Mutant and Wild-Type Isocitrate Dehydrogenase 1 Share Enhancing Mechanisms Involving Distinct Tyrosine Kinase Cascades in Cancer

Published OnlineFirst March 12, 2019; DOI: 10.1158/2159-8290.CD-18-1040

RESEARCH ARTICLE

Dong Chen 1 ,2 , Siyuan Xia 1 ,2 , Mei Wang 1 ,2 ,3 , Ruiting Lin 1 ,2 , Yuancheng Li 2 ,4 , Hui Mao 2 ,4 , Mike Aguiar 5 , Christopher A. Famulare 6 , Alan H. Shih 6 , Cameron W. Brennan 6 , Xue Gao 1 ,2 , Yaozhu Pan 1 ,7 , Shuangping Liu 1 ,8 , Jun Fan 2 ,9 , Lingtao Jin 1 ,2 , Lina Song 10 , An Zhou 10 , Joydeep Mukherjee 11 , Russell O. Pieper 11 , Ashutosh Mishra 12 , Junmin Peng 12 , Martha Arellano 1 ,2 , William G. Blum 1 ,2 , Sagar Lonial 1 ,2 , Titus J. Boggon 13 , Ross L. Levine 6 , and Jing Chen 1 ,2

ABSTRACT Isocitrate dehydrogenase 1 (IDH1) is important for reductive carboxylation in cancer cells, and the IDH1 R132H mutation plays a pathogenic role in cancers including acute myeloid leukemia (AML). However, the regulatory mechanisms modulating mutant and/ or wild-type (WT) IDH1 function remain unknown. Here, we show that two groups of tyrosine kinases (TK) enhance the activation of mutant and WT IDH1 through preferential Y42 or Y391 phosphorylation. Mechanistically, Y42 phosphorylation occurs in IDH1 monomers, which promotes dimer formation with enhanced substrate (isocitrate or α-ketoglutarate) binding, whereas Y42-phosphorylated dimers show attenuated disruption to monomers. Y391 phosphorylation occurs in both monomeric and dimeric IDH1, which enhances cofactor (NADP+ or NADPH) binding. Diverse oncogenic TKs phosphorylate IDH1 WT at Y42 and activate Src to phosphorylate IDH1 at Y391, which contributes to reductive carboxylation and tumor growth, whereas FLT3 or the FLT3-ITD mutation activates JAK2 to enhance mutant IDH1 activity through phosphorylation of Y391 and Y42, respectively, in AML cells.

SIGNIFICANCE : We demonstrated an intrinsic connection between oncogenic TKs and activation of WT and mutant IDH1, which involves distinct TK cascades in related cancers. In particular, these results provide an additional rationale supporting the combination of FLT3 and mutant IDH1 inhibitors as a promising clinical treatment of mutant IDH1-positive AML.

See related commentary by Horton and Huntly, p. 699.

1Department of Hematology and Medical Oncology, Winship Cancer Insti- Note: Supplementary data for this article are available at Cancer Discovery tute, Emory University School of Medicine, Atlanta, Georgia. 2 Winship Online (http://cancerdiscovery.aacrjournals.org/). Cancer Institute, Emory University School of Medicine, Atlanta, Georgia . D. Chen, S. Xia, and M. Wang contributed equally to this work. 3 Department of Pharmacy, Children’s Hospital of Soochow University, Suzhou, China. 4 Department of Radiology and Imaging Sciences, Winship Corresponding Authors: Ross L. Levine, Human Oncology and Pathogenesis Cancer Institute, Emory University School of Medicine, Atlanta, Geor- Program, Memorial Sloan Kettering Cancer Center, Box 20, New York, NY gia. 5 Cell Signaling Technology, Inc., Danvers, Massachusetts. 6 Memorial 10065. Phone: 646-888-2767; Email: [email protected]; and Jing Chen, Sloan Kettering Cancer Center, New York, New York. 7 General Hospital of Emory University School of Medicine, Winship Cancer Institute of Emory, Lanzhou Military Region, Lanzhou, China. 8Department of Pathology, Medi- 1365-C Clifton Road NE, Room C-3002, Atlanta, GA 30322. Phone: 404- cal College, Dalian University, Dalian, China. 9Department of Radiation 778-5274; Fax: 404-778-5520; E-mail: [email protected] . Oncology, Winship Cancer Institute, Emory University School of Medicine, Cancer Discov 2019;9:756–77 10 Atlanta, Georgia. Department of Neurobiology, Morehouse School of doi: 10.1158/2159-8290.CD-18-1040 Medicine, Atlanta, Georgia. 11 Department of Neurological Surgery, Uni- versity of California, San Francisco, California. 12Department of Structural ©2019 American Association for Cancer Research. Biology and Developmental Neurobiology, St. Jude Children’s Research Hospital, Memphis, Tennessee. 13 Department of Pharmacology, Yale University School of Medicine, New Haven, Connecticut.

756 | CANCER DISCOVERY JUNE 2019 www.aacrjournals.org

INTRODUCTION epigenetics, which is not found in normal cells harboring The terms metabolic “reprogramming” and “rewiring” wild-type (WT) IDH1/2 (5–8). We previously reported that have emerged to describe the increasingly better understood oncogenic BRAFV600E rewires the ketogenic pathway to metabolic changes observed in cancer cells (1, 2). From a defi- allow cancer cells to benefit from ketone body acetoacetate- nitional perspective, “metabolic reprogramming” represents promoted BRAFV600E–MEK1 binding, which is not found in “software changes” in cancer cells and describes metabolic cells expressing BRAF WT (3). Thus, clearly distinguishing alterations that are normally induced by growth factors in and characterizing metabolic “reprogramming” and “rewir- proliferating cells but are hijacked by oncogenic signals, ing” in cancer cells offers apparent advantages to inform whereas “metabolic rewiring” represents “hardware changes” therapy development because targeting rewiring (e.g., IDH and describes metabolic alterations due to neofunctions of mutant inhibitors) in cancer cells will have minimal toxicity oncogenic mutants, which are not found in normal cells (3). to normal cells. For example, oncogenic signals reprogram cancer cells in an IDH1 and IDH2 are two highly homologous members acute manner involving diverse post-translational modifica- of the IDH family of metabolic enzymes and are located tions of metabolic enzymes that also exist in proliferating in the cytoplasm and mitochondria, respectively. IDH1/2 normal cells (4). The identification of mutations in isocitrate form homodimers and convert isocitrate to α-ketoglutarate dehydrogenase (IDH) 1 and 2 in glioma and acute myeloid (αKG) with the reduction of NADP+ to NADPH (9). αKG leukemia (AML) represents a rewiring because the muta- is a key intermediate in the Krebs cycle and glutaminolysis, tions confer a neofunction to IDH1/2 to produce the onco- an important nitrogen transporter, and a ligand for αKG- metabolite 2-hydroxyglutamate (2-HG) to regulate cancer dependent enzymes, including histone demethylases such as

JUNE 2019 CANCER DISCOVERY | 757

RESEARCH ARTICLE Chen et al.

JHD1 and methylcytosine dioxygenase enzyme TET2 (10). target mutant IDH1 or IDH2 have been developed and evalu- NADPH not only fuels macromolecular biosynthesis, such ated in preclinical and clinical studies as single agents and in as lipogenesis, but also functions as a crucial antioxidant to combination with other anticancer agents. These inhibitors quench the reactive oxygen species (ROS) produced during were designed to bind to the catalytic site of mutant IDH rapid proliferation of cancer cells, which is important for the proteins and inhibit the enzyme activity of mutant IDH to maintenance of cellular redox homeostasis to protect against convert αKG to 2-HG (20). In addition, recent reports demon- toxicity of ROS and oxidative DNA damage (11). Thus, strate the ability of single-agent IDH2 R140 mutant inhibitor IDH1/2 are important for many metabolic processes in cells AG-221 to reverse the DNA hypermethylation and differen- including bioenergetics, biosynthesis, and redox homeostasis. tiation block induced by the IDH2 mutant in leukemia cells, Moreover, recent evidence demonstrates that IDH1/2 play an and improve efficacy when given in combination with a FLT3 important role in reductive carboxylation that is enhanced tyrosine kinase (TK) inhibitor in IDH2 mutant–expressing in cells under hypoxia, allowing the generation of isocitrate/ leukemia cells (21, 22). It remains unknown how oncogenic citrate from αKG and glutamine, which is in particular signals such as oncogenic TKs, including FLT3, regulate WT important in cancer cells for producing citrate and acetyl- IDH1 and/or mutant IDH1, what the regulatory mechanism CoA that are essential for lipid synthesis during tumorigen- is, and whether WT and mutant IDH1 share the same regula- esis, as well as reducing mitochondrial ROS to sustain redox tory mechanism in the corresponding related cancers. homeostasis during anchorage-independent growth (12, 13). Missense mutations of R132 in the enzyme active site of RESULTS IDH1 were identified in patients with glioblastoma (GBM) and in AML cases (5–7, 14, 15), and corresponding IDH2 An Intrinsic Link between FLT3 and IDH1 in AML R172 mutations as well as a novel R140Q mutant repeatedly To understand the pathogenic link between mutant FLT3 occur in patients with AML (14, 16, 17). Overall, IDH1/2 and IDH1, we treated primary leukemia cells from represent- mutations are identified in> 75% of grade 2/3 glioma and ative patients with AML with the FLT3 inhibitor quizartinib secondary GBM cases and in >20% of AML cases. IDH muta- and/or the IDH1 R132 mutant inhibitor AG-120. We found tions were also identified in other cancer types such as chon- that single-agent treatment for 24 hours resulted in decreased drosarcoma and cholangiocarcinoma (9). IDH mutations cell viability of IDH1 R132H mutant–expressing primary leu- are heterozygous events, resulting in loss of function of WT kemia cells harboring concurrent FLT3-ITD mutation (left, IDH1 enzyme activity but a gain of function to mutant IDH1, Fig. 1A; Supplementary Fig. S1A), or expressing FLT3 WT allowing NADPH-dependent reduction of αKG to produce (right, Fig. 1A; Supplementary Fig. S1A), whereas combined the oncometabolite 2-HG. 2-HG competitively inhibits the treatment resulted in further decreased cell viability of these function of αKG-dependent enzymes, such as TET2, which in cells. Surprisingly, treatment with either AG-120 or quizar- turn causes epigenetic dysregulation including DNA hyper- tinib resulted in decreased mutant IDH1 activity, which was methylation in both GBM and AML, and consequent block further reduced upon combined treatment in all of the tested of differentiation (18). In AML, IDH1 R132, IDH2 R172, and primary AML cells, accompanied by decreased tyrosine phos- IDH2 R140 mutations are mutually exclusive, and although phorylation levels of IDH1 proteins (Fig. 1A; Supplementary IDH1 R132 mutations were detected in patients with AML Fig. S1A). Similar results were obtained using primary leuke- with mutations in NPM1, FLT3, CEBPA, or NRAS, co-occur- mia cells from patients with AML expressing IDH1 WT and rence of IDH1 mutations and FLT3 internal tandem duplica- FLT3-ITD or FLT3 WT, where treatment with quizartinib tion (FLT3-ITD) is less common (19). resulted in decreased IDH1 enzyme activity (Fig. 1B). These The pathogenic role of IDH mutations suggested mutant data together suggest an intrinsic link between FLT3 and IDH proteins as promising therapeutic targets. Small- IDH1 regardless of the mut ational state of both proteins, molecule inhibitors, including AG-120, enasidenib (AG-221/ likely involving FLT3-dependent tyrosine phosphorylation CC-90007), AG-881, IDH305, and FT-2102, that selectively and activation of IDH1.

Figure 1. An intrinsic link between FLT3 and IDH1 involves tyrosine phosphorylation in AML and diverse TKs phosphorylate and enhance activation of mutant IDH1. A, Human primary AML cells harvested from patients 38687 expressing IDH1 R132H/FLT3-ITD (left) and 60713 expressing IDH1 R132H/ WT FLT3 (right) were treated with the FLT3 inhibitor quizartinib (200 nmol/L), IDH mutant inhibitor AG-120 (1 μmol/L), or a combination of quizartinib and AG-120, followed by cell viability assay (48 hours) and IDH1 R132H enzyme activity assay (12 hours; top left and right). Tyrosine phosphorylation (pTyr-100) of IDH1 R132H in each treated group was determined by Western blotting (bottom). B, Primary AML cells harvested from patients 60189 expressing IDH1 WT/FLT3-ITD (left) and 59409 expressing IDH1 WT/FLT3 WT (right) were grown with or without the FLT3 inhibitor quizartinib, followed by WT IDH1 enzyme activity assay (top). Tyrosine phosphorylation of IDH1 WT in each treated group was determined by Western blotting (bottom). C, Purified recombinant IDH1 R132H proteins were incubated with recombinant active form of TKs including rFLT3 and rFGFR1 in an in vitro kinase assay. IDH1 R132H enzyme activity assay (top) was assessed; tyrosine phosphorylation of IDH1 was detected by Western blotting (bottom). D, Top, schematic representation of identified phosphorylated tyrosine residues in IDH1 R132H. Bottom, purified FLAG-IDH1 variants were incubated with recombinant active form of FLT3, followed by IDH1 R132H enzyme activity assay (bottom and top) and Western blotting showing tyrosine phosphorylation of IDH1 R132H and IDH1 R132H YF mutants (bottom, bottom plots). E, Purified FLAG-IDH1 R132H-Y391F mutant was incubated with recombinant active form of group I TKs including rEGFR, rJAK2, rABL1, and rPDGFR (left) and group II TKs including rFLT3 and rSrc (right), respectively, followed by IDH1 R132H enzyme activity assay (top). Tyrosine phosphorylation of IDH1 R132H in each treated group was determined by Western blotting (bottom). F, Purified FLAG-IDH1 R132H and FLAG-IDH1 R132H YF mutants were incubated with or without active rFGFR1, followed by IDH1 R132H enzyme activity assay (top). Tyrosine phosphorylation of IDH1 R132H and IDH1 R132H YF mutants was assessed by Western blotting (bottom). G. Purified FLAG-IDH1 R132H-Y42F and FLAG-IDH1 R132H-Y391F mutants were incubated with or without active rEGFR, rJAK2, or rSrc, followed by IDH1 R132H enzyme activity assay (top). Tyrosine phosphorylation of IDH1 R132H and IDH1 R132H YF mutants was assessed by Western blotting (bottom). The error bars represent mean values ± SD from three replicates of each sample (*, 0.01 < P < 0.05; **, 0.01 < P < 0.001; ***, P < 0.001; ns, not significant). Data are mean± SD; P values were obtained by a two-tailed Student test.

758 | CANCER DISCOVERY JUNE 2019 www.aacrjournals.org

Tyrosine Phosphorylation Activates IDH1 and R132H Mutant RESEARCH ARTICLE

A IDH1 mutant patient samples B IDH1 WT patient samples AML 38687 AML 60713 IDH1 R132H/FLT3 ITD IDH1 R132H/FLT3 WT AML 60189 AML 59409 IDH1 WT/FLT3 ITD IDH1 WT/FLT3 WT *** *** *** *** ** ** ** *** 120 ** 120 ** 120 ** 120 *** 120 **120 ** ** ** ** ** ** * ** 100 100 100 100 100 100 80 80 80 80 80 80 60 60 60 60 60 60 IDH1 R132H IDH1 R132H

40 activity (%) 40 40 activity (%) 40 40 40 20 20 20 20 20 20 Relative Relative Relative Relative cell viability (%) Relative Relative cell viability (%) Relative

0 0 0 0 WT activity (%) IDH1 Relative 0 WT activity (%) IDH1 Relative 0 Quizartinib − +−+Quizartinib −+−+ Quizartinib −+−+Quizartinib − +−+ Quizartinib −+ Quizartinib −+ AG-120 −−++ AG-120 −−++ AG-120 −−++ AG-120 −−++ pTyr pIDH1 R132H pTyr pIDH1 pTyr pIDH1 pTyr pIDH1 R132H IDH1 Heavy chain IDH1 Heavy chain Heavy chain IDH1 R132H Heavy chain IDH1 IDH1 IDH1 R132H IDH1 R132H IDH1 R132H IDH1 IP IDH1 IP IDH1 R132H IP IDH1 R132H IP IDH1 IDH1 IDH1 IDH1 IDH1 R132H IDH1 R132H IDH1 R132H IDH1 R132H β-Actin β-Actin β-Actin β-Actin β-Actin β-Actin β-Actin β-Actin Cell lysates Cell lysates Cell lysates Cell lysates

CDY34 Y42 Y135Y139 Y208Y219 Y231Y235 Y316Y319Y391 1 PP PP PP PP PP P 414 160 ** ** IDH1 R132H 140 ** ** ** ** ** ** *** ****** *** *** *** ns 120 160 140 100 120

IDH1 R132H 80 100 60 80 IDH1 R132H activity (%) 60 40

activity (%) 40 ns ns Relative Relative 20 20 0 0 Relative rIDH1 R132H + +++ rIDH1 R132H ++Y34F Y42F Y135F Y139F Y208F Y219F ++Y231F Y235F Y316F Y319F Y391F − − rFLT3 −+−+−+ −+ −+−+ −+ −+ −+−− −+ −+ −+−+ −+ rFLT3 rFGFR1 pIDH1 pFLT3 pFLT3 R132H pTyr pTyr pIDH1 pFGFR1 pIDH1 R132H FLAG rFLAG-IDH1 rFLAG-IDH1 R132H R132H In vitro kinase assay FLAG rFLAG- IDH1 R132H In vitro kinase assay E Group IGroup II ns ns 160 ** ** ** ** 120 140 100 120 100 80 IDH1 R132H IDH1 R132H 80 60 60 activity (%) activity (%) 40 40 Relative Relative Relative Relative 20 20 0 0 rIDH1 R132H-Y391F + +++++++ rIDH1 R132H-Y391F + +++ − − − − − − rEGFR rJAK2 rABL1 rPDGFR rFLT3 rSrc pABL1 pPDGFR pSrc pJAK2 pTyr pEGFR pTyr pFLT3 pIDH1 pIDH1 pIDH1 pIDH1 pIDH1 pIDH1 R132H R132H R132H R132H R132H R132H FLAG rFLAG-IDH1 rFLAG-IDH1 rFLAG-IDH1 rFLAG-IDH1 FLAG rFLAG-IDH1 rFLAG-IDH1 R132H R132H R132H R132H R132H R132H In vitro kinase assay In vitro kinase assay

ns F 160 ** ** ** ** ** ** *** ** ** ** ** *** 140 120 100 80 IDH1 R132H 60

activity (%) 40 ns 20 ns

Relative Relative 0 rIDH1 R132H ++Y34F Y42F Y135F Y139F Y208F Y219F ++Y231F Y235F Y316F Y319FY391F rFGFR1 +− −++ −−+ −++ −+−+−+−+−+−+−+−+−+− pFGFR1 pTyr pIDH1

FLAG rFLAG- IDH1 R132H In vitro kinase assay G Group I Group II ns ns ns 140 ** ** 160 ** ** 160 ** ** 120 140 140 100 120 120 100 80 100 80 IDH1 R132H IDH1 R132H 80 IDH1 R132H 60 60 60 activity (%) activity (%) activity (%) 40 40 40 20 Relative Relative Relative Relative Relative Relative 20 20 0 0 0 rIDH1 R132H + Y42F Y391F rIDH1 R132H + Y42F Y391F rIDH1 R132H + Y42F Y391F rEGFR −++ −+− rJAK2 −++ −+− rSrc −++ −+− pSrc pIDH1 pTyr pIDH1 pTyr pTyr pIDH1 R132H R132H R132H rFLAG-IDH1 FLAG rFLAG-IDH1 FLAG rFLAG-IDH1 R132H FLAG R132H R132H In vitro kinase assay In vitro kinase assay In vitro kinase assay

JUNE 2019 CANCER DISCOVERY | 759

RESEARCH ARTICLE Chen et al.

