Detection and Quantification of Thermophilic Spore-Forming Moorella Thermoacetica in Canned Beverages Using Real-Time PCR

44 東洋食品研究所研究報告書，31（2016）東洋食品研究所研究報告書，31，45 − 49（2016） 45

1392

Research Note Detection and Quantification of Thermophilic Spore-Forming Moorella thermoacetica in Canned Beverages Using Real-Time PCR

MIYO NAKANO*

Division of Food Science, Toyo Institute of Food Technology, 23-2, 4-chome, Minami-hanayashiki, Kawanishi, Hyogo 666-0026, Japan

MS 14-547: Received 19 November 2014/Accepted 5 March 2015

ABSTRACT A quantitative real-time PCR assay was developed to specifically detect and quantify Moorella thermoacetica and/or Moorella thermoautotrophica from canned coffee beverages. Six different combinations of newly designed primers were examined, and primer pair v1-1F/v4R was found to specifically amplify M. thermoacetica and M. thermoautotrophica. The minimum detection sensitivity was 15 fg of pure culture DNA from M. thermoacetica. Twenty commercial canned coffee beverages were then screened for the presence of M. thermoacetica, and two were shown to contain >1.3 and >1.0 CFU/ml, respectively. Therefore, the assay developed in this study may be useful for accurately tracking and quantifying M. thermoacetica and M. thermoautotrophica in beverage samples.

One of the most heat-resistant bacterial species, Moor- assessment. High concentrations of emulsifiers also cause ella thermoacetica, whose spores can survive autoclaving, deterioration in qualities such as flavor. has a decimal reduction time of 23 to 111 min at 121°C, To explore the distribution of M. thermoacetica in depending on sporulation conditions (3). Thermophilic, canned beverages and their original ingredients and enable spore-forming bacteria, later characterized as M. thermoace- a microbial risk assessment during industrial processing, a tica, were detected in the 1970s in Japan in hot vending rapid and sensitive microbial detection technique is needed machines serving canned coffee with milk, soup, and “shir- to complement existing methods. Traditional culture-based uko” (sweet beverage made from azuki bean powder), all of methods require multiple culture steps to achieve isolation, which were maintained at 55 to 60°C (8, 10, 22). This spe- which makes them time consuming, and they are not always cies has also been associated with the spoilage of canned successful if bacteria that are present fail to grow. Real-time food in other countries (1, 14). These contaminants result PCR-based identification and quantification is a suitable in strong acidification, abnormal odors and colors, pH alternative because it is comparatively easy, rapid, and has decrease, and separation and coagulation of milk compo- a high level of sensitivity. To date, this technique has not nents (8, 23). To guarantee microbiological stability, an been developed for the detection of M. thermoacetica. In additional heat treatment step was added to commercial this study, we developed a real-time PCR assay for the iden- food sterilization processes by many manufacturers; how- tification and enumeration of the most frequently isolated ever, this is a costly operation in terms of energy and its thermophilic spoilage bacterium, M. thermoacetica. The impact on the organoleptic quality and nutritional value of assay was used to screen commercial canned coffee bev- the product (15). erages in parallel with traditional culture techniques to detect To avoid food spoilage caused by germination of con- and quantify M. thermoacetica. taminating bacterial spores, hydrophobic food emulsifiers, such as sucrose monopalmitate and sucrose monooleate, have been used commercially in the food and beverage MATERIALS AND METHODS industries, to remarkable effect (9, 11, 19). The ingredients PCR primer design. The 16S rRNA gene of M. thermoacetica of many canned drink products, including starch, carbohy- JCM 9319 was chosen as the target for amplification. An alignment drates, and skim milk, inhibit the bacteriostatic effects of of the 16S rRNA gene sequences from M. thermoacetica and other fatty acid ester-type emulsifiers (2). Consequently, large related species belonging to the family Thermoanaerobacteriaceae, amounts of emulsifiers are often used, accounting for such as Caldanaerobacter, Tepianaerobacter, and Thermoanaero- product variability, without a quantitative microbial risk monas species, along with nonrelated taxa, was performed using ClustalX (20). Overall, sequences from 170 bacterial species were obtained from the GenBank nucleotide database at the National Cen- * Author for correspondence. Tel: +81-72-740-3300; Fax: +81-72-758- ter for Biotechnology Information (http://www.ncbi.nlm.nih.gov/ 6934; E-mail: [email protected]. genbank/) and from the National Institute of Technology and

本論文は Journal of Food Protection, Vol. 78, No. 7, 2015, Pages 1392-1396 掲載論文を転載したものである 46 東洋食品研究所研究報告書，31（2016）

