Genome

FISH analysis of Zanthoxylum armatum based on oligonucleotides for 5S rDNA and (GAA)6

Journal: Genome

Manuscript ID gen-2018-0009.R3

Manuscript Type: Article

Date Submitted by the Author: 09-Jun-2018

Complete List of Authors: Luo, Xiaomei; Sichuan Agricultural University - Chengdu Campus Liu, Juncheng; Sichuan Agricultural University, Wang, Jingyan; Sichuan Agricultural University Gong, Wei;Draft Sichuan Agricultural University, Chen, Liang; Sichuan Agricultural University, Wan, Wenlin; Sichuan Agricultural University,

Keyword: rDNA, GAA, Zanthoxylum species, trinucleotide

Is the invited manuscript for consideration in a Special N/A Issue? :

https://mc06.manuscriptcentral.com/genome-pubs Page 1 of 10 Genome

1 / 8

1 FISH analysis of Zanthoxylum armatum based on oligonucleotides for 5S rDNA and (GAA)6 2 3 Xiaomei Luo, Juncheng Liu, Jingyan Wang, Wei Gong*, Liang Chen, Wenlin Wan 4 5 College of Forestry, Sichuan Agricultural University, Huimin Road 211, Wenjiang District 611130, 6 Chengdu City, China 7 * Corresponding author: Phone: 86-028-86291456; E-mail: [email protected] 8

Draft

https://mc06.manuscriptcentral.com/genome-pubs Genome Page 2 of 10

2 / 8

9 Abstract Fluorescence in situ hybridization (FISH) using oligonucleotide probes for (GAA)6 (18 bp)

10 and ribosomal DNA (rDNA) (5S rDNA, 41 bp) was applied to analyse Zanthoxylum armatum. (GAA)6 11 loci were detected on the pericentromeric regions of five chromosome pairs, and 5S rDNA loci were 12 also detected on the pericentromeric regions of another two chromosome pairs. The densities and

13 locations of (GAA)6 and 5S rDNA signals varied between individual chromosomes. High-intensity

14 (GAA)6 signals were detected at the centromeres of two large and two smaller metacentric

15 chromosomes. Relatively strong (GAA)6 signals were detected at the centromeres of two relatively 16 small metacentric chromosomes, although strong 5S rDNA signals were detected at the centromeres of

17 two additional smaller metacentric chromosomes. Weak (GAA)6 signals were detected at the 18 centromeres of four large metacentric chromosomes, whereas weak 5S rDNA signals were detected at 19 the centromeres of two smaller metacentric chromosomes. The remaining chromosomes exhibited no 20 signals. Z. armatum had 2n = ~128. The lengths of the mitotic metaphase chromosomes ranged from 21 1.22 µm to 2.34 µm. Our results provide information that may be beneficial for future cytogenetic 22 studies and could contribute to the physical assembly of the Zanthoxylum genome. 23 Keywords rDNA; GAA; trinucleotide; Zanthoxylum species 24