Distinct Groups of TKs Enhance Activation suggesting that WT and mutant IDH1 might share the same of WT and Mutant IDH1 through Preferential regulatory mechanisms involving tyrosine phosphorylation. Phosphorylation of Y42 or Y391 We next performed in vitro kinase assays coupled with Y42 Phosphorylation Promotes IDH1 Dimerization mutant IDH1 activity assays using purified, recombinant and Subsequent Substrate Binding IDH1 R132H mutant protein (rIDH1 R132H) incubated with We next sought to elucidate the distinct mechanisms under- recombinant active forms of diverse TKs, including rFLT3, lying Y42 and Y391 phosphorylation–dependent enhancement rFGFR1, rSrc, rPDGFR, rEGFR, rMET, rKIT, or rJAK2. We of IDH1 activation. Further studies confirmed that purified found that purified rIDH1 R132H mutant protein demon- dimeric and monomeric IDH1 R132H mutant or WT proteins strated basal-level enzyme activity, whereas all of the tested represented active and inactive forms of IDH1, respectively TKs were able to directly phosphorylate purified rIDH1 (Fig. 2A, left and right, respectively), and IDH1 R132H mutant R132H mutant, leading to increased mutant IDH1 activ- or WT enzyme activity correlated with increasing levels of ity (Fig. 1C; Supplementary Fig. S1B). We next performed dimer in different compositions of purified monomeric and mutational analysis and generated diverse phospho-deficient dimeric IDH1 proteins (Fig. 2B, left and right, respectively). Y→F mutants of IDH1 R132H (top, Fig. 1D) based on In addition, incubation with the group I TKs rFGFR1, rMET, publicly available data (https://www.phosphosite.org/protein or rEGFR but not group II TKs rFLT3 or rSrc resulted in Action.action?id=10630&showAllSites=true), which identified increased dimer formation of IDH1 R132H mutant or WT phosphorylated tyrosine residues of IDH1 in human cancer proteins assessed by Western blot after cross-linking (Fig. 2C, cells. We found that mutations at Y139 and Y219 intrinsi- left and right, respectively), suggesting that Y42 phosphoryla- cally abolished mutant IDH1 activity, whereas substitution of tion by group I TKs may contribute to IDH1 dimer formation. Y391 with phenylalanine resulted in the abolishment of FLT3- This was further confirmed by incubation of diverse group I enhanced activation of IDH1 R132H mutant (Fig. 1D). or II TKs with IDH1 R132H mutant proteins with or without However, we found that a group of TKs (which we termed Y42F or Y391F mutation, where FGFR1 (group I) but not FLT3 group I), including EGFR, JAK2, ABL1, PDGFR, and FGFR1, (group II; Fig. 2D, top), as well as EGFR and MET (group I) were still able to phosphorylate and enhance activation of but not Src (group II; Supplementary Fig. S3A) were able to IDH1 R132H mutant with Y391F mutation (Fig. 1E, left and promote the homerdimerization of IDH1 R132H mutant and 1F), whereas FLT3 or Src (termed group II)–enhanced activa- R132H/Y391F but not R132H/Y42F proteins through tyrosine tion of IDH1 R132H/Y391F mutant was abolished (Fig. 1E, phosphorylation. Similar results were obtained using IDH1 right). Only the Y42F mutation abolished FGFR1-enhanced WT, Y42F, and Y391F proteins incubated with diverse group I activation of mutant IDH1 in the coupled kinase and mutant and II TKs (Fig. 2D, bottom; Supplementary Fig. S3B). IDH1 activity assays (Fig. 1F). Similar results were obtained We purified monomeric and dimeric IDH1 proteins using using purified rIDH1 WT proteins incubated with rFLT3 a sucrose density ultracentrifugation approach (Fig. 2E, (group II) or rFGFR1 (group I), where Y391F or Y42F muta- top). We found that the majority of recombinant IDH1 tions exclusively abolished FLT3 or FGFR1-enhanced activa- R132H proteins were monomers, whereas phosphorylation tion of IDH1 WT, respectively (Supplementary Fig. S1C). by FGFR1 (group I) resulted in a shift to dimer formation Further studies confirmed that group I TKs, including EGFR (Fig. 2E, middle). This shift was abolished when using rIDH1 and JAK2 (Fig. 1G, left) as well as ABL1, FGFR3, c-MET, and R132H/Y42F mutant but retained using rIDH1 R132H/ PDGFR (Supplementary Fig. S2A), enhanced activation of Y391F mutant (Fig. 2E, bottom two plots). Similar results IDH1 R132H mutant by phosphorylating Y42, whereas group were obtained using rIDH1 WT, Y42F, and Y391F proteins II TK Src enhanced activation of mutant IDH1 through incubated with FGFR1 (Supplementary Fig. S3C). Y391 phosphorylation (Fig. 1G, right). Similar results were We next determined the underlying mechanism by which Y42 obtained using IDH1 WT proteins incubated with diverse TKs phosphorylation–enhanced dimer formation contributes to (Supplementary Fig. S2B–S2C). These data demonstrate that IDH1 activation. We separated monomeric and dimeric IDH1 two groups of TKs enhance activation of IDH1 WT or R132H R132H mutant or WT proteins on native gels (Fig. 3A, bottom). mutant in the same manner through preferential phospho- The gels loaded with IDH1 R132H mutant or WT proteins rylation of Y42 or Y391 of IDH1 despite mutational status, were incubated with 14C-labeled αKG or 3H-labeled isocitrate,

Figure 2. Y42 phosphorylation of IDH1 by group I TKs promotes protein dimerization. A, Purified dimers and monomers of FLAG-IDH1 R132H mutant or FLAG-IDH1 wild-type (IDH1 WT) by sucrose density ultracentrifugation were applied to IDH1 R132H or WT enzyme activity assays, respectively (top). Dimeric and monomeric forms of IDH1 were applied to native PAGE and detected by Coomassie Brilliant Blue (CBB) staining (bottom). B, FLAG-IDH1 R132H mutant (left) and FLAG-IDH1 WT (right) protein samples containing different compositions of purified dimeric and monomeric IDH1 by sucrose density ultracentrifugation were applied to IDH1 R132H or WT enzyme activity assays, respectively (top). Dimeric and monomeric forms of IDH1 were applied to native PAGE and detected by CBB staining (bottom). C, Purified FLAG-IDH1 R132H mutant (left) and FLAG-IDH1 WT (right) proteins were incubated with recombinant active form of group I TKs, including rFGFR1, rMET, and rEGFR, and group II TKs, including rFLT3 and rSrc, respectively. Dimeric and monomeric IDH1 proteins as well as tyrosine phosphorylation of IDH1 in each treated group were determined by Western blotting. D, Puri- fied FLAG-IDH1 R132H variants (top) and FLAG-IDH1 variants (bottom) were incubated with recombinant active form of group I TK rFGFR1 or group II TK rFLT3 in an in vitro kinase assay. Dimeric and monomeric IDH1 proteins as well as tyrosine phosphorylation of IDH1 proteins in each treated group were determined by Western blotting (left top and bottom and right top and bottom, respectively). In group II TK treatment, purified IDH1 WT and IDH1 R132H proteins incubated with or without group I TK FGFR1 were used as positive controls. E, IDH1 R132H (top), IDH1 R132H-Y42F (middle), and IDH1 R132H- Y391F (bottom) proteins were incubated with active rFGFR1 prior to sucrose density ultracentrifugation. Collected fractions were applied to PAGE, followed by CBB staining. The error bars represent mean values ± SD from three replicates of each sample (***, P < 0.001). Data are mean ± SD; P values were obtained by a two-tailed Student test.

760 | CANCER DISCOVERY JUNE 2019 www.aacrjournals.org

Tyrosine Phosphorylation Activates IDH1 and R132H Mutant RESEARCH ARTICLE

A IDH1 R132H IDH1 WT B IDH1 R132H IDH1 WT

120 *** 120 *** 120 120 100 100 100 100 activity (%) 80 80 80 80 60 60 WT IDH1 R132H 60 60 40 IDH1 R132H

activity (%) 40 40 IDH1 40 activity (%) 20 20 20 20 Relative Relative 0 0 Relative

0 Relative 0 Relative IDH1 WT activity (%) IDH1 Relative

Dimer Dimer Dimer (%) 100 80 60 40 20 0 Dimer (%) 100 80 60 40 20 0 Monomer Monomer Monomer (%) 0 20 40 60 80 100 Monomer (%) 0 20 40 60 80 100 IDH1 R132H IDH1 IDH1 R132H IDH1 dimer dimer dimer dimer

IDH1 R132H IDH1 IDH1 R132H IDH1 monomer monomer monomer monomer CBB CBB CBB native gelCBB native gel native gel native gel

C IDH1 R132H IDH1 WT Group I Group II Group IGroup II

rFLAG-IDH1 R132H + ++ ++++++ +++ rFLAG-IDH1 WT ++++++ ++++++ rFGFR1 −+−−−− −+−−−− rFGFR1 −+−−−− −+−−−− rMET −−−+−− −−−−−− rMET −−−+−− −−−−−− rEGFR −−−−−+ −−−−−− rEGFR −−−−−+ −−−−−− rFLT3 −−−−−− −−−+−− rFLT3 −−−−−− −−−+−− rSrc −−−−−− −−−−−+ rSrc −−−−−− −−−−−+ IDH1 R132H dimer IDH1 dimer

FLAG FLAG IDH1 R132H monomer IDH1 monomer Native gel Native gel

pEGFR pEGFR pSrc pSrc pTyr pMET pTyr pMET pFGFR1 pFGFR1 pIDH1 R132H pIDH1

pY42 pIDH1 R132H Y42 pY42 pIDH1 Y42

pIDH1 R132H Y391 pIDH1 Y391 pY391 pY391

FLAG rFLAG-IDH1 FLAG rFLAG-IDH1 R132H

In vitro kinase assay In vitro kinase assay

DEIDH1 R132H Group IGroup II 1 13.75% rFLAG-IDH1 R132H + Y42F Y391F rFLAG-IDH1 R132H ++Y42F Y391F 2 17.00% 3 20.25% rFGFR1 −−+ +− + rFLT3 −−+ +− + −− 4 23.50% rFGFR1 −−− −− − −+ 5 26.75% 6 30.00% IDH1 R132H 7 33.25% IDH1 R132H dimer dimer 8 36.00% FLAG FLAG Sucrose density IDH1 R132H IDH1 R132H ultracentrifugation monomer monomer Native gel Native gel pFGFR1 pFLT3 Monomer Dimer pTyr pIDH1 R132H pTyr pIDH1 R132H #1 #2 #3 #4 #5 #6 #7 #8 pIDH1 pY42 pIDH1 R132H Y42 rIDH1 R132H R132H Y42 pY42 rFLAG-IDH1 rIDH1 R132H FLAG R132H pY391 pIDH1 R132H Y391 + rFGFR1 CBB In vitro kinase assay rFLAG-IDH1 FLAG R132H Monomer Dimer In vitro kinase assay IDH1 WT #1 #2 #3 #4 #5 #6 #7 #8 Group IGroup II rIDH1 R132H Y42F rFLAG-IDH1 WT ++Y42F Y391F rFLAG-IDH1 WT Y42F Y391F + rIDH1 R132H Y42F rFGFR1 −++ −+− rFLT3 −++ −+−−− + rFGFR1 rFGFR1 −−− −−−−+ CBB IDH1 IDH1 dimer dimer Monomer Dimer FLAG FLAG

IDH1 IDH1 #1 #2 #3 #4 #5 #6 #7 #8 monomer monomer Native gel Native gel rIDH1 R132H Y391F pFLT3 pFGFR1 rIDH1 R132H Y391F pTyr pTyr pIDH1 + rFGFR1 pIDH1 CBB

pY42 pIDH1 Y42 pY42 pIDH1 Y42

FLAG rFLAG-IDH1 pY391 pIDH1 Y391

In vitro kinase assay FLAG rFLAG-IDH1

In vitro kinase assay

JUNE 2019 CANCER DISCOVERY | 761

RESEARCH ARTICLE Chen et al. respectively. The binding ability of 14C-αKG or 3H-isocitrate IDH1 activation by affecting cofactor NADP+ binding. To test to monomeric/dimeric IDH1 R132H mutant or IDH1 WT this hypothesis, we performed an NADP+ binding experiment proteins, respectively, was assessed by scintillation counting of using Blue Sepharose CL-6B (Sigma-Aldrich). CL-6B mimics excised gel bands containing radiolabeled IDH1 monomers or NADP+ and is a pseudo-affinity ligand of many dehydroge- dimers (Fig. 3A). The results of this “overlay” assay suggested nases using NADP+ as a substrate. We found that incubation that αKG or isocitrate as substrates demonstrated higher bind- of group II TKs, including rFLT3 or rSrc, but not group I TKs, ing ability to dimeric IDH1 R132H mutant or IDH1 WT pro- including rFGFR1, rMET, or rEGFR, resulted in a significant teins, respectively, compared with corresponding monomers of increase in the amount of IDH1 protein bound to the CL-6B IDH1 proteins (Fig. 3A, left and right, respectively), suggesting agarose beads, indicating increased binding between IDH1 IDH1 dimer formation promotes substrate binding. and NADP+ (Fig. 3E), suggesting the Y391 phosphorylation Moreover, incubation with group I TKs, including rMET by group II TKs may contribute to cofactor NADP+ binding and rEGFR, but not group II TKs, including rFLT3 and rSrc, to IDH1. This was further confirmed by incubation of diverse promoted 14C-αKG binding to IDH1 R132H mutant, whereas group II or I kinases with IDH1 WT, Y42F, or Y391F mutant control IDH1 WT showed minimal binding ability to 14C-αKG, proteins, where Src and FLT3 (group II TKs; Fig. 3F), but not which was not altered when phosphorylated by group I TK FGFR1, EGFR, or MET (group I; Fig. 3G), were able to pro- rMET or group II TK rFLT3 (Fig. 3B, left). In contrast, incu- mote binding of IDH1 WT and Y42F mutant but not Y391F bation with group I TKs, including rFGFR1, rEGFR, rMET, mutant proteins to CL-6B agarose beads. and rPDGFR, but not group II TKs, including rFLT3 and Further kinetics studies confirmed that, in the presence of rSrc, promoted 3H-isocitrate binding to IDH1 WT, whereas increasing concentrations of isocitrate as a substrate, phospho- control IDH1 R132H mutant showed minimal binding ability rylation of IDH1 WT and Y391F mutant but not Y42F mutant to 3H-isocitrate, which was not altered when phosphorylated by FGFR1 (group I TK) resulted in increased Vmax values (Fig. by group I TK rFGFR1 or group II TK rFLT3 (Fig. 3B, right). 4A, top two plots) with decreased Km values for isocitrate (Fig. This was further confirmed by incubation of diverse group 4A, bottom two plots), suggesting that Y42 phosphorylation I or II TKs with IDH1 R132H mutant proteins with or with- by group I TKs enhances IDH1 WT activation by promoting out Y42F or Y391F mutation, where FGFR1 (Fig. 3C, left), substrate binding. In contrast, in the presence of increasing EGFR, MET, and PDGFR (Supplementary Fig. S4A, top plots; concentrations of NADP+ as a cofactor, although phospho- group I TKs) but not FLT3 (Fig. 3C, right) or Src (Supple- rylation of IDH1 WT and Y391F mutant but not Y42F mutant mentary Fig. S4A, lower; group II TKs) were able to promote by FGFR1 resulted in increased Vmax values (Fig. 4B, top two 14C-αKG binding to IDH1 R132H mutant and R132H/Y391F plots), Km values for NADP+ as a cofactor were not altered but not R132H/Y42F proteins through tyrosine phosphoryla- among IDH1 variants (Fig. 4B, bottom two plots), suggesting tion, whereas IDH1 WT as a negative control showed minimal that Y42 phosphorylation does not affect cofactor binding. binding ability to 14C-αKG, which was not altered when phos- Furthermore, in the presence of increasing concentrations of phorylated by group I or II TKs (Fig. 3C; Supplementary Fig. isocitrate as a substrate, despite the increased Vmax values due S4A). Similar results were obtained using IDH1 WT, Y42F, and to phosphorylation of IDH1 WT and Y42F mutant but not Y391F proteins incubated with diverse group I and II TKs in Y391F mutant by FLT3 (group II; Fig. 4C, top two plots), the the presence of 3H-isocitate (Fig. 3D; Supplementary Fig. S4B). Km values for isocitrate remained unaltered (Fig. 4C, bottom two plots), whereas in the presence of increasing concentra- + Y391 Phosphorylation Enhances Cofactor NADP tions of NADP+ as a cofactor, phosphorylation of IDH1 WT Binding to IDH1 and Y42F mutant but not Y391F mutant by FLT3 resulted in In multiple structures of IDH1, the location of Y391 is increased Vmax values (Fig. 4D, top two plots) with decreased proximal to the NADP+ binding site (approximately 10Å); we Km values for NADP+ as a cofactor (Fig. 4D, bottom two plots). thus hypothesized that Y391 phosphorylation may enhance These data suggest that Y391 phosphorylation by group II TKs

Figure 3. Mutant and WT IDH1 dimer formation contributes to the binding ability to its substrates αKG and isocitrate, respectively. A, Dimeric and monomeric IDH1 R132H or IDH1 WT proteins were separated on native gel and detected by CBB staining (bottom). Bands containing dimeric or monomeric IDH1 R132H proteins were excised and applied to labeled αKG (14C-αKG) binding assay. The amount of mutant IDH1 protein–bound 14C-αKG was assessed by scintillation counting followed by quantitative analysis (top left). Bands containing dimeric or monomeric IDH1 WT proteins were excised and applied to labeled isocitrate (3H-isocitrate) binding assay. The amount of IDH1 WT-bound 14H-isocitrate was assessed by scintillation counting followed by quantitative analysis (top right). B, Left, purified IDH1 R132H proteins were incubated with or without recombinant active form of group I TKs rMET and rEGFR or group II TKs rFLT3 and rSrc, followed by 14C-αKG binding assay (purified IDH1 WT proteins incubated with or without group I TK rMET or group II TK rFLT3 were used as negative controls). Right, purified IDH1 WT proteins were incubated with or without purified recombinant active group I TKs rFGFR1, rEGFR, and rMET or group II TKs Src and FLT3, followed by isocitrate (3H-isocitrate) binding assay. Purified IDH1 R132H proteins incubated with or without group I TK rFGFR1 or group II TK rFLT3 were used as negative controls. C, Purified FLAG-IDH1 R132H variants were incubated with recombinant active form of group I TK rFGFR1 and group II TK rFLT3, respectively, followed by labeled αKG (14C-αKG) binding assays (left and right, respectively). Purified IDH1 WT protein was used as a negative control. D, Purified FLAG-IDH1 variants were incubated with a recombinant active form of group I TK rFGFR1 and group II TK rFLT3, respectively, followed by 3H-isocitrate binding assays (left and right, respectively). Purified IDH1 R132H protein was used as a negative control. E, Purified FLAG-IDH1 WT proteins were incubated with recombinant active group I TKs, including rFGFR1, rMET, and rEGFR, and group II TKs, including rFLT3 and rSrc, respectively, followed by incubation with Blue Sepharose CL-6B beads that mimic NADP+ binding. Bound IDH1 proteins and tyrosine phosphorylation of IDH1 were determined by Western blotting. F–G, Purified FLAG-IDH1 WT, FLAG-IDH1 Y391F, and FLAG-IDH1 Y42F mutant proteins were incubated with a recombinant active form of group II TKs, including rSrc and rFLT3 (F), and group I TKs rFGFR1, rEGFR, and rMET (G), followed by incubation with CL-6B beads that mimic NADP+ binding. Bound IDH1 proteins and tyrosine phosphorylation of IDH1 were determined by Western blotting. Phosphorylation of FLAG IDH1 WT by rSrc was performed in G as a positive control. The error bars represent mean values ± SD from three replicates of each sample (**, 0.01 < P < 0.001; ***, P < 0.001; ns, not significant). Data are mean± SD; P values were obtained by a two-tailed Student test.

