Insulin Synthesized in the Paraventricular Nucleus of the Hypothalamus Regulates Pituitary Growth Hormone Production

Insulin synthesized in the paraventricular nucleus of the hypothalamus regulates pituitary growth hormone production

Jaemeun Lee, … , Yong Chul Bae, Eun-Kyoung Kim

JCI Insight. 2020. https://doi.org/10.1172/jci.insight.135412.

Research In-Press Preview Endocrinology Neuroscience

Graphical abstract

Find the latest version: https://jci.me/135412/pdf 1 Insulin synthesized in the paraventricular nucleus of the hypothalamus regulates

2 pituitary growth hormone production

4 Jaemeun Lee1†, Kyungchan Kim1†, Jae Hyun Cho1, Jin Young Bae2, Timothy P. O’Leary3,

5 James D. Johnson3, Yong Chul Bae2, and Eun-Kyoung Kim1, 4*

7 1Department of Brain and Cognitive Sciences, Daegu Gyeongbuk Institute of Science and 8 Technology, Daegu, Republic of Korea

9 2Department of Anatomy and Neurobiology, School of Dentistry, Kyungpook National 10 University, Daegu, Republic of Korea

11 3Department of Cellular and Physiological Sciences, Diabetes Research Group, Life 12 Sciences Institute, University of British Columbia, Vancouver, BC, Canada

13 4Neurometabolomics Research Center, Daegu Gyeongbuk Institute of Science and 14 Technology, Daegu, Republic of Korea

15 †JL and KK contributed equally to this work.

16 *Correspondence: 17 Eun-Kyoung Kim, Ph.D. 18 Department of Brain & Cognitive Sciences, 19 Daegu Gyeongbuk Institute of Science and Technology, 20 333, Techno Jungang-daero, Hyeonpung-myeon, Dalseong-gun, 21 Daegu 42988, Republic of Korea 22 Phone: +82-53-785-6111 23 Fax: +82-53-785-6109 24 Email: [email protected] 25 26 Conflict of interest statement: The authors have declared that no conflict of interest exists.

27 Abstract

29 Evidence has mounted that insulin can be synthesized in various brain regions including

30 the hypothalamus. However, the distribution and functions of insulin-expressing cells in the

31 hypothalamus remain elusive. Herein, we show that in the mouse hypothalamus, the perikarya

32 of insulin-positive neurons are located in the paraventricular nucleus (PVN) and their axons

33 project to the median eminence; these findings define parvocellular neurosecretory PVN

34 insulin neurons. Contrary to corticotrophin-releasing hormone expression, insulin expression

35 in the PVN was inhibited by restraint stress (RS) in both adult and young mice. Acute RS–

36 induced inhibition of PVN insulin expression in adult mice decreased both pituitary growth

37 hormone (GH) mRNA level and serum GH concentration, which were attenuated by

38 overexpression of PVN insulin. Notably, PVN insulin knockdown or chronic RS in young mice

39 hindered normal growth via the down-regulation of GH gene expression and secretion,

40 whereas PVN insulin overexpression in young mice prevented chronic RS–induced growth

41 retardation by elevating GH production. Our results suggest that in both normal and stressful

42 conditions, insulin synthesized in the parvocellular PVN neurons plays an important role in the

43 regulation of pituitary GH production and body length, unveiling a physiological function of

44 brain-derived insulin.

45 Introduction

47 Insulin secreted from pancreatic β-cells can cross the blood–brain barrier and therefore

48 dominates the overall insulin content in the brain (1). Surprisingly, however, insulin expression

49 has been also discovered in various brain regions such as the choroid plexus, olfactory bulb,

50 cerebellum, cerebral cortex, hippocampus, and hypothalamus (2-6). A single-cell quantitative

51 reverse transcription–polymerase chain reaction (qRT-PCR) study demonstrated that Insulin

52 2 (Ins2) mRNA is present in GABAergic neurogliaform cells in the cerebral cortex of the rat

53 (7). In situ hybridization and immunohistochemistry studies revealed that insulin is produced

54 in the CA1 and CA3 pyramidal neurons, and dentate granule neurons in the adult mammalian

55 hippocampus (8-10). These findings suggest that local synthesis might be an alternative

56 source of brain insulin, but the physiological role of brain-derived insulin has not been clarified.

58 Although several brain regions have been suggested to possess the capacity for insulin

59 production, the existence of insulin-expressing cells in the hypothalamus remains

60 controversial. Insulin mRNA of rodents exists in 2 non-allelic forms, Ins1 and Ins2, and only

61 Ins2 is expressed in the brain (5, 11, 12). Li et al claimed that the Ins2 promoter is inactive in

62 the hypothalamus of Ins2-Cre knock-in mice (13). On the contrary, Mehran et al observed Ins2

63 mRNA expression in the hypothalamus of Ins2+/+ mice, which was significantly higher than the

64 background level seen in Ins2−/− hypothalamus, as well as patterns of histone methylation that

65 differed from those seen in islets (5). In terms of the mechanisms regulating insulin gene

66 expression in the mouse hypothalamus, glucose was found to up-regulate Ins2 mRNA levels,

67 while glucagon-like peptide 1 and forskolin biphasically regulated Ins2 mRNA levels in a

68 mouse hypothalamic cell line in a time-dependent manner (14). We have previously reported

69 that acute Wnt3a injection into the third ventricle of the mouse brain increases hypothalamic

70 Ins2 mRNA levels by triggering the expression of NeuroD1, which is a transcription factor for

71 insulin (15). These findings reinforce the notion that insulin-expressing cells exist within the

72 hypothalamus, but the regional distribution of the populations of these cells has not yet been

73 sufficiently explored.

75 The hypothalamus consists of several sub-regions with different nuclei including the

76 paraventricular nucleus (PVN). The PVN consists of 3 types of neurons: parvocellular

77 neurosecretory, parvocellular pre-autonomic, and magnocellular neurosecretory neurons. The

78 parvocellular neurosecretory neurons produce several neurohormones including thyrotropin-

79 releasing hormone (TRH), corticotropin-releasing hormone (CRH), and somatostatin (SST),

80 and release these neurohormones through their neurosecretory nerve terminals in the external

81 zone of the median eminence (ME) (16-18). The neurohormones are then transported to the

82 anterior pituitary via hypophyseal portal vessels adjacent to the ME and regulate the

83 production of a wide array of anterior pituitary hormones including growth hormone (GH) (16,

84 19-21). The hypothalamo–pituitary regulation mediates the body’s responses to physiological

85 stimuli or challenges, especially stress, by regulating hormone levels (22, 23).

87 In this study, we identify novel parvocellular neurosecretory neurons as the PVN insulin-

88 expressing neurons. We discovered a physiological role of PVN insulin in regulating pituitary

89 GH gene expression and secretion, leading to a change in body length of young mice under

90 both normal and stress conditions. This study will help better understanding of the regulatory

91 roles of brain-derived insulin in hormone production, growth, and other bodily functions.

92 Results

94 Hypothalamic insulin is synthesized mainly in the PVN neurons

95 To determine which hypothalamic sub-regions express insulin, we first conducted in situ

96 hybridization on serial coronal sections of the hypothalamus. Clear Ins2 mRNA-positive

97 signals were observed in PVN sections incubated with the Ins2 antisense probe (Figures 1A,

98 1B, 1C, and Supplemental Figure 1A) but not with the sense probe (Figure 1D). Consistent

99 with previous studies (8, 10), Ins2 mRNA expression was also found in the hippocampal

100 granule cell layer (Supplemental Figure 1B). Furthermore, immunostaining using an antibody

101 specific for proinsulin, a biosynthetic precursor of insulin, showed that insulin-expressing cells

102 were clearly located within the PVN (Figure 1E). Immunostaining using another antibody which

103 recognizes both proinsulin and mature insulin also confirmed that insulin-expressing cells

104 existed in the PVN (Supplemental Figure 1C). PVN sections from Ins2 KO (Ins1+/+:Ins2−/−)

105 mice showed no immunoreactivity to each antibody (Figure 1F and Supplemental Figure 1D),

106 confirming not only the specificity of the antibodies but also the expression of PVN insulin. The

107 specificity of the antibodies was further validated with the pancreas sections of WT and Ins2

108 KO mice (Supplemental Figures 2A and 2B). To verify the co-localization of Ins2 mRNA and

109 proinsulin protein within the same PVN cells, we next monitored β-gal expression in the

110 nucleus as a surrogate marker of Ins2 gene expression, since the coding sequencing of the

111 Ins2 gene was replaced with LacZ gene in the Ins2 KO mice used in our study (5). As expected,

112 all proinsulin-positive cells contained β-gal-positive nuclei in the PVN sections from Ins2+/β-gal

113 (Ins1+/+:Ins2+/−(β-gal)) mice (Supplemental Figure 3). Lastly, immunoblot analysis detected

114 proinsulin-positive bands in the hypothalamus and micro-dissected PVN of WT mice but not

115 in Ins2 KO mice (Supplemental Figure 4). Collectively, these data demonstrate that insulin-

116 expressing cells are present in the hypothalamic PVN.

117

118 To identify the cell types that express insulin in the PVN, we performed double

119 immunostaining of proinsulin with NeuN (a neuronal nuclear marker), microtubule-associated

120 protein 2 (MAP2; a neuronal soma and dendrite marker), glial fibrillary acidic protein (GFAP;

121 an astrocyte marker), or Iba-1 (a microglial marker). Proinsulin-positive cells in the PVN

122 contained mainly NeuN-positive nuclei (Figure 1G). Co-staining with MAP2 revealed that

123 proinsulin was prominently expressed in neuronal somata rather than dendrites in the PVN

124 (Supplemental Figure 1E). Proinsulin was not co-localized with GFAP-positive astrocytes in

125 the PVN (Supplemental Figure 1F). However, we found that proinsulin-positive cells

126 overlapped with GFAP-expressing ependymal cells lining the third ventricle (Supplemental

127 Figure 1F). In the PVN, proinsulin immunoreactivity was also detected in amoeboid microglia

128 but not in ramified microglia, although the microglial population with amoeboid morphology

129 was minor (Supplemental Figure 1G). Taken together, these data show that insulin is

130 expressed predominantly in neurons rather than astrocytes or microglia in the PVN, and is

131 located specifically in the neuronal somata.

132

133 To validate both de novo insulin synthesis and processing in the hypothalamus, we also

134 performed immunostaining for C-peptide, which is a small peptide that connects the A and B

135 chains of proinsulin and is excised during proinsulin processing, and thus is a proxy for

136 processed insulin. No C-peptide-positive signals were observed in the PVN (Supplemental

137 Figure 1H). Instead, C-peptide immunoreactivity was exclusively detected in the ME of the

138 hypothalamus (Figure 1H). A high magnification image revealed that C-peptide was present

139 in a diffuse punctate pattern within the external zone of the ME (Figure 1I). ME sections from

140 Ins2 KO mice showed no immunoreactivity for C-peptide (Figure 1J). The specificity of the C-

141 peptide antibody was validated in the pancreas sections of WT and Ins2 KO mice

142 (Supplemental Figures S2A and S2B). Proinsulin-positive signals were not evident in the

143 external zone of the ME (Supplemental Figure 1I).

144

145 The ME contains neurosecretory nerve terminals, tanycytes, astrocytes, and microglia

146 (24, 25). To investigate the origin of C-peptide present in the ME, we performed double

147 immunostaining of C-peptide with synapsin (a presynaptic marker), vimentin (a tanycyte

148 marker), GFAP, or Iba-1. C-peptide was highly co-localized with synapsin-positive presynaptic

149 nerve terminals in the external zone of the ME (Figure 1K). In contrast, C-peptide was not co-

150 localized with vimentin, although they were closely juxtaposed along the external zone of the

151 ME (Supplemental Figure 1J). C-peptide did not overlap with GFAP or Iba-1 in the ME

152 (Supplemental Figures 1K and 1L). These data indicate that C-peptide in the ME is

153 constitutively situated in neurosecretory nerve terminals but not in tanycytes, astrocytes, or

154 microglia.

