Integrative Taxonomy: Morphology and Molecular Phylogeny of the Genus Urotricha (Prostomatida, Ciliophora)

Master Thesis in Ecology and Biodiversity at the Leopold-Franzens University of Innsbruck

Supervised by Mag. Dr. Bettina Sonntag, Dr. Thomas Pröschold, Research Department for Limnology, Mondsee

B.Sc., Frantal Daniela Vorgelegt am: Innsbruck, 30.06.2020

30.06.2020

Abstract

Species of the genus Urotricha (Ciliophora: Prostomatea) are known to be key planktonic ciliates. Especially during the phytoplankton spring bloom in various freshwater systems, they consume a large proportion of the algal biomass. In lake plankton, around 20 different species of urotrichs occur throughout an annual cycle, and some of them turned out to be key species in co-occurrence networks. These ciliates are often insufficiently identified and assigned to 'Urotricha sp.’only and grouped in size classes in ecological studies. In this respect, several issues occurred specifically for the small species <20 µm because (i) no accurate identification key for urotrichs having 1-2 caudal cilia is available, (ii) a precise morphological characterization from living as well as from preserved urotrichs is challenging, (iii) reliable genetic sequences are virtually absent from public molecular databases, (iv) several species are yet undescribed, and, (v) only very few species-specific data exist. My integrative approach included morphology (in vivo observation, protargol impregnation, scanning electron microscopy) and molecular analyses (SSU rDNA, ITS-1, and ITS-2). From this combination, I am confident to add valuable species-specific datasets for especially small and some larger Urotricha species.

Table of Contents

1. Introduction ...... 8

2. Material and Methods ...... 16

2.1. Methodological Concept ...... 16

2.2. Origin of investigated Urotricha Strains ...... 17

2.3. Cultivation and Cloning Procedures ...... 18

2.4. In Vivo Observation ...... 20

2.5. Staining Methodology...... 20

2.5.1. Supravital Staining with Methyl-Green-Pyronin...... 21

2.5.2. Qualitative Protargol Impregnation ...... 21

2.5.1. Scanning-Electron-Microscopy ...... 22

2.5.2. Morphometric Analyses ...... 22

2.6. Molecular Methods ...... 23

2.6.1. Single Cell REPLIg, Amplification and Sequencing ...... 24

2.6.2. Bioinformatical Analysis ...... 26

3. Results ...... 27

3.1. Cultivation ...... 29

3.2. Morphology ...... 30

3.2.1. Cil 2017/19 ...... 30

3.2.2. Cil 2017/23 ...... 32

3.2.3. Cil 2017/24 ...... 33

3.2.4. Cil 2019/10 ...... 34

3.2.5. Cil 12 Urotricha 1 ZH from LZ ...... 35

3.2.6. Cil 2019/13 ...... 37

3.2.7. Cil 2019/6 ...... 38

3.2.8. Cil 2019/3 ...... 39

3.2.9. Cil 2017/25 ...... 40

3.2.10. Cil 2017/27 ...... 41

3.2.11. Cil 2019/1 ...... 42

3.3. Molecular Analyses ...... 44

3.3.1. Prostomatid Molecular Phylogeny ...... 44

3.3.2. Molecular Phylogeny of the Genus Urotricha ...... 46

3.3.3. The V9 secondary Structures of the investigated Urotricha Strains ...... 48

3.3.4. The V4 Secondary Structures of the investigated Urotricha Strains ...... 48

3.3.5. The ITS-2/CBC Approach in Urotricha ...... 49

4. Discussion...... 51

4.1. The Race for the most accurate Species Concept ...... 51

4.2. Cultivation of Urotricha spp...... 52

4.3. Single Cell RepliG – the Methodology of the Future? ...... 53

4.4. Molecular Phylogeny and CBC Species Concept for the Genus Urotricha ...... 54

4.5. Problems in accurate morphological Species Delimitation ...... 57

4.6. An integrative Approach - a new golden Standard? ...... 58

5. Conclusion ...... 60

6. Acknowledgements ...... 61

7. Publication Bibliography ...... 62

8. Supplementary Material ...... 71

List of Figures

Figure 1 Systematic scheme for the phylum Ciliophora ...... 8 Figure 2 Potential evolution of the phylum Ciliophora ...... 9 Figure 3 Annual distribution of ciliates ...... 10 Figure 4 Co-occurrence networks analysis of Urotricha castalia ...... 11 Figure 4 General morphology of the genus Urotricha ...... 12 Figure 5 Organization of the nucleus-encoded ribosomal operon...... 14 Figure 7 Integrative approach ...... 17 Figure 8 Study sites ...... 17 Figure 9 Recipe for the modified WC medium ...... 19 Figure 10 Live observation technique ...... 20 Figure 11 First steps of QPI: fixation of the organisms to the slides ...... 21 Figure 12 Flow chart of the staining steps of modified QPI ...... 22 Figure 13 Molecular workflow ...... 23 Figure 14 Cil 2017/19 ...... 31 Figure 15 Cil 2017/23 ...... 32 Figure 16 Cil 2017/24 ...... 33 Figure 17 Cil 2019/10 ...... 34 Figure 18 Cil 12 Urotricha 1 ZH from LZ ...... 36 Figure 19 Cil 2019/13 ...... 37 Figure 20 Cil 2019/6 ...... 38 Figure 21 Cil 2019/3 ...... 39 Figure 22 Cil 2017/25 ...... 40 Figure 23 Cil 2017/27 ...... 42 Figure 24 Cil 2019/1 ...... 43 Figure 25 SSU molecular phylogeny ...... 45 Figure 26 Molecular phylogeny of the genus Urotricha based on SSU and ITS rDNA ...... 47 Figure 27 Comparisons of the V9 secondary structures among the species of Urotricha...... 48 Figure 28 Comparisons of the V4 secondary structures ...... 49 Figure 29 General overview of the ITS-2 region ...... 50 Figure 30 Comparison of the ITS-2 secondary structures ...... 51 Figure 31 Modified illustration of the integrative species concept ...... 52

List of Tables

Table 1 Modified catalogue of life entry ...... 13 Table 2 Major characteristics on morphometric and hydrological data ...... 18 Table 3 PCR reactions components ...... 25 Table 4 Specific conditions for the SSU55 PCR ...... 25 Table 5 Modified Oligonucleotide primers ...... 26 Table 6 Synopsis of the integrative analyzed non-clonal and clonal Urotricha strains ...... 28 Table 7 Tested starvation time ...... 29 Table 8 Morphological assignment ...... 30

1. Introduction Ciliophora, an underestimated Phylum Ciliates form a considerable monophyletic entity among the unicellular eukaryotes that occupy an immense variety of limnetic, marine and terrestrial habitats worldwide (Gao et al. 2017; Gao et al. 2016; Foissner 2006). Their global biogeographical distribution varies strongly from cosmopolitan to micro-niche adaptations (Foissner 2006). Within the eukaryotic group, the phylum Ciliophora represents a mentionable taxonomic unit of organisms with specific characters that are constantly under revision (Adl et al. 2019; Gao et al. 2017; Gao et al. 2016; Corliss 1979). A detailed overview of the ciliate phylogeny of all classes (Figure 1), including the Prostomatea class, has been demonstrated by Gao et al. (2017).The potential evolutionary relationships among the phylum Ciliophora based on molecular and morphological data is shown in (Figure 2) (Gao et al. 2017).

Figure 1 Systematic scheme for the phylum Ciliophora suggested by present and a previous study (Gao et al. 2017)

The main name-giving character of the ciliates can be drawn back to the presence of cilia (Hausmann and Bradbury 1996). These features are extracellular organelles that are necessary for food ingestion and cell movement (Hausmann and Bradbury 1996).

Figure 2 Potential evolution of the phylum Ciliophora in a modified figure by combining morphological and molecular data. The evolutionary relationship and the positions of Prostomatea among the Ciliophora are marked by a red circle. (Gao et al. 2017).

Additionally, their nuclear dimorphism strikes as unique among the eukaryotes (Goldfarb and Gorovsky 2009). Besides, the presence of a divided nuclear apparatus into a macro- and a micronucleus, their availability to conjugate for sexual reproduction, qualifies them for suitable model organisms (Phadke et al. 2012; Lynn 2008; Corliss 1979). Many experts from various fields including phylogenetics, limnetic ecology and classical systematics: establish, discover, describe and redescribe various ciliates on species level (Adl et al. 2019; Gao et al. 2017; Gao et al. 2016; Adl et al. 2012; Agatha 2011). Regardless, of their high species diversity and heterogeneous morphology, accurate biogeoraphical distribution patterns and phylogenetic relationships prevail undiscovered and neglected (Foissner 2006; Corliss 1960). This ambiguity can be seen predominantly among the genera with particular obstacles in morphological and molecular species determination (Stoeck et al. 2014). One of these highly underrepresented and tremendously ambiguous genera is Urotricha (Claparède and Lachmann 1859). The latest taxonomic classification for eukaryotes places the genus Urotricha in the following lineage: Alveolata, Ciliophora, SAL (Stramenopila, Alveolata, Rhizaria), Prostomatea, Urotrichidae, Urotricha (Adl et al. 2019).

Ecology of Urotricha spp. The genus Urotricha represents one of the most common plankton ciliates, especially during the spring bloom in various freshwater systems (Weisse et al. 1990; Posch et al. 2015) During this period, Urotricha spp. dominate with other small prostomatids such as Balanion planctonicum (Sonntag et al. 2011, 2006). Urotricha spp. can be seen as typical “grazers” among zooplankton, by contributing significantly to the clear-water phase after the spring bloom (Sonntag et al. 2006; Tirok and Gaedke 2006). Thus, they can be considered as "key species" in lake plankton, as they consume a large part of the phytoplankton biomass (Figure 3, 4) (Qu et al. subm.). A general ecological overview about ciliates as “networkers” between trophic levels in the freshwater planktonic food webs was described in detail early in the past century (Beaver and Crisman 1989). However, precise statements about their autecology are rare although in the last decades numerous experiments, mainly from Lake Constance, have provided a basis for the first ecological observations also for the genus Urotricha (Weisse 2006; Weisse et al. 2001; Weisse 2001; Müller et al. 1991; Weisse and Müller 1990; Weisse et al. 1990).

Figure 3 Annual distribution of ciliates: Modified illustration showing variable species compositions across the temporal- spatial pattern. Blue Circle: Urotricha furcata is a representative for small urotrichs (<20µm) , Red Circle: Urotricha venatrix (Sonntag et al. 2006)

The role of urotrichs as key-species in co-occurrence networks

Figure 4 Co-occurrence networks analysis of Urotricha castalia in Lake Mondsee (a = 5 m; b = 40 m) and Lake Zurich (c = 120 m; d = 5 m), Different Taxa of unicellular Eukaryotes are explained in the legend. (Qu et al. subm.) Compared to Lake Mondsee, Lake Zurich inhabits lower biodiversity at the corresponding depth. These networks have been created for U. castalia as a central node from the respective sites (Qu et al. subm.).

Morphology of Urotricha The first description of the genus Urotricha can be dated back to 1859 (Claparède and Lachmann 1859). The first of, so far, of approximately 30 described urotrichs was the freshwater species Urotricha farcta (Claparède and Lachmann 1859). Initially, at the generic level, urotrichs were assigned to small Holophryidae. They all share an ellipsoid or ovoid cell shape, with one to several caudal cilia at the unciliated posterior end (Figure 5). Also, an asymmetry within their intracellular organization has been mentioned by Kahl (1935). Their oral apparatus is round and slightly subpolar, surrounded by a ring of oral flaps, which have been fused from two cilia. The contractile vacuole is eccentric at the unciliated posterior end and located opposite the adoral organelles. The macronucleus of this genus is usually spherical. According to Kahl (1935), the genus has been divided into two groups: (i) according to the number of caudal cilia, i.e., 1-2 or >3, and (ii) their typical swimming behaviour and their rapid jumping

11 movements.

Figure 5 General morphology of the genus Urotricha with its major morphological characters for determination: mostly unciliated posterior end with one or several caudal cilia (Foissner and Pfister 1997).

These observations have been supplemented, revised and edited in recent decades by several authors (Foissner 2014, 2012; Sonntag and Foissner 2004; Foissner et al. 1999; Foissner and Pfister 1997;

Foissner et al. 1994). In the current literature, about 30 species of the genus Urotricha (Table 1) are so far characterized morphologically in detail from traditional live observation complemented with silver staining methodologies (Foissner 2012; Foissner et al. 1999; Foissner et al. 1994). Further, first descriptions and misapplications combined with the revised version were displayed by Foissner et al. (2012, 1999, 1994).

Table 1 Modified catalogue of life entry of 2019 annual checklist for the genus Urotricha from the data source base CilCat (The World Ciliate catalogue). All Urotricha species are assigned in this catalogue to the group Chromista and sorted according to their caudal cilia number (CA (#)) (Aescht 2020; Roskov et al. 2019; Aescht et al. 2017; Muñoz et al. 1987)

Accepted Name Synonym for Reference CA habitat (#) Urotricha alveolata Kahl, 1926 1 freshwater Urotricha armata Urotricha lemani Foissner, Berger & Kohmann,1994 Dragesco, 1960 1 freshwater Urotricha farcta Urotricha fareta Claparède & 1 freshwater Lachmann, 1859 Urotricha minkewickzi Schouteden, 1906 1 freshwater

Urotricha minkewiczi Schouteden, 1906 1 freshwater

Urotricha parvula, Penard, 1922 1 freshwater

Urotricha globosa Schewiakoff, 1 freshwater 1892 Urotricha nais Urotricha agilis Muñoz, Tellez 1 freshwater & Fernandez- Galiano, 1987 Urotricha ovata Kahl, 1926 1 freshwater

Urotricha psenneri Sonntag & 1 freshwater Foissner, 2004 Urotricha agilis Stokes, 1886; 1 freshwater Kahl, 1930 Urotricha platystoma Urotricha armata , Kahl 1927 Stokes, 1886 1 freshwater Urotricha dragescoi Urotricha armata sensu , Dragesco, Iftode & Fryd- Foissner, 1984 1 freshwater Versavel, 1974 Urotricha furcata Schewiakoff, 2 freshwater 1892 Urotricha macrostoma Foissner, 1983 2 freshwater

Urotricha pseudofurcata Krainer, 1995 2 freshwater

Urotricha cyrtonucleata Montagnes, 3 marine, 1993 brackish Urotricha pusilla Penard, 1922 3 freshwater Urotricha matthesi subspecies. Urotricha matthesi , Krainer, 1995 Krainer, 1995 3-5 freshwater matthesi Urotricha matthesi subspecies. Foissner & 4 freshwater tristicha Pfister, 1997 Urotricha spetai Foissner, 2012 4 freshwater

Urotricha antarctica Wilbert & 6 marine, Song, 2008 brackish Urotricha castalia Urotricha rotunda Fernandez-Leborans & Novillo, 1994 Muñoz, Tellez 4 -9 freshwater & Fernandenz- Galiano, 1987 Urotricha tricha Wang & Nie, 8 freshwater 1933 Urotricha apsheronica Urotricha venatrix sensu Dragesco, Iftode & Fryd- Alekperov, 13 freshwater Versavel, 1974 1984 Urotricha terricola Alekperov & 13 soil Musayev, 1988 Urotricha pelagica Kahl, 1935 16 freshwater

Urotricha simonsbergeri Foissner, 25 freshwater Berger & Schaumburg, 1999 Urotricha valida Song & 10- freshwater Wilbert, 1989 14 Urotricha venatrix Kahl, 1935 27- freshwater 35

For a greater understanding of the ciliate taxa in aquatic environments, knowledge on their physiology is indispensable. Notable morphological adaptations to the aquatic life as the reduction of the sinking

13 rate due to their small size and their rather specialised movement including their fast and jumping behaviour are to be mentioned (Foissner et al. 1999). The characteristic jumping behaviour that serves for escape reaction could be explained by the use of its cilia (Foissner et al. 1999). Foissner and Pfister (1997) prepared a key for urotrichs with three or more caudal cilia, including newly described species. A key for urotrichs with less than three caudal cilia is still unavailable. In order to understand the small urotrichs (<20 µm), larger individuals with more than three caudal cilia must be implemented in this study. Establishing Urotricha morphotypes according to the morphospecies concept, was an essential part of this thesis (Aldhebiani 2018). Moreover resting cysts of pelagic ciliates are largely unknown – also for Urotricha spp. (Mertens et al. 2012, Foissner et. al 2007,1999).

Molecular Approaches in Ciliate Phylogeny In this study, a single-cell REPLIg PCR was used for developing molecular investigations in order to obtain reliable results by sequencing the nuclear-ribosomal operon using a bioinformatical approach. By using this method, the DNA of single cells can be amplified directly in a PCR and sequenced afterwards. The enormous advantage of this methodology is that all eukaryotic organisms share a similar ribosomal operon (Figure 6). It consists of highly conserved as well as highly variable regions following the same structural pattern (Sonnenberg et al. 2007). Although the mitochondrial marker from the cytochrome oxidase I gene (COI) is en vogue in science, nuclear genes of the ribosomal operon manage to deliver additional valuable insights into species determination taking the molecular path (Zhan et al. 2019; Sonnenberg et al. 2007). The ribosomal operon consists of a SSU (small subunit) rRNA region and a LSU (large subunit) rRNA region (Coleman 2003; Coleman 2000). The following gene regions of the SSU rRNA were used for the phylogenetic determination: V4 and V9 (Stoeck et al. 2014; Pawlowski et al. 2012; Zimmermann et al. 2011). Those regions of the nucleus-coding SSU rRNA were chosen as barcode markers, although the main focus concerning species delimitation was on the sequences of the Internal Transcribed Spacer (ITS) sequences of the nuclear rDNA (Figure 6).

Figure 6 Organization of the nucleus-encoded ribosomal operon. The major marker genes (yellow) and the barcode regions in the SSU (green) used for phylogenetics (modified by Thomas Pröschold) (Coleman 2000; Coleman 2003; Sonnenberg et al. 2007).

Regarding this species-specific region with a higher resolution, the ITS-1 is separated from the ITS-2 by the 5.8 s ribosomal gene. In contrast, the SSU rRNA and the LSU rRNA form the outer edges of the 14 ribosomal operon. The SSU rRNA markers were selected to provide the best possible starting point for comparisons among the various Urotricha strains. In recent eDNA studies for ciliates, the V9 marker is the method of choice. This region is proposed as a standard marker for marine aquaculture studies and is gaining popularity in freshwater studies as well (Forster et al. 2019; Pitsch et al. 2019; Vargas et al. 2017; Vargas et al. 2015a). Therefore, an essential question of this study is whether the popular V9 region is a valuable marker gene for the genus Urotricha as it is for other planktonic eukaryotes so far (Dunthorn et al. 2012). Generally, the SSU rRNA region and its barcode regions is a well-established marker region for phylogenetic studies. The hypervariable V4 region was also selected as well as the less variable V9 region (Stoeck et al. 2014). Additionally, comparisons between the specific barcode markers to already existing gene bank entries were made via BLASTn search (Altschul et al. 1990). A constant trade-off between hypervariability and conservation should be implemented in the choice of marker genes in order to draw accurate conclusions for molecular species determination. This dialogue among scientists concerning the ideal marker genes should be applied unbiased for every ciliate examination de novo (Zhan et al. 2019; Dunthorn et al. 2012). The comparison of various partially hypervariable marker regions of the 18S-rRNA seems to be an essential step in nowadays phylogenetical research to create a bigger picture for ciliate specific phylogeny (Tanabe et al. 2016; Dunthorn et al. 2012). Occasionally, the “too conservative V4” region hampers environmental diversity and could be estimated more precisely with a multilocus marker including the ITS-region analysis (Zhan et al. 2019). Whereas in other studies, the V4 region seems to be too variable in order to assess species diversity (Stoeck et al. 2014). The accuracy of marker genes is reliable on the genus level by examination of the LSU/SSU, whereas for a higher resolution at the species-level, the ITS region should be examined more closely (Coleman 2000). Concerning a more detailed ciliate differentiation, the ITS-2 region contained undoubtedly more valuable information about species reconstruction and has already been checked for various ciliates including Paramecium spp., Tetrahymena spp. and Spirostomum spp. in the past two decades (Shazib et al. 2016; Coleman 2005). Therefore, the ITS-2 region was chosen because of its exact delimitation at the species level and the underlying CBC species concept (Coleman 2003; Coleman 2000). This variation in the ITS-2 secondary structure showed that a compensatory base exchange (CBC) in Helix II or Helix lll of the ITS- 2 secondary structure resulted in sexual incompatibility and thus, represent two different biological species (Coleman 2000). Morphological descriptions of ciliate taxa lack valuable sequence data (Pitsch et al. 2019; Gimmler et al. 2016; Gimmler and Stoeck 2015; Dunthorn et al. 2014). Therefore, recent species descriptions include molecular data of the small subunit of the ribosomal RNA gene (SSU rRNA).