762 | CANCER DISCOVERY JUNE 2019 www.aacrjournals.org

Tyrosine Phosphorylation Activates IDH1 and R132H Mutant RESEARCH ARTICLE

A IDH1 R132H IDH1 WT B ** *** *** ns 4 ns 4 *** 16 *** 16 *** 3.5 *** 3.5 3 12 12 3 2.5 2.5 8 8 2 2 C- α -KG binding C- α -KG binding H-isocitrate binding 14 1.5 3 1.5 (fold change) (fold 14 H-isocitrate binding (fold change) (fold 4 3 4 (fold change) (fold (fold change) (fold 1 1 0.5 0.5 0 0 Relative Relative 0 Relative 0 Relative Relative

Relative Relative rFLAG-IDH1 R132H + ++++−−− rFLAG-IDH1 WT +++++ +−− − Dimer Dimer rFLAG-IDH1 WT − −−−−+++ rFLAG-IDH1 R132H − −−− − −++ + Monomer Monomer −− − − IDH1 R132H IDH1 WT rSrc rSrc IDH1 rMET rEGFR rFLT3 rMET rFLT3 rEGFR rMET rFLT3 rFLT3 IDH1 R132H dimer rFGFR1 rFGFR1 dimer FLAG rFLAG-IDH1 FLAG rFLAG-IDH1 IDH1 R132H IDH1 monomer monomer CBB CBB native gel native gel C IDH1 R132H Group I Group II 4 *** ns *** ns 4 3.5 3.5 3 3 2.5 2.5 2 2 C- α -KG binding C- α -KG binding ns ns ns ns 14 1.5 14 1.5

(fold change) (fold 1 change) (fold 1 0.5 0.5 0 0 Relative Relative Relative Relative rFLAG-IDH1 R132H + Y42F Y391F rFLAG- rFLAG-IDH1 R132H + Y42F Y391F rFLAG- IDH1 WT IDH1 WT rFGFR1 +− −++ −+− rFLT3 −++ −+−+−

FLAG rFLAG-IDH1 FLAG rFLAG-IDH1

D IDH1 WT Group I Group II 4 ns ns 4 3.5 *** *** 3.5 3 3 2.5 2.5 ns ns ns ns H-isocitrate 2 H-isocitrate 2 3 1.5 3 1.5 1 1 0.5 0.5 binding (fold change) binding (fold binding (fold change) binding (fold Relative Relative 0 Relative 0 rFLAG-IDH1 WT + Y42F Y391F rFLAG- rFLAG-IDH1 WT + Y42F Y391F rFLAG- IDH1 R132H IDH1 R132H rFGFR1 +− −++ −+− rFLT3 −++ −+−+−

FLAG rFLAG-IDH1 FLAG rFLAG-IDH1

EFGroup I Group II rFLAG-IDH1 WT + +++++++++ rFGFR1 −+−−−−−−−− Group II rMET −−−+−−−−−− rEGFR −−−−−+−−−− rFLAG-IDH1 WT + Y391F Y42F rFLAG-IDH1 WT + Y391F Y42F rFLT3 −−−−−−−+−− rSrc −++ −+− rFLT3 −++ −+− rSrc −−−−−−−−−+ FLAG rFLAG-IDH1 FLAG rFLAG-IDH1 FLAG rFLAG-IDH1 CL-6B CL-6B CL-6B pSrc pFLT3 pTyr pIDH1 p-Tyr pIDH1 pTyr pIDH1 pY391 pIDH1 Y391 p-Y391 pIDH1 Y391

FLAG rFLAG-IDH1 FLAG rFLAG-IDH1 pY42 pIDH1 Y42

pY391 pIDH1 Y391

FLAG rFLAG-IDH1

G Group I rFLAG-IDH1 WT ++Y391F Y42F rFLAG-IDH1 WT ++Y391F Y42F + rFLAG-IDH1 WT Y391F Y42F + rFGFR1 −+−+−+−− rEGFR −+−+−+−− rMET −++ −+−−− rSrc −−−−−−−+ rSrc −−−−−−−+ rSrc −−− −−−+− FLAG rFLAG-IDH1 FLAG rFLAG-IDH1 FLAG rFLAG-IDH1

CL-6B CL-6B CL-6B

pSrc pEGFR pMET/Src pTyr pIDH1 pTyr pSrc pTyr pIDH1 pIDH1 pFGFR1

pY42 pIDH1 Y42 pY42 pIDH1 Y42 pY42 pIDH1 Y42

pY391 pIDH1 Y391 pY391 pIDH1 Y391 pY391 pIDH1 Y391

FLAG rFLAG-IDH1 FLAG rFLAG-IDH1 FLAG rFLAG-IDH1

JUNE 2019 CANCER DISCOVERY | 763

RESEARCH ARTICLE Chen et al.

A ns B IDH1 WT IDH1 WT + FGFR1 IDH1 WT IDH1 WT FGFR1 ** ** 200 ns + 150 IDH1 Y42F IDH1 Y42F + FGFR1 ** ** IDH1 Y42F IDH1 Y42F + FGFR1 IDH1 Y391F IDH1 Y391F + FGFR1 IDH1 Y391F IDH1 Y391F + FGFR1 1.5 150 1.0 100 100 0.8 1.0 50 50

0.6 Vmax (%) Relative Relative Vmax (%) Relative

0.4 0 0.5 0 FGFR1 −−+ +−+ V (OD/min/mg) FGFR1 −−+ +−+ V (OD/min/mg) 0.2 IDH1 + Y42F Y391F IDH1 + Y42F Y391F 150 ns 150 0.0 ** ** 0.0 ns ns ns 050 100 150 200 050 100 150 200 Isocitrate (µmol/L) NADP + (µmol/L) 100 100 Vmax Vmax IDH1 FGFR1 Km (µmol/L) IDH1 FGFR1 Km (µmol/L) Km (%) (OD/min/mg) (OD/min/mg) WT − 0.85 ± 0.05 63.20 ± 13.80 50 WT − 0.72 ± 0.07 56.47 ± 7.23 50 Relati ve WT + 1.15 ± 0.04 32.93 ± 14.42 Km (%) Relative WT + 1.16 ± 0.09 52.13 ± 5.70 Y42F − 0.88 ± 0.06 66.16 ± 14.92 Y42F − 0.72 ± 0.06 52.87 ± 5.50 Y42F + 0.86 0.06 62.93 14.74 Y42F + 0.70 ± 0.09 51.73 ± 9.03 ± ± 0 0 Y391F Y391F − 0.73 0.05 − 0.87 ± 0.05 65.17 ± 15.71 FGFR1 −−+ +−+ ± 51.61 ± 5.16 FGFR1 −−+ +−+ Y391F + 1.16 ± 0.05 36.35 ± 13.11 Y391F + 1.12 ± 0.09 58.20 ± 6.07 IDH1 + Y42F Y391F IDH1 + Y42F Y391F

ns CDIDH1 WT IDH1 WT + FLT3 ** ** IDH1 WT IDH1 WT + FLT3 200 ** ** ns IDH1 Y42F IDH1 Y42F + FLT3 150 IDH1 Y42F IDH1 Y42F + FLT3 IDH1 Y391F IDH1 Y391F + FLT3 1.5 IDH1 Y391F IDH1 Y391F + FLT3 150 1.0 100 0.8 100

Vmax (%) 1.0

0.6 50 50 Relative Vmax (%) Relative Relati ve 0.4 0.5 V (OD/min/mg)

V (OD/min/mg) 0 0 0.2 FLT3 − + −+ −+ FLT3 −++ −+− WT Y42F Y391F IDH1 + Y42F Y391F IDH1 0.0 0.0 ns 050 100 150 200 150 050 100 150 200 150 ** ** ns ns ns Isocitrate (µmol/L) NADP + (µmol/L)

100 100 Vmax Vmax IDH1 FLT3 Km (µmol/L) IDH1 FLT3 Km (µmol/L) (OD/min/mg) (OD/min/mg) WT − 0.79 ± 0.04 58.91 ± 8.47 50 WT − 0.81 ± 0.06 40.87 ± 8.65 50 Relative Km (%) Relative WT + 1.13 ± 0.02 54.12 ± 3.09 Km (%) Relative WT + 1.26 ± 0.05 28.28 ± 4.48 Y42F − 0.80 ± 0.05 61.79 ± 9.72 Y42F − 0.83 ± 0.07 44.11 ± 10.41 Y42F + 1.15 ± 0.03 56.65 ± 3.46 Y42F + 0 1.29 ± 0.05 28.27 ± 4.03 0 Y391F − 0.76 ± 0.04 54.78 ± 8.49 Y391F − FLT3 − + −+ −+ 0.79 ± 0.06 40.75 ± 10.17 FLT3 −−+ +−+ Y391F + 0.68 ± 0.04 58.17 ± 7.33 Y391F + 0.79 ± 0.06 44.97 ± 8.86 IDH1 + Y42F Y391F IDH1 + Y42F Y391F

Figure 4. Y42 phosphorylation promotes substrate binding, whereas Y391 phosphorylation promotes cofactor binding to enhance IDH1 WT and IDH1 R132H activation. A–D, Vmax and Km of IDH1 WT were measured using purified FLAG-IDH1 and variants incubated with a recombinant active form of group I TK rFGFR1 (A and B) or group II TK rFLT3 (C and D) in the presence of increasing concentrations of isocitrate (A and C) or NADP+ (B and D), respectively, followed by IDH1 WT enzyme activity assay. Vmax and Km values of each treated group were calculated (bottom left) and plotted (top left). Right two plots represent the relative value of Vmax and Km in each treatment. (continued on following page) enhances IDH1 WT activation by promoting cofactor but not but not Y391F phosphorylated by FLT3 (group II) also showed substrate binding. enhanced activation, which was eliminated by PTP (Supple- Similar results were obtained using IDH1 R132H mutant mentary Fig. S5A, right). Consistent with these findings, treat- proteins phosphorylated by FGFR1 or FLT3 in the presence ment of IDH1 immunoprecipitates from MOLM-14 cells with of increasing concentrations of αKG or NADPH (Fig. 4E–H). PTP resulted in decreased IDH1 enzyme activity with reduced These results together also demonstrate that the Y42F and tyrosine phosphorylation (Supplementary Fig. S5B, top left), Y391F mutations do not affect intrinsic enzyme properties of and PTP treatment of MOLM-14 cell lysates resulted in a IDH1 WT or IDH1 R132H mutant. decrease in the amount of dimeric IDH1 proteins (Supplemen- tary Fig. S5B, bottom left). Similar results were obtained using Y42 Phosphorylation Occurs in IDH1 Monomers, IDH1 immunoprecipitates from MOLM-14 cells treated with Promoting Dimer Formation, but Attenuates Dimer the FLT3 inhibitor TKI258 (Supplementary Fig. S5B, right). Disruption, Whereas Y391 Phosphorylation Occurs We sought to determine whether Y42 and Y391 can be in Both Monomeric and Dimeric IDH1, Enhancing phosphorylated in monomeric and/or dimeric IDH1. Interest- Cofactor Binding ingly, we found that Y42 phosphorylation by FGFR1 (group In order to confirm whether TKs enhance IDH1 activa- I) occurred only in purified monomeric IDH1 WT protein, tion predominantly through tyrosine phosphorylation, we leading to increased dimer formation from IDH1 monomers performed an in vitro kinase assay followed by protein Tyr accompanied with enhanced enzyme activity, whereas puri- phosphatase (PTP) treatment. We found that rIDH1 WT fied dimeric IDH1 WT protein treated with FGFR1 was not but not Y42F phosphorylated by FGFR1 (group I) showed phosphorylated at Y42 with unaltered dimer amount and enhanced enzyme activity, which was abolished by PTP treat- enzyme activity (Fig. 5A). In contrast, Y391 phosphorylation ment (Supplementary Fig. S5A, left). In addition, rIDH1 WT by FLT3 (group II) occurred in both purified monomeric and

764 | CANCER DISCOVERY JUNE 2019 www.aacrjournals.org

Tyrosine Phosphorylation Activates IDH1 and R132H Mutant RESEARCH ARTICLE

EFns ** ** IDH1 R132H IDH1 R132H + FGFR1 IDH1 R132H IDH1 R132H FGFR1 250 200 + ns IDH1 R132H Y42F IDH1 R132H Y42F + FGFR1 ** ** IDH1 R132H Y42F IDH1 R132H Y42F + FGFR1 200 IDH1 R132H Y391F IDH1 R132H Y391F + FGFR1 150 IDH1 R132H Y391F IDH1 R132H Y391F + FGFR1 150 100 1.5 100 1.0 50

0.8 Vmax (%) Relative Relative Vmax (%) Relative 50 1.0 0 0.6 0 FGFR1 − + −+ −+ FGFR1 −++ −+− IDH1 R132H + Y42F Y391F 0.4 IDH1 R132H + Y42F Y391F V (OD/min/mg) 0.5

150 V (OD/min/mg) 150 ns 0.2 ** ** ns ns ns 0.0 0.0 0 500 1,000 100 0246810 100 α-KG (µmol/L) NADPH (µmol/L) IDH1 Vmax IDH1 Vmax FGFR1 Km (µmol/L) FGFR1 Km (µmol/L) R132H (OD/min/mg) 50 R132H (OD/min/mg) 50 Relative Km (%) Relative Relative Km (%) Relative WT − 0.85 ± 0.08 523.0 ± 55.9 WT − 0.70 ± 0.01 0.81 ± 0.02 WT + 1.50 ± 0.10 380.2 ± 33.5 WT + 0.99 ± 0.01 0.79 ± 0.04 Y42F − 0 0 0.88 ± 0.07 542.6 ± 49.8 Y42F − 0.70 ± 0.01 0.80 ± 0.03 FGFR1 − + −+ −+ −−+ +−+ Y42F + 0.86 ± 0.07 532.8 ± 47.8 Y42F + 0.70 ± 0.01 0.80 ± 0.03 FGFR1 Y391F − 0.87 ± 0.09 562.5 ± 63.9 IDH1 R132H + Y42F Y391F Y391F − 0.71 ± 0.01 0.81 ± 0.04 IDH1 R132H + Y42F Y391F Y391F + 1.43 ± 0.09 339.6 ± 31.3 Y391F + 0.98 ± 0.01 0.80 ± 0.04

G IDH1 R132H IDH1 R132H + FLT3 ns 250 ns H IDH1 R132H IDH1 R132H + FLT3 200 ** ** ** ** IDH1 R132H Y42F IDH1 R132H Y42F + FLT3 IDH1 R132H Y42F IDH1 R132H Y42F + FLT3 200 IDH1 R132H Y391F IDH1 R132H Y391F + FLT3 IDH1 R132H Y391F IDH1 R132H Y391F + FLT3 150 150 1.5

Vmax (%) 100 Vmax (%) 1.0 100 0.8 50 Relati ve 1.0 Relati ve 50

0 0.6 0 FLT3 −++ −+− FLT3 − + −+ −+ 0.4 IDH1 R132H + Y42F Y391F 0.5 IDH1 R132H + Y42F Y391F V (OD/min/mg)

V (OD/min/mg) 0.2 150 ns ns ns 150 ns 0.0 ** ** 0.0 0 500 1,000 0246810 α-KG (µmol/L) 100 NADPH (µmol/L) 100

IDH1 Vmax IDH1 Vmax FLT3 Km (µmol/L) FLT3 Km (µmol/L) R132H (OD/min/mg) 50 R132H (OD/min/mg) 50 Relative Km (%) Relative WT − 0.87 ± 0.08 519.0 ± 108.4 WT − 0.69 ± 0.01 0.86 ± 0.02 Km (%) Relative WT + 1.65 ± 0.10 528.3 ± 62.4 WT + 0.93 ± 0.01 0.65 ± 0.02 Y42F − 0.88 ± 0.07 531.6 ± 109.5 0 Y42F − 0.68 ± 0.01 0.86 ± 0.04 0 Y42F + 1.66 ± 0.11 520.9 ± 74.5 FLT3 − + −+ −+ Y42F + 0.92 ± 0.01 0.65 ± 0.02 FLT3 −−+ +−+ Y391F − 0.88 ± 0.10 535.7 ± 119.5 Y391F − 0.70 ± 0.01 0.86 ± 0.05 IDH1 R132H + Y42F Y391F IDH1 R132H + Y42F Y391F Y391F + 0.83 ± 0.08 533.9 ± 111.2 Y391F + 0.68 ± 0.01 0.82 ± 0.05

Figure 4. (Continued) E–H, Vmax and Km of IDH1 R132H were measured using purified FLAG-IDH1 R132H and variants incubated with a recombinant active form of group I TK rFGFR1 (E and F) or group II TK rFLT3 (G and H) in the presence of increasing concentrations of αKG (E and G) or NADPH (F and H), respectively, followed by an IDH1 R132H enzyme activity assay. Vmax and Km values of each treated group were calculated (bottom left) and plotted (top left). Right two plots represent the relative value of Vmax and Km in each treatment. The error bars represent mean values ± SD from three replicates of each sample (**, 0.01 < P < 0.001; ns, not significant). Data are mean± SD; P values were obtained by a two-tailed Student test. dimeric IDH1 WT proteins (Fig. 5B). However, Y391 phospho- WT or R132H mutant proteins, whereas Y42 phosphoryla- rylation of IDH1 monomers did not promote dimer formation tion of monomeric IDH1 WT or R132H mutant proteins or enhance enzyme activity, whereas Y391 phosphorylation by FGFR1 resulted in enhanced dimer formation (Fig. 5F, of IDH1 dimers enhanced enzyme activity despite unaltered left halves of left and right, respectively). In addition, puri- dimer amount, which is likely due to increased cofactor NADP+ fied, recombinant dimeric IDH1 WT or R132H mutant pro- binding. Indeed, incubation of rFLT3 resulted in increased teins spontaneously disrupt to form inactive monomers in Y391 phosphorylation of both monomeric and dimeric IDH1 a time-dependent manner (Fig. 5G, right halves of left and WT proteins, with a significant increase in the amount of right, respectively), whereas dimeric IDH1 WT or R132H both monomeric and dimeric IDH1 proteins bound to the mutant proteins purified from IDH1 proteins incubated CL-6B agarose beads, indicating increased binding between with rFGFR1, which contained Y42-phosphorylated dimers Y391-phosphorylated monomeric and dimeric IDH1 and that were likely formed from Y42-phosphorylated monomers, NADP+ (Fig. 5C). Similar results were obtained using purified showed attenuated dimer disruption to form monomeric monomeric and dimeric IDH1 R132H proteins incubated with IDH1 proteins (Fig. 5G, left halves of left and right, respec- rFGFR1 or rFLT3 (Fig. 5D and E). tively). These data together suggest that Y42 phosphorylation We next determined whether Y42 phosphorylation affects occurs in IDH1 monomers, which promotes dimer forma- dimer formation from monomers and/or dimer disruption tion, and once Y42-phosphorylated monomers form dimers, to monomers. We found that purified, recombinant mono- Y42 phosphorylation attenuates dimer disruption. meric IDH1 WT or R132H mutant proteins spontaneously IDH1 mutations exist as heterozygous mutations in AML form dimers in a time-dependent manner (Fig. 5F, right (5–7, 14, 15), and R132H/WT heterodimers were suggested halves of left and right, respectively), which explains the to be more efficient than R132H homodimers in 2-HG (23). basal levels of enzyme activity of nonphosphorylated IDH1 To determine the effect of Y42 phosphorylation on IDH1

JUNE 2019 CANCER DISCOVERY | 765

RESEARCH ARTICLE Chen et al.