155

156 A subset of PVN insulin neurons co-express CRH or SST

157 To investigate whether PVN insulin neurons also contain other neurohormones typically

158 produced by parvocellular neurosecretory neurons, we performed double immunostaining of

159 proinsulin with CRH or SST in the PVN and of C-peptide with CRH or SST in the ME. For

160 these experiments, we used a CRH or SST antibody that recognizes both the precursor and

161 mature form. Most proinsulin-positive cells contained CRH in the PVN (84.78 ± 2.73%, Figures

162 1L and 1P). Inversely, 97.078 ± 0.47% of CRH-positive cells were immunoreactive for

163 proinsulin (data not shown). C-peptide-positive nerve terminals were highly co-localized with

164 CRH-positive nerve terminals in the ME (Figures 1N and 1Q). Some proinsulin-positive cells

165 also contained SST, especially in the periventricular regions of the PVN (11.58 ± 2.07%,

166 Figures 1M and 1P). A small portion of C-peptide-positive nerve terminals were co-localized

167 with SST-positive nerve terminals in the ME, as indicated by rare yellow puncta (Figures 1O

168 and 1R). These data suggest that subpopulations of PVN insulin neurons produce and

169 transport CRH or SST along with insulin.

170

171 PVN insulin neurons send their nerve terminals to the external zone of the ME

172 Considering that parvocellular neurosecretory neurons of the PVN send their nerve

173 terminals into the external zone of the ME (26, 27), we intraperitoneally injected Fluorogold

174 (FG), a retrograde axonal tracer, to examine whether the axons of PVN insulin neurons

175 terminate in the ME. FG circulating in the blood is taken up by nerve terminals lying outside

176 the blood–brain barrier and is retrogradely transported to neuronal somata, resulting in the

177 labeling of neurons projecting to the external zone of the ME (28-30). Five days after i.p.

178 injection of FG, the vast majority of PVN insulin neurons contained FG (Figure 2A), indicating

179 that these neurons have the anatomical properties of parvocellular neurosecretory neurons.

180 Conversely, to ascertain whether C-peptide in the ME comes from parvocellular

181 neurosecretory neurons, we performed anterograde tracing experiments using lentivirus

182 expressing GFP. Injection of the lentivirus into the PVN yielded high GFP expression within

183 the PVN (Figure 2B). Two weeks after the injection, GFP-labeled nerve terminals of

184 parvocellular neurosecretory neurons overlapped with C-peptide-positive nerve terminals in

185 the external zone of the ME (Figure 2C), suggesting that some parvocellular neurosecretory

186 neurons deliver C-peptide into the ME along their axons. Several hypothalamic neuropeptides

187 such as TRH and CRH show different localization between premature and mature forms (31,

188 32). This is because mature neuropeptides produced by processing of immature proteins in

189 the neuronal somata are rapidly delivered to axon terminals through axonal transport (33).

190 Since the co-localization of proinsulin and C-peptide was not observed in the normal PVN, we

191 next administered colchicine, a blocker of rapid axonal transport, into the left lateral ventricle,

192 to block axonal transport of C-peptide from the PVN to the ME and examine whether the

193 colchicine injection leads to co-localization of proinsulin and C-peptide in the PVN. C-peptide-

194 positive signals were not apparent in the PVN of vehicle-injected mice, but were clearly

195 observed in cell bodies and axon-like processes and perfectly co-localized with proinsulin-

196 positive cell bodies in the PVN after the colchicine injection (Supplemental Figure 5A).

197 Conversely, a dramatic reduction in C-peptide-positive nerve terminals was observed in the

198 ME of colchicine-injected mice compared with that of vehicle-injected mice (Supplemental

199 Figure 5B). These data demonstrate that C-peptide is transported from the somata of insulin-

200 expressing neurons in the PVN to their axon terminals in the ME, suggesting that PVN insulin

201 neurons transport insulin to the ME through axonal projections.

202

203 Several members of the prohormone convertase (PC) family are distributed throughout

204 the PVN (34). Among them, the enzymatic activities of PC1 and PC2 in the parvocellular PVN

205 neurons are remarkably diminished following starvation (31). Since PC1 and PC2 convert

206 proinsulin into insulin and C-peptide within secretory granules (35), we hypothesized that

207 fasting induces the accumulation of proinsulin in the PVN by slowing its proteolytic processing.

208 The fluorescence intensity of proinsulin was significantly higher in the PVN of fasted mice than

209 in that of fed controls (Figures 2D and 2F). In contrast, the fluorescence intensity of C-peptide

210 was significantly lower in the ME of fasted mice than in that of fed controls (Figures 2E and

211 2F). However, there was no significant difference in Ins2 mRNA levels in the PVN between

212 fed and fasted mice (Figure 2G). These data further confirm that insulin is transported from

213 the PVN to the ME.

214

215 PVN neurons expressing both insulin and CRH co-transport these proteins into the ME

216 To examine whether CRH synthesized in the PVN insulin neurons is transported into the

217 ME along with insulin, we conducted double immunostaining for CRH and C-peptide in

218 colchicine-injected mice. In this experiment, we used a CRH antibody that detects mature

219 CRH (mCRH) but not the CRH precursor (32). Neither mCRH-positive nor C-peptide-positive

220 cell bodies were detected in the PVN of vehicle-injected mice, but both proteins were strongly

221 co-localized in the PVN of colchicine-injected mice (Figure 2H). A noticeable overlap was

222 found between mCRH-positive and C-peptide-positive nerve terminals in the ME of vehicle-

223 injected mice, but their fluorescence signals were conspicuously diminished in the ME of

224 colchicine-injected mice (Figure 2I). Similarly, axon collaterals positive for both mCRH and C-

225 peptide were found in the PVN of colchicine-injected mice (Figure 2J). Lastly, electron

226 microscopy analysis with immunogold staining showed that mCRH and C-peptide were

227 extensively co-localized in the same large dense-core vesicles within axon terminals in the

228 ME of normal mice (Figure 2K). Taken together, these data indicate that PVN neurons co-

229 expressing insulin and CRH co-package insulin and mCRH in the same neurosecretory

230 granules and transport them to the ME.

231

232 Acute restraint stress inhibits PVN insulin expression

233 CRH is the principal factor mediating stress responses, and PVN CRH neurons rapidly

234 produce CRH upon exposure to stress (22, 23). In this regard, we wondered how PVN insulin

235 neurons respond to stress. First, we analyzed the time course of hypothalamic CRH and

236 insulin gene expression during acute restraint stress (RS) for 8 h. In line with previous reports

237 (36, 37), hypothalamic Crh mRNA levels were elevated by acute RS, displaying a biphasic

238 response with peaks at 30 min and 8 h (Figure 3A). However, hypothalamic Ins2 mRNA levels

239 were steadily down-regulated at all time-points of RS (Figure 3B). Likewise, in the micro-

240 dissected PVN of mice exposed to RS for 8 h, Crh mRNA levels were increased, whereas Ins2

241 mRNA levels were decreased (Figure 3C). Next, we performed triple immunostaining for

242 proinsulin, CRH, and the neuronal activity marker c-Fos in the PVN and double

243 immunostaining for C-peptide and CRH in the ME using brain sections from mice subjected to

244 RS for 8 h. Acute RS significantly increased the percentage of proinsulin/CRH co-positive cells

245 containing c-Fos compared with control mice (Figures 3D and 3F), indicating that PVN

246 neurons co-expressing insulin and CRH are activated by acute RS. The fluorescence intensity

247 of proinsulin in the PVN was significantly lower in acute-RS mice than in control mice (Figures

248 3D and 3G). The fluorescence intensity of C-peptide in the ME was also significantly lower in

249 acute-RS mice than in control mice (Figures 3E and 3H). In contrast, the fluorescence intensity

250 of CRH in the PVN was significantly higher in acute-RS mice than in control mice (Figures 3D

251 and 3G). However, the fluorescence intensity of CRH in the ME was similar between control

252 and acute-RS mice (Figures 3E and 3H), despite a remarkable increase in CRH synthesis in

253 the PVN, similar to previous studies (38, 39) Collectively, these data suggest that insulin

254 expression, unlike that of CRH, is consistently inhibited in the PVN under acute-RS conditions.

255

256 PVN insulin supports pituitary GH production

257 Neurohormones synthesized in parvocellular neurosecretory neurons ultimately regulate

258 the production of a variety of anterior pituitary hormones, including GH (16, 19-21). This raises

259 the intriguing possibility that insulin produced in PVN neurons may control the gene expression

260 and secretion of anterior pituitary hormones. To examine this possibility, we knocked down the

261 insulin gene in the PVN of adult mice (8 weeks old). Two weeks after injection of GFP lentivirus

262 carrying four different Ins2 shRNA constructs into the PVN, successful knockdown of insulin

263 in the PVN was confirmed by reduced proinsulin immunoreactivity in GFP-positive cells

264 (Figure 4A) and a significant decrease in PVN Ins2 mRNA level (Figure 4B), in comparison

265 with non-silencing shRNA-injected control mice. C-peptide immunoreactivity was also

266 significantly lower in the ME of Ins2 shRNA–injected mice than in that of control mice (Figures

267 4C and 4D). Crh mRNA levels in the PVN were not altered in Ins2 shRNA–injected mice

268 (Figure 4B). Next, we analyzed the mRNA levels of several anterior pituitary hormones.

269 Interestingly, of these hormones, only Gh mRNA expression was significantly down-regulated

270 by the knockdown of PVN insulin (Figure 4E). Since GH is released from the anterior pituitary

271 in a pulsatile manner (40), serum GH levels were assessed from vein samples taken at 6 h

272 intervals throughout the day. Serum GH concentrations were also remarkably lower in PVN

273 insulin knockdown mice than in control mice (Figure 4F). These data suggest that PVN insulin

274 contributes to sustained GH gene expression and secretion in the anterior pituitary.

275

276 GH-secreting cells of the pituitary express insulin receptors (41). However, it is still unclear

277 whether a classic insulin signaling pathway mediates GH production. Intriguingly, PVN insulin

278 knockdown significantly suppressed phosphorylation of Akt (p-Akt), a major target of insulin

279 signaling, in the pituitary (Figures 4G and 4H). Considering that Pit-1 (pituitary-specific positive

280 transcription factor 1) is an essential transcription factor for GH (42-44), we also assessed Pit-

281 1 mRNA levels. Pit-1 mRNA in the pituitary of PVN insulin knockdown mice was significantly

282 down-regulated compared with that of control mice (Figure 4I).

283

284 Hypothalamic growth hormone–releasing hormone (GHRH) and SST are major GH

285 regulators. Pituitary GH gene expression and secretion are induced by GHRH but inhibited by

286 SST released from the hypothalamus (45-47). To investigate whether PVN insulin indirectly

287 regulates pituitary GH gene expression and secretion by changing hypothalamic GHRH or

288 SST production, we quantified Ghrh and Sst mRNA levels in the hypothalamus of PVN insulin

289 knockdown mice. Knockdown of PVN insulin did not affect hypothalamic Ghrh and Sst mRNA

290 levels (Figure 4J). Considering that serum glucocorticoids and insulin modulate GH production

291 (48), we also analyzed serum levels of corticosterone (a dominant glucocorticoid in rodents)

292 and insulin, but found no significant differences between control and PVN insulin knockdown

293 mice (Figures 4K and 4L). There were no significant differences in body weight or food

294 consumption between control and PVN insulin knockdown mice (Figures 4M and 4N).

295

296 Acute restraint stress–induced suppression of PVN insulin expression attenuates

297 pituitary GH production

298 Our results showed that knockdown of PVN insulin leads to down-regulation of pituitary

299 GH production. In addition, acute RS suppresses PVN insulin expression and concomitantly

300 decreases pituitary Gh mRNA levels relative to control (no RS) in a time-dependent manner

301 (Figure 5A). On the basis of these findings, we hypothesized that the suppression of PVN

302 insulin expression during acute RS would decrease pituitary GH production. To test this

303 hypothesis, we overexpressed insulin in the PVN of adult mice by injecting a lentivirus carrying

304 Ins2 into the PVN (LV-insulin) and examined whether overexpression of PVN insulin reverses

305 acute RS-induced decrease in pituitary GH production. Two weeks after the injection, the Ins2

306 mRNA level in the PVN was significantly higher in LV-insulin mice than in empty vector–

307 injected control mice (mock) (Figure 5B). Acute RS–induced reduction in PVN Ins2 mRNA

308 levels was rescued by overexpression of insulin in the PVN (Figure 5B). Hypothalamic Crh

309 mRNA levels were elevated following acute RS regardless of PVN insulin overexpression

310 (Figure 5C). Of note, overexpression of insulin in the PVN abolished acute RS–induced

311 reduction in pituitary Gh mRNA levels (Figure 5D) and blunted reductions in serum GH

312 concentrations (Figure 5E). These data suggest that the acute RS–induced decline in PVN

313 insulin levels reduces pituitary GH gene expression and secretion, whereas overexpression

314 of insulin in the PVN prevents the acute RS–induced reduction in pituitary GH production.