J. Food Prot., Vol. 78, No. 7 DETECTION AND QUANTIFICATION OF M. THERMOACETICA 1393

TABLE 1. Real-time PCR specificity test of designed primers using representative strains

Result of amplification with indicated primer combination (amplicon size [bp])b v1-1F/v3R v1-2F/v3R v1-1F/v4R v1-2F/v4R v3F-v4R v4F/v5R Species Strain and sourcea (161) (133) (436) (405) (296) (204)

a A designation in parentheses is the corresponding designation in an alternative collection. T, type strain; NBRC, NITE Biological Resource Center (Kisarazu, Chiba, Japan); ATCC, American Type Culture Collection (Manassas, VA); DSM, German Collection of Microorganisms and Cell Cultures (Braunschweig, Germany). b Forward primers are as follows: v1-1F, CAAGTCGAGCGGTCTTTAATTG; v1-2F, CTTCGGATGGAACCGATTAAAG; v3F, TACGGGAGGCATCTTCTGTAG; and v4F, CGAAGTCTTAAAGGCGAATAGC. Reverse primers are as follows: v3R, TACAGAA- GATGCCTCCCGTAGA; v4R, AGGCTATTCGCCTTTAAGACTTC; and v5R, AAGCCCGGCAGTTTCAAAT; +, positive real-time PCR result; −, negative real-time PCR result.

Evaluation Biological Resource Center (http://www.nbrc.nite.go.jp/e/). were incubated at 55 to 60°C in modified TGC medium (mTGC Based on the alignment, nine specific primers were selected, using medium; Nissui Pharmaceutical Co., Tokyo, Japan) with an Anae- Primer3Plus (http://www.bioinformatics.nl/cgi-bin/primer3plus/ roPack (Mitsubishi Gas Chemical Company, Tokyo, Japan) in a primer3plus.cgi (21)). Primer sequences are listed in footnote b container. Trypticase soy broth (BD, LePont de Claix, France) of Table 1. was used to grow other nonrelated bacterial species. Bacterial strains and culture conditions. A total of 26 Extraction of bacterial genomic DNA. For the real-time strains from 24 bacterial species, including three M. thermoacetica PCR assay, M. thermoacetica JCM 9319 was used to produce stan- strains and strains of other close and distant genera, listed in Table dard curves. M. thermoacetica was grown until the culture reached 1, were used for primer specificity studies. Strains were obtained an optical density at 600 nm (OD600) of 0.3 to 0.4 (approximately from various culture collections (Table 1) and maintained in the 1 108 CFU/ml). Genomic DNA was extracted using an Ultra laboratory according to the reference information. Moorella species cleanÂ DNA isolation kit (MO BIO Laboratories, Carlsbad, CA) 46 東洋食品研究所研究報告書，31（2016）東洋食品研究所研究報告書，31（2016） 47

J. Food Prot., Vol. 78, No. 7 DETECTION AND QUANTIFICATION OF M. THERMOACETICA 1393 1394 NAKANO J. Food Prot., Vol. 78, No. 7

TABLE 1. Real-time PCR specificity test of designed primers using representative strains

Result of amplification with indicated primer combination (amplicon size [bp])b v1-1F/v3R v1-2F/v3R v1-1F/v4R v1-2F/v4R v3F-v4R v4F/v5R Species Strain and sourcea (161) (133) (436) (405) (296) (204)

