Promotor: Prof. dr. Daisy Vanrompay

Laboratory of Immunology and Animal Biotechnology

Department of Animal Production

Faculty of Bioscience Engineering

Ghent University

Belgium

Dean: Prof. dr. ir. Guido Van Huylenbroeck

Rector: Prof. dr. Anne De Paepe

Kristien DE PUYSSELEYR

Development and implementation of novel diagnostic tests for epidemiological and zoonotic research on Chlamydia suis

Thesis submitted in fulfillment of the requirements for the degree of Doctor (PhD) in Applied Biological Sciences

Nederlandse vertaling titel: Ontwikkeling en implementatie van diagnostische testen voor epidemiologisch en zoönotisch onderzoek naar Chlamydia suis.

Refer to this thesis: De Puysseleyr, K. (2015). Development and implementation of novel diagnostic tests for epidemiological and zoonotic research on Chlamydia suis. PhD thesis, Ghent University, Ghent, Belgium

ISBN-nummer: 978-90-5989-796-0

The author and the promotor give the authorization to consult and to copy parts of this work for personal use only. Every other use is subject to copyright laws. Permission to reproduce any material contained in this work should be obtained from the author.

Members of the examination committee

Prof. dr. Anita Van Landschoot (Chairman) Department of Applied Biosciences Faculty of Bioscience Engineering Ghent University

Prof. dr. Nico Boon (Secretary) Department of Biochemical and Microbial Technology Faculty of Bioscience Engineering Ghent University

Prof. dr. Daisy Vanrompay(Promotor) Department of Animal Production Faculty of Bioscience Engineering Ghent University

Prof. dr. Eric Cox (Co-promotor) Department of Virology, Parasitology and Immunology Faculty of Veterinary Medicine Ghent University

Prof. dr. Frank Pasmans Department of Pathology, Bacteriology and Poultry Disease Faculty of Veterinary Medicine Ghent University

Prof. dr. Bruno Goddeeris Department of Biosystems Faculty of Bioscience Engineering KU Leuven

Department of Virology, Parasitology and Immunology Faculty of Veterinary Medicine Ghent University

Dr. ir. Joris Michiels Department of Applied Biosciences Faculty of Bioscience Engineering Ghent University

Dr. ir. Hein Imberechts Centrum voor onderzoek in Diergeneeskunde en Agrochemie CODA-CERVA Brussel

Table of contents I

Table of Contents

Table of Contents ...... I Abbreviations ...... V Study Objectives ...... 1 Chapter I. Chlamydial infection biology ...... 3 1. Introduction ...... 5 2. History ...... 5 3. Taxonomy ...... 6 4. Developmental cycle ...... 10 5. Chlamydial effector proteins ...... 12 6. The Chlamydial Outer Membrane Complex (COMC) ...... 12 7. Chlamydia suis infections in pigs ...... 17 7.1. Chlamydiaceae species ...... 17 7.2. Diagnosis of C. suis ...... 18 7.2.1. Culture ...... 18 7.2.2. Immunoassays ...... 19 7.2.3. Serology ...... 19 7.2.4. Immunohistochemistry ...... 20 7.2.5. Molecular diagnosis ...... 21

7.3. Epidemiology ...... 22 7.3.1. Seroprevalence ...... 22 7.3.2. Molecular diagnosis ...... 23

7.4. Pathogenesis ...... 24 7.4.1. Experimental infections ...... 24 7.4.2. Field studies ...... 26

7.5. Antibiotic resistance ...... 27 7.5.1. Persistence ...... 29 7.5.2. Diagnostic considerations ...... 29 7.5.3. Probiotics and vaccination ...... 30

7.6. Zoonosis ...... 31

II Table of contents

Chapter II. Development and validation of a real-time PCR for Chlamydia suis diagnosis in swine and humans ...... 33 Abstract ...... 34 1. Introduction ...... 35 2. Materials and methods ...... 36 2.1. Bacterial cultures ...... 36 2.2. DNA extraction ...... 36 2.3. Primers and probes ...... 36 2.4. Inhibition control plasmid ...... 38 2.5. Species-specific real-time PCR ...... 38 2.6. Detection limit and specificity ...... 39 2.7. Case studies ...... 40 2.7.1. Pig farms ...... 40 2.7.2. Slaughterhouse employees ...... 41

3. Results ...... 42 3.1. Primers and probes ...... 42 3.2. Internal inhibition control ...... 42 3.3. Species-specific real-time PCR ...... 43 3.4. Case studies ...... 44 3.4.1. Pig farms ...... 44 3.4.2. Slaughterhouse employees ...... 44

4. Discussion ...... 45 Chapter III. Evaluation of the presence and zoonotic transmission of Chlamydia suis in a pig slaughterhouse ...... 49 Abstract ...... 50 1. Introduction ...... 51 2. Materials and Methods ...... 52 2.1. Sampling of pigs and humans ...... 52 2.2. Sampling of air and contact surfaces ...... 52 2.3. DNA extraction ...... 53 2.4. Chlamydia suis PCR ...... 53 2.5. Chlamydia trachomatis PCR ...... 53 2.6. Culture ...... 54 2.7. Molecular characterization of Chlamydia isolates...... 54 2.8. Tet(C) PCR ...... 54 Table of contents III

3. Results ...... 55 3.1. Chlamydia suis in pigs ...... 55 3.2. Chlamydia suis and Chlamydia trachomatis in humans ...... 55 3.3. Chlamydia suis on contact surfaces ...... 57 3.4. Chlamydia suis bioaerosol monitoring ...... 58 4. Discussion ...... 59 Chapter IV. Identification of specific and antigenic epitopes for serodiagnosis of Chlamydia suis ...... 61 Abstract ...... 62 1. Introduction ...... 63 2. Materials and Methods ...... 65 2.1. Bacterial strains ...... 65 2.2. Pig sera ...... 65 2.3. Selection of the peptides ...... 66 2.3.1. ProteinA ...... 66 2.3.2. ProteinB and ProteinC ...... 67 2.3.3. Pin ELISA...... 68

3. Results ...... 69 3.1. In silico selection of C. suis specific peptides ...... 69 3.1.1. ProteinA ...... 69 3.1.2. ProteinB ...... 69 3.1.3. ProteinC ...... 69 3.1.4. In vitro selection of a ProteinA ...... 70 3.1.5. Specificity testing of PeptideB and C with experimental sera ...... 70 3.1.6. Validation of the Peptide A and B antigens ...... 71

4. Discussion ...... 73 Chapter V. General discussion and perspectives ...... 77 Summary ...... 91 Samenvatting ...... 93 References ...... 97 Curriculum Vitae ...... 129

Abbreviations V

Abbreviations ABTS 2,2’-Azino-di(3-ethylbenzthiazoline-6-sulfonate) AT Array TubeTM ATCC American Type Culture Collection ATP Adenosine tri-phosphate BGM Buffalo Green Monkey BSA Bovine Serum Albumin BLAST Basic Local Alignment Search Tool CaCo Human Colonic Adenocarcinoma Cell C. Chlamydia CFT Complement Fixation Test COMC Chlamydia Outer Membrane Complex Cp. Chlamydophila CRP Cystein Rich Protein Ct Threshold cycle CT rMOMP C. trachomatis recombinant MOMP DNA Deoxyribonucleic acid E. Escherichia EB Elementary Body FAM 6-carboxyfluoresceine FCS Fetal Calf Serum FITC Fluorescein Isothiocyanate ELISA Enzyme-linked Immunosorbent Assay GlcN Glucosamine HEX Hexachlorofluoresceine HRP Horseradish Peroxidase Hsp Heat shock protein IB Intermediate Body IFN Interferon Ig Immunoglobuline IHA Indirect Haemagglutination Assay IM Inner Membrane Kdo 3-deoxy-D-manno-oct-2-ulopyranosonic acids LGV Lymphogranuloma venereum VI Abbreviations

LPS Lipopolysaccharide MEM Minimal Essential Medium MIC Minimal Inhibitory Concentration MIF Micro Immunofluorescence MLST Multi Locus Sequence Typing MOMP Major Outer Membrane Protein mRNA messenger RNA NAAT Nucleic Acid Amplification Test OD Optical Density OEA Ovine Enzootic Abortion OM Outer Membrane Omc Outer membrane complex protein Omp Outer membrane protein PBS Phosphate Buffered Saline PCR Polymerase Chain Reaction PCV-2 Porcine Circovirus type 2 PD Passenger Domain Pmp Polymorphic outer membrane protein PRRSV Porcine Reproductive and Respiratory Syndrome Virus RB Reticulate Body RNA Ribonucleic Acid rRNA ribosomal RNA SDS Sodium Dodecyl Sulfate SNP Single Nucleotide Polymorphism SPF Specific Pathogen Free SPG Sucrose Phosphate Glutamate Buffer ST Sequence Type TAMRA Carboxytetramethylrhodamine Tc Tetracycline TcR Tetracycline Resistant TcS Tetracycline Sensitive tRNA transfer RNA Tc Tetracycline T3SS Type III Secretion System Abbreviations VII

UNG Uracil N-glycosylase WHO World Health Organization

Study objectives 1

Study Objectives

Chlamydia suis is considered to be endemic in commercial pigs and causes important economic losses in pig production (Schautteet and Vanrompay 2011a). Its primary pathogenicity is proven by several experimental infections in gnotobiotic pigs (Rogers et al. 1996;|Rogers et al. 1996}; Rogers and Andersen 1999, 2000; Reinhold et al. 2. 2009b; Pospischil et al. 2009b; Reinhold et al. 2010). Porcine chlamydial infections are not always associated with clinical symptoms, but if so, they lead to important economical losses due to arthritis, pericarditis, polyserositis, pneumonia, conjunctivitis, enteritis, diarrhea and reproductive failure (Willigan and Beamer 1955; Sarma et al. 1983; Woollen et al. 1990; Zahn et al. 1995; Andersen and Rogers 1998; Eggemann et al. 2000). Chlamydiae are generally highly sensitive to the relatively inexpensive Tc antibiotics. However, tetracycline resistant (TcR) Chlamydia suis strains have been appearing in the U.S. and European pig industry (Andersen and Rogers 1998; Di Francesco et al. 2008; Borel et al. 2012; Schautteet et al. 2013). The use of Tc antibiotics as treatment of chlamydial infections in pigs, leads to selection for resistant strains (Borel et al. 2012). Consequently, the emergence of TcR strains requires treatment with other, more expensive antibiotics and, may become economically devastating to pig production. Besides the economical consequences, TcR Chlamydia suis strains pose an additional risk for human health. Chlamydia suis is phylogenetically closely related to the human pathogenic species Chlamydia trachomatis (Everett et al. 1999b) and is, for this reason, believed to be a zoonotic bacteria. If zoonotic transmission really occurs, human patients may be co-infected with TcR Chlamydia suis and TcS Chlamydia trachomatis bacteria, providing the ideal environment for transfer of the resistance gene. Tetracycline treatment of these patients will even further enchance the emergence and spread of TcR Chlamydia trachomatis strains, endangering the treatment of millions of people worldwide (Mabey 2008; WHO 2008). Monitoring the spread of TcR Chlamydia suis into commercial pigs and the zoonotic transmission to humans is therefore needed to assess the associated risk and to decide on the appropriate measures. For this purpose, reliable Chlamydia suis-specific molecular and serological tests to detect Chlamydia suis bacteria in animal and human specimen, are indispensable. Although several efforts have been made during the last 15 years, a reliable molecular diagnostic test, able to specifically detect Chlamydia suis in both animal and human samples was unavailable. Therefore, the first aim of this thesis was the development of a sensitive and specific Chlamydia suis real-time PCR to examine clinical samples of both pigs and humans, suitable to be applied on a large scale basis. We targeted 2 Study objectives the 23S rRNA gene for its highly discriminatory sequences and used a labeled probe to further improve species specificity.

Although the zoonotic potential of Chlamydia suis is likely, no former studies addressed the transmission risk to humans in close contact with pigs. Therefore, the second aim of this thesis was to examine zoonotic transmission of Chlamydia suis in a pig slaughterhouse, considered to be a risk environment for transfer. Animals, slaughterhouse employees, air and potentially contaminated contact surfaces were sampled and diagnosed for TcR Chlamydia suis. Additionally, the human volunteers were examined for Chlamydia trachomatis, to detect co-infections, and questioned for the appearance of clinical symptoms.

Although DNA-based methods can provide fast detection of viable C. suis bacteria in animal or human samples, the presence of these specimens might still be the result of contamination. In contrast to nucleic acid amplification assays, serological tests to detect the presence of anti- C. suis antibodies are able to actually prove the presence of an immunological response and thus an infection. Unfortunately, at present, no assay for C. suis specific serodiagnosis is available. Therefore, the third aim of this thesis was the identification of an antigenic and C. suis specific peptide epitope for a serological test using three candidate proteins, selected based on a literature overview of the knowledge obtained from other species.

Chapter I

Chlamydial Infection Biology

Chlamydial infection biology 5

1. Introduction

Members of the family of the Chlamydiaceae are obligate intracellular pathogens that cause a broad range of diseases in man, other mammals and birds. Chlamydia (C.) trachomatis and C. pneumoniae are the most established species in humans. Chlamydia trachomatis is the leading cause of infectious blindness and sexually transmitted disease and is believed to be linked to cardiovascular disease (Schachter 1999). Chlamydia pneumoniae is responsible for ten percent of the pneumonia and five percent of bronchitis and sinusitis cases in adults. Moreover, chronic infection could contribute to atherosclerosis (Belland et al. 2004; Campbell and Kuo 2004). The most common chlamydial species infecting animals are C. suis (pigs), C. abortus (sheep and goats), C. psittaci (birds) and C. pecorum (mammals). These infections can result in conjunctivitis, cardiovascular or systemic disease, abortion, infertility, enteritis, encephalitis, arthritis or respiratory disease (Everett 2000; Longbottom and Coulter 2003).

2. History

Jacob Ritter was the first to link multiple cases of pneumonia to the prior exposure of the patients to tropical pet birds in Switzerland (Ritter 1880). After a new outbreak in Paris three years later, the disease was named ‘psittacosis’, after ‘psittakos’ the Greek word for parrot, since these animals were the source of infection (Morange 1895). Several pandemic outbrakes of human psittacosis occurred between 1929 and 1930. The first chlamydial infections in domestic mammals were described in 1936 subsequent to abortions in sheep in Schotland although at the time, the abortions were considered to be the result of environmental factors (Greig 1936). Only in 1950, it was demonstrated that these abortions were the result of an infectious disease caused by an organism of the psittacosis group (Stamp et al. 1950). Chamydial organisms were described for the first time by Halberstaedter & von Prowazek in 1907 when they described intracytoplasmatic inclusions containing large numbers of micro- organisms in human conjuncitval epithelial cells derived from human patients with trachoma, and from orang-utans inoculated with material from trachoma cases. Considered to be protozoa, those micro-organisms were named ‘Chlamydozoa’ after the Greek word ‘Chlamys’ for mantle. In 1930, Bedson & Western isolated small basophile particles from blood and tissues of infected birds and humans during an outbreak of human psittacosis. That same year, the causative agent of Lymphogranuloma venereum (LGV) was isolated from human tissue (Hellerström and Wassén 1930). Since these particles were not restrained by bacterial filters 6 Chapter I and could not be cultured on artificial media, they were classified as viruses in the psittacosis- LGV group. Two years later, the complicated developmental cycle was described for the first time when Bedson and Bland (1932) identified the reticulate body, additionally to the previously described elementary body. Still, these pathogens were considered to be viruses because of their obligate intracellular life style. Because of their multiplication through binary fission, Bedson & Gostling (1954) considered these ‘obligate intracellular parasites with bacterial affinities’ more related to Rickettsiae than to bacteria. The development of electron microscopy and cell culture (1965) facilitated the clarification of the true nature of these pathogens. Because of their distinct developmental cycle, the presence of both DNA and RNA, the structure of the cell wall and their sensitivity for antibiotics, the Chlamydiaceae were finally classified as Gram-negative bacteria (Moulder 1966).

3. Taxonomy

Till 1999, the order of the Chlamydiales contained one family, the Chlamydiaceae, with only one genus, Chlamydia, consisting of four species, Chlamydia (C.) trachomatis, C. psittaci, C. pneumoniae and C pecorum. Everett et al. (1999a) proposed a new classification based on phylogenetic analyses of the 16S and 23S ribosomal RNA (rRNA) genes and genetical, morphological and phenotypical information (Figure I-1). The family of the Chlamydiaceae were divided into two genera, Chlamydia and Chlamydophila, comprising nine species. The genus Chlamydia contained Chlamydia (C.) muridarum, C. suis and C. trachomatis. The genus Chlamydophila comprised Chlamydophila (Cp.) psittaci, Cp. pecorum and Cp. pneumoniae. Additionally, three new Chlamydophila species were derived from Cp. psittaci, namely Cp. abortus, Cp. caviae and Cp. felis (Everett et al. 1999a). Moreover, the order of the Chlamydiales was expanded with three additional families (Parachlamydiaceae, Simkaniaceae, Waddliaceae). Chlamydial infection biology 7

Figure I- 1 Phylogenetic classification of the order Chlamydiales as proposed by Everett et al. (1999a). Trees were constructed using full-length 23S rRNA genes. Branch lengths are measured in nucleotide substitutions and the numbers represent the percentage of time each branch was found in 1000 bootstrap replicates (no value shown if <50%).

All organisms within the order Chlamydiales are Gram-negative, obligate intracellular bacteria with a unique biphasic developmental cycle of replication, sharing more than 80% of 16S and 23S rRNA sequence identity (Everett et al. 1999a). Phylogenetic analysis based on the ompA gene, the groEL chaperonin, small and large (60-kDa) cysteine-rich lipoprotein and the KDO transferase, confirmed the separation in two genera (Bush and Everett 2001). Since the introduction of the classification, the order of the Chlamydiales was further expanded with four new families of Chlamydia-like bacteria (Piscichlamydiaceae, Clavochlamydiaceae, Rabdochlamydiaceae and Criblamydiaceae) (Horn 2008). These families will not be discussed further. Although the new classification generally seems relevant in terms of host range, disease symptoms and virulence, and provides easy tools for identifying new strains, the separation of the Chlamydiaceae family into the genera Chlamydia and Chlamydophila was controversial (Everett and Andersen 2001; Schachter et al. 2001). In 2010, the taxonomy has changed again and all nine species now belong to the single genus of Chlamydia (Table I-1) (Greub 2010a, 2010b). Recently, Sachse et al. proposed the addition of two new species to the current classification: Chlamydia avium sp. nov. comprising strains from pigeons and psittacine birds and Chlamydia gallinacea sp. nov. comprising strains from poultry. Evidence for the 8 Chapter I existence for two new members of the family Chlamydiaceae was obtained from phylogenetic analysis of ribosomal RNA and ompA genes, as well as multi-locus sequence analysis (Sachse et al. 2014). Figure I-2 shows the phylogenetic classification of the Chlamydiaceae, including the two new species, based on almost complete 16S rRNA sequences.

Table I- 1 Members of the family Chlamydiaceae [according to Greub (Greub 2010a, 2010b). Adapted from Kerr et al. (2005)

Species Host Clinical signs Chronic conjunctivitis and blindness (trachoma) Chlamydia trachomatis Humans Sexually transmitted disease (STD) Infection of the urogenital tract, infertility

Mice Respiratory tract infection Chlamydia muridarum Hamsters Genital tract infection

Diarrhea, pneumonia, conjunctivitis, reproductive Chlamydia suis b Pigs disorders

Humans Pneumonia, bronchitis, encephalomyelitis, laryngitis, Chlamydia pneumoniae Koala atherosclerosis, reactive arthritis

Chlamydia psittaci a Birds Respiratory tract infection

Chicken Chlamydia gallinaceaeb Guinea fowl Respiratory tract infection Turkey

Pigeons Chlamydia aviumb Respiratory tract infection Psittacine birds

Ruminants Reproductive disorders, abortion and bad semen Chlamydia abortus a Pigs quality

Reproductive disorders, infertility, infection of the Ruminants urine tract (koala) and abortion, enteritis, polyarthritis, Chlamydia pecorum Pigs encephomyelitis, metritis, conjunctivitis and Koala pneumonia (other animals)

Chlamydia felis b Cats Conjunctivitis and respiratory tract infection

Chlamydia caviae b Guinea pigs Ocular and urogenital tract infection a Zoonotic pathogen b Potential Zoonotic pathogen

Chlamydial infection biology 9

Figure I- 2 Phylogenetic reconstruction of the Chlamydiaceae classification, including the two new species C. avium and C. gallinaceae based on the alignment of almost complete 16S rRNA genes. The numbers on the nodes indicate the bootstrap support of each branch after 100 replicates. The bar indicates 1% sequence divergence. Adapted from Sachse et al. (2014)

10 Chapter I

4. Developmental cycle

Chlamydiaceae are obligate intracellular bacteria and are completely depending on host epithelial cells for their intracellular survival and growth. Therefore, Chlamydiaceae have a unique biphasic replication characterized by two distinct morphological forms (Figure I-3). The infectious elementary bodies (EBs) are small, 0.2 to 0.3 µm electron dense structures adapted to survive up to several months in the hostile extracellular environment (Longbottom and Coulter 2003). Upon internalization in cytoplasmatic inclusions, EBs transform to the metabolically active form, called reticulate bodies (RBs), and replicate by binary fission. RBs have a diameter of 0.5 to 1.6 µm and are non-infectious (Newhall and Jones 1983; Ward 1988).

Figure I-3 Schematic representation of the developmental cycle of the Chlamydiaceae. Numbers refer to hours post infection or inoculation, though the timing of the different stages in the cycle varies depending on the chlamydial species and the host cell (Geens 2005).

Chlamydial infection biology 11

Attachment of the EB to the eukaryotic cell surface forms the start of the acute infection. Binding preferentially occurs at surface microvilli. Since the base of the microvilli are areas of active transport of extracellular materials into the host cells, attachment to these sites might enable a rapid and efficient entry (Escalante-Ochoa et al. 1998). Upon binding, EBs are internalized in tight, endocytic vesicles, called inclusions. There is currently no general convention on the mechanism of attachment and entry since several conflicting mechanisms have been described, including receptor-mediated endocytosis in clathrin-coated pits (Wyrick et al. 1989), pinocytosis in non-clathrin-coated pits (Prain and Pearce 1989) and microfilament dependent phagocytosis (Byrne & Moulder, 1978; Ward & Murray, 1984). The newly formed inclusions efficiently escape fusion with cellular lysosomes and EBs start to differentiate into RBs two hours post infection. These RBs move towards the periphery of the inclusion and start replication from 8 h post infection on. Active replication through binary fission continues until RBs detach from the inclusion membrane and consequently revert into EBs again. EBs are stored in the lumen of the inclusion until they are released from the host cell at 48 to 72 h post infection through lysis or reversed endocytosis. The exact length of the developmental cycle is species dependent. During maturation from RBs to EBs, morphologically intermediate bodies (IBs) can be observed in the host cell. These IBs have a diameter of 0.3 to 1.0 µm and are able to infect host cells in vitro (Litwin et al. 1961; Costerton et al. 1976; Vanrompay et al. 1996). Alternatively, the normal developmental cycle can be interrupted and bacteria survive in an atypical, intracellular and metabolically less active state inside the host cell. This form of chronic infection is known as persistence and can be induced by nutritional deficiencies, antibiotic pressure, cytokines and environmental changes due to hormonal fluctuations. Thus, bacteria residing inside the host cell are partially protected from host-defense mechanisms and antibiotic therapy (Mpiga and Ravaoarinoro 2006). Once the inducing factor is removed, persistent bodies revert to normal RBs and generate infectious EBs.

12 Chapter I

5. Chlamydial effector proteins

Members of the Chlamydiales encode a Type III secretion system (T3SS) (Hsia et al. 1997). This efficient molecular syringe is essential for its entrance, growth and survival in eukaryotic host cells through transport of effector proteins to the host cell cytoplasm. The number of secreted anti-host proteins is estimated at 80 for C. trachomatis (Betts et al. 2009), although the exact function of many proteins remains to be uncovered. Within minutes upon attachment of EBs, the T3SS translocates already produced effector proteins to the host cytoplasm, including Tarp for Translocated Actin-Recruiting Phosphoprotein. This protein is spatially and temporarily associated with the recruitment of actin at the site of internalization (Clifton et al. 2004). The formation of an actin-rich pedestal underneath the attachment site eventually leads to the uptake of EBs into membrane-bound vesicles (Carabeo et al. 2002; Coombes and Mahony 2002; Subtil et al. 2004; Beeckman et al. 2007). The Tarp-mediated actin polymerization is not simply the result of a stable association between Tarp and actin but is more complex, involving multiple domains of Tarp (Jewett et al. 2006).

6. The Chlamydial Outer Membrane Complex (COMC)

Like all Gram-negative bacteria, Chlamydiaceae are surrounded by an outer membrane (OM) and a cytoplasmatic inner membrane (IM), separated by a periplasmic space (Figure I-4). The EB outer membrane contains phopholipids, lipids, lipopolysaccharides (LPS) and proteins. The strength of the Gram-negative cell wall is usually provided by peptidoglycan, covalently bound to lipoproteins. Typically, this part of the membrane is insoluble in sarkosyl, an ionic detergent. The Chlamydiaceae cell wall contains only a small amount of structural peptidoglycan, but, derives its strength from crosslinks formed between the sulphur atoms of sulphur amino acid rich proteins in the outer envelope (Moulder 1993; Hatch 1996). Still, a part of their cell wall is also insoluble in sarkosyl and this fraction is called the ‘Chlamydia Outer Membrane Complex’ (COMC). This protein complex predominantly consists of MOMP, two cystein rich proteins (CRP), EnvA or OmcA and EnvB or OmcB, and the polymorphic membrane proteins (Pmps) (Hatch et al. 1984; Sardinia et al. 1988; Stephens and Lammel 2001). Besides, the outer membrane also contains the proteins PorB, Omp85, OprB, heat shock proteins hsp60 and hsp70, CTL 0541, CTL0648, CTL0887 and Pal. The proteins of major importance will be discussed in more detail.

Chlamydial infection biology 13

Outer membrane

Periplasm

Inner membrane

Figure I-4 Schematic representation of the chlamydial EB double membrane. In the outer membrane, MOMP, both CRP and the Pmps are represented. Adapted from Hatch (1996).

The Major Outer Membrane Protein (MOMP) is a cystein-rich protein with a molecular weight of approximately 40 kDa. About 60% of the EB outer membrane and almost 100% of the RB is covered by MOMP (Hatch and McClarty 1998). This protein is important for the maintenance of the structural rigidity of the EB and functions as an adhesion, mediating nonspecific interactions with host cells (Su et al. 1990). After reduction of disulphide bonds, MOMP can also function as a porin for nutrient uptake. The MOMP protein is encoded by the ompA gene and contains five conserved domains (CS1-CS5) with in between four variable domains (VSI – VSIV) which are localized at the outside of the bacterial membrane (Figure I- 5) (Stephens et al. 1987; Baehr et al. 1988a; Yuan et al. 1989). MOMP is an immunodominant protein and contains genus-, species- and serovar-specific epitopes (Caldwell et al. 1981). Moreover, mono- and polyclonal antibodies against MOMP are able to neutralize Chlamydiaceae infections both in vitro and in vivo (Caldwell and Perry 1982; Zhang et al. 1987). Therefore, MOMP is an interesting candidate for selection of both family- and species-specific antigens. 14 Chapter I

Figure I-5 Model of the positioning of the MOMP protein in the outer membrane of the chlamydial cell wall. The conserved regions are represented as full lines and localized inside the outer membrane. The alternating lines represent the surface-exposed variable domains I to IV. Adapted from (Baehr et al. 1988b) (Kim and DeMars 2001).