A IDH1 WT BCIDH1 WT D *** IDH1 R132H 8 ns 8 IDH1 WT 7 ns 7 Monomer Dimer 8 6 6 7 5 5 rFLT3 −++ − 6 4 4 5 3 *** 3 ns FLAG IDH1 4 *** 2 2 activity (fold)

activity (fold) 3 Relative IDH1 Relative 1 IDH1 Relative 1 CL-6B 2 0 0 activity (fold) Monomer Dimer Monomer Dimer pTyr pIDH1 1 0 Relative IDH1 R132H Relative rFGFR1 −++ − rFLT3 −++ − Monomer Dimer FLAG IDH1 rFGFR1 −++ − IDH1 IDH1 dimer dimer SDS-PAGE gel pIDH1 dimer IDH1 R132H IDH1 IDH1 dimer pTyr FLAG IDH1 monomer IDH1 pIDH1 monomer monomer IDH1 R132H pIDH1 Y42 IDH1 dimer monomer dimer pIDH1 Y391 dimer FLAG pIDH1 R132H Y42 dimer pY42 pY391 IDH1 monomer pY42 pIDH1 Y42 Native gel monomer pIDH1 Y391 monomer pIDH1 R132H Y42 monomer Native gel Native gel Native gel

IDH1 R132H E F IDH1 WT dimer formation IDH1 R132H dimer formation *** 8 rFGFR1 +− +− 7 Time 1 h 2 h 4 h8 h 12 h1 h2 h4 h8 h 12 h 1 h2 h4 h8 h 12 h1 h2 h4 h8 h 12 h 6 5 IDH1 dimer 4 3 ns FLAG 2 activity (fold) 1 IDH1 monomer 0 Relative IDH1 R132H Relative Monomer Dimer rFLT3 −++ − pIDH1 dimer IDH1 R132H pY42 dimer pIDH1 monomer FLAG Native gel IDH1 R132H IDH1 WT dimer formation IDH1 R132H dimer formation monomer 25 rFGFR1− 25 rFGFR1− rFGFR1+ 20.2% rFGFR1+ pIDH1 R132H 20 20 19.6% Y391 dimer 16.5% 15 15 15.3% pY391 10 10 pIDH1 R132H Y391 monomer 5 5 Dimer/total IDH1 WT (%) Dimer/total IDH1

Native gel 0 Dimer/total IDH1 R132H (%) 0 0510 15 0510 15 Time (h) Time (h)

Figure 5. Activation of IDH1 is enhanced by distinct oncogenic TK cascades through direct and indirect phosphorylation. A–B, Purified IDH1 WT monomer and dimer were treated with recombinant active group I TK FGFR1 (A) or group II TK FLT3 (B), respectively, followed by IDH1 WT enzyme activity (top). Monomeric and dimeric IDH1 protein levels and tyrosine phosphorylation at Y42 and Y391 of IDH1 were detected by Western blotting using native PAGE (bottom). C, Purified IDH1 WT monomer and dimer were treated with or without recombinant active group II TK FLT3, followed by incubation with Blue Sepharose CL-6B beads that mimic NADP+ binding. Bound monomeric and dimeric IDH1 proteins and tyrosine phosphorylation of IDH1 were determined by Western blotting using native PAGE. D–E, Purified IDH1 R132H monomer and dimer were treated with recombinant active group I TK FGFR1 D( ) or group II TK FLT3 (E), respectively, followed by IDH1 R132H enzyme activity (top). Monomeric and dimeric IDH1 R132H protein levels and tyrosine phosphorylation at Y42 and Y391 of IDH1 R132H were detected by Western blotting using native PAGE (bottom). F–G, Purified monomeric IDH1 and IDH1 R132H F( ) or purified dimeric IDH1 and IDH1 R132H (G) were treated with recombinant active group I TK FGFR1 in a time-dependent manner, followed by native PAGE. (continued on following page) heterodimers, we purified monomers of FLAG-tagged IDH1 rylation by rFGFR1 resulted in increased heterodimer forma- and HA-tagged IDH1 R132H. The monomers were mixed in tion of IDH1/R132H (left) and IDH1 Y391F/R132H Y391F the presence and absence of recombinant FGFR1. Theoreti- (right), but not IDH1 Y42F/R132H Y42F (middle). Similar cally, the mixture contains FLAG-IDH1 and HA-IDH1 R132H results were obtained using FLAG-IDH1/HA-IDH1 R132H monomers, FLAG-IDH1 and HA-IDH1 R132H homodimers, heterodimers purified by sequential FLAG-HA pulldowns and heterodimers of FLAG-IDH1/HA-IDH1 R132H (Fig. 5H; detected by FLAG blotting (Fig. 5H, bottom right). Moreover, top left). FLAG pulldown enriched FLAG-IDH1 monomers, as shown in Fig. 5I, purified FLAG-IDH1/HA-IDH1 R132H FLAG-IDH1 homodimers, and FLAG-IDH1/HA-IDH1 R132H heterodimers spontaneously disrupt to form monomers in heterodimers (Fig. 5H; middle of left). The FLAG pulldown a time-dependent manner, whereas heterodimers formed by samples were applied either to native gel followed by Western FGFR1-phosphorylated monomers of FLAG-IDH1 and HA- blotting (Fig. 5H, top right), or to HA pulldown to further IDH1 R132H (left) or monomers of FLAG-IDH1 Y391F and purify the heterodimers (Fig. 5H; bottom left). As shown in Fig. HA-IDH1 R132H Y391F (right), but not monomers of FLAG- 5H, top right, HA blotting detected the FLAG-IDH1/HA-IDH1 IDH1 Y42F and HA-IDH1 R132H Y42F (middle), showed R132H heterodimers, and the results suggested that phospho- attenuated dimer disruption to monomers.

766 | CANCER DISCOVERY JUNE 2019 www.aacrjournals.org

Tyrosine Phosphorylation Activates IDH1 and R132H Mutant RESEARCH ARTICLE

G H FLAG- HA-IDH1 IDH1 R132H dimer disruption IDH1 IDH1 IDH1 IDH1 IDH1 IDH1 WT dimer disruption IDH1 R132H R132H + R132H Y42F + Y391F + IDH1 R132H Y42F Y391F rFGFR1 +−+− + rFGFR1 − + rFGFR1 −++ rFGFR1 − Time 0 h 2 h4 h8 h 12 h0 h2 h4 h8 h 12 h0 h2 h4 h8 h 12 h0 h2 h4 h8 h 12 h With/without FLAG-IDH1 FLAG-IDH1 FLAG-IDH1 IDH1 R132H FGFR1 WT/HA-IDH1 Y42F/HA-IDH1 Y391F/ HA-IDH1 dimer R132H R132H Y42F R132H Y391F HA HA HA FLAG heterodimer heterodimer heterodimer

IDH1 R132H Native gel Native gel Native gel monomer pIDH1 R132H HA HA HA dimer FLAG FLAG FLAG pY42 FLAG FLAG pulldown FLAG pulldown FLAG pulldown pIDH1 R132H pulldown monomer IDH1 IDH1 IDH1 IDH1 IDH1 IDH1 R132H R132H + R132H Y42F + Y391F + Native gel Western blot Y42F Y391F rFGFR1 −++ rFGFR1 −+rFGFR1 −

IDH1 WT dimer disruption IDH1 R132H dimer disruption FLAG-IDH1 FLAG-IDH1 FLAG-IDH1 WT/HA-IDH1 Y42F/HA-IDH1 Y391F/ HA-IDH1 110 rFGFR1− 110 rFGFR1− R132H R132H Y42F R132H Y391F rFGFR1+ FLAG FLAG FLAG rFGFR1+ heterodimer heterodimer heterodimer 100 100 HA Native gel Native gel Native gel pulldown

90 89.5% 90 89.2% Western blot FLAG FLAG FLAG 81.8% 82.0% Heterodimer 80 80 HA HA HA

Dimer/total IDH1 WT (%) Dimer/total IDH1 HA pulldown HA pulldown HA pulldown

70 Dimer/total IDH1 R132H (%) 70 0 510 15 0510 15 Time (h) Time (h)

I WT Y42F Y391F

IDH1 IDH1 IDH1 IDH1 IDH1 IDH1 IDH1 IDH1 IDH1 IDH1 IDH1 IDH1 R132H R132H R132H R132H R132H + R132H Y42F Y42F Y42F + Y42F Y391F Y391F Y391F + Y391F rFGFR1 ++−−+ − Time 0 h2 h4 h8 h12 h0 h2 h4 h8 h12 h0 h2 h4 h8 h12 h0 h2 h4 h8 h12 h0 h2 h4 h8 h12 h0 h2 h4 h8 h12 h Heterodimer FLAG Monomer

pHeterodimer pTyr pMonomer

110 FGFR1− 110 FGFR1− 110 FGFR1− FGFR1+ FGFR1+ FGFR1+ 100 100 100 87.0% 90.0% 90 90 90 87.6% 89.6% 80 80 80 80.9% 82.6% 70 70 70 0510 15 0 5 10 15 0 5 10 15

Heterodimer/total IDH1 (%) Time (h) Time (h) Time (h)

Figure 5. (Continued) Spontaneous dimer formation (F), monomer conversion (G), and tyrosine phosphorylation levels at Y42 of IDH1 and IDH1 R132H were detected by Western blotting. Bottom, density analysis of corresponding bands to assess dimer formation and monomer conversion in Western blotting. The ratio between homodimers and total IDH1 WT or mutant proteins was quantitatively determined based on density analyses of the Western blotting. H, Left, purified monomers of FLAG-tagged IDH1 and HA-tagged IDH1 R132H were mixed in the presence and absence of recombinant FGFR1, and different monomers and dimers in the mixture were indicated (top two plots, respectively). FLAG pulldown was performed to enrich FLAG-IDH1 containing monomers and homo- and heterodimers (middle), which were either applied to native gel followed by Western blotting (H, top right), or to HA pulldown to further purify the heterodimers (bottom left). Top right, FLAG-IDH1/HA-R132H heterodimers were detected by HA blotting in native gels. Bottom right, FLAG-IDH1/HA-R132H heterodimers purified by sequential FLAG-HA pulldowns were detected by FLAG blotting in native gels. I, Purified FLAG-IDH1/HA-IDH1 R132H heterodimers form by nonphosphorylated or FGFR1-phosphorylated monomers of FLAG-IDH1, and HA-IDH1 R132H variants spontaneously disrupt to form monomers in a time-dependent manner. Heterodimers and monomer conversions as well as tyrosine phosphorylation levels of dimeric and monomeric proteins were detected by Western blotting. The ratio between heterodimers and total IDH1 proteins was quantitatively determined based on density analyses of the Western blotting. The error bars represent mean values ± SD from three replicates of each sample (***, P < 0.001; ns, not significant). Data are mean± SD; P values were obtained by a two-tailed Student test.

Distinct Oncogenic TK Cascades Enhance 14 cells expressing FLT3-ITD (Supplementary Fig. S5C and Activation of IDH1 through Direct and Indirect S5D). Interestingly, treatment with distinct TK inhibitors Phosphorylation to target group I TKs, including FGFR1 (TKI258), BCR– We next sought to determine whether IDH1 R132H mutant ABL (imatinib), and JAK2 V617F (AG490; Supplementary Fig. and IDH1 WT may be phosphorylated at both or either of the S5C), or group II TK FLT3-ITD (quizartinib; Supplementary Y42 and Y391 sites in diverse cancer cells expressing differ- Fig. S5D) in corresponding cancer/leukemia cells resulted ent oncogenic TKs. We found that both Y42 and Y391 were in decreased phosphorylation levels of both Y42 and Y391, phosphorylated in lung cancer H1299 cells expressing FGFR1 suggesting these oncoge nic/leukemogenic group I or II TKs and leukemia cell lines including K562 cells expressing BCR– activate partner kinases in group II or I, respectively, to achieve ABL, HEL cells expressing JAK2 V617F mutant, and MOLM- both Y42 and Y391 phosphorylation to further activate IDH1.

JUNE 2019 CANCER DISCOVERY | 767

RESEARCH ARTICLE Chen et al.

A Group I Group II (Src) B Group II (FLT3) Group I (JAK2)

H1299 K-562 MOLM-14 MV-4-11 H1299H1299+TKI-258K-562 K-562+Imatinib MOLM-14MOLM-14+Quizartinib ControlPP2 QuizartinibControlPP2 Quizartinib WB: pTyr pMBP ControlAG-490QuizartinibImatinibPP2 ControlAG-490QuizartinibImatinibPP2 WB: pTyr pMBP pIDH1 Y42 pIDH1 Y42 pIDH1 Y42 pIDH1 Y42 MBP CBB: MBP CBB: MBP MBP pIDH1 Y391 pIDH1 Y391 pIDH1 Y391 pIDH1 Y391 WB: Src Src Heavy chain WB: JAK2 JAK2 IDH1 IDH1 IDH1 Heavy chain SRC IP IDH1 JAK2 IP IDH1 IP IDH1 IP IDH1 IP IDH1 IP WB: p-Src pSrc WB: pJAK2 pJAK2 IDH1 IDH1 IDH1 IDH1 WB: Src Src WB: JAK2 JAK2 β-Actin β-Actin β-Actin β-Actin WB: β-Actin β-Actin WB: β-Actin β-Actin Cell lysates Cell lysates Cell lysates Cell lysates Cell lysates Cell lysates

CDProliferation without GM-CSF E α-KG, NADPH as substrate MOLM-14 Vector Vector + 250 µmol/L TFMB-2HG R132H R132H + 250 µmol/L TFMB-2HG *** R132H Y42F R132H Y42F + 250 µmol/L TFMB-2HG ** 400 500 FLT3 R132H Y391F R132H Y391F + 250 µmol/L TFMB-2HG *** ) ) 120

4 R132H Y42F/Y391F 4 R132H Y42F/Y391F + 250 µmol/L TFMB-2HG ControlsiRNAsiRNA JAK2siRNA siRNA ABL1 Src 400 300 100 *P <0.05 80 pY42 pIDH1 Y42 300 60 200 ***P <0.001 IDH1 R132H 40 200 activity (%) pY391 pIDH1 Y391 20 Cell number ( × 10 Cell number Cell number ( × 10 Cell number 100

100 Relati ve 0 FLAG-IDH1 IDH1 IDH1 0 0 VectorR132H Y42FY391F Y391F 01357911 13 15 01357911 13 15 R132H Y42F/ IDH1 IP DayDay R132H R132H JAK2 JAK2

TF-1 F GH Y42F Y391FY42F/Y391F

FLT3 FLAG-IDH1 VectorR132HR132HR132H R132H FLT3 ** 7,000 * ** H3K4me3 H3K4me3 *** 6,000 *** c-ABL ABL1 100

cells) 5,000 *** *** 7 H3K9me2 4,000 H3K9me2 80 Src Src 3,000 60 H3K9me3 H3K9me3 2,000 40 IDH1 IDH1 1,000 percentage 2-HG (ng/1 × 10 20 0 Total H3 Total H3 Glycophorin A + cell FLAG-IDH1 0 β-Actin β-Actin Vector Y42F R132H Y391F FLAG-IDH1 R132H FLAG-IDH1 R132H Y42F/Y391F IDH1 Endogenous IDH1 VectorR132H Y42FY391F Cell lysates R132H R132H R132HR132H Y42F/Y391F β-Actin β-Actin R132H

Cell lysates I Hypoxia FLAG-IDH1 pLHCX pLHCXWT Y42F Y391FY42F/Y391F IDH1-shRNA −+++++ pLHCX shlDH1 *** *** Heavy chain 40 ** ) ** pIDH1 Y42 shlDH1 + WT rescue ns ns pFLAG-IDH1 Y42 shlDH1 + Y42F rescue ) *** C] 4 *** 30 shlDH1 + Y391F rescue 120 14 120 Heavy chain pIDH1 Y391 ***P < 0.001 100 100 ( × 10 shlDH1 + Y42F/Y391F rescue pFLAG-IDH1 Y391 20 80 80 Heavy chain *P < 0.05 60 60 IDH1 FLAG-IDH1 10 ns 40 e lipogenesis rate (% 40 activity (%) glutamine L-[5-