Moorella thermoacetica JCM 9319T ++++++ (ATCC 35608) Moorella thermoacetica JCM 9320T ++++++ (ATCC 39073) Moorella thermoacetica 24-1 (our collection) + + + + ++ Moorella glycerini DSM 11254T ++−−+ − Moorella humiferrea DSM 23265T − + −−+ − Moorella mulderi DSM 14980T ++− + −− Moorella stamsii DSM 26217T − + − − −− Moorella thermoautotrophica DSM 1974T ++++++ Moorella perchloratireducens ATCC BAA-1531 − + − − −− Ammonifex sp. NBRC 100904 −−−−−− Caldanaerobacter subterraneus NBRC 100824T − + − − −− subsp. tengcongensis Carboxydothermus pertinax NBRC 107576T −−−−−− (DSM 23698) Tepidanaerobacter syntrophicus NBRC 100060T −−−−−− (DSM 15584) Thermoaneromonas toyohensis NBRC 101528T − + − + −− (DSM 14490) Thermanaerobacter cellulolyticus NBRC 14436 −−−−−− T FIGURE 1. Schematic of the experimental procedure for DNA extraction used for conventional PCR and real-time PCR analysis, and Clostridium acetobutylicum NBRC 13948 −−−−−− (ATCC 824) culture methods for M. thermoacetica from canned coffee beverage samples. Clostridium clariflavum NBRC 101661T − + − − −− (DSM 19732) following the manufacturer’s instructions, with a minor modifica- washed three times with 1 phosphate-buffered saline (pH 7.4). Clostridium kluyveri NBRC 12016T ++ + Â − −− tion for extraction of DNA from spores (17). Microbial genomic Next, 1 ml of M. thermoacetica microbial cell suspension (OD600 (DSM 555) DNA was extracted as illustrated in Figure 1. Then, genomic of 0.3 to 0.4) was serially diluted (108 to 101 CFU/ml) and then Clostridium thermocellum NBRC 103400T −−−−−− DNA concentrations were determined using a spectrophotometer spiked into Moorella-free microbial pellets derived from the (ATCC 27405) T ( Quant, BioTek Instruments, Inc., Winooski, VT) and diluted to canned coffee beverages. These pellets were prepared prior to con- Bacillus subtilis NBRC 13719 −−−+ −− μ (ATCC 6051) the appropriate concentration prior to use. firmation of a negative result in the real-time PCR assay with a 40- cycle amplification. Microbial DNA was then extracted from the Bacillus coagulans ATCC 80078 + + − − −− Real-time PCR. Quantitative PCR was performed using SYBR Bacilus licheniformis NBRC 12200T + pellets as described above (17). The genomic DNA from the spiked − − − −− Green chemistry. The reactions were carried out in 25- l volumes con- (ATCC 14580) μ samples was subjected to real-time PCR, and the cycle threshold T taining 12.5 lof2 SYBR Premix Ex Taq (Tli RNaseH Plus) (Takara Paenibacillus polymyxa NBRC 15309 ++− − −− μ values were plotted. All measurements were performed in triplicate, Bio, Shiga, Japan),Â 0.2 M each primer, and 1 l of microbial genomic (ATCC 842) μ μ and all experiments were repeated two times to evaluate the repro- T DNA template at various concentrations for standard curve construc- Geobacillus stearothermophilus NBRC 12550 −−−−−− ducibility of the real-time PCR assay. (ATCC 12980) tion. Meanwhile, 9 μl of DNA extracted from canned beverage samples Staphylococcus aureus NBRC 100910T −−−−−− was used to determine the concentrations of M. thermoacetica using a Detection and quantification of M. thermoacetica in (ATCC 12600) Thermal Cycler Dice Real Time System TP800 (Takara Bio). The opti- commercial canned coffee samples. To identify M. thermoacetica T Escherichia coli NBRC 102203 −−−−−− mal cycling parameters were 95°C for 30 s, followed by 36 cycles of from canned coffee beverages, samples (20 canned beverages from (ATCC 11775) 95°C for 5 s, 64°C for 30 s, and 72°C for 1 min. A melting curve nine different beverage makers) were prepared (Fig. 1) and then a was generated after the last amplification cycle using a temperature A designation in parentheses is the corresponding designation in an alternative collection. T, type strain; NBRC, NITE Biological subjected to real-time PCR. The cycle threshold values obtained range of 64 to 95°C and a temperature transition rate of 0.5°C. The