetero-dimeric ubiquitin protein is modified independently from the
modifications in the other monomeric ubiquitin unit.
17. The complex according t o claim 16, wherein each modified monomeric ubiquitin unit
has an amino acid sequence identity of at least 80% t o the amino acid sequence
defined by SEQ ID NO: 1 or t o the amino acid sequence defined by SEQ ID NO: 2 or t o
the amino acid sequence defined by SEQ ID NO: 23.
18. The complex according t o any one of claims 15 t o 17, wherein the target molecule is
a tumor target molecule.
19. The complex according t o any one of claims 16 t o 18, wherein the modified hetero-
dimeric ubiquitin protein comprises an amino acid sequence selected from the group
consisting of SEQ ID NO: 3 and an amino acid sequence that exhibits at least 90%
sequence identity t o the amino acid sequence according t o SEQ ID NO: 3.
20. The complex of claim 13, wherein the cytokine is selected from the group consisting
of IFN, interleukin 2, TNFalpha, and scTN Falpha.
21. The complex of any one of claims 1 t o 20 for use in medicine, preferably for use in
the treatment of cancer. 22. A pharmaceutical composition comprising a complex as defined in any one of claims
1 to 20; and further comprising a pharmaceutically acceptable carrier.
23. A use of at least two ubiquitin moieties for extending the serum half-life of a
pharmaceutically active moiety.
24. A method for extending the serum half-life of a pharmaceutically active moiety,
comprising the steps:
(a) fusing a nucleic acid encoding at least two ubiquitin moieties to a nucleic acid
encoding a pharmaceutically active moiety, thereby obtaining a fused nucleic
acid;
(b) introducing said fused nucleic acid into an expression vector;
(c) introducing said expression vector into a host cell;
(d) cultivating the host cell;
(e) subjecting the host cell to culturing conditions under which a fusion protein is
expressed from said vector, thereby producing a fusion protein com prising at
least two ubiquitin moieties and a pharmaceutically active moiety, wherein
said fusion protein has an extended serum half-life as compared t o the
pharmaceutically active moiety without ubiquitin moieties;
(f) optionally isolating the fusion protein produced in step (e).
25. A nucleic acid comprising a sequence encoding the complex of any one of claims 1 to
20.
26. A vector comprising the nucleic acid of claim 25.
27. A cell comprising the vector of claim 26.
INTERNATIONAL SEARCH REPORT PCT/EP2 0 1 2 / 0 0 5 2 8 1
Box No. I Nucleotide and/or amino acid sequence(s) (Continuation of item 1.c of the first sheet)
1. With regard to any nucleotide and/or amino acid sequence disclosed in the international application and necessary to the claimed invention, the international search was carried out on the basis of:
(means)
Ξ on paper
Ξ in electronii
(time)
Ξ in the international application as filed
Ξ together with the international application in electronic form □ subsequently to this Authority for the purpose of search
In addition, in the case that more than one version or copy of a sequence listing and/or table relating thereto has been filed □ or furnished, the required statements that the information in the subsequent or additional copies is identical to that in the application as filed or does not go beyond the application as filed, as appropriate, were furnished.
3 . Additional comments:
Form PCT/ISA/21 0 (continuation of first sheet (1)) (July 2009) A . CLASSIFICATION O F SUBJECT MATTER INV. C07K16/18 A61K47/48 C07K14/525 C07K14/555 C07K14/47 ADD.
According to International Patent Classification (IPC) o r to both national classification and IPC
B . FIELDS SEARCHED Minimum documentation searched (classification system followed by classification symbols) C07K A61K
Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched
Electronic data base consulted during the international search (name of data base and, where practicable, search terms used)
EPO-Internal , BIOSIS, EMBASE, WPI Data
C . DOCUMENTS CONSIDERED TO B E RELEVANT
Category* Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No.
WO 2011/073208 Al (SCI L PROTEINS GMBH 1-23 , [DE] ; STEUERNAGEL ARND [DE] ; FI EDLER ERI K 25-27 [DE] ; FI E) 23 June 2011 (2011-06-23) c i ted i n the appl i cati on c l aims 1-15 ; exampl es 1, 2 ,5-7 24
W0 2011/055897 A2 (SAMSUNG ELECTRONICS CO 24 LTD [KR] ; LEE JAE-I L [KR] ; LEE YOUNG-SUN [KR] ; ) 12 May 2011 (2011-05-12) paragraph [0024] ; c l aims 1-10; exampl e 2
W0 2008/153745 A2 (AMGEN INC [US] ; WALKER 24 KENNETH W [US] ; GEGG COLIN V J R [US] ) 18 December 2008 (2008-12-18) c l aims 1-10 -/-
X | Further documents are listed in the continuation of Box C . See patent family annex.