Cell number 20 20 FLAG pulldown WT IDH1 Relative 0 0 Relativ 0 IDH1 FLAG-IDH1 123 4 567 IDH1-shRNA −+++++ IDH1-shRNA −+++++ Endogenous IDH1 Day FLAG-IDH1 FLAG-IDH1 WT WT Y42F Y42F pLHCXpLHCX Y391F pLHCXpLHCX Y391F β-Actin β-Actin Y42F/Y391F Y42F/Y391F H1299 J Cell lysates Xenograft Hypoxia *** *** FLAG-IDH1 pLHCX pLHCXWT Y42F Y391FY42F/Y391F ns *** ** IDH1-shRNA −+ ++++ ** ) *** 1.5 *** ns ns 140 ) pIDH1 Y42 pFLAG-IDH1 Y42

*** C] 120 *** 120 14 1.0 100 100 pIDH1 Y391 pFLAG-IDH1 Y391 80 80 60 Heavy chain 60 mor weight (g 0.5 IDH1 FLAG-IDH1 e lipogenesis rate (% Tu activity (%) 40 40 FLAG pulldown glutamine L-[5- 20 Relative IDH1 WT IDH1 Relative 20

0.0 0 IDH1 FLAG-IDH1 Relativ 0 IDH1-shRNA −+++++ IDH1-shRNA −+++++ Endogenous IDH1 IDH1-shRNA −+++++ FLAG-IDH1 FLAG-IDH1 FLAG-IDH1 WT WT β-Actin β-Actin WT Y42F Y42F Y42F pLHCX pLHCX Y391F /Y391F pLHCX pLHCX Y391F /Y391F pLHCXpLHCX Y391F /Y391F Tumor lysates Y42F Y42F Y42F

768 | CANCER DISCOVERY JUNE 2019 www.aacrjournals.org

Tyrosine Phosphorylation Activates IDH1 and R132H Mutant RESEARCH ARTICLE

Indeed, we found that treatment with group II TK inhibitors FLT3 directly phosphorylated JAK2, whereas ABL, FGFR1, and PP2 (Src) but not quizartinib (FLT3) reduced Y391 phospho- JAK2 phosphorylated Src. These data supported the proposed rylation of IDH1 in H1299 and K562 cells expressing FGFR1 distinct group II→I and I→II TK cascades, respectively, which and BCR–ABL, respectively, which are group I TKs (Fig. 6A, achieve phosphorylation of both Y42 and Y391 of IDH1. left), suggesting that group I TKs may activate Src, but not FLT3, to achieve Y391 phosphorylation. This was further Abolishment of Tyrosine Phosphorylation of IDH1 confirmed by results showing that treatment with group I TK Mutant and WT Attenuates Cytokine-Independent inhibitors TKI258 (FGFR1) or imatinib (BCR–ABL) resulted Growth Ability with Reduced Production of in decreased Src phosphorylation levels in H1299 and K562 Oncometabolite 2-HG in Human Hematopoietic cells, respectively (Fig. 6A, bottom right), and reduced activity TF-1 Erythroleukemia Cells of Src kinases in an in vitro kinase assay using immunopre- Proliferation of TF-1 erythroleukemia cells depends on the cipitated Src incubated with myelin basic protein (MBP) as cytokine GM-CSF, and when transformed by expression of an exogenous substrate, where Src activity was assessed by the IDH1 R132H, TF-1 cells can grow in the absence of GM-CSF amount of phospho-MBP (Fig. 6A, top right). and are resistant to erythropoietin (EPO)-induced cell differen- Similar results were obtained using two FLT3-ITD–express- tiation (24, 25). We generated TF-1 cell lines with stable expres- ing leukemia cell lines, including MOLM-14 and MV4-11, sion of FLAG-tagged IDH1 R132H or R132H/Y42F, R132H/ where treatment with the FLT3 inhibitor quizartinib resulted Y391F, and R132H/Y42F/Y391F mutants by lentiviral trans- in decreased phosphorylation levels of both Y42 and Y391 of duction. We found that expression of IDH1 R132H resulted IDH1, whereas JAK2 inhibitors, including AG490 and ruxoli- in increased GM-CSF–independent cell proliferation, whereas tinib, reduced only Y42 phosphorylation (Fig. 6B, left; Sup- cells expressing R132H/Y42F, R132H/Y391F, and R132H/ plementary Fig. S5E). In contrast, control inhibitors, including Y42F/Y391F mutants showed attenuated potential for imatinib and PP2, did not affect Y42 or Y391 phosphorylation GM-CSF–independent cell proliferation (Fig. 6D, left), which of IDH1 (Fig. 6B, left). These data suggest that group II TK was partially “rescued” by adding cell-permeable TFMB-(R)- FLT3 may activate group I TK JAK2 to achieve Y42 phos- 2-HG (24) in the culture media (Fig. 6D, right). Consistent phorylation of IDH1. This is consistent with results showing with these findings, compared with TF-1 cells expressing that treatment with the FLT3 inhibitor quizartinib resulted in IDH1 R132H, cells expressing diverse phospho-deficient decreased JAK2 phosphorylation levels in MOLM-14 cells (Fig. R132H mutants showed attenuated IDH1 mutant enzyme 6B, bottom right), and reduced JAK2 kinase activity in an in activity (Fig. 6E), 2-HG production (Fig. 6F), histone hyper- vitro kinase assay using immunoprecipitated JAK2 incubated methylation (Fig. 6G), and resistance to EPO-induced differ- with MBP as an exogenous substrate (Fig. 6B, top right). Similar entiation of TF-1 cells that was assessed using staining with results were obtained using siRNAs to specifically knock down glycophorin A (ref. 24; Fig. 6H; Supplementary Fig. S6A). different TKs in MOLM-14 cells, where FLT3 siRNA resulted in reduced phosphorylation levels of both Y42 and Y391 of Abolishment of Tyrosine Phosphorylation of IDH1 IDH1, whereas JAK2 siRNA decreased only Y42 phosphoryla- WT Reduces Subsequent Proliferative and Tumor tion, but both siRNAs targeting ABL and Src did not alter Growth Potential of H1299 Lung Cancer Cells IDH1 phosphorylation (Fig. 6C). Further in vitro kinase assays We next generated “rescue” H1299 cells with stable knockdown using immunoprecipitated group I TK JAK2 or group II TK Src of endogenous IDH1 and stable rescue expression of FLAG- (Supplementary Fig. S5F, left and right, respectively) pretreated IDH1 WT, Y42F, Y391F, or Y42F/Y391F mutants (Fig. 6I, left). with protein tyrosine phosphatase PTP1B to remove tyrosine Expression of IDH1 WT reversed the decreased cell proliferation phosphorylation prior to incubation with group II TK rFLT3 or and IDH1 activity of H1299 cells under both normoxia (Sup- group I TKs rABL, rFGFR1, or rJAK2, respectively, showed that plementary Fig. S6B, left and middle, respectively) and hypoxia

Figure 6. Abolishment of tyrosine phosphorylation of IDH1 WT and R132H mutant attenuates proliferative and tumor growth potential. A, H1299 and K562 cells were treated with PP2 (Src) or quizartinib (FLT3), followed by endogenous IDH1 immunoprecipitation. Tyrosine phosphorylation at Y42 and Y391 of IDH1 was detected in cell lysates by Western blotting (left). Right, H1299 and K562 cells were treated with or without TKI258 and imatinib, respectively. Endogenous Src protein was then immunoprecipitated from cell lysates, followed by in vitro Src kinase activity assay using myelin basic protein (MBP) as an exogenous substrate. Phosphorylation of endogenous Src was tested by Western blotting (right). B, MOLM-14 and MV4-11 cells were treated with AG490, quizartinib, imatinib, and PP2, followed by endogenous IDH1 immunoprecipitation. Tyrosine phosphorylation at Y42 and Y391 of IDH1 in cell lysates was detected by Western blotting (left two plots). Right, endogenous JAK2 protein was immunoprecipitated from MOLM-14 cells treated with or without quizartinib, followed by in vitro JAK2 kinase activity assay using MBP as a substrate. Phosphorylation of endogenous JAK2 was tested by Western blotting. C, MOLM-14 cells were transfected with siRNAs targeting diverse endogenous TKs including JAK2, FLT3, ABL1, and Src, followed by endogenous IDH1 immunoprecipitation. Tyrosine phosphorylation at Y42 and Y391 of endogenous IDH1 and knockdown efficacy of each TK were detected by Western blotting. D, TF-1 cell lines stably expressing FLAG-tagged IDH1 R132H or R132H-Y42F, R132H-Y391F, and R132H-Y42F/ Y391F mutants were generated, followed by cell proliferation assay in the absence or presence of TFMB-2HG treatment (left and right, respectively) in the absence of GM-CSF. E, FLAG-tagged IDH1 protein was pulled down from TF-1 stable cell lines expressing IDH1 R132H and variants, followed by IDH1 R132H enzyme activity assay using αKG and NADPH as substrates. F–H, 2-HG production (F), histone methylation (G), and resistance to EPO-induced differentiation (H) of TF-1 stable cell lines expressing IDH1 R132H and variants were measured. I, Generation of H1299 cells with stable knockdown of endogenous human IDH1 and stable “rescue” expression of FLAG-IDH1 WT, Y42F, Y391F, or Y42F/Y391F. Rescued IDH1 protein levels were detected by Western blotting (left). Cell proliferation assay (middle left), IDH1 WT enzyme activity assay (middle right), and lipogenesis rate using labeled glutamine (glutamine L-[5-14C]) as a carbon source (right) were performed using H1299 stable rescue cells under hypoxia. J, From left to right, tumor weight, IDH1 WT enzyme activity assay, phosphorylation at Y42 and Y391 of IDH1, and lipogenesis rate under hypoxia were detected in xenograft tumors derived from diverse “rescue” H1299 cells expressing IDH1 variants. The error bars represent mean values ±SD from three replicates of each sample except J left (*, 0.01 < P < 0.05; **, 0.01 < P < 0.001; ***, P < 0.001; ns, not significant). Data are mean± SD; P values were obtained by a two-tailed Student test, except a two-way ANOVA was used for cell proliferation assay.

JUNE 2019 CANCER DISCOVERY | 769

RESEARCH ARTICLE Chen et al.

AML patient AML PDX sample Healthy donor (IDH1 WT) ABAML patient (IDH1 R132H/ Healthy donor (IDH1 R132H) Healthy donor FLT3 WT)

#64 #65 #8.91 #102 #71830#1265 (FLT3-ITD) #1280(FLT3 WT)#61512(FLT3 WT) (FLT3 WT)

pY42 pIDH1 Y42 #64 #65 #8.91#102 #61912#87414 (FLT3-ITD)#61391 (FLT3-D835H)#60713 (FLT3-ITD)#55454 (FLT3 (FLT3WT) WT) #64 #65 #8.91 #102 JAX labDFCI (Short exposure)

pY42 pIDH1 Y42 pY42 pIDH1 Y42 (Long exposure)

pY391 pIDH1 Y391 pY391 pIDH1 Y391

IDH1 R132H IDH1 R132H (anti: IDH1 R132H) (anti: IDH1 R132H) IDH1 IDH1 IDH1 R132H IP (anti: IDH1 R132H) IDH1 R132H IP (anti: IDH1 R132H) IDH1 IP IDH1 R132H IDH1 R132H IDH1 IDH1

β-Actin β-Actin β-Actin β-Actin Cell lysates Cell lysates Cell lysates

AML 61391 AML 87414 AML 61912 C D IDH1 R132H/FLT3-ITD IDH1 R132H/FLT3-D835H IDH1 R132H/FLT3-ITD F 61912 UPN1275 IDH1 mutant patient samples ** IDH1 R132H/FLT3-ITD IDH1 WT/FLT3 WT 120 ** 120 ** 120 AML 38687 AML 60713 AML 61391 100 100 100 IDH1 R132H/FLT3-ITD IDH1 R132H/FLT3 WT IDH1 R132H/FLT3-ITD 120 ** 120 ** 80 80 80 Quizartinib − + − + − + − + 100 100 60 60 60 AG-120 − − + + − − + + ControlRuxolitinibQuizartinib 80 80 40 40 40 pIDH1 Y42 pIDH1 R132H Y42 60

60 IDH1 R132H activity (%)

IDH1 R132H 20 20 20 IDH1 activity (%) 40 pIDH1 Y391 pIDH1 R132H Y391

activity (%) 40 0 0 0 20 Heavy chain

20 Relati ve IDH1 R132H Con Con Con IDH1 R132H Relati ve

Relati ve AC220 AC220 AC220 0 0 IDH1 R132H IP IDH1 R132H IP IDH1 R132H IP Con Con Dimer IDH1 R132H IDH1 R132H PTP1B PTP1B β-Actin -Actin pIDH1 pY42 pIDH1 Y42 β pY42 IDH1 R132H R132H Y42 Cell lysates Cell lysates Cell lysates

pY391 pIDH1 pY391 pIDH1 Y391 R132H Y391 Monomer

IDH1 R132H IDH1 R132H IDH1 IDH1 Native gel Native gel Native gel G IDH1 WT patient samples IDH1 R132H IP IDH1 IP IDH1 R132H AML 60189 AML 59409 AML 71830 Dimer/total Dimer/total 69% 50% 63% 50% IDH1 WT/ IDH1 WT/ IDH1 WT/FLT3-ITD IDH1 (%) IDH1 (%) β-Actin Dimer FLT3-ITD FLT3 WT Dimer Quizartinib −++ − ControlRuxolitinibQuizartinib IDH1 IDH1 R132H E pIDH1 Y42 pIDH1 Y42 UPN 1282 AML 48231 AML 61391 AML 61912 pIDH1 Y391 pIDH1 Y391 Monomer Monomer IDH1 Heavy chain Native gel Native gel IDH1 R132C/FLT3IDH1 WT R132H/FLT3-ITDIDH1 R132H/FLT3-ITDIDH1 R132H/FLT3-ITD IDH1 35 IDH1 IP IDH1 IP IDH1 IP IDH1 R132H IDH1 R132H IDH1 IDH1 30 IDH1 IDH1 cells) 7 25 β-Actin β-Actin β-Actin β-Actin β-Actin β-Actin 20 Cell lysates Cell lysates Cell lysates Cell lysates Cell lysates 15 10 5 2-HG ( µ g/2 × 10 0 AC220 −−++−++ −

Human cancers expressing Human AML expressing Inactive Active IDH1 HImonomer dimer IDH1 WT mutant IDH1 TK group I TK group II FLT3 IDH1 IDH1 IDH1 FGFR1/3, EGFR, c-MET, Src (WT or ITD) IDH pY42/IDH1 in tumor tissue arrays ABL1, PDGFR, JAK2 FLT3 IDH1 Substrate Brain glioblastoma Head and neck cancer JAK2 pY42 Group I Lung cancer Prostate cancer P TKs Phosphorylated, P P P P Breast cancer Colon cancer stabilized dimer Y42 Y391 Y42 IDH1 Y391 IDH1 3 *** Pancreatic cancer R132H IDH1 IDH1 IDH1 ns Dimer NADP+ Dimer NADPH *** P P formation binding formation binding *** Y42 Y42 Substrate 2 * ** *** Substrate Substrate binding binding Isocitrate NADP+ α-KG NADPH Inactive Active IDH1 P P P P monomer dimer IDH1* IDH1 R132H* 1 IDH1 IDH1 IDH1 2HG 0 IDH1 Metabolic advantages

Relative intensity of IDH1 pY42/IDH1 Relative Group II Group II pY391 P P (reductive carboxylation Epigenetic = 7) = 8) TKs TKs = 52) = 30) N under hypoxia) advantages N = 45)N N = 60)(N = 30)N = 29)N = 12)N = 64)N = 10)N N = 35)N = 35) N = 40)

Normal (N Normal ( TumorNormal ( Tumor ( Normal ( Tumor Normal ( Tumor ( Normal ( Tumor ( Normal ( Tumor ( ( Tumor ( IDH1 IDH1 IDH1 Cell proliferation AML development PPTumor growth Y391 Cofactor Cofactor Y391

770 | CANCER DISCOVERY JUNE 2019 www.aacrjournals.org

Tyrosine Phosphorylation Activates IDH1 and R132H Mutant RESEARCH ARTICLE

(Fig. 6I, left and middle of right plot, respectively), whereas Y→F left) or IDH1 WT (Fig. 7C; Supplementary Fig. S7A, top right), mutants demonstrated attenuated “rescue” of reduced cell pro- with reduced phosphorylation levels of Y42 and Y391 (Fig. liferation due to decreased IDH1 activity compared with IDH1 7C; Supplementary Fig. S7A, middle), and that PTP treatment WT. In addition, knockdown of endogenous IDH1 or “rescue” of primary AML cell lysates reduced the amount of dimeric expression of IDH1 variants had no effect on lipogenesis under IDH1 proteins (Fig. 7C, bottom). Moreover, treatment with normoxia (Supplementary Fig. S6B, right), whereas IDH1 knock- the FLT3 inhibitor quizartinib resulted in decreased amounts down resulted in decreased lipogenesis under hypoxia, which of IDH1 R132H dimers but increased monomers (Fig. 7D), was completely or partially rescued by IDH1 WT or IDH1 Y→F with reduced 2-HG production (Fig. 7E) in primary leukemia mutants, respectively (Fig. 6I, right of right plot). Consistently, in cells from patients with AML expressing mutant IDH1 with a xenograft experiment, rescue expression of IDH1 WT reversed either FLT3-ITD or WT. In addition, treatment with quizartinib the decreased tumor growth rate and masses (Supplementary Fig. resulted in decreased Y42 and Y391 phosphorylation of IDH1 S6C, left, and 6J, left, respectively) of injected H1299 cells with R132H mutant (Fig. 7F; Supplementary Fig. S7B) or IDH1 WT stable knockdown of endogenous IDH1, whereas IDH1 Y→F (Fig. 7G) in primary leukemia cells from patients with AML mutants demonstrated attenuated rescue ability with reduced expressing either FLT3-ITD or WT, whereas treatment with the IDH1 activity due to abolishment of Y42 and/or Y391 phospho- JAK2 inhibitor ruxolitinib decreased only Y42 phosphorylation rylation (Fig. 6J, middle two plots, respectively). In tumor cells, of IDH1 R132H or WT (Fig. 7F and G, right, respectively). Fur- IDH1 or “rescue” expression of IDH1 variants had no effect on thermore, IHC staining results showed that relative Y42-phos- lipogenesis under normoxia (Supplementary Fig. S6C, middle), phorylated IDH1 levels compared with overall IDH1 protein whereas IDH1 knockdown resulted in decreased lipogenesis under levels were commonly upregulated in diverse primary tumor hypoxia, which was completely or partially rescued by IDH1 WT tissue samples from human patients with GBM, lung, breast, or IDH1 Y→F mutants, respectively (Fig. 6J, right). In addition, head and neck, prostate, and colon cancers, but not pancreatic these tumor growth results correlate with tumor cell proliferation cancer, compared with corresponding normal control tissue potential assessed by IHC staining of Ki67 (Supplementary Fig. samples (Fig. 7H; Supplementary Fig. S7C). S6C, right two plots). Similar results were obtained using “rescue” MOLM-14 cells expressing Y→F mutants of IDH1 with decreased cell proliferation under both normoxia and hypoxia, with reduced DISCUSSION lipogenesis only under hypoxia (Supplementary Fig. S6D–S6F). Our findings reveal a molecular mechanism shared by WT and mutant IDH1 in related human cancers, which involves FLT3 WT and ITD Mutant Enhance Activation of WT distinct TK cascades containing group I and II TKs that and Mutant IDH1 through Direct Phosphorylation preferentially phosphorylate Y42 and Y391, respectively, to of Y391 and Indirect Phosphorylation of Y42 by fulfill activation of WT and mutant IDH1. Moreover, our find- Activating JAK2 in AML Cells ing of tyrosine phosphorylation–dependent IDH1 activation Phosphorylation of Y42 and Y391 was detected in human represents a novel isoform-specific activating mechanism for primary leukemia cells from patients with AML harboring IDH1 in AML, because the functional phosphorylation sites of IDH1 R132H mutation despite different FLT3 mutational state IDH1 reported in our article, Y42 and Y391, are replaced with (Fig. 7A), whereas upregulated phosphorylation levels of Y42 F82 and F431, respectively, in IDH2. Our results suggest that and Y391 of IDH1 WT were detected in primary leukemia cells spontaneous formation of active IDH1 dimers from mono- from representative patients with AML compared with control mers and disruption of dimers to form monomers coexist peripheral blood cells from healthy donors (Fig. 7B). We next and eventually reach an equilibrium, such that IDH1 dimers confirmed that PTP treatment resulted in decreased enzyme but not monomers are able to recruit substrate (isocitrate activities of immunoprecipitated IDH1 R132H (Fig. 7C, top for WT and αKG for R132H mutant) and thus represent the