Resource Center (Kisarazu, Chiba, Japan); ATCC, American Type Culture Collection (Manassas, VA); DSM, German Collection of from the assay were used to calculate the CFU/ml of M. thermoace- cycle threshold (C ) and the melting temperature (T ) of amplification Microorganisms and Cell Cultures (Braunschweig, Germany). T m tica in each sample based on the standard curve (Fig. 2). The ampli- b products were calculated automatically. Forward primers are as follows: v1-1F, CAAGTCGAGCGGTCTTTAATTG; v1-2F, CTTCGGATGGAACCGATTAAAG; v3F, fication was confirmed by agarose gel electrophoresis. In addition, microbial DNA was subjected to conventional PCR analysis. The TACGGGAGGCATCTTCTGTAG; and v4F, CGAAGTCTTAAAGGCGAATAGC. Reverse primers are as follows: v3R, TACAGAA- Specificity and sensitivity assays. Different combinations of pellets from the canned coffee products were also suspended in GATGCCTCCCGTAGA; v4R, AGGCTATTCGCCTTTAAGACTTC; and v5R, AAGCCCGGCAGTTTCAAAT; +, positive real-time the forward and reverse primers (Table 1) were examined for species mTGC broth and then spread on mTGC plates and incubated at PCR result; −, negative real-time PCR result. specificity. The specificity was evaluated using 50 pg of DNA 55°C anaerobically for 14 days (Fig. 1). extracted from pure cultures of all of the reference strains (Table 1). Evaluation Biological Resource Center (http://www.nbrc.nite.go.jp/e/). were incubated at 55 to 60°C in modified TGC medium (mTGC Genomic DNA extracted from M. thermoacetica JCM 9319 was Based on the alignment, nine specific primers were selected, using medium; Nissui Pharmaceutical Co., Tokyo, Japan) with an Anae- quantified and used to prepare a 10-fold serial dilution series in sterile RESULTS AND DISCUSSION Primer3Plus (http://www.bioinformatics.nl/cgi-bin/primer3plus/ roPack (Mitsubishi Gas Chemical Company, Tokyo, Japan) in a distilled water. Standard curves using M. thermoacetica were pro- primer3plus.cgi (21)). Primer sequences are listed in footnote b container. Trypticase soy broth (BD, LePont de Claix, France) duced by plotting the cycle threshold values from three replicate Primer specificity. Among the six primer pairs tested, pri- of Table 1. was used to grow other nonrelated bacterial species. PCR assays against the bacterial count based on the optical density. mer pair v1-1F/v4R was the most suitable for species-specific detection of M. thermoacetica by real-time PCR. Using 50 pg Bacterial strains and culture conditions. A total of 26 Extraction of bacterial genomic DNA. For the real-time Detection limit and efficiency calculated from a spiking strains from 24 bacterial species, including three M. thermoacetica PCR assay, M. thermoacetica JCM 9319 was used to produce stan- experiment in canned coffee beverages. The quantitative PCR of template DNA from non-Moorella bacterial strains (Table strains and strains of other close and distant genera, listed in Table dard curves. M. thermoacetica was grown until the culture reached assay was tested for its ability to detect M. thermoacetica in canned 1), no cycle threshold reading was obtained within the 36 ampli- 1, were used for primer specificity studies. Strains were obtained an optical density at 600 nm (OD600) of 0.3 to 0.4 (approximately coffee beverages also containing diverse nonpathogenic micro- fication cycles for any of the isolates (data not shown). The from various culture collections (Table 1) and maintained in the 1 108 CFU/ml). Genomic DNA was extracted using an Ultra organisms. In the first step, 4 ml of each of the canned coffee bev- amplicon obtained from real-time PCR analysis was confirmed laboratory according to the reference information. Moorella species cleanÂ DNA isolation kit (MO BIO Laboratories, Carlsbad, CA) erages was centrifuged at 16,000 g for 15 min, and pellets were as a single DNA band that corresponded to the expected product Â 48 東洋食品研究所研究報告書，31（2016）