Draft

https://mc06.manuscriptcentral.com/genome-pubs Page 3 of 10 Genome

3 / 8

25 Introduction 26 The genus Zanthoxylum (Rutaceae) comprises two hundred or more species that are pantropical and 27 extend to temperate latitudes in East Asia and eastern North America; 41 species (25 endemic) are 28 found in China. Zanthoxylum armatum Candolle is found in many habitats, all of which are below 3100 29 m. The chromosome counts of the Zanthoxylum genus are 2n = 32, 64, 68, 70, 72, and 136 in the 30 Chinese version of Flora of China (Huang 1997). In the English revision of Flora of China, Zhang and 31 Hartley (2008) reported chromosome counts for seven Zanthoxylum species: Z. acanthopodium 32 Candelle (2n = 64), Z. armatum Candelle (2n = 66), Z. dimorphophyllum Hemsley (2n = 36 and 68), Z. 33 scandens Blume (2n = 68), Z. oxyphyllum Edgeworth (2n = 72), Z. tomentellum JD Hance (2n = 72), 34 and Z. simulans Hance (2n = ~132). Another two Zanthoxylum species, Z. nitidum (Roxburgh) 35 Candolle and Z. bungeanum Maximowicz, had chromosome counts of 2n = 68 (Yu et al. 2010) and 2n 36 = 136 (Chen et al. 2009), respectively. The chromosome counts in certain species of Zanthoxylum vary 37 widely and remain in dispute. 38 For the shrub Z. armatum, karyotype analysis has been difficult because germinating seeds is 39 challenging and the presence of abundant oil renders metaphase chromosomes unobtainable. In 40 addition, metaphase chromosomes are smaller in this species than in other plant species. However, by 41 using fluorescence in situ hybridization (FISH) with probes targeting 5S rDNA (120 bp), Wang et al. 42 (2015) elucidated the ribosomal DNA (rDNA) distribution pattern of Rubus, and via FISH with 43 oligonucleotide probes for 5S rDNA (41 bp), Luo et al. (2017) analysed the karyotype of Piptanthus 44 concolor; this approach may be applicableDraft to shrubs. FISH analyses in which 5S rDNAs are used as 45 molecular markers to identify chromosomes have been performed on many woody plants, including 46 Hippophae rhamnoides (Puterova et al. 2017), Gossypium species (Gan et al. 2013) and Pinus species 47 (Cai et al. 2006). 48 Satellite sequences are primarily GAA repeats organized in long tracts of heterochromatic DNA. 49 Probing GAA repeats using in situ hybridization is a useful diagnostic tool in cytogenetics and for 50 understanding genome organization. GAA satellite sequences have been investigated in detail and have 51 been used for in situ hybridization in barley and rye as well as Triticum and Aegilops species (Gerlach 52 et al. 1978, 1983; Appels et al. 1978, 1982; Dennis et al. 1980; Peacock et al. 1981). The

53 oligonucleotide sequence (GAA)7 has been used for genome and chromosome identification via in situ 54 hybridization in cultivated barley and related species of the Triticeae (Poaceae) (Pedersen et al. 1996).

55 The sequence (GAA)5 has been used for in situ hybridization to identify different chromatin classes in

56 wheat (Cuadrado et al. 2000, 2008). The sequence (GAA)9 has recently been used for the 57 complementary identification of all A-genome chromosomes in diploid and polyploid wheat (Badaeva 58 et al. 2015, 2016). 59 However, FISH has rarely been used to assess Zanthoxylum species. Therefore, in this work, we 60 used FISH to perform a more accurate karyotype analysis of Z. armatum. 61 Materials and methods 62 Plant materials and chromosome preparation 63 Seedlings of the cultivar Z. armatum ‘Hanyuan Putao Qingjiao’ (Wang et al. 2016) collected from 64 Hanyuan County, Sichuan Province, China, were cultivated at room temperature under natural light 65 conditions. When the root tips reached a length of 1.5-2.0 cm, they were excised, fully immersed in 66 nitrous oxide for 4 h and then stored in 75% ethanol (Kato et al. 2004). The root tip meristems, which 67 were approximately 1 mm in length, were cut and treated with cellulose and pectinase (2:1), after 68 which they were transferred in a suspension to slides (Komuro et al. 2013). After the slides were

https://mc06.manuscriptcentral.com/genome-pubs Genome Page 4 of 10

4 / 8

69 air-dried, they were examined using an Olympus CX21 microscope (Olympus, Japan) and then stored 70 at -20°C for further use. 71 Probe DNA preparation