Figure 7. FLT3 WT and ITD mutant enhance activation of WT and mutant IDH1 through direct phosphorylation of Y391 and indirect phosphorylation of Y42 by JAK2 activation in primary AML cells. A, Endogenous IDH1 protein was immunoprecipitated from primary leukemia cells of representative patients with AML (left) and AML PDX samples (right) with IDH1 R132H mutation. Tyrosine phosphorylation of Y42 and Y391 was detected by Western blotting. Peripheral blood samples from four healthy donors were included as controls. B, Endogenous IDH1 protein was immunoprecipitated from primary leukemia cells of representative patients with AML with IDH1 WT. Tyrosine phosphorylation of Y42 and Y391 was detected by Western blotting. Peripheral blood samples from four healthy donors were included as controls. C, Primary leukemia cell lysates with IDH1 R132H/FLT3-ITD or IDH1 WT/ FLT3 WT from patients with AML (left and right, respectively) were treated with PTP1B, followed by endogenous IDH1 protein immunoprecipitation and IDH1 R132H and IDH1 WT enzyme activity assay, respectively (top). Tyrosine phosphorylation of Y42 and Y391 of IDH1 was detected by Western blotting (middle). Dimeric and monomeric IDH1 protein levels were measured by Western blotting using native PAGE (bottom). D, Primary leukemia cells from representative patients with AML harboring IDH1 R132H and FLT3-ITD mutations were treated with quizartinib, followed by mutant IDH1 enzyme activity assay (top) and Western blotting to detect dimers and monomers of IDH1 R132H (bottom). E, Primary leukemia cells from representative patients with mutant IDH1-expressing AML expressing FLT3 WT (left one) or FLT3-ITD (right three) were treated with quizartinib, followed by detection of cellular 2-HG levels by nuclear magnetic resonance analysis. F, Primary leukemia cells from representative patients with IDH1 R132H AML with FLT3-ITD (left) and FLT3 WT (middle) were treated with quizartinib and/or AG-120, followed by IDH1 R132H pulldown. Right, primary leukemia cells from representative patients with IDH1 R132H AML with FLT3-ITD were treated with the JAK2 inhibitor ruxolitinib or FLT3 inhibitor quizartinib, followed by IDH1 R132H immunoprecipitation. Y42 and Y391 phosphorylation of IDH1 R132H was detected by Western blotting. G, Primary leukemia cells from representative patients with WT IDH1 AML with FLT3-ITD (left) and FLT3 WT (middle) were treated with quizartinib, followed by IDH1 immunoprecipitation. Right, primary leukemia cells from a patient with WT IDH1 AML with FLT3-ITD were treated with JAK2 inhibitor ruxolitinib or FLT3 inhibitor quizartinib, followed by IDH1 pulldown. Y42 and Y391 phosphorylation of IDH1 was detected by Western blotting. H, IHC staining of phosphorylated IDH1 (pY42) and total IDH1 in normal or tumor tissues in diverse tumor tissue arrays. Relative intensities of pIDH1 Y42/IDH1 were calculated. I, Working model (detailed description is included in Discussion). The error bars represent mean values ± SD from three replicates of each sample except H (*, 0.01 < P < 0.05; **, 0.01 < P < 0.001; ***, P < 0.001; ns, not significant). Data are mean± SD; P values were obtained by a two-tailed Student test.

JUNE 2019 CANCER DISCOVERY | 771

RESEARCH ARTICLE Chen et al. active portion of total IDH1 proteins (Fig. 7I, top left). Group Our studies revealed that a spectrum of tyrosine residues of I TKs preferentially phosphorylate Y42 on monomeric but IDH1 WT and R132H can be phosphorylated. These include not dimeric IDH1, and Y42-phosphorylated IDH1 monomers the previously reported Y139, which is believed to play a exhibit enhanced ability to form active dimers, leading to critical role in IDH1 R132H–mediated catalysis of αKG by increased substrate binding and enzyme activity (Fig. 7I, top compensating the increased negative charge on the C2 atom left). Moreover, active dimers formed by Y42-phosphorylated of αKG during reduction of αKG to 2-HG (28). IDH1 R132H/ monomers showed attenuated disruption to form monomers, Y139A mutant demonstrates <1% activity (28), which is con- suggesting that Y42 phosphorylation has a dual role in enhanc- sistent with our finding that Y139F mutant is catalytically ing IDH1 activation by promoting dimer formation from deficient. Future structural and mechanistic studies are war- Y42-phosphorylated monomers and preventing disruption of ranted to determine whether phosphorylation at Y139 also Y42-phosphorylated dimers, which represents a mechanism to contributes to IDH1-mediated catalysis. In contrast, unlike sustain IDH1 activation in cells (Fig. 7I, top left). In contrast, Y139F or Y219F mutations that almost abolish IDH1 enzyme Y391 phosphorylation by group II TKs occurs in both mono- activity, Y42F and Y391F mutations do not alter the intrinsic meric and dimeric IDH1 proteins, which is able to promote enzymatic properties of IDH1 WT or R132H mutant, which cofactor (NADP+ for WT and NADPH for R132H mutant) was supported by the diverse kinetic studies. binding to IDH1 monomers and dimers, respectively (Fig. 7I, These results also provide an additional rationale support- bottom left). Future structural studies of IDH1 monomers and ing the combination of TK and mutant IDH1 inhibitors for the dimers are warranted to decipher the underlying mechanisms clinical treatment of IDH1 mutant–expressing human cancers. by which Y42 phosphorylation contributes to monomer– It is plausible to consider combined therapy using inhibitors of dimer equilibrium and subsequent substrate binding, whereas mutant IDH1 and FLT3 to treat patients with AML harboring Y391 phosphorylation promotes cofactor binding to IDH1 IDH1 mutations regardless of the mutational status of FLT3, despite monomeric or dimeric status. Moreover, it will be inter- given both FLT3 WT and ITD mutant are able to phosphoryl- esting to determine whether one or both molecules of an active ate IDH1 mutant directly and indirectly through activation dimer need to be phosphorylated at Y42 and/or Y391, or both of JAK2. It was reported that FLT3-ITD is able to induce Y42 and Y391 need to be phosphorylated in one molecule in STAT5 phosphorylation independent of JAK2, where FLT3 an active dimer to functionally contribute to IDH1 activation. may directly phosphorylate STAT5 (29). Thus, it is likely that In human cancers expressing IDH1 WT, diverse group FLT3 WT or ITD mutant is able to phosphorylate and activate I TKs activate Src (group II), or FLT3 (group II) activates JAK2, which might be dispensable for STAT5 phosphoryla- JAK2 (group I) to achieve phosphorylation of both Y42 tion and activation but is critical for the phosphorylation and and Y391, leading to sustained levels of active dimers and subsequently enhanced activation of WT and mutant IDH1 enhanced substrate and cofactor NADP+. Phosphorylation- in AML leukemia cells. Taken together, our studies elucidate a enhanced IDH1 activation is important to provide meta- novel regulatory mechanism of IDH1, which not only provides bolic advantages to cancer cell proliferation and tumor insight into how signaling affects metabolic function but also growth, including reductive carboxylation for lipogenesis informs mechanism-based combination therapeutic studies. under hypoxia (Fig. 7I, middle). In human cancers harboring IDH1 mutations, mutant IDH1 retains such an METHODS enhancing mechanism. For example, in AML, FLT3 (group Primary Tissue Samples from Patients with Leukemia II) activates JAK2 (group I) to achieve phosphorylation and Healthy Donors at both sites and subsequently full activation of mutant IDH1, leading to 2-HG production that provides an epi- The approval for use of human specimens was given by the Insti- tutional Review Board of Emory University School of Medicine. The genetic advantage to tumorigenesis and tumor growth clinical samples numbered with UPN were obtained with informed (Fig. 7I, right). However, because IDH1 mutations exist as consent with approval by the Emory University Institutional Review heterozygous mutations in AML and glioma cases (5–7, Board. The clinical samples from the Memorial Sloan Kettering 14, 15), it is believed that homodimers of IDH1 WT and Cancer Center were approved by the Institutional Review Board of mutant, as well as WT/mutant heterodimers, coexist. It has Memorial Sloan Kettering Cancer Center. Patients provided written been suggested that, although WT:R132H heterodimers informed consent in all cases at the time of enrollment. Only sam- exhibit almost abolished IDH1 WT enzyme activity (26), ples from patients with leukemia who were not previously treated IDH1 mutants require IDH1 WT activity to produce 2-HG with chemotherapy or radiotherapy were used. Mononuclear cells of (27). Moreover, R132H/WT heterodimers demonstrate a peripheral blood and bone marrow samples from patients with leukemia or healthy donors were isolated using lymphocyte separation significantly lower Km for αKG as substrate compared with medium (Cellgro). Cells were then counted and cultured in RPMI- R132H homodimers (23). These studies suggest an over- 1640 medium supplemented with 10% fetal bovine serum (FBS) and all advantage of R132H/WT heterodimers that favors the penicillin/streptomycin for further indicated treatments. R132H mutant–driven conversion of αKG to 2-HG. Our results demonstrate that phosphorylation of Y42 similarly Cell Culture enhances the IDH1 mutant/WT heterodimer formation TF-1 cells (#CRL-2003, ATCC; purchased in 2018; not authenticated) from monomers and attenuates disruption of heterodimers were cultured in RPMI-1640 medium with 10% FBS and 2 ng/mL recom- to monomers as Y42 phosphorylation does to homodimers binant human GM-CSF (R&D Systems). K-562 (#CCL-243, ATCC; pur- of IDH1 WT and mutant, which further strengthens the chased in 2015; not authenticated; Mycoplasma tested in November 2018), importance of IDH1 tyrosine phosphorylation in mutant H1299 (#CRL-5803, ATCC; purchased in 2015; not authenticated; Myco- IDH1-expressing human cancers. plasma tested in November 2018), MOLM-14, MV-4-11, and HEL cells

772 | CANCER DISCOVERY JUNE 2019 www.aacrjournals.org

Tyrosine Phosphorylation Activates IDH1 and R132H Mutant RESEARCH ARTICLE were cultured in RPMI-1640 medium with 10% FBS. HEK293T cells were CHIR-258), imatinib, AG-490, quizartinib, PP2, erlotinib, ruxolitinib, cultured in Dulbecco’s Modified Eagle Medium with 10% FBS. Cells were dasatinib, and AG-120 were purchased from Selleckchem. Recombi- cultured at 37°C with 5% CO2. MOLM-14, MV-4-11, HEL, and HEK293T nant proteins including FLT3, SRC, PDGFRα, PDGFRβ, EGFR, MET, cells (not authenticated) were obtained from Dr. Gary Gilliland’s labora- KIT, JAK2, FGFR3, and ABL1 were purchased from Thermo Fisher. tory at Brigham and Women’s Hospital in 2004. Cell Proliferation and Cell Viability Assay RNAi-Resistant IDH1 WT and Diverse YF Mutant Plasmids Cell proliferation assays were performed by seeding 5 × 104 cells in The shRNA sequence for WT IDH1 is CGAATCATTTGGGAATT a 6-well plate in normoxia (5% CO and 95% air) or hypoxia (5% CO , GATT. The WT IDH1 and diverse YF mutant plasmids were muta- 2 2 1% O , and 94% N ) with daily counting of cell numbers. Cell prolif- genized by PCR to generate IDH1 plasmids that contain three silent 2 2 eration was determined by cell numbers recorded after being seeded mutations introduced in the 21 bp IDH1 shRNA target sequence and normalized to that of each cell line at the starting time (T = 0 (CGTATCATATGGGAGTTGATT). The mutations were confirmed hour) by trypan blue exclusion using TC20 Automated Cell Counter by sequence analysis. (Bio-Rad). For cell viability assay, 5 × 104 cells were seeded in each well of a 96-well plate and incubated with ivosidenib (AG-120) or Cell Lines quizartinib for 48 hours. Relative cell viability was determined using Stable knockdown of endogenous IDH1 was achieved by using lentivi- the CellTiter 96 Aqueous One solution proliferation kit (Promega). ral vectors harboring shRNA constructs. To be specific, each shRNA construct was cotransfected with psPAX2 packaging plasmid and pMD2.G Mutant IDH1 Enzyme Activity Assay envelope plasmid (Addgene) into HEK293T cells using TransIT-LT1 Transfection Reagent (Mirus Bio) according to the manufacturer’s An in vitro or in vivo IDH1 R132H activity assay was performed as instructions. The supernatant of culture medium containing lentivirus previously described (30). Specifically, 20 ng purified IDH1 R132H and was collected 36 to 48 hours after transfection and filtered by 0.2-μm fil- variant proteins treated with or without recombinant active TKs in an ter, followed by addition to host cell lines. Twenty-four hours after infec- in vitro kinase assay were added to 50 μL assay buffer [150 mmol/L NaCl, tion, target cells were subjected to puromycin (2 μg/mL) selection for 24 20 mmol/L Tris-HCl (pH7.5), 10 mmol/L MgCl2, 0.05% (w/v) bovine to 48 hours. The knockdown efficiency of the endogenous IDH1 protein serum albumin (BSA)] containing 15 μmol/L NADPH (Sigma-Aldrich) was confirmed by Western blotting. Stable overexpression of IDH1 WT and 1.5 mmol/L α-KG (Sigma-Aldrich). After 1-hour incubation at and mutants in MOLM14, H1299, and TF-1 cells was conducted using room temperature, 20 μmol/L resazurin and 10 μg/mL diaphorase were retroviral vectors harboring RNAi-resistant FLAG-tagged IDH1 WT, added to the reaction mixture and incubated for another 10 minutes FLAG-tagged IDH1 R132H, and RNAi-resistant FLAG-tagged IDH1 WT at room temperature. To determine the IDH1 R132H activity in cells, 6 or R132H plus diverse YF mutants. Briefly, to produce retrovirus, each 1 × 10 cells were harvested and directly lysed using 100 μL 1% NP-40 construct was cotransfected with VSVG, EcoPak packaging plasmid, and cell lysis buffer. Whole-cell lysates (25 μL) were then added with 25 μL envelope plasmid (Addgene) into HEK293T cells using FuGENE Trans- 2× assay buffer [300 mmol/L NaCl, 40 mmol/L Tris-HCl (pH7.5), 20 fection Reagent (Promega) according to the manufacturer’s instructions. mmol/L MgCl2, 0.05% (w/v) BSA] containing 30 μmol/L NADPH and Retrovirus-containing supernatant medium was collected 48 hours after 3 mmol/L α-KG. After 1-hour incubation at room temperature, 20 transfection and filtered before addition to the indicated host cell lines μmol/L resazurin and 10 μg/mL diaphorase were added to the primary (1 mol/L HEPES was used to adjust the pH to 7.4 in culture medium). reaction and incubated for another 10 minutes at room temperature. Twenty-four hours after infection, target cells were subjected to hygromy- Fluorescence was recorded on a Spectramax GEMINIEM plate reader cin selection (Invitrogen). The overexpression of proteins was confirmed (Molecular Devices) at Ex544/Em590. by Western blotting using antibodies against IDH1. WT IDH1 Enzyme Activity Assay Antibodies An in vitro enzyme activity assay for WT IDH1 was performed as Antibodies against DYKDDDDK (FLAG) tag, p-Tyrosine (pTyr-100), previously described (8). In brief, 20 ng purified IDH1 and YF vari- JAK2, pJAK2 (Tyr1007/1008), dimethyl-histone H3 (Lys9), histone H3, ant proteins that were pretreated with or without recombinant active FLT3, and Src were from Cell Signaling Technology (CST). Antibodies TKs in an in vitro kinase assay were added to 100 μL enzyme activ- against β-actin and p-Src (Tyr418) were from Sigma-Aldrich. Antibody ity assay buffer [25 mmol/L Tris-HCl (pH7.5), 10 mmol/L MgCl2, against HA was from Santa Cruz Biotechnology. Antibody against trime- 5 mmol/L DTT] containing 0.5 mmol/L NADP+ (Sigma-Aldrich) and thyl (Lys9) was from Abcam. Antibodies against IDH1 R132H and Tri- 1 mmol/L isocitric acid (Sigma-Aldrich). To determine the WT IDH1 methyl-Histone H3 (Lys4) were from EMD Millipore. Antibody against activity in cells, endogenous IDH1 from 1 × 107 cells was bound to IDH1 was from R&D Systems. Antibody against PE-Cy5 Mouse Anti- protein G-Sepharose 4 Fast Flow beads (Sigma-Aldrich) by immuno- Human CD235a was from BD Pharmingen. Goat anti-Mouse IgG (H + L) precipitation using IDH1 antibody (CST). To test IDH1 activity in secondary antibody and goat anti-rabbit IgG (H + L) secondary antibody xenograft tumor tissues, around 2 mg of total tumor lysates were used. were from Thermo Fisher Scientific. Antibodies against pIDH1 Y42 and After immunoprecipitation, the IDH1-bound beads were washed 3 pIDH1 Y391 were custom-made by Shanghai Genomics, Inc. Antibodies times and eluted using IDH1 peptide (CST). Then, 10 μL of the super- against Ki67 and IDH1 for IHC staining studies were from Abcam. natant was added to 100 μL assay buffer (25 mmol/L Tris-HCl, pH7.5, + 10 mmol/L MgCl2, 5 mmol/L DTT) containing 0.5 mmol/L NADP Reagents and 1 mmol/L isocitric acid. IDH1 activity was measured by recording absorbance of 340 nm in kinetic mode every 20 seconds for 15 minutes MBP from bovine, DL-isocitric acid trisodium salt hydrate, using a SpectraMax Plus spectrophotometer (Molecular Devices). β-nicotinamide adenine dinucleotide phosphate hydrate (NADP+), β-nicotinamide adenine dinucleotide 2′-phosphate reduced tetraso- dium salt hydrate (NADPH), α-ketoglutaric acid sodium salt, dia- Immunoprecipitation phorase from Clostridium kluyveri, resazurin sodium salt, and ATP Cells or tumor lysates (1–2 mg) were incubated with anti-IDH1 disodium salt hydrate were purchased from Sigma-Aldrich. Ketoglu- antibody (R&D Systems) or anti-IDH1 antibody (CST) overnight at taric acid sodium salt, α-[1-14C], 50μCi (1.85MBq) and glucose, 4°C. After incubation, protein G-Sepharose was used for precipitation D-[U-14C]- were from PerkinElmer. Glutamine L-[5-14C] and isocitric for 2 hours. The beads were then washed 3 times with 1× TBS and acid[3H(G)] were from ARC. Inhibitors including dovitinib (TKI-258, eluted by boiling in SDS sample buffer for Western blotting analysis.