Objectives The aim of the study includes novel morphological and molecular data collection for the so far underestimated genus Urotricha with the focus on species <20 µm, having 1 or 2 caudal cilia. This Master thesis relies on a holistic taxonomical analysis by conducting an integrative phylogenetic approach. Also, one of the goals was to intensify barcoding efforts for the genus Urotricha by supporting their role as model organisms. Including such a broad approach, their importance by occupying ecological niches can be improved and their role in complex co-occurrence networks finally analysed. Due to queries in cultivation with many ciliates, a molecular environmental data approach is an indispensable backbone for first insights into phylogenetic questions. Following this molecular track in this study, a specific approach concerning molecular evaluations is applied here. The use of an integrative approach allowed us to establish a link between the Urotricha morphotypes and the molecularly elaborated species. A total of 23 strains from different study sites from Austria and Switzerland were studied to assess the morphological and genetic variability of the species.

Therefore, the following objectives were addressed:

(i) Detailed morphological and genetic characterization of small" Urotricha species (<20 µm, with 1 or 2 caudal cilia) (ii) Detailed morphological and genetic characterization of larger Urotricha species (>20 µm, with >4 caudal cilia) originating from various biogeographic regions (iii) Identification of yet undescribed species

2. Material and Methods

2.1. Methodological Concept

By applying an integrative approach, the following working protocol was applied (Figure 7).

Single cell SEM - Morphology Cultivation Cloning PCR + (optional) Barcoding

Figure 7 Integrative approach for the investigation of a ciliate species

2.2. Origin of investigated Urotricha Strains

The Urotricha spp. used in this study originated from diverse water bodies in Austria and in Switzerland (Figure 8). Data from the investigation sites Lake Mondsee (LM) and Lake Zurich (LZ) are currently under investigation in the course of the polyphasic D-A-CH project. An intensive sampling campaign was conducted during the years 2016 - 2017 biweekly in both lakes (Qu et al. subm.). All five sampling sites are characterized by varying physico-chemical parameters and biotic conditions (Table 2).

Figure 8 Study sites across Tyrol; Upper Austria in Austria and Canton, Zurich, Switzerland; Legend explanation: Lake Mondsee (LM, Lake Zurich (LZ), Lake Piburg (Lake PIB), Lake Faselfad 5 (Lake FAS 5); and Lake Hairlach (Lake HAI) Source: google maps via coordinates.

The three pre-alpine lakes (LZ, LM and Lake PIB) are located at altitudes <913 m above sea level (a.s.l.), whereas all others are situated above 2,324 m a.s.l including two alpine lakes (i.e., situated above the treeline). Lake HAI and Lake PIB are both situated in the same biogeographic area (Figure 8) Further detailed information about the investigations sites can be found elsewhere (Pitsch et al. 2019; Bergkemper and Weisse 2018; Niedrist et al. 2018; Yankova et al. 2017; Sonntag et al. 2017; Kammerlander et al. 2016; Stoeck et al. 2014; Sonntag et al. 2011) and (https://awel.zh.ch).

Table 2 Major characteristics on morphometric and hydrological data of the five lakes investigated.

LM LZ Lake PIB Lake FAS 5 Lake HAI altitude (m a.s.l) 481 406 913 2,324 2,830 maximal depth (m) 68.3 136 24.6 2.7 8.0

mean depth (m) 35.9 49.9 - - surface area (km²) 13.78 66.8 0.17 - -

catchment-area 247 1,811 1.34 - - (km²) volume (km ³) 0.51 3.9 - - - water retention 1.7 1.2 1.6 - -

time (year)

Mean-water 12 5.4 -22 10.5 3.6 1.7–9.0

temperature (°C)

Coordinates 47°48'59.0" N 47°17'08.8"N 47°11′42.0″ N, 47°4'46.28.0''N, 47°06'10.9"N 13° 22' 59.0" E 8°35'27.6"E 10°53′20.0″ E 10°13'27.0'' E 10°51'48.2"E Mixis holo-dimictic Monomictic; Dimictic - - Transition to Holomixis monomictic potentially possible Trophic status oligo- oligo- oligo- ultra- oligotrophic mesotrophic mesotrophic mesotrophic oligotrophic

2.3. Cultivation and Cloning Procedures

Initially, all cultures were treated as mixed cultures containing potentially multiple species. Later, ciliates were cloned after washing. These steps are described under the section cloning procedure. Detailed information of the manipulated strains is shown elsewhere. Cultivation Conditions For most Urotricha strains, I used a modified Wood Hole MBL medium (WC) /Volvic® mineral water (5:1) medium for cultivation that has been tested before as appropriate for these ciliates (Figure 9) 18

(Qian et al. unpubl.). For the cultivation of Cryptomonas SAG 26.80 originating from Göttingen a modified WC medium was used (Guillard and Lorenzen 1972).

Figure 9 Recipe for the modified WC medium for freshwater algae (Guillard and Lorenzen 1972)

Purification Only after an adequately conducted washing procedure, a pure strain can be cultivated. For both the molecular part before PCR and for the cultivation of new strains, the following described process is crucial. Initially, a drop from the original mixed sample is transferred with a plastic Pasteur pipette (2 ml) onto a clean slide. On a second slide, five single drops of medium (WC: V; 5:1 or pure WC) were distributed. Using a stereo magnifier (Olympus SZ61), single individuals were transferred from one drop to the next by a drawn glass pipette following Foissner (2014) in order to remove debris particles another protists. From the fifth drop, the single ciliate was moved into a 96-well (Biomedica) plate with the desired medium-amount of 5-10 small drops with a plastic Pasteur pipette (2 ml) (S-Table 1). The appropriate proportion of food resource and medium needs to be tested per strain, with at least three parallels. Precise handling guaranteed success in growing the culture and also reduced the risk of contamination. Overall, the inoculated strains finally contained 3 ml culture, 1 ml dense Cryptomonas SAG 26.80 culture and 40 ml of the desired medium. The entire inoculation of the single-cell strains was done under the Clean Bench. The overall “swarming behaviour” served as a valuable indicator of cultural status that is mentioned in detail in the discussion. A diminishing movement of the cells indicated a worsened status of the Urotricha cells. The feeding procedure of the cloned ciliates included noting down the age of Cryptomonas sp. SAG 26.80, the amount of added medium (ml).The distrbution in the culture bottles was conducted by a sense of proportion because there is a danger that the 19 cryptomonads overgrow the few ciliate cells. To counteract overgrowth, it helped to wrap the well- plates or culture bottles with aluminium foil for a few days so that mass reproduction of the cryptomonads could be inhibited.

2.4. In Vivo Observation

Living ciliates were examined under differential interference contrast by using an Olympus BX51 microscope with various magnifications between 40x and 1000x. Two different image analysis systems from Jenoptik ProgRes SpeedXT core 5 2.9.0.1. and Jenoptik PROGRES Gryphax ® Arktur for documentation were used. For species determination, the following characters were investigated: cell-shape, position and size of the contractile vacuole, swimming behaviour, position and size of the nuclei, shape, position and size of the extrusomes, somatic and caudal cilia (length and number). The literature used for the morphological species determination included (Foissner (2012); Foissner et al. (1999); Foissner and Pfister (1997) and original literature with first descriptions listed in the introduction.

Figure 10 Live observation technique (Foissner 2014).

2.5. Staining Methodology

It is crucial to apply different impregnation methods for holistic results of all morphological characters because the various methods reveal different features in the ciliates (Foissner 2014; Foissner et al. 1999). Impregnation methods for species determination of Urotricha spp. included supravital staining

20 with Methyl-Green-Pyronin, the qualitative protargol impregnation (QPI) after Foissner and Scanning- electron microscopy (SEM) (Foissner 2014).

2.5.1. Supravital Staining with Methyl-Green-Pyronin Hand in hand with the in vivo observation, the supravital staining method with 1% Methyl-Green- Pyronin (Sigma-Aldrich) was used. One drop of the 1 % distilled Methyl-Green-Pyronin solution was added to the manipulated specimen and after approximately 1 min, the often inconspicous nuclei, eventually food vacuoles and extrusomes were revealed.

2.5.2. Qualitative Protargol Impregnation The QPI methodology after Foissner with modifications was applied (Figure 11 and Figure 12) including a list of needed reagents listed in the supplementary material (S-Table 4, S-Table 5). Cultures containing a dense concentration of Cryptomonas SAG 26.80 need to be diluted beforehand in order to get appropriated imaging of the desired ciliates. For fixation purposes, Bouin’s fluid (1:10) was used. All purifications steps served to eliminate Bouin’s fluid from the samples (Figure 11). Albumin-Glycerol was produced immediately before the staining procedure (Renu Gupta pers. comm.).

Drying process of 12-24 h Dilution of dense culture Distribution of ciliates on crucial step for sucessful with medium (optional) the slides Staining

Smooth distribution of Over night: Preservation in Albumin-Glycerol (1:1) Bouin's Fluid (1:10) with mounted needle

Purification by centrifugation: 3–4 times Slide labelling for 5 min at 4.0 rpm in MILLI-Q® ((Eppendorf, Centrifuge 5424)

Figure 11 First steps of QPI: fixation of the organisms to the slides

Tap water Tap water Isopropyl 100% MILLI-Q® Isopropyl 70% (3 min) (few minutes) (30 min) (3 min) (5 min)

Sodium- Isopropyl 70% Tap water heated Protargol Isopropyl 100% Thiosulfate (5%) (5 min) (few seconds) (30 -45 min) (5 min) (5 min)

Tap water Oxalic acid (2,5%) MILLI-Q® Tap water Rotihistol (5 min) (100s - 110 s) (few minutes) (3 min) (10 min)

Acetone Tap water Tap water Tap water Rotihistol Developper (5 min) (3 min) (3 min) (10 min - infinite) (5 -10 s)

Tap water KMnO₄ (0,2%) Tap water Microscopic Mounting in (3 min) (50 s - 60 s) (3 min) evaluation Canadabalm

Figure 12 Flow chart of the staining steps of modified QPI after fixation of the organisms on the slides the previous day with Albumin-Glycerol. Each step is conducted in a separate staining jar. Further information see in the supplementary material.

2.5.1. Scanning-Electron-Microscopy Although scanning electron microscopy (SEM) can visualize specific organelles with high resolution, it would be insufficient using only this method for species determination. It serves for a detailed perspective on the ciliary pattern and the adoral organelles of the single cell. All cell organelles inside the ciliate such as the nuclear apparatus remain undiscovered. I used SEM for two strains Cil 2019/3 and Cil 2017/48 in order to confirm their taxonomical designation by examine further details like the adoral organelles or the position of the excretory pore. The SEM followed Foissner (2014). The manipulation of the cultures before the SEM is crucial beforehand for this method. Best results can be achieved with several times purified samples with a relatively low cryptomonad- and debris concentration. All specimens were fixed for 30 min in a Parducz’ solution made of OsO4 (2%) and denaturated aqueous HgCl2 (0,6%). Purification in a Sodium cacodyl buffer, three times was essential for further steps processed by the laboratory of Sabine Agatha, University of Salzburg.

2.5.2. Morphometric Analyses With the obtained data from the in vivo observation and various staining methods a morphometric table was created. The morphometrical table includes body length (µm), body width (µm), somatic cilia length (µm), length,(μm); macronucleus, length, (μm); macronucleus, width, (μm); micronucleus, length, (μm); micronucleus, width, (μm); posterior extrusomes, length, (μm); anterior extrusomes, 22 length, (μm); contractile vacuole, diameter, (μm); oral opening/basket, max.diameter, (μm); oral basket width: body width, ratio in %, somatic ciliary row, (number); cilia in somatic row, (number); anterior end to end of macronucleus, distance, (μm); unciliated posterior end, (μm); oral flaps length, (μm); caudal cilia, (number); caudal cilia, length, (μm); dikinetids in brosse kinety number 1, number; dikinetids in brosse kinety number 2, number; dikinetids in brosse kinety number 3, number; body shape, extrusomes shape, food vacuoles, length, (μm), fat globuli; All calculated or measured parameters included the following statistical tests calculated with Excel®: X̄ (arithmetic mean), M (median), SD (standard deviation), SE (standard error), CV (coefficient of variation ), Min (minimum), Max (maximum) with n (number of individuals).

2.6. Molecular Methods

Before the ribosomal operon of desired strains could be phylogenetically examined, a particular molecular and bioinformatics based workflow has been generated (Figure 13). Initially, multiple cells were isolated from a culture in case that some specimens died during starvation. The washing procedure guaranteed uncontaminated sequences in the end and was therefore a crucial step. For evaluation of the barcodes, the necessary programs served for a detailed interpretation of the secondary structure and visualization of the base differences among strains on the species level.

PopART Isolation of several Sequencing Assembly (Visualization of base cells from culture (GATC Biotech) (Mac Vector) differences)

Purification of the Consensus BLAST Gel elektrophoresis single cell (Gen Bank, wordpad) (similiar sequences)

PCR x 2 Alignment Phylogentical analysis Starvation of the cells (2 overlapping PCR (Mac vector, Nexus) (PAUP) products)

Folding of Secondary Visualization Purification of the structure Single cell REPLIg (Varna/Pseudo single cells (m-fold; Vienna viewer) package)

Figure 13 Molecular workflow

2.6.1. Single Cell REPLIg, Amplification and Sequencing This relatively quick methodology aims to amplify the desired DNA region via the so-called single-cell REPLIg method. Therefore, two independent PCR-reactions revealed regions of the ribosomal operon including the marker genes ITS-1/ITS-2. For a more general view within the Prostomatea, 18 S rRNA including the markers V4 and V9 were examined. The Single Cell REPLIg method was applied according to the REPLIg® Single Cell Handbook for whole genome amplification from single cells (Qiagen with the Catalog no 150343). This method guarantees relatively quick, reliable results without the amplification of foreign DNA. The following steps are crucial to obtain successful results. Initially, all specimens needed to be manipulated individually and starved preventing contamination by foreign DNA.

Approximately ten cells per strain were washed in 96-well plates (see before). This washing- and starvation procedure has been modified several times due to the high mortality rate of single-cells under stress conditions (Table 7).

Steps of the Single Cell REPLIg approach: After adding 4 µl of phosphate-buffered saline solution (PBS Qiagen) into labelled 200 µl PCR Tubes (StarLab) that were placed on a precooled rack, one single cell was added. After adding 3 µl D2 buffer (Qiagen) and flicking the tubes, they were incubated for 10 min at 65 °C (program 65) in a Mastercycler (Thermal Mastercycler ®nexus gradient, Eppendorf). After 10 minutes, 3 µl of the Stop solution

(Qiagen) were added. The following 40 µl Mastermix was transferred into the PCR-tubes: 9 µl H2O sc, 29 µl REPLI-g sc Reaction Buffer, 2 µl REPLI-g sc DNA Polymerase. Finally, the following program was applied: 8 h over 30 °C and 3 min at 65 °C in the thermal Mastercycler. Afterwards, two independent PCR reactions were performed with an overlap of approximately 180 bp among them. The PCR reactions were conducted with the following primers under the conditions given in Table 3 and Table 4.

For the first PCR product, the forward eukaryotic-specific primer EAF3 (5’TCGACAATCTGGTTGATCCTGCCAG3’) and the reverse ciliates-specific CilR were used (Marin et al. 2003). The CilR primer was a combination of three already existing primers after several modifications of CilR1 (5’TCTGATCGTCTTTGATCCCTTA), CilR2 (5’TCTRATCGTCTTTGATCCCCTA3’), CilR3 (5’TCTGATTGTCTTTGATCCCCTA3’) (Lara et al. 2011). For the second PCR product, the primer pair consisting of the ciliate-specific CILF (5’TGGTAGTGTATTGGACWACCA3’) and the eukaryotic specific ITS055R (5’CTCCTTGGTCCGTGTTTCAAGACGGG3’) were used (Lara et al. 2007; Marin et al. 2003).

The First PCR consisting of the primer pair EAF3 + CilR amplified the front part of the 18 SSU rRNA with a length about 600 base pairs. The second PCR (CilF and ITS055R) had an overlap of approximately 180 bp between the two PCR products. In total, the primers used amplified a gene region with a length of

24 approximately 2,200-2,500 bp and contained the following barcode regions: V4 and V9 region of the nucleus-encoded SSU, ITS-1 and ITS-2, and regions of the LSU as shown in (Figure 6).

All of the components listed in Table 3 were pipetted together to a PCR mastermix and 50 µl of this mix was added to the ciliates in each tube. The PCR tubes were placed therefore directly into the PCR thermal cycler (Eppendorf flexlid Mastercycler nexus gradient) and the program SSU55 was started with the settings shown in Table 4.

Table 3 PCR reactions components, including the forward (EAF3/CilR) and reverse (CilF/ITS055R) primer regions with a volume of 50 µl performed twice by gathering an overlapping result.

Components Volume

Taq-PCR-Mastermix (Qiagen) 25 µl

H2O (Qiagen) 24 µl

EAF3/CilF (forward) (10 µM) 0.5 µl

Primer CilR/ITS055R (reverse) (10 µM) 0.5 µl

Table 4 Specific conditions for the SSU55 PCR reactions in 30 cycles (green)

PCR-Phase Temperature Time

initial denaturation 96 °C 5 min denaturation 96 °C 1 min primer annealing 55 °C 2 min elongation 68 °C 3 min final elongation 68 °C 10 min storage 10 °C infinite

For the detection of PCR products, a gel electrophoresis was performed. A 2% agarose was used (Carl Roth Agarose) diluted in TRIS-Boric acid-EDTA-Puffer (0,5 x TBE-Buffer). Visulization was performed with using the Image Lab (BIORAD Molecular Imager). The samples with visible PCR bands were extracted from the gel with the QIAquick gel extraction kit and purified with QIAquick PCR Purification Kit, both from Qiagen. Afterwards, 5 µl of the purified PCR product was mixed with 5 µl of 5 µM sequence primers (N82F, E528F, N920F, BR, N920R, 536R, GF and GR) and sent for sequencing to Eurofins Genomics Europe Sequencing GmbH; GATC Biotech (Table 5).

Table 5 Modified Oligonucleotide primers used for amplification and sequencing. Green marked sections show primers for front part /first PCR reaction, white marked primers used for back part/ second PCR reaction

Name Base composition (5’-3’) Reference

N82F 5´-ATACTGTGAAACTGCGAATGGCTC-3´ Darienko et al. (2019)

536R 5´-GWATTACCGCGGCKGCTG-3´ Marin et al.(2003)

E528F 5´-TGCCAGCAGCYGCGGTAATTCCAGC-3´ Darienko et al. (2019)

N920F 5´-CAAGGCTGAAACTTAAAKGAATTG-3´ Darienko et al. (2019)

BR 5´-TTGATCCTTCTGCAGGTTCACCTAC-3´ Marin et al. (2003)

N920R 5´-TTCCGTCAATTCCTTTRAGTTTC-3´ Darienko et al. (2019)

GF 5´-GGGATCCGTTTCCGTAGGTGAACCTGC-3´ Coleman et al. (1994)

GR 5´-GGGATCCATATGCTTAAGTTCAGCGGGT-3´ Coleman et al. (1994)

2.6.2. Bioinformatical Analysis

Both SSU and ITS rDNA of the nuclear ribosomal operon were sequenced and analyzed, including the barcode marker regions V4 and V9 (Figure 13). Initially, all sequences were assembled using MacVector, version 17 and aligned according to their secondary structures. The SSU rRNA sequence of a Paramecium bursaria strain (SAG 27.96) served as a template for the secondary structure alignment according to the Vienna format. Primarily, the program mfold following a thermodynamic model that is folding helices at 37°C into the secondary structures served as a useful tool for secondary structure analyses (Zuker 2003). Additionally, ITS rRNA structures were graphically displayed using PseudoViewer 3 (Byun and Han 2006) and VARNA 3.9 (Darty et al. 2009). Afterwards, these thermodynamically folded hairpin-loops were used for species determination within the genus Urotricha at a molecular level. Moreover, following the CBC procedure, the highly conserved region of ITS-2 was examined by comparisons of the V4 and V9 barcode regions (Coleman 2000). Therefore, compensatory base changes (CBCs) and hemi-CBCs, and other substitutions were identified individually for every Urotricha strain (Coleman 2005). The aligned Urotricha spp. sequences were integrated into two data sets: (1) SSU data set of 37 taxa of the Prostomatea (1,755 bases) and (2) SSU/ITS data sets of 18 taxa of the studied Urotricha strains (2,343 bases). To find the most suitable evolutionary model for the data sets, the program ModelTest 3.7 was used (Posada 2008). After the results of these tests, the best model for the Akaike Information criterion was chosen (Akaike 1974). The used settings are displayed in the section results in the legends of the family tree figures, including the settings of the best models. The following methods were used for the phylogenetic analyses: Maximum Likelihood, Neighbor-Joining and Maximum Parsimony using the model determined as best by ModelTest. For all these calculations, the program PAUP version 4.0a167

26 using the NEXUS format was used (Maddison et al. 1997). The closest match of the Blasted Sequences from NCBI (Nation Center for Biotechnology) of the V4 region with the query cover close to 100% and the percentage identity of at least 98% were searched and compared with the examined Urotricha strains.