J. Food Prot., Vol. 78, No. 7 DETECTION AND QUANTIFICATION OF M. THERMOACETICA 1395

size (data not shown). Negative controls and all non-Moorella strains also showed no peaks in the melting profiles. The repro- ducible, distinct melting point was 89.7°C (data not shown). The absence of nonspecific products and primer dimers was confirmed by agarose gel electrophoresis. The specificity of this region was confirmed by melting temperature analysis (16), which was constant for the amplicon obtained. Conse- quently, primer pair v1-1F/v4R was used for specific detection and quantification of this species in all subsequent analyses of canned coffee beverages in this study. A product was also amplified from Moorella thermoautotrophica using all primer pairs, indicating that these two species could not be distinguished in this region using any of the primer pairs designed in this study. Previous 16S rRNA gene FIGURE 2. Standard curve (●) obtained by plotting log cells sequence comparison revealed that M. thermoacetica and per milliliter against the cycle threshold obtained from real-time PCR M. thermoautotrophica sequences are very similar in this analysis of serially diluted DNA solution extracted from T region. The sequence from type strain M. thermoautotrophica M. thermoacetica JCM 9319 . The linear regression straight equation DSM 1974T exhibited 99.6 to 99.9% similarity to the sequence was y = 3.466 (±0.095)x + 35.705 (±1.706), with a coefﬁcient of determination of R2= 0.9994 (±0.0033). Additionally, curves from the of type strain M. thermoacetica JCM 9319T (ATCC 35608) spiking experiment used to evaluate the efﬁciency of this method for and to that of another M. thermoacetica reference strain, T detection of M. thermoacetica from samples containing nontarget JCM 9320 (ATCC 39073) (4). Phylogenetic analysis showed species are shown. The symbols and equations from the spiking that all M. thermoacetica and M. thermoautotrophica isolates experiment are as follows: spiked 1 (▴), y = 2.895 (±0.11)x + 36.31 form a highly homogenous group that is clearly distinct from (±1.49) (R2 = 0.9983 to 0.9977); spiked 2 (◆), y = 3.623 (±0.19)x + other Moorella species, namely Moorella glycerini and Moor- 39.94 (±0.66) (R2 = 0.9872–0.999); spiked 3 (■), y = 2.688 ella mulderi (4). Thus, the degree of difference between (±0.03)x + 33.24 (±0.12) (R2 = 0.9862 to 0.9906). M. thermoacetica and M. thermoautotrophica is borderline for their separation into two different species. statistical analyses revealed no significant differences (P > 0.05) among the slopes, R2 values, and intercepts. Calibration curve for real-time PCR assay and spiking Additionally, the analyses revealed no significant differ- experiments to examine the efficiency of the assay. A calibra- ences (P > 0.05) among the slopes, intercepts, and R2 values tion curve based on a known concentration of DNA from of the reference M. thermoacetica strain and the spiked M. thermoacetica allowed quantification of DNA from any DNA samples. Thus, we concluded that the amplification source. Three individual suspensions of M. thermoacetica efficiency and target gene detection were not affected by with OD600 values of 0.364, 0.365, and 0.351 were prepared, the presence of nontarget microbial DNA, except when tar- and the corresponding cell counts were estimated to range get DNA was only present in low concentrations. The small from 3 108 to 6 108 CFU/ml. The genomic DNA concen- Â Â slope differences indicated a relatively small amount of error trations of these individual samples were measured as 14.75, in the presence of nontarget DNA. Furthermore, this method 15.25, and 19.25 ng/μl, respectively. In this study, the seven may have been affected by the genomic DNA extraction different serial dilutions of DNA template used to construct efficiencies when only a small amount of target DNA was the standard curve ranged from 15.25 ng/μl to 15.25 fg/μl. present with nontarget DNA. Consequently, we used a stan- The linear regression equation was y = 3.466 (±0.095)x + dard curve based on a known concentration of DNA from M. 2 35.705 (±1.706), with a coefficient of determination of R = thermoacetica for all further analyses. 0.9994 (±0.0033), with genomic equivalents over 7 orders of magnitude. The efficiency of real-time PCR ranged from Detection and quantification of M. thermoacetica from 102.7 to 121.5%. The efficiencies of >100% may be caused canned coffee beverages. We next used this assay to estimate by saturation of the real-time PCR, impairing discrimination the microbial load of M. thermoacetica in a selection of com- between cycle threshold values at higher dilutions. mercial canned coffee beverages based on the standard curve Spiking experiments were then carried out to evaluate generated as described above (Fig. 2). Two samples were posi- the efficiency of this method for sufficient detection of the tive for the presence of M. thermoacetica, and the cell numbers target species from beverage samples also containing nontar- were quantified as >1.3 (CT, 33.98, and Tm, 89.79) and >1.0 get species. Genomic DNA from the spiked samples was (CT, 35.52, and Tm, 89.75) CFU/ml, respectively. Sequence subjected to real-time PCR, and the cycle threshold values analysis of the amplicons obtained from canned beverages were plotted. Similar results were obtained for the three sam- showed 99% sequence homology to the published 16S rRNA ples, with values of y = 2.895 (±0.11)x + 36.31 (±1.49) gene of M. thermoacetica. Meanwhile, a conventional PCR (R2 = 0.9983 to 0.9977), y = 3.623 (±0.19)x + 39.94 assay and plate counting method using enrichment broth culti- (±0.66) (R2 = 0.9872 to 0.999), and y = 2.688 (±0.03)x vation produced negative results for all samples. A possible + 33.24 (±0.12) (R2 = 0.9862 to 0.9906) for spiked samples reason for this discrepancy in the results is that a certain number 1, 2, and 3, respectively (Fig. 2). The results revealed cycle of target species cells may have been present in the beverage threshold values corresponding to 101 to 106 CFU/ml, and samples but not in a culturable state. Bacteria present in spore 48 東洋食品研究所研究報告書，31（2016）東洋食品研究所研究報告書，31（2016） 49