315

316 Acute RS significantly reduced p-Akt levels in the pituitary of mock mice, but

317 overexpression of insulin in the PVN attenuated the acute RS–induced reduction in p-Akt

318 levels (Figures 5F and 5G). Pit-1 mRNA levels were not significantly reduced in the pituitary

319 of LV-insulin mice as opposed to mock mice, following acute RS (Figure 5H).

320

321 Hypothalamic Ghrh and Sst mRNA levels were unaffected by insulin overexpression in

322 the PVN either under control or acute-RS conditions (Figures 5I and 5J). Serum corticosterone

323 level was markedly elevated in both control and LV-insulin mice following acute RS (Figure

324 5K). Although the serum insulin level was significantly higher in LV-insulin than in control mice,

325 this difference was offset by a profound reduction in serum insulin following acute RS (Figure

326 5L). Body weight and food consumption did not show significant differences between control

327 and LV-insulin mice (Figures 5M and 5N).

328

329 PVN insulin regulates body length by modulating pituitary GH production

330 GH promotes growth until adolescence in mammals (49-51). Therefore, to investigate the

331 effect of PVN insulin on growth, we injected lentivirus containing Ins2 shRNA into the PVN of

332 young mice (4 weeks old). Six weeks after the injection, hypothalamic Ins2 mRNA expression

333 was significantly down-regulated (Figure 6A), and interestingly, a significant reduction in body

334 length was observed (Figure 6B) in PVN insulin knockdown mice in comparison with non-

335 silencing shRNA-injected control mice. Although there were no significant differences in body

336 weight or food consumption between control and PVN insulin knockdown mice during the 6

337 weeks (Figures 6C and 6D), the weight gain of PVN insulin knockdown mice tended to be

338 slightly slower than that of control mice (Figure 6C). Relative pituitary Gh mRNA levels (Figure

339 6E), serum GH concentrations (Figure 6F), and relative Pit-1 mRNA levels (Figure 6G) were

340 significantly lower in PVN insulin knockdown mice than in control mice. Taken together, these

341 data suggest that insulin knockdown in the PVN retards the growth of young mice by

342 suppressing pituitary GH production.

343

344 Chronic restraint stress–induced suppression of PVN insulin expression triggers

345 growth retardation in young mice by attenuating pituitary GH production

346 We next tested the hypothesis that stress would impede growth of young mice by

347 suppressing pituitary GH production via decreased PVN insulin levels. We subjected young

348 mice to chronic RS (2 h/day for 1, 2, 3, or 4 weeks) and observed a significant inhibition of the

349 gain in body length (Figure 7A). Hypothalamic Ins2 mRNA expression was significantly lower

350 at 1, 2, and 3 weeks in chronic-RS than in control mice (Figure 7B). In line with decreased

351 hypothalamic Ins2 mRNA expression, chronic RS reduced or tended to reduce both pituitary

352 Gh mRNA and serum GH levels (Figures 7C and 7D).

353

354 To determine whether chronic RS–induced growth retardation can be attributed to a

355 decreased PVN insulin expression, young mice were injected with Ins2-overexpressing

356 lentiviruses into the PVN, followed by exposure to chronic RS (2 h/day for 3 weeks). Chronic

357 RS–induced reduction in hypothalamic Ins2 mRNA expression was blocked (Figure 7E), and

358 of note, the growth retardation was prevented (Figure 7G) by PVN insulin overexpression.

359 Chronic RS up-regulated hypothalamic Crh mRNA expression (Figure 7F) and significantly

360 slowed down weight gain (Figure 7H) in both mock and LV-insulin mice. Food consumption

361 was similar between mock and LV-insulin mice regardless of chronic RS (Figure 7I). The

362 chronic RS–induced decrease in pituitary Gh mRNA and serum GH levels was abolished by

363 insulin overexpression in the PVN (Figures 7J and 7K). Furthermore, Pit-1 mRNA levels were

364 not reduced by chronic RS in LV-insulin as opposed to mock mice (Figure 7L). On the other

365 hand, hypothalamic Ghrh and Sst mRNA levels were unaffected by insulin overexpression in

366 the PVN either under control or chronic-RS conditions (Figures 7M and 7N). Serum

367 corticosterone levels were elevated (Figure 7O), whereas serum insulin levels were

368 substantially diminished (Figure 7P) by chronic RS in both mock and LV-insulin mice. Taken

369 together, these findings suggest that chronic RS stunts the growth of young mice by inhibiting

370 pituitary GH production via the down-regulation of insulin expression in the PVN, whereas

371 overexpression of insulin in the PVN prevents chronic RS–induced growth retardation.

372 Discussion

373

374 In this study, we demonstrated for the first time that in the mouse hypothalamus, insulin-

375 expressing neurons are present in the PVN and transport insulin through axonal projections

376 to the ME. Furthermore, we found that in both adult and young mice, normal PVN insulin

377 expression is important in maintaining pituitary GH gene expression and secretion. Of note,

378 RS-induced inhibition of PVN insulin expression decreases both the pituitary Gh mRNA and

379 serum GH levels. Physical or psychological stress is well known to cause growth retardation

380 in children (52-55). However, the specific mechanism underlying this growth retardation has

381 not been clearly elucidated. Our findings suggest that decreased PVN insulin levels under

382 stress conditions underlie growth retardation in young mice by suppressing pituitary GH

383 production. Thus, our study helps further understanding of stress-induced growth retardation

384 that might happen during childhood.

385

386 Then, how does PVN insulin regulate pituitary GH production? Peripheral insulin has been

387 considered as a negative regulator of pituitary GH gene expression and secretion, since

388 pituitary GH production is suppressed by the exposure of a pituitary cell line to insulin in vitro,

389 peripheral injection of insulin into animals, and hyperinsulinemia in obese animals (56-59).

390 High concentrations of insulin inhibit GH production via an increase in SST secretion and a

391 decrease in GHRH secretion from the hypothalamus (60). In contrast, insulin-induced

392 hypoglycemia is known to be a potent stimulus for GH release in humans (61, 62). However,

393 there is an emerging view that insulin may be required to maintain the level and sensitivity of

394 GHRH receptor, thus regulating the action of GHRH on GH-secreting cells, and promoting the

395 release of GH from pituitary under normal physiological conditions (60). Our results are in line

396 with this new notion and suggest that PVN insulin is necessary to maintain normal GH level.

397 Furthermore, immunoblot analysis of p-Akt suggests that PVN insulin may regulate pituitary

398 GH production by modulating insulin signaling independently of peripheral insulin.

399

400 GHRH, SST, and glucocorticoids, which are major GH regulators, control GH production

401 by acting directly on GH-secreting cells of the anterior pituitary (45-48). However, our results

402 demonstrate that the reduction in pituitary GH production by PVN insulin knockdown is not

403 due to alterations in GHRH, SST, or glucocorticoid levels, since PVN insulin knockdown did

404 not change hypothalamic Ghrh and Sst mRNA contents or serum corticosterone

405 concentrations. Similarly, our results suggest that in mice overexpressing insulin in the PVN,

406 the blockade of RS-induced reduction in pituitary GH production is not mediated by GHRH,

407 SST, or glucocorticoids. These findings imply the possibility that PVN insulin may also act

408 directly on GH-secreting cells in the anterior pituitary to regulate GH production.

409

410 Although proinsulin was expressed predominantly in the neuronal somata in the PVN,

411 proinsulin immunoreactivity was also observed in non-neuronal cells in the hypothalamus.

412 Proinsulin immunoreactivity was detected in ependymal cells lining the third ventricle. This

413 finding is in accordance with previous reports that ependymal cells produce insulin (63, 64).

414 Proinsulin immunoreactivity was found in all amoeboid microglial cells in the PVN, although

415 there were very few of these cells. Microglial cell activation is reflected in their morphological

416 change from ramified to amoeboid (65). Thus, this observation suggests that insulin could also

417 be produced by activated microglia in the PVN. Further experiments will be needed to

418 determine the functions of insulin derived from non-neuronal cells in the hypothalamus.

419

420 Another interesting point which warrants further study is the potential interaction of PVN

421 insulin and the hypothalamic–pituitary–adrenal (HPA) axis. The HPA axis plays a critical role

422 in mediating stress responses, and the PVN is the starting point of this axis regulation (22, 23).

423 In response to stress, PVN CRH neurons are activated and increase the synthesis and

424 secretion of CRH, leading to elevation of serum glucocorticoid levels. In this study, we

425 observed co-expression and co-transportation of insulin and CRH in a significant population

426 of the PVN neurons. However, insulin and CRH genes show reciprocal expression pattern in

427 the PVN of mice subjected to acute RS, and modulation of PVN insulin does not affect serum

428 corticosterone levels, suggesting that PVN insulin expression does not correlate with HPA axis

429 activity in stressful situations. Further study will be needed to confirm this conjecture.

430

431 In summary, PVN insulin neurons send their neurosecretory nerve terminals to the

432 external zone of the ME, transporting insulin to the anterior pituitary where it stimulates GH

433 gene expression and secretion, contributing to the increase in body length. Given that PVN

434 insulin overexpression prevented chronic RS–induced growth retardation, our study proposes

435 the role of PVN insulin as a positive regulator of pituitary GH production.

436 Methods

437

438 Animal procedures

439 Animals. Male C57BL/6 mice (3 or 7 weeks old) were purchased from Koatech

440 (Pyeongtaek, South Korea). Mice were housed under a 12 h light / dark cycle (lights on from

441 7:00 am to 7:00 pm) in individually ventilated cages (one mouse per cage) with chip bedding

442 at 23 ± 3°C and a relative humidity of 50% ± 10%. Sterilized food and water were provided ad

443 libitum. Changes in food intake were monitored individually. Adult mice (8–12 weeks old) were

444 used in all experiments except growth observation studies. Ins1+/+:Ins2+/− and Ins1+/+:Ins2−/−

445 mice were originally generated by the group of Dr. Jacques Jami (INSERM, France), and were

446 bred and obtained from Dr. James Johnson (University of British Columbia, Canada) (66, 67).

447 Since Ins2 was disrupted by inserting the LacZ gene at the Ins2 locus under the control of the

448 Ins2 promoters, these mice had β-gal knocked into their endogenous Ins2 locus.

449

450 i.p. injection of FG. FG (Fluorochrome, Denver, CO) is a non-viral fluorescent retrograde

451 axonal tracer. The ME is located below 3V, and in order to target the ME, the needle must

452 pass through the 3V during the stereotaxic injection. Therefore, in this process, FG may

453 spread to other unintended brain regions through the 3V. Since FG circulating in the blood is

454 retrogradely transported to neurons that send their axon terminals to the external zone of the

455 ME, IP injection of FG has been conventionally used in many studies as an experimental

456 method to see if a specific hypothalamic neuronal population projects into the ME (28-30). To

457 label neurons that project to the external zone of the ME, mice were injected i.p. with FG (15

458 μg/g body weight in 100 μL 0.9% saline). Five days after the injection, mice were perfused and

459 their brains were processed for double immunostaining for proinsulin and FG as described

460 below.

461

462 Injection of GFP-expressing lentivirus into the PVN. For anterograde axonal tracing, GFP-

463 expressing lentivirus was bilaterally injected into the PVN using a Hamilton syringe under deep

464 anesthesia with Zoletil 50 (Virbac, Carros, France) and Rompun (Bayer Korea, Ansan, South

465 Korea). The stereotaxic coordinates for the PVN were 0.82 mm posterior to bregma, 0.21 mm

466 lateral to the midline, and 5.30 mm below the surface of the skull. Two weeks later, mice were

467 perfused and their brains were processed for C-peptide immunostaining as described below.

468

469 i.c.v. injection of colchicine. Colchicine blocks rapid axonal transport, which results in

470 somatic accumulation of neuropeptides. Colchicine (20 μg; Sigma-Aldrich, St. Louis, MO)

471 dissolved in 2 μL of 0.01 M PBS was stereotaxically injected into the left lateral ventricle using

472 a Hamilton syringe under deep Zoletil 50/Rompun anesthesia. The stereotaxic coordinates for

473 the lateral ventricle were 0.58 mm posterior to bregma, 1.5 mm lateral to the midline, and 2.5

474 mm ventral to the skull surface. After 48 h, vehicle- or colchicine-treated mice were perfused

475 and their brains were processed for double immunostaining of proinsulin and C-peptide or

476 mCRH and C-peptide as described below. The dose and exposure time of colchicine used in

477 this experiment were based on the previous axonal transport studies with mice (30, 68, 69).