72 A trinucleotide repeat probe for (GAA)6, including the 18-bp fragment 5’ 73 GAAGAAGAAGAAGAAGAA 3’, was developed in accordance with the methods of Pedersen et al. 74 (1996) and localized to the pericentromeric, subtelomeric and interstitial regions of chromosomes in 75 Hordeum vulgare, Secale cereale, Triticum aestivum, Aegilops umbellulata and Aegilops speltoides. An 76 oligonucleotide probe for 5S rDNA, which contained the 41-bp fragment 5’ 77 TCAGAACTCCGAAGTTAAGCGTGCTTGGGCGAGAGTAGTAC 3’, was used for FISH analyses 78 and localized to the nucleolar organizing regions (NORs), subtelomeric regions and interstitial regions 79 of chromosomes in P. concolor, as described by Luo et al. (2017). The two probes were first tested in Z. 80 armatum and were synthesized by Sangon Biotech Co., Ltd. (Shanghai, China). The 5’ ends of the 81 synthetic oligonucleotides were labelled with 6-carboxytetramethylrhodamine (TAMRA) or 82 6-carboxyfluorescein (FAM). The synthesized probes were diluted using a 1× TE solution, maintained 83 at a concentration of 10 µM, and stored at -20°C. 84 FISH and karyotype analysis 85 In conjunction with multiple probes, FISH was performed as described by Hao et al. (2013). The 86 chromosome preparations were fixed with 4% (w/v) paraformaldehyde, washed with 2× saline sodium 87 citrate (SSC), and dehydrated using an ethanol series before being air-dried. Deionized formamide (FA; 88 60 µL) was added to the chromosome preparations,Draft which were then denatured for 2 min at 80°C and 89 subsequently placed in an ethanol series at -20°C before air drying. A hybridization mixture (10 µL) 90 containing 0.35 µL oligonucleotides, 4.825 µL 2× SSC and 4.825 µL 1× TE was applied to each 91 chromosome preparation. The preparations were covered with glass coverslips, and the chromosomes 92 and probes were hybridized at 37°C in a humidity chamber for 1-2 h. The preparations were rinsed

93 twice for 5 min with 2× SSC at room temperature and again with ddH2O. The air-dried chromosome 94 preparations were counterstained with 4,6-diamidino-2-phenylindole (DAPI, Vector Laboratories, Inc., 95 Burlingame, USA). The slides were examined using an Olympus BX-63 microscope coupled to a 96 Photometric SenSys Olympus DP70 CCD camera (Olympus, Japan). The raw images were processed 97 with Photoshop version 7.1 (Adobe Systems Incorporated, San Jose, CA, USA) using only functions 98 affecting the entire image equally. 99 Approximately 30 metaphases from 6 slides of 6 Z. armatum root tips were observed in this study. 100 Greater than 10 metaphases in which the chromosomes were well separated were selected to count 101 chromosome number. Three better spreads were used for karyotype analysis. The length of each 102 chromosome was calculated by Photoshop version 7.1, and each spread was measured 3 times to 103 provide consistent karyotype data. Chromosomes were arranged by length from the longest to the 104 shortest chromosome. 105 Results and discussion

106 FISH with 5S rDNA and (GAA)6 probes 107 Images of one mitotic metaphase plate of Z. armatum visualized after FISH are shown in Figure 1. The 108 other two additional metaphase plates (S-Figure 1) produced consistent results with respect to 109 chromosome counts and both signal numbers and locations. Karyotypes of the chromosomes from 110 Figure 1c and S-Figure 1c and 1f are shown in Figure 2 and S-Figure 2. Ten chromosomes were

111 labelled by (GAA)6 in Figure 1a and Figure 1c (red, TAMRA) in the pericentromeric region, including 112 four very strong signals, two relatively strong signals and four minor signals. Four chromosomes

https://mc06.manuscriptcentral.com/genome-pubs Page 5 of 10 Genome

5 / 8

113 exhibited 5S rDNA signals in Figure 1b and Figure 1c (green, FAM) in the pericentromeric region, 114 including two relatively strong signals and two weak signals. 115 Figure 2 shows a single chromosome from Z. armatum; the chromosome image was captured from 116 Figure 1c. The single chromosomes in S-Figure 2a and 2b were cut out from S-Figure 1c and 1f, 117 respectively. Each chromosome was arranged according to length. The densities and locations of