JUNE 2019 CANCER DISCOVERY | 773

RESEARCH ARTICLE Chen et al.

Purification of Prokaryotic Recombinant IDH1 Proteins at 50,000 rpm for 12 hours using a Beckman MLS-50 rotor. Fractions 6×His-FLAG-IDH1 or 6×His-HA-IDH1 and variant proteins were in each section were collected and analyzed by Coomassie blue staining. purified by sonication of high expression BL21(DE3) pLysS cells Substrate Binding Assay obtained from a 250 mL culture subjected to IPTG induction for 16 hours at 30°C. Bacteria cell lysates were obtained by centrifugations and Purified recombinant ×6 His-FLAG-IDH1 and variants that are loaded onto a Ni-NTA column within 20 mmol/L imidazole. The bound immobilized on anti-FLAG beads were treated with or without diverse proteins were eluted with 250 mmol/L imidazole, followed by desalting recombinant active TKs in an in vitro kinase assay. The beads were 3 using a PD-10 column. The purified recombinant IDH1 proteins were then incubated with 0.1 mmol/L isocitric acid [ H(G)] (ARC) at room examined by Coomassie Brilliant Blue staining and Western blotting. temperature for 1 hour and then washed twice with TBS to remove the unbound isocitric acid [3H(G)] molecule. IDH1 and variant proteins In Vitro TK Assays were then eluted with 3× FLAG peptide. Bound isocitric acid molecules to proteins were measured using a scintillation counter. Purified In vitro kinase assays were performed as previously described (31, 32). recombinant 6×His-FLAG-IDH1 R132H and variants that are immobi- Specifically, 1μ g recombinant IDH1, IDH1 R132H, and variant proteins lized on anti-FLAG beads were treated with or without diverse recom- were incubated with diverse recombinant active form of TKs for 90 min- binant active TKs in an in vitro kinase assay. The beads were incubated utes in the presence of 800 μmol/L ATP (Sigma) at 30°C in the following with 0.1 mmol/L α-ketoglutaric acid [1-14C] (PerkinElmer) at room assay buffers, respectively: for FGFR1 assay buffer, 10 mmol/L HEPES temperature for 1 hour and then washed twice with TBS to remove (pH 7.5), 10 mmol/L MnCl2, 150 mmol/L NaCl, 5 mmol/L DTT, and the unbound α-ketoglutaric acid [1-14C]. The IDH1 R132H and vari- 0.01% Triton X-100 were used; for FLT3 assay buffer, 60 mmol/L HEPES ant proteins were eluted with 3× FLAG peptide. Bound α-ketoglutaric (pH 7.5), 3 mmol/L MgCl , 3 mmol/L MnCl , 3 μmol/L Na VO , and 1.2 2 2 3 4 acid molecules to proteins were measured using a scintillation counter. mmol/L DTT were used; for FGFR3 assay buffer, 60 mmol/L HEPES (pH 7.5), 3 mmol/L MgCl , 3 mmol/L MnCl , 3 μmol/L Na VO , and 2 2 3 4 Substrate Binding Assay for Monomer or Dimer of IDH1 1.2 mmol/L DTT were used; for JAK2 assay buffer, 25 mmol/L HEPES or IDH1 R132H (pH 7.5), 10 mmol/L MgCl2, 0.5 mmol/L EGTA, 0.5 mmol/L Na3VO4, 5 mmol/L β-glycerophosphate, 2.5 mmol/L DTT, and 0.01% Triton Purified recombinant IDH1 monomers and dimers were separated X100 were used; for ABL1 assay buffer, 60 mmol/L HEPES (pH 7.5), 3 on a native gel. The gel was incubated with 0.1 mmol/L isocitric 3 mmol/L MgCl2, 3 mmol/L MnCl2, 3 μmol/L Na3VO4, and 1.2 mmol/L acid [ H(G)] (ARC) for 2 hours at 4°C and then washed twice with DTT were used; for SRC buffer, 50 mmol/L HEPES (pH 7.5), 10 mmol/L TBS to remove the unbound isocitric acid [3H(G)]. The IDH1 pro-

MgCl2, 10% glycerol, 2.5 mmol/L DTT, and 0.01% Triton X-100 were teins in monomer and dimer form were cut from the gel and the 3 used; for EGFR buffer, 20 mmol/L Tris (pH 7.5), 10 mmol/L MgCl2, 1 retained isocitric acid [ H(G)] on both forms of IDH1 proteins were mmol/L EGTA, 1 mmol/L Na3VO4, 5 mmol/L β-glycerophosphate, 2 measured using a scintillation counter. Purified recombinant IDH1 mmol/L DTT, and 0.02% Triton X-100 were used; for MET assay buffer, R132H monomers and dimers were separated on a native gel, then 14 25 mmol/L Tris (pH 7.5), 10 mmol/L MgCl2, 0.5 mmol/L EGTA, 0.5 incubated with 0.1 mmol/L α-ketoglutaric acid [1- C] (PerkinElmer) mmol/L Na3VO4, 5 mmol/L β-glycerophosphate, 2.5 mmol/L DTT, and for 2 hours at 4°C and then washed twice with TBS to remove the 0.01% Triton X-100 were used. The amount of each recombinant active unbound α-ketoglutaric acid [1-14C]. The IDH1 R132H proteins in kinase used for the reaction was as follows: 100 ng rFGFR1 (0.1 U), 160 monomer and dimer form were cut from the gel, and the retained ng rMET (0.06 U), 800 ng rEGFR (0.1 U), 200 ng rJAK2 (0.06 U), 120 ng α-ketoglutaric acid [1-14C] on both forms of IDH1 R132H proteins rPDGFRα (0.066 U), 250 ng rPDGFRβ (0.066 U), 25 ng rFLT3 (0.06 U), was measured using a scintillation counter. 100 ng rSRC (0.2 U), and 120 ng rABL1 (0.06 U). For in vitro kinase assay + of IDH1 dimer or monomer, 1 mg IDH1 WT or R132H protein was used NADP Binding Assay for sucrose gradient centrifugation to separate monomer or dimer, then NADP+ binding assay was performed as previously described 1 μg monomer or dimer protein was used for in vitro kinase assay with or (33). Briefly, 200 ng of ×6 His-FLAG-IDH1 and variant proteins without recombinant active form of rFGFR1 or rFLT3. Then, samples was incubated with 30 μL Blue Sepharose CL-6B beads (Amersham were injected for the Western blotting analysis with native gel. Biosciences), which mimics NADP+ at 4°C for 2 hours, then washed with 20 mmol/L Tris-HCL (pH 8.6) 3 times. The beads were then FLAG Pulldown Assay subjected to SDS-PAGE, followed by Western blotting analysis. For Total protein (200 μg) from whole-cell lysates was incubated with NADP+ binding assay with IDH1 dimer or monomer, 1 mg IDH1 30 μL of ANTI-FLAG M2 Affinity Gel (Sigma-Aldrich) for 4 hours WT protein was used for sucrose gradient centrifugation to separate at 4°C, followed by washing with phosphate-buffered saline (PBS) 3 monomer or dimer, and then 1 μg monomer or dimer protein was times to remove unbound materials. The bound proteins were then used for in vitro kinase assay with or without FGFR1. After kinase eluted from beads by boiling in SDS buffer [50 mmol/L Tris-Cl (pH assay, 200 ng protein were incubated with 30 μL Blue Sepharose 6.8), 2% (w/v) SDS, 0.1% (w/v) bromophenol blue, 100 mmol/L DTT] CL-6B beads (Amersham Biosciences) at 4°C for 2 hours, then for 10 minutes and visualized via immunoblotting analysis. washed with 20 mmol/L Tris-HCL (pH 8.6) 3 times. The beads were subjected to SDS-PAGE, followed by Western blotting. The same Native PAGE amount of protein was loaded in parallel as loading control. Native gels were prepared as described (31) using 0.375 mol/L Tris- HCl, pH 8.8, 10% acrylamide, without SDS. Cell lysates were mixed Kinetic Assay with 5× native gel sample buffer (0.05% bromophenol blue, 10% glyc- Twenty nanograms purified IDH1 and YF variant proteins pretreated erol, 312.5 mmol/L Tris-HCl, pH 6.8) before loading. The samples with or without recombinant active TKs in an in vitro kinase assay were applied to native PAGE that ran in buffer (25 mmol/L Tris-HCl, were incubated with various concentrations of NADP+ (0–200 μmol/L; 192 mmol/L glycine), followed by Western blotting. Sigma-Aldrich) or isocitrate acid (0–200 μmol/L; Sigma-Aldrich) and 1 mmol/L isocitric acid (Sigma-Aldrich) or 0.5 mmol/L NADP+ Sucrose Density Ultracentrifugation (Sigma-Aldrich), respectively, at 100 μL enzyme activity assay buffer (25

Sucrose gradient centrifugation was performed as previously described mmol/L Tris-HCl pH7.5), 10 mmol/L MgCl2, 5 mmol/L DTT). Absorb- (31). In brief, purified recombinant ×6 His-FLAG-IDH1 or R132H and ance at 340 nm was measured every 20 seconds for 5 minutes using a variant protein was laid on a 13.75% to 36% sucrose gradient and spun SpectraMax Plus spectrophotometer (Molecular Devices).

774 | CANCER DISCOVERY JUNE 2019 www.aacrjournals.org

Tyrosine Phosphorylation Activates IDH1 and R132H Mutant RESEARCH ARTICLE

Twenty nanograms purified IDH1 R132H and YF variant proteins Cell Culture Treatment pretreated with or without recombinant active TKs in an in vitro Treatments with TK inhibitors were performed by incubating cells kinase assay were incubated with various concentrations of NADPH with 0.1 μmol/L TKI-258, 1 μmol/L imatinib, 50 μmol/L AG-490, (0–10 μmol/L; Sigma-Aldrich) and 1.5 mmol/L α-KG (Sigma-Aldrich) 100 nmol/L erlotinib, 0.1 μmol/L ruxolitinib, 200 nmol/L quizartinib, or various concentrations of α-KG (0–1500 μmol/L; Sigma-Aldrich) 50 nmol/L dasatinib, or 1 μmol/L AG-120 for 4 hours. PP2 treatment and 15 μmol/L NADPH (Sigma-Aldrich) at 100 μL enzyme activ- was performed by incubating cells with 10 μmol/L PP2 for 4 hours. ity assay buffer [25 mmol/L Tris-HCl (pH7.5), 10 mmol/L MgCl2, 5 mmol/L DTT]. Absorbance at 340 nm was measured every 20 sec- siRNA-Mediated Knockdown onds for 5 minutes using a SpectraMax Plus spectrophotometer (Molecular Devices). Nonlinear regression analysis (Michaelis-Menten) The transfection of siRNA into MOLM-14 cells was carried out was performed in GraphPad Prism 6.0. using Lipofectamine 2000 transfection reagent (Thermo Fisher), according to the manufacturer’s instructions. Briefly, siRNA and Lipo- IDH1 WT or R132H Protein Dimer Formation fectamine 2000 reagent were mixed in Opti-MEM medium (Thermo Fisher) and incubated for 30 minutes at room temperature to allow One milligram IDH1 WT or R132H protein was used for sucrose the complex formation. Then the cells were washed with Opti-MEM gradient centrifugation to separate monomer, and then 1 μg mono- medium (Thermo Fisher), and the mixtures were added. Twelve hours mer protein was used for in vitro kinase assay with FGFR1 at indicated after transfection, the culture medium was replaced by a fresh com- time and stopped in a minus 80 freezer. Then samples were injected plete medium. The cells were harvested 72 hours after transfection, for the Western blotting analysis with native gel. followed by further analysis. The following siRNA sequences were NADP+ Competitive Binding Assay used for knockdown: negative control siRNA (nonsilencing; QIAGEN; SI03650325); Hs_ABL1_6 Flexi Tube siRNA (QIAGEN; SI00299089); One microgram of 6×His-FLAG-IDH1 protein was incubated with Hs_SRC_7 Flexi Tube siRNA (QIAGEN; SI02223928); Hs_JAK2_7 100 μL Blue Sepharose CL-6B beads (Amersham Biosciences) at 4°C for Flexi Tube siRNA (QIAGEN; SI02659657); and Hs_FLT3_6 Flexi Tube 2 hours, then washed with 20 mmol/L Tris-HCL (pH 8.6) 3 times and siRNA (QIAGEN; SI02659608). separated to 3 tubes equally. The beads were incubated with indicated concentrations of NADP+ at 4°C for 1 hour. Then the samples were cen- trifuged to separate the supernatant and beads. The supernatant or beads TF-1 Cell Differentiation Assay were subjected to SDS-PAGE, followed by Western blotting analysis. TF-1 stable cell lines were washed four times with plain RPMI medium and cultured for 24 hours without GM-CSF. Then 2 U/mLEPO (recom- IDH1 Heterodimer Formation binant human erythropoietin) was added for differentiation. Eight days One milligram FLAG-IDH1 WT and HA-IDH1 R132H protein was later, glycophorin A was used for erythroid differentiation assay by flow used for sucrose gradient centrifugation to separate monomer, then 100 cytometry. Cell-surface staining for glycophorin A was performed as fol- μg monomer protein was mixed and used for in vitro kinase assay with lows: Cells were washed once in PBS supplemented with 2% FBS (PBS– FGFR1 for 2 hours. The protein was incubated with 50 μL of ANTI-FLAG FBS) and then resuspended in a 1:200 dilution of PE-Cy5–conjugated M2 Affinity Gel (Sigma-Aldrich) for 4 hours at °4 C, followed by washing mouse anti-human CD235a antibody (BD Pharmingen) in PBS–FBS. with PBS 3 times to remove unbound materials. Then bound protein was The cells were incubated for 20 minutes at 4°C in the dark, then washed eluted with 100 μg FLAG peptide (Sigma-Aldrich). Then half of the eluted once with PBS-FBS. The cells were analyzed on a FACSCanto II cytom- protein was injected for the Western blotting analysis with native gel. eter (Becton Dickinson). All flow cytometry data were analyzed using The rest of the eluted protein was incubated with 30 μL of monoclonal FlowJo software (TreeStar, Inc.). anti-HA agarose (Sigma-Aldrich) for 4 hours at 4°C, followed by washing with PBS 3 times to remove unbound materials. The bound protein was 2-HG Measurement in Cell Lines, Patient Samples, eluted with 10 μg HA peptide (Sigma-Aldrich), and then the samples were and Tumor Samples applied to native gels for the Western blotting analysis. The sample preparation for ex vivo nuclear magnetic resonance (NMR) analysis followed a previously described method (34). Briefly, IDH1 WT or R132H Protein Monomer Conversion 1 × 107 cells were thawed in 99.996% saline deuterium oxide (D2O; One milligram IDH1 WT or R132H protein was used for in vitro Sigma-Adrich) in the sample holder/rotor (4 mm ZrO2). A 50 μL insert kinase assay with FGFR1, and then the dimer was separated by was subsequently placed in the sample holder to stabilize the sample sucrose gradient centrifugation. One microgram dimer was collected and to provide the balance for the rotor. For NMR experiments, D2O at indicated time, and the monomer conversion was stopped in a (99.996%) containing 0.75% 3-(trimethylsilyl) propionic acid (TSP) was minus 80 freezer; then the samples were loaded on native gels for the added to get a frequency-lock signal, as well as to serve as an internal Western blotting analysis. reference for chemical shift and concentration measurements. Each sample added with TSP containing D2O was reweighed for metabolite The Conversion of IDH1 Heterodimer to Monomer quantification. All NMR samples were treated rapidly on ice to avoid For the purification of IDH1 heterodimer, 1 mg FLAG-IDH1 possible degradation. HRMAS NMR experiments were conducted with WT and HA-IDH1 R132H protein was used for in vitro kinase assay a dedicated 4-mm HRMAS probe at 4°C using a Bruker AVANCE 600 with FGFR1 for 2 hours. The protein was incubated with 100 μL of WB solid state NMR spectrometer (Bruker Instruments, Inc.). The ANTI-FLAG M2 Affinity Gel (Sigma-Aldrich) for 4 hours at °4 C, fol- entire process throughout the experiment was maintained at 4°C lowed by washing with PBS 3 times to remove unbound materials. (±0.1°C) via a variable temperature control unit, and the probe-head Then bound protein was eluted with 200 μg FLAG peptide (Sigma- was precooled to 4°C before loading the sample. To ensure the spin Aldrich). The eluted protein was incubated with 1000 μL of mono- sidebands did not affect the spectrum, the spinning rates of the sam- clonal anti-HA agarose (Sigma-Aldrich) for 4 hours at 4°C, followed ple were controlled in the range of 2,800 kHz (±2 Hz) or at the lower by washing with PBS 3 times to remove unbound materials. Then spin rate of 800 Hz if the rotor-synchronized delay alternating with bound protein was eluted with 50 μg HA peptide (Sigma-Aldrich). nutation for tailored excitation sequence was used. The presaturation Then the heterodimer was collected at indicated time and the mono- of water was achieved with a zqpr sequence before acquisition pulses. mer conversion was stopped by a minus 80 freezer. Then the samples A rotor-synchronized Carr–Purcell–Meibom–Gill pulse sequence was were loaded on a native gel for the Western blotting analysis. used to suppress broad signals from macromolecules. The number of