3. Results

In total, 23 strains of Urotricha spp. were analyzed following a combined morphological - molecular- integrative approach. All of the 23 strains were examined genetically and 12 of those also morphometrically, 14 clonal cultures were successfully obtained (Table 6).

Table 6 Synopsis of the integrative analyzed non-clonal and clonal Urotricha strains including old and new strain number, origin, sampling and isolation date, lab conditions and lab treatment. Analysis of Urotricha spp. strains: M+G = morphologically and genetically determined; G = genetically determined only; New strain numbers marked with an X represent original non-clonal cultures. Abbreviations: B.S. = Bettina Sonntag; B.K. = Barbara Kammerlander; D.F.= Daniela Frantal; G.P.= Gianna Pitsch.

Original Strain number New strain number Isolated by, isolating date Medium, Temperature (C°) Analysis

Urotricha sp. 1 FAS 5 Cil-2017/19 B.K., WC, 15 °C/ 5°C M+G unknown Urotricha sp. 2 clone 1 LM Cil-2017/23 B.K., WC/V 5:1, 15 °C M+G 10/31/2017 Urotricha sp. 2 clone 2 LM Cil-2017/24 B.K., WC/V 5:1, 15 °C M+G 10/31/2017 Cil-2017/25 Cil-2017/25 B.K., WC/V 5:1, 15 °C M+G Urotricha castalia LM (clone 1) 10/31/2017 Cil-2017/27 Cil-2017/27 B.K., WC/V 5:1, 15 °C M+G Urotricha castalia LM (clone 3) 31/10/2017 Cil-48 X X WC/V 5:1, 21 °C G Urotricha sp. #3 LZ Cil-48 Cil-2019/1 D.F., WC/V 5:1, 21 °C M+G Urotricha sp. #3 LZ 07/23/2019 (clone 1) Cil-48 Cil-2019/2 D.F., WC/V 5:1, 21 °C G Urotricha sp. #3 LZ 07/23/2019 (clone 2) Cil-49 X X WC/V 5:1, 21 °C G Urotricha sp. #5 LZ (non-clonal) Cil-49 Cil-2019/3 D.F., WC/V 5:1, 21 °C M+G Urotricha sp. #5 LZ 07/22/2019 (clone 1) Cil-49 Cil-2019/4 D.F., WC/V 5:1, 21 °C G Urotricha sp. #5 LZ 07/22/2019 (clone 2) Cil-12 X X WC/V 5:1, 21 °C M+G Urotricha 1 LZ Cil-12 Cil-2019/5 D.F., WC/V 5:1, 21 °C G Urotricha 1 LZ 08/05/2019 (clone 1) Cil-12 Cil-2019/6 D.F., WC/V 5:1, 21 °C M+G Urotricha 1 LZ 08/05/2019 (clone 2) Cil-12 Cil-2019/7 D.F., WC/V 5:1, 21 °C G Urotricha 1 LZ 08/05/2019 (clone 3) Cil-12 Cil-2019/13 D.F., WC/V 5:1, 21 °C M+G Urotricha 1 ZH 12/13/2019 (clone 4) Cil-12 Cil-2019/14 D.F., WC/V 5:1, 21 °C G Urotricha 1 LZ 12/13/2019 (clone 5) Cil-12 Cil-2019/15 D.F., WC/V 5:1, 21 °C M+G Urotricha 1 LZ 12/17/2019 (clone 6) Cil-11 X X WC/V 5:1, 21 °C G Urotricha 8 PIB Cil-11 Cil-2019/8 D.F., WC/V 5:1, 21 °C G Urotricha 8 PIB 07/19/2019 (clone 1) Cil-11 Cil-2019/9 D.F., WC/V 5:1, 21 °C G Urotricha 8 PIB 07/19/2019 (clone 2) Cil-11 Cil-2019/10 D.F., WC/V 5:1, 21°C M+G Urotricha 8 PIB 07/19/2019 (clone 3) CIl HAI x unknown NO CULTURE G (non clonal)

3.1. Cultivation

Cultivation and Starving : Urotrichs with specimens <20 µm seem to react sensitively towards long starvation periods. The starvation time had to be determined individually for each clone according to their cell size and the number of food vacuoles (Table 7). Larger individuals from, e.g., U. castalia contained more food vacuoles and accordingly needed longer starvation periods. Astonishingly, smaller individuals (<20 µm) had a lower stress tolerance towards missing food resources and could be treated with shortened or no starvation periods at all. Starvation for specimens < 20µm is optional since no contamination by foreign DNA was detected in the sequences.

Table 7 Tested starvation time tables according to new strain name and successful sequencing results labelled with OK, Unsuccessful results are marked with an X and had to be repeated. Numbers marked with a *show loss of cell due to prolonged starvation time.

Strain Starvation Time (min) Sequencing result 2019/1 240 X

2019/2 240 Ok Cil 2017/25 240 Ok Cil 2017/27 240 Ok Cil 2017/23 240 *→ 0 Ok Cil 2017/24 240 *→0 Ok Cil 2017/19 0 Ok Cil 2017/23 0 Ok Cil 2017/24 0 Ok Cil 2019/3 0 Ok Cil 2019/4 0 Ok Cil 2019/1 80 Ok Cil 2019/8 105 OK Cil 2019/9 45 Ok Cil 2019/10 20 Ok Cil 2019/5 80 Ok Cil 2019/6 90 Ok Cil 2019/7 90 *→ 0 Ok Cil 2019/13 90 *→ 0 OK Cil 2019/14 20 X Cil 2019/15 10 X Cil 2019/14 0 OK Cil 2019/15 0 OK

3.2. Morphology

All strains in this section were grouped according to their number of caudal cilia (CC), starting with four strains with one CC, continuing with four strains with 2 CC and finishing with three strains with more than 4 CC per specimen; (i) 1 caudal cilium: Cil 2017 /19, Cil 2017 /23, Cil 2017 / 24, Cil 2019 /10; (ii) 2 caudal cilia: CIL 2017/ 12 ZH, Cil 2019/6, Cil 2019/13, Cil 2019/3; (iii) ≥ 4 CC: Cil 2017/25, Cil 2017/27, Cil 2019/ 1. The species-specific morphometric table combining in vivo and protargol impregnated specimens is displayed in the supplement (S-Table 7 ).

Table 8 Morphological assignment to already described species including number of caudal cilia (CC)

Strain Assigned species Cil 2017 /19 Urotricha cf. globosa (1CC) Cil 2017 /23 Urotricha cf. agilis (1CC) Cil 2017 /24 Urotricha cf. agilis (1CC) Cil 2019 /10 Urotricha cf. agilis (1CC) Cil 12 Urotricha 1 ZH from LZ Urotricha cf. furcata (2CC) Cil 2019/6 Urotricha cf. furcata (2CC) Cil 2019/13 Urotricha cf. furcata (2CC) Cil 2019/3 Urotricha sp. (2CC) Cil 2017/25 Urotricha castalia (≥4 CC) Cil 2017/27 Urotricha castalia (≥4 CC) Cil 2019/ 1 Urotricha castalia (≥4 CC)

3.2.1. Cil 2017/19 This strain corresponds to Urotricha cf. globosa (measurements and countings are compared to Foissner et al. (1999) : cell length = 16.9 – 34.8 µm (in vivo) vs. 18.0 - 25.0 µm, cell width= 14.5 – 28.9 µm (in vivo) vs. 15 - 25 µm, number of caudal cilia = 1, cell shape = globular (in vivo), somatic ciliary rows = 15 -19 vs. 17 - 25, and extrusomes present (Figure 14). Further investigation of key characters for final species delineation in particular of the adoral organelles is recommended to be performed by applying SEM. However, the length of the one caudal cilium should reach body length for U. globosa and would speak therefore rather for Urotricha farcta. All other characaters could be connected to U. cf globosa.

Figure 14 Cil 2017/19 assigned to Urotricha cf. globosa: ( a,c-g: living observation; b: after supravital-methyl green-pyronin impregnation) a: lateral view of specimen with large FV, b: illustration of globular macronucleus, c: specimen in lateral view with no food vacuole and globular body form, d: bursted specimen with Macrunucleus structure ruptured, e: extrusomes and somatic cilia of bursted specimen f, g: globular body shape and swimming behaviour with relatively slow jumps in various directions and spinning behaviour, release of FV; C = somatic cilia CA = caudal cilia, CV = contractile vacuole, FV = food vacuoles, MA = macronucleus,OF = oral flaps.

3.2.2. Cil 2017/23 This strain corresponds mainly to Urotricha cf. agilis (measurements and countings are compared to Foissner et al. (1999): cell length = 13.3 – 24.4 µm (in vivo) vs. 10.0 - 20.0 µm and width= 8.0 – 16.3 µm (in vivo) vs. 7.0 - 14.0 µm, number of caudal cilia = 1, vs. 1, cell shape = triangular (in vivo), somatic ciliary rows = 10 - 13 vs. 12 - 14, and the occurrence of in vivo rather inconspicuous extrusomes, that were stained well by protargol (Figure 15). The number and arrangement of the adoral organelles is not known so far, but crucial for species assignment. Further investigation of key characters for final species delineation in particular of the adoral organelles is recommended to be performed by applying SEM. According to the caudal cilium for Urotricha agilis the length of this character should reach body length. Here only caudal cilia with half of their body size were measured (S-Table 7).

Figure 15 Cil 2017/23 assigned to Urotricha cf. agilis: (a,b: living observation; b-g: after qualitative protargol impregnation) a: lateral view of slightly squished specimen with ingested food vacuoles, b: illustration of globular macronucleus and triangular body shape, c: ciliary rows illustrated, d-e:lateral view of specimen with species-specific organelles, f: oral apparatus in detail including oral flaps g : lateral view, rod-shaped extrusomes, C = somatic cilia CA = caudal cilia, CV = contractile vacuole , E = extrusomes; FG = fat globuli, FV = food vacuoles, MA = macronucleus, OB = oral brosse; OF = oral Flaps. 32

3.2.3. Cil 2017/24 This strain corresponds mainly to Urotricha cf. agilis (measurements and countings are compared to (Foissner et al. (1999) : cell length = 14.1 – 22.8 µm (in vivo) vs. 10.0 - 20.0 µm and width = 8.9 – 16.1 µm (in vivo) vs. 7.0 - 14.0 µm, number of caudal cilia = 1 vs. 1, cell shape = triangular (in vivo), somatic ciliary rows = 14 - 20 vs. 12 - 14. Further investigation of key characters for final species delineation in particular of the adoral organelles is recommended to be performed by applying SEM. Similar to Cil 2017/23 the number of the adoral organelles must be confirmed, before final species assignment. Similar to strain Cil 2017/23 the length of caudal cilium is not reaching the full body length.

Figure 16 Cil 2017/24 assigned to Urotricha cf. agilis: (a,b: living observation; c- f: after qualitative protargol impregnation) a: lateral view of lightly squished specimen, b: illustration of specimen with one large ingested FV and size measurement in vivo, c: focus on ciliary pattern, d-e: lateral view of specimen with most characteristic organelles, f: oral apparatus in detail with nicely stained oral basket g: lateral view, C = somatic cilia; CA = caudal cilia, CR = ciliary rows; FG = fat globuli, FV = food vacuoles, MA = macronucleus, OB = oral basket; OF = oral flaps;

3.2.4. Cil 2019/10 This strain corresponds mainly to Urotricha cf. agilis (measurements and countings are compared to (Foissner et al. (1999) : cell length = 13.3 – 19.2 µm (in vivo) vs. 10.0 - 20.0 µm and width = 9.1 – 14.4 µm (in vivo) vs. 7.0 - 14.0 µm, number of caudal cilia = 1 vs. 1, cell shape = ellipsoid, lateral = lemonlike (in vivo) vs. triangular, somatic ciliary rows = 12- 19 vs. 12 - 14 and inconspicuous extrusomes, that were stained well by the protargol. Urotricha agilis is so far the only species with 1 CC and maximum of 15 ciliary rows (Foissner et al. 1999). Further investigation of key characters for a more detailed species description in particular of the adoral organelles is recommended to be performed by applying SEM. However, the adoral organelles are not yet described for U. agilis. Similar to Cil 2017/23 and Cil 2017/24 the number of the adoral organelles must be confirmed, before final species assignment. Similar to strain Cil 2017/23 and Cil 2017/24 the length of caudal cilium is not reaching the ful required body length. Although

Figure 17 Cil 2019/10 assigned to Urotricha cf. agilis: (a -e: after qualitative protargol impregnation; f- h: during living observation) a: typical infraciliature with somatic cilia b: visualization of rod-shaped extrusomes, c: illustration of major organelles: 1 caudal cilium and somatic cilia with same length, d: typical illustration of ciliate after protargol impregnation within vast amounts of cryptophyte food, e: focus on the anterior part of cell including oral flaps displayed in lateral view; f: ellipsoidal body shape and large ingested food vacuole g: view of slightly squished specimen, h: illustration caudal cilium in lateral viewed cell; C = somatic cilia CA =

34 caudal cilia, Cry= Cryptomonas SAG 26.80, CR = ciliary rows, CV = contractile vacuole, E= extrusomes; FV = food vacuoles, MA = Macronucleus, OF = oral flaps;

3.2.5. Cil 12 Urotricha 1 ZH from LZ This strain can be assigned morphologically to none of the so far described species. Potentially multiple species were examined in this culture (Figure 18 (f, i )). However, it corresponds partially to both Urotricha cf. furcata and Urotricha cf. pseudofurcata (measurements and countings are compared to Foissner et al. (1999): cell length = 16.3 – 30.1 µm (in vivo) vs. 20 – 30 µm (U. furcata) vs. 15 -30 µm (U. pseudofurcata) and width = 10.1 – 23.1 µm (in vivo) vs. 15.0 -20.0 µm (U. furcata) vs. 10- 15 µm (U. pseudofurcata), number of caudal cilia = 2, cell shape = ellipsoid (in vivo), somatic ciliary rows = 19-26 vs. 17-24 (U. furcata) vs. 25-27, variable occurrence of inconspicuous extrusomes, that were stained well in protargol. Further investigation of key characters for final species delineation in particular of the adoral organelles is strongly recommended to be performed by applying SEM.

Figure 18 Cil 12 Urotricha 1 ZH from LZ : ( a-c: living observation; d: after supravital-methyl green-pyronin impregnation h- i: after protargol impregnation) a,b: ellipsoidal body shape, b: illustration of body-size measurement of slightly squished specimen, c: changed body form due to multiple large ingested FV and no visible extrusomes in posterior part, d: visualization of the globular Macronucleus, that was in vivo inconspicuous e: ciliary pattern of lateral positioned specimen f: lateral view, slightly larger size of single-cell than Cryptomonas SAG 26.80., g: focus on oral apparatus with oral flaps h: posterior view of specimen with unciliated posterior part and 2 caudal cilia i: visualization of MA and posterior extrusomes in lateral view; C = somatic cilia, CA = caudal cilia, CR = ciliary rows, E = extrusomes , FG = fat globuli, FV = food vacuoles, MA = macronucleus,OB = oral basket; OF = oral flaps.

3.2.6. Cil 2019/13 This strain was examined solely in vivo but combined with the results of Cil 2019/6. Both strains originate from the identical heterogenous strain. However, strain 2019/6 could not be observed in vivo due to the rapid loss of the cell culture. It corresponds to Urotricha furcata (Foissner et al. 1999): cell length = 16.6 – 35.2 µm (in vivo) vs. 20 – 30 µm and width = 10.3 – 28.5 µm (in vivo) vs. 15.0 - 20.0 µm, number of caudal cilia = 2, cell shape = ellipsoid (in vivo), and absence of extrusomes. Further investigation of characters for final species delineation in particular of the adoral organelles is strongly recommended to be performed by applying SEM.

Figure 19 Cil 2019/13 assigned to Urotricha furcata: (a-c: living observation) a,b: ellipsoidal body shape, 2 CA throughout all observed specimen with the lack of extrusomes and short somatic cilia with unciliated posterior part in all individuals b: bursted specimen with inconspicuous macronucleus; C = somatic cilia CA = caudal cilia, FG = fat globuli, MA = macronucleus, OF = oral flaps;

3.2.7. Cil 2019/6 This strain was examined solely after protargol impregnation but combined with the results of Cil 2019/13. It corresponds to Urotricha furcata (measurements and countings are compared to Foissner et al. (1999): number of caudal cilia = 2, somatic ciliary rows = 18-24 vs. 17-24, and absence of extrusomes. Further investigation of key characters for final species delineation in particular of the adoral organelles is strongly recommended to be performed by applying SEM.

Figure 20 Cil 2019/6 assigned to Urotricha furcata: (a-e: after protargol impregnation ) a:ciliate single cell among vast amounts of cryptomonads, b,c: illustration of ciliary pattern and somatic cilia with slightly lateral view, d:main organelles for species determination in lateral view, similar size of cell with Cryptomonas SAG 26.80 sp., e: posterior view of specimen with unciliated posterior part and 2 caudal cilia, ciliary pattern from posterior and large macronucleus; C= somatic cilia CA = caudal cilia, CR = ciliary rows, Cry = Cryptomonas SAG 26.80., MA = macronucleus, OB = oral brosse, OF = oral flaps, SC = single individual;

3.2.8. Cil 2019/3 This strain can be assigned morphologically to none of the so far described species. However, it corresponds partially to Urotricha furcata (measurements and countings are compared to (Foissner et al. 1999): cell length = 15.7 – 23.8 µm (in vivo) vs. 20 – 30 µm and width= 10.4 – 18.5 µm (in vivo) vs. 15.0 - 20.0 µm, number of caudal cilia = 2, cell shape = ellipsoid (in vivo), somatic ciliary rows = 15 - 19, vs. 17 - 24 variable occurrence of inconspicuous extrusomes, that were stained well in protargol. With Urotricha pseudofurcata, this strain shares the presence of extrusomes although they are and the same cell size and the number of caudal cilia (Krainer, 1995). Further investigation of key characters for final species delineation in particular of the adoral organelles is strongly recommended to be performed by repeating SEM. The adoral pattern around the oral apparatus could also not be examined because of an unfortunate orientation of the cells. A detailed description of this strain should be repeated.

Figure 21 Cil 2019/3 : (a-c: living observation; d-g: after protargol impregnation; d-g: SEM) a, b: ellipsoidal body shape, b: bursted specimen with macronucleus surrounded by a white fringe, c: visualization of MA, d: lateral view of specimen and comparison to cryptophyte food e: ciliary pattern of lateral side including somatic cilia length f: lateral view with nicely stained oral basket, g: posterior view of specimen with unciliated posterior part and 2 caudal cilia, h: somatic ciliary rows; C = somatic cilia CA = caudal cilia, CR = ciliary rows, Cry = Cryptomonas SAG 26.80, E = extrusomes , FG - fat globuli, FV = food vacuoles, MA = macronucleus, OB = oral basket, OF = oral flaps;

3.2.9. Cil 2017/25 This strain corresponds mainly to Urotricha castalia (measurements and countings are compared to Muñoz et al. (1987): cell length = 26.1 x 50.6 µm vs. 30 - 40 µm and width = 24.9 - 43.8 µm (in vivo) vs. 20-30 µm, a variable number of caudal cilia = 4 - 7, cell shape = ellipsoidal, number of somatic ciliary rows = 34 - 42 vs. 39 - 50, presence of 2 distinct rod-shaped extrusomes (longer extrusomes in posterior part, and short extrusomes situated in anterior part of cell) (S-Table 7). Further investigation of key characters for final species delineation in particular of the adoral organelles and the position of the excretory pore of the contractile vacuole is strongly recommended to be performed by applying SEM.