478

479 Food deprivation. Fasting reduces enzymatic activities of PC1 and PC2 in the PVN (31).

480 To inhibit these activities, mice were deprived of food for 24 h from 7:00 pm, but were allowed

481 free access to water. Control mice were given ad libitum access to food and water. Fed and

482 fasted mice were sacrificed to collect microdissected PVN, or were perfused and their brains

483 were processed for proinsulin and C-peptide immunostaining as described below.

484

485 Restraint stress. Mice were subjected to acute RS by physical immobilization in a well-

486 ventilated, 50 mL conical plastic tube for 15 min, 30 min, 1 h, 2 h, 4 h, or 8 h (RS group).

487 Control mice were allowed to roam freely in their home cage, but were deprived of food and

488 water (no-RS group). Mice in both groups were sacrificed to collect the hypothalamus and

489 pituitary for mRNA expression analysis, or were perfused and their brains were processed for

490 triple immunostaining of proinsulin, CRH, and c-Fos or double immunostaining of C-peptide

491 and CRH as described below. For exposure to chronic RS, young mice (4 weeks old) were

492 immobilized as above for 2 h daily (11:00 am to 1:00 pm) for 1, 2, 3, or 4 weeks, and body

493 length from nose to rump was measured every week. Following the last measurement, mice

494 were sacrificed to collect blood, hypothalamus, and pituitary.

495

496 Immunofluorescence staining

497 Mice were deeply anesthetized with an i.p. injection of a cocktail containing Zoletil 50 and

498 Rompun, and then perfused transcardially with PBS (pH 7.4) at 37°C, followed by 4%

499 paraformaldehyde in PBS [pH 7.4; shifted from 37°C (15 mL) to ice-cold (10 mL)]. Brain and

500 pancreas were quickly dissected out, post-fixed with the same fixative for 4 h at 4°C, and

501 immersed in 30% sucrose in PBS (pH 7.4) until they sank. To prepare frozen sections, the

502 brain and pancreas were embedded in optimal cutting temperature compound (CellPath,

503 Powys, UK), frozen on dry ice. Serial coronal brain sections (30–40 μm) and pancreas sections

504 (12 μm) were cut on a cryostat (Thermo Fisher Scientific, Waltham, MA) and extensively rinsed

505 in PBS.

506

507 The sections were incubated in combinations of primary antibodies diluted in PBS with 5%

508 donkey serum and 0.3% Triton X-100 for 16–72 h at 4°C. The final dilutions of primary

509 antibodies were as follows: mouse anti-proinsulin (1:50; R&D Systems, Minneapolis, MN,

510 #MAB13361; recognizes proinsulin but not mature insulin or C-peptide), guinea pig anti-insulin

511 (1:100; Abcam, Cambridge, UK, #ab7842; recognizes both proinsulin and mature insulin),

512 rabbit anti-C-peptide (1:300; Cell Signaling Technology, Danvers, MA, #4593; recognizes C-

513 peptide but not proinsulin or mature insulin), rabbit anti-β-gal (1:100; Thermo Fisher Scientific,

514 #A-11132), rabbit anti-NeuN (1:200; Cell Signaling Technology, #24307), chicken anti-MAP2

515 (1:1,000; Abcam, #ab5392), rabbit anti-GFAP (1:800; Dako, Carpenteria, CA, #Z0334), mouse

516 anti-GFAP (1:800; Millipore, Burlington, MA, #MAB360), goat anti-Iba-1 (1:500; Abcam,

517 #ab5076), guinea pig anti-synapsin (1:500; Synaptic Systems, Göttingen, Germany, #106

518 004), chicken anti-vimentin (1:2,500; Millipore, #AB5733), rabbit anti-FG (1:10,000;

519 Fluorochrome), goat anti-mCRH (1:200; Santa Cruz Biotechnology, Inc., Santa Cruz, CA, #sc-

520 1759; recognizes only the mature form), guinea pig anti-CRH (1:600; Peninsula Laboratories

521 International, Inc., San Carlos, CA, #T-5007; recognizes both the precursor and mature form),

522 goat anti-SST (1:200; Santa Cruz Biotechnology, Inc., #sc-7819), rabbit anti-c-Fos (1:1,000;

523 Santa Cruz Biotechnology, Inc., #sc-52), and rabbit anti-GFP (1:1000; Abcam, #ab290).

524

525 After extensive rinsing in PBS with 0.01% Tween-20, fluorophore-conjugated secondary

526 antibodies (Jackson ImmunoResearch) were applied for 1–2 h at room temperature (RT). The

527 sections were subsequently incubated for 5 min with 1 μg/mL Hoechst 33258 (Invitrogen,

528 Carlsbad, CA) in PBS for nuclear staining, mounted on glass slides, and cover-slipped with

529 Vectashield Mounting Medium (Vector Laboratories, Burlingame, CA).

530

531 Sections were analyzed using an LSM 780 or LSM 800 confocal laser-scanning

532 microscope (Carl Zeiss, Jena, Germany) with maximal signal separation. To analyze the

533 fluorescence intensity of proinsulin or CRH in the PVN, we used both sides of each of the 3–

534 5 PVN sections per mouse. To analyze the fluorescence intensity of C-peptide or CRH in the

535 ME, we used 3–5 sections from the ME per mouse. Fluorescence intensity was quantified

536 using ImageJ software (National Institutes of Health, Bethesda, MD) and represented as a

537 ratio of immunoreactivity to background fluorescence. To analyze the percentage of proinsulin-

538 positive cells that co-express CRH or SST, the number of such cells was blindly counted on

539 both sides of each of the 3–5 PVN sections per mouse. To analyze the percentage of CRH-

540 positive neurons that co-express proinsulin, the number of CRH-positive cells with proinsulin

541 was blindly counted on both sides of each of the 3–5 PVN sections per mouse. To analyze the

542 percentage of PVN insulin/CRH-expressing neurons that co-express c-Fos, the number of

543 proinsulin and CRH co-positive cells with c-Fos was blindly counted on both sides of each of

544 the 3–5 PVN sections per mouse.

545

546 In situ hybridization

547 Brains from transcardially perfused mice were embedded in paraffin as described

548 previously with some modifications (70). Serial brain sections (5 μm) were obtained from the

549 paraffin-embedded brain blocks. The sections were then deparaffinized with xylene, boiled in

550 pretreatment solution for 10 min, and digested with Protease QF (Affymetrix, Santa Clara, CA)

551 for 10 min at 40°C. To determine localization of Ins2 mRNA in the hypothalamus, the ViewRNA

552 ISH tissue assay kit (Affymetrix) was used as recommended by the manufacturer. The sections

553 were hybridized with mouse antisense Ins2 (Affymetrix, #VB1-10063) and sense Ins2

554 (Affymetrix, #VB1-20038) Fast Red probes for 4 h at 40°C. Slides were then incubated with

555 Label Probe 1-AP Type 1 solution and Fast Red substrate. Coverslips were mounted on slides,

556 and images were acquired using an ECLIPSE 90i light microscope (Nikon, Tokyo, Japan).

557

558 Electron microscopic immunohistochemistry

559 Ultrathin ME sections were collected on 300-mesh nickel grids as described as described

560 previously (71). Grids were etched for 5 s in sodium ethanolate (a saturated solution of NaOH

561 in 100% ethanol) at least 24 h before use. Grids were rinsed in TBS with 0.1% Triton X-100

562 (TBST; pH 7.4), and then incubated for 20 min in 2% human serum albumin (Sigma-Aldrich)

563 containing 0.1% sodium borohydride and 50 mM glycine (pH 7.4). Grids were then washed in

564 TBST and incubated for 3 h at RT in a mixture of goat anti-mCRH (1:80; Santa Cruz

565 Biotechnology) and rabbit anti-C-peptide (1:30; Cell Signaling Technology) antibodies. Grids

566 were rinsed in TBST, incubated with 12 nm gold–conjugated donkey anti-goat IgG antibody

567 (1:25 in TBST containing 0.05% polyethylene glycol; Jackson ImmunoResearch) for 2 h,

568 rinsed in TBST and incubated with 30 nm gold–conjugated goat anti-rabbit IgG antibody (1:25

569 in TBST containing 0.05% polyethylene glycol; BBI Solutions, Crumlin, UK) for 2 h. After

570 rinsing in distilled water, the grids were stained with uranyl acetate and lead citrate and

571 examined on a Hitachi H-7500 electron microscope (Hitachi, Tokyo, Japan) at 80 kV

572 accelerating voltage. Images were captured with Digital Montage software driving a MultiScan

573 cooled ES1000W Erlangshen CCD Camera (Gatan, Inc., Pleasanton, CA) attached to the

574 microscope.

575

576 Preparation of lentiviral shRNAs and Ins2-overexpressing lentiviral vector

577 GIPZ non-silencing lentiviral shRNA control (Dharmacon, Lafayette, CO, #RHS4346),

578 four different mouse Ins2 shRNAs (Dharmacon, V3LMM 471259, 471262, 471263, and

579 471364), which were cloned into the GIPZ lentiviral vector, and an Ins2-overexpressing

580 lentiviral vector (GeneCopooeia, Rockville, MD, EX-Mn03325-LV205) were used for gene

581 delivery. The pMD2.G and psPAX2 vectors were used as an envelope and packaging vector,

582 respectively, to produce lentivirus in the Lenti-X 293T cell line (Clontech Laboratories,

583 Mountain View, CA). Transient transfections were performed with the TurboFect transfection

584 reagent (Thermo Fisher Scientific) following the manufacturer’s protocol. Lentivirus-containing

585 cell supernatants were collected 72 h post-transfection, filtered through 0.45 μm syringe filters,

586 loaded onto 20% sucrose solution and concentrated by ultracentrifugation at 40,000 ×g for 90

587 min at 4°C (72). Viral pellets were suspended in PBS. Lentivirus was titrated by counting GFP-

588 positive cells on an Accuri C6 flow cytometer (BD Biosciences, San Jose, CA). Lentiviral

589 vectors were diluted to 0.3–1 × 1010 transducing units / mL.

590

591 Administration of lentiviral shRNAs or Ins2-overexpressing lentivirus into the PVN

592 Lentiviral vectors for knockdown or overexpression of Ins2 (1 μL each) were administered

593 into the PVN of adult mice (8 weeks old). For adult mice, the stereotaxic coordinates for

594 bilateral injections were as described above for GFP-expressing lentivirus injections. The

595 coordinates for young mice were adjusted to 0.74 mm caudal to bregma, 0.20 mm lateral to

596 the midline, and 4.75 mm below the surface of the skull.

597

598 After lentivirus administration into the PVN of adult mice, body weight and food

599 consumption were measured in the middle of the light cycle every day. Two weeks after

600 injection, mice were sacrificed to collect blood, pituitary samples, and brain; mice

601 overexpressing insulin in the PVN were subjected to RS for 8 h before sacrifice as describe

602 above.

603

604 In the case of young mice, body weight and food consumption were measured in the

605 middle of the light cycle every 2 days for 6 weeks (PVN insulin knockdown mice), or every day

606 for 3 weeks (mice overexpressing insulin in the PVN). The latter mice were subjected to

607 chronic RS for 3 weeks as describe above, starting from 5 days after lentiviral injection. Body

608 length was measured from nose to rump immediately before lentiviral injection and 6 weeks

609 after the injection (PVN insulin knockdown mice) or every week (mice overexpressing insulin

610 in the PVN). Following the last measurement of body length, mice were sacrificed to collect

611 blood, hypothalamus, and pituitary.