The second most abundant proteins in the EB outer membrane complex, OmcA and OmcB, are hardly present in RBs (Newhall 1987; Everett and Hatch 1995; Sanchez-Campillo et al. 1999; Watts and Kennedy 1999). Both proteins are highly immunogenic and contain many conserved cysteine residues. OmcA, also known as ‘outer membrane protein 3’ (Omp3) or EnvA, is a lipoprotein with a molecular weight ranging from 9 kDa in C. trachomatis to 12 kDa in C. psittaci. The OmcA protein is probably inserted into the outer membrane, considering the presence of the signal peptide (Everett and Hatch 1991). OmcB, also known as ‘outer membrane protein 2’ (Omp2) or EnvB, is a Chlamydiaceae- specific protein that can be used as a marker for chlamydial infections (Sanchez-Campillo et al. 1999). This 60 kDa protein contains genus-specific epitopes and its sequence is highly conserved, suggesting a crucial function in the chlamydial life cycle (Watson et al. 1989; de la Maza et al. 1991). In contrast to C. trachomatis serovar E and C. psittaci 6BC, the OmcB protein of C. trachomatis LGV1 is surface exposed and functions as an adhesin (Watson et al. 1994; Everett and Hatch 1995; Stephens and Lammel 2001; Fadel and Eley 2007, 2008). Polymorphic membrane proteins or Pmps are unique to Chlamydiales and were first discovered at the surface of C. abortus S26/3 (Longbottom et al. 1996). The number of Pmp genes varies from nine for C. trachomatis (Stephens et al. 1998) to 21 for C. pneumoniae (Kalman et al. 1999) and phylogentic analysis indicated the existence of six subfamilies (A, B/C, D, H, E/F and G/I) (Grimwood and Stephens 1999). Table I-2 gives an overview of the number of Pmp genes and the associated nomenclature for each chlamydial species, which is Chlamydial infection biology 15 based on the subfamily to which the protein belongs. All Pmp proteins are heterogeneous, both in amino acid sequence and in predicted size. The Pmps typically are rich in serine residues and contain multiple GGAI and FxxN motifs, repeated in the N-terminal half of each protein. These proteins resemble classical autotransporter proteins, with an N-terminal leader sequence for sec-dependent translocation across the membrane and a C-terminal β-barrel domain with a phenylalanine residue at the end, suggestive for their outer membrane localization. The central passenger domain (PD) is responsible for the protein's function and can remain surface-localized or be secreted (Henderson and Lam 2001; Dautin and Bernstein 2007). Yet, it remains unclear if all Pmp genes are expressed and appear in the outer membrane (Grimwood et al. 2001; Tanzer et al. 2001). The existence of six Pmp subfamilies proposes at least six different functions, most likely in chlamydial virulence (Henderson and Lam 2001). Although specific roles have been described for only some Pmps, they are generally responsible for avoidance of the immune response while maximizing virulence (Tanzer et al. 2001; Tan et al. 2006).

Table I-2 Overview of the number and associated nomenclature of the Pmp genes present in the different chlamydial species. (Tan et al. 2006)

Species Number of Pmp genes Nomenclature

Chlamydia trachomatis 9 A to I

Chlamydia suis 9 A to I

Chlamydia psittaci 21 An, Bn, Dn, En, Hn, Gn

Chlamydia abortus 18 An, Bn, Dn, En, Hn, Gn

Chlamydia pneumoniae 21 An, Bn, Dn, En, Hn, Gn

Chlamydia caviae 17 An, Bn, Dn, En, Hn, Gn

Chlamydia felis 12 An, Bn, Dn, En, Hn, Gn

Chlamydia pecorum 15 An, Bn, Dn, En, Hn, Gn

Chlamydia muridarum 9 A to I n represents a number

16 Chapter I

PorB or OmpB is a 37 kDa, cystein-rich protein, expressed in very low amounts and present in the outer membrane of EBs. The sequence is highly conserved among chlamydial strains and the protein probably functions as a substrate-specific porin, providing chlamydiae with dicarboxylic acids to compensate for the incomplete tricarboxylic acid cycle (Iliffe-Lee and McClarty 2000; Kubo and Stephens 2001). PorB-specific antibodies have neutralizing activity and where first discovered in human sera (Sanchez-Campillo et al. 1999). Omp85 is a highly conserved outer membrane protein and widely present in a wide range of Gram-negative bacteria and mitochondria. Omp85 is generally considered to be essential for cell viability and is involved in insertion of lipids and proteins into the bacterial outer membrane (Genevrois et al. 2003; Voulhoux et al. 2003). Omp85-specific antibodies neutralize chlamydial infections in vitro (Stephens and Lammel 2001). The chlamydial lipopolysaccharide (LPS) is present on both EBs and RBs and is a major antigenic component. This 10 kDa molecule has a lipid A part, containing two glucosamines (GlcN) bound to fatty acids, and contains a specific tri-saccharide of 3-deoxy-D-manno-oct-2- ulopyranosonic acids (Kdo). Two of this Kdo residues are linked through a 2 → 8 linkage and this structure is unique for Chlamydiaceae (Brade et al. 1987). Heat shock proteins (Hsps) are present in the COMC of both EBs and RBs, and are considered to play an important role in chlamydial immunopathology (Zhong and Brunham 1992). So far, the Hsp10, Hsp60 and Hsp70 proteins have been identified for Chlamydia (Kornak et al. 1991; Brunham and Peeling 1994). These proteins are structurally alike and highly conserved within chlamydial species. Moreover, Hsps are homologous to GroEL (Hsp60) and DnaK (Hsp70) of Escherichia (E.) coli and human mitochondria, with up to 50% protein sequence identity (Brunham and Peeling 1994). Chlamydial infection biology 17

7. Chlamydia suis infections in pigs

7.1. Chlamydiaceae species

To date, four chlamydial species are regularly observed in pigs: C. suis, C. abortus, C. pecorum and C. psittaci (Schautteet and Vanrompay 2011). Chlamydia psittaci primarily infects birds and these infections are often systemic and can be inapparent, severe, acute or chronic. Bacteria are mainly spread between birds by inhalation of contaminated aerosols, but transfer can also occur vertically, through the egg. Chlamydia psittaci has also been isolated from lungs and the genital tract of pigs (Busch et al. 2000; Vanrompay et al. 2004) and is transmissible to humans. Clinical signs of human infections vary from mild flu-like symptoms to severe pneumonia (Beeckman and Vanrompay 2009). The reference strain for C. psittaci is 6BCT (=ATCC VR 125T). Chlamydia pecorum is a serologically and pathogenically diverse species and strains have been isolated from different mammal hosts including ruminants (cattle, sheep, goats) (Fukushi and Hirai 1992), koalas (Girjes et al. 1993) and swine (Kaltenboeck and Storz 1992; Anderson et al. 1996). Symptoms of infections range from reproductive disease, infertility and urinary tract disease to abortion, conjunctivitis, encephalomyelitis, enteritis, pneumonia and polyarthritis (Fukushi and Hirai 1992; Kaltenboeck and Storz 1992; Girjes et al. 1993; Anderson et al. 1996). The reference strain for C. pecorum is E58T (=ATCC VR 628T). Chlamydia abortus is the most common cause of infectious abortion in sheep, also known as ovine enzootic abortion (OEA), in Europe, resulting in major economic losses in agriculture (Kerr et al. 2005). This species is endemic among ruminants, efficiently colonizing the placenta, but, can also infect swine, horses, rabbits, guinea pigs and mice (Everett et al. 1999a; Longbottom and Coulter 2003). Moreover, miscarriages and stillbirths due to zoonotic C. abortus infections have been observed in woman who work with sheep (Johnson et al. 1985; Wong et al. 1985; Herring et al. 1987; Janssen et al. 2006) and goats (Villemonteix et al. 1990; Pospischil et al. 2002a; Meijer et al. 2004b). The reference strain for C. abortus is B577T (= ATCC VR 656T). Chlamydia suis is the most prevalent member of the Chlamydiacea occurring in pigs, which are the only confirmed natural hosts for this species (Schautteet and Vanrompay 2011). Its primary pathogenicity is proven by several experimental infections in gnotobiotic and conventionally raised pigs (Rogers and Andersen 1996; Rogers et al. 1996; Rogers and Andersen 1999; Reinhold et al. 2008b; Reinhold et al. 2010; De Clercq et al. 2014). Chlamydia suis seems to be widespread and the incidence of apparently asymptomatic 18 Chapter I infections is high. However, C. suis infections are often also associated with conjunctivitis, enteritis, pneumonia and reproductive disorders (Rogers and Andersen 1996, 1999; Everett 2000; Schautteet and Vanrompay 2011). Recent reports demonstrate the involvement of C. suis in several cases of conjunctivitis in humans in Nepal, suggesting a zoonotic potential for this chlamydial species (Dean et al. 2013b).

7.2. Diagnosis of C. suis

Chlamydial infections can be diagnosed via direct detection of the bacteria or bacterial components, or via screening for Chlamydiaceae-specific antibodies produced by the host. The available tests vary markedly in terms of sensitivity and specificity, however, each plays an important role in diagnosis. The ultimately applied test is dependent on a number of factors, including (a) the type of sample, (b) the viability of the organisms in the specimen, depending on the preservation and transport of the sample, (c) a possible presumptive diagnosis based on clinical symptoms and pathology, and (d) the clinical history. The following section overviews the main techniques used for diagnosis of C. suis.

7.2.1. Culture Isolation of Chlamydiaceae in cell cultures is historically considered as the ‘gold standard’ for chlamydial diagnosis (Thejls et al. 1994). HeLa cells, derived from human cervical cancer, and McCoy cells, mouse fibroblasts, are predominantly used. In addition, Schiller et al. (2004) demonstrated that CaCo-2 cells, Human colonic adenocarcinoma, perform markedly better for isolation of C. suis, compared to African Green Monkey Kidney cells (Vero). In addition, Buffalo Green Monkey cells (BGM) are also regularly used for propagation of chlamydiae. However, culture of pig strains is problematic and its sensitivity is low. Therefore, a study was performed in our lab (unpublished results) to determine the growth characteristics of C. suis (strains S45, H7 and R24) on in six different cell lines [BGM, SK-6 (swine kidney), IPEC-J2 (jejunal epithelium), Vero, McCoy, Caco-2]. The preferred cell line appeared to be strain dependent, and thus adaption of the cell line used for isolation to the nature of the sample might be recommended. Moreover, other than the requirement for advanced facilities and expertise, the need for rapid and cooled transport of samples for efficient recovery of chlamydial pathogens, reduces the suitability of culture for chlamydial screening. Still, culture remains essential to demonstrate the viability of a field strain, to generate and characterize new isolates and to study pathogenesis (Sachse et al. 2009).

Chlamydial infection biology 19

7.2.2. Immunoassays Immunoassays for chlamydial antigen detection are not dependent on the viability of the bacteria and are easy to use. The vast majority of these tests is developed for detection of C. trachomatis infections in human clinical specimens and is based on the family-specific LPS antigen. Therefore, most of these assays should theoretically be suitable for detection of chlamydial infections in animals, however, the involved species cannot be identified. Immunoassays are available in different formats, including direct fluorescent antibody tests (DFA), plate-based ELISAs and solid-phase ELISAs [reviewed by Sachse et al. (2009)]. The main drawback is the varying sensitivity and specificity depending on the type of sample tested (Eggemann et al. 2000; Bagdonas et al. 2005). Therefore, many laboratories prefer serological methods or more specific and sensitive molecular approaches for detection of chlamydial infections in animals. The reference strain for C. suis is S45 (= ATCC VR 1474T).

7.2.3. Serology Confirmation of infections through detection of anti-chlamydial antibodies in animal sera has been widely used to estimate the prevalence of infection. Presence of an antibody response may be the result of a present or prior infection. Therefore, serology is less adequate to distinguish infected from vaccinated animals. Moreover, there is a lag period between the moment of infection and the appearance of an antibody response, with a minimum of one to two weeks. In addition, infected animals are often asymptomatic with low or borderline levels of antibodies (Longbottom and Coulter 2003) and sera of piglets may contain maternal antibodies. Thus, serology and infection status are not fully correlated, which can complicate the interpretation of the results. In addition, the antibody response may be highly variable within a pig population and is dependent of the age of the animal. Therefore, sampling of multiple animals in a herd, preferably of different age, is necessary to get a realistic idea of the infection prevalence in a farm. Sampling at different time points enables the detection of titer changes, and an increase of the antibody titer is a more accurate indication of infections. Variance within serological tests themselves or due to laboratory circumstances can be considerable, requiring the analysis of all samples in the same batch. However, serological tests have some important advantages, such as the relatively straight forward sample collection and transport and the timing of sampling being less critical. Inclusions, elementary bodies (EBs) or chlamydial antigens are generally used to capture anti- chlamydial antibodies. Subsequent detection of the bound antibodies is achieved by estimation of the consumption of complement, in a complement fixation test, or by use of 20 Chapter I labeled secondary antibodies. Fluorescent markers are widely used for antibody labeling, in indirect immunofluorescence and micro immunofluoresence (MIF) tests. Besides, also other tags, like the horseradish peroxidase enzyme in indirect ELISA tests, are available [reviewed by Sachse et al. (2009)]. Several serological assays were applied in order to determine the prevalence of Chlamydiaceae in pig sera. An LPS-based ELISA assay (Wittenbrink 1991) was used to estimate seroprevalence rates in German and Swiss pigs (Eggemann et al. 2000; Camenisch et al. 2004). Vanrompay et al. (2004) examined the Chlamydiaceae seroprevalence rate in Belgium with an ELISA based on the recombinant MOMP of an avian C. psittaci genotype D strain. The commercially marketed indirect haemagglutination assay (IHA kit; Lanzhou Veterinary Research Institute, Lanzhou, China) was used to study the prevalence of chlamydial infections in chinese pigs (Xu et al. 2010; Jiang et al. 2013; Zhang et al. 2014). Besides, also the LPS-based complement fixation test (CFT) is widely used to detect anti- chlamydial antibodies in pig sera (Szeredi et al. 1996; Bagdonas et al. 2005; Rypula et al. 2014a). However, these assays fail to identify the distinct chlamydial species occurring in swine. According to Di Francesco et al. (2006), the MIF test, using elementary bodies as antigens, is suitable to discern the involved chlamydial species. Nevertheless, recent studies raised serious doubts on the MIF test when applied for diagnosing human psittacosis (Verminnen et al. 2008). Moreover, results obtained by using chlamydial LPS or EBs should be interpreted with caution, since serological cross-reactions with antibodies against other pathogens may occur (Caldwell and Hitchcock 1984; Nurminen et al. 1984; Brade et al. 1987; Yuan et al. 1992). Although Hoezle et al. (2004) demonstrated the suitability of the entire MOMP protein of C. suis, C. abortus and C. pecorum to serologically identify the infecting chlamydial species in ELISA, no further efforts have been done to develop a species-specific MOMP-based assay. In fact, at present, no specific and sensitive assay is available for detection of antibodies produced in response to C. suis, the major species involved in chlamydial infections in swine.

7.2.4. Immunohistochemistry Immunohistochemical staining of histological sections with monoclonal antibodies directed against chlamydial surface antigens, such as LPS or MOMP, are commonly used to detect chlamydial species for diagnostic purposes, as well as for epidemiological and pathogenesis studies (Juvonen et al. 1997; Tsakos et al. 2001; Hotzel et al. 2004; Navarro et al. 2004; Borel Chlamydial infection biology 21 et al. 2006a; Borel et al. 2006b). The used monoclonal antibodies are directly conjugated with the enzyme horseradish peroxidase or detected using a fluorescein-conjugated secondary antibody. Labeling can be enhanced using the streptavidin-biotin method (Szeredi et al. 1996; Buxton et al. 2002). Immunohistochemical staining procedures can be automated and are routinely applied in many laboratories. However, poor tissue penetration of the primary antibody may impair the sensitivity. In addition, the specificity of immunohistochemical assays is often poor due to a relatively high background caused by nonspecific binding of the antibodies with proteins, such as collagen, or the presence of endogenous peroxidases or biotin. Moreover, quantification of the amount of antigen present is challenging and the reproducibility is often low.

7.2.5. Molecular diagnosis The introduction of molecular methods has considerably improved the sensitivity and specificity of the detection of chlamydiae. However, as a large number of PCR tests are currently in use, it is not always clear whether these tests have been properly validated (Sachse et al. 2009). For reasons of clarity, the following overview of available molecular diagnostic tests is therefore limited to the most relevant assays. Everett et al. (1999a) designed assays for amplification and sequencing of the 16S and 23S rRNA signature sequences. These assays are widely used and adapted to identify the involved chlamydial species (Becker et al. 2007; Englund et al. 2012; Di Francesco et al. 2013). Besides, also sequencing of the omp2 and ompA genes was applied for chlamydial species identification (Schiller et al. 1997a; Hoelzle et al. 2000; Kauffold et al. 2006). However, sequencing is time-consuming compared to other nucleic acid based tests, such as real-time PCR. Moreover, the sensitivity of the used assays is variable and sequencing is less attractive for large-scale studies. Therefore, other chlamydial species-specific nucleic acid amplification tests (NAATs) have been developed, which allow examination of the prevalence of chlamydiae in pigs. Sachse et al. (2005) designed a 23S rRNA gene based microarray hybridization assay for the identification of chlamydial species using the ArrayTubeTM (AT) platform (Clondiag Chip Technologies, Jena, Germany). This assay starts with a biotinylation-PCR, amplifying an 1-kbp segment of the rRNA operon. This initial PCR is not completely chlamydiae specific, since also E. coli DNA is amplified. The resulting amplicon is hybridized on a plastic tube-integrated microchip, containing 11 different probes. Detection is performed using the HRP-streptavidin conjugate, which enables signal amplification. Species identification is performed based on the obtained pattern of coloured spots. Borel et 22 Chapter I al. (2008) calculated the sensitivity of the AT micro array using an entire panel of human and animal clinical samples, including 5 human pharyngeal swabs and 4 tissues of naturally infected diseased pigs. The sensitivity of the AT micro array was slightly lower than a 23S rRNA based real-time PCR (Ehricht et al. 2006). Pantchev et al. (2010) developed six separate real-time PCR assays for detection of all chlamydial species of veterinary interest (C. psittaci, C. abortus, C. pecorum, C. caviae, C. felis and C. suis). The ompA gene appeared suitable for discrimination of all species, except for C. suis. Instead, the 23S rRNA gene seemed to be a more convenient target. However, this PCR assay was developed for the examination of veterinary samples and cannot distinguish C. suis from the genetically closely related human pathogen C. trachomatis. Schautteet et al. (2013) used real-time PCR assays based on the ompA and 16S rRNA genes for detection of C. abortus (Livingstone et al. 2009), C. psittaci (Geens et al. 2005) and C. pecorum (Wan et al. 2011) in pig samples.

7.3. Epidemiology

7.3.1. Seroprevalence Although, there is a large variation in reported prevalence, Chlamydiaceae are believed to be widespread in the pig population worldwide (Schautteet and Vanrompay 2011). The serological epidemiology of C. suis is largely unknown, partly due to the inability of the available tests to determine the involved chlamydial species. Therefore, the majority of available data reports the prevalence of Chlamydiaceae on family level. Nevertheless, chlamydial infections are highly abundant in European commercial pigs. In Germany, 33% to 72% of the sows and 10 to 47% of the boars produced Chlamydiaceae-specific antibodies (Eggemann et al. 2000). In Switzerland, seroprevalence rates were 62% for sows, 6.9% for piglets younger than four weeks and 48.1% for piglets older than four weeks (Camenisch et al. 2004). Moreover, 82.6% of the tested Swiss slaughter pig sera yielded positive anti- chlamydial reactions (Szeredi et al. 1996). Chlamydiaceae-specific antibodies were detected in 63.5 to 80.3% of Italian slaughter pigs (Di Francesco et al. 2006). Chlamydial infections seem also endemic in Belgian pigs, since 96.5% of the examined farms were seropositive for Chlamydiaceae (Vanrompay et al. 2004). Bagdonas et al (2005) found seroprevalence rates of only 7.7% in Lithuanian pigs. In poland, only 5.65% of the examined pigs were positive for Chlamydiaceae-specific antibodies (Rypula et al. 2014b). Studies of the Chlamydiaceae seroprevalence rates of pigs in the different provinces of China revealed a relatively high Chlamydial infection biology 23 prevalence of 62.7% for the Hunan province, 58.59% in Jiangxi and 30.78% for the Guangdong province (Xu et al. 2010; Jiang et al. 2013; Zhang et al. 2014). Moreover, Chlamydiaceae-specific antibodies were demonstrated in 63.6% of Italian, free-living boars, suggesting wild boar populations may be Chlamydia reservoirs (Di Francesco et al. 2011).

7.3.2. Molecular diagnosis Implementation of the recently developed species-specific NAATs revealed C. suis as the major species involved in chlamydial infections in swine. Becker et al. (2007) demonstrated a high prevalence of C. suis in the eyes of Swiss and German pigs without clinical symptoms (23-88%) or suffering from conjunctivitis (79-90%). Moreover, Di Francesco et al. (2013) detected C. suis in conjunctival swabs of wild boars in Italy. Chlamydia suis was involved in the vast majority of Belgian, German and Swiss pigs with chlamydial intestinal infections (Zahn et al. 1995; Szeredi et al. 1996; Schiller et al. 1997b). In Sweden, a high prevalence of C. suis was observed in growing pigs with or without diarrhea, and in slaughter pigs with or without conjunctivitis (Englund et al., 2012). Schautteet et al. (2013) demonstrated the presence of C. suis in the intestine and urogenital tract of Belgian, Cypryotic and Israelian sows suffering from reproductive disorders. Boar sperm may be the source of urogenital infections, since C. suis was found in boar semen of a German artificial insemination center, intended for export. The occurrence of C. suis in the urogenital tract was also confirmed in Polish pigs (Szymanska-Czerwinska et al. 2011). In Germany, mixed infections of C. suis and C. abortus were demonstrated in the lungs and intestines of pigs (Hoelzle et al. 2000). Similarly, C. psittaci and C. pecorum seem to be of lower significance although also C. pecorum DNA was found in boar sperm, fetuses and pig gut tissue (Thoma et al. 1997; Kauffold et al. 2006). Hotzel et al. (2004) demonstrated the presence of C. psittaci, C. abortus and C. suis in the lung tissue of a small population of wild boars in Thuringia (Germany), suggesting a possible wildlife reservoir of these bacteria.

24 Chapter I

7.4. Pathogenesis

7.4.1. Experimental infections At present, 25 C. suis strains are described in literature (Table I-3), and all are isolated from pigs with clinical disease, with the exception of S45, 130 and 132. The pathogenicity of C. suis has been confirmed by experimental infections of gnotobiotic pigs with R19 and R27 (intestinal lesions), R33 and DC6 (lung and nasal lesions) and H7 (conjunctivitis) (Rogers and Andersen 1996; Rogers et al. 1996; Rogers and Andersen 1999; Sachse et al. 2004; Reinhold et al. 2008b). Although the reference strain S45 was isolated from feces of an asymptomatic pig, experimental enteric infection of gnotobiotic piglets elicited significant enteric disease (Guscetti et al. 2009a). Interestingly, Pospischil et al. (2009a) observed aberrant C. suis developmental forms, indicative for a persistent infection in experimentally infected gnotobiotic pigs. Besides, administration of a C. psittaci isolate of pigeon origin (T49/90) resulted in a productive enteric infection with mild lesions, weak systemic dissemination, and fecal shedding, suggesting the pig as a potential host for avian Chlamydiaceae (Guscetti et al. 2000). The role of C. suis and C. abortus in reproductive problems is experimentally less studied, partly due to the ethical objections associated with experimental infections of Chlamydiaceae- negative sows, in different stages of gestation. Yet, De Clercq et al. (2014) demonstrated the pathogenicity of C. suis S45 for the pig female urogenital tract upon intravaginal infection. Chlamydia replication occurred throughout the urogenital tract, causing inflammation and pathology. Re-infection was characterized by less severe macroscopic lesions and less chlamydial elementary bodies and inclusions in the female reproductive tract. Inoculation of four sows with the BS ruminant C. psittaci serovar 1 strain at 42 days of gestation resulted in infection of fetal membranes, however, failed to induce abortion (Vazquezcisneros et al. 1994).

Chlamydial infection biology 25

Table I-3 Chlamydia suis strains isolated from pigs. Adapted from Schautteet and Vanrompay (2011)

Isolated from

Strain Location Year Tissue Clinical Symptoms of the pigs

S45 Austria 1969 Intestines (feces) Asymptomatic infection

R19 Nebraska 1992 Intestines (feces) Pneumonia, enteritis, conjunctivitis R22 Nebraska 1992 Conjunctiva Conjunctivitis R24 Nebraska 1992 Respiratory tract (nasal mucosa) Upper respiratory tract disease R27 Nebraska 1993 Intestines (colon) Enteritis R33 Nebraska 1994 Respiratory tract (nasal mucosa) Pneumonia H5 Iowa 1994 Conjunctiva Conjunctivitis H7 Iowa 1994 Conjunctiva Conjunctivitis 130 Nebraska 1996 Intestines (jejunum) Asymptomatic infection 132 Nebraska 1996 Intestines (ileum) Asymptomatic infection DC6 Germany 2004 Conjunctiva Conjunctivitis MS1 Italy 2004-2007 Conjunctiva Conjunctivitis MS2 Italy 2004-2007 Conjunctiva Conjunctivitis MS3 Italy 2004-2007 Conjunctiva Conjunctivitis MS4 Italy 2004-2007 Conjunctiva Conjunctivitis and return to oestrus MS5 Italy 2004-2007 Conjunctiva Conjunctivitis and return to oestrus MS6 Italy 2004-2007 Conjunctiva Conjunctivitis and return to oestrus MS7 Italy 2004-2007 Conjunctiva Conjunctivitis and return to oestrus MS8 Italy 2004-2007 Conjunctiva Conjunctivitis and return to oestrus MS9 Italy 2004-2007 Conjunctiva Conjunctivitis and return to oestrus MS10 Italy 2004-2007 Conjunctiva Conjunctivitis and return to oestrus MS11 Italy 2004-2007 Conjunctiva Conjunctivitis and return to oestrus MS12 Italy 2004-2007 Conjunctiva Conjunctivitis MS13 Italy 2004-2007 Conjunctiva Conjunctivitis MS14 Italy 2004-2007 Conjunctiva Conjunctivitis

26 Chapter I

7.4.2. Field studies Although experimental infections demonstrate its pathogenicity, the reported virulence of C. suis in commercial pigs is highly variable, possibly the consequence of the high degree of genetic diversity observed for C. suis compared to other chlamydial species (Everett et al. 1999b; Bush and Everett 2001). In fact, intestinal C. suis infections have been frequently detected in clinically healthy and diarrheic pigs (Pospischil and Wood 1987; Zahn et al. 1995; Szeredi et al. 1996; Nietfeld et al. 1997; Hoelzle et al. 2000; Camenisch et al. 2004; Englund et al. 2012). Moreover, C. suis appears to be a common causative agent of conjuncitivitis (Rogers et al. 1993; Rogers and Andersen 1999). Becker et al. (2007) showed a significant correlation between the presence of C. suis and the occurrence of conjunctivitis in extensively-kept pigs. However, this correlation was not observed for intensive farming systems, where a high prevalence of C. suis was also demonstrated for clinically healthy pigs. Thus, intensively-kept pigs seem to be predisposed to ocular C. suis infections and associated conjunctivitis, as also observed by Schautteet et al. (2010). Besides, also the significance of C. suis and C. abortus in porcine respiratory disease has been confirmed in pigs suffering from bronchopneumonia (Hoelzle et al. 2000). In addition, chlamydiae have been linked to arthritis, pericarditis and polyserositis in piglets (Willigan and Beamer 1955; Kölbl 1969; Kölbl et al. 1970). Chlamydia suis is associated with numerous reproductive problems such as vaginal discharge, endometritis, return to oestrus, abortion, delivery of weak piglets, increased perinatal and neonatal mortality and mummification in sows (Woollen et al. 1990; Wittenbrink 1991; Schiller et al. 1997b; Camenisch et al. 2004; Kauffold et al. 2006; Schautteet et al. 2010; Schautteet et al. 2013). Moreover, C. suis, C. pecorum and C. abortus have been demonstrated in aborted foetuses (Schiller et al. 1997b; Thoma et al. 1997). Eggemann et al. (2000) found a significant correlation between the presence of chlamydial DNA and the incidence of abortion and litters with stillborn piglets and piglets with low viability. Hoelzle et al. (2000) demonstrated a significantly higher Chlamydia PCR positive rate for sows with reproductive disorders (mostly vaginal discharge) compared to healthy controls, although C. abortus was identified to be the causative agent in most cases and C. suis appeared to be less frequently present. In boars, C. suis infections have been linked to orchitis, epididymitis, urethritis and inferior semen quality (Sarma et al., 1983; Schautteet and Vanrompay, 2011). However, the exact role of C. suis still has to be clarified for most reproductive disorders. Chlamydial infection biology 27

Several studies suggest the appearance of clinical symptoms in pigs through synergistic interaction of chlamydiae with other pathogenic bacteria. Chlamydiae may induce intestinal lesions, albeit without clinical symptoms, altering susceptibility of the intestine for other enteropathogenic bacteria, as demonstrated for chlamydiae and Salmonella (Pospischil and Wood 1987). Schautteet et al. (2010) showed the impact of the co-occurrence of Chlamydiaceae (C. suis and C. abortus) and Porcine circovirus type 2 (PCV-2) during a concurrent outbreak of chlamydial disease in boars, sows and gilts and postweaning multisystemic wasting syndrome (PMWS) in weaned piglets on a large Estonian pig production plant. In fact, both pathogens can be present in healthy pig herds, but might trigger each other’s pathology. Similarly, co-infection of Acanthamoebae and C. suis was able to cause serious ocular manifestations in intensively-kept pigs (Becker et al. 2007).