Figure 22 Cil 2017/25 assigned to Urotrich castalia: ( a-e: living observation; f-i: after protargol impregnation ) a: ellipsoidal body shape b: CV and anterior short extrusomes c: lateral view: long posterior extrusomes, d, e: large amounts of food vacuoles inside cells f: oral basket g: anterior view of oral apparatus h: ciliary pattern of lateral side positioned specimen i: visualization of a minimum of caudal cilia at posterior end; AE = anterior extrusomes; C = somatic cilia, CA = caudal cilia, CR = ciliary rows, Cry = Cryptomonas SAG 26.80, FG = fat globuli, FV = food vacuoles, MA = macronucleus, OB = oral brosse, OF = oral flaps, PE= posterior extrusomes;

3.2.10. Cil 2017/27 This strain corresponds mainly to Urotricha castalia (measurements and countings are compared to Muñoz et al. (1987): cell length = 37.9 x 59.2 µm vs. 30 - 40 µm and width = 25.1 - 43.6 µm (in vivo) vs. 20 - 30 µm, a variable number of caudal cilia = 4 - 7, cell shape = ellipsoidal, number of somatic ciliary rows = 32 - 42 (Protargol) vs. 39 - 50, presence of 2 distinct extrusomes (as described for Cil 2017/25). Further investigation of key characters for final species delineation in particular of the adoral organelles and the position of the excretory pore of the contractile vacuole is strongly recommended to be performed by applying SEM.

Figure 23 Cil 2017/27 assigned to Urotricha castalia: (a-f: living observation; g-j: after protargol impregnation) a: body size measurement, b: oral basket illustrated in slightly squished cell, c: long posterior extrusomes d: visualization of anterior extrusomes e: nuclear apparatus in bursted cell f: caudal cilia organization inconspicuous visible g: lateral view of specimen, h: size difference between single-cell and cryptophyte food, i: organization of infraciliature j: Caudal cilia arrangement in posterior body part. AE = anterior extrusomes, AO= adoral organelles, C= somatic cilia, CA = caudal cilia, CR = ciliary rows, Cry = Cryptomonas SAG 26.80, FG - fat globuli, FV = food vacuoles, MA = macronucleus, OB = oral basket, OF = oral flaps, PE = posterior extrusomes, SC= single individual.

3.2.11. Cil 2019/1 This strain corresponds mainly to Urotricha castalia (measurements and countings are compared to Muñoz et al. (1987): cell length = 37.9 x 59.2 µm vs. 30-40 µm and width = 25,1 -43,6 µm (in vivo) vs. 20-30 µm, a variable number of caudal cilia = 4-7, cell shape = ellipsoidal, number of somatic ciliary rows = 32-42 (Protargol) vs. 39-50, presence of 2 distinct extrusomes (as described for Cil 2017/25 and 42

Cil 2017/27). The position of the excretory pore of the contractile vacuole could be confirmed by performing SEM (Figure 24 f-i). Furthermore, the excretory pore, the infraciliature and extrusomes became visible. The adoral pattern around the oral apparatus could also not be fully examined because of an unfortunate orientation of the cells. Further investigation of key characters, especially the adoral organelles via SEM, is recommended for final species delineation.

Figure 24 Cil 2019/1 assigned to Urotricha castalia: (a-b: living observation; c: after supravital-methyl green- pyronin impregnation d-e: after protargol impregnation f - i: after SEM) a: ellipsoidal body shape, ciliary pattern and large amounts of ingested cryptomonads, b : illustration large posterior extrusomes, c: nicely stained macronucleus d: anterior view with oral basket e: ciliary pattern of lateral side positioned specimen f: infraciliature of single-cell and Cryptomonas SAG 26.80 in lateral view, g: fully ciliated specimen with multiple caudal cilia at posterior end, h: close up of posterior end with excretory pore slightly within caudal cilia circle i: organization of oral apparatus and visualisation of adoral organelles; AE = anterior extrusomes AO = adoral organelles, C = somatic cilia CA = caudal cilia, CR = ciliary rows, Cry = Cryptomonas SAG 26.80 EP = excretory pore from contractile vacuole , FG - fat globuli, FV = food vacuoles, MA = macronucleus, OB = oral brosse, OF = oral flaps, PE = posterior extrusomes;

3.3. Molecular Analyses

3.3.1. Prostomatid Molecular Phylogeny

Phylogenetic analyses based on SSU rDNA sequences revealed the evolutionary relationship among the Prostomatea. All examined strains of the genus Urotricha formed a highly supported monophyletic group in all analyses (ML, NJ and MP). within the prostomatid group (Figure 25). The sequences from Plagiocampa sp. (KY980324) and Halodinium verrucatum (LC424401) also appeared among Urotricha in the phylogenetical analyses after a performed blast search with a query cover of 100% check on NCBI compared to the strains. The genus Prorodon was used as outgroup, whereas Colepidae including Coleps spp. was the sister-group to the Urotricha clade.

Figure 25 SSU molecular phylogeny of 37 taxa of Prostomatea phylum inferred by maximum likelihood, neigbourjoining and maximum parsimony method in PAUP 4.0b10, using data set of 1,755 aligned positions of SSU sequences. Best model was GTR+I+G model (base frequencies: A 0.2749, C 0.1837, G 0.2492, U 0.2921; rate matrix: A‐C 1.37439, A‐G 2.9188, A‐U 1.70888, C‐G 0.268557, C‐U 4.84778, G‐U 1.0000) with the proportion of invariable sites (I = 0.6579) and gamma distribution shape parameter (G = 0.6030) as calculated by ModelTest 3.7. Bootstrap method with heuristic search and the number of bootstraps replicates was 1000 using the same Model as estimated by PAUP.; Branches in grey box are highly supported (ML, NJ; MP >0.90) in all analyses. All morphological species names, strain designations, and GenBank accession numbers indicated; and examined in the grey part of the figure. Further data on accession numbers in parentheses in are displayed in the S-Table 6. 45

3.3.2. Molecular Phylogeny of the Genus Urotricha To get a better phylogenetic resolution, the concatenated data set of SSU and ITS rDNA sequences was analyzed. The phylogenetic tree revealed four lineages, which are highly supported in all analyses. The molecular phylogeny of the genus Urotricha and its close relatives based on a combined SSU rRNA and rDNA sequences with the ITS region. The phylogenetic tree was calculated using the Neighbour- joining (NJ) distance method. The numbers on the branches each show the bootstrap values (1000 replicates) for the following methods: Distance (NJ), Maximum Parsimony (MP), and Maximum Likelihood (ML). The GenBank accession numbers are given after the species names, according to various authors (Figure 26). An unrooted tree with all investigated Urotricha strains without an outgroup is shown here. The various marker regions, i.e., V9, V4, and, ITS-2, were examined in more detail in the subsequent sections.

Urotricha cf. agilis

Urotricha furcata

new species

Urotricha castalia

Figure 26 Molecular phylogeny of the genus Urotricha based on SSU and ITS rDNA sequence comparisons. The phylogenetic trees shown were inferred using the maximum likelihood method based on the data sets (2343 aligned positions of 18 taxa) using PAUP 4.0a167. For the analyses the best model was calculated by ModelTest 3.7. The setting of the best model was given as follows: GTR+I (base frequencies: A 0.3017, C 0.1700, G 0.2153, T 0.3130; rate matrix A-C 1.3248, A-G 1.4840, A-U 1.8283, C-G 0.5727, C-U 2.8434, G-U 1.0000) with the proportion of invariable sites (I = 0.7703). The branches in bold are highly supported in all analyses (bootstrap values >70%, calculated with PAUP, 1000 replicates using maximum likelihood, neighbor-joining, and maximum parsimony). The circles after the strain designation showed the origin of the investigated strains. Strains labelled with a * were morphologically and genetically examined. 47

3.3.3. The V9 secondary Structures of the investigated Urotricha Strains As demonstrated in Figure 27, the different Urotricha species cannot always discriminated using V9. Urotricha cf. agilis and the sample of Lake HAI had identical V9 regions, respectively. This pattern can be applied to the Urotricha furcata cluster and the strains that were morphologically assigned to Urotricha castalia (Figure 27).

Urotricha cf. agilis (Cil 2017/23, Cil 2017/24, Cil 2017/10, Cil HAI)

Urotricha cf. globosa (Cil 2017/19)

Urotricha cf. furcata / Urotricha cf. pseudofurcata (Cil 2019/6, Cil 2019/13, Cil 2019/3, Cil 2019/4, Cil 12 Urotricha from ZH)

U. castalia /U (Cil 2017/25, Cil 2017/27, Cil 2019/1)

Figure 27 Comparisons of the V9 secondary structures among the species of Urotricha.The structures were calculated with mfold (Zuker, 2003).

3.3.4. The V4 Secondary Structures of the investigated Urotricha Strains The V4 region allows for species delimitation for the strains 2017/19 and Urotricha sp. from Lake HAI. Therefore, the V 4 region has a diagnostic character. It is important to highlight the differences between CBCs (2 base differences), HCBCs (1 base difference) and variable loops (partial dissolution of hydrogen bonds with a new base composition). The V4 region is ideal for distinguishing the different urotrichs on species level.

Urotricha cf. agilis Urotricha sp. from HAI Urotricha cf. globosa (Cil 2017/19) (Cil 2017/23, Cil 2017/24, Cil 2017/10)

1 2 3

U. cf. furcata / U. cf. Urotricha cf. furcata / Urotricha U. castalia (Cil 2019/1) 6 pseudofurcata, new species? cf. pseudofurcata (Cil 2019/6, Cil 2019/13) (Cil 2019/3, Cil 2019/4 ) U. castalia (Cil 2017/25, Cil

2017/27) 5 7 4

Figure 28 Comparisons of the V4 secondary structures among the species of Urotricha. The structures were calculated with mfold (Zuker, 2003). The variable sites and differences according to the CBC Concept (CBC and HCBC = hemi-compensatory base exchange) and the loop region are marked in boxes Comparisons between strains are highlighted with arrows. . 1: Urotricha cf. agilis; (Cil 2019/10 ,Cil 2017/23, Cil 2017/24); 2: Urotricha sp. from HAI; 3: Urotricha cf. globosa (Cil 2017/19); 4: Urotricha cf. furcata / Urotricha cf. pseudofurcata or potentially new species in mixed sample. (Cil 2019/6, Cil 2019/13) from LZ; 5: Urotricha cf. furcata / Urotricha cf. pseudofurcata (Cil 2019/3, Cil 2019/4 ) from LZ , 6: U. castalia (Cil 2019/1) from LZ, 7: U. castalia (Cil 2017/25, Cil 2017/27) from LM;

3.3.5. The ITS-2/CBC Approach in Urotricha The ITS-2 and its secondary structure is well-established marker for species delineation. Therefore, I compared the ITS-2 secondary structure of each Urotricha strain to discover compensatory base 49 changes. The ITS-2 of Urotricha showed the structure with one exception. The helix I is missing (Figure 29), but the remaining three helices had the typical structure including the RNA processing sites in the Helices II and III. The comparison of the structures revealed that all species can be distinguished by CBCs and HCBCs. In addition, the presence of a CBC in U. agilis and the differences in the loops in U. castalia (MS and ZS) indicated cryptic speciation in Urotricha.

Figure 29 General overview of the ITS-2 region with the Helices II- IV. Helix I is absent vor the genus Urotricha.

Figure 30 Comparison of the ITS-2 secondary structures among the investigated Urotricha strains. The differences (CBC) and the loop area are marked in white boxes. 1: Urotricha cf. agilis; White box marks a CBC between Cil 2019/10 (top) from LZ and Cil 2017/23, Cil 2017/24 (down) from LM; 2: Urotricha cf. furcata / Urotricha cf. pseudofurcata or potentially new species in mixed sample. (Cil 2019/6, Cil 2019/13) from LZ 3: Urotricha cf. furcata / Urotricha cf. pseudofurcata (Cil 2019/3, Cil 2019/4 ) from LZ; 4: U. castalia (Cil 2019/1) from LZ, 5: U. castalia (Cil 2017/25, Cil 2017/27) from LM.

4. Discussion

4.1. The Race for the most accurate Species Concept

In recent literature, the aquatic peer-group favours Long-Term Ecological Research Sites (LTER) postulating a plankton index approach reviewing both genetic and morphological diversity comparison studies (Stern et al. 2018). However, data from the microscopic analyses contradict molecular datasets from the same sampling area (Stern et al. 2018). Most recently, the term “problematic species concept for protists” is probably the most accurate description of the evolving field of species determination in the past decades for many small eukaryotic planktonic species (Caron and Hu 2019). So far, a generally accepted and consistent species concept for protists is absent. However, new ideas propose that a constantly evolving definition of protist species should be based on a case-by-case approach, integratively by a description of the improved methodology (Boenigk et al. 2012; Auinger et al. 2008). Caron and Hu (2019) also suggest a

51 combination of the morphological species concept, with the implementation of the biological species concept, genetical similarity species concept and ecological species concept (Figure 31).

Morphological species concept

Biological species concept

Genetic similarity species concept

Ecological species concept

Figure 31 Modified illustration of the integrative species concept evolution and description of the problematic species concept in Protistology (Caron and Hu 2019).

Moreover, the state of the art of many Urotricha species based exclusively on sequencing data appears in recent literature under the label uncultured alveolate, uncultured eukaryote or Urotricha spp. (S- Table 6) Contrary, only a few experts reach the taxonomical resolution based on alpha-taxonomy. Therefore, an interdisciplinary collaboration with experts including various expertises plays a crucial role in protistology.

4.2. Cultivation of Urotricha spp.

The historical use of Cryptomonas sp. SAG 26.80 as an ideal food source for ciliates can be dated back to the past century from feeding experiments and is used until recent experimental setups and recent feeding experiments conducted by Kuimei Qian (Weisse 2017; Müller and Schlegel 1999). The outcome of Kuimei Qian showed that this genus prefers moving food. Therefore, cryptomonads serve as a suitable food source for this ciliate genus. Generally, accurate handling and morphological expertise are necessary to set up cloned strains of Urotricha spp. (S-Table 1-3). Difficulties in cloning and cultivation appear regularly due to several

52 factors. First of all, their small size contributes to the problem distinguishing them from their food resource (Figure 17d, 20a). In particular, the rapid swimming behaviour and tremendous vulnerability of these ciliates impact the isolation process. Additionally, no pretested cloning protocol can be applied to all strains equally with high success. A great uncertainty concerning overgrowth by, e.g., algae is given. Overall, this makes studying Urotricha for species delimitation challenging. Researchers are therefore left over with trial and error to get a stable clone culture of an Urotricha species (or another ciliate) in the end. (Table 6). The often observed swarming behaviour during cultivation is an ideal indicator for the status of the Urotricha cells. This rapid swarming behaviour resembled predator-prey interactions known from fish – often with unpredictable fast jumps in various directions. Increased movement indicated “healthier” cultivation conditions.

4.3. Single Cell RepliG – the Methodology of the Future? Although the application of molecular methods has become standard for research on questions of microbial diversity and ecological relationships, new findings show large differences between molecular and morphological data sets (Stern et al. 2018; Stoeck et al. 2014). High abundances of Urotricha spp. throughout the temporal-spatial pattern across all trophic levels make urotrichs key players in aquatic ecosystems ( Qu et al. subm.). Nevertheless, with a molecular approach exclusively, their real abundances would remain undiscovered and other aquatic organisms such as Rimostrombidium lacustris, Stokesia vernalis and Codonella cratera are often over-represented in metagenomics studies (Pitsch et al. 2019, Steock et al.2014). In the aquatic sciences, predominantly on marine ecosystems, the sampling effort towards analysis via high-throughput sequencing (HTS) conspicuously increased (Grattepanche and Katz 2020; Piredda et al. 2018; Gimmler et al. 2016; Vargas et al. 2015a; Massana et al. 2015; Pawlowski et al. 2014). Such a HTS approach anticipated a greater understanding of more general questions concerning the worldwide biogeographical distribution of protists even in the remotest areas. However, more specific studies deal, for example, with the dispersal of protists due to human impact of non-indigenous species from ships’ ballast water (Pagenkopp Lohan et al. 2017). Also, other more general issues concerning cryptic species complexes and ecological context-based questions like bottom-up control experiments could be unriddled recently (Grattepanche and Katz 2020; Pawlowski et al. 2014). Therefore, the HTS methodology can allow a greater databased workflow and platforms such as the EukRef are necessary to rely on cured databases (Boscaro et al. 2018). However, the interpretation of the HTS datasets are hampered by often rather quick conclusions being drawn from the environmental data. The public data bases tend to be incomplete for ciliates due to missing single cells sequence data. In order to draw right conclusions out of HTS data, e.g., phylogenetic realationships with 100 % matches from NCBI

53 would be necesarry.(Qu et al. subm., Stoeck et al. 2014). Morphological and ecological studies are often being overlooked and hampered for the sake of the modern and rapid HTS methodology. The here applied Single Cell RepliG methodology in comparison to conventional molecular procedures, could be seen as a promising new methodology for future analyses because of its simplicity and ideal time efficiency. For all strains, the Single Cell RepliG method revealed reliable sequences (Table 8, Figure 25). However, it is important to know its limitations: (i) the starving procedure before treatment was essential and crucial for cells >20 µm (Table 7), (ii) the potential loss of the desired cell due to its vulnerability after treatment, (iii) knowledge about the contamination potential through algal food because of genetic similarities of urotrichs and cryptomonads, (iV) use of a multiple primer approach based on eukaryotic and species-specific primers for unbiased results.

4.4. Molecular Phylogeny and CBC Species Concept for the Genus Urotricha

So far, single cell analyses on the genus Urotricha are virtually not existing (Auinger et al. 2008). From my results, the SSU rRNA can be confirmed as a valuable marker region for a phylogeny at the genus level (Figure 25). Hence, the genus Urotricha forms a highly supported monophyletic group within the phylum Prostomatea. The V4 region is ideal for distinguishing the various Urotricha strains. It is important to highlight the differences between CBCs (2 base differences), HCBCs (1 base difference) and variable loops (partial dissolution of hydrogen bonds with a new base composition). Additionally, genetically based on a combined SSU rRNA and ITS examination, four clades of urotrichs can be distinguished (Figure 26). Moreover, the genus Urotricha is closely related to the genus Coleps. All colepids share calcareous plates as a main diagnostic feature (Foissner et al. 1999). Those plates are absent within the genus Urotricha. However, Urotricha spp. and Coleps spp more or less resemble almost all other morphological features with which can be confirmed by the phylogenetic analysis .

In the SSU rRNA tree of prostomatids, two related sequences cannot be assigned to the genus Urotricha (Figure 25), instead to Plagiocampa sp. (KY980324) and Halodinium verrucatum (LC424401) (Gurdebeke et al. 2018). In recent studies and based on my results, urotrichs were obviously erroneously assigned to Plagiocampa (Gao et al. 2017; Lynn 2008). An explanation can be that either both sequences were misidentifications of the morphotype since no data on Urotricha spp. as cysts have been found to date. In the case of H. verrucatum, I suppose that either Urotricha sp. can form cysts which has not been found before, or, urotrich DNA was accidentally extracted together with H. verrucatum. Consequently, it is important to include a ciliates’ morphology and the analysis of the secondary structure of the ITS-2 region. However, the phylogenetic position of the genus Plagiocampa is controversial (Gao et al. 2017; Zhang et al. 2014).

Which genetic Marker of the SSU rRNA enables a Discrimination of Urotricha Species? Recently, Tanabe et al. (2016) revised the most accepted marker regions of the ribosomal operon for estimating biodiversity across eukaryotic plankton taxa (i.e., V1–3, V4–5 and V7–9) by rating criteria such as primer universality and identification accuracy. Although Tanabe et al. (2016) favoured the V1- V3 for eukaryotic studies, the V9 has being chosen more frequently (Pitsch et al. 2019; Vargas et al. 2017; Vargas et al. 2015a; Adl et al. 2012). A constant trade-off between hypervariability and hyperconservative regions should be implemented in the choice of marker genes in order to draw accurate conclusions for molecular species determination. This dialogue among scientists concerning the ideal marker genes varies strongly and needs to be applied unbiased for every species-specific ciliate examination de novo (Zhan et al. 2019; Dunthorn et al. 2012). I decided to compare both the V4 and the V9 region of all clonal strains by following a multi-marker approach and elucidated the results for each strain separately as previously suggested by Dunthorn et al. (2012), Stoeck et al. (2014), Vargas et al. (2015b), Pitsch et al. (2019).