612

613 Microdissection of PVN for RNA extraction

614 Brains were rapidly dissected out, embedded in optimal cutting temperature compound,

615 and frozen on dry ice. Frozen sections (120 μm) were obtained on a cryostat. PVN-containing

616 serial coronal brain sections between bregma levels –0.58 and –0.94 mm were placed on

617 cover glasses. The PVN regions were then microdissected bilaterally using a 0.5-mm-diameter

618 brain punch (Stoelting Co., Wood Dale, IL). Microdissected PVN samples were expelled into

619 microcentrifuge tubes and frozen in liquid nitrogen. PVNs of 3 mice were pooled to extract

620 RNA.

621

622 RNA extraction and gene expression analysis by qRT-PCR

623 TRIzol reagent (Ambion, Austin, TX) and chloroform were used to extract total RNA from

624 each tissue. Total hypothalamic tissues were used for analysis of Ins2, Crh, Ghrh, and Sst

625 mRNA. Microdissected PVN samples were used for analysis of Ins2 and Crh mRNA. Total

626 pituitary gland tissues were used for analysis of proopiomelanocortin (Pomc), prolactin,

627 follicle-stimulating hormone β (Fshβ), luteinizing hormone β (Lhβ), Gh, pituitary-specific

628 positive transcription factor 1 (Pit-1) mRNA. Using 1 μg of total RNA extracted from each

629 sample, cDNA was synthesized as described previously (73). cDNA from total hypothalamic

630 and total pituitary tissues was diluted 1:5 and 1:20 in nuclease-free water, respectively. 2 μL

631 of diluted cDNA was used as a template for qRT-PCR, which was performed according to the

632 SYBR Green protocol (Takara Bio, Shiga, Japan) in a CFX-96 qRT-PCR machine (Bio-Rad

633 Laboratories, Hercules, CA). Sequences of primers used in qRT-PCR are listed in Table 1.

634 The ΔΔCt method was used to determine the relative expression level of each target gene

635 after normalization to that of the Gapdh gene. The Ct values for Ins2 mRNA were 29.779 ±

636 0.122 in total hypothalamic tissues and 30.735 ± 0.143 in microdissected PVN samples under

637 40 thermal cycles.

638

639 Serum GH, corticosterone, and insulin analysis

640 Serum GH, corticosterone, and insulin levels were measured by ELISA. Blood samples

641 were collected by tail bleeding at 05:00, 11:00, 17:00, and 23:00 or heart puncture at 17:00,

642 clotted for 1 h at RT, and centrifuged for 20 min at 2000 ×g to separate serum from blood clots.

643 Blood samples collected by tail bleeding were used for GH ELISA, and blood samples

644 collected by heart puncture were used for GH, corticosterone, and insulin ELISA. A mouse GH

645 ELISA kit (LifeSpan Biosciences, Seattle, WA), a mouse corticosterone ELISA kit (ALPCO

646 Diagnostics, Salem, NH), or a mouse insulin ELISA kit (ALPCO Diagnostics) was used,

647 respectively, following the manufacturers’ protocols.

648

649 Immunoblot analysis

650 To extract protein from total pituitary tissues, samples were dissolved in lysis buffers as

651 described previously (68). Lysates were separated on 10% SDS-polyacrylamide gels and

652 blotted onto polyvinylidene difluoride membranes (Millipore, IPVH00010) for 40 min at 20 V in

653 transfer buffer containing 25 mM Tris base, 192 mM glycine, and 10% methanol. The

654 membranes were blocked with 5% skim milk for 1 h and then incubated with primary antibodies

655 against phospho-Akt (1:1000; Cell Signaling Technology, #4060), Akt (1:1000; Cell Signaling

656 Technology, #9272), or GAPDH (1:10000; Cell Signaling Technology, #2118) at 4 °C overnight.

657 After extensive washing in Tris-buffered saline with 0.1% Tween 20, the membranes were

658 incubated with anti-rabbit horseradish peroxidase secondary antibody (Thermo Scientific,

659 NCI1460KR) and visualized by ECL solutions (Thermo Scientific, NCI4080KR) according to

660 the manufacturer’s procedure. Band intensities were quantified using ImageJ software.

661

662 For immunoblot assay of proinsulin, mice were perfused with PBS only before collecting

663 the samples. The pancreatic protein was extracted from one WT and Ins1+/+:Ins2−/− mouse,

664 respectively. Also, in both WT and Ins1+/+:Ins2−/− mice, the total hypothalamus of 3 mice and

665 the micro-dissected PVNs of 7 mice were pooled and concentrated to extract protein,

666 respectively. Lysates were separated on 15% SDS-polyacrylamide gels and blotted onto the

667 polyvinylidene difluoride membranes for 30 min at 16 V in the transfer buffer. The membranes

668 were blocked and then incubated with primary antibody against proinsulin (1:1000; Cell

669 Signaling Technology, #8138) at 4 °C overnight. After extensive washing, the membranes were

670 incubated with anti-mouse horseradish peroxidase secondary antibody (Jackson

671 ImmunoResearch, #115-035-003) and visualized by the ECL solutions.

672

673 Experimental design

674 In situ hybridization and immunostaining analyses were performed with 3–5 PVN or ME

675 sections from each mouse (at least 3 mice), and representative data were presented. For each

676 experimental condition, we calculated the sample size from the results of pilot experiments

677 with 3 mice per group using G*Power 3.1.9.2 (74). Considering the possible loss of mice during

678 experiments, the number of mice per experiment was greater than but less than twice the

679 calculated sample size, with one exception: we used 15 mice to obtain enough PVN samples

680 for microdissection, although the calculated sample size was 4. Final sample sizes (n) are

681 indicated in the legend of each figure.

682

683 Statistics

684 Statistical analyses were carried out using GraphPad Prism 8 software (GraphPad, La

685 Jolla, CA). Statistical comparisons between a control group and an experimental group were

686 made using Student’s t-test. Multiple comparisons in time course study of hypothalamic Crh

687 and Ins2 mRNA expression were determined using one-way ANOVA followed by Bonferroni

688 post-hoc tests. Multiple comparisons in PVN insulin overexpression data were made using

689 two-way ANOVA followed by Bonferroni post-hoc tests. Data are presented as mean ± SEM

690 and significance was determined at p < 0.05.

691

692 Study approval

693 All animal experiments were conducted in accordance with the guidelines on animal care

694 and use as approved by the Institutional Animal Care and Use Committee of DGIST. For

695 electron microscopic immunohistochemistry, animal procedures were performed according to

696 the National Institutes of Health guidelines and were approved by the Kyungpook National

697 University Intramural Animal Care and Use Committee. For immunofluorescence staining

698 using Ins1+/+:Ins2+/− and Ins1+/+:Ins2−/− mice, animal protocols were approved by the University

699 of British Columbia Animal Care Committee in accordance with national and international

700 guidelines.

701 Author contributions

702

703 E.K.K., J.L., and K.K. conceived and designed the experiments. J.L., K.K., and J.Y.B.

704 performed the experiments. E.K.K., J.L., K.K., J.H.J., and Y.C.B. analyzed and interpreted the

705 data. T.P.O. and J.D.J. provided the tissues of Ins1+/+:Ins2+/− and Ins1+/+:Ins2−/− mice, helped

706 design some experiments and interpret data, and edited the manuscript. E.K.K. and K.K. wrote

707 the manuscript with input from all authors.

708

709 Acknowledgements

710

711 This work was supported by the National Research Foundation of Korea

712 (2018M3C7A1056275 and 2020R1A2B5B02001468), Korea Brain Research Institute basic

713 research program (20-BR-04-02) funded by the Ministry of Science and ICT of Korea (E.-K.

714 K.), and Brain Canada (2015), the Canadian Institutes for Health Research (PJT168857)

715 (J.D.J.).

716 References

717

718 1. Banks WA, Owen JB, and Erickson MA. Insulin in the brain: there and back again. Pharmacol 719 Ther. 2012;136(1):82-93. 720 2. Grunblatt E, Salkovic-Petrisic M, Osmanovic J, Riederer P, and Hoyer S. Brain insulin system 721 dysfunction in streptozotocin intracerebroventricularly treated rats generates 722 hyperphosphorylated tau protein. J Neurochem. 2007;101(3):757-70. 723 3. Havrankova J, Schmechel D, Roth J, and Brownstein M. Identification of insulin in rat brain. 724 Proc Natl Acad Sci U S A. 1978;75(11):5737-41. 725 4. Young WS, 3rd. Periventricular hypothalamic cells in the rat brain contain insulin mRNA. 726 Neuropeptides. 1986;8(2):93-7. 727 5. Mehran AE, Templeman NM, Brigidi GS, Lim GE, Chu KY, Hu X, et al. Hyperinsulinemia 728 drives diet-induced obesity independently of brain insulin production. Cell Metab. 729 2012;16(6):723-37. 730 6. Mazucanti CH, Liu QR, Lang D, Huang N, O'Connell JF, Camandola S, et al. Insulin is 731 produced in choroid plexus and its release is regulated by serotonergic signaling. JCI Insight. 732 2019. 733 7. Molnar G, Farago N, Kocsis AK, Rozsa M, Lovas S, Boldog E, et al. GABAergic neurogliaform 734 cells represent local sources of insulin in the cerebral cortex. J Neurosci. 2014;34(4):1133-7. 735 8. Kuwabara T, Kagalwala MN, Onuma Y, Ito Y, Warashina M, Terashima K, et al. Insulin 736 biosynthesis in neuronal progenitors derived from adult hippocampus and the olfactory bulb. 737 EMBO Mol Med. 2011;3(12):742-54. 738 9. Nemoto T, Toyoshima-Aoyama F, Yanagita T, Maruta T, Fujita H, Koshida T, et al. New 739 insights concerning insulin synthesis and its secretion in rat hippocampus and cerebral cortex: 740 Amyloid-β 1–42-induced reduction of proinsulin level via glycogen synthase kinase-3β. 741 Cellular signalling. 2014;26(2):253-9. 742 10. Devaskar SU, Giddings SJ, Rajakumar PA, Carnaghi LR, Menon RK, and Zahm DS. Insulin 743 gene expression and insulin synthesis in mammalian neuronal cells. Journal of Biological 744 Chemistry. 1994;269(11):8445-54. 745 11. Devaskar SU, Singh BS, Carnaghi LR, Rajakumar PA, and Giddings SJ. Insulin II gene 746 expression in rat central nervous system. Regulatory peptides. 1993;48(1):55-63. 747 12. Deltour L, Leduque P, Blume N, Madsen O, Dubois P, Jami J, et al. Differential expression of 748 the two nonallelic proinsulin genes in the developing mouse embryo. Proc Natl Acad Sci U S 749 A. 1993;90(2):527-31. 750 13. Li L, Gao L, Wang K, Ma X, Chang X, Shi JH, et al. Knockin of Cre Gene at Ins2 Locus 751 Reveals No Cre Activity in Mouse Hypothalamic Neurons. Sci Rep. 2016;6:20438. 752 14. Madadi G, Dalvi PS, and Belsham DD. Regulation of brain insulin mRNA by glucose and 753 glucagon-like peptide 1. Biochem Biophys Res Commun. 2008;376(4):694-9. 754 15. Lee J, Kim K, Yu SW, and Kim EK. Wnt3a upregulates brain-derived insulin by increasing 755 NeuroD1 via Wnt/beta-catenin signaling in the hypothalamus. Mol Brain. 2016;9:24. 756 16. Eigler T, and Ben-Shlomo A. Somatostatin system: molecular mechanisms regulating anterior 757 pituitary hormones. J Mol Endocrinol. 2014;53(1):R1-19. 758 17. Kawano H, Daikoku S, and Shibasaki T. CRF-containing neuron systems in the rat 759 hypothalamus: retrograde tracing and immunohistochemical studies. J Comp Neurol. 760 1988;272(2):260-8. 761 18. Merchenthaler I, and Liposits Z. Mapping of thyrotropin-releasing hormone (TRH) neuronal 762 systems of rat forebrain projecting to the median eminence and the OVLT. 763 Immunocytochemistry combined with retrograde labeling at the light and electron microscopic 764 levels. Acta Biol Hung. 1994;45(2-4):361-74. 765 19. Lennard DE, Eckert WA, and Merchenthaler I. Corticotropin-releasing hormone neurons in the 766 paraventricular nucleus project to the external zone of the median eminence: a study 767 combining retrograde labeling with immunocytochemistry. J Neuroendocrinol. 1993;5(2):175- 768 81. 769 20. Ghamari-Langroudi M, Vella KR, Srisai D, Sugrue ML, Hollenberg AN, and Cone RD. 770 Regulation of thyrotropin-releasing hormone-expressing neurons in paraventricular nucleus of 771 the hypothalamus by signals of adiposity. Mol Endocrinol. 2010;24(12):2366-81. 772 21. Horn AM, Robinson IC, and Fink G. Oxytocin and vasopressin in rat hypophysial portal blood:

773 experimental studies in normal and Brattleboro rats. J Endocrinol. 1985;104(2):211-24. 774 22. Guilliams TG, and Edwards L. Chronic stress and the HPA axis. The standard. 2010;9(2):1- 775 12. 776 23. Jankord R, and Herman JP. Limbic regulation of hypothalamo-pituitary-adrenocortical function 777 during acute and chronic stress. Ann N Y Acad Sci. 2008;1148:64-73. 778 24. Kobayashi H, Matsui T, and Ishii S. Functional electron microscopy of the hypothalamic 779 median eminence. Int Rev Cytol. 1970;29:281-381. 780 25. Buma P, and Nieuwenhuys R. Ultrastructural characterization of exocytotic release sites in 781 different layers of the median eminence of the rat. Cell Tissue Res. 1988;252(1):107-14. 782 26. Swanson LW, and Kuypers HG. The paraventricular nucleus of the hypothalamus: 783 cytoarchitectonic subdivisions and organization of projections to the pituitary, dorsal vagal 784 complex, and spinal cord as demonstrated by retrograde fluorescence double-labeling 785 methods. J Comp Neurol. 1980;194(3):555-70. 786 27. Armstrong WE, Warach S, Hatton GI, and McNeill TH. Subnuclei in the rat hypothalamic 787 paraventricular nucleus: a cytoarchitectural, horseradish peroxidase and immunocytochemical 788 analysis. Neuroscience. 1980;5(11):1931-58. 789 28. Merchenthaler I. Retrograde labeling of hypophysiotropic neurons by local injection of wheat 790 germ agglutinin (WGA) into the median eminence or peripheral administration of fluoro-gold. 791 Mol Cell Neurosci. 1990;1(2):93-106. 792 29. Merchenthaler I. Neurons with access to the general circulation in the central nervous system 793 of the rat: a retrograde tracing study with fluoro-gold. Neuroscience. 1991;44(3):655-62. 794 30. Kakizawa K, Watanabe M, Mutoh H, Okawa Y, Yamashita M, Yanagawa Y, et al. A novel 795 GABA-mediated corticotropin-releasing hormone secretory mechanism in the median 796 eminence. Sci Adv. 2016;2(8):e1501723. 797 31. Sanchez VC, Goldstein J, Stuart RC, Hovanesian V, Huo L, Munzberg H, et al. Regulation of 798 hypothalamic prohormone convertases 1 and 2 and effects on processing of prothyrotropin- 799 releasing hormone. J Clin Invest. 2004;114(3):357-69. 800 32. Gonzalez-Hernandez T, Afonso-Oramas D, Cruz-Muros I, Barroso-Chinea P, Abreu P, del Mar 801 Perez-Delgado M, et al. Interleukin-6 and nitric oxide synthase expression in the vasopressin 802 and corticotrophin-releasing factor systems of the rat hypothalamus. J Histochem Cytochem. 803 2006;54(4):427-41. 804 33. Cortes R, Ceccatelli S, Schalling M, and Hokfelt T. Differential effects of 805 intracerebroventricular colchicine administration on the expression of mRNAs for 806 neuropeptides and neurotransmitter enzymes, with special emphasis on galanin: an in situ 807 hybridization study. Synapse. 1990;6(4):369-91. 808 34. Dong W, Seidel B, Marcinkiewicz M, Chretien M, Seidah NG, and Day R. Cellular localization 809 of the prohormone convertases in the hypothalamic paraventricular and supraoptic nuclei: 810 selective regulation of PC1 in corticotrophin-releasing hormone parvocellular neurons 811 mediated by glucocorticoids. J Neurosci. 1997;17(2):563-75. 812 35. Weiss M, Steiner DF, and Philipson LH. In: Feingold KR, Anawalt B, Boyce A, Chrousos G, 813 Dungan K, Grossman A, et al. eds. Endotext. South Dartmouth (MA); 2000. 814 36. Uchoa ET, Aguilera G, Herman JP, Fiedler JL, Deak T, and de Sousa MB. Novel aspects of 815 glucocorticoid actions. J Neuroendocrinol. 2014;26(9):557-72. 816 37. Kalin NH, Takahashi LK, and Chen FL. Restraint stress increases corticotropin-releasing 817 hormone mRNA content in the amygdala and paraventricular nucleus. Brain Res. 818 1994;656(1):182-6. 819 38. Flak JN, Ostrander MM, Tasker JG, and Herman JP. Chronic stress-induced neurotransmitter 820 plasticity in the PVN. J Comp Neurol. 2009;517(2):156-65. 821 39. Makino S, Smith MA, and Gold PW. Increased expression of corticotropin-releasing hormone 822 and vasopressin messenger ribonucleic acid (mRNA) in the hypothalamic paraventricular 823 nucleus during repeated stress: association with reduction in glucocorticoid receptor mRNA 824 levels. Endocrinology. 1995;136(8):3299-309. 825 40. Steyn FJ, Huang L, Ngo ST, Leong JW, Tan HY, Xie TY, et al. Development of a method for 826 the determination of pulsatile growth hormone secretion in mice. Endocrinology. 827 2011;152(8):3165-71. 828 41. Gahete MD, Cordoba-Chacon J, Lin Q, Bruning JC, Kahn CR, Castano JP, et al. Insulin and 829 IGF-I inhibit GH synthesis and release in vitro and in vivo by separate mechanisms. 830 Endocrinology. 2013;154(7):2410-20. 831 42. Karin M, Theill L, Castrillo JL, McCormick A, and Brady H. Cell type specific expression of the

832 growth hormone gene and its control by GHF-1. Nihon Naibunpi Gakkai zasshi. 833 1990;66(12):1205-20. 834 43. Gaiddon C, Tian J, Loeffler JP, and Bancroft C. Constitutively active G(S) alpha-subunits 835 stimulate Pit-1 promoter activity via a protein kinase A-mediated pathway acting through 836 deoxyribonucleic acid binding sites both for Pit-1 and for adenosine 3',5'-monophosphate 837 response element-binding protein. Endocrinology. 1996;137(4):1286-91. 838 44. Bodner M, Castrillo JL, Theill LE, Deerinck T, Ellisman M, and Karin M. The pituitary-specific 839 transcription factor GHF-1 is a homeobox-containing protein. Cell. 1988;55(3):505-18. 840 45. Brazeau P, Vale W, Burgus R, Ling N, Butcher M, Rivier J, et al. Hypothalamic polypeptide 841 that inhibits the secretion of immunoreactive pituitary growth hormone. Science. 842 1973;179(4068):77-9. 843 46. Plotsky PM, and Vale W. Patterns of growth hormone-releasing factor and somatostatin 844 secretion into the hypophysial-portal circulation of the rat. Science. 1985;230(4724):461-3. 845 47. Tannenbaum GS, Painson JC, Lengyel AM, and Brazeau P. Paradoxical enhancement of 846 pituitary growth hormone (GH) responsiveness to GH-releasing factor in the face of high 847 somatostatin tone. Endocrinology. 1989;124(3):1380-8. 848 48. Mazziotti G, and Giustina A. Glucocorticoids and the regulation of growth hormone secretion. 849 Nat Rev Endocrinol. 2013;9(5):265-76. 850 49. Savage MO, Blum WF, Ranke MB, Postel-Vinay MC, Cotterill AM, Hall K, et al. Clinical 851 features and endocrine status in patients with growth hormone insensitivity (Laron syndrome). 852 The Journal of clinical endocrinology and metabolism. 1993;77(6):1465-71. 853 50. Zhou Y, Xu BC, Maheshwari HG, He L, Reed M, Lozykowski M, et al. A mammalian model for 854 Laron syndrome produced by targeted disruption of the mouse growth hormone 855 receptor/binding protein gene (the Laron mouse). Proceedings of the National Academy of 856 Sciences of the United States of America. 1997;94(24):13215-20. 857 51. Efstratiadis A. Genetics of mouse growth. The International journal of developmental biology. 858 1998;42(7):955-76. 859 52. Dobrova-Krol NA, van Ijzendoorn MH, Bakermans-Kranenburg MJ, Cyr C, and Juffer F. 860 Physical growth delays and stress dysregulation in stunted and non-stunted Ukrainian 861 institution-reared children. Infant Behav Dev. 2008;31(3):539-53. 862 53. Fernald LC, and Grantham-McGregor SM. Growth retardation is associated with changes in 863 the stress response system and behavior in school-aged Jamaican children. J Nutr. 864 2002;132(12):3674-9. 865 54. Fernald LC, and Grantham-McGregor SM. Stress response in school-age children who have 866 been growth retarded since early childhood. Am J Clin Nutr. 1998;68(3):691-8. 867 55. Savendahl L. The effect of acute and chronic stress on growth. Sci Signal. 2012;5(247):pt9. 868 56. Melmed S. Insulin suppresses growth hormone secretion by rat pituitary cells. The Journal of 869 clinical investigation. 1984;73(5):1425-33. 870 57. Luque RM, and Kineman RD. Impact of obesity on the growth hormone axis: evidence for a 871 direct inhibitory effect of hyperinsulinemia on pituitary function. Endocrinology. 872 2006;147(6):2754-63. 873 58. Lanzi R, Luzi L, Caumo A, Andreotti AC, Manzoni MF, Malighetti ME, et al. Elevated insulin 874 levels contribute to the reduced growth hormone (GH) response to GH-releasing hormone in 875 obese subjects. Metabolism: clinical and experimental. 1999;48(9):1152-6. 876 59. Lanzi R, Manzoni MF, Andreotti AC, Malighetti ME, Bianchi E, Sereni LP, et al. Evidence for 877 an inhibitory effect of physiological levels of insulin on the growth hormone (GH) response to 878 GH-releasing hormone in healthy subjects. The Journal of clinical endocrinology and 879 metabolism. 1997;82(7):2239-43. 880 60. Qiu H, Yang JK, and Chen C. Influence of insulin on growth hormone secretion, level and 881 growth hormone signalling. Sheng Li Xue Bao. 2017;69(5):541-56. 882 61. Shibasaki T, Hotta M, Masuda A, Imaki T, Obara N, Demura H, et al. Plasma GH responses to 883 GHRH and insulin-induced hypoglycemia in man. J Clin Endocrinol Metab. 1985;60(6):1265- 884 7. 885 62. Hanew K, and Utsumi A. The role of endogenous GHRH in arginine-, insulin-, clonidine- and l- 886 dopa-induced GH release in normal subjects. Eur J Endocrinol. 2002;146(2):197-202. 887 63. Dakic TB, Jevdjovic TV, Peric MI, Bjelobaba IM, Markelic MB, Milutinovic BS, et al. Short-term 888 fasting promotes insulin expression in rat hypothalamus. Eur J Neurosci. 2017;46(1):1730-7. 889 64. Tarrach CHA, Dodson AAR, Foster CS, Harrold JA, and Wilding JPH. Rat third ventricle 890 ependymal cells possess the ability to produce insulin. Diabetes. 2005;54:A369-A.