7.5. Antibiotic resistance

Tetracyclines and its derivatives (chlortetracycline, oxytetracycline, doxycycline) are the drugs of choice for treatment of Chlamydia infections in most animal species because of their low cost, broad spectrum of activity, excellent tissue distribution and low toxicity (Michalova et al. 2004). Tetracyclines prevent interaction of aminoacyl tRNAs with ribosomes and thus block bacterial protein synthesis. Alternatively, Quinolones (enrofloxacin), macrolides (erythromycin) and erofloxacin can be administered, in case of an infection with a tetracycline resistant (TcR) C. suis strain (Schautteet 2010). Until fifty years ago, live stock feed has been systematically supplemented with Tc to counter bacterial infections and to promote growth (Andersen and Rogers 1998; Di Francesco et al. 2008). However, several antibiotic resistant strains of veterinary important pathogens arose. Given the associated risk of consumption of milk and meat originating from life stock fed with antibiotics, the in-feed use of Tc as growth promotor or preventive measure is no longer allowed in Europe since the late 1960’s, to avoid the creation of multi-drug resistant bacteria. Indeed, multi-resistant strains could have devastating and potentially irreversible effects on the viability of antibiotics as agents to effectively treat diseases in humans. The first C. suis strains, stably resistant to Tc, were isolated from diseased and normal pigs during the 1990’s in the USA, and some of these also exhibited a stable resistance to sulfadiazine (Andersen and Rogers 1998). Di Francesco et al. (2008) identified 14 additional TcR C. suis strains in Italy. Borel et al. (2012) demonstrated the rapid selection for tetracyline- resistant C. suis after antibiotic treatment in a pig farm with an outbreak of conjunctivitis and diarrhea. The TcR phenotype is attributed to the presence of a foreign genomic island (ranging 28 Chapter I from 6 to 13.5 kb) in the chlamydial chromosome. Four different genomic islands were identified, all carrying genes encoding a Tc efflux pump, tet(C), and a regulatory repressor, tetR (Dugan et al. 2004). The membrane associated Tc efflux pump prevents the Tc mediated inhibition of protein synthesis through export of Tc entering the bacterial cell. The regulatory repressor encoded by the tetR gene suppresses production of the Tc efflux pump and its function is neutralized through binding of the antibiotic (Chopra and Roberts 2001). Three of four tet(C) containing islands also carry a unique insertion sequence (IScs605). Dugan et al. (2007) demonstrated that a transposase within the IScs605 sequence is likely responsible for integration of the genomic islands into the C. suis chromosome. In all examined strains, the C. suis tet(C) is integrated in the inv-like gene, wherefore the exact function remains unknown. The tet(C) islands represent the first identification of antibiotic resistance acquired through horizontal gene transfer in any obligate intracellular bacteria, but, the exact nature of acquisition is still subject to scientific speculation. Yet, Tc resistance genes are widely distributed among pathogenic, opportunistic and normal flora bacteria isolated from man, animals and the environment (Roberts 1989; Roberts and Hillier 1990; Brown and Roberts 1991; Roberts 1996). Indeed, Tc resistance genes are frequently isolated from pigs and soil and water samples from areas surrounding pig farms (Chee-Sanford et al. 2001; Stanton et al. 2004; Koike et al. 2007; Stine et al. 2007). Moreover, the pig gut seems to be a source of Tc resistance genes, even in apparently antibiotic-free animals (Kazimierczak et al. 2009). The majority of Tc resistance genes is associated with mobile genetic elements which contribute to the distribution and maintenance of antibiotic resistance genes (Mendez et al. 1980; Jones et al. 1992). It is likely that the extensive in-feed use of Tc established an environment in the intestines where the tet(C) gene could be acquired and maintained by C. suis (Dugan et al., 2004). However, the exact process through which the obligate intracellular bacterium C. suis required the tet(C) containing genomic island from other gram- negative bacteria in the pig digestive tract remains completely uncharacterized (Suchland et al. 2009). So far, no stable antibiotic resistance have been reported in C. trachomatis isolates from human patients. A few cases of treatment failure displayed ‘heterotypic resistance’, a form of phenotypic resistance in which a small portion of an infecting microbial species is surviving after exposure to antibiotics. However, the isolates could not survive long-term passage or lost their resistance upon passage (Jones et al. 1990; Wang et al. 2005). Several alternative antibiotics are applied in clinical setting in case of treatment failure when using Tc. Genetically-based clinical resistance to these alternatives in Chlamydia has not been Chlamydial infection biology 29 documented so far. However, naturally occurring Tc and sulfadiazine doubly-resistant C. suis strains were already isolated from pigs in the USA (Andersen and Rogers 1998). In addition, Suchland et al. (2009) demonstrated the in vitro horizontal gene transfer of the Tc resistance gene from C. suis to C. trachomatis. Moreover, Lenart et al. (2001) showed that C. suis R19 and C. trachomatis L2 could develop within a single inclusion after sequential in vitro infection, creating an environment where the two strains can interact. Hence, emergence of (multi-)resistant human chlamydial pathogens might be plausible and would represent a significant public health challenge.

7.5.1. Persistence Failure of antibiotic therapy in the treatment of chlamydial infections is not always attributed to the acquisition of resistance genes. In fact, exposure of infected cells to beta-lactam antibiotics, IFN-gamma or deprivation of iron supplements or amino acids, induces a phenomenon called ‘persistence’. Persistent or ‘aberrant’ RBs proceed DNA replication and protein synthesis, but halt cell division. The resulting inclusions, containing small numbers of very large RBs, yield a prolonged infection caused by viable but non-culturable chlamydiae, that are refractory to antibiotic therapy. Removal of the inducing factor(s) results in septum formation, RB division and differentiation to EBs (Chopra et al. 1998; Hogan et al. 2004). Several studies demonstrate that long-term infections might lead to phenotypic resistance to antibiotics that are normally very effective in both C. trachomatis and C. pneumonia (Kutlin et al. 1999; Dreses-Werringloer et al. 2000; Kutlin et al. 2002). Consequently, it may be challenging to differentiate persistence induced by antibiotics from potential cases of antibiotic resistance in vivo, and this might lead to erroneous conclusions regarding the antibiotic resistance of clinical isolates. Moreover, a further understanding of long-term infections is important, because persistence may cause a cascade of potentially serious inflammatory-induced abnormalities, such as pelvic inflammatory disease, infertility, blindness, arthritis, asthma and atherosclerosis (Patton et al. 1994; Stamm 1999; Campbell and Kuo 2004; Burton and Mabey 2009; Gerard et al. 2009).

7.5.2. Diagnostic considerations Antimicrobial susceptibility assays demand the isolation and culturing of the involved chlamydial strain in host cells. Previous isolation is also recommended for detection of the tet(C) gene using the PCR test developed by Dugan et al. (2004), since the assay is not Chlamydia-specific. Many different cell lines are used in different diagnostic laboratories and 30 Chapter I there is no universal testing methodology. Small differences in technical approaches may influence the outcome significantly and complicate the interpretation of in vitro resistance and its association with clinical relevance. Although their specificity approaches 100%, culture- based methods are time-consuming, require technical expertise and their sensitivity is often marginal. The sensitivity of NAATs is often 20-30% better than culture, however, the false positive rate can be considerable and the reproducibility is often low. All these technical issues present significant challenges in evaluating potential emergence of antibiotic resistance (reviewed by Sandoz and Rockey (2010)).

7.5.3. Probiotics and vaccination Antibiotic treatment failure demands the use of alternative treatment methods, or prevention of infection by vaccination. Pollmann et al. (2005) demonstrated the reducing effect of a probiotic strain of Enterococcus faecium (NCIMB 10415) on the carryover of infections from Chlamydiaceae-infected sows to newborn piglets. The authors hypothesized that the probiotic strain may reduce the infection rate, likely through competition with chlamydiae for binding to the glucosaminoreceptor on the intestinal epithelial cells. Moreover, probiotic treatment might also influence the intracellular proliferation of chlamydiae in the host cell, or result in a more rapid elimination of Chlamydia-infected cells through modulation of the immune response. Further investigation could clarify the nature of the probiotic effect of Enterococcus faecium. The probiotic strain is licensed by the European Union as an animal feed supplement. So far, no vaccines are commercially available. However, a few preliminary studies towards vaccine development yielded promising results. Knitz et al. (2003) showed a marked primary and secondary IgG serum antibody response upon immunization of breeding sows with a formalin-inactivated C. abortus strain (OCHL03/99) originating from vaginal discharge of sows. Zhang et al. (2009) demonstrated a protective immune response in mice against C. abortus infections following co-vaccination of a DNA vaccine and recombinant MOMP. Moreover, the results obtained by De Clercq et al. (2014) indicate that an initial vaginal C. suis infection creates partial protection against re-infection. The latter is promising for the development of an effective vaccine. Research towards vaccination is worthwhile since vaccination would be an effective strategy to prevent C. suis infections and the associated clinical problems. Chlamydial infection biology 31

7.6. Zoonosis

Chlamydiae are among the most prevalent microorganisms in animals. The most prominent zoonotic examples are C. abortus and C. psittaci (Beeckman and Vanrompay 2009). Chlamydia psittaci is transmitted to humans through aerosols from infected birds and their excretions and causes human psittacosis, also called ornithosis or parrot disease. The clinical course of this condition is usually severe, resembling the symptoms of influenza and eventually pneumonia. The disease can be fatal without antibiotics treatment. The avian strains of C. psittaci are belonging to risk group 3 (Directive 2000/54/EC), due to the danger of human infections (Perry 1973; Salisch et al. 1996). Chlamydia abortus infected animals are a potential danger for pregnant women, since several reports notify spontaneous abortions and potentially fatal systemic infections in pregnant women after exposure to infected sheep or goats (Buxton 1986; Kampinga et al. 2000a; Pospischil et al. 2002a; Walder et al. 2003; Walder et al. 2005b). Little is known about the transmission of chlamydial pathogens from pigs to humans. Yet, the most prevalent chlamydial species in pigs, C. suis, is highly related to C. trachomatis (Everett et al. 1999b). This human pathogen is the most common bacterial sexually transmitted disease in the world (Bebear and de Barbeyrac 2009). Besides, ocular C. trachomatis infections can give rise to trachoma, the leading cause of preventable blindness in developing countries (WHO 2008). Chlamydia suis is frequently isolated from the eyes of pigs suffering from conjuncitivitis (Rogers et al. 1993) and was also involved in eye infections causing conjunctivitis in human patients in Nepal (Dean et al., 2013). Hence, C. suis might be a zoonotic pathogen and transfer to humans could have clinical consequences for public health. Further epidemiological and clinical research towards human C. suis infections is of significant importance.

Chapter II

Development and validation of a real-time PCR for Chlamydia suis diagnosis in swine and humans

Adapted from: De Puysseleyr K., De Puysseleyr L., Geldhof J., Cox E. and Vanrompay D. (2014). Development and validation of a real-time PCR for Chlamydia suis diagnosis in swine and humans. PLoS One, 9, e96704. 34 Chapter II

Abstract Pigs are the natural host for Chlamydia suis, a pathogen which is phylogenetically highly related to the human pathogen C. trachomatis. Chlamydia suis infections are generally treated with Tc. In 1998, tetracyline resistant C. suis strains emerged on U.S. pig farms and they are currently present in the Belgian, Cypriote, German, Israeli, Italian and Swiss pig industry. Infections with TcR C. suis strains are mainly associated with severe reproductive failure leading to marked economical loss. We developed a sensitive and specific TaqMan probe- based C. suis real-time PCR for examining clinical samples of both pigs and humans. The analytical sensitivity of the real-time PCR is 10 rDNA copies/reaction without cross- amplifying DNA of other Chlamydia species. The PCR was successfully validated using conjunctival, pharyngeal and stool samples of slaughterhouse employees, as well as porcine samples from two farms with evidence of reproductive failure and one farm without clinical disease. Chlamydia suis was only detected in diseased pigs and in the eyes of humans. Positive humans had no clinical complaints. PCR results were confirmed by culture in McCoy cells. In addition, Chlamydia suis isolates were also examined by the tet(C) PCR, designed for demonstrating the Tc resistance gene tet(C). The tet(C) gene was only present in porcine C. suis isolates. Development of a Chlamydia suis specific real-time PCR 35

1. Introduction

Chlamydiaceae are obligate intracellular Gram-negative bacteria that cause a broad range of diseases in both humans and animals. Pigs can become infected by Chlamydia (C.) pecorum, C. abortus, C. psittaci and C. suis (Everett et al. 1999b). Seroprevalence rates of Chlamydiaceae in German, Swiss, Italian and Belgian pigs are high (40-96%) (Eggemann et al. 2000; Camenisch et al. 2004; Vanrompay et al. 2004; Di Francesco et al. 2006). As far as known, the pig is the only host for C. suis, which is phylogenetically closely related to the human pathogenic agent C. trachomatis (Everett et al. 1999b). Chlamydia suis infections can be asymptomatic or associated with arthritis, pericarditis, polyserositis, pneumonia, conjunctivitis, enteritis, diarrhea and reproductive failure (Willigan and Beamer 1955; Sarma et al. 1983; Woollen et al. 1990; Zahn et al. 1995; Andersen and Rogers 1998; Eggemann et al. 2000). Experimental infections in specific pathogen free and gnotobiotic pigs using C. suis field strains have resulted in conjunctivitis, respiratory lesions and gastrointestinal lesions (Reinhold et al. 2008b; Guscetti et al. 2009b; Pospischil et al. 2009b). To date, transmission of C. suis to humans has not been reported (Schautteet and Vanrompay 2011). However, C. suis and C. trachomatis are closely related (Everett et al. 1999b) and, therefore, the zoonotic potential of C. suis is likely. Chlamydia suis can be difficult to grow in cell culture or embryonated eggs (Schautteet and Vanrompay 2011). A molecular diagnostic test, able to specifically detect C. suis in both animal and human samples, is crucial to gain insight into the prevalence, the economic impact and the zoonotic ‘threat’ of C. suis infections. In 2006, Sachse et al. (2005), developed a 23S rDNA gene-based array tube (AT) micro array for detection and differentiation of Chlamydia spp. The assay detects a single copy of the cloned target DNA (Ehricht et al. 2006). Borel et al. (2008) calculated the sensitivity of the AT micro array over an entire panel of human and animal clinical samples, including five human pharyngeal swabs and four tissues of naturally infected diseased pigs. The sensitivity of the AT micro array was slightly lower than for real- time PCR. When excluding long-time stored swab samples from the calculation, the sensitivity was equivalent to that of real-time PCR. However, in our hands, C. suis species identification by use of the AT microarray was often only possible on isolates of vaginal and rectal swabs and not directly on these clinical samples (Schautteet et al. 2013). More recently, Pantchev et al. (2010) developed a 23S rDNA gene-based real-time PCR for C. suis. However, the PCR was strictly developed for the examination of veterinary samples as it cannot distinguish C. suis from the genetically closely related human pathogen C. trachomatis 36 Chapter II

(Pantchev et al. 2010). Therefore, the present study aimed to develop a sensitive and specific C. suis real-time PCR for the purpose of examining clinical samples of both pigs and humans.

2. Materials and methods

2.1. Bacterial cultures

For determination of sensitivity, specificity and detection limit of the C. suis-specific real- time PCR, the following 14 chlamydial strains were used: C. suis strains S45, R19, H7, R24, R27 and R33, C. pneumoniae (TW-183), C. felis (FP Baker), C. caviae (GIPC), C. abortus (S26/3), C. psittaci (92/1293), C. pecorum (1710S), C. muridarum (MoPn) and C. trachomatis (L2/434/BU). Bacteria were grown in cycloheximide treated McCoy cells (mouse fibroblast cells, obtained from Els De Coster, Labo Medische Analyse, CRI, Zwijnaarde, Belgium; original source: ATCC CRL-1696) using a standard methodology, as described previously (Vanrompay et al. 1992). Chlamydiae were released from infected monolayers (two passages) by freezing and thawing, followed by ultrasonication (Bransonic 12, BIOMEDevice, San Pablo, CA, USA). Cell culture harvest was centrifuged for 10 min (1000 × g, 4°C) and chlamydiae were subsequently concentrated by ultracentrifugation for 45 minutes (50,000 × g, 4°C). Bacteria were resuspended in 2 mL sucrose phosphate glutamate buffer (SPG, 218 mM sucrose, 38 mM KH2PO4, 7 mM K2HPO4, 5 mM L-glutamic acid) and stored at –80°C until use.

2.2. DNA extraction

Genomic DNA of bacterial cultures was prepared using the DNeasy Blood and Tissue Kit (Qiagen, Antwerp, Belgium). DNA extraction of clinical samples was performed using the G- spin Total DNA Extraction Mini Kit (Goffin Molecular Biotechnologies, Beek, The Netherlands). Both extraction methods were performed according to the instructions of the manufacturers.

2.3. Primers and probes Published 23S ribosomal RNA sequences of all known chlamydial species (Table II-1) (Everett et al. 1999b) were aligned using Clustal X software (default settings) (Thompson et al. 1997). Forward and reverse primers (Life technologies, Paisley, United Kingdom) and probes (Eurogentec, Seraing, Liège, Belgium) were designed using primer3 software Development of a Chlamydia suis specific real-time PCR 37

(Skaletsky 2000) (Table II-2). Primer and probe specificity was checked by BLAST (Thompson et al. 1997). The optimal annealing temperature and specificity of the primers and probes within the genome was evaluated in 20 µl PCR reactions containing 3µl of 2µM of forward and reverse primers, 0.5 µl Super Taq 5U/µl (Sphaero Q, Gorinchem, The Netherlands), 2µl Super Taq Reaction Buffer, 2 µl of each of 1.25 mM dNTP and 50 ng of genomic DNA of C. suis strain S45. The cycling conditions were as follows: 72°C for 5 minutes; 35 cycles of 95°C for 60s, 60°C for 60s and 72°C for 60s and a final step of 72°C for 5 min. CS23S-probe A and B were 5’ labeled with the reporter dye 6-carboxyfluorescein (FAM) and hexachloro-fluoresceine (HEX) respectively, and 3’ labeled with the quencher dye carboxytetramethylrhodamine (TAMRA).

Table II-1 NCBI Nucleotide Accession numbers of the 23S rRNA gene sequences used for the alignment to design the primers and C. suis specific probes. Species Strain NCBI Nucleotide Accession Number C. suis R22 U68420 C. trachomatis L2/434/BU U68443 C. abortus EBA U76710 C. psittaci NJ1 U68419 6BC U68447 C. pecorum IPA U68434 C. felis FP Baker U68457 C. muridarum MoPn U68436 SFPD U68437 C. caviae GPIC U68451 C. pneumoniae TW-183 U76711

38 Chapter II

Table II-2 Primers and probes of the C. suis specific real-time PCR. Name Sequence (5’- 3’) Positiona Specificity

C. suis and CS23S-F GCAGAGGAAAAGAAATCGAAGA 215-236 C. trachomatis

C. suis and CS23S-R CGGGACTATCACCCTGTATC 359-378 C. trachomatis

CS23S-ProbeA FAM-CGAGCTGAAGAAGCGAGGGGTTGTAG-TAMRA 280-305 C. suis

CS23S-ProbeB HEX-CGAGCCGAAGAAGCGAGGGGTTGTAG-TAMRA 280-305 C. suis

a Binding position from base 1 of the 23S rRNA gene of the chlamydial reference strain S45.

2.4. Inhibition control plasmid

The 23S rDNA amplicon of C. suis (S45) was amplified using 20 µl PCR reactions containing 3µl of 2µM of forward and reverse primers, 0.5 µl Super Taq 5U/µl (Sphaero Q, Gorinchem, The Netherlands), 2µl Super Taq Reaction Buffer, 2 µl of each of 1.25 mM dNTP and 50 ng of genomic DNA. PCR products were purified using the Wizard SV Gel and PCR Clean-Up System (Promega, Madison, WI, USA) and cloned into pGemT (Promega, Madison, WI, USA) according to the manufacturer’s protocol. To verify the nucleotide sequence of the inserted fragment, sequence analyses were performed by the VIB Genetic Service Facility (University of Antwerp, Antwerp, Belgium) using vector associated T7 and SP6 priming sites. The resulting C. suis-species-specific internal inhibition control plasmid was designated pGemT::CSIC.

2.5. Species-specific real-time PCR

Real-time PCR was performed with the Rotor-Gene Q Instrument (Qiagen Benelux, Venlo, The Netherlands) using 25 µl reaction mixture containing 2 µl of DNA template, 4 µl of primer mixture (300 nM forward and reverse primer), 2.5 µl of CS23S-probe A and B (200 nM), 12.5 µl of absolute qPCR mix (Thermoscientific, Acros Organics, Geel, Belgium) and 1.5 µl DNAse and RNAse free water. The cycling conditions were as follows: 95°C for 15 minutes, 50 cycles of 95°C for 15 seconds, 60°C for 60 seconds. All default program settings were used. Standard graphs of the Cycle threshold (Ct) values, obtained by testing tenfold serial dilutions (108 to 101) of the purified species-specific inhibition control plasmid, were used for quantification. DNA was always tested in the presence of control plasmid (50 copies/µl) to check for PCR inhibitors. Development of a Chlamydia suis specific real-time PCR 39

2.6. Detection limit and specificity

The lower detection limit of the assay was evaluated using decimal serial dilutions (106 to 101 copies/µl) of the inhibition control plasmid and of purified genomic DNA of the C. suis reference strain S45 from suspensions equivalent to 106 to 101 copies/µl. Three independent dilution series were analyzed and reactions were performed in triplicate. The specificity was evaluated using: i) genomic DNA from C. peumoniae (TWAR), C. felis (FP Baker), C. caviae (GPIC), C. abortus(S26/3), C. psittaci (92/1293), C. pecorum (1710S), C. muridarum (MoPn) and C. trachomatis (L2/434/BU) as well as ii) DNA from 23 and 38 bacterial species commonly found in swine and humans, respectively, and iii) genomic DNA from swine and human tissues (Table II-3 and 4).

Table II-3 Organisms of non-chlamydial origin found in swine and used for specificity testing. Organisms*

Acinetobacter calcoaceticus Clostridium novyi Mycoplasma hyopneumoniae

Bacteroides coprosuis Enterobacter cloacal Mycoplasma hyosynoviae

Bacteroides pyogenes Enterobacter aerogenes Pasteurella multocida

Bordetella bronchiseptica Enterococcus faecalis Pseudomonas aeruginosa

Bordetella pertussis Enterococcus durans Proteus mirabilis

Bordetella parapertussis Escherichia coli Proteus vulgaris

Brachyspira hyodesenteria Klebsiella pneumoniae Salmonella Typhimurium

Brachyspira pilosicoli Lactobacillus fermentum Staphylococcus aureus

Brucella suis Lactobacillus acidophilus Staphylococcus hyicus

Clostridium perfringens Lactobacillus delbrueckii Streptococcus suis

* Identification of micro-organisms was performed by culture on selective media, biochemical identification and molecular characterization methods like PCR and DNA sequencing.

40 Chapter II

Table II-4 Organisms of non-chlamydial origin found in humans and used for specificity testing. Organisms*

Acinetobacter baumannii Eubacterium cylindroides Propionibacterium acnes

Bacteroides fragilis Eubacterium lentum Pseudomonas aeruginosa

Bifidobacterium adolescentis Eubacterium hadrum Proteus mirabilis

Bifidobacterium longum Eubacterium ventriosum Proteus vulgaris

Bordetella bronchiseptica Faecalibacterium prausnitzii Ruminococcus luti

Citrobacter braakii Klebsiella oxytoca Salmonella enterica

Citrobacter freundii Klebsiella pneumoniae Serratia marcescens

Clostridium botulinum Lactobacillus acidophilus Shigella dysenteriae

Clostridium difficile Lactobacillus plantarum Shigella flexneri

Clostridium perfringens Lactobacillus gasseri Shigella sonnei

Clostridium tetani Stenotrophomonas maltophilia Staphylococcus aureus

Corynebacterium urealiticum Moraxella catarrhalis Staphylococcus epidermidis

Enterobacter aerogenes Morganella morganii Moraxella catarrhalis

Enterococcus faecalis Mycoplasma pneumoniae Streptococcus agalactiae

Enterococcus faecium Peptostreptococcus magnus Streptococcus mitis

Escherichia coli Peptostreptococcus asaccharolyticus Streptococcus nilleri

Eubacterium nodatum Peptostreptococcus anaerobius Streptococcus pyogenes

Eubacterium biforme Streptococcus pneumoniae Veillonella parvula

* Identification of micro-organisms was performed by culture on selective media, biochemical identification and molecular characterization methods like PCR and DNA sequencing.

2.7. Case studies

2.7.1. Pig farms To validate the performance of the C. suis real-time PCR, vaginal swabs originating of 10 to 15 sows from three Dutch pig (A, B, C) farms were tested. Two of the three farms were dealing with cases of reproductive failure (decrease of the conception rate from 90 to <65%, 1-3% abortions, sows that delivered only two to five piglets of a non-uniform weight, white to yellow non-smelling vulval liquid, irregular return to estrus). Clinical disease did not improve Development of a Chlamydia suis specific real-time PCR 41 following medication with doxycycline [400 g (ton feed) -1] plus a combination of trimethoprim [120 g (ton feed) -1] and sulfamethoxazole [600 g (ton feed) -1] for 10–14 days during gestation and half of these drug concentrations during lactation. Antibody detection or PCR for Leptospira species, Mycoplasma species, Brucella suis, porcine reproductive and respiratory syndrome virus, Aujeszky’s disease, swine influenza, porcine circovirus 2 and porcine parvovirus, were negative. Tests were performed at the Dutch Animal Health Service (Deventer, The Netherlands) and by the Flemish Animal Health Service (Drongen, Belgium). The third farm reported no clinical problems and was included as a negative control. Animals were sampled for C. suis culture and PCR. For culture, rayon-tipped aluminum- shafted swabs (Copan; Fiers, Kuurne, Belgium) were immersed in chlamydia transport medium (Vanrompay et al. 1992) immediately after vaginal sampling and stored at -80°C for culture. For PCR, vaginal swabs immersed in DNA/RNA stabilization buffer (Roche) were stored at -80°C. All DNA extractions were performed using the G-spin Total DNA Extraction Mini Kit (Goffin Molecular Biotechnologies, Beek, The Netherlands) according to the manufacturer‘s protocol. Purified DNA of vaginal swabs was analyzed by the newly developed C. suis-specific real- time PCR. Presence of viable chlamydiae was determined by inoculation on McCoy cells (in duplicate) followed by direct immunofluorescence (anti-LPS/FITC) staining on the first culture drum at six days post inoculation (Imagen, Oxoid, Drongen, Belgium). If positive, the second culture drum was used for C. suis identification by use of the newly developed real- time PCR. Positively identified C. suis isolates were also examined by the tet(C) PCR, designed for demonstrating the Tc resistance gene tet(C) (Dugan et al. 2004), For this purpose, we used genomic DNA of the TcR C. suis strain R19 (Rogers and Andersen 1996) as positive control. All animal samples were received from veterinary practitioners and were delivered for diagnostic purpose. Therefore, approval of the veterinary ethical committee was not required.