Are the V9 or the V4 region ideal barcode Markers for species Delimitation in the Genus Urotricha? Comparing the V9 region among the strains, four molecular species became visible (Figure 27). Only a difference of one base in the V9 could be determined among the U. castalia strains (Figure 27). The resolution of the V9 region was too conservative for all other strains of the genus Urotricha and allowed for no differentiation (Figure 27). This phenomenon can be explained through the hypervariability of this marker region (Pitsch et al. 2019; Vargas et al. 2017; Vargas et al. 2015a; Dunthorn et al. 2012). Although the literature claims that V9 is a more accurate marker for certain species than V4 for the genus Urotricha the opposite can be confirmed (Figure 27) (Pitsch et al. 2019; Vargas et al. 2017).

The V4 region turned out to be diagnostic for the genus Urotricha (

Figure 28). In NCBI, only results with a query cover of 100% and a percent identity above 98% were compared with all examined strains of this study (S-Table 6). A value with a percent identity of 98% means that between strains only one base mutation occurred in the 218 bp long V4 region. For example, although no valuable data on SSU rRNA level could be resolved for the strain Cil 2017/19 that

55 matched its morphology with Urotricha cf. globosa, a detailed marker analysis is essential for further statements concerning its phylogeny. On V4, six species could be distinguished. However, the resolution of the V9 barcode marker region that is suitable for Coleps sp. is too low for urotrichs. The genetics with respective sequences of the edited V9 region should not be seen as diagnostic here (Figure 27).

A future choice of the various V4/V9 regions as a reliable marker can be supported and I suggest that a database was based on the alpha-taxonomic identification of ciliate species including various clones from the same and different biogeographical regions. This is important, because especially urotrichs are underrepresented in molecular studies due to their underestimated amplicon size (Stoeck et al. 2014). Consequently, HTS studies will deliver useful informations on the species inventory of an environment (e.g., Pitsch et. al. 2019). Why examining ITS-2 for species Determination purposes in all the Strains? Concerning the ciliate differentiation, the ITS region contained important information about species reconstruction and was checked for various ciliates apart from the genus Urotricha in the past (Coleman 2005). Combining morphometric data at the species level and the underlying CBC species concept invented by Coleman (2000), one key benefit of the ITS-2 region becomes obvious (Figure 29). Certain variations in the ITS-2 secondary structure showed that a compensatory base exchange (CBC) in Helix II or Helix lll of the ITS-2 secondary structure results in sexual incompatibility and thus represent two different biological species (Coleman 2005). An examination of the ITS-2 region of Urotricha spp. allows further conclusions to be drawn about species differentiation at the molecular level (Figure 30).

The ITS 2 region is more informative than the SSU rRNA on a molecular level in order to compare CBC's between clones. The conservation of the secondary structure of ITS-2 region among essentially all eukaryotes is far more remarkable conserved than ever anticipated. Especially the formation of a stable ITS-2-proximal stem (Côté and Peculis 2001). Therefore this enhanced resolution with the help of ITS and CBC’s are discussed speaks for cryptic species formation among the Urotricha cf. agilis strains from LM and Lake PIB. These strains are found in distinct biogeographical regions (Figure 26-28, 30). Besides the greater detailed classical morphological examination, on the molecular level, valuable further barcode regions could be studied as well. Therefore on top of SSU rRNA and the ITS-2 sequences, the cytochrome oxidase I gene (COI), could contribute to crucial findings concerning the biogeographical distribution on organism level among the urotrichs (Barth et al. 2006). A further molecular examination should be drawn into consideration, especially since the barcode markers on SSU rRNA-level (V9, V4) and ITS-2 regions show identical results for certain strains. These new finding could reveal intraspecific genetic variation similar to the study of (Barth et al. 2006).

4.5. Problems in accurate morphological Species Delimitation

Detailed morphology-based keys support accurate identification of many taxa of ciliates (Foissner et al. 1999; Foissner and Pfister 1997; Foissner et al. 1994). However, for taxa that are not well studied, or for which distinctive morphological characters have not been elucidated in detail, identification can be difficult. Identification is especially problematic for very small organisms as well as for members of cryptic species complexes. For such cases, DNA barcodes may provide diagnostic characters as shown with the V4 for the genus Urotricha (Figure 28). Nevertheless, the correct identification of species at the morphological level is essential as a basis for ecological and evolutionary research.Although Urotricha spp. <20 µm can occur in high abundances (30 * 10³ cells L-1) in the lake plankton, they lack accurate species delimitation (Pitsch et al. 2019; Sonntag et al. 2017; Posch et al. 2015; Foissner et al. 1999;1994). The morphospecies concept shows a minimum of one different morphological character between strains or populations (Foissner et al. 1999; Finlay et al. 1996). Distinguishing ciliates on species is crucial for statements about aquatics ecosystem, e.g., following the saprobical index and for a greater understanding of co-occurrence networks. Implementing the strengths and limitations of this strict morphological approach is essential for an accurate and unbiased workflow. However, the occurrence of the high variability of characters within one examined strain (cell size, infraciliature or appearance of extrusomes) is hampering this traditional concept (S-table 7).

High Plasticity among Characters Not all species could be assigned to a described species (Figure 14- 24, S-table 7). Although a general differentiation according to cell size and number of caudal cilia formed no queries, certain tiny morphological species-specific features such as the oral ciliature pattern including the adoral organelles remained undiscovered among the strains (Figure 14-22, S-Table 7). The adoral organelles are barely visible under the light microscope although they have been considered as important features for species determination among urotrichs (Foissner et al. 1999; Foissner et al. 1994). Therefore, further SEM investigations need to be done in addition (Figure 21;24). Moreover, other characteristics including the infraciliature, must be complemented by silver staining methodology (Foissner 2014). From my results, I assume that, e.g., for Urotricha cf. agilis, a broader range in respect to the ciliary pattern needs to be considered (Figure 15-17, S-Table 7) (Foissner et al. 1999; Muñoz et al. 1987). The possibility that U. nais may be assigned to U. agilis can be confirmed for the strains 2017/23, 2017/24 and 2019/10 (Table 6; 8, Fig. 14-24 ). However, despite all effort, the number of ciliary rows as well as the presence of extrusomes of both U. agils and U. nais need to be clarified later (S-Table 7).

Such varying results may explained by the quality of a silver stain or a molecular variation in the ITS-2 region (Figure 29;30). Variable characters may be explained by the cryptic species concept (Simon et al. 2007). Genetically Cil 2017/10 is a bit further away from Cil 2017/23 and Cil 2017/24 and could confirm the cryptic species hypthesis among the genus Urotricha (Figure 26). Furthermore, the morphospecies concept must be complemented by ecological parameters, species biogeography and molecular barcode of analysis (S- Table 6, S-Figure 1). The biogeographical outcomes could be analyzed through the additional blasted sequences from aquatic habitats worldwide (S-Table 6).

4.6. An integrative Approach - a new golden Standard?

The term integrative methodology can be certainly seen as the “new golden standard” of the 21st- century - side by side with morphological taxonomy as a primary studied requirement (Caron and Hu 2019). However, this approach is often inhibited by the partial incongruence of the molecular data sets and the “one-and-only species concept”-approach. An accurate definition of the ‘appropriate’ level of sequence diversity stands at the beginning of every taxonomical study (Caron and Hu 2019). Nevertheless, studies like the “user-friendly guide to environmental protistology: primers, metabarcoding, sequencing, and ecological analyses” give valuable ideas of integrative work by combining various species concepts (Geisen et al. 2019; Zhang et al. 2014). The central idea behind taxonomy is an unbiased, unambiguous, and precise definition of species, although these key aspects still form a central challenge for the phylogenetic field. Studies incorporating various species concepts should fulfil the aim to complement each other, leading to an integrative taxonomy (Schwentner et al. 2011). The main question behind all species concepts is the definition of a boundary between species and intraspecific variations.

However, especially in standard surveys in the ciliate related field, a lack of integrative studies can be observed. Therefore, representatives of the phylum Ciliophora have so far only been of limited relevance for making statements on lake biodiversity. Neither the general autecology is known for most ciliates, nor is it possible to rely solely on molecular surveys that deal predominantly with vast genetic data by applying HTS (Charvet et al. 2012; Majaneva et al. 2012; Amacher et al. 2009; Romari and Vaulot 2004). In these molecular studies, Urotricha spp. occur mainly as uncultured alveolates or uncultured eukaryote. Morphological surveys remain underestimated for urotrichs: (i) due to their small size on the one hand, (ii) and on the other hand, due to the exact delimitation of which characteristics can be regarded morphologically as species-specific. These challenges could also be confirmed in this work since most adoral organelles for the studied strains remained undiscovered (S- Table 7). Variable characteristics within a strain are common in all strains and make an accurate

58 classification difficult (S-Table 7). Therefore, all species described here will be abbreviated con fere until further experts can agree on the exact characteristics.

From a molecular point of view, essential markers of the ribosomal operon at species level are extremely variable for all ciliates which could be confirmed for the genus Urotricha as well (Figure 6). The V9 region that is diagnostic for the sister-group Coleps sp. is substituted here by the V4 region for urotrichs (Pröschold et al. subm.). Similar queries concerning species delimitation appeared in the morphological analysis. From a morphological point of view, the size of the individual organisms only gives a rough indication of the species, as the size as a determining characteristic can be extremely variable within a strain (S-Table 7). Therefore, it is morphologically recommended to examine other rough morphological indicators like the cell shape or more detailed characters like the adoral organelles for experts (SEM or QPI). Thus, representatives of the genus Urotricha cannot be classified in detail by ecologists solely according to their morphological features. Regarding the various habitat distribution of small urotrichs, ecological statements can only be made to a limited extent due to lack of reliable data in this field (Šimek et al. 2019; Posch et al. 2015; Sonntag et al. 2011; Tirok and Gaedke 2006; Foissner 2006; Foissner et al. 1999). Concerning their diet, there always exists the dilemma that only experiments with Cryptomonas sp. SAG 26.80 have been conducted and little is known on what Urotricha spp. feeds on in their natural habitats (Weisse 2006; Weisse 2001; Müller et al. 1991; Weisse et al. 1990; Weisse and Müller 1990). I would extend the integrative approach and also refer to the biological species concept: strictly speaking, whether a conjugation between species is possible or not. Communication among ciliates, mainly induced conjugation experiments, are absent from the protistologist study field (Weisse and Sonntag 2016 ).

5. Conclusion

Traditional morphological approaches and the exploration of taxonomic marker genes separately seem to be insufficient for species determination nowadays. However, a traditional taxonomical approach that has the main focus on the morphological examination does not reveal the evolutionary relationships among species. A combined approach could unravel cryptic species complexes or discover new taxa in this genus. Generally, a molecular-morphological-ecological-integrative approach is recommended for representatives of this genus. This work could contribute to further research in terms of taxonomic comparability. These data could play a crucial role in further research questions like species-specific interactions among aquatic ciliates. Additionally, it could help with the interpretation of NCBI sequences by investigating species-specific barcode markers for Urotricha spp. The main task in this Master’s thesis was to assign the strains to the already described species under the examination of an integrative approach.

Further taxonomic research and work on this genus are required on:

(i) The development of an identification key for small Urotricha with 1-2 caudal cilia (ii) A new description of Urotricha species from the strains 2019/3 and 2019/4 (iii) Further investigations on SEM concerning the adoral organelles for morphological species determination (iv) Deposition of all examined strains to the Culture Collection of Algae and Protozoa (CCAP) as a resource for further studies on protistan genomics or ecology

6. Acknowledgements

The study is funded by the Austrian Science Fund (FWF): I2238-B25, the German Research Foundation DFG: project STO 414/13-1 and the Swiss National Science Foundation SNF: project 31003E-160603/1. I would first like to thank my thesis supervisors Bettina Sonntag and Thomas Pröschold (Research Department for Limnology at Mondsee) for their supportive way throughout the last year and their valuable feedback not only on research level but also on supporting me in the bowling -glitter adventures, barbeque-sessions, and cookie emergencies at the institute at Lake Mondsee. I would also like to thank all the scientists who were involved for this research project from the University of Salzburg; the University of Kaiserslautern and the University of Zurich.

I want to thank Barbara Kammerlander (Research Department for Limnology Mondsee) for providing me with the Urotricha-strains from the high mountain lake, Lake Mondsee and her company during the R-Kurs, Renu Gupta for the astonishing introduction to the world of Protargol impregnation, Anita Hatheuer for taking care of the cultures during my holiday, and Ulli Scheffel for the great support in the lab; Tatyana Darienko (University Göttingen) for the supporting way at the microscope, Christian Spanner for the introduction to the world of bursting cells. I would also like to thank Julie Blommaert for being a great colleague, proof reading support and friend. Without their passionate input, the thesis could not have been successfully performed.

I want express my gratitude to my father, Jiri Frantal for supporting me in the last years of my studies. Finally I would like to thank profoundly my boyfriend, Malte Heuer for providing me with his unfailing support and his continuous encouragement throughout all individual steps of researching time in Lake Mondsee and throughout the whole writing process of this thesis during the past months. Thank you.

Daniela Frantal

7. Publication Bibliography

Adl, S. M.; Bass, D.; Lane, C. E.; Lukeš, J.; Schoch, C. L.; Smirnov, A. et al. (2019): Revisions to the classification, nomenclature, and diversity of eukaryotes. J. Eukaryot. Microbiol. 66: 4–119. DOI: 10.1111/jeu.12691.

Adl, S. M.; Simpson, A. G. B.; Lane, C. E.; Lukeš, J.; Bass, D.; Bowser, S. S. et al. (2012): The revised classification of eukaryotes. J. Eukaryot. Microbiol. 59: 429–493. DOI: 10.1111/j.1550- 7408.2012.00644.x.

Aescht, E. (2020): CilCat: The World Ciliate Catalog. Leiden, the Netherlands (ISSN 2405-884X.). Available online at www.catalogueoflife.org/annual-checklist/2019. Species 2000: Naturalis, checked on 2/12/2020.

Aescht, E.; Foissner, W.; Blatterer, H.; Kohmann, F.; Berger, H. (2017): Ciliophora. - In: Moog O. & Hartmann A. (Eds): Wasserwirtschaftskataster, Bundesministerium für Land- und Forstwirtschaft, Umwelt und Wasserwirtschaft. In Fauna Aquatica Austriaca 3, 1-31, 1-11, 1-2, 1-18.

Agatha, S. (2011): Global diversity of aloricate Oligotrichea (Protista, Ciliophora, Spirotricha) in marine and brackish sea water. PloS One 6: e22466. DOI: 10.1371/journal.pone.0022466.

Akaike, H. (1974): A new look at the statistical model identification. IEEE Trans. Automat. Contr. 19: 716–723. DOI: 10.1109/TAC.1974.1100705.

Aldhebiani, A. Y. (2018): Species concept and speciation. Saudi journal of biological sciences 25 (3), S. 437-440. DOI: 10.1016/j.sjbs.2017.04.013.

Altschul, S. F.; Gish, W.; Miller, Webb; Myers, Eugene W.; Lipman, David J. (1990): Basic local alignment search tool. J. Mol. Biol. 215: 403–410. DOI: 10.1016/S0022-2836(05)80360-2.

Amacher, J.; Neuer, S.; Anderson, I.; Massana, R. (2009): Molecular approach to determine contributions of the protist community to particle flux. Deep Sea Res. Part I: Oceanogr. Res. Pap. 56: 2206–2215. DOI: 10.1016/j.dsr.2009.08.007.

Auinger, B. M.; Pfandl, K.; Boenigk, J. (2008): Improved methodology for identification of protists and microalgae from plankton samples preserved in Lugol's iodine solution: combining microscopic analysis with single-cell PCR. Appl. Environm. Microbiol. 74: 2505–2510. DOI: 10.1128/AEM.01803-07.

Barth, D.; Krenek, S.; Fokin, S. I.; Berendonk, T. U. (2006): Intraspecific genetic variation in Paramecium revealed by mitochondrial cytochrome C oxidase I sequences. J. Eukaryot. Microbiol. 53: 20–25. DOI: 10.1111/j.1550-7408.2005.00068.x.

Beaver, J. R.; Crisman, T. L. (1989): The role of ciliated protozoa in pelagic freshwater ecosystems. Microbial Ecol. 17: 111–136. DOI: 10.1007/BF02011847. 62

Bergkemper, V.; Weisse, T. (2018): Do current European lake monitoring programmes reliably estimate phytoplankton community changes? Hydrobiologia 824 (1), S. 143-162. DOI: 10.1007/s10750-017- 3426-6.

Boenigk, J.; Ereshefsky, M.; Hoef-Emden, K.; Mallet, J.; Bass, D. (2012): Concepts in protistology: species definitions and boundaries. Eur. J. Protistol. 48: 96–102. DOI: 10.1016/j.ejop.2011.11.004.

Boscaro, V.; Santoferrara, L. F.; Zhang, Q.; Gentekaki, E.; Syberg-Olsen, M. J.; Del Campo, J.; Keeling, P. J. (2018): EukRef-Ciliophora: a manually curated, phylogeny-based database of small subunit rRNA gene sequences of ciliates. Environm. Microbiol. 20: 2218–2230. DOI: 10.1111/1462-2920.14264.

Byun, Y.; Han, K. (2006): PseudoViewer: web application and web service for visualizing RNA pseudoknots and secondary structures. Nucleic Acids Res. 34: W416-422. DOI: 10.1093/nar/gkl210.

Caron, D. A.; Hu, S. K. (2019): Are we overestimating protistan diversity in nature? Trends Microbiol. 27: 197–205. DOI: 10.1016/j.tim.2018.10.009.

Charvet, S.; Vincent, W. F.; Lovejoy, C. (2012): Chrysophytes and other protists in High Arctic lakes: molecular gene surveys, pigment signatures and microscopy. Polar Biol. 35: 733–748. DOI: 10.1007/s00300-011-1118-7.

Claparède, E.; Lachmann, J. (1859): Études sur les infusoires et les rhizopodes. In Mém Inst Natn Genev 6,261–482+Plates14–24. Available online at https://scholar.google.com/scholar?q=%C3%89tudes+sur+les+infusoires+et+les+rhizopodes.+Clapar %C3%A8de+1859, checked on 2/4/2020.

Coleman, A. W. (2000): The significance of a coincidence between evolutionary landmarks found in mating affinity and a DNA sequence. Protist 151: 1–9. DOI: 10.1078/1434-4610-00002.

Coleman, A. W. (2003): ITS2 is a double-edged tool for eukaryote evolutionary comparisons. Trends Genet. 19: 370–375. DOI: 10.1016/S0168-9525(03)00118-5.

Coleman, A. W. (2005): Paramecium aurelia revisited. J. Eukaryot. Microbiol. 52: 68–77. DOI: 10.1111/j.1550-7408.2005.3327r.x.

Corliss, J. O. (1960): The problem of homonyms among generic names of ciliated protozoa, with proposal of several new names. J. Protozool. 7: 269–278. DOI: 10.1111/j.1550-7408.1960.tb00741.x.

Corliss, J. O. (1979): The ciliated protozoa: characterization, classification and guide to the literature. Oxford, Frankfurt: Pergamon Press.

Côté, C. A.; Peculis, B. A. (2001): Role of the ITS2-proximal stem and evidence for indirect recognition of processing sites in pre-rRNA processing in yeast. Nucleic Acids Res. 29: 2106–2116. DOI: 10.1093/nar/29.10.2106. 63

Darty, K.; Denise, A.; Ponty, Y. (2009): VARNA: Interactive drawing and editing of the RNA secondary structure. Bioinformatics 25: 1974–1975. DOI: 10.1093/bioinformatics/btp250.

Darienko, T.; Rad-Menéndez, C.; Campbell, C.; Pröschold, T. (2019): Are there any true marine Chlorella species? Molecular phylogenetic assessment and ecology of marine Chlorella -like organisms, including a description of Droopiella gen. nov. Systematics and Biodiversity 17 (8), S. 811-829. DOI: 10.1080/14772000.2019.1690597.

Dunthorn, M.; Klier, J.; Bunge, J.; Stoeck, T. (2012): Comparing the hyper-variable V4 and V9 regions of the small subunit rDNA for assessment of ciliate environmental diversity. J. Eukaryot. Microbiol. 59: 185–187. DOI: 10.1111/j.1550-7408.2011.00602.x.

Dunthorn, M.; Stoeck, T.; Clamp, J.; Warren, A.; Mahé, F. (2014): Ciliates and the rare biosphere: a review. J. Eukaryot. Microbiol. 61: 404–409. DOI: 10.1111/jeu.12121.