118 (GAA)6 and 5S rDNA signals varied among individual chromosomes. High-intensity (GAA)6 signals 119 were detected at the centromeres of two large and two smaller metacentric chromosomes. Strong

120 (GAA)6 signals were detected at the centromeres of two fairly small metacentric chromosomes, 121 whereas strong 5S rDNA signals were detected at the centromeres of two additional smaller

122 metacentric chromosomes. Weak (GAA)6 signals were detected at the centromeres of four large 123 metacentric chromosomes, and weak 5S rDNA signals were detected at the centromeres of two smaller

124 metacentric chromosomes. The remaining chromosomes displayed no (GAA)6 or 5S rDNA signals.

125 No prior study has reported the FISH analysis of a Zanthoxylum species, but the (GAA)n signal 126 patterns distributed across several chromosomes have been observed at the NORs, pericentromeric 127 regions, subtelomeric regions, and interstitial regions of chromosomes in diploid and polyploid wheat 128 (Badaeva et al. 2015, 2016; Cuadrado et al. 2000, 2008). A signal pattern for 5S rDNA distributed 129 across every single chromosome has been observed at the NORs, subtelomeric regions, pericentromeric 130 regions and interstitial regions of chromosomes in Iris boissieri (Martinez et al. 2010) and at the NORs,

131 subtelomeric regions and interstitial regions of chromosomes in P. concolor (Luo et al. 2017). In this 132 study, 5S rDNA and (GAA)6 signals wereDraft detected only on the pericentromeric region of Z. armatum 133 chromosomes, which differs slightly from the results of previous studies. 134 Karyotype analysis 135 The lengths of the mitotic metaphase chromosomes in Figure 2 and S-Figure 2 ranged from 2.34 µm 136 for chromosome 1 (the longest chromosome) to 1.22 µm for chromosome 128 (the shortest 137 chromosome). Metaphase chromosome lengths in Fragaria vesca were 1.48-2.08 µm (Rho et al. 2012); 138 in Fragaria nilgerrensis, they were 1.23-2.11 µm (Rho et al. 2012); in P. concolor, they were 4.03-7.21 139 µm (Luo et al. 2017); in Rubus species, they were ~1-4 µm (Wang et al. 2015); in T. aestivum ‘Chinese 140 Spring’, they were ~9-13 µm (Cuadrado et al. 2008); and in Avena sativa, they were ~5-13 µm (Luo et 141 al. 2014). The metaphase chromosome lengths of Z. armatum are similar to those of Fragaria and 142 Rubus species but are shorter than those of T. aestivum and A. sativa. 143 In disagreement with previous chromosome counts for Zanthoxylum species, ~128 chromosomes 144 were observed in Z. armatum. There are more than two hundred Zanthoxylum species worldwide; 145 however, only nine Zanthoxylum species have clear chromosome counts (Zhang and Hartley 2008, 146 Chen et al. 2009, Yu et al. 2010), including Z. armatum with 2n = 66 (Zhang and Hartley 2008). This 147 difference is most likely caused by the small chromosome size and large number of chromosomes. 148 Huang (1997) described six types of chromosome counts (2n = 32, 64, 68, 70, 72, and 136) in the 149 Chinese version of the Flora of China. Because chromosome counts are difficult to determine, the 150 ploidy level of Zanthoxylum species is also difficult to determine. It is possible that Z. armatum in this 151 study is polyploid. In a previous study, Z. armatum chromosome counts were 2n = 66, whereas in the 152 present study, the counts were 2n = ~128, which is nearly twice this number. A similar phenomenon 153 was reported in which Zanthoxylum species exhibited chromosome counts of 2n = 32, 36, 64, 66, 68, 154 70, 72, 132, and 136 (Huang 1997, Zhang and Hartley 2008, Chen et al. 2009, Yu et al. 2010). However, 155 polyploidy seems difficult to accept in Zanthoxylum species as they are parthenogenetic in nature 156 (Huang 1997), seemingly rendering natural polyploidization impossible. Another reason is that