2.7.2. Slaughterhouse employees Validation of the C. suis PCR for human diagnosis was performed by sampling abattoir workers. During a yearly medical checkup, employees of a Belgian pig slaughterhouse were asked (informed consent) to voluntarily provide a pharyngeal and conjunctival swab, as well as a swab of fresh stool. Rayon-tipped aluminum-shafted swabs were immersed in chlamydia transport medium (Vanrompay et al. 1992) and stored at -80°C until culture. Swabs for PCR 42 Chapter II were immersed in DNA/RNA stabilization buffer and stored at -80°C. Purified DNA was analyzed by the newly developed C. suis-specific real-time PCR. Presence of viable chlamydiae, identification of viable C. suis and the presence of the tet(C) gene in C. suis strains was examined as mentioned for the pig farms. The case study was approved by the medical ethical committee (approval EC UZG 2011/459). Participants provided their written informed consent and the consent procedure was approved by the medical ethical committee of Ghent University.

3. Results

3.1. Primers and probes

It was impossible to design C. suis-specific primers in the 23S rDNA target region, such that the forward and reverse primers would also not anneal to C.°trachomatis DNA. However, we were able to design C. suis-specific probes for real-time PCR. The differentially labeled probes CS23S-A and CS23S-B were C. suis-specific and they were both required for coverage of the selected target region of all known C. suis strains. Forward (CS23S-F) and reverse (CS23S-R) primers generated a PCR product of 159 bp.

3.2. Internal inhibition control

Standard curves made using 106 to 101 copies of the pGemT::CSIC control plasmid (Figure II1) showed slopes around -3.103, which correlates to an efficiency of 109%, with correlation coefficients > 98%.

Development of a Chlamydia suis specific real-time PCR 43

Figure II-1 Real-time PCR quantitation of chlamydial S45 genomic DNA (A) and pGemT::CSIC control plasmid (B). The standard curve data points are the average of 3 replications, standard deviations are shown as error bars. The equations and R2 linearity values resulting from the linear regression analysis are shown on the graphs.

3.3. Species-specific real-time PCR

The species-specific real-time PCR detected all known C. suis strains. Amplification of genomic DNA extracts of all C. suis strains resulted in the expected PCR products with amplification curves exceeding the 0.02 threshold before cycle 25. The species-specific PCR was able to detect 10 rDNA copies (or two copies/µl) of both genomic and control plasmid DNA, as demonstrated through analysis of the serial decimal dilutions of plasmid and genomic DNA. Standard curves resulting from the sensitivity analysis are shown in Figure II- 1. The slopes were around -3.5, which correlates to an efficiency of 91%, with correlation coefficients > 99%. The species-specificity test revealed a Ct-value of 19 for DNA of 106

TCID50 C. suis. Real-time PCR on genomic DNA of C. pneumoniae, C. felis, C. caviae, C. pecorum, C. abortus, C. muridarum and C. trachomatis generated no signal. The real-time PCR gave no results for genomic DNA of other pathogens commonly found in the eyes, respiratory or urogenital tract of swine and humans, neither with DNA from swine or human tissues.

44 Chapter II

3.4. Case studies

3.4.1. Pig farms Chlamydia suis was not detected on the clinically healthy farm C. The pathogen was present on farms A and B, both dealing with reproductive failure. Chlamydia suis DNA was found in all (100%) vaginal swabs of farms A and B. Viable C. suis organisms were present in 7 of 10 (70%) and 11 of 15 (73.3%) vaginal swabs of farms A and B, respectively. Chlamydial isolates of farm A and B were examined for the presence of the tet(C) gene. The tet(C) gene was discovered in two of seven (28.5%) and 6 of 11 (54.5%) C. suis isolates of farms A and B, respectively. Clinical symptoms disappeared after treatment with enrofloxacin (fluoroquinolone, Baytril 5 %; Bayer Healthcare), as previously described (Schautteet et al. 2012). Enrofloxacin was added to the sperm diluter [2 ml (l diluter) -1] and it was also used to rinse the sow’s reproductive tract (Baytril 5%, 5 ml+95 ml distilled water) immediately before artificial insemination. Infected sows were re-examined two weeks after treatment and were negative in both PCR and culture.

3.4.2. Slaughterhouse employees Only 12 of 84 (14.3%) employees voluntarily participated. They provided 12 conjunctival, 12 pharyngeal and 12 stool swabs. Pharyngeal swabs and stool were all C. suis negative. Two of 12 (16.6%) conjunctival swabs were positive by the newly developed C. suis real-time PCR, revealing a Ct-value of 26 and 28, respectively. Real-time PCR results on all swabs could be confirmed by culture. Culture harvest of both positively identified C. suis isolates was negative by the tet(C) PCR. Positive employees worked daily for three years in the pig gut washing area and for eight years in the animal reception area, respectively. Clinical signs were absent.

Development of a Chlamydia suis specific real-time PCR 45

4. Discussion

Chlamydial infections are treated with Tc. In 1998, TcR C. suis strains emerged in the U.S. pig industry (Iowa and Nebraska), and are currently also known to be prevalent in the Belgian, Cypriote, German, Israeli, Italian and Swiss pig industry (Andersen and Rogers 1998; Lenart et al. 2001; Camenisch et al. 2004; Di Francesco et al. 2006; Borel et al. 2012). The present study adds a country to the list, since it is the first report on TcR C. suis strains in the Dutch pig industry. The C. suis TcR phenotype is manifested through the Tc resistance gene tet(C). Tet(C) is integrated into the chlamydial chromosome (Dugan et al. 2004), but it is a transposable genetic element, which is also present in other bacteria such as E. coli. The international economic consequences of C. suis infections are not yet fully established, but the financial loss due to severe reproductive failure and the need for antibiotic treatment currently worries pig producers all over the world. Moreover, pig farmers are aware of the existence of TcR C. suis strains and the risk of importing TcR C. suis contaminated sperm for artificial insemination (Schautteet et al. 2013) (and P. Delava, personal communication 2014). Furthermore, emergence of TcR chlamydial strains might pose a potential threat for public health if this species turns out to be a zoonotic pathogen. Suchland et al. demonstrated in vitro horizontal transfer of the Tc resistance gene among chlamydial species (Suchland et al. 2009). Therefore, contact between TcR and TcS Chlamydia spp. could lead to transfer of the tet(C) gene and the subsequent phenotype, which could then be propagated and selected for in patients that are treated with Tc. However, the lack of evidence of antibiotic resistance leading to treatment failure in humans seems to indicate that horizontal transfer of the tet(C) gene is rather rare. Sandoz and Rockey (Sandoz and Rockey 2010) state that unsufficiency of the current diagnostic methods, could be the cause of this lack of evidence. In this respect, studying the presence of C. suis in humans, dealing with pigs on a regular basis, is meaningful. Thus, there is an urgent need for a highly sensitive and specific molecular diagnostic test to study the epidemiology of C. suis in pigs and to study a possible transfer of C. suis to humans. Real-time PCR technology offers the possibility to automatically combine amplification, specific hybridization and detection in one single test. It allows specific and sensitive gene quantification with a minimal contamination risk, as the AmpErase UNG system can be incorporated in order to prevent post-PCR carry-over of amplified DNA. The technique has been used successfully to detect C. pneumoniae (Kuoppa et al. 2002; Tondella et al. 2002; Welti et al. 2003; Hardick et al. 2004), C. trachomatis (Solomon et al. 2003), C. felis (Helps 46 Chapter II et al. 2001; Sykes et al. 2001; Helps et al. 2003), C. pecorum (DeGraves et al. 2003), C. psittaci (Geens et al. 2005), and C. abortus (Pantchev et al. 2010). Although, the high genomic sequence similarity between C. suis and C. trachomatis made it difficult to design a sensitive C. suis-specific PCR, the analytical sensitivity of the assay was 10 rDNA copies/reaction (or two copies/µl). Besides, the C. suis real-time PCR contains two differentially labeled probes. Albeit differentially labeling is not required for the detection of all C. suis strains, their use creates the ability to differentiate the two ‘groups’ of C. suis strains which are distinguished by one single SNP in the target region. The C. suis-specific real-time PCR is suitable for diagnosis in swine as successfully demonstrated in the present case report. Importantly, the C. suis-specific real-time PCR is also suitable for human samples, as it distinguishes C. suis from i) the human pathogens C. trachomatis and C. pneumoniae and ii) the currently known zoonotic species: C. felis, C. abortus and C. psittaci. The detection of C. suis DNA as well as viable C. suis in the eyes of two slaughterhouse employees illustrates the value of this assay in future investigations on the zoonotic potential of C. suis. Becker et al. (2007) showed intensively raised pigs to be pre-disposed to chlamydial associated conjunctivitis. Transmission from infected pig eyes to humans is perhaps not unusual in highly irritant environments like a slaughterhouse and intensive pig farms. C. suis positive persons had no clinical complaints and they showed no disease symptoms. We detected only low amounts of C. suis in the eyes, and perhaps C. suis only ended up in the eyes by touching face/eyes with contaminated hands. Possibly, it was just an eye “contaminant” and not a real infection. Perhaps serology would have clarified this issue. However, employees refused to give blood during our experiment. Thus, future studies in humans should include the detection of C. suis-specific antibodies in serum or at least in conjunctival swabs. None of the participating employees was infected with C. trachomatis and both C. suis isolates were TcS. Therefore, further research is needed, sampling larger human risk populations, to estimate the prevalence of C. trachomatis and TcR C. suis strains in people working with pigs. Besides, the potential of C. suis to cause pathology in the human eye needs to be examined in more detail, especially since C. suis is phylogenetically highly related to C. trachomatis, the etiology of human trachoma and as a recent study by Deborah Dean also found C. suis in the human eye (Dean et al. 2013a). In conclusion, we designed and validated a C. suis-specific real-time PCR for use in swine and humans. The assay can be used for detection and monitoring of C. suis strains in pigs and for examining their zoonotic potential more extensively. Additionally, the real-time PCR Development of a Chlamydia suis specific real-time PCR 47 could be useful for systematic screening of boar sperm in insemination centers. The ability to detect C. suis in semen enables implementation of the appropriate measures to prevent the spread through international trade of boars and sperm.

Acknowledgements F. Boyen (Department of Pathology, Bacteriology and Poultry Diseases, UGent, Belgium), M. Uyttendaele (Department of Food Safety and Food Quality, UGent, Belgium), G. Claeys (Department of Clinical Biology, Microbiology and Immunology, UGent, Belgium) and P. Butaye (Department of Pathology, Bacteriology and Poultry Diseases, UGent, Belgium) are acknowledged for providing human or swine pathogens. A. Dumont, L. De Vogelaere and L. Devlieger are acknowledged for excellent assistance during the experiments.

Chapter III

Evaluation of the presence and zoonotic transmission of Chlamydia suis in a pig slaughterhouse

Adapted from: De Puysseleyr K., De Puysseleyr L., Dhondt H., Geens T., Braeckman L., Morré S. A., Cox E. and Vanrompay D. (2014). Evaluation of the presence and zoonotic transmission of Chlamydia suis in a pig slaughterhouse. Bmc Infectious Diseases, 14, 560. 50 Chapter III

Abstract A significant number of studies on pig farms and wild boars worldwide, demonstrate the endemic presence of Chlamydia suis in pigs. However, the zoonotic potential of this pathogen, phylogenetically closely related to Chlamydia trachomatis, is still uninvestigated. Therefore, this study aims to examine the zoonotic transmission in a Belgian pig abattoir. Presence of Chlamydia suis in pigs, contact surfaces, air and employees was assessed using a Chlamydia suis specific real-time PCR and culture. Furthermore, Chlamydia suis isolates were tested for the presence of the tet(C) gene. Chlamydia suis bacteria could be demonstrated in samples from pigs, the air and contact surfaces. Moreover, eye swabs of two employees were positive for Chlamydia suis by both PCR and culture. The tet(C) gene was absent in both human Chlamydia suis isolates and no clinical signs were reported. These findings suggest the need for further epidemiological and clinical research to elucidate the significance of human ocular Chlamydia suis infections.

Chlamydia suis in pigs and humans 51

1. Introduction

The negative influence of Chlamydiaceae infections on the economic yield of the pig industry is underestimated (Schautteet and Vanrompay 2011). Four chlamydial species are regularly observed in the pig population: Chlamydia (C.) pecorum, C. abortus, C. psittaci and C. suis (Schautteet and Vanrompay 2011). Chlamydia suis is the most prevalent and its primary pathogenicity is proven by several experimental infections in gnotobiotic pigs (Rogers and Andersen 1996; Rogers et al. 1996; Rogers and Andersen 1999; Reinhold et al. 2008b; Guscetti et al. 2009a; Pospischil et al. 2009a; Reinhold et al. 2010). In the field, this pathogen is mainly associated with respiratory disease, diarrhea, conjunctivitis, reproductive failure and subclinical infections (Pospischil et al. 2009a; Schautteet and Vanrompay 2011). Chlamydiae are generally highly sensitive to the relatively inexpensive Tc antibiotics. However, the first tetracyline resistant (TcR) C. suis strains appeared in the U.S. in 1998 (Andersen and Rogers 1998). Ever since, infections with C. suis strains have been reported on Italian (Di Francesco et al. 2008; Di Francesco et al. 2011), Estonian (Schautteet et al. 2010), Belgian, Cypriot, German, Israeli (Schautteet et al. 2013), Swiss (Borel et al. 2012) and Dutch (De Puysseleyr et al. 2014b) pig farms. The majority of these infections were due to TcR C. suis strains. Moreover all of these farms suffered from severe reproductive failure leading to marked economic loss. Exposure to TcR C. suis strains poses an additional risk for pig handlers. In fact, Suchland et al. (Suchland et al. 2009) demonstrated horizontal transfer of the Tc resistance gene tet(C) among chlamydial species. The use of Tc antibiotics as treatment for chlamydial infections in pigs, leads to selection for resistant strains (Borel et al. 2012). Consequently, the emergence of TcR strains requires the use of other, more expensive antibiotics and, may become economically devastating to pig production. Besides the economical consequences, TcR C. suis strains are also a potential threat to public health. Contact between TcR C. suis and TcS C. trachomatis bacteria might lead to creation of a TcR C. trachomatis strain in persons infected with both strains. Nevertheless, the co-infection of a person with C. suis and C. trachomatis is only possible if C. suis is a zoonotic bacteria. Albeit the zoonotic potential of C. suis is still unexamined, the zoonotic transfer of C. suis is a plausible hypothesis since C. suis is phylogenetically highly related to C. trachomatis, a natural pathogen of humans (Everett et al. 1999b). Therefore, the present study examines the prevalence of C. suis in slaughter pigs (100 kg) being slaughtered in a Belgian abattoir, and simultaneously investigates zoonotic transmission. For 52 Chapter III this purpose, slaughterhouse employees, air and possible direct contact surfaces were sampled. Pigs, air and contact surfaces were diagnosed for TcR C. suis, while humans were examined for TcR C. suis and C. trachomatis. As far as known, the present study is the first evaluation of the zoonotic potential of C. suis in a pig slaughterhouse.

2. Materials and Methods

2.1. Sampling of pigs and humans Rayon-tipped aluminium-shafted swabs (Copan; Fiers, Kuurne, Belgium) were used to sample pigs and humans. For monitoring C. suis in pigs, rectal swabs (n=100; 10 pigs of 10 Belgian farrowing to slaughter farms) were taken upon arrival in the slaughterhouse. No information on clinical signs or medication during the fattening period was available. Sampling was performed on one day. A swab for PCR was placed in DNA/RNA stabilization buffer (Roche) and a swab for culture was immersed in chlamydia transport medium (2-SP). At the same day, employees voluntarily provided (informed consent) an ocular and pharyngeal swab, and they were asked to bring a fresh stool swab and a first void morning urine sample the next day. All samples were kept at 4°C and they were stored at 80°C upon arrival in the laboratory. Volunteers filled out a medical questionnaire, in the presence of a medical doctor, to assess information on professional (work environment of the employee) and nonprofessional activities, general health status, smoking habits, use of medication, allergies and clinical signs. This study was approved by the medical ethical committee of Ghent University (approval EC UZG 2011/459). Participants provided their written informed consent and the consent procedure was approved by the medical ethical committee.

2.2. Sampling of air and contact surfaces

Bioaerosol monitoring for C. suis was performed using the MAS-100 Eco sampler (Merck, Darmstadt, Germany) as previously described (Dickx et al. 2010) at different locations in the abattoir: the pig reception area (lairage and stunning), slaughtering and bleeding area, pre- washing bath location, dehairing area, cutting/deboning area, carcass splitting area, organ evisceration area, individual weighing area, chilling/hanging room, pig intestine washing room, employee dining room, and the administrative office. In addition, also contact surfaces Chlamydia suis in pigs and humans 53 were sampled (water taps, door handles, tables, knives, start and stop button of machines) at all these locations by use of rayon-tipped aluminium-shafted swabs (Copan; Fiers, Kuurne, Belgium). Swabs were examined by PCR and culture. In addition, we also sampled water taps and door handles at the sanitary facilities at the individual weighing area, the pig intestine washing room and the cloakrooms.

2.3. DNA extraction

DNA extraction on urine samples was performed using the High Pure PCR Template Preparation (HPPTP) Kit (Roche Molecular Biochemicals, Mannheim, Germany), according to the manufacturers’ protocol (version 16.0). DNA extraction of swabs and Chlamydia cell culture harvest was performed as described by Wilson et al. (Wilson et al. 1996).

2.4. Chlamydia suis PCR

Pig swabs were examined by real-time PCRI, a 23S rRNA-based real-time PCR detecting C. suis in pigs (Pantchev et al. 2010). However, this PCR analysis cannot be used for examining transfer of C. suis to humans, as it also detects C. trachomatis. Therefore, all pig and human samples were also examined by real-time PCRII, a recently developed C. suis- specific 23S rRNA-based real-time PCR (De Puysseleyr et al. 2014b). This allowed the comparison between real-time PCRI and II, for examining C. suis. Similarly, all air and contact surface samples were analysed with PCRI and II. Samples with a Ct-value below 35 cycles, were retested. Only repeatedly positive samples were judged as positive. Genomic DNA of the C. suis reference strain S45 was used as positive control DNA (105 particles per reaction), and DNAse –RNAse free water as negative control.

2.5. Chlamydia trachomatis PCR

All ocular and pharyngeal swabs and urine samples of the employees were tested for presence of C. trachomatis DNA using the CE-IVD certified PRESTO Kit (Goffin Molecular Diagnostics, Houten, The Netherlands) according to manufacturer’s instructions (Schuurs et al. 2013).

54 Chapter III

2.6. Culture

All samples were examined for viable chlamydial bacteria in cycloheximide-treated Vero cells using standard techniques (Vanrompay et al. 1992). Positive cells were enumerated in five randomly selected microscopic fields (600 x, Nikon Eclipse TE2000-E, Japan) and results were scored from 0 to 6. Score 0 indicated that no chlamydiae were present; Score 1 was given when a mean of 1 to 5 non-replicating elementary bodies (EB’s) plus maximum one inclusion (elementary and replicating reticulate bodies) with multiplying EB’s was observed; scores 2 to 5 were given when observing a mean of 2 to 5, 6 to 10, 11 to 15, 16 to > 90% inclusion positive cells (Lagae et al. 2014).

2.7. Molecular characterization of Chlamydia isolates

Chlamydial isolates were molecularly characterized by real-time PCRII (De Puysseleyr et al. 2014b) and DNA sequence analysis of the 16S (298 bp) and 23S (627 bp) signature sequences of Chamydia (Everett et al. 1999b). Sequence analyses were performed by the VIB Genetic Service Facility (University of Antwerp, Antwerp, Belgium).

2.8. Tet(C) PCR

Chlamydia suis isolates of pigs and humans were examined for presence of the Tc resistance gene by the tet(C) PCR, as described by Dugan et al. (Dugan et al. 2004).

Chlamydia suis in pigs and humans 55

3. Results

3.1. Chlamydia suis in pigs

Rectal swabs of 100 pigs were examined by real-time PCRI and II. Real-time PCRI revealed 45 (45%) positives. The Ct-values varied between 26.6 and 32. PCRII discovered 7 additional positives, resulting in a final number of 52 positives on 100 (52%) pigs, with the number of positives per farm ranging from 2 (20%) to 10 (100%). This finding is consistent with the reported higher sensitivity of PCRII (De Puysseleyr et al. 2014b) compared to PCRI (Pantchev et al. 2010). The Ct-value of real-time PCRII varied between 16.8 and 30.1. PCRII positive pigs were found on all farms. The percentage of PCRII positive pigs per farm ranged from 10 to 100%. Fifteen of 52 (28.8%) PCR positive pigs excreted C. suis, as demonstrated by PCRII and DNA sequencing of 16S and 23S signature sequences of obtained Chlamydia isolates. Those 15 culture positives originated from 8 of 10 examined farms. Three of 15 (20%) C. suis isolates contained the tet(C) gene (Figure III-1). Chlamydia suis tet(C) positives were found on 3 of 10 farms.

Figure III-1 Results of the Tc resistance PCR performed on swine and human Chlamydia suis isolates. Three Chlamydia suis strains isolated from pigs were tetC positive. The other 12 obtained swine isolates, whereof three are represented, and both human isolates, were tetC negative.

3.2. Chlamydia suis and Chlamydia trachomatis in humans

Only 12 of 84 (14.3%) employees participated. The age of the participants varied between 25 and 60 years with an average of 43 years. The set of 48 human samples comprised: 12 conjunctival, 12 pharyngeal, 12 stool and 12 urine samples, which were all examined for C. suis and C. trachomatis. Samples were negative for C. trachomatis. Pharyngeal, stool and urine samples were negative for C. suis by both real-time PCRI and II. However, 2 of 12 (16.6%) conjunctival swabs were positive in real-time PCRII, showing Ct-values of 26 and 28, respectively. Those two swabs were negative by real-time PCRI. Positive real-time PCRII results were confirmed by culture (both score 1), as we isolated C. suis from both conjunctival swabs (Figure III2). None of the human C. suis isolates contained the tet(C) gene 56 Chapter III

(Figure III1). Both C. suis positive employees worked daily in the abattoir. One of them worked in the pig intestine washing room during the last three years and the other person was responsible for the bleeding of the pigs during the last eight years. They had no clinical signs or disease complaints while being examined by the occupational physician, nor did they mention having symptoms related to eye infections, ever since working in the slaughterhouse.

Figure III-2 Micrographic image of one of the obtained human C. suis isolates. The larger green spot, adjacent to the red stained cell nucleus, represents a chlamydial inclusion. The small green dots, indicated with a white arrow, are chlamydial EBs. This image corresponds to a culture score of 1. (Magnification 400x)

Chlamydia suis in pigs and humans 57

3.3. Chlamydia suis on contact surfaces

Contact surfaces were all negative by real-time PCRI. Real-time PCRII could discover C. suis DNA, albeit small amounts (Ct-values ranging from 32.5 to 34.1) on contact surfaces of nine of the 14 sampled work locations in the slaughterhouse. For six of these locations, positive real-time PCRII results were confirmed by culture (culture score 1) (Table III1).

Table III-1 Results of the molecular analyses on contact surface samples at different locations in the abattoir. Location PCRII Viable C. suis

Pig reception area - -

Slaughtering and bleeding area + +

Pre-washing bath location - -

Dehairing area + +

Cutting/deboning area - -

Carcass splitting area + -

Organ evisceration area - -

Individual weighing area + +

Chilling/hanging room - -

Pig intestine washing room + -

Employee dining room + +

Sanitary facilities at the individual wheighing area + -

Sanitary facilities at the pig intestine washing room + +

Sanitary facilities at the cloakrooms + +

Total (positives/examined) 9/14 6/14

Swabs in DNA/RNA stabilization buffer were used to detect the presence of C. suis DNA by use of PCRI and II. The results of the PCRII analysis are mentioned in column ‘PCRII’. Swabs in 2-SP medium were inoculated on Vero-cells for evaluation of the presence of viable chlamydiae. Culture positive chlamydial isolates were analyzed using PCRII for subsequent molecular detection of C. suis. Results are shown in column ‘viable C. suis’. All culture positive samples showed isolation score 1.

58 Chapter III

3.4. Chlamydia suis bioaerosol monitoring

Air samples were all negative by real-time PCRI. Real-time PCRII could discover small amounts of C. suis DNA (Ct-values ranging from 32.5-34.12) in the air of seven of ten sampled locations. Positive real-time PCRII results were confirmed by culture for five of these locations (Table III2). Table III-2 Results of the molecular analyses on air samples at different locations in the abattoir. Location PCRII Viable C. suis Isolation score

Pig reception area + - 4

Slaughtering/bleeding area + - -

Pre-washing bath location + + 2

Dehairing area + + 2

Organ evisceration area + + 1

Individual wheighing area - - -

Chilling/hanging room + + 2

Pig intestine washing room + + 4

Dining room - - -

Administration office - - -

Total (positives/examined) 7/10 5/10

All samples were used for direct detection of C. suis DNA, by use of PCRI and II (results in column ‘PCRII’), for inoculation on Vero cells (results in column ‘Isolation score’) and subsequent identification of C. suis (column ‘viable C. suis’).

Chlamydia suis in pigs and humans 59

4. Discussion

The present study examines the occurrence of TcR C. suis strains in slaughter pigs being slaughtered in a Belgian abattoir and, at the same time, is focusing on zoonotic transmission of C. suis. Chlamydia suis infections are emerging worldwide in the pig industry (Schautteet and Vanrompay 2011). Increased awareness of veterinarians and improved diagnostics might explain, albeit partially, the increasing number of reports on C. suis outbreaks in pigs (Sachse et al. 2005; Pantchev et al. 2010). However, we are unaware if contact with C. suis infected pigs presents a public health risk, in particular for pig farmers and abattoir employees. After all, C. suis is phylogenetically highly related to the human pathogen C. trachomatis (Everett et al. 1999b). Moreover, both pathogens cause infections of the eye and urogenital tract in their natural hosts (Schautteet and Vanrompay 2011). Recently, Dean et al. examined 101 conjunctival samples of trachoma (preventable blindness) patients who resided in a trachoma- endemic region of Nepal (Dean et al. 2013b). They found two C. suis infections and five mixed C. trachomatis plus C. suis infections, all leading to trachomatous inflammation. Hence, zoonotic transmission is likely. Besides, the number of reports on TcR C. suis infections in pigs is augmenting (Andersen and Rogers 1998; Lenart et al. 2001; Camenisch et al. 2004; Di Francesco et al. 2008; Borel et al. 2012; Schautteet et al. 2013). In 2010, Schautteet et al. demonstrated tet(C) positive C. suis strains in 10 examined Belgian farms and in 8 on 49 (16.3%) sick pigs ending up in the autopsy room of DGZ-Animal Health Care Flanders (Schautteet et al. 2010). Hence, the previously reported epidemiology of C. suis in Belgian pigs is confirmed by the present study since we found tet(C) positive C. suis strains in 8 of 10 examined Belgian farms. Therefore, a pig slaughterhouse is a confirmed risk environment to study the zoonotic transfer of C. suis. Employees provided urine and ocular, pharyngeal and fresh stool swab specimens for both PCR and culture. Two of 12 examined employees tested positive for C. suis by PCR and culture. However, only 12 of 84 employees participated, which was low compared to former similar studies on C. psittaci zoonotic transmission in poultry abattoirs (Dickx et al. 2010). Analysis of the answers on all questionnaires indicated that there were no clinical complaints, and the yearly routine medical examination revealed no clinical signs of infection, although viable C. suis were found in the eyes of two employees. Both individuals worked for several years in the abattoir, in the pig intestine washing room and in the slaughtering and bleeding area, respectively. Thus, exposure to blood and intestinal contents might present a source of C. suis for transmission to humans, but it is not strictly leading to a symptomatic course of 60 Chapter III infection. Employees may be regularly exposed to C. suis and therefore could have natural immunity against disease. Serological analyses could have clarified this issue, however, employees did not give their consent for blood sampling. Contact surfaces at both locations were equally positive by both PCR and culture. Thus, Chlamydia suis could have ended up in the eyes through direct contact of hands with ‘contaminated’ contact surfaces. Besides, bioaerosol monitoring demonstrated high amounts (score 4) of viable C. suis in the air of the the intestine washing room. However, the air of the slaughtering and bleeding area was negative in isolation, suggesting the air is not the main C. suis transmission route. Nevertheless, sampling was only performed at one time point and may not completely reflect the actual exposure. Repeated sampling might clarify this issue. Further studies on larger risk populations should be conducted to get more insight into transmission routes and clinical consequences of C. suis in humans.