J. Food Prot., Vol. 78, No. 7 DETECTION AND QUANTIFICATION OF M. THERMOACETICA 1395 1396 NAKANO J. Food Prot., Vol. 78, No. 7 size (data not shown). Negative controls and all non-Moorella form may not germinate during the experimental period and, 5. Cooper, R. M., and J. L. McKillip. 2006. Enterotoxigenic Bacillus strains also showed no peaks in the melting profiles. The repro- therefore, may appear nonculturable, while the addition of spp. DNA fragment revealed in naturally contaminated nonfat dry ducible, distinct melting point was 89.7°C (data not shown). emulsifiers to the beverages could have a bacteriostatic effect. milk powder using rep-PCR. J. Basic Microbiol. 46:358–364. The absence of nonspecific products and primer dimers was While technically still viable, these cells would not be detected 6. Le Drean, G., J. Mounier, V. Casseur, D. Arzur, O. Habrylo, and G. Barbier. 2010. Quantification of Paenibacillus camemberti and confirmed by agarose gel electrophoresis. The specificity of by culturing methods but would contribute DNA to PCR-based P. roqueforti mycelium by real-time PCR to assess their growth dynamics this region was confirmed by melting temperature analysis techniques. Although bacterial spores can survive commercial during ripening cheese. Int. J. Food Microbiol. 138:100–107. (16), which was constant for the amplicon obtained. Conse- heat, food emulsifiers like sucrose monopalmitate could 7. Malorny, B., C. Lofstrom, M. Wagner, N. Kramer, and J. Hoorfar. quently, primer pair v1-1F/v4R was used for specific detection damage and inhibit microbial spore germination. The finding 2008. Enumeration of Salmonella bacteria in food and feed samples and quantification of this species in all subsequent analyses of that the majority of samples were negative for the presence of by real-time PCR for quantitative microbial risk assessment. Appl. canned coffee beverages in this study. M. thermoacetica suggests that spores germinate at some point Environ. Microbiol. 74:1299–1304. A product was also amplified from Moorella thermoauto- 8. Matsuda, N., H. Masuda, M. Komaki, and N. Matsumoto. 1982. during food processing, losing their heat resistance and becom- Thermophilic, spore-forming, strict anaerobes isolated from spoiled trophica using all primer pairs, indicating that these two spe- ing relatively easy to kill. Finally, DNA from cells that are canned “shiruko” and coffee containing milk. J. Food Hyg. Soc. Jpn. cies could not be distinguished in this region using any of the killed during processing will also be detected by PCR-based 23:480–486. primer pairs designed in this study. Previous 16S rRNA gene FIGURE 2. Standard curve (●) obtained by plotting log cells techniques, making it appear that there is a greater level of con- 9. Moriyama, R., K. Sugimoto, S. Miyata, T. Katsuragi, and S. Makino. sequence comparison revealed that M. thermoacetica and per milliliter against the cycle threshold obtained from real-time PCR tamination than is detected using culturing methods. 1996. Antimicrobial action of sucrose esters of fatty acids on bacterial M. thermoautotrophica sequences are very similar in this analysis of serially diluted DNA solution extracted from Recently, Prevost et al. (14) reported that thermophilic spores. J. Antibact. Antifung. Agents 24:3–8. M. thermoacetica JCM 9319T. The linear regression straight equation 10. Nakayama, A., and R. Shinya. 1980. A new type of flat sour spoilage region. The sequence from type strain M. thermoautotrophica bacteria, including Geobacillus searothermophilus, M. ther- DSM 1974T exhibited 99.6 to 99.9% similarity to the sequence was y = 3.466 (±0.095)x + 35.705 (±1.706), with a coefﬁcient of of commercial canned coffee. J. Food Hyg. Soc. Jpn. 22:30–36. determination of R2= 0.9994 (±0.0033). Additionally, curves from the moacetica and/or M. thermoautotrophica, and the Thermoa- 11. Nakayama, A., J. Sonobe, and R. Shinya. 