https://mc06.manuscriptcentral.com/genome-pubs Genome Page 6 of 10

6 / 8

157 Zanthoxylum cultivars are commonly bred by vegetative propagation based methods (such as grafting). 158 Hence, Z. armatum is treated as a diploid species in this study. 159 The chromosome number of Zanthoxylum species varies widely. In this study, the karyotype and 160 cytotype were limited by the unclear location of the majority of chromosome centromeres. We are 161 devoting ongoing research efforts to exploring additional FISH probes to label Zanthoxylum species 162 and help analyse the karyotype of these species. 163 Acknowledgements 164 This study was funded by the Natural Science Foundation of China (31500993) andthe Crops Breeding 165 Project of Sichuan Province, China (Nos. 2006YZGG-10, 2011NZ0098-10, and 2016NYZ0035). 166 Compliance with Ethical Standards 167 Conflict of Interest The authors declare that they have no conflicts of interest. 168 References 169 Appels R., Driscoll C., and Peacock W.J. 1978. Heterochromatin and highly repeated DNA sequences 170 in rye (Secale cereale). Chromosoma, 70: 67-89. doi: 10.1007/bf00292217 171 Appels R., Gustafson J.P., and May C.E. 1982. Structural variation in the heterochromatin of rye 172 chromosomes in triticales. Theoretical and Applied Genetics, 63: 235-244. doi: 173 10.1007/BF00304002 174 Badaeva E.D., Amosova A.V., Goncharov N.P., Macas J., Ruban A.S., and Grechishnikova I.V., et al., 175 2015. A set of cytogenetic markers allows the precise identification of all A-genome chromosomes 176 in diploid and polyploid wheat. CytogeneticDraft and Genome Research, 146: 71-79.doi: 177 10.1159/000433458 178 Badaeva E.D., Ruban A.S., Zoshchuk S.A., Surzhikov S.A., Knüpffer H., and Kilian B. 2016. 179 Molecular cytogenetic characterization of Triticum timopheevii chromosomes provides new 180 insight on genome evolution of T. zhukovskyi. Plant Systematics and Evolution, 302: 943-956. doi: 181 10.1007/s00606-016-1309-3 182 Cai Q., Zhang Z., Liu Z.L., and Wang X.R. 2006. Chromosomal localization of 5S and 18S rDNA in 183 five species of subgenus Strobus and their implications for genome evolution of Pinus. Annals of 184 Botany, 97: 8. doi: 0.1093/aob/mcl030 185 Chen R.Y., Chen C.B., Song W.Q., Liang G.L., Li X.L., and Chen L., et al. 2009. Chromosome atlas of 186 major economic plants genome in China (Tomus V). In chromosome atlas of medicinal plants in 187 China. Edited by Li S.W. and Wang J. Science Press, Beijing, China, pp. 636. ISBN: 188 978-7-03-022915-1 189 Cuadrado A., Cardoso M., and Jouve N. 2008. Increasing the physical markers of wheat chromosomes 190 using SSRs as FISH probes. Genome, 51: 809-815.doi: 10.1139/G08-065 191 Cuadrado A., Schwarzacher T., and Jouve N. 2000. Identification of different chromatin classes in 192 wheat using in situ hybridization with simple sequence repeat oligonucleotides. Theoretical and 193 Applied Genetics, 101: 711-717. doi: 10.1007/s001220051535 194 Dennis E.S., Gerlach W.L., and Peacock W.J. 1980. Identical polypyrimidine-polypurine satellite 195 DNAs in wheat and barley. Heredity, 44: 349-366.doi: 10.1038/hdy.1980.33 196 Gan Y., Liu F., Chen D., Wu Q., Qin Q., and Wang C., et al. 2013. Chromosomal locations of 5S and 197 45S rDNA in Gossypium genus and its phylogenetic implications revealed by FISH. PloS one, 8: 198 e68207. doi: 10.1371/journal.pone.0068207