Conclusion The present study shows the presence of viable C. suis bacteria in the eyes of two employees and in air samples and contact surfaces along the slaughter line. None of the human C. suis isolates contained the tet(C) gene and both humans were negative for C. trachomatis. However, the adaptive ability of C. suis to acquire the tet(C) gene, especially when exposed to selective pressure, and the possibility of C. suis transfer to humans could have far-reaching consequences for public health. Preventive measures might reduce the risk of C. suis transfer to slaughterhouse employees. Besides, further epidemiological and clinical research towards human ocular C. suis infections is of great importance.

Acknowledgements Annelien Dumont, Lien De Vogelaere and Line Devlieger are acknowledged for technical assistance during the experiments. This study was funded by the Federal Public Service of Health, Safety of the Food Chain and Environment (convention RF-10/6234), Ghent University (IOF/STARTT/002) and MSD Animal Health (Boxmeer, The Netherlands).

Chapter IV

Identification of specific and antigenic epitopes for serodiagnosis of Chlamydia suis

This chapter will be published as: De Puysseleyr K., De Puysseleyr L., Dean D., Huot-Creasy H., Myers G., Cox E. and Vanrompay D. Identification of specific and antigenic epitopes for serodiagnosis of Chlamydia suis. In preparation. 62 Chapter IV

Abstract Chlamydia suis is widespread among commercial pigs and clinical consequences of infections are well documented. The appearance of TcR strains and recent reports on zoonotic transfer of Chlamydia suis, have raised concerns on the risk associated with the emergence of TcR Chlamydia trachomatis strains, leaving antibiotic treatments ineffective, possibly affecting millions of people worldwide. In this context, detection of Chlamydia suis antibodies in swine and human sera to confirm infections in swine and humans is indispensable. However, a Chamydia suis-specific serodiagnosis assay is currently unavailable. This present study aims to identify an antigenic and Chlamydia suis specific peptides for serodiagnostic use. Three promising candidate proteins were selected based on a literature overview of the knowledge obtained from other species. The respective protein sequences were aligned to identify Chlamydia suis-specific peptides. Sequence alignments and software-based antigenicity analysis were combined with the in vitro screening for Chlamydia suis-specific antigens using a panel of control sera of pigs. The use of an additional set of molecularly-characterized field sera demonstrated the suitability of two peptide antigens for use in serodiagnosis of C. suis in swine. Although further optimization of the assay is required and the specificity of the antigens for C. suis remains to be confirmed using C. trachomatis antisera, one of the peptides is as well promising for development of an assay for serodiagnosis in humans.

The results represented in this chapter will be used to file a patent application. Therefore, the identity of the selected candidate proteins or peptide sequences will not be disclosed.

Serodiagnosis of Chlamydia suis in pigs and humans 63

1. Introduction

Chlamydiaceae species are well known pathogens, and cause a wide variety of symptoms in both animals and humans (Longbottom and Coulter 2003). Beside the well documented zoonotic potential of Chlamydia (C). abortus and C. psittaci, only recently, a few studies report the isolation of C. suis strains from human eyes (Dean et al. 2013b; De Puysseleyr et al. 2014a). The source of a zoonotic C. suis infection is the pig, the only animal host for this bacteria. Although C. suis is considered to be the most prevalent chlamydial species, pigs can also become infected by C. pecorum, C. abortus and C. psittaci (Schautteet and Vanrompay 2011). Porcine chlamydial infections are not always associated with symptoms, but if so, they lead to important economical losses due to arthritis, pericarditis, polyserositis, pneumonia, conjunctivitis, enteritis, diarrhea and reproductive failure (Willigan and Beamer 1955; Sarma et al. 1983; Woollen et al. 1990; Zahn et al. 1995; Andersen and Rogers 1998; Eggemann et al. 2000). Diagnosed infections are commonly treated with Tc antibiotics, however, more and more TcR C. suis strains are emerging (Andersen and Rogers 1998; Di Francesco et al. 2008; Schautteet et al. 2010; Di Francesco et al. 2011; Borel et al. 2012; Schautteet et al. 2013). In vitro transfer of the antibiotic resistance genes between chlamydial species is demonstrated by Suchland et al. (Suchland et al. 2009). These findings raise another point of concern associated with the possible zoonotic character of C. suis. Co-infection of a human individual with a TcR C. suis and the phylogenetically closely related human pathogen C. trachomatis, creates the ideal setting for transfer of the resistance gene and emergence of a TcR C. trachomatis strain. To avoid creation of multi-resistant strains, comprehensive knowledge about the epidemiology and infection biology of C. suis is required. Recent efforts were done to develop C. suis specific molecular tests (De Puysseleyr et al. 2014b; Lis et al. 2014) and to apply these analyses to investigate the presence of C. suis in a human risk population (De Puysseleyr et al. 2014a). However, the presence of viable C. suis bacteria in animal or human samples may still be a result of contamination and is no foolproof evidence for an existent infection. Additional serological tests to demonstrate an anti-C. suis antibody response may show the presence of an immunological response and thus confirm the zoonotic transfer of C.suis. Unfortunately, at present, no assay for C. suis specific serodiagnosis is available. Numerous serological assays targetting chlamydial antigens or anti-chlamydial antibodies are published (Sachse et al. 2009). Assays based on detection of antibodies directed against the full length proteins or peptides from the surface exposed lipopolysaccharide (LPS) (Wittenbrink et al. 1991), major outer membrane protein (MOMP) (Vanrompay et al. 2004), 64 Chapter IV polymorphic outer membrane proteins (Pmps) (Longbottom et al. 2001) or whole elementary body (EB) preparations (Di Francesco et al. 2006), were developed with varying degrees of success in terms of sensitivity and specificity. Nevertheless, no studies to identify the major reactive antigens of C. suis have been published until today. Therefore, a literature overview of the knowledge obtained from other species was used during the present study to select protein candidates for identification of antigenic and C. suis specific peptides to develop a serological test. For reasons of confidentiality in view of valorization, the identity of the selected candidates is not disclosed in this thesis. Instead, the respective proteins are designated ProteinA, B and C.

Serodiagnosis of Chlamydia suis in pigs and humans 65

2. Materials and Methods

2.1. Bacterial strains

The following strains were used for production of experimental sera in 4-weeks-old piglets: C. suis strains S45, R19 and H7; C. abortus (S26/3); C. psittaci (98AV2129); C. pecorum (1710S). Bacteria were grown in cycloheximide treated McCoy cells according the standard methodology described previously (Vanrompay et al. 1992). Chlamydiae were released from infected monolayers by freezing and thawing prior to ultrasonication (Bransonic 12, BIOMEDevice, San Pablo, CA, USA). Cell culture harvest was centrifuged for 10 min (1000xg, 4°C) and bacteria were subsequently concentrated by ultracentrifugation for 45 minutes (50.000xg, 4°C). Chlamydiae were resuspended in 2 ml sucrose phosphate glutamate buffer (SPG, 218 mM sucrose, 38 mM KH2PO4, 7 mM K2HPO4, 5 mM L-glutamic acid) and stored at –80°C until use.

2.2. Pig sera

Sera were derived from non-infected, naturally infected and experimentally infected/immunized pigs. For experimental infection of four-weeks-old SPF pigs, 106 bacteria were administered orally, intravaginally and via aerosolization. Two pigs were inoculated with the C. suis reference strain S45. In addition, one pig was infected for each of the C. suis strains H7 and R19, the C. abortus S26/3 strain, and the C. psittaci 98AV2129 strain. Pigs were euthanized four weeks post infection. For immunization of four-weeks-old SPF piglets, 106 bacteria (of the C. abortus strain S26/3 or C. pecorum 1710S) were mixed with equal volumes of complete Freund’s adjuvant (CFA; Sigma, Diegem, Belgium) and injected subcutaneously. Two weeks later, immunization was repeated to boost antibody production using incomplete Freund’s adjuvant (Sigma, Diegem, Belgium). Pigs were euthanized three weeks after booster immunization and blood was collected. Immunization and infection experiments were approved by the medical ethical committee of Ghent University (approval EC2012/078). Naturally infected pigs were sampled in a Belgian pig slaughterhouse. Blood and rectal swabs were collected from 83 animals, originating from 8 different farms. No information concerning the health status or antibiotic treatment of the sampled pigs was available. Swabs were stored in DNA/RNA stabilization buffer (Roche, Brussels, Belgium) at -80°C for PCR analysis. DNA extraction was performed using the G-spin Total DNA Extraction Mini Kit (Goffin Molecular Biotechnologies, Beek, The Netherlands) according to the instructions of 66 Chapter IV the manufacturer. The resulting DNA extract was analyzed using a C. suis specific real-time PCR (De Puysseleyr et al. 2014b), to confirm the presence of C. suis in the sampled pigs. Additionally, a set of 10 sera originating from 4-weeks-old SPF-piglets were used as negative control sera. All blood samples were incubated overnight at room temperature. Sera were collected, heat inactivated for 30 min at 56°C and kaolin treated to reduce background reading (Novak et al. 1993). Four volumes of a kaolin suspension (25% (w/v) in PBS; pH 7.4) were added to one volume of serum and incubated at room temperature for 30 min. The samples were centrifuged (5500xg for 10 min) and the supernatant was stored at -20 °C. All sera were tested for the presence of anti-MOMP antibodies in a direct ELISA using C. trachomatis recombinant MOMP (CT rMOMP ELISA) as antigen (Schautteet et al. 2011). The test allows the detection of family-specific MOMP antibodies since the family specific epitope is located in the conserved region of MOMP (Stephens et al. 1998). The positive cut- off value was calculated as the mean of the OD-values of negative control pigs sera plus twice the standard deviation.

2.3. Selection of the peptides

2.3.1. ProteinA The ProteinA amino acid sequences of C. suis MD56 were compared to the sequences of the reference strains A/Har-13 and L2/434/BU (C. trachomatis). The clustal omega program was used to construct multiple sequence alignments, using default parameters (Thompson et al. 1997). Nine regions were selected as templates for production of 152 synthetic peptides, which were produced by Pepscan Systems (Lelystad, The Netherlands). Peptides were eight amino acid residues in length, with an overlap of six residues. All peptides contained an N- terminal acetyl group and were C-terminal attached to polyethylene pins via incorporation of an extra cysteine at an amount of 100 µg per pin. The peptide coated pins were assembled on a polyethylene carrier in a ‘96-well format’. This enables the use of the pins for an ELISA assay in a 96-well microplate (referred to as ‘pinELISA’).

Serodiagnosis of Chlamydia suis in pigs and humans 67

2.3.2. ProteinB and ProteinC Identification of the C. suis specific regions using amino acid sequence alignments was combined with an epitope prediction of the identified sequences, for selection of a specific and antigenic peptide. Alignments were constructed with the clustal omega program using default parameters (Thompson et al. 1997). The strains used to create the ProteinB and ProteinC alignments are listed in Table IV- 1. The B-cell epitope prediction of the identified C. suis specific regions was performed using tools provided by the Immune Epitope Database Analysis Resource (IEDB analysis resource; http://tools.immuneepitope.org/main/index.html). This website offers a collection of six tools for the prediction of linear epitopes from protein sequences (Chou and Fasman Beta-Turn (Chou and Fasman 1978), Emini surface Accessibility (Emini et al. 1985), Karplus and Schulz Flexibility (Karplus and Schulz 1985), Kolaskar and Tongaonkar Antigenicity (Kolaskar and Tongaonkar 1990), Parker Hydrophilicity (Parker et al. 1986) and Bepipred Linear Epitope prediction (Larsen et al. 2006)).

Table IV-1 Overview of the chlamydial strains used to construct the amino acid sequence alignment to identify C. suis-specific regions in the ProteinB and ProteinC sequences. ProteinB Species Strain Source H7, R16, R1, R33, H5, R19, S45, R24, C. suis Deborah Dean, unpublished data 130 Rogers, R27, R22, R28 C. psittaci 6BC Genbank* C. pecorum E58 Genbank* C. abortus S26/3 Genbank* C. trachomatis A/HAR-13 and 434/Bu Genbank*

ProteinC Species Strain Source C. suis S45 Deborah Dean, unpublished data C. psittaci 6BC Genbank*

C. pecorum MC Marsbar Genbank* C. abortus S26/3 Genbank* C. trachomatis A/HAR-13 and 434/Bu Genbank*

*The accession numbers of ProteinB and C are not disclosed in this thesis for reasons of confidentiality in view of valorization. 68 Chapter IV

2.3.3. Pin ELISA

2.3.3.1. Experimental Sera

Pins were blocked with blocking buffer (0.01M PBS* [7.5 mM Na2HPO4, 145 mM NaCl,

3.25mM NaH2PO4.2H2O; pH=7.2] supplemented with 0.1% Tween 20 and 5% BSA) for 3 hours, at room temperature (RT) and 100 rpm. Subsequently, pins were washed three times (washing buffer [0.01M PBS*, 0.1% Tween 20], 10 min, 100 rpm). Sera were diluted in dilution buffer (0.01M PBS*, 3%BSA, 0.1% Tween 20) and incubated overnight at 4°C and 100 rpm. After another washing step, pins were incubated in a 1000-fold dilution of polyclonal HRP conjugated anti-swine IgG (H+L) antibody (Bethyl Laboratories, Montgomery, USA) for 1 hour at room temperature and 100 rpm. After a final washing step, the optical density (OD) at 405 nm was measured upon addition of hydrogen peroxide and ABTS substrate (KPL, Gaithersburg, Maryland, USA). Stripping of the bound antibodies after measurement enabled re-use of the pin peptides. Therefore, pins were sonicated (70°C, 40 kHz) for 1 hour in disrupt buffer solution (0.1M Na2HPO4.2H2O, 35 mM SDS, 0.1% 2- mercapto-ethanol; pH 7.2) followed by 30 min sonication in ultra pure water. Pin peptides were stored at -20°C. For use in the pinELISA, experimental sera were diluted to the minimal concentration needed to exceed the positive cut-off value in the CT rMOMP ELISA. Thus, all experimental sera were used at approximately the same anti-chlamydial antibody concentration, to reduce false positive results due to background reading.

2.3.3.2. Interpretation of data All data obtained with experimental sera were corrected for background signal using the values of the negative control serum. In order to find a C. suis specific antigen, peptides were selected for high OD-values for the anti-C. suis experimental sera and low OD-values for sera of animals infected/immunized with C. abortus, C. psittaci or C. pecorum.

2.3.3.3. Field sera The pin ELISA protocol was slightly altered to test the set of ‘field sera’, obtained by sampling SPF-piglets and slaughter pigs (slaughterhouse). The blocking step was extended to an overnight incubation, and the sera were incubated for 1 hour at 37°C instead of at 4°C overnight. All field sera were tested in two dilutions: 1/100 and 1/500. The positive cut-off value was calculated as the mean of the OD values of negative control pigs sera plus twice the standard deviation and appeared to be 0.5. Serodiagnosis of Chlamydia suis in pigs and humans 69

3. Results

3.1. In silico selection of C. suis specific peptides

3.1.1. ProteinA The amino acid sequence alignments were used to search for the C. suis sequences with the highest divergence compared to C. trachomatis. Nine ‘C. suis specific regions’ were purchased as overlapping pin peptides (eight amino acids in length with a six residue overlap) for further in vitro specificity testing.

3.1.2. ProteinB Similarly to the approach used for ProteinA, amino acid sequences were searched for C. suis specific regions, using alignments. The pairwise ProteinA sequence similarity among the considered C. suis strains varied from 76% to 100%. As expected, C. suis is among all species mostly related to C. trachomatis, with observed homology percentages ranging from 64 to 86 %. The overall sequence similarity for the five considered chlamydial species varied from 59 to 85 %. The multiple sequence alignment allowed the selection of a 52 amino acid region that is conserved among the considered C. suis strains and contains a high concentration of C. suis specific amino acid residues. In silico epitope prediction enabled the identification of an eight residue peptide (PeptideB), able to discriminate C. suis from the other chlamydial species occurring in pigs. However, it was unfeasible to select an antigenic ProteinB peptide to distinguish C. trachomatis from all available C. suis sequences. Therefore, PeptideB peptide is only valuable for serodiagnosis in pigs. PeptideB was purchased from pepscan (Lelystad, The Netherlands) in a pinELISA format for further in vitro specificity testing.

3.1.3. ProteinC Alignment of all available C. trachomatis ProteinC sequences showed a high sequence conservation, with pairwise sequence identities ranging from 91 to 100%. When comparing the ProteinC sequences of C. suis S45 and C. trachomatis, on average 60% of the sequence is identical. The C. pecorum, C. psittaci and C. abortus ProteinC sequence showed on average 33% sequence similarity to C. suis and C. trachomatis. The results of the protein sequence alignments, combined with epitope prediction, enabled the selection of the eight amino acid peptide (PeptideC). 70 Chapter IV

3.1.4. In vitro selection of a ProteinA

3.1.4.1. Optimization of experimental sera dilution The optimal dilution of the experimental sera for use in the pin ELISA, was determined by analysis of a two-fold dilution series in the CT rMOMP ELISA. The obtained optimal dilutions ranged from 1/3.5 to 1/896. More detailed results are represented in Table IV2.

Table IV-2 The optimal dilution of the experimental sera based on the results of the C. trachomatis rMOMP ELISA. Species Strain Titer C. suis# S45_1 1/224 S45_2 1/112 H7 1/3.5 R19 1/7 C. abortus# S26/3_1 1/100 C. abortus* S26/3_2 1/896 C. pecorum* 1710S 1/448 C. psittaci# 98AV2129 1/857

*: sera obtained after immunization; #: sera obtained after infection

3.1.4.2. ProteinA peptide ELISA with experimental sera The 152 ProteinA peptides were screened for sensitivity and specificity for C. suis with the experimental sera. One peptide, PeptideA, was selected based on maximal OD-values for C. suis antisera and minimal OD-values for C. abortus, C. psittaci and C. pecorum antisera.

3.1.5. Specificity testing of PeptideB and C with experimental sera Both peptides showed no cross reaction to the C. abortus, C. pecorum and C. psittaci antisera. Moreover, all C. suis antisera clearly reacted to PeptideB with OD-values exceeding the cut- off (0.5). However, for PeptideC, the OD values of the C. suis S45_1 and R19 antisera did not reach the cut-off. Therefore, the PeptideC was no longer considered as an antigen candidate and excluded from further experiments. Serodiagnosis of Chlamydia suis in pigs and humans 71

3.1.6. Validation of the Peptide A and B antigens

3.1.6.1. Molecular characterization of field sera The field sera, sampled in the slaughterhouse, were molecularly characterized, using two tests. The presence of C. suis bacteria in the sampled pigs was detected by examination of rectal swabs using the C. suis specific real-time PCR. Bacterial DNA was detected in 69 of 83 swabs. Furthermore, to detect anti-chlamydial antibodies, all sera were analyzed at a dilution of 1/100 using the CT rMOMP ELISA. Sixty-eight of 83 serum samples were positive. According to these results, the set of field samples originating from the slaughterhouse was divided in three groups: group A consisted of 64 sera originating from pigs that were positive in both real-time PCR and CT rMOMP ELISA, group B contained 9 sera and was subdivided in groups B1 and B2. The four sera of group B1 were sampled from PCR negative pigs and showed a clear response in the CT rMOMP ELISA. The five sera of group B2, sampled from PCR positive pigs, showed no response in the CT rMOMP ELISA. Group C comprises 10 sera negative in both tests.

3.1.6.2. Pin ELISA The sera of group A, B and C were used to validate the performance of the selected peptides for use in detection of anti-C. suis antibodies. An additional group (D) that contained sera of 10 SPF-animals, served as an extra negative control group. All field samples were tested at dilutions 1/100 and 1/500. However, the majority of the OD-values of the 100-fold dilutions reached the upper detection limit of the used technology, possibly partly due to background reading. Therefore, field samples were tested in a 500-fold dilution in subsequent experiments. The cut-off value was calculated at 0.5. All sera of the negative control groups C and D were negative in the PeptideA and PeptideB ELISAs. In 50 of 64 sera of the positive control group A, antibodies for both peptides were demonstrated. Twelve sera contained anti-PeptideA antibodies, but no anti-PeptideB antibodies. The two remaining sera showed no response for both candidate antigens. All sera of group B1 showed a clear response to both candidate peptides. For three (of five) sera of group B2, only anti-PeptideA antibodies were demonstrated. The remaining two (of five) sera showed no response to both candidate peptides. Table IV3 summarizes the obtained results of the field sera.

72 Chapter IV

Table IV-3 Results of the C. suis real-time PCR, CT rMOMP ELISA and C. suis PeptideA and B ELISAs on 83 field sera. Positive in Group Number Real-time CT rMOMP PeptideB PeptideA PCR ELISA ELISA ELISA

A 64 64 64 50 [0.77±0.33] 62 [0.96±0.34] B1 4 0 4 4 [0.67±0.08] 4 [1.16±0.33] B2 5 5 0 0 3 [0.67± 0.15] C 10 0 0 0 0 D 10 NP 0 0 0 NP: not performed; The values of the average OD and associated standard deviations are respectively represented between brackets.

Serodiagnosis of Chlamydia suis in pigs and humans 73

4. Discussion

The present study aimed to identify a C. suis specific and antigenic peptide for serodiagnostic use. Specific detection of anti-C. suis antibodies can provide the evidence for an existent infection in pigs and humans, an essential factor in the study of the zoonotic transfer of this microbe. Unfortunately, to date, no sensitive C. suis specific assay is available for animal or human serodiagnosis. In fact, seroprevalence studies in pigs are based on detection of antibodies against LPS, MOMP and whole EB preparations and serological cross-reactions with antibodies against other chlamydial species or other pathogens do occur (Schautteet and Vanrompay 2011). Specificity of an assay can be improved by using protein fragments or peptides instead of full length proteins, due to the reduced incidence of cross-reactions. However, direct coating via passive adsorption to the polystyrene surface of microplates in alkaline conditions is less efficient for peptide antigens compared to full length proteins. Nevertheless, several technical solutions, like synthesis of peptide-dextran conjugates (Bocher et al. 1997), the use of a streptavidin-biotinylated peptide system (Ivanov et al. 1992), or the use of a capture antibody (sandwich ELISA), have been developed to resolve these coating difficulties. Moreover, several peptide based ELISAs for chlamydiae are already developed and successfully used for serodiagnosis. Longbottom et al. applied a protein fragment of the Pmp90 protein of C. abortus (Longbottom et al. 2002). Furthermore, peptides of the MOMP variable domain IV are used as the antigen in commercially available ELISAs for C. trachomatis (Medac, Wedel, Germany). Since C. suis and C. trachomatis are phylogenetically closely related and the availability of C. suis sequence information is rather limited, the selection of a specific antigen is rather complex. Therefore, the present study focused on the identification of eight-aminoacid peptide antigens to minimize cross-reactions to other pathogens. Based on the literature on antigen discovery in C. trachomatis , C. abortus and C. suis , three candidate proteins were chosen for screening for a C. suis specific antigen. Although the in silico analysis of the C. suis ProteinA and C was based on the sequences of only two strains (S45 and MD56 respectively), the in vitro screening was executed with sera of pigs infected with H7, S45 and R19 to compensate for this in silico limitation. Hence, the methodology screens for representative peptide antigens for all used C. suis strains and led to the selection of three peptides for further testing using experimentally generated positive and negative control sera. The quality of the two remaining peptides was assessed using molecularly characterized pig sera. Real-time PCR of rectal swabs and an ELISA based on the full length recombinant 74 Chapter IV

MOMP of C. trachomatis, were used to create four control groups of sera. The real-time PCR enabled the sensitive and specific detection of C. suis bacteria (De Puysseleyr et al. 2014b). Recombinant MOMP based detection of anti-chlamydial antibodies has been applied successfully in several former studies (Vanrompay et al. 2004; Verminnen et al. 2006; Schautteet et al. 2011). All sera of the negative control groups C and D were negative in the PeptideA and B ELISAs. The absence of reactivity of negative control sera supports the specificity of the peptides for serodiagnosis of C. suis. The high reaction rate of the positive control sera of group A confirms the antigenicity of both peptides. Furthermore, twelve positive control sera contained anti-PeptideA, but no anti- PeptideB antibodies, suggesting the PeptideA antigen performs better in terms of sensitivity. However, two sera from pigs that reacted positive in real-time PCR and CT rMOMP ELISA, showed no response for both candidate antigens. These false negative observations could be attributed to an inability of the peptide antigens to detect certain C. suis strains. However, false positive results of the CT rMOMP ELISA could have caused the incorrect assessment of the two sera as true positives. After all, cross-reaction with other pathogens is common when using full length proteins as antigens (Schautteet and Vanrompay 2011). Nevertheless, since the CT rMOMP ELISA is a family-specific assay, also antibodies produced in response to infections with other chlamydial species, are detected. In fact, mixed infections of chlamydial species may occur in pigs (Szeredi et al. 1996; Hoelzle et al. 2000). Additional analysis of the used sera to detect the presence of antibodies to different antigens of other chlamydial species might clarify the real nature of the negative result of these two positive control sera. Group B contained sera from pigs that were negative in PCR, but positive in the CT rMOMP ELISA (B1) or vice versa (B2). All four sera of group B1 showed a clear response to both peptides. In fact, this may indicate a prior infection since antibodies were present, but no bacteria could be demonstrated. The five samples assembled in group B2 were derived from PCR positive pigs, but contained no anti-CT rMOMP antibodies. All five sera were negative in the PeptideB ELISA, however, anti-PeptideA antibodies were demonstrated in three sera. This observation is consistent with a higher sensitivity of PeptideA compared to PeptideB when testing positive control sera, especially since equal amounts of both antigens were used. In general, the peptide ELISAs seem to be more sensitive compared to the CT rMOMP ELISA, however, it should be mentioned that the total amount of antigen used in the pin ELISA assays is rather high (100µg), especially compared to cell lysates containing recombinantly produced MOMP. Yet, full length proteins are considered to be far more antigenic than peptides. The remaining two (of five) sera of group B2 showed no response to Serodiagnosis of Chlamydia suis in pigs and humans 75 both candidate peptides, possibly due to a very limited or absent antibody response in the pigs. In summary, analysis of the experimental sera and molecularly characterized field sera demonstrated the suitability of the PeptideA and B antigens for use in serodiagnosis of C. suis in swine. Moreover, PeptideA appeared more sensitive compared to PeptideB, and PeptideA is as well promising for development of an assay for serodiagnosis in humans. However, the set of experimental sera, used for preliminary specificity screening did not include a C. trachomatis antiserum. Therefore, the specificity of the antigens for C. suis remains to be confirmed using C. trachomatis antisera. Furthermore, optimization of the used reagents, including antigen concentration and serum and secondary antibody dilutions, are required. In addition, the performance of the ELISA test, such as the sensitivity and specificity, needs to be evaluated using a larger set of negative and positive control sera, in order to validate the assay.

Acknowledgments Annelien Dumont, Julie Geldhof, Isabelle Kalmar, Matthias Van Gils and Bakr Ahmed are acknowledged for technical assistance during the experiments. This study was funded by the Federal Public Service of Health, Safety of the Food Chain and Environment (convention RF- 10/6234), Ghent University (IOF/STARTT/002) and MSD Animal Health (Boxmeer, The Netherlands).