Finlay, B. J.; Corliss, J. O.; Esteban, G.; Fenchel, T. (1996): Biodiversity at the microbial level: The number of free-living ciliates in the biosphere. Quart. Rev. Biol. 71: 221–237. DOI: 10.1086/419370.

Foissner, W.; Berger, H.; Kohmann, F. (1994): Taxonomische und ökologische Revision der Ciliaten des Saprobiensystems. Band III: Hymenostomata, Prostomatida, Nassulida. Informationsber. Bay. Landesamt. Wasserwirtsch. 1/94: 1-548.

Foissner, W.; Pfister, G. (1997): Taxonomic and ecologic revision of urotrichs (Ciliophora, Prostomatida) with three or more caudal cilia, including a user-friendly key. Limnologica 27: 311–347.

Foissner, W.; Berger, H.; Schaumburg, J. (1999): Identification and ecology of limnetic plankton ciliates. Informationsber. Bay. Landesamt. Wasserwirtsch. 3/99: 1-793.

Foissner, W. (2006): Biogeography and dispersal of micro-organisms. a review emphasizing protists. Acta Protozool. 45: 111–136.

Foissner, W.; Müller, H.; Agatha, S. (2007): A comparative fine structural and phylogenetic analysis of resting cysts in oligotrich and hypotrich Spirotrichea (Ciliophora). European journal of protistology 43 (4), S. 295-314. DOI: 10.1016/j.ejop.2007.06.001.

Foissner, W. (2012): Urotricha spetai nov. spec., a new plankton ciliate (Ciliophora, Prostomatea) from a fishpond in the Seidlwinkel Valley, Rauris, Austrian Central Alps. Verh. Zool.-Bot. Ges. Österreich 148/149: 173–184.

Foissner, W. (2014): An update of 'basic light and scanning electron microscopic methods for taxonomic studies of ciliated protozoa'. Internat. J. Syst. Evol. Microbiol. 64: 271–292. DOI: 10.1099/ijs.0.057893-0.

Forster, D.; Filker, S.; Kochems, R.; Breiner, H.-W.; Cordier, T.; Pawlowski, J.; Stoeck, T. (2019): A comparison of different ciliate metabarcode genes as bioindicators for environmental impact assessments of salmon aquaculture. J. Eukaryot. Microbiol. 66: 294–308. DOI: 10.1111/jeu.12670.

Gao, F.; Huang, J.; Zhao, Y.; Li, L.; Liu, W.; Miao, M. et al. (2017): Systematic studies on ciliates (Alveolata, Ciliophora) in China: Progress and achievements based on molecular information. Eur. J. Protistol. 61: 409–423. DOI: 10.1016/j.ejop.2017.04.009.

Gao, F.; Warren, A.; Zhang, Q.; Gong, J.; Miao, M.; Sun, P. et al. (2016): The all-data-based evolutionary hypothesis of ciliated protists with a revised classification of the phylum Ciliophora (Eukaryota, Alveolata). Sci. Rep. 6: 24874. DOI: 10.1038/srep24874.

Geisen, S.; Vaulot, D.; Mahé, F.; Lara, E.; de Vargas, C; Bass, D. (2019): A user guide to environmental protistology: primers, metabarcoding, sequencing, and analyses. BioRxiv 850610.

Gimmler, A.; Korn, R.; de Vargas, C.; Audic, S.; Stoeck, T. (2016): The Tara Oceans voyage reveals global diversity and distribution patterns of marine planktonic ciliates. Sci. Rep. 6: 33555. DOI: 10.1038/srep33555.

Gimmler, A.; Stoeck, T. (2015): Mining environmental high-throughput sequence data sets to identify divergent amplicon clusters for phylogenetic reconstruction and morphotype visualization. Environm. Microbiol. Rep. 7: 679–686. DOI: 10.1111/1758-2229.12307.

Goldfarb, D. S.; Gorovsky, M. A. (2009): Nuclear dimorphism: two peas in a pod. Curr. Biol. : CB 19: R449-452. DOI: 10.1016/j.cub.2009.04.023.

Grattepanche, J.-D.; Katz, L. A. (2020): Top-down and bottom-up controls on microeukaryotic diversity (i.e., amplicon analyses of SAR lineages) and function (i.e., metatranscriptome analyses) assessed in microcosm experiments. Front. Mar. Sci. 6: E2182. DOI: 10.3389/fmars.2019.00818.

Guillard, R. R. L.; Lorenzen, C. J. (1972): Yellow-green algae with chlorophyllide C 2. J. Phycol. 8: 10– 14. DOI: 10.1111/j.1529-8817.1972.tb03995.x.

Gurdebeke, P. R.; Mertens, K. N.; Takano, Y.; Yamaguchi, A.; Bogus, K.; Dunthorn, M. et al. (2018): The affiliation of Hexasterias problematica and Halodinium verrucatum sp. nov. to ciliate cysts based on molecular phylogeny and cyst wall composition. Eur. J. Protistol. 66: 115–135. DOI: 10.1016/j.ejop.2018.09.002.

Hausmann, K.; Bradbury, P. C. (1996): Ciliates. Cells as organisms. Stuttgart: Gustav Fischer.

Kahl, A. (1935): Urtiere oder Protozoa. I: Wimperntiere oder Ciliata (Infusoria). Eine Berarbeitung der freilebenden und ectocommensalen Infusorien der Erde, unter Auschluß der marinen Tintinnidae. Hamburg: Verlag von Gustav Fischer.

Kammerlander, B.; Koinig, K. A.; Rott, E.; Sommaruga, R.; Tartarotti, B.; Trattner, F.; Sonntag, B. (2016): Ciliate community structure and interactions within the planktonic food web in two alpine lakes of contrasting transparency. Freshwater biology 61 (11), S. 1950-1965. DOI: 10.1111/fwb.12828.

Lara, E.; Berney, C.; Harms, H.; Chatzinotas, A. (2007): Cultivation-independent analysis reveals a shift in ciliate 18S rRNA gene diversity in a polycyclic aromatic hydrocarbon-polluted soil. FEMS Microbiol. Ecol. 62: 365–373. DOI: 10.1111/j.1574-6941.2007.00387.x.

Lara, E.; Mitchell, E. A. D.; Moreira, D.; López G., Purificación, L. G. (2011): Highly diverse and seasonally dynamic protist community in a pristine peat bog. Protist 162: 14–32. DOI: 10.1016/j.protis.2010.05.003.

Lynn, Denis H. (2008): The ciliated protozoa. Characterization, classification, and guide to the literature. Dordrecht: Springer.

Maddison, D. R.; Swofford, D. L.; Maddison, W. P. (1997): NEXUS: an extensible file format for systematic information. Syst. Biol. 46: 590–621. DOI: 10.1093/sysbio/46.4.590.

Majaneva, M.; Rintala, J.-M.; Piisilä, M.; Fewer, D. P.; Blomster, J. (2012): Comparison of wintertime eukaryotic community from sea ice and open water in the Baltic Sea, based on sequencing of the 18S rRNA gene. Polar Biol. 35: 875–889. DOI: 10.1007/s00300-011-1132-9.

Marin, B.; Palm, A.; Klingberg, M.; Melkonian, M. (2003): Phylogeny and taxonomic revision of plastid- containing euglenophytes based on SSU rDNA sequence comparisons and synapomorphic signatures in the SSU rRNA secondary structure. Protist 154: 99–145. DOI: 10.1078/143446103764928521.

Massana, R.; Gobet, A.; Audic, S.; Bass, D.; Bittner, L.; Boutte, C. et al. (2015): Marine protist diversity in European coastal waters and sediments as revealed by high-throughput sequencing. Environm. Microbiol. 17: 4035–4049. DOI: 10.1111/1462-2920.12955.

Mertens, K. N.; Rengefors, K.; Moestrup, Ø.; Ellegaard, M. (2012): A review of recent freshwater dinoflagellate cysts: taxonomy, phylogeny, ecology and palaeocology. Phycologia 51: 612–619. DOI: 10.2216/11-89.1.

Müller, H.; Schlegel, A. (1999): Responses of three freshwater planktonic ciliates with different feeding modes to cryptophyte and diatom prey. Aquat. Microbiol. Ecol. 17: 49–60.

Müller, H.; Schöne, A.; Pinto-Coelho, R. M.; Schweizer, A.; Weisse, T. (1991): Seasonal succession of ciliates in lake constance. Microbial Ecol. 21: 119–138. DOI: 10.1007/BF02539148.

Muñoz, A.; Téllez, C.; Fernández-Galiano, D. (1987): Morphology an Infraciliature in Urotricha nais sp. n. and Urotricha castalia sp. n. (Ciliophora, Prorodontida). Acta Protozool. 26: 197–204.

Niedrist, G. H.; Psenner, R.; Sommaruga, R. (2018): Climate warming increases vertical and seasonal water temperature differences and inter-annual variability in a mountain lake. In: Climatic Change 151 (3-4), S. 473-490. DOI: 10.1007/s10584-018-2328-6.

Pagenkopp Lohan, K. M.; Fleischer, R. C.; Carney, K. J.; Holzer, K. K.; Ruiz, G. M. (2017): Molecular characterisation of protistan species and communities in ships’ ballast water across three U.S. coasts. Divers. Distrib. 23: 680–691. DOI: 10.1111/ddi.12550.

Pawlowski, J.; Audic, S.; Adl, S.; Bass, D.; Belbahri, L.; Berney, C. et al. (2012): CBOL protist working group: barcoding eukaryotic richness beyond the animal, plant, and fungal kingdoms. PLoS Biol. 10: e1001419. DOI: 10.1371/journal.pbio.1001419.

Pawlowski, J.; Lejzerowicz, F.; Esling, P. (2014): Next-generation environmental diversity surveys of foraminifera: preparing the future. Biol. Bull. 227: 93–106. DOI: 10.1086/BBLv227n2p93.

Phadke, S. S.; Cooper, L.; Zufall, R. A. (2012): Is evolution of mating preferences inevitable? Random mating in the multisex system of Tetrahymena thermophila. Internat. J. Evol. Biol. 2012: 201921. DOI: 10.1155/2012/201921.

Piredda, R.; Claverie, J.-M.; Decelle, J.; de Vargas, C.; Dunthorn, M.; Edvardsen, B. et al. (2018): Diatom diversity through HTS-metabarcoding in coastal European seas. Sci. Rep. 8: 18059. DOI: 10.1038/s41598-018-36345-9.

Pitsch, G.; Bruni, E. P.; Forster, D.; Qu, Z.; Sonntag, B.; Stoeck, T.; Posch, T. (2019): Seasonality of planktonic freshwater ciliates. Are analyses based on V9 regions of the 18S rRNA gene correlated with morphospecies counts? Front. Microbiol. 10: 248. DOI: 10.3389/fmicb.2019.00248.

Posada, D. (2008): jModelTest: phylogenetic model averaging. Mol. Biol. Evol. 25: 1253–1256. DOI: 10.1093/molbev/msn083.

Posch, T.; Eugster, B.; Pomati, F.; Pernthaler, J.; Pitsch, G.; Eckert, E. M. (2015): Network of Interactions Between Ciliates and Phytoplankton During Spring. Front. Microbiol. 6: 1289. DOI: 10.3389/fmicb.2015.01289.

Qu, Z., Forster, D., Bruni, E., Frantal, D., Kammerlander, B., Nachbaur L et al. (submitted) Aquatic food webs in deep temperate lakes: key species establish through their autecological versatility.

Romari, K.; Vaulot, D. (2004): Composition and temporal variability of picoeukaryote communities at a coastal site of the English Channel from 18S rDNA sequences. Limnol. Oceanogr. 49: 784–798. DOI: 10.4319/lo.2004.49.3.0784.

Roskov, Y.; Ower, G.; Orrell, T.; Nicolson, D.; Bailly, N.; Kirk, P. M. et al. (2019): Species 2000 & ITIS catalogue of life, 2019 annual checklist. Leiden, the Netherlands. (ISSN 2405-884X). Available online at www.catalogueoflife.org/annual-checklist/2019. Species 2000: Naturalis, checked on 2/12/2020.

Schwentner, M.; Timms, B.; Richter, S. (2011): An integrative approach to species delineation incorporating different species concepts: a case study of Limnadopsis (Branchiopoda: Spinicaudata). Biol. J. Linn. Soc. 104: 575–599. DOI: 10.1111/j.1095-8312.2011.01746.x.

Shazib, S. U. A.; Vďačný, P.; Kim, J. H.; Jang, S. W.; Shin, M. K. (2016): Molecular phylogeny and species delimitation within the ciliate genus Spirostomum (Ciliophora, Postciliodesmatophora, Heterotrichea), using the internal transcribed spacer region. Mol. Phylogen. Evol. 102: 128–144. DOI: 10.1016/j.ympev.2016.05.041.

Šimek, K.; Grujčić, V.; Nedoma, J.; Jezberová, J.; Šorf, M.; Matoušů, A. et al. (2019): Microbial food webs in hypertrophic fishponds: Omnivorous ciliate taxa are major protistan bacterivores. Limnol. Oceanogr. 64: 2295–2309. DOI: 10.1002/lno.11260.

Simon E.M., Nanney D.L., Doerder F.P. (2007) The “Tetrahymena pyriformis” complex of cryptic species. In: Foissner W., Hawksworth D.L. (eds) Protist Diversity and Geographical Distribution. Topics in Biodiversity and Conservation, vol 8. Springer, Dordrecht DOI: 10.1007/978-90-481-2801-3_10

Sonnenberg, R.; Nolte, A. W.; Tautz, D. (2007): An evaluation of LSU rDNA D1-D2 sequences for their use in species identification. Front. Zool. 4: 6. DOI: 10.1186/1742-9994-4-6.

Sonntag, B.; Posch, T.; Klammer, S.; Teubner, K.; Psenner, R. (2006): Phagotrophic ciliates and flagellates in an oligotrophic, deep, alpine lake. Contrasting variability with seasons and depths. Aquat. Microb. Ecol. 43: 193–207. DOI: 10.3354/ame043193.

Sonntag, Bettina; Foissner, Wilhelm (2004): Urotricha psenneri n. sp. and Amphileptus piger (Vuxanovici, 1962) n. comb., two planktonic ciliates (Protozoa, Ciliophora) from an oligotrophic lake in Austria. J. Eukaryot. Microbiol. 51: 670–677.

Sonntag, B.; Kammerlander, B.; Summerer, M. (2017): Bioaccumulation of ultraviolet sunscreen compounds (mycosporine-like amino acids) by the heterotrophic freshwater ciliate Bursaridium living in alpine lakes. Inland Waters 7: 55–64. DOI: 10.1080/20442041.2017.1294348.

Sonntag, B.; Summerer, M.; Sommaruga, R. (2011): Are freshwater mixotrophic ciliates less sensitive to solar ultraviolet radiation than heterotrophic ones? J. Eukaryot. Microbiol. 58: 196–202. DOI: 10.1111/j.1550-7408.2011.00540.x.

Stern, R.; Kraberg, A.; Bresnan, E.; Kooistra, W. H. C. F.; Lovejoy, C.; Montresor, M. et al. (2018): Molecular analyses of protists in long-term observation programmes—current status and future perspectives. J. Plankton Res. 40: 519–536. DOI: 10.1093/plankt/fby035.

Stoeck, T.; Breiner, H.-W.; Filker, S.; Ostermaier, V.; Kammerlander, B.; Sonntag, B. (2014): A morphogenetic survey on ciliate plankton from a mountain lake pinpoints the necessity of lineage- specific barcode markers in microbial ecology. Environm. Microbiol. 16: 430–444. DOI: 10.1111/1462- 2920.12194.

Tanabe, A. S.; Nagai, S.; Hida, K.; Yasuike, M.; Fujiwara, A.; Nakamura, Y. et al. (2016): Comparative study of the validity of three regions of the 18S-rRNA gene for massively parallel sequencing-based monitoring of the planktonic eukaryote community. Mol. Ecol. Res. 16: 402–414. DOI: 10.1111/1755- 0998.12459.

Tirok, K.; Gaedke, U. (2006): Spring weather determines the relative importance of ciliates, rotifers and crustaceans for the initiation of the clear-water phase in a large, deep lake. J. Plankton Res. 28: 361– 373. DOI: 10.1093/plankt/fbi121.

De Vargas, C.; Audic, Stephane; Tara Oceans Consortium, Coordinators; Tara Oceans Expedition, Participants (2017): Total V9 rDNA information organized at the OTU level for the Tara Oceans Expedition (2009-2012) .DOI: 10.1594/PANGAEA.873275

De Vargas, Colomban et al. (2015 a): A world of plankton - Marine biodiversity surveyed by the schooner Tara. Science 348:865-873)

Vargas, Colomban de; Audic, Stéphane; Henry, Nicolas; Decelle, Johan; Mahé, Frédéric; Logares, Ramiro et al. (2015b): Ocean plankton. Eukaryotic Plankton Diversity in the sunlit ocean. Science (New York, N.Y.) 348 (6237), p. 1261605. DOI: 10.1126/science.1261605.

Weisse, Thomas; Müller, Helga (1990): Significance of Heterotrophic Nanoflagellates and Ciliates in Large Lakes: Evidence from Lake Constance. In Max M. Tilzer, Colette Serruya (Eds.): Large Lakes. Ecological Structure and Function, vol. 10. Berlin, Heidelberg: Springer Berlin Heidelberg (Brock/Springer Series in Contemporary Bioscience), pp. 540–555.

Weisse, Thomas; Müller, Helga; Pinto-Coelho, Ricardo M.; Schweizer, Anette; Springmann, Doris; Baldringer, Gisela (1990): Response of the microbial loop to the phytoplankton spring bloom in a large prealpine lake. Limnol Oceanogr 35 (4), pp. 781–794. DOI: 10.4319/lo.1990.35.4.0781.

Weisse, T. (2001): Species-specific interactions between small planktonic ciliates (Urotricha spp.) and rotifers (Keratella spp.). J. Plankton Res. 23: 1329–1338. DOI: 10.1093/plankt/23.12.1329.

Weisse, T.; Karstens, N.; Meyer, V. C.L.; Janke, L.; Lettner, S.; Teichgräber, K. (2001): Niche separation in common prostome freshwater ciliates: the effect of food and temperature. Aquat. Microbial Ecol. 26: 167–179. DOI: 10.3354/ame026167.

Weisse, T. (2006): Freshwater ciliates as ecophysiological model organisms – lessons from Daphnia, major achievements, and future perspectives. Arch. hydrobiol. 167 (1), pp. 371–402. DOI: 10.1127/0003-9136/2006/0167-0371.

Weisse, T.; Sonntag, B.; Witzany, G.; Nowacki, M. (2016): Biocommunication of Ciliates. Cham: Springer International Publishing.

Weisse, T. (2017): Functional diversity of aquatic ciliates. European journal of protistology 61 (Pt B), pp. 331–358. DOI: 10.1016/j.ejop.2017.04.001.

Yankova, Y.; Neuenschwander, S.; Köster, O.; Posch, Thomas (2017): Abrupt stop of deep water turnover with lake warming: Drastic consequences for algal primary producers. Scientific reports 7 (1), S. 13770. DOI: 10.1038/s41598-017-13159-9.

Zhan, Z.; Li, J.; Xu, K. (2019): Ciliate Environmental Diversity Can Be Underestimated by the V4 Region of SSU rDNA: Insights from Species Delimitation and Multilocus Phylogeny of Pseudokeronopsis (Protist, Ciliophora).Microorganisms 7 (11). DOI: 10.3390/microorganisms7110493.

Zhang, Q.; Yi, Z.; Fan, X.; Warren, A.; Gong, J.; Song, W. (2014): Further insights into the phylogeny of two ciliate classes Nassophorea and Prostomatea (Protista, Ciliophora). Molecular Phylogenetics and Evolution 70, pp. 162–170. DOI: 10.1016/j.ympev.2013.09.015.

Zimmermann, J.; Jahn, R.; Gemeinholzer, B. (2011): Barcoding diatoms: evaluation of the V4 subregion on the 18S rRNA gene, including new primers and protocols. Org Divers Evol 11 (3), pp. 173–192. DOI: 10.1007/s13127-011-0050-6.

Zuker, M. (2003): Mfold web server for nucleic acid folding and hybridization prediction. Nucleic Acids Research 31 (13), pp. 3406–3415. DOI: 10.1093/nar/gkg595.

8. Supplementary Material

S-Table 1 A manipulated 96-Well Plate for the cloning procedure: In each well labelled with a capital letter and a number B2 -F2 a purified single-cell was transferred and tested with a variable medium to cryptomonas sp. SAG 26.80 proportion. Wells labelled with an X remain empty in order to reduce the risk of contamination. The outer edges marked with MILLI- Q®protect the inner cells from drying out.