891 65. Kettenmann H. Neuroscience: the brain's garbage men. Nature. 2007;446(7139):987-9. 892 66. Duvillie B, Cordonnier N, Deltour L, Dandoy-Dron F, Itier JM, Monthioux E, et al. Phenotypic 893 alterations in insulin-deficient mutant mice. Proc Natl Acad Sci U S A. 1997;94(10):5137-40. 894 67. Templeman NM, Flibotte S, Chik JHL, Sinha S, Lim GE, Foster LJ, et al. Reduced Circulating 895 Insulin Enhances Insulin Sensitivity in Old Mice and Extends Lifespan. Cell Rep. 896 2017;20(2):451-63. 897 68. Romanov RA, Alpar A, Zhang MD, Zeisel A, Calas A, Landry M, et al. A secretagogin locus of 898 the mammalian hypothalamus controls stress hormone release. EMBO J. 2015;34(1):36-54. 899 69. Ryu KY, Garza JC, Lu XY, Barsh GS, and Kopito RR. Hypothalamic neurodegeneration and 900 adult-onset obesity in mice lacking the Ubb polyubiquitin gene. Proc Natl Acad Sci U S A. 901 2008;105(10):4016-21. 902 70. Yoo SJ, Lee JH, Kim SY, Son G, Kim JY, Cho B, et al. Differential spatial expression of 903 peripheral olfactory neuron-derived BACE1 induces olfactory impairment by region-specific 904 accumulation of beta-amyloid oligomer. Cell death & disease. 2017;8(8):e2977. 905 71. Mah W, Lee SM, Lee J, Bae JY, Ju JS, Lee CJ, et al. A role for the purinergic receptor P2X3 906 in astrocytes in the mechanism of craniofacial neuropathic pain. Sci Rep. 2017;7(1):13627. 907 72. Ichim CV, and Wells RA. Generation of high-titer viral preparations by concentration using 908 successive rounds of ultracentrifugation. J Transl Med. 2011;9:137. 909 73. Oh TS, Cho H, Cho JH, Yu SW, and Kim EK. Hypothalamic AMPK-induced autophagy 910 increases food intake by regulating NPY and POMC expression. Autophagy. 911 2016;12(11):2009-25. 912 74. Faul F, Erdfelder E, Buchner A, and Lang AG. Statistical power analyses using G*Power 3.1: 913 tests for correlation and regression analyses. Behavior research methods. 2009;41(4):1149- 914 60. 915

A B C D PVN

Ins2 antisense Ins2 antisense Ins2 antisense Ins2 sense E F G WT Ins2 KO

PVN 3V

Hoechst Hoechst NeuN Proinsulin Proinsulin Proinsulin H I J K WT Ins2 KO

Arc Arc 3V

ME Hoechst Hoechst Hoechst Hoechst Synapsin C-peptide C-peptide C-peptide C-peptide L M

3V 3V

CRH SST Proinsulin Proinsulin N O 3V 3V

CRH SST C-peptide C-peptide

P ) Q R ( % 100 80000 CRH C-peptide 80000 SST C-peptide s l y y t t i i c e 80 s s n n

+ 60000 60000 e e t t i n n n i i u l

60 e e

c 40000 c 40000 o i n s n n e e

p r 40 c c s s d

e 20000 e 20000 r r

20 o o i z a e u u l l a l F 0 F 0 o c 0 0 10000 20000 30000 0 10000 20000 30000 o l

C CRH SST Distance [nm] Distance [nm] Figure 1. Proinsulin and C-peptide in the hypothalamus are localized in the PVN neuronal somata and ME neurosecretory nerve terminals, respectively. (A–D) in situ hybridization images. PVN sections were incubated with the Ins2 antisense probe (A, low magnification; B, C, high magnification), or with the Ins2 sense probe (D). (E, F) An immunofluorescence image showing the presence of proinsulin immunoreactivity in the PVN of WT mice (E). The specificity of the proinsulin antibody (R&D Systems, #MAB13361) was validated in the PVN sections from Ins2 KO mice (F). (G) A confocal image of double immunostaining for proinsulin and the neuronal marker NeuN in the PVN. Solid arrowheads show co-localization. (H–J) Immunofluorescence images showing the presence of C-peptide immunoreactivity in the ME of WT mice (H, low magnification; I, high magnification). The specificity of the C-peptide antibody (Cell Signaling Technology, #4593) was validated in the

ME sections from Ins2 KO mice (J). (K) A confocal image of double immunostaining for C- peptide and the presynaptic marker synapsin in the ME. (L, M) Confocal images of double immunostaining of proinsulin with CRH (L) or SST (M) in the PVN. Open arrowheads indicate single proinsulin labeling. Solid arrowheads show co-localization. (N, O) Confocal images of double immunostaining of C-peptide with CRH (N) or SST (O) in the ME. Solid arrowheads indicate co-localization. (P) The percentage of proinsulin-positive cells co-expressing CRH or

SST in the PVN. (Q, R) Fluorescence intensity of C-peptide and CRH (Q) or SST (R) along white arrows in the enlarged images in (N) and (O), respectively. Data are mean ± SEM, n =

3 or 4 mice/group. Scale bars: 200 μm (A), 100 μm (H, J) 50 μm (E–G, L–O), 20 μm (B–D, I,

K, high magnification inset images in L–O), 10 μm (high magnification inset images in G), 5

μm (high magnification inset images in K). 3V, third ventricle; PVN, paraventricular nucleus;

Arc, arcuate nucleus; ME, median eminence. A B C

3V 3V

FG GFP Proinsulin GFP C-peptide

Fed Fasted D Fed Fasted F 2.0 G 1.5 ** N A m R 1.5 1.0 I n s 2 1.0 * 0.5 3V 0.5 Proinsulin R e l a t i v o f 0.0 0.0

R e l a t i v f o u r s c n y Proinsulin C-peptide Fed Fasted J E

mCRH C-peptide

C-peptide H Vehicle Colchicine

mCRH / C-peptide

K PVN H / C-peptide

R 3V C m

I 3V

ME H / C-peptide R C m Figure 2. PVN insulin neurons project to the external zone of the ME, thereby co- transporting insulin and CRH from the PVN to the ME. (A) A confocal image of double immunostaining for proinsulin and FG in the PVN of mice i.p. injected with FG. Open arrowheads indicate single proinsulin labeling. Solid arrowheads show co-localization. (B, C)

2 weeks after injection of GFP-expressing lentivirus into the PVN, a confocal image of GFP expression in the PVN (B) and of double immunostaining for C-peptide and GFP in the ME

(C). Solid arrowheads show co-localization. (D–G) Confocal images of the PVN and ME from fed and 24-h fasted mice, and qRT-PCR analysis of Ins2 mRNA levels in the micro-dissected

PVN. The PVN was immunostained for proinsulin (D) and the ME for C-peptide (E).

Quantification of fluorescence intensity of proinsulin-immunoreactive cells in the PVN and C- peptide-immunoreactive nerve terminals in the ME (F). Relative levels of Ins2 mRNA in the

PVN (G). (H–J) Confocal images of double immunostaining for mCRH and C-peptide 48 h after vehicle or colchicine injection. PVN (H) and ME (I) at low magnification (H). PVN at high- magnification (J). (K) Double immunogold labeling showing co-localization of mCRH and C- peptide within the same neurosecretory granules in an axon nerve terminal located in the ME.

An arrowhead indicates an mCRH-immunoreactive 12 nm gold particle. An arrow denotes a

C-peptide-immunoreactive 30 nm gold particle. Data are mean ± SEM, Student’s t test, ** p <

0.01, n = 4 mice/group (F), n = 6 mice/group (G). Scale bars: 50 μm (A, B, D, H, I), 20 μm (C,

E, high-magnification inset images in A), 10 μm (J), 100 nm (K). A B C No RS RS 8 h 2.0 *** ** ** 1.2 3.5 N A N A *** 1.0 3.0

m R *** m R

R N A 1.5 2.5 0.8 C r h I n s 2 o f m 2.0 1.0 0.6 v e l 1.5 ###

0.4 e l 0.5 1.0 a t i v 0.2 0.5 R e l R e l a t i v o f 0.0 R e l a t i v o f 0.0 0.0 No RS 0.25 0.5 1 2 4 8 No RS 0.25 0.5 1 2 4 8 Crh Ins2 RS (hours) RS (hours)

D Proinsulin CRH c-Fos Proinsulin / CRH / c-Fos S R

N 3V h

8 S R

E C-peptide CRH C-peptide / CRH C-peptide / CRH / Hoechst 3V S R

o N h

8 S R ) 100 2.5 No RS RS 8 h 1.5 No RS RS 8 h F ( % G H

s ** 2.0

c e l 80

s + *** 1.0

F o 60 1.5 H + c - + C R

+ 40 1.0 R H

n 0.5 l i C ** *** s u n +

l i 20 0.5 i n s u r o P i n r o R e l a t i v f o u r s c n y 0 0.0 R e l a t i v f o u r s c n y 0.0 P No RS RS 8 h Proinsulin CRH C-peptide CRH Figure 3. Insulin synthesis in the PVN is suppressed by acute restraint stress. (A, B)

Time course study of hypothalamic Crh (A) and Ins2 (B) mRNA expression after acute RS from 15 min to 8 h. Data are mean ± SEM, one-way ANOVA with Bonferroni post-hoc tests, ** p<0.01, *** p<0.001, n = 5–7 mice/group. (C) Effects of acute RS for 8 h (RS 8 h) on the relative levels of Crh and Ins2 mRNA in the micro-dissected PVN. (D–H) Confocal images of the PVN and ME, and quantitative analysis of the positive cell number and fluorescence intensity. PVN sections triple-immunostained for proinsulin, CRH, and the neuronal activity marker c-Fos (D). ME sections double-immunostained for C-peptide and CRH (E). The percentage of proinsulin+/CRH+ cells co-expressing c-Fos (F). Fluorescence intensity of proinsulin- or CRH-immunoreactive cells in the PVN (G) and of C-peptide- or CRH- immunoreactive nerve terminals in the ME (H). Data are mean ± SEM, Student’s t test, ** p<0.01, *** and ### p<0.001, n = 9 mice/group (C), n = 4 mice/group (F–H). Scale bars: 50

μm. No RS, no-restraint-stress group; RS, restraint-stress group. A B shNon-silencing 1.4 shRNA Ins2 1.2 R N A

2 1.0 s n o f m I 0.8

A v e l n-silencing N 0.6 ** o R e l h N 0.4 s h s a t i v 0.2 R e l GFP GFP 0.0 Proinsulin Proinsulin Crh Ins2

C C-peptide D E shNon-silencing F shNon-silencing 1.75 shRNA Ins2 20 shRNA Ins2 1.4 1.50 ) *** L 1.2 R N A 15 *** m 1.25 ** / 1.0 g ** o f m n 1.00 ( shNon-silencing

0.8 H 10 v e l G

0.75 0.6

* e l m s 2 u n r I 0.4 0.50 5 e a t i v A S

N 0.2 0.25 R e l i n t e s y o f C - p d R R e l a t i v f u o r s c n 0 s h 0.0 0.00 shNon-silencing shRNA Ins2 Pomc Prolactin Fshβ Lhβ Gh 05:00 11:00 17:00 23:00

G H I J shNon-silencing 1.2 1.2 1.4 shRNA Ins2 N A shNon-silencing shRNA Ins2 1.0 1.2 m R **

1.0 R N A

** 1 1.0 i t p-Akt k t 0.8

0.8 P o f m

- A 0.8 t o f

0.6 v e l l / 0.6 Akt 0.6 k t v e e l l e - A 0.4 0.4

p 0.4 GAPDH e a t i v 0.2 i v 0.2 0.2 a t R e l e l

0.0 R 0.0 0.0 shNon-silencing shRNA Ins2 shNon-silencing shRNA Ins2 Ghrh Sst

K L M shNon-silencing N shNon-silencing N.S. shRNA Ins2 shRNA Ins2 200 3.0 N.S. 26 6 ) e ) g n

25 ( L

2.5 )

o 5 r n g 150 m / ( e

24 o

t i g t t

s 2.0 4 n h p L) ( o

23 g c i m i m n i t /

l 3 u

r 100 1.5 g u 22 s o w e s n

n c ( n

i 2

1.0 21 d c o m

m o

u 50 d r u 1 B 20 r o e 0.5

e 2 o S S

0 F 0 0 0.0 0 1 2 3 4 5 6 7 8 9 10 11 1213 14 1 2 3 4 5 6 7 8 9 10 11 12 13 14 shNon-silencing shRNA Ins2 shNon-silencing shRNA Ins2 days after administration days after administration Figure 4. Insulin knockdown in the PVN of adult mice reduces pituitary GH gene expression and secretion. GFP lentiviral vector carrying non-silencing shRNA control

(shNon-silencing) or Ins2 shRNA (shRNA Ins2) was injected into the PVN of adult mice. (A) A confocal image showing co-localization of the GFP-infected cells with proinsulin in the PVN 2 weeks after the lentiviral injection. (B) qRT-PCR data showing the efficient knockdown of Ins2, but not Crh by Ins2 shRNA in the micro-dissected PVN. (C, D) Confocal images of C-peptide- immunoreactive nerve terminals in the ME (C) and quantification of the fluorescence intensity

(D). (E) Relative levels of the mRNA for anterior pituitary hormones in the pituitary. (F) Serum

GH concentrations in tail vein samples taken 4 times a day. (G, H) Immunoblot analysis of p-

Akt (Ser473), Akt, and GAPDH levels in the pituitary (G). Quantification of p-Akt levels normalized to Akt (H). (I) Relative pituitary Pit-1 mRNA levels. (J) Relative hypothalamic Ghrh or Sst mRNA levels. (K, L) Serum corticosterone (K) and insulin (L) concentrations. (M, N)

Changes in body weight (M) and food consumption (N) for 2 weeks after the injection. Data are mean ± SEM, Student’s t test, * p<0.05, ** p<0.01, *** p<0.001, n = 6–9 mice/group (B, E,