Chapter V

General discussion and perspectives

General discussion and perspectives 79

Significance of chlamydiae in pigs Chlamydiae are widespread in farmed pigs throughout the world (Schautteet and Vanrompay 2011) and are found in wild boars (Di Francesco et al. 2011). Chlamydia suis is the most prevalent species and its primary pathogenicity for the respiratory system, the gastrointestinal tract, the conjunctiva and the urogenital tract has been proven by several experimental infections in gnotobiotic and conventionally raised pigs (Rogers and Andersen 1996; Rogers et al. 1996; Rogers and Andersen 1999, 2000; Sachse et al. 2004; Reinhold et al. 2008b; Guscetti et al. 2009a; Pospischil et al. 2009b; Reinhold et al. 2010; De Clercq et al. 2014). Additionally, chlamydial infections may lead to economical losses in commercial pigs due to arthritis, pericarditis, polyserositis, pneumonia, conjunctivitis, enteritis, diarrhea and reproductive failure (Willigan and Beamer 1955; Sarma et al. 1983; Woollen et al. 1990; Zahn et al. 1995; Andersen and Rogers 1998; Eggemann et al. 2000). Although C. suis is endemic in pigs, a significant part of the infections are asymptomatic (Hoelzle et al. 2000; Camenisch et al. 2004; Englund et al. 2012). Chlamydiae are still considered of minor importance in commercial pigs and are relatively unknown swine pathogens. Therefore, the available funding to investigate these apparently less important infections is limited. Besides, a number of other considerations might complicate the evaluation of the significance of chlamydiae for pig production. Firstly, the ecomomical impact of chlamydial infections on pig production has not been demonstrated so far. Consequently, the required evidence of the significance of chlamydiae to swine health is lacking. Studies comparing the economic yield of pigs protected against chlamydial infections, for instance through vaccination, and untreated swine, might clarify the consequences on growth, mortality and reproduction. However, efficient vaccines or alternative protection mechanisms are not available. Moreover, the discrimination of vaccinated and naturally infected swine may be challenging. Secondly, several cases of the appearance of pathology due to synergistic interactions with other common pathogens of pigs have been reported. This phenomenon was already observed for Salmonella, Porcine circovirus type 2 (PCV-2) and Acanthamoebae (Pospischil and Wood 1987; Carrasco et al. 2000; Becker et al. 2007; Schautteet et al. 2010). In fact, both pathogens can be present in healthy pig herds, but might trigger each other’s pathology. Consequently, the involvement of chlamydiae in the observed pathology may be masked by the presence of other, commonly known swine pathogens. Nevertheless, even if the pathogenicity of chlamydiae is less severe compared to other well known swine pathogens like Mycoplasma hyopneumoniae and PCV-2, pig health might benefit from increasing awareness of veterinarians. 80 Chapter V

Spread of C. suis in pigs Numerous studies demonstrate a high prevalence of chlamydial species in the intestines of clinically healthy and diseased pigs, suggesting the porcine intestinal tract to be the natural habitat for chlamydial species (Schiller et al. 1997a; Hoelzle et al. 2000). Yet, C. suis is considered to be the most prevalent, as was also confirmed in Chapter III. The intestines may function as a reservoir from where the pathogen can spread to other organs and animals (Nietfeld et al. 1993). Urogenital chlamydiosis may result from fecal contamination of the vagina (Hoelzle et al. 2000; Yeruva et al. 2013). This hypothesis is supported by the ability of the C. suis strain S45, originally isolated from the intestines of an asymptomatic piglet, to cause pathology in the urogenital tract of pigs (De Clercq et al. 2014). Furrowing in feces of chlamydiae-shedding animals may yield eye-, respiratory- and gastro-intestinal infections. In addition, C. suis has been detected in the semen of boars, suggesting potential venereal transmission during mating or artificial insemination (Kauffold et al. 2006; Teankum et al. 2006; Schautteet et al. 2013). Systematic screening of semen in insemination centers could be useful to monitor the spread of C. suis and might clarify if measures are needed to prevent spread of infections through international trade of boar sperm.

Tetracycline resistance in C. suis Another issue that contributes to the significance of chlamydial infections in swine is the emergence of antibiotic resistance genes. Chlamydiae are generally highly sensitive to the relatively inexpensive broad spectrum Tc antibiotics. However, TcR C. suis strains have been appearing in the U.S. and European pig industry (Andersen and Rogers 1998; Di Francesco et al. 2008; Borel et al. 2012; Schautteet et al. 2013). Borel et al. (2012) suggested that the rapid selection for TcR C. suis strains observed after treatment of conjunctivitis and diarrhea with Tc, was facilitated by close contact of the pigs. Therefore, the recent implementation plan of the European Commission on group housing of sows and gilts (Directive 2008/120/EC on the protection of pigs) might contribute to the increasing prevalence of TcR C. suis strains in European pigs. The C. suis TcR phenotype is attributed to the stable integration of the Tc resistance gene tet(C) into the chlamydial chromosome (Dugan et al. 2004). In chapter III, rectal swabs of slaughtering pigs from 10 different farms were examined for the presence of C. suis strains. Fifteen C. suis isolates were obtained, whereof three contained the tet(C) gene. These results confirm the presence of the Tc resistance gene in the Belgian pig population, as was equally demonstrated by Schautteet et al. (2013). This study reported the presence of the tet(C) resistance gene in swine suffering from severe reproductive disorders and failure of General discussion and perspectives 81 antibiotic treatment. Our study did not comprise information concerning the health status and possible failure of antibiotic treatment of the animals sampled in the slaughterhouse (Chapter III). Although the presence of the tet(C) gene was always associated with a TcR phenotype in American and Italian C. suis strains (Andersen and Rogers 1998; Di Francesco et al. 2008), it would be interesting to determine the minimal inhibitory concentration (MIC) values for the isolated strains to support the significance of the obtained results. This in vitro antimicrobial susceptibility testing procedure is based on the minimal concentration of the antimicrobial needed to affect the size and morphology of 90% of the inclusions, and may be used to address phenotypical resistance (Suchland et al. 2003). Alternatively, a reverse transcriptase PCR based method has been described which enables a more sensitive and specific MIC quantification (Cross et al. 1999). However, it should be mentioned that the in vitro MIC may not necessarily correlate with the in vivo value. Indeed, experimental conditions like the cell line and culture media, have a notable influence on the success of inclusion forming and antimicrobial penetration. Moreover, the influence of the immune clearance mechanisms is not taken into account in the in vitro system. The presence of C. suis isolates with and without the tet(C) gene in animals raised on the same farm might also indicate the circulation of different strains in a pig herd. In this respect, it would be interesting to investigate the genetic diversity of C. suis bacteria on herd level. Multi-locus sequence typing (MLST) has successfully been used to study population biology (Maiden et al. 1998; Liang et al. 2013) and might also be very useful as genotyping method for the fastidious micro-organism C. suis, since this technique allows culture-independent strain typing. The MLST approach is based on the sequencing of internal fragments of multiple housekeeping genes. The observed combination of housekeeping-alleles defines the allelic profile or sequence type (ST). It would be interesting to study the correlation between the STs and pathologies observed in pigs. Furthermore, this approach could provide insights in the spread of the C. suis in the pig population on herd level or beyond.

Zoonotic potential of C. suis The two chlamydial species C. psittaci and C. abortus are well described agents of zoonotic infections. Chlamydia psittaci is transferred from birds to humans through aerosols, and infections can vary from apparently asymptomatic to severe pneumonia. Moreover, Chlamydia abortus infections in pregnant women, resulting from exposure to infected sheep and goats, can result in miscarriages and stillbirths (Buxton 1986; Kampinga et al. 2000b; Pospischil et al. 2002b; Walder et al. 2003; Meijer et al. 2004a; Walder et al. 2005a). 82 Chapter V

Chlamydia suis is phylogenetically highly related to the human pathogen C. trachomatis (Everett et al. 1999b) and therefore, its zoonotic potential has been suggested. However, if C. suis is transferred from pigs to humans, the significance of these events, and hence the necessary preventive measures, are largely dependent on the probability and the clinical consequences of potential infections. To address these issues, four parameters need to be studied: presence of a source/reservoir of bacteria, release of the pathogen in the environment, exposure of humans and the appearance of (clinical) consequences. If zoonotic transmission actually occurs, persons who are in daily contact with live pigs, like pig farmers or slaughterhouse employees, are the most likely subjects for transfer. Therefore, the presence and zoonotic transmission of C. suis were evaluated in a Belgian slaughterhouse, as described in Chapter III. The presence of C. suis was confirmed for 52% of the sampled animals, with positives on all 10 sampled farms. Thus, slaughter pigs are indeed a reservoir of C. suis bacteria and the abattoir is a confirmed environment to study the associated potential risk. Analysis of the contact surfaces and air allowed us to address the release of bacteria and exposure of the employees to C. suis. Indeed, air and contact surfaces seemed to be a source of viable C. suis bacteria, albeit only in limited amounts. Compared to a study on the zoonotic transfer of C. psittaci in a chicken and turkey slaughterhouse (Dickx et al. 2010), the amount of released C. suis bacteria seems to be smaller, suggesting a smaller infection pressure. However, this assumption needs further confirmatory examination in additional abattoirs to clarify the significance of bacterial spreading. The main finding of chapter III is the isolation of viable C. suis bacteria from ocular swabs of two employees. These results represent presumptive evidence supporting the zoonotic transfer hypothesis, in addition to the identification of single and mixed infections of C. suis and C. trachomatis as the cause of trachoma in patients in Nepal (Dean et al. 2013b). In addition, recent unpublished result of our lab, which are not part of this thesis, provided us with three additional pharyngeal and rectal C. suis isolates originating from nine Belgian pig farmers. In contrast to the Nepal case, the presence of C. suis was not linked to the appearance of clinical symptoms in the infected persons in our studies. Thus, the clinical consequences of zoonotic transfer of C. suis appear limited, certainly compared to other known zoonoses like C. psittaci, able to cause a respiratory infection that may be fatal if untreated (Kovacova et al. 2007), or Salmonella species, causing intestinal illness or even osteomyelitis, bacteremia or meningitis (Parry 2003). However, additional studies are certainly required to clarify possible clinical effects before zoonotic transfer of C. suis is considered to be less important. General discussion and perspectives 83

The associated risk of confirmed zoonotic pathogens for persons that are handling pigs during their professional activities can be managed at different levels. The first level aims to eliminate the exposure to and infection from zoonotic pathogens. This could be achieved by combating animal infections on the one hand, and by limiting the emission (shedding) of viable bacteria in the environment, through reduction of the stress level experienced by the animals, on the other hand. Screening of stock using bacteriological monitoring or serology to trace infections is applied for some pathogens, such as Salmonella (Mousing et al. 1997). In this context, the use of antibiotics to deal with such infections should be avoided since major concern is associated with emerging antibiotic resistance genes, especially in the case of chlamydiae, and C. suis in particular. Alternatively, an effective vaccine is of greater value to reduce the prevalence of the concerned pathogen. Besides efforts to eliminate the source of infections, collective and personal protective measures are often applied to reduce the remaining exposure to harmless level. These range from general practices and procedures, such as ventilation in case of airborne pathogens, special waste collection and disposal or safety and warning signs, to more personal precautionary measures, including hand hygiene and protective equipment such as gloves, eyewear and masks. However, monitoring and management strategies involve a considerable effort and cost. Therefore, further prior studies are needed to clarify the economical consequences to pig production and zoonotic importance of C. suis to justify implication of precautionary measures.

The potential zoonotic character of C. suis is also important in the context of the appearance of TcR strains in farming pigs. Emergence of drug resistance, even to new classes of antimicrobials, poses a challenge for treatment of patients in healthcare settings (Bassetti et al. 2011). Tetracycline and its derivatives are critical therapeutic agents in the fight against C. trachomatis, a pathogen of significant importance to human patients, particularly in the developing world. Indeed, ocular strains cause active trachoma affecting an estimated 84 million people, of whom about 1.3 million are blind (Mabey 2008). Furthermore, C. trachomatis infection is the most common bacterial sexually transmitted disease in the world (WHO 2008). The main concern is attributed to the possibility of the introduction and spread of the tet(C) gene, originating from C. suis strains circulating in the swine population, to C. trachomatis strains, and this would impede treatment and control of infections. Some former studies attempted to bring some clarity on the probability of this event. Lenart et al. (2001) showed that the two biologically distinct chlamydial strains C. suis R19 and C. trachomatis L2 could develop within a single inclusion after sequential in vitro 84 Chapter V infection, creating an environment where the two strains can interact. This event observed in vitro might also occur in vivo if TcR C. suis strains are transferred to C. trachomatis infected persons. Interestingly, Dean et al. (2013b) demonstrated mixed infections of C. suis and C. trachomatis as the cause of trachoma in two patients in Nepal. In addition, we isolated C. suis from the eyes of two slaughterhouse employees (Chapter III). Thus, the eye might act as a niche where both strains interact. Moreover, Suchland et al. (2009) demonstrated the in vitro transfer of a Tc resistance gene from C. suis S45 to C. trachomatis L2. Therefore, in vivo exchange of antibiotic resistance genes and consequent emergence of TcR C. trachomatis strains is believed to be plausible. No stable antibiotic resistance, leading to treatment failure, has been reported in C. trachomatis isolates from human patients. However, Suchland et al. (2009) hypothesized that the entry of the tet(C) island into the C. suis genome was more challenging, and transfer among strains, and even species, is more straightforward and certainly not unlikely. If allowed by the government, the fluoroquinolone antibiotic enrofloxacine is currently being used to reduce the economic loss due to TcR C. suis outbreaks in pigs. However, fluoroquinolones are used extensively in human medicine and agricultural use of these drugs may increase selection of antibiotic resistance in bacteria (Knudsen 2001). Indeed, some of the first C. suis strains, stably-resistant to Tc, isolated from diseased and normal pigs, were actually doubly-resistant, also exhibiting a stable resistance to sulfadiazine (Andersen and Rogers 1998). New Tc analogs which are immune to Tc resistance protection mechanism, and new agents belonging to completely new classes of antimicrobials, are regularly examined. However, clinical examination of these compounds takes years and emergence and spread of antibiotic resistance genes occurs rapidly, turning back the clock to preantibiotic era (Roberts 1996). If bacterial strains are present in the animals, even asymptomatically or in very low numbers, they are subjected to the selective pressure of any administered antibiotic treatment. Therefore, antimicrobials should be used in a responsible way and the emergence and spread of antibiotic resistance in life stock should be monitored.

Role of diagnostic performance Additionally, some considerations concerning the performance of the available diagnostics need to be mentioned. Sandoz and Rockey (2010) state that the lack of genetic evidence of antibiotic resistance leading to treatment failures in humans may be a consequence of insufficiency of the current diagnostic methods. Culture was considered as the ‘gold standard’ for chlamydial diagnosis. However, isolation of clinical strains can be extremely challenging, General discussion and perspectives 85 particularly in the case of the heterogenic species C. suis. Many different cell lines are used in different diagnostic laboratories and there is no universal testing methodology, although McCoy, BGM, Vero or Hela cells are most often used (Sachse et al. 2009). No difference in isolation performance was observed between the McCoy and Vero cells during culture analysis of the slaughterhouse employee samples (Chapter II versus Chapter III). Culture recovery rate is particularly low for rectal samples (Schachter et al. 2008). However, the intestines are the most promising sampling site in terms of the number of present bacteria, since they presumably function as a reservoir for C. suis. Although culture remains essential for isolation and propagation of viable chlamydiae and the specificity approaches 100%, it is a time-consuming technique requiring technical expertise and its sensitivity is often marginal. Moreover, additional DNA based assays need to be performed on the isolated bacteria to identify the involved species. Therefore, more and more NAATs are developed and optimized to allow direct analyses on matrices such as swabs or organs, without the need for prior cultivation. The 20-30% higher sensitivity of NAATs and the short performance time are important advantages of this technique over culture. Moreover, the success of DNA detection does not rely on the viability of the diagnosed organisms and thus, less stringent sample transport conditions are required. However, additional diagnostics, such as isolation, are thus still necessary to confirm the viability of the organisms. Moreover, the false positive rate, predominantly caused by contamination, can be considerable and the reproducibility is often low. Moreover, also false-negative results are an important concern. In addition to the presence of inhibitory substances and the occasional failure of DNA extraction procedures, emergence of sequence variation may cause a false negative outcome. The primer and/or probe target sequences need to be conserved across different target strains or organisms. Therefore, the number of available sequences in nucleotide databases and the appearance of mutations or new strains strongly influence the performance of NAATs. In this respect, targeting multiple genes may be useful to reduce the occurrence of sequence-related false negative results. Moreover, the choice of the applied molecular-based diagnostics is biased by our understanding of particular species and strains involved in disease pathologies. Not all species are routinely screened for and uncommon infections might be missed. Indeed, many ocular C. trachomatis manifestations were actually mixed infections with C. pneumoniae, C. suis and/or C. psittaci in a trachoma-endemic region of Nepal (Dean et al. 2008). These technical issues present significant challenges in evaluating the zoonotic potential of chlamydial strains and emergence of antibiotic resistance (Sandoz and Rockey 2010). 86 Chapter V

Apart from molecular tests aiming at direct detection of the involved bacteria, serological tests can be helpful. Antibody detection is often applied to diagnose infections on herd or individual animal level, for instance during epidemiology studies. However, animals do not always produce antibodies immediately upon infection and the absence of an antibody response is thus not always correlated to the absence of infection. Moreover, the produced antibodies remain present in the serum for a long period after clearance of the infection. Therefore, detection of antibodies may indicate a present or past infection. Nevertheless, analysis of samples of different time-points enables detection of disease outbreaks, reflected as antibody titer changes. This principle is often applied during animal health monitoring programs. Reports on the serological prevalence of chlamydial infections in swine are generally based on detection on Chlamydiaceae family level, and do not allow identification of the involved species. Although family specific detection of antibodies is useful to study the epidemiology, in some cases, a C. suis specific assay would be even more informative. Indeed, a specific antibody test would enable C. suis specific epidemiology and the discrimination of C. suis from other chlamydial species in human individuals, as supporting evidence of a zoonotic infection. Therefore, Chapter IV aimed to select antigenic peptides for serodiagnostic use. Specificity of an assay can be improved by using protein fragments or peptides instead of full length proteins, due to the reduced incidence of cross-reactions. Despite the lower efficiency of the passive adsorption of peptides to carrier surfaces, several peptide based ELISAs for chlamydiae are already developed and successfully used for serodiagnosis (Longbottom et al. 2002). Based on the literature on antigen discovery in C. trachomatis , C. abortus and C. suis , three candidate proteins were chosen for screening for a C. suis specific antigen. Analysis of experimental and molecularly characterized field sera allowed selection of a two peptide antigens for serodiagnostic use on swine sera. Prior in silico peptide selection included C. trachomatis protein sequences to rule out cross-reactions. However the set of used experimental sera did not contain C. trachomatis positive control sera. Still, it would be beneficial to verify the absence of cross-reactions of the selected peptides with C. trachomatis to confirm the suitability of these antigens for diagnosis of C. suis infections and zoonotic transfer in human sera. Without doubt, validation of serological assays does not only involve the selection of suitable antigens, as reported in Chapter III. Additionally, the concentrations or dilutions of the antigen adsorbed to the plate, serum, enzyme-antibody conjugate and substrate solution need to be optimized, to achieve minimal background activity and maximal spread in activity between negative and high positive samples. These optimization is performed using checkerboard titrations of each General discussion and perspectives 87 reagent against all others. Furthermore, additional determination of the optimal temporal, physical and chemical variables, like the pH and composition of the diluents, washing and blocking buffers or even the used equipment, might further improve the performance of the assay. Apart from the protocol optimization, the assessment of the reproducibility, repeatability, accuracy and the analytical sensitivity and specificity are also necessary steps in the assay development and validation. The repeatability is the agreement between replicates within and between runs of the assay, and can be addressed by evaluation of the results from replicates analyzed on the same plate, different plates, and distinct days. Similarly, the reproducibility is associated with the degree of concordance of the results obtained with the identical assay performed in different laboratories. The accuracy is the amount of agreement between the test value and the expected value for an analyte in a standard sample of known activity in each run of the assay. This parameter can be assessed by inclusion of a standard sample for which the titer is determined with an independent method. The analytical sensitivity is related to the ability of the assay to assess infected animals as ‘positive’, and is determined using a panel of at least 300 sera from reference individuals having known history and infection status relative to the concerning disease. The specificity, related to the amount of false positives, is addressed with sera of known uninfected reference individuals and requires even more samples, since more biological variables may contribute to false positive results (Jacobson 1998). However, for endemic infections, it is almost impossible to find a large number of proven uninfected individuals, as is the case for chlamydiae in pigs. Consequently, relatively small panels of sera are used, rendering less precise estimations. Therefore, it is recommended to obtain confirmatory data to update the estimated sensitivity and specificity once the concerning assay is routinely used.

Future Perspectives To fully understand the consequences and risk factors associated with chlamydiaceae infections in swine, further investigation is needed on farms and throughout production and processing systems. The primary pathogenicity of C. suis is proven in several experimental infections and several studies report the involvement of chlamydiae in disease in commercial pigs. However, additional experiments addressing the overall economical impact of chlamydiae on pig production are needed to elucidate the real importance of these infections, and suggest the justified and required measures to prevent spread of infections. In this context, it should be mentioned that bacteria are under constant evolutionary pressure and their epidemiology and virulence may change over time. Therefore, monitoring of these 88 Chapter V changes is necessary to observe effects on the associated health complications. Similarly, the evolution of bacterial strains might also influence the performance characteristics of validated diagnostic measures and monitoring of test performance is recommended. Chlamydia suis is a heterogeneous species and its strain diversity might explain the variance in observed clinical symptoms. Research on a potential link between the causative strain and the appearing pathology might provide insight into the actual trigger to disease. The first full genome sequence for C. suis, the MD56 strain isolated in Italy, was only recently made public (Donati et al. 2014), but additional genome sequences could be useful to address these issues. In addition, kinetic studies to follow the route of infection and clinical manifestations in pigs from birth to slaughter may gain comprehensive knowlegde about the chlamydial infection biology in pigs. Moreover, it would be interesting to investigate the genetic susceptibility of various pig breeds to C. suis-associated disease, since breed-dependent susceptibility was observed for pseudorabies virus (Reiner et al. 2002b), porcine reproductive and respiratory syndrome virus (PRRSV) (Halbur et al. 1998), E. coli (Duchet-Suchaux et al. 1991; Michaels et al. 1994), and Sarcocystis miescheriana (Reiner et al. 2002a). Considering the emerging Tc resistance in C. suis and the possible associated public health concerns, future research should also focus on confirmation of the zoonotic transmission and significance of C. suis infections in larger human risk populations. Detection of DNA, viable bacteria and mucosal antibodies may provide conclusive evidence of zoonotic transfer and eye infections caused by C. suis in humans. In addition, also monitoring of TcR C. suis in pig farming and efforts to restrict the use of Tc in the veterinary field are advisable. The development of alternative treatments, which target virulence traits instead of killing bacteria, leading to a lower selective pressure compared to conventional antibiotics, might provide a solution. Promising compounds have already been described, for instance transferrins (Beeckman et al. 2007; Van Droogenbroeck et al. 2008; Van Droogenbroeck et al. 2011). Moreover, research on the prevention of infection through vaccination should be promoted. The ideal veterinary vaccine is inexpensive, safe, genetically and physically stable, suitable for industrial mass application and induces long-term heterotypic protective immune responses with a single dose (Littel-van den Hurk et al. 2000). Genital infection of pigs with C. suis S45 elicits both cellular and humoral immune responses and provides a certain level of protection against re-infection, suggesting that vaccination of pigs might provide the intended protection (De Clercq et al. 2014).

Summary 91

Summary

Chlamydiaceae are Gram-negative obligate-intracellular bacteria that cause a variety of diseases in humans and animals. Chlamydiaceae infections are widespread in commercial pigs and cause important economic losses in pig production. This thesis focuses on Chlamydia (C.) suis, the most prevalent chlamydial species occurring in pigs, and considered as endemic in the intestines of domestic swine (Schautteet and Vanrompay 2011). Its primary pathogenicity is proven by several experimental infections in gnotobiotic pigs (Rogers et al. 1996; Rogers and Andersen 1999, 2000; Reinhold et al. 2008a; Guscetti et al. 2009b; Pospischil et al. 2009b; Reinhold et al. 2010). Infections are mainly associated with respiratory disease, enteritis, periparturient dysgalactiae syndrome, conjunctivitis and reproductive failure (Sarma et al. 1983; Woollen et al. 1990; Rogers and Andersen 1996; Schiller et al. 1997b; Rogers and Andersen 1999; Eggemann et al. 2000; Kauffold et al. 2006; Reinhold et al. 2008b; Guscetti et al. 2009a; Schautteet et al. 2013). Chlamydiae are generally highly sensitive to the relatively inexpensive Tc antibiotics. However, TcR C. suis strains have been appearing in the U.S. and European pig industry (Andersen and Rogers 1998; Di Francesco et al. 2008; Borel et al. 2012; Schautteet et al. 2013). Besides the economic impact on pig production due to treatment failure, TcR C. suis strains pose an additional risk for human health. Chlamydia suis is phylogenetically closely related to the human pathogenic species Chlamydia (C.) trachomatis (Everett et al. 1999b) and is, for this reason, believed to be a zoonotic bacteria. Zoonotic transmission of C. suis might enable transfer of the Tc resistance gene to the human pathogenic species C. trachomatis, affecting millions of people worldwide (Mabey 2008; WHO 2008). Monitoring the spread of TcR C. suis into commercial pigs and the zoonotic transmission to humans is needed to assess the associated risk and to decide on the appropriate measures. For this purpose, reliable C. suis-specific molecular and serological tests to detect C. suis bacteria and anti-C. suis antibodies in animal and human specimen and sera, are indispensable.

Chapter I, gives a brief overview of the history, taxonomy and biology of chlamydial infections, followed by a short introduction to chlamydial effector proteins and the chlamydial outer membrane complex. Furthermore, the occurrence of Chlamydiaceae species in pigs is described with a focus on the diagnosis, epidemiology, pathology, antibiotic resistant properties and zoonotic potential of C. suis. 92 Summary

In Chapter II, we developed a sensitive and specific TaqMan probe-based C. suis real-time PCR to examine clinical samples of both pigs and humans. The analytical sensitivity of the real-time PCR is 10 rDNA copies/reaction without cross-amplification with DNA of other Chlamydia species. The PCR was successfully validated using conjunctival, pharyngeal and stool samples of pig handlers, as well as porcine samples from two farms with evidence of reproductive failure and one farm without clinical disease. The assay can be applied for detection of C. suis strains in pigs and to examine their zoonotic potential more extensively. Additionally, the real-time PCR could be useful to monitor and prevent the spread of C. suis strains, for instance through international trade of boars and sperm.

In Chapter III, we assessed the presence of C. suis in pigs, contact surfaces, air and employees in a pig slaughterhouse using isolation of chlamydial organisms in cell culture and the real-time PCR, developed in chapter II. Furthermore, C. suis isolates were tested for the presence of the tet(C) gene. Chlamydia suis bacteria could be demonstrated in samples from pigs, the air and contact surfaces. Moreover, eye swabs of two employees were positive for C. suis by both PCR and culture. The tet(C) gene was absent in both human C. suis isolates. The employees showed no clinical signs and were negative for C. trachomatis. However, the adaptive ability of C. suis to acquire the tet(C) gene, especially when exposed to selective pressure, and the possibility of C. suis transfer to humans could have far-reaching consequences for public health. These findings emphasize the need for further epidemiological and clinical research to elucidate the significance of human ocular C. suis infections.

In Chapter IV, we identified antigenic and C. suis specific peptide epitopes for serodiagnostic use. Protein sequences of three candidate proteins of the chlamydial species prevalent in pigs and humans, were aligned to select C. suis specific peptides. Sequence alignments and software-based antigenicity analysis were combined with the in vitro screening using a panel of control sera of pigs. The use of an additional set of molecularly- characterized field sera demonstrated the suitability of the PeptideA and B antigens for use in serodiagnosis of C. suis in swine. Moreover, PeptideA appeared more sensitive compared to PeptideB. Although further optimization of the assay is required and the specificity of the antigens for C. suis remains to be confirmed using C. trachomatis antisera, PeptideA is promising for development of an assay for serodiagnosis in humans.