MILLI- MILLI- MILLI- MILLI- MILLI- MILLI- MILLI- MILLI- MILLI- MILLI- MILLI- MILLI- Q® Q® Q® Q® Q® Q® Q® Q® Q® Q® Q® Q® MILLI- B2 x B4 x B6 x B8 x B10 x MILLI- Q® Q® MILLI- x x x x x x x x x x MILLI- Q® Q® MILLI- D2 x D4 x D6 x D8 x D10 x MILLI- Q® Q® MILLI- x x x x x x x x x x MILLI- Q® Q® MILLI- F2 x F4 x F6 x F8 x F10 x MILLI- Q® Q® MILLI- x x x x x x x x x x MILLI- Q® Q® MILLI- MILLI- MILLI- MILLI- MILLI- MILLI- MILLI- MILLI- MILLI- MILLI- MILLI- MILLI- Q® Q® Q® Q® Q® Q® Q® Q® Q® Q® Q® Q®

After successful growth of the ciliates in the 96-Well plate, specimens of two strains are transferred to larger well plates with a corresponding amount (500 - 1000 µl) of medium and Cryptomonas sp. SAG 26.80 (2 small drops) S-Table 1.

S-Table 2 Illustration of a 24-Well Plate for prepared for cultivation after successful isolation steps

Clone 1 Clone 1 Clone 1 Clone 1 Clone 1 Clone 1 Clone 1 x x x x x x x Clone 2 Clone 2 Clone 2 Clone 2 Clone 2 Clone 2 Clone 2 x x x x x x x After a successful reproduction in the 24-Well plate, specimens of the two strains are transferred and treated separately in larger well plates with a corresponding amount of additional medium (max .2,000 µl) and Cryptomonas sp. SAG 26.80. (S-Table 2).

S-Table 3 Illustration of 12-Well plate for cultivation and “rescuing”- purposes

Clone1 Clone 1 Clone 1 Clone1 Clone 1 Clone 1 Clone 1 Clone 1 Clone 1 Clone 1 Clone 1 Clone 1

After successful reproduction in the 12-Well plate, specimens can be transferred to culture bottles. Initially, 10-20 ml of medium and 2-3 ml culture from the largest well plate was ideal. Addition of food was strain dependant. A good indicator for the transfer to a higher volume of medium is the “swarming behaviour” of all strains. (S-Table 3).

Qualitative Protargol Methodology Reagents for QPI: 1. Bouin’s fluid (prepared immediately before use; components can be stored) 2. (70%) Isopropyl solution (prepared immediately before use; components can be stored)

3. Albumin-glycerol solution (stable for 1-3 months at 5 C°)

4. 0.2% potassium permanganate solution (stable for a few months)

5. 2.5% oxalic acid solution (stable for a few months)

6. 0.4–1.5% protargol solution (stable for about 1 week when not heated, variation with different stain numbers, protargol concentrations)

7. Ordinary developer

8. Acetone developer (stable for about two weeks; add components in the series given and dissolve each before adding the next)

9. Fixative for impregnation sodium thiosulfate (stable for years)

S-Table 4 Reagents for Bouin’s fluid (1:10) with sample (modified after Skibbe 1994)

Fixative Chemical Volume Brand

Picric acid C6H3N3O7 3.57 ml (saturated) Fluka Formaldehyde 37% HCHO 1.19 ml Roth

Glacial acetic acid C2H4O2 240 µl Roth

S-Table 5 Reagents for qualitative protargol Staining after Foissner

Chemical Conz. (in %) Conc. Brand

new developper (= "Aceton-developer") - 100 ml Milli Q

Boric acid - 1.4 g Roth

Hydrochinon C6H6O2 - 0.3 g Roth

Na-Sulfite Na2SO3 - 2.0 g Merck

Aceton - 15 ml Roth

Albumin 100% Roth

Glycerol C3H8O3 100% Roth

Protargol 0.4 - 1,5% 0.4 - 1.5 g in 100 ml aq.d.

Oxalic acid C2H2O4 x 2 H2O 2.5% 2.5 g in 100 ml aq.d. Merck

Potassium-Permanganate KMnO4 0.2% 0.2 g in 100 ml aq.d. Merck

Na-Thiosulfate Na2S2O3 x 5 H2O 5% 50 g in 1,000 ml Milli Q Merck

Isopropyl (2-Propanol) 70% Roth

Isopropyl (2-Propanol) 95% Roth

Isopropyl (2-Propanol) 100% Roth

Rotihistol 100% Roth

Canada balm Merck

S-Table 6 Accession number classification table shortened version according to the closest match in NCBI. Accession numbers, Base difference, percent identity, different biogeographical distribution and label of an organism is displayed All sequences reached a query cover of 100%, green = 1 CC, orange = 2 CC; blue = >4 CC.

74 S-Table 7 Morphometrical characters

Body length, µm Strain Number X̄̄̄̄ M SD SE CV Min Max n Method Cil-2017/19 24.4 23.0 5.1 1.1 21.1 16.9 34.8 21s IV Cil-2017/19 13.6 13.1 2.2 0.5 16.0 10.3 17.5 19 P Cil-2017/23 18.7 18.6 2.9 0.6 15.3 13.3 24.4 21 IV Cil-2017/23 14.1 14.2 1.4 0.3 10.1 12.0 17.5 21 P Cil-2017/24 17.9 18.1 2.0 0.4 10.9 14.1 22.8 21 IV Cil-2017/24 13.8 13.9 1.3 0.2 9.3 10.3 16.3 33 P Cil-2019/10 16.4 16.5 1.7 0.4 10.4 13.3 19.2 21 IV Cil-2019/10 11.4 11.0 1.5 0.3 13.2 8.7 14.5 21 P Cil 12 LZ 23.6 23.7 3.3 0.7 13.9 16.3 30.1 21 IV Cil 12 LZ 16.5 16.2 1.9 0.4 11.7 13.3 19.7 21 P Cil-2019/13 22.5 21.7 4.0 0.9 18.0 16.6 35.2 21 IV Cil-2019/6 16.0 16.3 2.0 0.4 12.7 10.7 18.5 23 P Cil-2019/3 19.8 19.9 2.3 0.5 11.4 15.7 23.8 21 IV Cil-2019/3 12.8 12.2 2.4 0.5 19.1 8.5 19.8 23 P Cil-2017/25 38.7 38.9 5.6 1.2 14.5 26.1 50.6 21 IV Cil-2017/25 21.8 22.1 2.8 0.6 12.7 17.7 28.2 23 P Cil-2017/27 49.1 48.7 6.2 1.4 12.6 37.9 59.2 21 IV Cil-2017/27 23.7 24.0 3.4 0.7 14.3 17.0 29.0 24 P Cil-2019/1 39.7 39.9 7.7 1.7 19.3 25.4 53.3 21 IV Cil-2019/1 30.1 29.1 4.1 0.8 13.7 24.4 41.5 27 P Body width, µm Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 19.6 18.3 4.1 0.9 20.7 14.5 28.9 21 IV Cil-2017/19 11.0 11.0 1.7 0.4 15.3 8.3 14.4 19 P Cil-2017/23 11.5 11.2 2.0 0.4 17.2 8.0 16.3 21 IV Cil-2017/23 11.2 11.4 1.1 0.2 10.0 8.9 12.9 21 P Cil-2017/24 11.7 11.7 1.8 0.4 15.3 8.9 16.1 21 IV Cil-2017/24 10.6 10.5 1.6 0.3 14.9 8.0 13.5 33 P Cil-2019/10 11.8 11.6 1.4 0.3 12.1 9.1 14.4 21 IV Cil-2019/10 8.0 8.0 1.3 0.3 16.4 6.0 11.0 21 P Cil 12 LZ 17.0 17.7 3.0 0.7 17.8 10.1 23.1 21 IV Cil 12 LZ 12.2 12.2 1.7 0.4 14.1 8.6 15.6 21 P Cil-2019/13 14.8 14.3 3.9 0.8 26.3 10.3 28.5 21 IV Cil-2019/6 13.2 13.4 2.0 0.4 15.5 10.4 16.3 23 P Cil-2019/3 13.7 12.7 2.4 0.5 17.9 10.4 18.5 21 IV Cil-2019/3 9.3 8.6 2.2 0.5 23.8 6.2 14.2 23 P Cil-2017/25 31.4 30.3 4.7 1.0 14.9 24.9 43.8 21 IV Cil-2017/25 15.8 15.7 2.0 0.4 12.4 13.3 19.4 23 P Cil-2017/27 35.9 37.3 6.2 1.4 17.4 25.1 43.6 21 IV Cil-2017/27 17.9 17.7 2.3 0.5 13.1 14.1 22.9 24 P Cil-2019/1 35.5 35.8 6.2 1.4 17.5 25.5 46.4 21 IV Cil-2019/1 25.9 25.4 4.1 0.8 15.9 20.7 37.6 27 P Somatic cilia, length, µm Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 5.4 5.9 1.1 0.2 20.0 3.8 7.2 21 IV Cil-2017/19 4.7 4.8 0.7 0.2 15.7 3.5 6.3 20 P Cil-2017/23 4.5 4.3 0.6 0.1 14.1 3.4 5.5 21 IV Cil-2017/23 3.4 3.1 0.8 0.2 23.1 2.4 5.4 21 P Cil-2017/24 4.5 4.6 0.8 0.2 17.7 3.0 6.2 21 IV Cil-2017/24 4.4 4.3 0.9 0.2 19.9 2.9 6.5 21 P Cil-2019/10 4.1 4.2 1.0 0.2 24.7 2.1 6.3 21 IV Cil-2019/10 5.5 6.0 0.8 0.2 14.8 4.0 6.5 21 P Cil 12 LZ 3.9 4.2 0.8 0.2 20.0 2.0 4.9 21 IV Cil 12 LZ 3.9 3.5 1.0 0.2 25.5 2.8 6.2 21 P Cil-2019/13 5.7 6.0 0.9 0.2 15.8 3.2 6.8 21 IV Cil-2019/6 4.1 4.0 0.8 0.2 19.5 2.6 5.7 23 P Cil-2019/3 4.1 4.2 0.5 0.1 13.2 2.8 5.1 21 IV Cil-2019/3 4.1 4.1 0.7 0.2 17.1 3.1 6.0 21 P Cil-2017/25 ------IV Cil-2017/25 3.7 3.7 0.6 0.1 16.0 2.8 5.1 21 P Cil-2017/27 ------IV Cil-2017/27 3.7 3.6 0.9 0.2 24.0 2.3 5.8 21 P Cil-2019/1 5.7 5.4 1.6 0.3 27.8 3.6 8.6 21 IV Cil-2019/1 3.6 3.5 0.7 0.2 19.2 2.2 4.8 21 P

Macronucleus, length, µm Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 5.9 5.8 1.7 0.4 28.8 4.0 10.5 21 IV Cil-2017/19 4.6 4.4 0.9 0.2 19.5 3.4 6.5 19 P Cil-2017/23 4.1 3.9 0.8 0.2 18.7 3.3 5.9 21 IV Cil-2017/23 3.8 3.9 1.0 0.2 25.7 1.8 5.6 21 P Cil-2017/24 4.0 3.9 0.7 0.1 16.6 2.8 5.2 21 IV Cil-2017/24 4.2 3.8 1.0 0.2 24.0 2.4 6.2 21 P Cil-2019/10 3.9 3.8 1.0 0.2 25.9 1.8 6.3 21 IV Cil-2019/10 3.2 3.0 1.0 0.2 31.6 1.0 5.0 21 P Cil 12 LZ 4.7 4.6 1.3 0.3 27.5 3.0 8.1 21 IV Cil 12 LZ 5.7 5.6 1.1 0.2 19.0 3.7 8.5 21 P Cil-2019/13 5.0 4.8 0.8 0.2 16.0 4.0 6.7 21 IV Cil-2019/6 5.3 5.4 0.9 0.2 17.9 3.4 6.6 21 P Cil-2019/3 4.6 4.0 1.3 0.3 29.1 3.1 7.9 21 IV Cil-2019/3 5.0 4.8 1.0 0.3 19.9 3.7 7.2 9 P Cil-2017/25 10.8 10.6 1.4 0.3 13.4 8.5 15.1 21 IV Cil-2017/25 8.0 8.0 1.6 0.3 19.9 5.3 10.9 21 P Cil-2017/27 10.4 9.7 1.4 0.3 13.1 8.8 13.3 21 IV Cil-2017/27 7.5 7.4 1.7 0.4 22.9 5.2 12.1 21 P Cil-2019/1 10.0 9.9 2.2 0.5 21.4 6.6 14.9 21 IV Cil-2019/1 9.1 8.8 1.8 0.4 20.3 6.5 13.6 24 P Macronucleus, width, µm Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 5.9 5.7 1.6 0.4 27.8 4.1 10.6 21 IV Cil-2017/19 4.5 4.4 0.5 0.1 12.3 3.5 5.6 19 P Cil-2017/23 4.1 3.9 0.9 0.2 23.0 3.1 6.8 21 IV Cil-2017/23 3.9 4.0 1.1 0.2 27.0 1.7 5.5 21 P Cil-2017/24 4.3 4.3 1.1 0.2 25.0 2.7 7.7 21 IV Cil-2017/24 4.1 4.0 1.0 0.2 23.8 2.7 5.8 21 P Cil-2019/10 4.1 4.2 0.9 0.2 22.7 1.8 6.2 21 IV Cil-2019/10 2.9 3.0 0.8 0.2 28.1 1.5 5.0 21 P Cil 12 LZ 4.8 4.3 1.3 0.3 27.4 3.1 7.9 21 IV Cil 12 LZ 5.1 5.0 0.9 0.2 16.6 3.7 6.4 21 P Cil-2019/13 4.8 4.6 1.1 0.2 22.0 3.3 7.2 21 IV Cil-2019/6 4.9 4.5 1.4 0.3 27.7 3.3 9.0 21 P Cil-2019/3 4.5 4.5 1.1 0.2 24.4 2.5 6.8 21 IV Cil-2019/3 4.7 4.5 0.8 0.3 16.5 3.6 6.0 9 P Cil-2017/25 8.9 8.7 1.4 0.3 15.6 7.3 12.5 21 IV Cil-2017/25 7.1 7.1 1.2 0.3 17.0 5.6 10.3 21 P Cil-2017/27 10.7 10.8 1.9 0.4 18.1 8.2 13.4 21 IV Cil-2017/27 7.8 7.2 1.7 0.4 21.8 5.3 12.1 21 P Cil-2019/1 9.5 9.7 1.2 0.3 13.1 6.9 12.1 21 IV Cil-2019/1 8.4 8.1 1.8 0.4 21.0 5.1 12.6 24 P Micronucleus, length, µm Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 2.1 2.1 0.6 0.1 27.6 1.1 3.3 21 IV Cil-2017/19 1.7 1.7 0.4 0.2 24.1 1.2 2.3 6 P Cil-2017/23 ------IV Cil-2017/23 ------P Cil-2017/24 ------IV Cil-2017/24 ------P Cil-2019/10 ------IV Cil-2019/10 ------P Cil 12 LZ ------IV Cil 12 LZ 2.9 2.9 0.4 0.2 14.9 2.4 3.4 4 P Cil-2019/13 2.2 2.1 0.3 0.1 13.8 1.8 2.8 21 IV Cil-2019/6 ------P Cil-2019/3 1.7 1.7 0.3 0.1 19.0 0.9 2.3 21 IV Cil-2019/3 ------P Cil-2017/25 ------IV Cil-2017/25 ------P Cil-2017/27 2.6 2.6 0.6 0.5 25.0 2.1 3.0 2 IV Cil-2017/27 ------P Cil-2019/1 2.6 2.6 0.7 0.2 28.2 1.4 4.5 21 IV Cil-2019/1 ------P

Micronucleus, width, µm Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 2.0 1.9 0.8 0.2 42.0 1.2 4.9 21 IV Cil-2017/19 1.6 1.6 0.2 0.1 14.8 1.3 1.9 6 P Cil-2017/23 ------IV Cil-2017/23 ------P Cil-2017/24 ------IV Cil-2017/24 ------P Cil-2019/10 ------IV Cil-2019/10 ------P Cil 12 LZ ------IV Cil 12 LZ 2.9 2.7 0.5 0.2 17.1 2.5 3.6 4 P Cil-2019/13 2.2 2.1 0.3 0.1 14.2 1.6 2.7 21 IV Cil-2019/6 ------P Cil-2019/3 1.7 1.7 0.3 0.1 19.7 1.1 2.4 21 IV Cil-2019/3 ------P Cil-2017/25 ------IV Cil-2017/25 ------P Cil-2017/27 3.0 3.0 1.3 0.9 44.6 2.0 3.9 2 IV Cil-2017/27 ------P Cil-2019/1 2.7 2.5 0.8 0.2 29.8 1.5 4.7 21 IV Cil-2019/1 ------P Posterior extrusomes, length, µm Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 1.8 1.8 0.5 0.1 26.9 1.0 2.7 21 IV Cil-2017/19 1.0 1.0 0.1 0.0 7.0 0.9 1.1 7 P Cil-2017/23 3.2 3.2 1.5 0.3 48.8 2.1 4.3 2 IV Cil-2017/23 1.4 1.5 0.3 0.1 18.1 1.0 2.1 21 P Cil-2017/24 1.4 1.4 - - - 1.4 1.4 1 IV Cil-2017/24 ------P Cil-2019/10 ------IV Cil-2019/10 1.0 1.0 0.0 0.0 0.0 1.0 1.0 10 P Cil 12 LZ ------IV Cil 12 LZ 1.4 1.4 0.2 0.1 14.8 1.1 1.9 16 P Cil-2019/13 ------IV Cil-2019/6 ------P Cil-2019/3 0.9 0.8 0.2 0.0 25.2 0.6 1.5 21 IV Cil-2019/3 ------P Cil-2017/25 4.9 4.8 0.6 0.1 12.7 4.0 6.2 18 IV Cil-2017/25 ------P Cil-2017/27 4.1 4.3 0.9 0.2 22.2 2.4 5.4 21 IV Cil-2017/27 ------P Cil-2019/1 4.0 3.9 0.7 0.2 18.8 2.5 5.3 21 IV Cil-2019/1 ------P Anterior extrusomes, length, µm Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 ------IV Cil-2017/19 ------P Cil-2017/23 ------IV Cil-2017/23 ------P Cil-2017/24 ------IV Cil-2017/24 ------P Cil-2019/10 ------IV Cil-2019/10 ------P Cil 12 LZ ------IV Cil 12 LZ ------P Cil-2019/13 ------IV Cil-2019/6 ------P Cil-2019/3 ------IV Cil-2019/3 ------P Cil-2017/25 2.3 2.2 0.4 0.1 17.0 1.7 2.9 21 IV Cil-2017/25 ------P Cil-2017/27 2.4 2.6 0.5 0.1 19.0 0.8 2.9 21 IV Cil-2017/27 ------P Cil-2019/1 1.8 1.8 0.2 0.0 12.1 1.3 2.2 21 IV Cil-2019/1 ------P