https://mc06.manuscriptcentral.com/genome-pubs Page 7 of 10 Genome

7 / 8

199 Gerlach W.L., Appels R., Dennis E.S., and Peacock W.J. 1978. Evolution and analysis of wheat 200 genomes using highly repeated DNA sequences. Wheat Genetic Symposium, pp. 81-91. 201 https://eurekamag.com/research/000/656/000656064.php 202 Gerlach W.L., Dennis E.S., and Peacock W.J. 1983. Molecular cytogenetics of wheat. MacMillan India 203 Limited Company, New Delhi, pp. 191-212. 204 Huang C.C. 1997. Angiospermae Dicotyledoneae Rutoideae. In Flora reipublicae popularis sinicae. 205 Edited by Flora of China Editorial Committee. Science Press, Beingjing, China, pp. 8-13. 206 http://frps.eflora.cn/frps/Zanthoxylum 207 Kato A., Lamb J.C., and Birchler J.A. 2004. Chromosome painting using repetitive DNA sequences as 208 probes for somatic chromosome identification in maize. Proceedings of the National Academy of 209 Sciences of the United States of America, 101: 13554-13559. doi: 10.1073/pnas.0403659101 210 Komuro S., Endo R., Shikata K., and Kato A. 2013. Genomic and chromosomal distribution patterns of 211 various repeated DNA sequences in wheat revealed by a fluorescence in situ hybridization 212 procedure. Genome, 56: 131-137. doi: 10.1139/gen-2013-0003 213 Luo X., Liu J., Zhao A., Chen X., Wan W., and Chen L. 2017. Karyotype analysis of Piptanthus 214 concolor based on FISH with an oligonucleotides for rDNA 5S. Scientia Horticulturae, 226: 215 361-365. doi: 10.1016/j.scienta.2017.09.003 216 Luo X., Zhang H., Kang H., Fan X., Wang Y., and Sha L., et al. 2014. Exploring the origin of the D 217 genome of oat by fluorescence in situ hybridization. Genome, 57: 469-472. doi: 218 10.1139/gen-2014-0048 Draft 219 Peacock W.J., Gerlach W.L., and Dennis E.S. 1981. Molecular aspects of wheat evolution: repeated 220 DNA sequences. Wheat Science Today , & Tomorrow. Cambridge University Press, Cambridge. 221 Pedersen C., Rasmussen S.K., and Linde-Laursen I. 1996 Genome and chromosome identification in 222 cultivated barley and related species of the Triticeae (Poaceae) by in situ hybridization with the 223 GAA-satellite sequence. Genome, 39: 93-104. doi: 10.1139/g96-013 224 Puterova J., Razumova O., Martinek T., Alexandrov O., Divashuk M., and Kubat, et al. 2017. Satellite 225 DNA and transposable elements in seabuckthorn (Hippophae rhamnoides), a dioecious plant with 226 small Y and large X chromosomes. Genome Biology and Evolution, 9: 197-212. doi: 227 10.1093/gbe/evw303 228 Rho R.I., Hwang Y.J., Lee H.I., Lee C.H., and Lim K.B. 2012. Karyotype analysis using FISH 229 (fluorescence in situ hybridization) in Fragaria. Scientia Horticulturae, 136: 95-100. doi: 230 10.1016/j.scienta.2011.12.025 231 Wang J.Y., Gong W., Xiao Q.W., Hu W., Wang Y., and Lu C.Y., et al. 2016. A new cold tolerance green 232 Chinese prickly ash cultivar ‘Hanyuan Putao Qiangjiao’. Acta Horticulturae Sinica, 43 (7): 233 1425-1426. doi: 10.16420/j.issn.0513-353x.2014-0013 234 Wang Y., Wang X., Chen Q., Zhang L., Tang H., and Luo Y., et al. 2015. Phylogenetic insight into 235 subgenera Idaeobatus and Malachobatus (Rubus, Rosaceae) inferring from ISH analysis. 236 Molecular Cytogenetics, 8: 11-13.doi: 10.1186/s13039-015-0114-y 237 Yu L.Y., Tan X.M., and Zhou Y.Q. 2010. Karyotype analysis of Z. nitidum. Lishizhen Medicine and 238 Material Medical Research, 21: 3284-3285. doi: 10.3969/j.issn.1008-0805.2010.12.121 239 Zhang D.X., and Hartley G.T. 2008. Zanthoxylum Linnaeus. In Flora of China. Edited by Flora of 240 China Editorial Committee. Science Press and Missouri Botanical Garden Press, pp. 53-66. 241 http://foc.eflora.cn/content.aspx?TaxonId=135262 242