1982. Effect of sucrose of type strain M. thermoacetica JCM 9319T (ATCC 35608) spiking experiment used to evaluate the efﬁciency of this method for naerobacerium group, were involved in canned food esters of fatty acids on flat sour spoilage by obligate spoilage. and to that of another M. thermoacetica reference strain, spoilage. Thermophilic bacterial spores were detected in 13 J. Food Hyg. Sci. Jpn. 23:25–32. T detection of M. thermoacetica from samples containing nontarget JCM 9320 (ATCC 39073) (4). Phylogenetic analysis showed species are shown. The symbols and equations from the spiking ingredients, including spices, milk powder, and flavorings 12. Oomes, S. J., A. C. van Zuijlen, J. O. Hehenkamp, H. Witsenboere, that all M. thermoacetica and M. thermoautotrophica isolates experiment are as follows: spiked 1 ( ), y = 2.895 (±0.11)x + 36.31 (14). Several other studies have identified thermophilic bac- J. M. B. M. van der Vossenc, and S. Brul. 2007. The characterisation 2 ▴ of Bacillus spores occurring in the manufacturing of (low acid) canned form a highly homogenous group that is clearly distinct from (±1.49) (R = 0.9983 to 0.9977); spiked 2 (◆), y = 3.623 (±0.19)x + terial spore contamination of milk powder, a product that products. Int. J. Food Microbiol. 120:85 94. other Moorella species, namely Moorella glycerini and Moor- 39.94 (±0.66) (R2 = 0.9872–0.999); spiked 3 (■), y = 2.688 – undergoes heating during processing (5, 18). These primary 13. Postollec, F., H. Falentin, S. Pavan, J. Combrisson, and D. Sohier. ella mulderi (4). Thus, the degree of difference between (±0.03)x + 33.24 (±0.12) (R2 = 0.9862 to 0.9906). ingredients may therefore be the entrance point for highly 2011. Recent advances in quantitative PCR (qPCR) applications in M. thermoacetica and M. thermoautotrophica is borderline heat-resistant bacteria into other food products (12). food microbiology. Food Microbiol. 28:848–861. for their separation into two different species. statistical analyses revealed no significant differences Currently, PCR-based methods, in particular quantitative 14. Prevost, S., S. Andre, and F. Remize, 2010. PCR detection of thermo- 2 (P > 0.05) among the slopes, R values, and intercepts. PCR, are predominantly used to detect, identify, and quantify philic spore-forming bacteria involved in canned food spoilage. Curr. Calibration curve for real-time PCR assay and spiking Additionally, the analyses revealed no significant differ- both pathogens and beneficial microbial species, such as fer- Microbiol. 61:525–533. experiments to examine the efficiency of the assay. A calibra- 2 15. Rigaux, C., S. Andre, I. Albert, and F. Carlin. 2014. Quantitative ences (P > 0.05) among the slopes, intercepts, and R values menting microbes or probiotics (6, 7). Furthermore, combined tion curve based on a known concentration of DNA from assessment of the risk of microbial spoilage in foods. Prediction of of the reference M. thermoacetica strain and the spiked with reverse transcription, quantitative PCR can also estimate M. thermoacetica allowed quantification of DNA from any non-stability at 55°C caused by Geobacillus stearothermophilus in DNA samples. Thus, we concluded that the amplification transcript amounts, thereby providing information on microbial source. Three individual suspensions of M. thermoacetica canned green beans. J. Food Microbiol. 171:119–128. efficiency and target gene detection were not affected by gene activity (13). Routine bacteriological culture methods 16. Ririe, K. M., R. P. Rasmussen, and C. T. Wittwer. 1997. Product dif- with OD values of 0.364, 0.365, and 0.351 were prepared, 600 the presence of nontarget microbial DNA, except when tar- require a minimum of 4 days to detect M. thermoacetica ferentiation by analysis of DNA melting curves during the polymerase and the corresponding cell counts were estimated to range get DNA was only present in low concentrations. The small chain reaction. Anal. Biochem. 245:154–160. 8 8 from a food sample and require a further 4 days for subsequent from 3 10 to 6 10 CFU/ml. The genomic DNA concen- 17. Rose, H. L., C. A. Dewey, M. S. Ely, S. L. Willoughby, T. M. Parsons, slope differences indicated a relatively small amount of error bacterial identification on the basis of growth and biochemical trationsÂ of these individualÂ samples were measured as 14.75, V. Cox, P. M. Spencer, and S. A. Weller. 2011. Comparison of in the presence of nontarget DNA. Furthermore, this method characteristics. The method described here is highly reliable 15.25, and 19.25 ng/μl, respectively. In this study, the seven eight methods for the extraction of Bacillus atrophaeus spore may have been affected by the genomic DNA extraction and can be directly performed within several hours. This spe- different serial dilutions of DNA template used to construct DNA from eleven common interferents and a common swab. PLoS efficiencies when only a small amount of target DNA was cies-specific assay could be useful for tracking and monitoring One 6:e22668 the standard curve ranged from 15.25 ng/μl to 15.25 fg/μl. present with nontarget DNA. Consequently, we used a stan- bacterial contaminants in various foods or food ingredients. 