* Special categories of cited documents : "T" later document published after the international filing date o r priority date and not in conflict with the application but cited to understand "A" document defining the general state of the art which is not considered the principle o r theory underlying the invention to be of particular relevance "E" earlier application o r patent but published o n o r after the international "X" document of particular relevance; the claimed invention cannot be filing date considered novel o r cannot b e considered to involve a n inventive "L" documentwhich may throw doubts o n priority claim(s) orwhich is step when the document is taken alone cited to establish the publication date of another citation o r other "Y" document of particular relevance; the claimed invention cannot be special reason (as specified) considered to involve a n inventive step when the document is "O" document referring to a n oral disclosure, use, exhibition o r other combined with one o r more other such documents, such combination means being obvious to a person skilled in the art "P" document published prior to the international filing date but later than the priority date claimed "&" document member of the same patent family
Date of the actual completion of the international search Date of mailing of the international search report
30 August 2013 05/09/2013
Name and mailing address of the ISA/ Authorized officer European Patent Office, P.B. 5818 Patentlaan 2 NL - 2280 HV Rijswijk Tel. (+31-70) 340-2040, Fax: (+31-70) 340-3016 Si aterl i , Mari a C(Continuation). DOCUMENTS CONSIDERED TO BE RELEVANT
Category* Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No.
WO 2012/171541 Al (SCI L PROTEINS GMBH 1-23 , [DE] ; NERKAMP JOERG [DE] ; HAENSSGEN I LKA 25-27 [DE] ; LANG) 20 December 2012 (2012-12-20) c l aims 1-26
W0 2012/172058 Al (SCI L PROTEINS GMBH 1-27 [DE] ; NERKAMP JOERG [DE] ; HAENSGEN I LKA [DE] ; LANGE) 20 December 2012 (2012-12-20) c l aims 1-30; exampl e s 1-5 ; tabl e 4
W0 2012/172054 Al (SCI L PROTEINS GMBH 1-23 , [DE] ; B0SSE-D0ENECKE EVA [DE] ; NERKAMP 25-27 JOERG [DE] ; ) 20 December 2012 (2012-12-20) the whol e document c l aim 15 Patent document Publication Patent family Publication cited in search report date member(s) date
WO 2011073208 Al 23-06-2011 AU 2010332932 Al 10-05 2012 AU 2010332938 Al 10-05 2012 CA 2778871 Al 23-06 2011 CA 2778872 Al 23-06 2011 CA 2782093 Al 23- 06 2011 102753568 A 24- 10 2012 102753569 A 24-10 2012 EP 2367843 Al 28- 09 2011 EP 2379581 A2 26-10 2011 EP 2513138 Al 24-10 2012 J P 2012523227 A 04-10 2012 J P 2013513375 A 22-04 2013 J P 2013513376 A 22- 04 2013 KR 20110111304 A 10-10 2011 KR 20120110171 A 09- 10 2012 US 2012301393 Al 29- 11 2012 US 2013011334 Al 10- 0 1 2013 US 2013157878 Al 20-06 2013 W0 2011073208 Al 23- 06 2011 W0 2011073209 Al 23-06 2011 W0 2011073214 A2 23-06 2011
W0 2011055897 A2 12-05-2011 EP 2496608 A2 12-09-2012 KR 20110048777 A 12-05-2011 US 2012283408 Al 08-11-2012 W0 2011055897 A2 12-05-2011
W0 2008153745 A2 18-12-2008 AU 2008262490 Al 18 -12 -2008 CA 2687141 Al 18 -12 -2008 EP 2162540 A2 17 -03 -2010 P 2010527607 A 19 -08 -2010 US 2009118181 Al 07 -05 -2009 US 2013209466 Al 15 -08 -2013 US 2013217625 Al 22 -08 -2013 WO 2008153745 A2 18 -12 -2008
WO 2012171541 Al 20- 12 -2012 WO 2012171541 Al 20- 12 -2012 WO 2012172058 Al 20- 12 -2012
WO 2012172058 Al 20- 12 -2012 WO 2012171541 Al 20- 12 -2012 WO 2012172058 Al 20- 12 -2012
WO 2012172054 Al 20- 12 -2012 NONE