https://mc06.manuscriptcentral.com/genome-pubs Genome Page 8 of 10

8 / 8

243 Legends 244 Figure 1. Metaphase plates from Zanthoxylum armatum visualized after FISH. The chromosomes were

245 probed with 5’-TAMRA-labelled (GAA)6 (red) in Figure 1a and 1c; the chromosomes were probed 246 with 5’-FAM-labelled 5S rDNA (green) in Figure 1 b and 1c. The concentration of probes used for

247 (GAA)6 and 5S rDNA was 10 µM. All of the chromosomes were counterstained with DAPI (blue). 248 White arrows show chromosomes displaying signals. Scale bar = 5 µm.

249 Figure 2. Karyotype of Zanthoxylum armatum revealed by FISH analysis and probed by (GAA)6 and 250 5S rDNA oligonucleotides. Chromosomes in Figure 2 were captured using Photoshop version 7.1 from 251 Figure 1c. The chromosome nomenclature was determined by length, i.e., from the longest 252 chromosome (#1) to the shortest chromosome (#128). Scale bars are located at the beginning and end 253 of each line and change as the chromosome length changes (first line, 2.5-2.0 µm; second line, 2.0-2.0 254 µm; third line, 2.0-1.5 µm; fourth line, 1.5-1.5 µm). 255 Supplementary Figure 1. Metaphase plates from Zanthoxylum armatum visualized after FISH. The

256 chromosomes were probed with 5’-TAMRA-labelled (GAA)6 (red) in Supplementary Figure (S-Figure) 257 1a, 1c, 1d and 1f; the chromosomes were probed with 5’-FAM-labelled 5S rDNA (green) in S-Figure 1

258 b, 1c, 1e and 1f. The concentration of the probes used for (GAA)6 and for 5S rDNA was 10 µM. All of 259 the chromosomes were counterstained with DAPI (blue). White arrows show chromosomes displaying 260 signals. Scale bar = 5 µm. 261 Supplementary Figure 2. Karyotype of Zanthoxylum armatum revealed by FISH analysis and probed 262 with (GAA)6 and 5S rDNA oligonucleotides.Draft Chromosomes in S-Figure 2a and 2b were captured using 263 Photoshop version 7.1 from S-Figure 1c and 1f. The chromosome nomenclature was determined by 264 length, i.e., from the longest chromosome (#1) to the shortest chromosome (#128). Scale bars are 265 located at the beginning and end of each line and change as the chromosome length changes (first line, 266 2.5-2.0 µm; second line, 2.0-2.0 µm; third line, 2.0-1.5 µm; fourth line, 1.5-1.5 µm). 267 268

https://mc06.manuscriptcentral.com/genome-pubs Page 9 of 10 Genome

Draft

https://mc06.manuscriptcentral.com/genome-pubs Genome Page 10 of 10

Draft

https://mc06.manuscriptcentral.com/genome-pubs