18. Ruckert, A., R. S. Ronimus, and H. W. Morgan. 2004. A RAPD-based The linear regression equation was y = 3.466 (±0.095)x + dard curve based on a known concentration of DNA from M. survey of thermophilic bacilli in milk powders from different coun- 2 35.705 (±1.706), with a coefficient of determination of R = thermoacetica for all further analyses. tries. Int. J. Food Microbiol. 96:263–272. 0.9994 (±0.0033), with genomic equivalents over 7 orders ACKNOWLEDGMENT 19. Suwa, N., H. Kubota, K. Takahashi, and H. Machida, H. 1986. Effect of of magnitude. The efficiency of real-time PCR ranged from Detection and quantification of M. thermoacetica from The author thanks Yoshio Aoyama (principal investigator, Division of sucrose fatty acid esters on spoilage of canned coffee caused by thermo- 102.7 to 121.5%. The efficiencies of >100% may be caused canned coffee beverages. We next used this assay to estimate Food Science, Toyo Institute of Food Technology) for helpful advice and philic spore forming bacteria. Nippon Shokuhin Kogyo Gakkai 33:44–51. by saturation of the real-time PCR, impairing discrimination the microbial load of M. thermoacetica in a selection of com- suggestions throughout the study. 20. Thompson, J. D., T. J. Gibson, F. Plewniak, F. Jeanmougin, and D. G. Higgins. 1997. The ClustalX Windows interface: flexible strategies for between cycle threshold values at higher dilutions. mercial canned coffee beverages based on the standard curve multiple sequence alignment aided by quality analysis tools. Nucleic REFERENCES Spiking experiments were then carried out to evaluate generated as described above (Fig. 2). Two samples were posi- Acids Res. 25:4876–4882. the efficiency of this method for sufficient detection of the tive for the presence of M. thermoacetica, and the cell numbers 1. Andre, S., and F. Z. Remize. 2013. Thermophilic spore-forming bacteria 21. Untergasser, A., H. Nijveen, X.-Y.Rao, T. Bisseling, R. Geurts, and target species from beverage samples also containing nontar- were quantified as >1.3 (CT, 33.98, and Tm, 89.79) and >1.0 isolated from spoiled canned food and their heat resistance. Results of a J. A. M. Leunissen. 2007. Primer3Plus, an enhanced web interface to Primer3. Nucleic Acids Res. 35:W71 W74. get species. Genomic DNA from the spiked samples was (CT, 35.52, and Tm, 89.75) CFU/ml, respectively. Sequence French ten-year survey. Int. J. Food Microbiol. 165:134–143. – subjected to real-time PCR, and the cycle threshold values analysis of the amplicons obtained from canned beverages 2. Asaka, M., and T. Enda. 2009. Inhibitory effect of starch to bacterios- 22. Yamamoto, K., T. Kamiya, M. Komura, S. Kakefuda, R. Murakami, were plotted. Similar results were obtained for the three sam- showed 99% sequence homology to the published 16S rRNA tasis of fatty acid ester. Toyo Inst. Food Technol. Res. Rep. 27:71–76. and G. Ichijo. 1987. Studies on the sulfite and heat resistance of Clos- 3. Byrer, D. E., F. A. Rainey, and J. Wiegel. 2000. Novel strains of tridium responsible for flat sour spoilage of canned foods. J. Food ples, with values of y = 2.895 (±0.11)x + 36.31 (±1.49) gene of M. thermoacetica. Meanwhile, a conventional PCR 2 Moorella thermoacetica from unusually heat-resistant spores. Arch. Hyg. Soc. Jpn. 29:256–261. (R = 0.9983 to 0.9977), y = 3.623 (±0.19)x + 39.94 assay and plate counting method using enrichment broth culti- Microbiol. 174:334 339. 23. Yamamoto, K., T. Kamiya, M. Komuro, S. Kakefuda, R. Murakami, 2 – (±0.66) (R = 0.9872 to 0.999), and y = 2.688 (±0.03)x vation produced negative results for all samples. A possible 4. Carrlier, J. P., and M. B. Faure. 2006. Phenotypic and genotypic char- and K. Takai. 1984. Characteristics of thermophilic spore-forming + 33.24 (±0.12) (R2 = 0.9862 to 0.9906) for spiked samples reason for this discrepancy in the results is that a certain number acterization of some Moorella sp. strains isolated from canned foods. obligate anaerobes isolated from flat sour spoiled canned “Shiruko”. 1, 2, and 3, respectively (Fig. 2). The results revealed cycle of target species cells may have been present in the beverage Syst. Appl. Microbiol. 29:581–588. J. Food Hyg. Soc. Jpn. 25:233–240. threshold values corresponding to 101 to 106 CFU/ml, and samples but not in a culturable state. Bacteria present in spore