Finally, Chapter V describes our conclusions and perspectives for further research. Samenvatting 93

Samenvatting

De familie van de Chlamydiaceae zijn Gram-negatieve, obligaat intracellulaire bacteriën die verscheidene ziekten veroorzaken in mens en dier. De Chlamydiaceae zijn wijdverspreid in de varkenshouderij en zijn verantwoordelijk voor aanzienlijke economische verliezen. In deze thesis werd de focus gelegd op Chlamydia (C.) suis, het meest voorkomende Chlamydia species bij varkens, dat bovendien als endemisch beschouwd wordt in de intestinale flora van varkens (Schautteet and Vanrompay 2011). De primaire pathogeniciteit van C. suis werd reeds aangetoond in verscheidene experimentele infectie proeven in gnotobiotische varkens (Rogers et al. 1996; Rogers and Andersen 1999, 2000; Reinhold et al. 2008a; Guscetti et al. 2009b; Pospischil et al. 2009b; Reinhold et al. 2010). Infecties zijn voornamelijk geassocieerd met respiratoire aandoeningen, entiritis, periparturient dygalactiae syndroom, conjunctivitis en reproductiestoornissen (Sarma et al. 1983; Woollen et al. 1990; Rogers and Andersen 1996; Schiller et al. 1997b; Rogers and Andersen 1999; Eggemann et al. 2000; Kauffold et al. 2006; Reinhold et al. 2008b; Guscetti et al. 2009a; Schautteet et al. 2013). Chlamydiae zijn doorgaans erg gevoelig voor het relatief goedkope Tc antibioticum. In de V.S. en Europa duiken echter steeds meer Tc resistente Chlamydia suis stammen op (Andersen and Rogers 1998; Di Francesco et al. 2008; Borel et al. 2012; Schautteet et al. 2013). Naast de economische impact in de varkenshouderij, vormen de TcR C. suis stammen bovendien ook een risico voor de volksgezondheid. Chlamydia suis is immers fylogenetisch nauw verwant met het menselijke pathogene species Chlamydia trachomatis (Everett et al. 1999b), en wordt hierdoor als een potentieel zoonotisch bacterie aanzien. De zoonotische transfer van Chlamydia suis zou bovendien de transfer van het TcR gen naar C. trachomatis mogelijk maken, en dit zou wereldwijd milljoenen mensen treffen (Mabey 2008; WHO 2008). Het opvolgen van de verspreiding van TcR Chlamydia suis binnen de varkenssector en de mogelijk zoonotische transmissie naar de mens is noodzakelijk om het geassocieerde risico en de nodige maatregelen te kunnen bepalen. Hiervoor zijn betrouwbare, Chlamydia suis- specifieke moleculaire en serologische testen voor de detectie van Chlamydia suis bacteriën en Chlamydia suis-specifieke antistoffen in dierlijke en menselijke specimen vereist.

Hoofdstuk I geeft een kort overzicht van de geschiedenis, taxonomie en biologie van chlamydiale infecties, gevolgd door een korte inleiding over de chlamydiale effector eiwitten en het ‘outer membrane complex’. Verder wordt ook het voorkomen van Chlamydiaceae 94 Samenvatting species in varkens beschreven, met de nadruk op diagnose, epidemiologie, pathologie antibioticum resistentie en zoonose van Chlamydia suis.

Hoofdstuk II beschrijft de ontwikkeling van een gevoelige en specifieke TaqMan probe- gebaseerde Chlamydia suis real-time PCR voor het analyseren van klinische stalen van mens en dier. De analytische gevoeligheid van deze real-time PCR is 10 rDNA kopijen/reactie, en dit zonder kruis-amplificatie met DNA van andere Chlamydia species. De PCR werd succesvol gevalideerd aan de hand van conjuctivale, faryngale en fecale stalen van mensen die dagelijks contact hebben met varkens. Bovendien werden ook stalen afkomstig van varkens van een gezond bedrijf en twee bedrijven met reproductiestoornissen geanalyseerd. Het assay kan aangewend worden voor de detectie van Chlamydia suis stammen in varkens, en voor het verder onderzoek naar het zoönotisch potentieel van deze bacterie. Bovendien kan deze real-time PCR nuttig zijn voor het opvolgen en het voorkomen van de verspreiding van C. suis stammen, onder meer via de internationale sperma handel voor varkens.

In hoofdstuk III werd de aanwezigheid onderzocht van C. suis in een varkensslachthuis, meer bepaald in varkens, ter hoogte van contact oppervlakken, in de lucht en in de werknemers. Hierbij werd gebruik gemaakt van Chlamydia isolatie in celcultuur en the real- time PCR ontwikkeld in hoofdstuk II. Bovendien werden de geïdentificeerde C. suis isolaten getest op de aanwezigheid van het tet(C) gen. De aanwezigheid van C. suis bacteriën kon aangetoond worden in stalen afkomstig van varkens, de lucht en verschillende contactoppervlakken verspreid in het slachthuis. Bovedien testten ook oogstalen afkomstig van twee werknemers positief in zowel isolatie als PCR. Het tet(C) gen kon niet aangetoond worden in de menselijke C. suis isolaten. De werknemers vertoonden ook geen klinische symptomen en waren negatief voor C. trachomatis. Echter, het verwerven van het tet(C) gen door C. suis, voornamelijk bij blootstelling aan een selectieve druk, en de potentiële transfer van C. suis naar de mens, zou vergaande gevolgen kunnen hebben voor de volksgezondheid. Deze bevindingen benadrukken de nood voor verder onderzoek om de rol en betekenis van oculaire C. suis infecties bij de mens te verduidelijken.

In hoodstuk IV werden antigene en C. suis specifieke peptide geïdentificeerd die aangewend kunnen worden voor serodiagnose. De aminozuursequenties van drie kandidaat eiwitten van de Chlamydia species die voorkomen bij varkens en de mens werden gealigneerd, voor de selectie van Chlamydia suis specifieke peptiden. Sequentie alignering en software-gebaseerde analyse van de antigeniciteit werden gecombineerd met de in vitro screening met behulp van Samenvatting 95 een set van controle sera afkomstig van varkens. Daarnaast werd ook een set van moleculair gekarakteriseerde veldsera gebruikt om de bruikbaarheid van de PeptideA en B antigenen voor serodiagnose van C. suis, te bevestigen. Hierbij bleek het PeptideA gevoeliger dan PeptideB. Hoewel verdere optimalisatie van het assay en specificiteitsanalyse van de antigenen met C. trachomatis antisera vereist zijn, is het geïdentificeerde PeptideA ook een veelbelovende kandidaat voor de ontwikkeling van een C. suis serodiagnose assay voor de mens.

In hoofdstuk V werden ten slotte onze conclusies en toekomstperspectieven voor verder onderzoek beschreven.

References 97

References

Andersen AA and Rogers DG (1998). Resistance to tetracycline and sulfadiazine in swine C. trachomatis isolates. Ninth International Symposium on Human Chlamydial Infection, San Francisco, Calif.

Anderson IE, Baxter SIF, Dunbar S, Rae AG, Philips HL, Clarkson MJ and Herring AJ (1996). "Analyses of the genomes of chlamydial isolates from ruminants and pigs support the adoption of the new species Chlamydia pecorum." International Journal of Systematic Bacteriology 46(1): 245-251.

Baehr W, Zhang YX, Joseph T, Su H, Nano FE, Everett KD and Caldwell HD (1988a). "Mapping antigenic domains expressed by Chlamydia trachomatis major outer membrane protein genes." Proceedings of the National Academy of Sciences of the United States of America 85(11): 4000-4004.

Baehr W, Zhang YX, Joseph T, Su H, Nano FE, Everett KDE and Caldwell HD (1988b). "Mapping Antigenic Domains Expressed by ChlamydiaTrachomatis Major Outer- Membrane Protein Genes." Proceedings of the National Academy of Sciences of the United States of America 85(11): 4000-4004.

Bagdonas J, Mauricas M, Gerulis G, Petkevicius S and Jokimas J (2005). "Evaluation of different laboratory methods for diagnosis of pig chlamydiosis in Lithuania." Polish journal of veterinary sciences 8(1): 49-56.

Bassetti M, Ginocchio F, Mikulska M, Taramasso L and Giacobbe DR (2011). "Will new antimicrobials overcome resistance among Gram-negatives?" Expert review of anti- infective therapy 9(10): 909-922.

Bebear C and de Barbeyrac B (2009). "Genital Chlamydia trachomatis infections." Clinical microbiology and infection : the official publication of the European Society of Clinical Microbiology and Infectious Diseases 15(1): 4-10.

Becker A, Lutz-Wohlgroth L, Brugnera E, Lu ZH, Zimmermann DR, Grimm F, Beilage EG, Kaps S, Spiess B, Pospischil A and Vaughan L (2007). "Intensively kept pigs pre- disposed to chlamydial associated conjunctivitis." Journal of Veterinary Medicine Series a-Physiology Pathology Clinical Medicine 54(6): 307-313.

Bedson SP and Bland JOW (1932). "A morphological study of psittacosis virus, with the description of a developmental cycle." Britisch Journal of Experimental Pathology 35: 299-308.

Bedson SP and Gostling JV (1954). "A study of the mode of multiplication of psittacosis virus." British journal of experimental pathology 35(3): 299-308.

Beeckman DSA, Van Droogenbroeck CMAD, De Cock BJA, Van Oostveldt P and Vanrompay DCG (2007). "Effect of ovotransferrin and lactoferrins on Chlamydophila psittaci adhesion and invasion in HD11 chicken macrophages." Veterinary research 38(5): 729-739. 98 References

Beeckman DSA and Vanrompay DCG (2009). "Zoonotic Chlamydophila psittaci infections from a clinical perspective." Clinical Microbiology and Infection 15(1): 11-17.

Belland RJ, Ouellette SP, Gieffers J and Byrne GI (2004). "Chlamydia pneumoniae and atherosclerosis." Cellular microbiology 6(2): 117-127.

Betts HJ, Wolf K and Fields KA (2009). "Effector protein modulation of host cells: examples in the Chlamydia spp. arsenal." Current Opinion in Microbiology 12(1): 81-87.

Bocher M, Boldicke T, Kiess M and Bilitewski U (1997). "Synthesis of mono- and bifunctional peptide dextran conjugates for the immobilization of peptide antigens on ELISA plates: properties and application." Journal of Immunological Methods 208(2): 191-202.

Borel N, Kempf E, Hotzel H, Schubert E, Torgerson P, Slickers P, Ehricht R, Tasara T, Pospischil A and Sachse K (2008). "Direct identification of chlamydiae from clinical samples using a DNA microarray assay-A validation study." Molecular and Cellular Probes 22(1): 55-64.

Borel N, Mukhopadhyay S, Kaiser C, Sullivan ED, Miller RD, Timms P, Summersgill JT, Ramirez JA and Pospischil A (2006a). "Tissue MicroArray (TMA) analysis of normal and persistent Chlamydophila pneumoniae infection." Bmc Infectious Diseases 6.

Borel N, Regenscheit N, Di Francesco A, Donati M, Markov J, Masserey Y and Pospischil A (2012). "Selection for tetracycline-resistant Chlamydia suis in treated pigs." Vet Microbiol 156(1-2): 143-146.

Borel N, Thoma R, Spaeni P, Weilenmann R, Teankum K, Brugnera E, Zimmermann DR, Vaughan L and Pospischil A (2006b). "Chlamydia-related abortions in cattle from Graubunden, Switzerland." Veterinary pathology 43(5): 702-708.

Brade H, Brade L and Nano FE (1987). "Chemical and Serological Investigations on the Genus-Specific Lipopolysaccharide Epitope of Chlamydia." Proceedings of the National Academy of Sciences of the United States of America 84(8): 2508-2512.

Brown MB and Roberts MC (1991). "Tetracycline Resistance Determinants in Streptococcal Species Isolated from the Bovine Mammary-Gland." Veterinary Microbiology 29(2): 173-180.

Brunham RC and Peeling RW (1994). "Chlamydia Trachomatis Antigens - Role in Immunity and Pathogenesis." Infectious Agents and Disease-Reviews Issues and Commentary 3(5): 218-233.

Burton MJ and Mabey DCW (2009). "The Global Burden of Trachoma: A Review." Plos Neglected Tropical Diseases 3(10).

References 99

Busch M, Thoma R, Schiller I, Corboz L and Pospischil A (2000). "Occurrence of chlamydiae in the genital tracts of sows at slaughter and their possible significance for reproductive failure." Journal of veterinary medicine. B, Infectious diseases and veterinary public health 47(6): 471-480.

Bush RM and Everett KDE (2001). "Molecular evolution of the Chlamydiaceae." International Journal of Systematic and Evolutionary Microbiology 51: 203-220.

Buxton D (1986). "Potential Danger to Pregnant-Women of Chlamydia Psittaci from Sheep." Veterinary Record 118(18): 510-511.

Buxton D, Anderson IE, Longbottom D, Livingstone M, Wattegedera S and Entrican G (2002). "Ovine chlamydial abortion: Characterization of the inflammatory immune response in placental tissues." Journal of Comparative Pathology 127(2-3): 133-141.

Caldwell HD and Hitchcock PJ (1984). "Monoclonal-Antibody against a Genus-Specific Antigen of Chlamydia Species - Location of the Epitope on Chlamydial Lipopolysaccharide." Infection and Immunity 44(2): 306-314.

Caldwell HD, Kromhout J and Schachter J (1981). "Purification and Partial Characterization of the Major Outer-Membrane Protein of Chlamydia Trachomatis." Infection and Immunity 31(3): 1161-1176.

Caldwell HD and Perry LJ (1982). "Neutralization of Chlamydia Trachomatis Infectivity with Antibodies to the Major Outer-Membrane Protein." Infection and Immunity 38(2): 745-754.

Camenisch U, Lu ZH, Vaughan L, Corboz L, Zimmermann DR, Wittenbrink MM, Pospischil A and Sydler T (2004). "Diagnostic investigation into the role of Chlamydiae in cases of increased rates of return to oestrus in pigs." The Veterinary record 155(19): 593- 596.

Campbell LA and Kuo CC (2004). "Chlamydia pneumoniae - An infectious risk factor for atherosclerosis?" Nature Reviews Microbiology 2(1): 23-32.

Carabeo RA, Grieshaber SS, Fischer E and Hackstadt T (2002). "Chlamydia trachomatis induces remodeling of the actin cytoskeleton during attachment and entry into HeLa cells." Infection and Immunity 70(7): 3793-3803.

Carrasco L, Segales J, Bautista MJ, Gomez-Villamandos JC, Rosell C, Ruiz-Villamor E and Sierra MA (2000). "Intestinal chlamydial infection concurrent with postweaning multisystemic wasting syndrome in pigs." Veterinary Record 146(1): 21-23.

Chee-Sanford JC, Aminov RI, Krapac IJ, Garrigues-Jeanjean N and Mackie RI (2001). "Occurrence and diversity of tetracycline resistance genes in lagoons and groundwater underlying two swine production facilities." Applied and environmental microbiology 67(4): 1494-1502.

100 References

Chopra I and Roberts M (2001). "Tetracycline antibiotics: Mode of action, applications, molecular biology, and epidemiology of bacterial resistance." Microbiology and Molecular Biology Reviews 65(2): 232-+.

Chopra I, Storey C, Falla TJ and Pearce JH (1998). "Antibiotics, peptidoglycan synthesis and genomics: the chlamydial anomaly revisited." Microbiology 144 ( Pt 10): 2673-2678.

Chou PY and Fasman GD (1978). "Prediction of the secondary structure of proteins from their amino acid sequence." Advances in enzymology and related areas of molecular biology 47: 45-148.

Clifton DR, Fields KA, Grieshaber SS, Dooley CA, Fischer ER, Mead DJ, Carabeo RA and Hackstadt T (2004). "A chlamydial type III translocated protein is tyrosine- phosphorylated at the site of entry and associated with recruitment of actin." Proceedings of the National Academy of Sciences of the United States of America 101(27): 10166-10171.

Coombes BK and Mahony JB (2002). "Identification of MEK- and phosphoinositide 3- kinase-dependent signalling as essential events during Chlamydia pneumoniae invasion of HEp2 cells." Cellular microbiology 4(7): 447-460.

Costerton JW, Poffenroth L, Wilt JC and Kordova N (1976). "Ultrastructural studies of the nucleoids of the pleomorphic forms of Chlamydia psittaci 6BC: a comparison with bacteria." Canadian journal of microbiology 22(1): 16-28.

Cross NA, Kellock DJ, Kinghorn GR, Taraktchoglou M, Bataki E, Oxley KM, Hawkey PM and Eley A (1999). "Antimicrobial susceptibility testing of Chlamydia trachomatis using a reverse transcriptase PCR-based method." Antimicrobial Agents and Chemotherapy 43(9): 2311-2313.

Dautin N and Bernstein HD (2007). "Protein secretion in gram-negative bacteria via the autotransporter pathway." Annual review of microbiology 61: 89-112.

De Clercq E, Devriendt B, Yin LZ, Chiers K, Cox E and Vanrompay D (2014). "The immune response against Chlamydia suis genital tract infection partially protects against re- infection." Veterinary research 45. de la Maza LM, Fielder TJ, Carlson EJ, Markoff BA and Peterson EM (1991). "Sequence diversity of the 60-kilodalton protein and of a putative 15-kilodalton protein between the trachoma and lymphogranuloma venereum biovars of Chlamydia trachomatis." Infection and Immunity 59(3): 1196-1201.

De Puysseleyr K, De Puysseleyr L, Dhondt H, Geens T, Braeckman L, Morre SA, Cox E and Vanrompay D (2014a). "Evaluation of the presence and zoonotic transmission of Chlamydia suis in a pig slaughterhouse." Bmc Infectious Diseases 14: 560.

De Puysseleyr K, De Puysseleyr L, Geldhof J, Cox E and Vanrompay D (2014b). "Development and Validation of a Real-Time PCR for Chlamydia suis Diagnosis in Swine and Humans." PloS one 9(5): e96704.

References 101

Dean D, Kandel RP, Adhikari HK and Hessel T (2008). "Multiple chlamydiaceae species in trachoma: Implications for disease pathogenesis and control." Plos Medicine 5(1): 57- 69.

Dean D, Rothschild J, Ruettger A, Kandel RP and Sachse K (2013a). "Zoonotic Chlamydiaceae species associated with trachoma, Nepal." Emerging Infectious Diseases 19(12): 1948-1955.

Dean D, Rothschild J, Ruettger A, Kandel RP and Sachse K (2013b). "Zoonotic Chlamydiaceae Species Associated with Trachorna, Nepal." Emerging Infectious Diseases 19(12): 1948-1955.

DeGraves FJ, Gao DY, Hehnen HR, Schlapp T and Kaltenboeck B (2003). "Quantitative detection of Chlamydia psittaci and Chlamydophila pecorum by high-sensitivity real- time PCR reveals high prevalence of vaginal infection in cattle." Journal of Clinical Microbiology 41(4): 1726-1729.

Di Francesco A, Baldelli R, Cevenini R, Magnino S, Pignanelli S, Salvatore D, Galuppi R and Donati M (2006). "Seroprevalence to Chlamydiae in pigs in Italy." Veterinary Record 159(25): 849-850.

Di Francesco A, Baldelli R, Donati M, Cotti C, Bassi P and Delogu M (2013). "Evidence for Chlamydiaceae and Parachlamydiaceae in a wild boar (Sus scrofa) population in Italy." Veterinaria Italiana 49(1): 119-122.

Di Francesco A, Donati M, Morandi F, Renzi M, Masia MA, Ostanello F, Salvatore D, Cevenini R and Baldelli R (2011). "Seroepidemiologic Survey for Chlamydia suis in Wild Boar (Sus scrofa) Populations in Italy." J of Wildlife Dis 47(3): 709-712.

Di Francesco A, Donati M, Rossi M, Pignanelli S, Shurdhi A, Baldelli R and Cevenini R (2008). "Tetracycline-resistant Chlamydia suis isolates in Italy." Vet Rec 163(8): 253- 253.

Dickx V, Geens T, Deschuyffeleer T, Tyberghien L, Harkinezhad T, Beeckman DSA, Braeckman L and Vanrompay D (2010). "Chlamydophila psittaci Zoonotic Risk Assessment in a Chicken and Turkey Slaughterhouse." Journal of Clinical Microbiology 48(9): 3244-3250.

Donati M, Huot-Creasy H, Humphrys M, Di Paolo M, Di Francesco A and Myers GS (2014). "Genome Sequence of Chlamydia suis MD56, Isolated from the Conjunctiva of a Weaned Piglet." Genome announcements 2(3).

Dreses-Werringloer U, Padubrin I, Jurgens-Saathoff B, Hudson AP, Zeidler H and Kohler L (2000). "Persistence of Chlamydia trachomatis is induced by ciprofloxacin and ofloxacin in vitro." Antimicrobial Agents and Chemotherapy 44(12): 3288-3297.

Duchet-Suchaux MF, Bertin AM and Menanteau PS (1991). "Susceptibility of Chinese Meishan and European large white pigs to enterotoxigenic Escherichia coli strains bearing colonization factor K88, 987P, K99, or F41." American Journal of Veterinary Research 52(1): 40-44. 102 References

Dugan J, Andersen AA and Rockey DD (2007). "Functional characterization of IScs605, an insertion element carried by tetracycline-resistant Chlamydia suis." Microbiology 153(Pt 1): 71-79.

Dugan J, Rockey DD, Jones L and Andersen AA (2004). "Tetracycline resistance in Chlamydia suis mediated by genomic islands inserted into the chlamydial inv-like gene." Antimicrobial Agents and Chemotherapy 48(10): 3989-3995.

Eggemann G, Wendt M, Hoelzle LE, Jager C, Weiss R and Failing K (2000). "Prevalence of Chlamydia infections in breeding sows and their importance in reproductive failure." DTW. Deutsche tierarztliche Wochenschrift 107(1): 3-10.

Ehricht R, Slickers P, Goellner S, Hotzel H and Sachse K (2006). "Optimized DNA microarray assay allows detection and genotyping of single PCR-amplifiable target copies." Molecular and Cellular Probes 20(1): 60-63.

Emini EA, Hughes JV, Perlow DS and Boger J (1985). "Induction of Hepatitis-a Virus- Neutralizing Antibody by a Virus-Specific Synthetic Peptide." Journal of Virology 55(3): 836-839.

Englund S, af Segerstad CH, Arnlund F, Westergren E and Jacobson M (2012). "The occurrence of Chlamydia spp. in pigs with and without clinical disease." Bmc Veterinary Research 8.

Escalante-Ochoa C, Ducatelle R and Haesebrouck F (1998). "The intracellular life of Chlamydia psittaci: how do the bacteria interact with the host cell?" FEMS microbiology reviews 22(2): 65-78.

Everett KD, Bush RM and Andersen AA (1999a). "Emended description of the order Chlamydiales, proposal of Parachlamydiaceae fam. nov. and Simkaniaceae fam. nov., each containing one monotypic genus, revised taxonomy of the family Chlamydiaceae, including a new genus and five new species, and standards for the identification of organisms." International Journal of Systematic Bacteriology 49 Pt 2: 415-440.

Everett KDE (2000). "Chlamydia and Chlamydiales: more than meets the eye." Veterinary Microbiology 75(2): 109-126.

Everett KDE and Andersen AA (2001). "Radical changes to chlamydial taxonomy are not necessary just yet - Reply." International Journal of Systematic and Evolutionary Microbiology 51: 251-253.

Everett KDE, Bush RM and Andersen AA (1999b). "Emended description of the order Chlamydiales, proposal of Parachlamydiaceae fam. nov. and Simkaniaceae fam. nov., each containing one monotypic genus, revised taxonomy of the family Chlamydiaceae, including a new genus and five new species, and standards for the identification of organisms." International Journal of Systematic Bacteriology 49: 415- 440.

References 103

Everett KDE and Hatch TP (1991). "Sequence-Analysis and Lipid Modification of the Cysteine-Rich Envelope Proteins of Chlamydia Psittaci 6bc." Journal of Bacteriology 173(12): 3821-3830.

Everett KDE and Hatch TP (1995). "Architecture of the Cell-Envelope of Chlamydia psittaci 6bc." Journal of Bacteriology 177(4): 877-882.

Fadel S and Eley A (2007). "Chlamydia trachomatis OmcB protein is a surface-exposed glycosaminoglycan-dependent adhesin." Journal of medical microbiology 56(1): 15- 22.

Fadel S and Eley A (2008). "Differential glycosaminoglycan binding of Chlamydia trachomatis OmcB protein from serovars E and LGV." Journal of medical microbiology 57(9): 1058-1061.

Fukushi H and Hirai K (1992). "Proposal of Chlamydia Pecorum Sp Nov for Chlamydia Strains Derived from Ruminants." International Journal of Systematic Bacteriology 42(2): 306-308.

Geens T (2005). Identification and characterization of a type three secretion system in genotypes of Chlamydophila psittaci. PhD thesis, Ghent University.

Geens T, Dewitte A, Boon N and Vanrompay D (2005). "Development of a Chlamydophila psittaci species-specific and genotype-specific real-time PCR." Veterinary Research 36(5-6): 787-797.

Genevrois S, Steeghs L, Roholl P, Letesson JJ and van der Ley P (2003). "The Omp85 protein of Neisseria meningitidis is required for lipid export to the outer membrane." Embo Journal 22(8): 1780-1789.

Gerard HC, Whittum-Hudson JA, Carter JD and Hudson AP (2009). "Molecular Biology of Infectious Agents in Chronic Arthritis." Rheumatic Disease Clinics of North America 35(1): 1-+.

Girjes AA, Hugall A, Graham DM, Mccaul TF and Lavin MF (1993). "Comparison of Type-I and Type-Ii Chlamydia psittaci Strains Infecting Koalas (Phascolarctos Cinereus)." Veterinary Microbiology 37(1-2): 65-83.

Greig JR (1936). "Enzootic abortion in ewes: a preliminary note." Veterinary Record(48): 1227.

Greub G (2010a). "International Committee on Systematics of Prokaryotes. Subcommittee on the taxonomy of the Chlamydiae: minutes of the closed meeting, 21 June 2010, Hof bei Salzburg, Austria." International Journal of Systematic and Evolutionary Microbiology 60(Pt 11): 2694.

Greub G (2010b). "International Committee on Systematics of Prokaryotes. Subcommittee on the taxonomy of the Chlamydiae: minutes of the inaugural closed meeting, 21 March 2009, Little Rock, AR, USA." International Journal of Systematic and Evolutionary Microbiology 60(Pt 11): 2691-2693. 104 References

Grimwood J, Olinger L and Stephens RS (2001). "Expression of Chlamydia pneumoniae polymorphic membrane protein family genes." Infection and Immunity 69(4): 2383- 2389.

Grimwood J and Stephens RS (1999). "Computational analysis of the polymorphic membrane protein superfamily of Chlamydia trachomatis and Chlamydia pneumoniae." Microbial & comparative genomics 4(3): 187-201.

Guscetti F, Hoop R, Schiller I, Corboz L, Sydler T and Pospischil A (2000). "Experimental enteric infection of gnotobiotic piglets with a Chlamydia psittaci strain of avian origin." Journal of Veterinary Medicine Series B-Infectious Diseases and Veterinary Public Health 47(8): 561-572.

Guscetti F, Schiller I, Sydler T, Heinen E and Pospischil A (2009a). "Experimental enteric infection of gnotobiotic piglets with Chlamydia suis strain S45." Vet Microbiol 135(1- 2): 157-168.

Guscetti F, Schiller I, Sydler T, Heinen E and Pospischil A (2009b). "Experimental enteric infection of gnotobiotic piglets with Chlamydia suis strain S45." Veterinary Microbiology 135(1-2): 157-168.

Halbur PG, Rothschild MF, Thacker BJ, Meng XJ, Paul PS and Bruna JD (1998). "Differences in susceptibility of Duroc, Hampshire, and Meishan pigs to infection with a high virulence strain (VR2385) of porcine reproductive and respiratory syndrome virus (PRRSV)." Journal of Animal Breeding and Genetics-Zeitschrift Fur Tierzuchtung Und Zuchtungsbiologie 115(3): 181-189.

Hardick J, Maldeis N, Theodore M, Wood BJ, Yang S, Lin S, Quinn T and Gaydos C (2004). "Real-time PCR for Chlamydia pneumoniae utilizing the Roche lightcycler and a 16S rRNA gene target." Journal of Molecular Diagnostics 6(2): 132-136.

Hatch GM and McClarty G (1998). "Cardiolipin remodeling in eukaryotic cells infected with Chlamydia trachomatis is linked to elevated mitochondrial metabolism." Biochemical and biophysical research communications 243(2): 356-360.

Hatch TP (1996). "Disulfide cross-linked envelope proteins: The functional equivalent of peptidoglycan in chlamydiae?" Journal of Bacteriology 178(1): 1-5.

Hatch TP, Allan I and Pearce JH (1984). "Structural and Polypeptide Differences between Envelopes of Infective and Reproductive Life-Cycle Forms of Chlamydia Spp." Journal of Bacteriology 157(1): 13-20.

Hellerström S and Wassén E (1930). "Meningo-enzephalitische Veränderungen bei Affen nach intracerebraler Impfung mit Lymphogranuloma inguinale." Verhandl. Internat. Kong. Dermat. u. Syph.: 1147-1151.

Helps C, Reeves N, Egan K, Howard P and Harbour D (2003). "Detection of Chlamydophila felis and feline herpesvirus by multiplex real-time PCR analysis." Journal of Clinical Microbiology 41(6): 2734-2736. References 105

Helps C, Reeves N, Tasker S and Harbour D (2001). "Use of real-time quantitative PCR to detect Chlamydophila felis infection." Journal of Clinical Microbiology 39(7): 2675- 2676.