JUNE 2019 CANCER DISCOVERY | 775

RESEARCH ARTICLE Chen et al. transients was 256. In all experiments, the repetition time was 5 sec- 0.05% NP-40 containing 0.1 μg of BSA) and incubated for 90 minutes onds, and the spectral width was 10 kHz. A 95% pure 2HG compound at 30°C. At the end of the reaction, the beads were washed with TBS (Santa Cruz Biotechnology) in solution was used as 2HG resonance 3 times, then IDH1 proteins were eluted by adding 2 μg of FLAG pep- identification and assignment. One-dimensional NMR spectra of a tide, followed by Western blotting analysis and enzyme activity assay. pure 2HG compound, and a mixture of 2HG, and a combination of glutamate (Glu) and glutamine (Gln) compounds (together termed IHC Staining Glx) were obtained at ∼10 mmol/L 2HG in D2O, pH 7.0 and collected IHC staining for Ki67, phospho-IDH1 Y42, and IDH1 was per- at 300 MHz at 25°C. J-coupling correlations and patterns of protons formed as previously described (35–37). In brief, tumor tissues from in the pure 2HG were then analyzed by a two-dimensional (2-D) xenograft mice were fixed in 10% buffered formalin, embedded in J-coupled correlated spectroscopy (COSY) method. For the tumor paraffin, and mounted on slides. Slides of xenograft tumor tissues sample analysis, data of 2-D COSY were collected at 4°C with 6,000 Hz or tumor tissue arrays were deparaffinized and rehydrated, followed spectral width and 1.5-second relaxation delay. Thirty-two transients by incubation in 3% hydrogen peroxide to suppress endogenous in the time domain t2 were averaged for each of the 512 increments in peroxidase activity. High-pressure antigen retrieval was achieved in time domain of t1 with a total acquisition time of ∼3 hours. 10 mmol/L sodium citrate (pH6.0). Sections were then blocked by incubation in 10% goat serum. Human Ki67 antibody (Abcam; Lipid Biosynthesis Assay 1:500), human phospho-IDH1 Y42 antibody (Shanghai Genomics, For 14C-lipid biosynthesis assay, cells were preincubated with 4 μL of Inc.; 1:200), or human IDH1 antibody (Abcam; 1:500) was applied 14 glucose, D-[ C(U)] (PerkinElmer) under normoxia (5% CO2 and 95% overnight at 4°C. A Dako IHC kit (Agilent Technologies) was used for air) for 2 hours or 4 mmol/L glutamine L-[5-14C] (ARC) under hypoxia detection. A secondary antibody was applied at room temperature for

(5% CO2, 1% O2, and 94% N2) for 24 hours. Lipids were then extracted 1 hour. Slides were then stained with 3,3′-diaminobenzidine, washed, by the addition of 500 μL of hexane: isopropanol (3:2 v/v), dried, resus- counterstained with hematoxylin, dehydrated, and mounted. pended in 50 μL of chloroform, and subjected to scintillation counting. Quantification and Statistical Analysis Xenograft Studies A two-tailed Student t test was used in studies in which statisti- Approval for the use of mice and designed experiments was given cal analyses were performed to generate P values, except a two-way by the Institutional Animal Care and Use Committee of Emory Uni- ANOVA was used for cell proliferation assay and tumor growth. P versity. Briefly, NSG mice (NOD/SCID gamma, female 6-week-old; values less than or equal to 0.05 were considered significant. Data The Jackson Lab) were subcutaneously injected with 1 × 106 H1299 with error bars represent mean ± SD, except for tumor growth cells stably expressing IDH1 WT, IDH1 Y42F, IDH1 Y391F, and IDH1 curves which represent mean ± SEM. There is no estimate of varia- Y42F/Y391F with stable knockdown of endogenous IDH1 on the left tion in each group of data, and the variance is similar between the and right flanks, respectively. Tumor growth was recorded every 2 days groups. No statistical method was used to predetermine sample size. from 7 to 12 days after inoculation by measurement of two perpendic- The experiments were not randomized. The investigators were not ular diameters using the formula 4π/3 × (width/2)2 × (length/2). The blinded to allocation during experiments and outcome assessment. masses of tumors (mg) derived from treatments were analyzed. For All data are expected to have normal distribution. Statistical analysis single-cell isolation from tumor tissues, fresh tumors were removed and graphical presentation were performed using Prism 6.0 (Graph- from xenograft mice and were placed in PBS. The tumors were then Pad) and Microsoft Office Excel 2016. minced into small pieces using scissors and digested with 5 mL digestion buffer (Accumax@ Stemcell) for 1 hour at room temperature on Disclosure of Potential Conflicts of Interest a horizontal shaker. The digestion buffer was then neutralized with S. Lonial reports receiving commercial research grants from an equal amount of cell culture media after digestion, and xenograft Takeda, Celgene, and Janssen and is a consultant/advisory board tumor cells were strained through a 70-μm cell strainer, followed by member for Takeda, Celgene, BMS, AbbVie, Merck, Amgen, and washing twice with PBS. Cells were then counted and cultured in Janssen. R.L. Levine is on the supervisory board of Qiagen, reports RPMI-1640 medium supplemented with 10% FBS and penicillin/ receiving commercial research grants from Roche, Prelude, and Cel- streptomycin (100 unit/mL) for further treatment. gene, has ownership interest (including stock, patents, etc.) in Loxo, Isoplexis, and C4, and is a consultant/advisory board member for PTP1B Treatment Celgene, Roche, Morphosys, Janssen, Incyte, C4, and Astellas. No For in vivo assay, 1 × 107 cells were harvested and lysed using 900 μL potential conflicts of interest were disclosed by the other authors. NP-40 cell lysis buffer with 100 μL 10 × PTP1B buffer (500 mmol/L HEPES, pH 7.2, 10 mmol/L EDTA, 10 mmol/L DTT, 0.5% NP-40) con- Authors’ Contributions taining 0.5 μg BSA, followed by incubation with 2 μg PTP1B protein Conception and design: D. Chen, S. Xia, M. Wang, T.J. Boggon, for 90 minutes at 30°C. Reaction mixture (200 μL) was then stored as R.L. Levine, J. Chen input samples, whereas the remaining 800 μL reaction mixture was Development of methodology: D. Chen, S. Xia, M. Wang, J. Fan, subjected to IDH1 immunoprecipitation using anti-IDH1 antibody L. Jin, L. Song, J. Peng, J. Chen (R&D Systems) for 6 hours at 4°C. After immunoprecipitation, pro- Acquisition of data (provided animals, acquired and managed tein G-Sepharose was added for precipitation for 2 hours. The beads patients, provided facilities, etc.): D. Chen, S. Xia, M. Wang, were then washed 3 times with TBS, followed by analysis using PAGE Y. Li, M. Aguiar, C.A. Famulare, A.H. Shih, Y. Pan, S. Liu, J. Fan, and Western blotting. Input samples were applied to native gel fol- L. Jin, L. Song, A. Zhou, R.O. Pieper, A. Mishra, J. Peng, M. Arellano, lowed by Western blotting. For the in vitro assay, recombinant FLAG- W.G. Blum, R.L. Levine tagged IDH1 and mutant proteins (1 μg each) were incubated with Analysis and interpretation of data (e.g., statistical analysis, FLAG beads (30 μL) for 3 hours at 4°C. After incubation, the beads biostatistics, computational analysis): D. Chen, S. Xia, M. Wang, were washed 3 times with TBS, followed by in vitro TK assay in the Y. Li, H. Mao, M. Aguiar, J. Fan, L. Jin, L. Song, A. Mishra, J. Peng, presence or absence of recombinant active form of FGFR1 or FLT3 for M. Arellano, S. Lonial, R.L. Levine, J. Chen 90 minutes at 30°C. The beads were then washed 3 times with TBS to Writing, review, and/or revision of the manuscript: D. Chen, remove kinases, followed by addition of 1 μg PTP1B in 100 μL reaction S. Xia, M. Wang, R. Lin, Y. Li, H. Mao, C.W. Brennan, M. Arellano, buffer (50 mmol/L HEPES, pH 7.2, 1 mmol/L EDTA, 1 mmol/L DTT, W.G. Blum, S. Lonial, R.L. Levine, J. Chen

776 | CANCER DISCOVERY JUNE 2019 www.aacrjournals.org

Tyrosine Phosphorylation Activates IDH1 and R132H Mutant RESEARCH ARTICLE

Administrative, technical, or material support (i.e., reporting 17. Green A, Beer P. Somatic mutations of IDH1 and IDH2 in the leuke- or organizing data, constructing databases): M. Wang, R. Lin, mic transformation of myeloproliferative neoplasms. N Engl J Med C.A. Famulare, A.H. Shih, C.W. Brennan, X. Gao, J. Chen 2010;362:369–70. Study supervision: R. Lin, J. Peng, J. Chen 18. McKenney AS, Levine RL. Isocitrate dehydrogenase mutations in Other (provided cell lines developed in the study): J. Mukherjee leukemia. J Clin Invest 2013;123:3672–7. 19. Patel KP, Ravandi F, Ma D, Paladugu A, Barkoh BA, Medeiros LJ, Acknowledgments et al. Acute myeloid leukemia with IDH1 or IDH2 mutation: frequency and clinicopathologic features. Am J Clin Pathol 2011;135:35–45. We thank Dr. Anthea Hammond for critical reading and editing 20. Medeiros BC, Fathi AT, DiNardo CD, Pollyea DA, Chan SM, Swords of the manuscript. This work was supported in part by NIH grants, R. Isocitrate dehydrogenase mutations in myeloid malignancies. including CA140515, CA183594, CA174786 (J. Chen), R35197594, Leukemia 2017;31:272–81. CA173636, MSKCC Support Grant/Core Grant P30 CA008748 (R.L. 21. Yen K, Travins J, Wang F, David MD, Artin E, Straley K, et al. AG-221, Levine), CA169937 (H. Mao), and K08CA181507-01A1 (A.H. Shih), a first-in-class therapy targeting acute myeloid leukemia harboring and Joel A. Katz Music Medicine Fund supported by the T.J. Martell oncogenic IDH2 mutations. Cancer Discov 2017;7:478–93. Foundation/Winship Cancer Institute ( J. Chen and R. Lin). R. Lin 22. Shih AH, Meydan C, Shank K, Garrett-Bakelman FE, Ward PS, Intle- and A.H. Shih are Special Fellows of the Leukemia and Lymphoma kofer AM, et al. Combination targeted therapy to disrupt aberrant Society. J. Chen is the Winship 5K Scholar and the R. Randall Rollins oncogenic signaling and reverse epigenetic dysfunction in IDH2- and Chair in Oncology. TET2-mutant acute myeloid leukemia. Cancer Discov 2017;7:494–505. 23. Brooks E, Wu X, Hanel A, Nguyen S, Wang J, Zhang JH, et al. Received September 7, 2018; revised February 10, 2019; accepted Identification and characterization of small-molecule inhibitors of the March 7, 2019; published first March 12, 2019. R132H/R132H mutant isocitrate dehydrogenase 1 homodimer and R132H/wild-type heterodimer. J Biomol Screen 2014;19:1193–200. 24. Losman JA, Looper RE, Koivunen P, Lee S, Schneider RK, McMahon C, et al. (R)-2-hydroxyglutarate is sufficient to promote leukemogen- REFERENCES esis and its effects are reversible. Science 2013;339:1621–5. . 1 Warburg O. On the origin of cancer cells. Science 1956;123:309–14. 25. Wang F, Travins J, DeLaBarre B, Penard-Lacronique V, Schalm S, 2. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Hansen E, et al. Targeted inhibition of mutant IDH2 in leukemia cells Cell 2011;144:646–74. induces cellular differentiation. Science 2013;340:622–6. 3. Kang HB, Fan J, Lin R, Elf S, Ji Q, Zhao L, et al. Metabolic rewiring by 26. Zhao S, Lin Y, Xu W, Jiang W, Zha Z, Wang P, et al. Glioma-derived oncogenic BRAF V600E links ketogenesis pathway to BRAF-MEK1 mutations in IDH1 dominantly inhibit IDH1 catalytic activity and signaling. Mol Cell 2015;59:345–58. induce HIF-1alpha. Science 2009;324:261–5. 4. Hitosugi T, Chen J. Post-translational modifications and the Warburg 27. Ward PS, Lu C, Cross JR, Abdel-Wahab O, Levine RL, Schwartz GK, effect. Oncogene 2014;33:4279–85. et al. The potential for isocitrate dehydrogenase mutations to pro- 5. Parsons DW, Jones S, Zhang X, Lin JC, Leary RJ, Angenendt P, et al. duce 2-hydroxyglutarate depends on allele specificity and subcellular An integrated genomic analysis of human glioblastoma multiforme. compartmentalization. J Biol Chem 2013;288:3804–15. Science 2008;321:1807–12. 28. Yang B, Zhong C, Peng Y, Lai Z, Ding J. Molecular mechanisms of 6. Mardis ER, Ding L, Dooling DJ, Larson DE, McLellan MD, Chen K, “off-on switch” of activities of human IDH1 by tumor-associated et al. Recurring mutations found by sequencing an acute myeloid mutation R132H. Cell Res 2010;20:1188–200. leukemia genome. N Engl J Med 2009;361:1058–66. 29. Choudhary C, Brandts C, Schwable J, Tickenbrock L, Sargin B, Ueker 7. Yan H, Parsons DW, Jin G, McLendon R, Rasheed BA, Yuan W, et al. A, et al. Activation mechanisms of STAT5 by oncogenic Flt3-ITD. IDH1 and IDH2 mutations in gliomas. N Engl J Med 2009;360:765–73. Blood 2007;110:370–4. 8. Dang L, White DW, Gross S, Bennett BD, Bittinger MA, Driggers EM, 30. Davis MI, Gross S, Shen M, Straley KS, Pragani R, Lea WA, et al. et al. Cancer-associated IDH1 mutations produce 2-hydroxyglutarate. Biochemical, cellular, and biophysical characterization of a potent Nature 2009;462:739–44. inhibitor of mutant isocitrate dehydrogenase IDH1. J Biol Chem 9. Cairns RA, Mak TW. Oncogenic isocitrate dehydrogenase muta- 2014;289:13717–25. tions: mechanisms, models, and clinical opportunities. Cancer Discov 31. Fan J, Lin R, Xia S, Chen D, Elf SE, Liu S, et al. Tetrameric Acetyl- 2013;3:730–41. CoA acetyltransferase 1 is important for tumor growth. Mol Cell 10. Inoue S, Lemonnier F, Mak TW. Roles of IDH1/2 and TET2 muta- 2016;64:859–74. tions in myeloid disorders. Int J Hematol 2016;103:627–33. 32. Fan J, Shan C, Kang HB, Elf S, Xie J, Tucker M, et al. Tyr phospho- 11. Kroemer G, Pouyssegur J. Tumor cell metabolism: cancer’s Achilles’ rylation of PDP1 toggles recruitment between ACAT1 and SIRT3 heel. Cancer Cell 2008;13:472–82. to regulate the pyruvate dehydrogenase complex. Mol Cell 2014;53: 12. Jiang L, Shestov AA, Swain P, Yang C, Parker SJ, Wang QA, et al. 534–48. Reductive carboxylation supports redox homeostasis during anchor- 33. Shan C, Elf S, Ji Q, Kang HB, Zhou L, Hitosugi T, et al. Lysine acetyla- age-independent growth. Nature 2016;532:255–8. tion activates 6-phosphogluconate dehydrogenase to promote tumor 13. Metallo CM, Gameiro PA, Bell EL, Mattaini KR, Yang J, Hiller K, growth. Mol Cell 2014;55:552–65. et al. Reductive glutamine metabolism by IDH1 mediates lipogenesis 34. Kalinina J, Carroll A, Wang L, Yu Q, Mancheno DE, Wu S, et al. Detec- under hypoxia. Nature 2011;481:380–4. tion of “oncometabolite” 2-hydroxyglutarate by magnetic resonance 14. Gross S, Cairns RA, Minden MD, Driggers EM, Bittinger MA, Jang analysis as a biomarker of IDH1/2 mutations in glioma. J Mol Med HG, et al. Cancer-associated metabolite 2-hydroxyglutarate accumu- 2012;90:1161–71. lates in acute myelogenous leukemia with isocitrate dehydrogenase 35. Kang HB, Fan J, Lin R, Elf S, Ji Q, Zhao L, et al. Metabolic rewiring by 1 and 2 mutations. J Exp Med 2010;207:339–44. oncogenic BRAF V600E links ketogenesis pathway to BRAF-MEK1 15. Marcucci G, Maharry K, Wu YZ, Radmacher MD, Mrozek K, signaling. Mol Cell 2015;59:345–58. Margeson D, et al. IDH1 and IDH2 gene mutations identify novel molec- 36. Lin R, Xia S, Shan C, Chen D, Liu Y, Gao X, et al. The dietary ular subsets within de novo cytogenetically normal acute myeloid leuke- supplement chondroitin-4-sulfate exhibits oncogene-specific pro- mia: a cancer and leukemia group B study. J Clin Oncol 2010;28:2348–55. tumor effects on BRAF V600E melanoma cells. Mol Cell 2018;69: 16. Ward PS, Patel J, Wise DR, Abdel-Wahab O, Bennett BD, Coller HA, 923–37 e8. et al. The common feature of leukemia-associated IDH1 and IDH2 37. Zhao L, Fan J, Xia S, Pan Y, Liu S, Qian G, et al. HMG-CoA synthase mutations is a neomorphic enzyme activity converting alpha-ketoglu- 1 is a synthetic lethal partner of BRAFV600E in human cancers. J Biol tarate to 2-hydroxyglutarate. Cancer Cell 2010;17:225–34. Chem 2017;292:10142–52.

JUNE 2019 CANCER DISCOVERY | 777

Mutant and Wild-Type Isocitrate Dehydrogenase 1 Share Enhancing Mechanisms Involving Distinct Tyrosine Kinase Cascades in Cancer

Dong Chen, Siyuan Xia, Mei Wang, et al.

Cancer Discov 2019;9:756-777. Published OnlineFirst March 12, 2019.

Updated version Access the most recent version of this article at: doi:10.1158/2159-8290.CD-18-1040

Supplementary Access the most recent supplemental material at: Material http://cancerdiscovery.aacrjournals.org/content/suppl/2019/03/12/2159-8290.CD-18-1040.DC1

Cited articles This article cites 37 articles, 14 of which you can access for free at: http://cancerdiscovery.aacrjournals.org/content/9/6/756.full#ref-list-1

Citing articles This article has been cited by 2 HighWire-hosted articles. Access the articles at: http://cancerdiscovery.aacrjournals.org/content/9/6/756.full#related-urls

E-mail alerts Sign up to receive free email-alerts related to this article or journal.

Reprints and To order reprints of this article or to subscribe to the journal, contact the AACR Publications Subscriptions Department at [email protected].

Permissions To request permission to re-use all or part of this article, use this link http://cancerdiscovery.aacrjournals.org/content/9/6/756. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC) Rightslink site.