Excretery pore of contractile vacuole, diameter, µm Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 3.6 3.6 1.0 0.2 26.4 2.3 5.8 21 IV Cil-2017/19 ------P Cil-2017/23 5.1 5.3 0.7 0.4 14.8 4.2 5.7 3 IV Cil-2017/23 ------P Cil-2017/24 4.9 3.9 2.0 0.6 41.5 2.4 8.3 13 IV Cil-2017/24 ------P Cil-2019/10 3.4 3.1 0.9 0.2 26.4 2.0 5.2 21 IV Cil-2019/10 ------P Cil 12 LZ 3.6 3.2 0.8 0.2 23.5 2.5 5.6 21 IV Cil 12 LZ ------P Cil-2019/13 4.8 4.8 1.4 0.3 28.5 2.5 6.7 21 IV Cil-2019/6 ------P Cil-2019/3 4.1 4.0 1.0 0.2 24.9 2.6 6.2 21 IV Cil-2019/3 ------P Cil-2017/25 ------IV Cil-2017/25 ------P Cil-2017/27 10.6 9.3 3.5 1.3 33.4 7.7 17.7 8 IV Cil-2017/27 ------P Cil-2019/1 8.0 7.1 3.3 0.7 41.2 3.6 16.5 21 IV Cil-2019/1 ------P Oral opening/basket, max.diameter, µm Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 ------IV Cil-2017/19 4.3 4.3 0.6 0.1 13.4 3.2 5.3 15 P Cil-2017/23 6.5 7.0 1.2 0.3 19.1 4.3 8.0 21 IV Cil-2017/23 4.1 4.2 0.6 0.1 13.7 2.8 4.9 21 P Cil-2017/24 4.0 3.8 1.2 0.3 29.4 2.3 6.9 21 IV Cil-2017/24 3.6 3.5 0.5 0.1 14.9 2.7 4.9 21 P Cil-2019/10 ------IV Cil-2019/10 3.6 3.5 0.7 0.2 19.5 2.5 5.0 20 P Cil 12 LZ ------IV Cil 12 LZ 4.8 4.6 0.9 0.2 18.6 3.4 6.4 21 P Cil-2019/13 ------IV Cil-2019/6 4.2 4.1 0.6 0.1 14.5 3.2 5.7 21 P Cil-2019/3 ------IV Cil-2019/3 4.1 4.0 0.6 0.1 14.4 3.0 5.2 23 P Cil-2017/25 ------IV Cil-2017/25 4.6 4.8 0.6 0.1 13.0 3.6 5.8 21 P Cil-2017/27 ------IV Cil-2017/27 4.7 4.8 0.7 0.1 13.9 3.4 6.0 21 P Cil-2019/1 12.7 11.7 3.9 0.8 30.4 5.7 18.7 21 IV Cil-2019/1 6.8 6.9 1.3 0.3 18.8 4.3 10.1 24 P Oral basket width: body width, ratio in % Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 ------IV Cil-2017/19 ------P Cil-2017/23 ------IV Cil-2017/23 137.2 130.9 45.0 9.8 32.8 85.5 252.9 21 P Cil-2017/24 0.3 0.4 0.1 0.0 30.4 0.2 0.6 21 IV Cil-2017/24 43.7 40.9 9.1 2.0 20.8 28.7 62.5 21 P Cil-2019/10 ------IV Cil-2019/10 ------P Cil 12 LZ ------IV Cil 12 LZ ------P Cil-2019/13 ------IV Cil-2019/6 0.3 0.3 0.0 0.0 14.0 0.2 0.4 21 P Cil-2019/3 ------IV Cil-2019/3 ------P Cil-2017/25 ------IV Cil-2017/25 0.3 0.3 0.0 0.0 13.6 0.2 0.4 21 P Cil-2017/27 ------IV Cil-2017/27 0.3 0.3 0.0 0.0 13.8 0.2 0.3 21 P Cil-2019/1 0.4 0.4 0.1 0.0 32.9 0.2 0.6 21 IV Cil-2019/1 0.3 0.3 0.0 0.0 14.4 0.2 0.3 21 P

Somatic ciliary row, number Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 ------IV Cil-2017/19 17.2 17.0 1.3 0.3 7.6 15 19 15 P Cil-2017/23 14.0 14.0 0.0 0.0 0.0 14 14 4 IV Cil-2017/23 11.6 11.0 1.0 0.2 8.9 10 13 21 P Cil-2017/24 14.7 14.0 1.2 0.3 8.2 14 18 21 IV Cil-2017/24 16.7 16.0 1.4 0.3 8.6 14 20 21 P Cil-2019/10 ------IV Cil-2019/10 14.7 14.0 1.9 0.4 13.1 12 19 21 P Cil 12 LZ ------IV Cil 12 LZ 21.8 21.0 1.9 0.4 8.8 19 26 21 P Cil-2019/13 ------IV Cil-2019/6 21.7 22.0 1.7 0.4 8.0 18 24 21 P Cil-2019/3 ------IV Cil-2019/3 17.0 17.0 1.1 0.2 6.6 15 19 21 P Cil-2017/25 ------IV Cil-2017/25 35.8 35.0 2.1 0.5 5.8 34 42 21 P Cil-2017/27 36.0 36.0 0.0 0.0 0.0 36 36 2 IV Cil-2017/27 36.0 36.0 2.9 0.6 8.0 32 42 21 P Cil-2019/1 39.0 40.0 2.0 0.7 5.1 34 40 9 IV Cil-2019/1 38.2 37.5 3.3 0.7 8.8 34 46 20 P Cilia in somatic row, number Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 ------IV Cil-2017/19 8.9 8.5 1.1 0.3 12.0 8.0 11.0 15 P Cil-2017/23 ------IV Cil-2017/23 10.2 10.0 1.8 0.4 17.4 8.0 14.0 21 P Cil-2017/24 9.1 9.0 1.2 0.3 13.3 7.0 12.0 21 IV Cil-2017/24 8.8 8.0 1.2 0.3 13.9 6.0 11.0 21 P Cil-2019/10 ------IV Cil-2019/10 5.8 6.0 0.8 0.2 14.4 5.0 7.0 21 P Cil 12 LZ ------IV Cil 12 LZ 10.7 10.0 2.2 0.5 20.4 8.0 15.0 21 P Cil-2019/13 ------IV Cil-2019/6 11.4 11.0 0.9 0.2 7.9 10.0 14.0 21 P Cil-2019/3 ------IV Cil-2019/3 9.6 9.0 1.7 0.4 18.0 8.0 14.0 21 P Cil-2017/25 ------IV Cil-2017/25 18.0 18.0 3.2 0.7 17.7 13.0 27.0 21 P Cil-2017/27 ------IV Cil-2017/27 19.0 19.0 2.8 0.6 14.9 13.0 27.0 21 P Cil-2019/1 ------IV Cil-2019/1 21.2 20.0 3.1 0.7 14.6 18.0 30.0 18 P Anteriour end to end of macronucleus, distance, µm Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 ------IV Cil-2017/19 ------P Cil-2017/23 ------IV Cil-2017/23 7.3 7.5 1.4 0.3 18.7 5.1 9.4 21 P Cil-2017/24 ------IV Cil-2017/24 10.0 10.5 2.8 0.6 27.8 0.7 13.9 21 P Cil-2019/10 ------IV Cil-2019/10 ------P Cil 12 LZ ------IV Cil 12 LZ ------P Cil-2019/13 ------IV Cil-2019/6 ------P Cil-2019/3 ------IV Cil-2019/3 ------P Cil-2017/25 ------IV Cil-2017/25 ------P Cil-2017/27 ------IV Cil-2017/27 ------P Cil-2019/1 ------IV Cil-2019/1 ------P

Anteriour end to end of macronucleus, distance, µm Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 ------IV Cil-2017/19 ------P Cil-2017/23 ------IV Cil-2017/23 7.3 7.5 1.4 0.3 18.7 5.1 9.4 21 P Cil-2017/24 ------IV Cil-2017/24 10.0 10.5 2.8 0.6 27.8 0.7 13.9 21 P Cil-2019/10 ------IV Cil-2019/10 ------P Cil 12 LZ ------IV Cil 12 LZ ------P Cil-2019/13 ------IV Cil-2019/6 ------P Cil-2019/3 ------IV Cil-2019/3 ------P Cil-2017/25 ------IV Cil-2017/25 ------P Cil-2017/27 ------IV Cil-2017/27 ------P Cil-2019/1 ------IV Cil-2019/1 ------P Unciliated posterior end, µm Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 ------IV Cil-2017/19 4.1 4.1 0.6 0.2 15.0 2.8 4.9 13 P Cil-2017/23 ------IV Cil-2017/23 4.1 4.3 0.9 0.2 22.7 2.6 5.9 21 P Cil-2017/24 ------IV Cil-2017/24 3.5 3.4 0.8 0.2 23.1 2.5 5.7 21 P Cil-2019/10 ------IV Cil-2019/10 4.2 4.0 0.6 0.1 13.3 3.0 5.0 19 P Cil 12 LZ ------IV Cil 12 LZ 4.3 4.2 0.7 0.2 16.0 3.4 6.5 21 P Cil-2019/13 ------IV Cil-2019/6 3.4 3.5 0.6 0.1 18.3 2.3 4.4 21 P Cil-2019/3 ------IV Cil-2019/3 3.6 3.5 1.5 0.3 41.3 1.4 9.0 21 P Cil-2017/25 ------IV Cil-2017/25 4.2 4.3 0.8 0.2 18.1 3.0 5.7 21 P Cil-2017/27 ------IV Cil-2017/27 4.1 3.9 1.0 0.2 25.2 2.4 6.4 21 P Cil-2019/1 ------IV Cil-2019/1 6.1 6.3 1.5 0.4 24.0 3.4 9.3 11 P Extrusomes, posterior, width, µm Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 ------IV Cil-2017/19 ------P Cil-2017/23 ------IV Cil-2017/23 ------P Cil-2017/24 ------IV Cil-2017/24 ------P Cil-2019/10 ------IV Cil-2019/10 0.3 0.3 0.1 0.0 38.5 0.2 0.5 10 P Cil 12 LZ ------IV Cil 12 LZ ------P Cil-2019/13 ------IV Cil-2019/6 ------P Cil-2019/3 ------IV Cil-2019/3 ------P Cil-2017/25 ------IV Cil-2017/25 ------P Cil-2017/27 ------IV Cil-2017/27 ------P Cil-2019/1 ------IV Cil-2019/1 ------P

Oral flaps length, µm Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 ------IV Cil-2017/19 ------P Cil-2017/23 ------IV Cil-2017/23 ------P Cil-2017/24 1.724 1.7 0.551 0.12 31.98 1.2 3.8 21 IV Cil-2017/24 ------P Cil-2019/10 1.381 1.3 0.232 0.051 16.77 1.2 2.1 21 IV Cil-2019/10 ------P Cil 12 LZ 1.914 2 0.536 0.117 28 0.9 2.9 21 IV Cil 12 LZ ------P Cil-2019/13 2.046 2.1 0.446 0.093 21.81 1.2 2.9 23 IV Cil-2019/6 ------P Cil-2019/3 1.976 1.8 0.653 0.142 33.02 0.9 3.3 21 IV Cil-2019/3 ------P Cil-2017/25 2.19 2.2 0.319 0.07 14.57 1.6 2.8 21 IV Cil-2017/25 ------P Cil-2017/27 2.005 1.9 0.285 0.062 14.24 1.5 2.7 21 IV Cil-2017/27 ------P Cil-2019/1 2.648 2.4 0.564 0.123 21.32 1.8 3.9 21 IV Cil-2019/1 ------P Caudal cilia, number Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 1.0 1.0 0.0 0.0 0.0 1.0 1 21 IV Cil-2017/19 1.0 1.0 0.0 0.0 0.0 1.0 1 13 P Cil-2017/23 1.0 1.0 0.0 0.0 0.0 1.0 1 21 IV Cil-2017/23 1.0 1.0 0.0 0.0 0.0 1.0 1 21 P Cil-2017/24 1.0 1.0 0.0 0.0 0.0 1.0 1 21 IV Cil-2017/24 1.0 1.0 0.0 0.0 0.0 1.0 1 21 P Cil-2019/10 1.0 1.0 0.0 0.0 0.0 1.0 1 21 IV Cil-2019/10 1.0 1.0 0.0 0.0 0.0 1.0 1 21 P Cil 12 LZ 2.0 2.0 0.0 0.0 0.0 2.0 2 21 IV Cil 12 LZ 2.0 2.0 0.0 0.0 0.0 2.0 2 21 P Cil-2019/13 2.0 2.0 0.0 0.0 0.0 2.0 2 21 IV Cil-2019/6 2.0 2.0 0.0 0.0 0.0 2.0 2 21 P Cil-2019/3 2.0 2.0 0.0 0.0 0.0 2.0 2 21 IV Cil-2019/3 2.0 2.0 0.0 0.0 0.0 2.0 2 21 P Cil-2017/25 4.5 4.0 0.8 0.2 18.2 4.0 7 21 IV Cil-2017/25 5.1 5.0 1.0 0.2 19.5 4.0 7 21 P Cil-2017/27 4.4 4.0 0.8 0.2 18.3 4.0 7 21 IV Cil-2017/27 6.0 6.0 1.1 0.2 18.0 4.0 7 21 P Cil-2019/1 4.7 4.0 0.9 0.2 19.6 4.0 7 21 IV Cil-2019/1 5.4 5.0 1.3 0.3 23.3 4.0 7 19 P Caudal cilia, length, µm Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 10.8 10.8 2.4 0.5 21.8 7.1 16.6 21 IV Cil-2017/19 7.4 7.5 1.7 0.5 22.7 5.1 10.7 13 P Cil-2017/23 8.5 8.0 2.4 0.8 28.2 6.6 14.5 10 IV Cil-2017/23 6.2 5.8 1.1 0.2 17.6 4.9 8.9 21 P Cil-2017/24 9.0 8.7 1.7 0.4 19.3 6.3 12.1 21 IV Cil-2017/24 7.3 7.4 1.4 0.3 18.9 5.2 9.7 21 P Cil-2019/10 6.8 6.8 1.0 0.2 15.3 4.8 8.7 21 IV Cil-2019/10 7.0 7.0 0.7 0.1 9.4 6.0 8.5 21 P Cil 12 LZ 7.3 7.5 0.8 0.2 11.2 5.7 8.7 21 IV Cil 12 LZ 5.8 5.6 1.1 0.2 19.3 4.1 8.1 21 P Cil-2019/13 8.0 7.8 1.3 0.3 16.1 5.5 10.8 21 IV Cil-2019/6 6.0 5.9 1.1 0.2 19.1 4.0 8.0 21 P Cil-2019/3 6.4 6.3 1.1 0.2 16.5 4.8 8.8 21 IV Cil-2019/3 6.1 5.7 1.2 0.3 19.9 4.5 8.7 21 P Cil-2017/25 9.4 9.3 1.1 0.2 12.0 7.3 12.6 21 IV Cil-2017/25 5.9 6.0 1.1 0.2 19.4 3.1 8.5 21 P Cil-2017/27 8.4 8.6 0.9 0.2 10.7 6.7 9.8 21 IV Cil-2017/27 6.4 6.7 1.1 0.2 16.6 4.6 8.3 21 P Cil-2019/1 8.0 8.3 1.5 0.3 19.2 4.3 10.7 21 IV Cil-2019/1 5.9 5.1 1.6 0.3 27.3 4.4 10.6 21 P

Free circumoral field, µm Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 ------IV Cil-2017/19 ------P Cil-2017/23 ------IV Cil-2017/23 ------P Cil-2017/24 ------IV Cil-2017/24 ------P Cil-2019/10 ------IV Cil-2019/10 2.3 2.0 0.4 0.1 17.3 1.8 3.0 21 P Cil 12 LZ ------IV Cil 12 LZ ------P Cil-2019/13 ------IV Cil-2019/6 ------P Cil-2019/3 ------IV Cil-2019/3 ------P Cil-2017/25 ------IV Cil-2017/25 ------P Cil-2017/27 ------IV Cil-2017/27 ------P Cil-2019/1 ------IV Cil-2019/1 ------P Dikinetids in brosse kinety number 1, number Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 ------IV Cil-2017/19 ------P Cil-2017/23 ------IV Cil-2017/23 ------P Cil-2017/24 ------IV Cil-2017/24 ------P Cil-2019/10 ------IV Cil-2019/10 3.0 3.0 0.0 0.0 0.0 3 3 2 P Cil 12 LZ ------IV Cil 12 LZ ------P Cil-2019/13 ------IV Cil-2019/6 ------P Cil-2019/3 ------IV Cil-2019/3 ------P Cil-2017/25 ------IV Cil-2017/25 ------P Cil-2017/27 ------IV Cil-2017/27 ------P Cil-2019/1 ------IV Cil-2019/1 ------P Dikinetids in brosse kinety number 2, number Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 ------IV Cil-2017/19 ------P Cil-2017/23 ------IV Cil-2017/23 ------P Cil-2017/24 ------IV Cil-2017/24 ------P Cil-2019/10 ------IV Cil-2019/10 4.0 4.0 0.0 0.0 0.0 4 4 2 P Cil 12 LZ ------IV Cil 12 LZ ------P Cil-2019/13 ------IV Cil-2019/6 ------P Cil-2019/3 ------IV Cil-2019/3 ------P Cil-2017/25 ------IV Cil-2017/25 ------P Cil-2017/27 ------IV Cil-2017/27 ------P Cil-2019/1 ------IV Cil-2019/1 ------P

Dikinetids in brosse kinety number 3, number Strain Number X̄̄ M SD SE CV Min Max n method Cil-2017/19 ------IV Cil-2017/19 ------P Cil-2017/23 ------IV Cil-2017/23 ------P Cil-2017/24 ------IV Cil-2017/24 ------P Cil-2019/10 ------IV Cil-2019/10 2.0 2.0 - - - 2 2 2 P Cil 12 LZ ------IV Cil 12 LZ ------P Cil-2019/13 ------IV Cil-2019/6 ------P Cil-2019/3 ------IV Cil-2019/3 ------P Cil-2017/25 ------IV Cil-2017/25 ------P Cil-2017/27 ------IV Cil-2017/27 ------P Cil-2019/1 ------IV Cil-2019/1 ------P Body shape Strain Number method Cil-2017/19 globular IV Cil-2017/19 - P Cil-2017/23 triangular/cone IV Cil-2017/23 - P Cil-2017/24 triangular/cone IV Cil-2017/24 - P Cil-2019/10 triangular/cone IV Cil-2019/10 - P Cil 12 LZ ellipsoid IV Cil 12 LZ - P Cil-2019/13 ellipsoid IV Cil-2019/6 - P Cil-2019/3 ellipsoid IV Cil-2019/3 - P Cil-2017/25 ellipsoid IV Cil-2017/25 - P Cil-2017/27 ellipsoid IV Cil-2017/27 - P Cil-2019/1 ellipsoid IV Cil-2019/1 - P Extrusomes shape Strain Number method Cil-2017/19 rods IV Cil-2017/19 - P Cil-2017/23 rods IV Cil-2017/23 - P Cil-2017/24 - IV Cil-2017/24 rods P Cil-2019/10 - IV Cil-2019/10 - P Cil 12 LZ - IV Cil 12 LZ - P Cil-2019/13 - IV Cil-2019/6 - P Cil-2019/3 rods IV Cil-2019/3 - P Cil-2017/25 - IV Cil-2017/25 - P Cil-2017/27 - IV Cil-2017/27 - P Cil-2019/1 - IV Cil-2019/1 - P

Food vacuoles, diameter, µm Strain Number X̄̄ M SD SE CV Min Max N method Cil-2017/19 5.3 5.2 1.4 0.3 26.0 2.4 7.9 21 IV Cil-2017/19 ------P Cil-2017/23 5.0 5.2 1.6 0.4 32.5 2.5 8.4 21 IV Cil-2017/23 ------P Cil-2017/24 4.8 5.1 1.4 0.3 28.5 2.5 6.9 21 IV Cil-2017/24 ------P Cil-2019/10 4.3 4.2 1.1 0.2 25.4 2.6 6.4 21 IV Cil-2019/10 ------P Cil 12 LZ 4.7 4.4 1.6 0.3 34.1 2.0 7.2 21 IV Cil 12 LZ ------P Cil-2019/13 4.6 4.7 1.4 0.3 30.4 2.6 7.7 21 IV Cil-2019/6 ------P Cil-2019/3 4.8 4.4 1.7 0.4 35.6 2.3 10.3 21 IV Cil-2019/3 ------P Cil-2017/25 5.6 5.9 1.1 0.2 19.2 3.6 7.4 21 IV Cil-2017/25 ------P Cil-2017/27 ------IV Cil-2017/27 ------P Cil-2019/1 5.5 5.4 1.7 0.4 30.6 3.0 10.4 21 IV Cil-2019/1 ------P Fat globuli, diameter, µm Strain Number X̄̄ M SD SE CV Min Max N method Cil-2017/19 1.4 1.4 0.3 0.1 24.4 0.8 2.0 21 IV Cil-2017/19 ------P Cil-2017/23 1.2 1.1 0.2 0.0 17.3 0.9 1.6 21 IV Cil-2017/23 ------P Cil-2017/24 1.7 1.8 0.6 0.1 32.5 0.9 2.9 21 IV Cil-2017/24 ------P Cil-2019/10 ------IV Cil-2019/10 ------P Cil 12 LZ 2.0 1.9 0.4 0.1 20.4 1.3 2.9 21 IV Cil 12 LZ ------P Cil-2019/13 2.0 1.9 0.4 0.1 22.4 1.4 3.1 21 IV Cil-2019/6 ------P Cil-2019/3 1.6 1.5 0.4 0.1 22.9 1.1 2.7 21 IV Cil-2019/3 ------P Cil-2017/25 ------IV Cil-2017/25 ------P Cil-2017/27 ------IV Cil-2017/27 ------P Cil-2019/1 1.5 1.4 0.4 0.1 29.0 0.9 2.5 21 IV Cil-2019/1 ------P