F, I–N), n = 3 or 4 mice/group (D), n = 5 mice/group (H, J). Scale bars: 50 μm. No RS No RS No RS A B RS 8 h ### C RS 8 h D RS 8 h ## 1.2 2.0 3.0 $ 1.5 N A

N A N.S. N A N.S. *** N A ** ** 2.5 1.0 * m R m R

m R ** m R

1.5 ** *** 2.0 0.8 G h 1.0 C r h G h I n s 2 0.6 1.0 1.5

0.4 1.0 0.5 0.5 0.2 0.5 R e l a t v i o f R e l a t i v o f R e l a t i v o f 0.0 R e l a t i v o f 0.0 0.0 0.0 No RS 2 4 8 Mock LV-insulin Mock LV-insulin Mock LV-insulin RS (hours)

No RS N.S. No RS No RS E F G RS 8 h H RS 8 h RS 8 h Mock LV-insulin # 22 # 1.4 p=0.08 1.6 20 No RS RS 8 h No RS RS 8 h N.S. N A N.S. 1.2 1.4 ** ) 18 ** m R

L *** 1.2 - 1 k t

m 16 1.0 i t

/ p-Akt g 14 P 1.0 n

( 0.8 12 T - A 0.8 H 10 Akt

k t / 0.6 G 8 0.6 m 0.4 u

6 P - A r GAPDH 0.4

e 4 S 0.2 0.2 2

0 0.0 R e l a t i v o f 0.0 Mock LV-insulin Mock LV-insulin Mock LV-insulin

I J K No RS L No RS No RS No RS RS 8 h RS 8 h RS 8 h RS 8 h 1.4 1.4

N A 500 4

N A * $$$ $$ ) m R 1.2 1.2

m R

L ** 400 **

m 3 1.0 1.0 / g S s t G h r n

300 ( 0.8 0.8 n i l 2 0.6 u 0.6 200 s n (ng/mL) i 0.4 0.4 m 1 u

100 r 0.2 0.2 e Serum corticosterone S

0.0 R e l a t i v o f 0 0 R e l a t i v o f 0.0 Mock LV-insulin Mock LV-insulin Mock LV-insulin Mock LV-insulin

Mock Mock M 26 LV-insulin N 6 LV-insulin ) g

( 5 ) 24 g n (

o i t

t 4 h p g

i 22 m 3 u w e s

n y 20 d 2 c o o

B d

18 o 1 2 o F 0 0 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 1 2 3 4 5 6 7 8 9 10 11 12 13 14 days after administration days after administration Figure 5. Insulin overexpression in the PVN of adult mice prevents acute restraint stress–induced reduction in pituitary GH gene expression and secretion. (A) Time course study of Gh mRNA levels in the pituitary of adult mice after acute RS. (B–L) Lentiviral vector expressing GFP (empty control vector, mock) or GFP and Ins2 (LV-insulin) was injected into the PVN of adult mice. Two weeks after the injection, mice were exposed to acute RS for

8 h (RS 8 h). qRT-PCR data showing the efficiency of PVN insulin overexpression (B). Relative hypothalamic Crh mRNA levels (C). Relative pituitary Gh mRNA levels (D). Serum GH concentrations (E). Immunoblot analysis of p-Akt (Ser473), Akt, and GAPDH levels (F).

Quantification of p-Akt levels normalized to Akt (G). Relative pituitary Pit-1 mRNA levels (H).

Relative hypothalamic Ghrh (I) and Sst (J) mRNA levels. Serum corticosterone (K) and insulin

(L) concentrations. Changes in body weight (M) and food consumption (N) for 2 weeks after the injection. Data are mean ± SEM, two-way ANOVA with Bonferroni post-hoc tests, *, #, and

$ p<0.05, ** and ## p<0.01, *** and ### p<0.001, n = 5–7 mice/group (A–E, H–L), n = 3 mice/group (G), n = 14 mice/group (M, N). shNon-silencing 1.4 A B 9.8 shRNA Ins2 N A 1.2 9.6 m R ) 9.4 **

2 1.0 m 9.2 c ( n s

I 9.0

0.8 h t

o f ** 8.8 g l 0.6 n 8.6 e l v e

y l e 8.4

0.4 d e

o 8.2 i v B 8.0

a t 0.2

e l 0.2

R 0.0 0.0 shNon-silencing shRNA Ins2 0 6 weeks

C shNon-silencing D shNon-silencing shRNA Ins2 shRNA Ins2 30 200 )

28 g (

) n g 26 150 d ( o i

e t t t p h 24 a l g i m 22 u 100 u m s w e

u 20 n y c o d c c

18 o 50 A d B

16 o

2 o f 0 0 0 2 4 6 8 1012141618202224262830323436384042 0 2 4 6 8 1012141618202224262830323436384042 days after administration days after administration

E 1.5 F G 1.2 A

A 16 R N

) 1.0 R N 14 L m

m **

m 12 h / 1.0 - 1 0.8 g i t G n 10 ** P ** ( o f

l 0.6 o f

H 8 l v e G

v e l e 0.5 6 0.4 m l e e u e r 4 i v e i v

a t 0.2 S

2 a t e l e l R

0.0 0 R 0.0 shNon-silencing shRNAIns2 shNon-silencing shRNA Ins2 shNon-silencing shRNAIns2 Figure 6. Insulin knockdown in the PVN of young mice causes growth retardation.

Lentiviral vector carrying non-silencing shRNA control (shNon-silencing) or Ins2 shRNA

(shRNA Ins2) was injected into the PVN of young mice. (A) Relative hypothalamic Ins2 mRNA levels 6 weeks after the injection. (B) Body length from nose to rump immediately before the injection and 6 weeks after the injection. (C, D) Time course study of body weight (C) and accumulated food consumption (D). (E) Relative pituitary Gh mRNA levels. (F) Serum GH concentrations. (G) Relative pituitary Pit-1 mRNA levels. Data are mean ± SEM, Student’s t test, ** p<0.01, n = 6–8 mice/group. No RS No RS No RS No RS A B Chronic RS C Chronic RS D Chronic RS 16 Chronic RS 10.0 1.4 1.4 * N A * * * * ** 14 * N A ** 1.2 1.2 ) * L )

m R 12

9.5 ** m *** m R / m 1.0 1.0 g c

( 10 n

G h ( I n s 2 h

t 9.0 0.8 0.8

H 8 g G n 0.6 0.6 e

l 6

8.5 m y u r

d 0.4 0.4 4 e o S B 8.0 0.2 0.2 2 0.5

0.0 0.0 R e l a t i v o f 0.0 0 0 1 2 3 4 R e l a t i v o f 1 2 3 4 1 2 3 4 1 2 3 4 weeks weeks weeks weeks

No RS No RS Mock - No RS Mock - No RS E Chronic RS F Chronic RS G Mock - Chronic RS H Mock - Chronic RS N.S. 9.8 LV-ins - No RS LV-ins - No RS $$$ 2.0 2.0 $$ LV-ins - Chronic RS LV-ins - Chronic RS ** 9.6 ***

N A 24 ### N A ** $$ ) 9.4 m R m R

m ** ) 1.5 1.5 22 c

* g (

9.2 (

t C r h I n s 2 9.0 h

g 20 1.0 1.0 i 8.8 e length ** w

y * ## # y 18 d

8.6 d

0.5 0.5 o B o 8.4 B 16 0.2 2 0.0 0 R e l a t i v o f R e l a t i v o f 0.0 0.0 0 2 3 -4 -3 -2 -1 0 1 2 3 4 5 6 7 8 910111213141516171819 2021 Mock LV-insulin Mock LV-insulin weeks days

No RS No RS No RS Mock - No RS Chronic RS Chronic RS Chronic RS I Mock - Chronic RS J ## K L # N.S. LV-ins - No RS 1.5 N.S. 16 ## 1.4 100 LV-ins - Chronic RS ** * N A N A ) 14 N.S. 1.2 g L) ( m R

80 m R **

m n - 1

/ 1.0 d

12 i t o

1.0 g i G h e t P n t ( p 60 0.8 a l 10 m u u

GH 0.6 m

s 40

u 8 n

0.5 m c o

u 0.4 c r c

e A 20 6 d

S 2 0.2 o o f R e l a t v i o f

0 0.0 0 R e l a t v i o f 0.0 -3 -2 -1 0 1 2 3 4 5 6 7 8 9 101112131415161718192021 days Mock LV-insulin Mock LV-insulin Mock LV-insulin

No RS No RS No RS No RS M Chronic RS N Chronic RS O P Chronic RS 1.4 1.4 Chronic RS A N A 400 $$ 1.5 $$$ R N

1.2 1.2 e

m R * * n L)

m o m r 1.0 1.0 300 / e g t S s t G h r n s 1.0 ( L)

0.8 0.8 o c n i m i l t /

r 200 u 0.6 0.6 g o s n c ( n

i 0.4 0.4 0.5 m m

u 100 r u r

0.2 0.2 e e S S R e l a t i v o f

R e l a t i v o f 0.0 0.0 0 0.0 Mock LV-insulin Mock LV-insulin Mock LV-insulin Mock LV-insulin Figure 7. Insulin overexpression in the PVN of young mice prevents chronic restraint stress–induced growth retardation. (A–D) Young mice were subjected to chronic RS (2 h/day for 1, 2, 3, or 4 weeks). Body length from nose to rump (A). Relative hypothalamic Ins2

(B) and pituitary Gh (C) mRNA levels. Serum GH concentrations (D). Data are mean ± SEM,

Student’s t test, * p<0.05, ** p<0.01, *** p<0.001, n = 6–8 mice/group. (E–P) Lentiviral vector expressing GFP (empty vector, mock) or GFP and Ins2 (LV-insulin) was injected into the PVN of young mice. Four days after the injection, mice were exposed to chronic RS (2 h/day for 3 weeks). Relative hypothalamic Ins2 (E) and Crh (F) mRNA levels. Body length from nose to rump (G). Body weight (H). Accumulated food consumption (I). Relative pituitary Gh mRNA levels (J). Serum GH concentrations (K). Relative pituitary Pit-1 mRNA levels (L). Relative hypothalamic Ghrh (M) and Sst (N) mRNA levels. Serum corticosterone (O) and insulin (P) concentrations. Data are mean ± SEM, two-way ANOVA with Bonferroni post-hoc tests, * and

# p<0.05, **, ##, and $$ p<0.01, ***, ###, and $$$ p<0.001, n = 5–8 mice/group. *, **, and *** indicate significance of the differences between mock mice under no stress (mock - No RS) and mock mice exposed to chronic RS (mock - Chronic RS). #, ##, and ### indicate significance of the differences between mock - Chronic RS and LV-insulin - Chronic RS mice.

$$ and $$$ indicate significance of the differences between LV-insulin - No RS and LV-insulin

- Chronic RS mice. Table 1. Primers used for qRT-PCR.

Product Gene Accession number Primer sequence length (bp)

NM_001185083 GTGACCTTCAGACCTTGGCACTG Ins2 NM_001185084 129 AGGCTGGGTAGTGGTGGGTCTAG NM_008387

NM_001278581

NM_001278582 GAACAGCCCCTGACTGAAAA

Pomc NM_001278583 248

NM_001278584 ACGTTGGGGTACACCTTCAC NM_008895

NM_011164 122 GAAGTGTGTTCCCAGCAGTC Prolactin NM_001163530 119 TGGCAGAGGCTGAACATTTTG

GAAGAGTGCCGTTTCTGCAT Fshβ NM_008045 150 AGGCAATCTTACGGTCTCGT

CTGTCAACGCAACTCTGGC Lhβ NM_008497 123 CAGGAGGCAAAGCAGCC

TGTGGACAGATCACTGCTTG Gh NM_008117 398 GCTGTTGGTGAAAATCCTGC

CATCTGGCTCCCACAACATCA Ghrh NM_010285 237 GATCCTCTCCCCTTGCTTGT

TGAGCAGGACGAGATGAGG Sst NM_009215 149 AGGTCTGGCTAGGACAACAA

GTGCCTTCCTGTCATTATGGA Pit-1 NM_008849 96 CAGGGTGTGGTCTGGAAACT

CTCTCTGGATCTCACCTTCCAC Crh NM_205769 150 CTAAATGCAGAATCGTTTTGGC

ATCACTGCCACCCAGAAGAC Gapdh NM_008084 181 ACACATTGGGGGTAGGAACA