Henderson IR and Lam AC (2001). "Polymorphic proteins of Chlamydia spp. - autotransporters beyond the Proteobacteria." Trends in Microbiology 9(12): 573-578.

Herring AJ, Anderson IE, Mcclenaghan M, Finglis NF, Williams H, Matheson BA, West CP, Rodger M and Brettle RP (1987). "Restriction Endonuclease Analysis of DNA from 2 Isolates of Chlamydia psittaci Obtained from Human Abortions." British Medical Journal 295(6608): 1239-1239.

Hoelzle LE, Hoelzle K and Wittenbrink MM (2004). "Recombinant major outer membrane protein (MOMP) of Chlamydophila abortus, Chlamydophila pecorum, and Chlamydia suis as antigens to distinguish chlamydial species-specific antibodies in animal sera." Veterinary Microbiology 103(1-2): 85-90.

Hoelzle LE, Steinhausen G and Wittenbrink MM (2000). "PCR-based detection of chlamydial infection in swine and subsequent PCR-coupled genotyping of chlamydial omp1-gene amplicons by DNA-hybridization, RFLP-analysis, and nucleotide sequence analysis." Epidemiology and Infection 125(2): 427-439.

Hogan RJ, Mathews SA, Mukhopadhyay S, Summersgill JT and Timms P (2004). "Chlamydial persistence: beyond the biphasic paradigm." Infection and Immunity 72(4): 1843-1855.

Horn M (2008). "Chlamydiae as Symbionts in Eukaryotes." Annual review of microbiology 62: 113-131.

Hotzel H, Berndt A, Melzer F and Sachse K (2004). "Occurrence of Chlamydiaceae spp. in a wild boar (Sus scrofa L.) population in Thuringia (Germany)." Veterinary Microbiology 103(1-2): 121-126.

Hsia RC, Pannekoek Y, Ingerowski E and Bavoil PM (1997). "Type III secretion genes identify a putative virulence locus of Chlamydia." Molecular Microbiology 25(2): 351-359.

Iliffe-Lee ER and McClarty G (2000). "Regulation of carbon metabolism in Chlamydia trachomatis." Molecular Microbiology 38(1): 20-30.

Ivanov VS, Suvorova ZK, Tchikin LD, Kozhich AT and Ivanov VT (1992). "Effective Method for Synthetic Peptide Immobilization That Increases the Sensitivity and Specificity of Elisa Procedures." Journal of Immunological Methods 153(1-2): 229- 233.

Jacobson RH (1998). "Validation of serological assays for diagnosis of infectious diseases." Revue Scientifique Et Technique De L Office International Des Epizooties 17(2): 469- 486.

106 References

Janssen MJ, van de Wetering K and Arabin B (2006). "Sepsis due to gestational psittacosis: A multidisciplinary approach within a perinatological center - Review of reported cases." International Journal of Fertility and Womens Medicine 51(1): 17-20.

Jewett TJ, Fischer ER, Mead DJ and Hackstadt T (2006). "Chlamydial TARP is a bacterial nucleator of actin." Proceedings of the National Academy of Sciences of the United States of America 103(42): 15599-15604.

Jiang HH, Huang SY, Zhang WB, Zhao L, Xu CM, Deng SZ and Zhu XO (2013). "Seroprevalence of Chlamydia infection in pigs in Jiangxi province, south-eastern China." Journal of medical microbiology 62: 1864-1867.

Johnson FWA, Matheson BA, Williams H, Laing AG, Jandial V, Davidsonlamb R, Halliday GJ, Hobson D, Wong SY, Hadley KM, Moffat MAJ and Postlethwaite R (1985). "Abortion Due to Infection with Chlamydia Psittaci in a Sheep Farmers Wife." British Medical Journal 290(6468): 592-594.

Jones CS, Osborne DJ and Stanley J (1992). "Enterobacterial tetracycline resistance in relation to plasmid incompatibility." Molecular and Cellular Probes 6(4): 313-317.

Jones RB, Vanderpol B, Martin DH and Shepard MK (1990). "Partial Characterization of Chlamydia Trachomatis Isolates Resistant to Multiple Antibiotics." Journal of Infectious Diseases 162(6): 1309-1315.

Juvonen J, Laurila A, Juvonen T, Alakarppa H, Surcel HM, Lounatmaa K, Kuusisto J and Saikku P (1997). "Detection of Chlamydia pneumoniae in human nonrheumatic stenotic aortic valves." Journal of the American College of Cardiology 29(5): 1054- 1059.

Kalman S, Mitchell W, Marathe R, Lammel C, Fan L, Hyman RW, Olinger L, Grimwood L, Davis RW and Stephens RS (1999). "Comparative genomes of Chlamydia pneumoniae and Chlamydia trachomatis." Nature Genetics 21(4): 385-389.

Kaltenboeck B and Storz J (1992). "Biological Properties and Genetic-Analysis of the Ompa Locus in Chlamydiae Isolated from Swine." American Journal of Veterinary Research 53(9): 1482-1487.

Kampinga GA, Schroder FP, Visser IJ, Anderson JM, Buxton D and Moller AV (2000a). "Lambing ewes as a source of severe psittacosis in a pregnant woman." Nederlands tijdschrift voor geneeskunde 144(52): 2500-2504.

Kampinga GA, Schroder FP, Visser IJ, Anderson JM, Buxton D and Moller AV (2000b). "[Lambing ewes as a source of severe psittacosis in a pregnant woman]." Nederlands tijdschrift voor geneeskunde 144(52): 2500-2504.

Karplus PA and Schulz GE (1985). "Prediction of Chain Flexibility in Proteins - a Tool for the Selection of Peptide Antigens." Naturwissenschaften 72(4): 212-213.

References 107

Kauffold J, Melzer F, Henning K, Schulze K, Leiding C and Sachse K (2006). "Prevalence of Chlamydiae in boars and semen used for artificial insemination." Theriogenology 65(9): 1750-1758.

Kazimierczak KA, Scott KP, Kelly D and Aminov RI (2009). "Tetracycline Resistome of the Organic Pig Gut." Applied and environmental microbiology 75(6): 1717-1722.

Kerr K, Entrican G, McKeever D and Longbottom D (2005). "Immunopathology of Chlamydophila abortus infection in sheep and mice." Research in Veterinary Science 78(1): 1-7.

Kim SK and DeMars R (2001). "Epitope clusters in the major outer membrane protein of Chlamydia trachomatis." Current Opinion in Immunology 13(4): 429-436.

Knitz JC, Hoelzle LE, Affolter P, Hamburger A, Zimmermann K, Heinritzi K and Wittenbrink MM (2003). "[Humoral immune response in breeding sows after vaccination with a herd-specific Chlamydophila abortus vaccine]." DTW. Deutsche tierarztliche Wochenschrift 110(9): 369-374.

Knudsen KEB (2001). "Development of antibiotic resistance and options to replace antimicrobials in animal diets." Proceedings of the Nutrition Society 60(3): 291-299.

Koike S, Krapac IG, Oliver HD, Yannarell AC, Chee-Sanford JC, Aminov RI and Mackie RI (2007). "Monitoring and source tracking of tetracycline resistance genes in lagoons and groundwater adjacent to swine production facilities over a 3-year period." Applied and environmental microbiology 73(15): 4813-4823.

Kolaskar AS and Tongaonkar PC (1990). "A Semiempirical Method for Prediction of Antigenic Determinants on Protein Antigens." Febs Letters 276(1-2): 172-174.

Kölbl O (1969). "Untersuchungen über das Vorkommen von Miyagawanellen beim Schwein." Wien. Tierarztl. Monatsschr 56: 355-361.

Kölbl O, Burtscher H and Hebenstreit J (1970). "Polyarthritis bei Schlachtsweinen. Mikrobiologische, histologische und fleischhygienische Untersuchungen und Aspekte." Wiener Tierärztl Monatssch 57: 355-361.

Kornak JM, Kuo CC and Campbell LA (1991). "Sequence-Analysis of the Gene Encoding the Chlamydia-Pneumoniae Dnak Protein Homolog." Infection and Immunity 59(2): 721- 725.

Kovacova E, Majtan J, Botek R, Bokor T, Blaskovicova H, Solavova M, Ondicova M and Kazar J (2007). "A fatal case of psittacosis in Slovakia, January 2006." Euro surveillance : bulletin Europeen sur les maladies transmissibles = European communicable disease bulletin 12(8): E070802 070801.

Kubo A and Stephens RS (2001). "Substrate-specific diffusion of select dicarboxylates through Chlamydia trachomatis PorB." Microbiology-Sgm 147: 3135-3140.

108 References

Kuoppa Y, Boman J, Scott L, Kumlin U, Eriksson I and Allard A (2002). "Quantitative detection of respiratory Chlamydia pneumoniae infection by real-time PCR." Journal of Clinical Microbiology 40(6): 2273-2274.

Kutlin A, Roblin PM and Hammerschlag MR (1999). "In vitro activities of azithromycin and ofloxacin against Chlamydia pneumoniae in a continuous-infection model." Antimicrobial Agents and Chemotherapy 43(9): 2268-2272.

Kutlin A, Roblin PM and Hammerschlag MR (2002). "Effect of prolonged treatment with azithromycin, clarithromycin, or levofloxacin on Chlamydia pneumoniae in a continuous-infection Model." Antimicrobial Agents and Chemotherapy 46(2): 409- 412.

Lagae S, Kalmar I, Laroucau K, Vorimore F and Vanrompay D (2014). "Emerging Chlamydia psittaci infections in chickens and examination of transmission to humans." Journal of medical microbiology 63: 399-407.

Larsen JE, Lund O and Nielsen M (2006). "Improved method for predicting linear B-cell epitopes." Immunome research 2: 2.

Lenart J, Andersen AA and Rockey DD (2001). "Growth and development of tetracycline- resistant Chlamydia suis." Antimicrobial Agents and Chemotherapy 45(8): 2198-2203.

Liang JG, Ducatelle R, Pasmans F, Smet A, Haesebrouck F and Flahou B (2013). "Multilocus Sequence Typing of the Porcine and Human Gastric Pathogen Helicobacter suis." Journal of Clinical Microbiology 51(3): 920-926.

Lis P, Kumala A, Spalinski M and Rypula K (2014). "Novel locked nucleic acid (LNA)-based probe for the rapid identification of Chlamydia suis using real-time PCR." Bmc Veterinary Research 10.

Littel-van den Hurk SV, Gerdts V, Loehr BI, Pontarollo R, Rankin R, Uwiera R and Babiuk LA (2000). "Recent advances in the use of DNA vaccines for the treatment of diseases of farmed animals." Advanced Drug Delivery Reviews 43(1): 13-28.

Litwin J, Officer JE, Brown A and Moulder JW (1961). "A comparative study of the growth cycles of different members of the psittacosis group in different host cells." The Journal of infectious diseases 109: 251-279.

Livingstone M, Wheelhouse N, Maley SW and Longbottom D (2009). "Molecular detection of Chlamydophila abortus in post-abortion sheep at oestrus and subsequent lambing." Veterinary Microbiology 135(1-2): 134-141.

Longbottom D and Coulter LJ (2003). "Animal chlamydioses and zoonotic implications." Journal of Comparative Pathology 128(4): 217-244.

References 109

Longbottom D, Fairley S, Chapman S, Psarrou E, Vretou E and Livingstone M (2002). "Serological diagnosis of ovine enzootic abortion by enzyme-linked immunosorbent assay with a recombinant protein fragment of the polymorphic outer membrane protein POMP90 of Chlamydophila abortus." Journal of Clinical Microbiology 40(11): 4235-4243.

Longbottom D, Psarrou E, Livingstone M and Vretou E (2001). "Diagnosis of ovine enzootic abortion using an indirect ELISA (rOMP91B iELISA) based on a recombinant protein fragment of the polymorphic outer membrane protein POMP91B of Chlamydophila abortus." Fems Microbiology Letters 195(2): 157-161.

Longbottom D, Rusell M, Jones GE, Lainson FA and Herring AJ (1996). "Identification of a multigene family coding for the 90 kDa proteins of the ovine abortion subtype of Chlamydia psittaci." Fems Microbiology Letters 142(2-3): 277-281.

Mabey D (2008). "Trachoma: Recent developments." Hot Topics in Infection and Immunity in Children Iv 609: 98-107.

Maiden MCJ, Bygraves JA, Feil E, Morelli G, Russell JE, Urwin R, Zhang Q, Zhou JJ, Zurth K, Caugant DA, Feavers IM, Achtman M and Spratt BG (1998). "Multilocus sequence typing: A portable approach to the identification of clones within populations of pathogenic microorganisms." Proceedings of the National Academy of Sciences of the United States of America 95(6): 3140-3145.

Meijer A, Brandenburg A, de Vries J, Beentjes J, Roholl P and Dercksen D (2004a). "Chlamydophila abortus infection in a pregnant woman associated with indirect contact with infected goats." European Journal of Clinical Microbiology & Infectious Diseases 23(6): 487-490.

Meijer A, Brandenburg A, de Vries J, Beentjes J, Roholl P and Dercksen D (2004b). "Chlamydophila abortus infection in a pregnant woman associated with indirect contact with infected goats." European journal of clinical microbiology & infectious diseases : official publication of the European Society of Clinical Microbiology 23(6): 487-490.

Mendez B, Tachibana C and Levy SB (1980). "Heterogeneity of Tetracycline Resistance Determinants." Plasmid 3(2): 99-108.

Michaels RD, Whipp SC and Rothschild MF (1994). "Resistance of Chinese Meishan, Fengjing, and Minzhu pigs to the K88ac+ strain of Escherichia coli." American Journal of Veterinary Research 55(3): 333-338.

Michalova E, Novotna P and Schlegelova J (2004). "Tetracyclines in veterinary medicine and bacterial resistance to them." Veterinarni Medicina 49(3): 79-100.

Morange A (1895). De la psittacose, ou infection spéciale déterminée par des perruches. PhD thesis, Academie de Paris.

Moulder JW (1966). "The relation of the psittacosis group (Chlamydiae) to bacteria and viruses." Annual review of microbiology 20: 107-130. 110 References

Moulder JW (1993). "Why Is Chlamydia Sensitive to Penicillin in the Absence of Peptidoglycan." Infectious Agents and Disease-Reviews Issues and Commentary 2(2): 87-99.

Mousing J, Jensen PT, Halgaard C, Bager F, Feld N, Nielsen B, Nielsen JP and BechNielsen S (1997). "Nation-wide Salmonella enterica surveillance and control in Danish slaughter swine herds." Preventive Veterinary Medicine 29(4): 247-261.

Mpiga P and Ravaoarinoro M (2006). "Chlamydia trachomatis persistence: An update." Microbiological Research 161(1): 9-19.

Navarro JA, de la Fuente JNG, Sanchez J, Martinez CM, Buendia AJ, Gutierrez-Martin CB, Rodriguez-Ferri EF, Ortega N and Salinas J (2004). "Kinetics of infection and effects on the placenta of Clamydophila abortus in experimentally infected pregnant ewes." Veterinary pathology 41(5): 498-505.

Newhall WJ (1987). "Biosynthesis and Disulfide Cross-Linking of Outer-Membrane Components during the Growth-Cycle of Chlamydia trachomatis." Infection and Immunity 55(1): 162-168.

Newhall WJ and Jones RB (1983). "Disulfide-linked oligomers of the major outer membrane protein of chlamydiae." Journal of Bacteriology 154(2): 998-1001.

Nietfeld JC, Janke BH, Lesliesteen P, Robison DJ and Zeman DH (1993). "Small Intestinal Chlamydia Infection in Piglets." Journal of Veterinary Diagnostic Investigation 5(1): 114-117.

Nietfeld JC, LeslieSteen P, Zeman DH and Nelson D (1997). "Prevalence of intestinal chlamydial infection in pigs in the midwest, as determined by immunoperoxidase staining." American Journal of Veterinary Research 58(3): 260-264.

Novak M, Moldoveanu Z, Schafer DP, Mestecky J and Compans RW (1993). "Murine Model for Evaluation of Protective Immunity to Influenza-Virus." Vaccine 11(1): 55-60.

Nurminen M, Lounatmaa K, Leinonen M and Wahlstrom E (1984). "The Effect of Mercaptoethanol on the Solubilization of the 39.5 Kda Major Outer-Membrane Protein of Elementary Bodies of Chlamydia trachomatis and Purification of the Protein." Fems Microbiology Letters 24(2-3): 185-191.

Pantchev A, Sting R, Bauerfeind R, Tyczka J and Sachse K (2010). "Detection of all Chlamydophila and Chlamydia spp. of veterinary interest using species-specific real- time PCR assays." Comp Immunol Microbiol 33(6): 473-484.

Parker JMR, Guo D and Hodges RS (1986). "New Hydrophilicity Scale Derived from High- Performance Liquid-Chromatography Peptide Retention Data - Correlation of Predicted Surface Residues with Antigenicity and X-Ray-Derived Accessible Sites." Biochemistry 25(19): 5425-5432.

References 111

Parry CM (2003). "Antimicrobial drug resistance in Salmonella enterica." Current Opinion in Infectious Diseases 16(5): 467-472.

Patton DL, Askienazyelbhar M, Henrysuchet J, Campbell LA, Cappuccio A, Tannous W, Wang SP and Kuo CC (1994). "Detection of Chlamydia trachomatis in Fallopian- Tube Tissue in Women with Postinfectious Tubal Infertility." American Journal of Obstetrics and Gynecology 171(1): 95-101.

Perry H (1973). "Psittacosis." The Lancet 1(302): 1246.

Pollmann M, Nordhoff M, Pospischil A, Tedin K and Wieler LH (2005). "Effects of a probiotic strain of Enterococcus faecium on the rate of natural chlamydia infection in swine." Infection and Immunity 73(7): 4346-4353.

Pospischil A, Borel N, Chowdhury EH and Guscetti F (2009a). "Aberrant chlamydial developmental forms in the gastrointestinal tract of pigs spontaneously and experimentally infected with Chlamydia suis." Vet Microbiol 135(1-2): 147-156.

Pospischil A, Borel N, Chowdhury EH and Guscetti F (2009b). "Aberrant chlamydial developmental forms in the gastrointestinal tract of pigs spontaneously and experimentally infected with Chlamydia suis." Veterinary Microbiology 135(1-2): 147-156.

Pospischil A, Thoma R, Hilbe M, Gresi P and Gebbers JO (2002a). "Abortion in woman caused by caprine Chlamydophila abortus (Chlamydia psittaci serovar 1)." Swiss Medical Weekly 132(5-6): 64-66.

Pospischil A, Thoma R, Hilbe M, Grest P and Gebbers JO (2002b). "Abortion in woman caused by caprine Chlamydophila abortus (Chlamydia psittaci serovar 1)." Swiss medical weekly 132(5-6): 64-66.

Pospischil A and Wood RL (1987). "Intestinal Chlamydia in Pigs." Veterinary pathology 24(6): 568-570.

Prain CJ and Pearce JH (1989). "Ultrastructural Studies on the Intracellular Fate of Chlamydia psittaci (Strain Guinea-Pig Inclusion Conjunctivitis) and Chlamydia trachomatis (Strain Lymphogranuloma Venereum 434) - Modulation of Intracellular Events and Relationship with Endocytic Mechanism." Journal of General Microbiology 135: 2107-2123.

Reiner G, Eckert J, Peischl T, Bochert S, Jakel T, Mackenstedt U, Joachim A, Daugschies A and Geldermann H (2002a). "Variation in clinical and parasitological traits in Pietrain and Meishan pigs infected with Sarcocystis miescheriana." Veterinary parasitology 106(2): 99-113.

Reiner G, Melchinger E, Kramarova M, Pfaff E, Buttner M, Saalmuller A and Geldermann H (2002b). "Detection of quantitative trait loci for resistance/susceptibility to pseudorabies virus in swine." The Journal of general virology 83(Pt 1): 167-172.

112 References

Reinhold P, Hartmann H and Constable PD (2010). "Characterisation of acid-base abnormalities in pigs experimentally infected with Chlamydia suis." Veterinary Journal 184(2): 212-218.

Reinhold P, Kirschvink N, Theegarten D and Berndt A (2008a). "An experimentally induced Chlamydia suis infection in pigs results in severe lung function disorders and pulmonary inflammation." Vet Res 39(3).

Reinhold P, Kirschvink N, Theegarten D and Berndt A (2008b). "An experimentally induced Chlamydia suis infection in pigs results in severe lung function disorders and pulmonary inflammation." Veterinary Research 39(3): 35.

Ritter J (1880). "Beitrage zur frage des Pneumotyphus (Eine Hausepidemie in Uster (Schweiz) betreffend)." Deutsches Archiv für Klinische Medizin 25:53-96.

Roberts MC (1989). Gene transfer in the urogenital and respiratory tract. Gene transfer in the environment. S. Levy and R. V. Miller. New York, McGrawHill Publishing Co: 347- 375.

Roberts MC (1996). "Tetracycline resistance determinants: mechanisms of action, regulation of expression, genetic mobility, and distribution." FEMS microbiology reviews 19(1): 1-24.

Roberts MC and Hillier SL (1990). "Genetic-Basis of Tetracycline Resistance in Urogenital Bacteria." Antimicrobial Agents and Chemotherapy 34(2): 261-264.

Rogers DG and Andersen AA (1996). "Intestinal lesions caused by two swine chlamydial isolates in gnotobiotic pigs." Journal of Veterinary Diagnostic Investigation 8(4): 433- 440.

Rogers DG and Andersen AA (1999). "Conjunctivitis caused by a swine Chlamydia trachomatis-like organism in gnotobiotic pigs." Journal of Veterinary Diagnostic Investigation 11(4): 341-344.

Rogers DG and Andersen AA (2000). "Intestinal lesions caused by a strain of Chlamydia suis in weanling pigs infected at 21 days of age." Journal of Veterinary Diagnostic Investigation 12(3): 233-239.

Rogers DG, Andersen AA, Hogg A, Nielsen DL and Huebert MA (1993). "Conjunctivitis and Keratoconjunctivitis Associated with Chlamydiae in Swine." Journal of the American Veterinary Medical Association 203(9): 1321-1323.

Rogers DG, Andersen AA and Hunsaker BD (1996). "Lung and nasal lesions caused by a swine chlamydial isolate in gnotobiotic pigs." Journal of Veterinary Diagnostic Investigation 8(1): 45-55.

Rypula K, Kumala A, Lis P, Niemczuk K, Ploneczka-Janeczko K and Pejsak Z (2014a). "Rapid detection of Chlamydia/Chlamydophila group in samples collected from swine herds with and without reproductive disorders." Polish journal of veterinary sciences 17(2): 367-369. References 113

Rypula K, Porowski M, Nowak M, Kumala A, Niemczuk K, Ploneczka-Janeczko K, Szymanska-Czerwinska M and Pejsak Z (2014b). "Preliminary study on serological, molecular, histological and clinical evidence of Chlamydia spp in Polish swine herds." Annals of Animal Science 14(1): 179-187.

Sachse K, Grossmann E, Berndt A, Schutt C, Henning K, Theegarten D, Anhenn O and Reinhold P (2004). "Respiratory chlamydial infection based on experimental aerosol challenge of pigs with Chlamydia suis." Comparative immunology, microbiology and infectious diseases 27(1): 7-23.

Sachse K, Hotzel H, Slickers P, Ellinger T and Ehricht R (2005). "DNA microarray-based detection and identification of Chlamydia and Chlamydophila spp." Molecular and Cellular Probes 19(1): 41-50.

Sachse K, Laroucau K, Riege K, Wehner S, Dilcher M, Creasy HH, Weidmann M, Myers G, Vorimore F, Vicari N, Magnino S, Liebler-Tenorio E, Ruettger A, Bavoil PM, Hufert FT, Rossello-Mora R and Marz M (2014). "Evidence for the existence of two new members of the family Chlamydiaceae and proposal of Chlamydia avium sp nov and Chlamydia gallinacea sp nov." Systematic and Applied Microbiology 37(2): 79-88.

Sachse K, Vretou E, Livingstone M, Borel N, Pospischil A and Longbottom D (2009). "Recent developments in the laboratory diagnosis of chlamydial infections." Veterinary Microbiology 135(1-2): 2-21.

Salisch H, VonMalottki K, Ryll M and Hinz KH (1996). "Chlamydial infections of poultry and human health." Worlds Poultry Science Journal 52(3): 279-308.

Sanchez-Campillo M, Bini L, Comanducci R, Raggiaschi R, Marzocchi B, Pallini V and Ratti G (1999). "Identification of immunoreactive proteins of Chlamydia trachomatis by Western blot analysis of a two-dimensional electrophoresis map with patient sera." Electrophoresis 20(11): 2269-2279.

Sandoz KM and Rockey DD (2010). "Antibiotic resistance in Chlamydiae." Future Microbiology 5(9): 1427-1442.

Sardinia LM, Segal E and Ganem D (1988). "Developmental Regulation of the Cysteine-Rich Outer-Membrane Proteins of Murine Chlamydia trachomatis." Journal of General Microbiology 134: 997-1004.

Sarma DK, Tamuli MK, Rahman T, Boro BR, Deka BC and Rajkonwar CK (1983). "Isolation of Chlamydia from a Pig with Lesions in the Urethra and Prostate-Gland." Veterinary Record 112(22): 525-525.

Schachter J (1999). Infection and disease epidemiology. Chlamydia, Intracellular Biology, Pathogenesis and Immunity. R. S. Stephens. Washington, D.C., ASM Press: 139-169.

114 References

Schachter J, Moncada J, Liska S, Shayevich C and Klausner JD (2008). "Nucleic acid amplification tests in the diagnosis of chlamydial and gonococcal infections of the oropharynx and rectum in men who have sex with men." Sexually Transmitted Diseases 35(7): 637-642.

Schachter J, Stephens RS, Timms P, Kuo C, Bavoil PM, Birkelund S, Boman J, Caldwell H, Campbell LA, Chernesky M, Christiansen G, Clarke IN, Gaydos C, Grayston JT, Hackstadt T, Hsia R, Kaltenboeck B, Leinonnen M, Ojcius D, McClarty G, Orfila J, Peeling R, Puolakkainen M, Quinn TC, Rank RG, Raulston J, Ridgeway GL, Saikku P, Stamm WE, Taylor-Robinson DT, Wang SP and Wyrick PB (2001). "Radical changes to chlamydial taxonomy are not necessary just yet." International Journal of Systematic and Evolutionary Microbiology 51(Pt 1): 249; author reply 251-243.

Schautteet K (2010). "Epidemiological Research on Chlamydiaceae in pigs and evaluation of a Chlamydia trachomatis DNA vaccine." Ghent, Belgium: Ghent Univeristy.

Schautteet K, Beeckman DS, Delava P and Vanrompay D (2010). "Possible pathogenic interplay between Chlamydia suis, Chlamydophila abortus and PCV-2 on a pig production farm." The Veterinary record 166(11): 329-333.

Schautteet K, De Clercq E, Miry C, Van Groenweghe F, Delava P, Kalmar I and Vanrompay D (2012). "Tetracycline-resistant Chlamydia suis in cases of reproductive failure on Belgian, Cypriote and Israeli pig production farms." Journal of medical microbiology.

Schautteet K, De Clercq E, Miry C, Van Groenweghe F, Delava P, Kalmar I and Vanrompay D (2013). "Tetracycline-resistant Chlamydia suis in cases of reproductive failure on Belgian, Cypriote and Israeli pig production farms." Journal of medical microbiology 62: 331-334.

Schautteet K, Stuyven E, Beeckman DS, Van Acker S, Carlon M, Chiers K, Cox E and Vanrompay D (2011). "Protection of pigs against Chlamydia trachomatis challenge by administration of a MOMP-based DNA vaccine in the vaginal mucosa." Vaccine 29(7): 1399-1407.

Schautteet K and Vanrompay D (2011). "Chlamydiaceae infections in pig." Veterinary research 42(1): 29.

Schiller I, Koesters R, Weilenmann R, Kaltenboeck B and Pospischil A (1997a). "Polymerase chain reaction (PCR) detection of porcine Chlamydia trachomatis and ruminant Chlamydia psittaci serovar 1 DNA in formalin-fixed intestinal specimens from swine." Zentralblatt fur Veterinarmedizin. Reihe B. Journal of veterinary medicine. Series B 44(3): 185-191.

Schiller I, Koesters R, Weilenmann R, Thoma R, Kaltenboeck B, Heitz P and Pospischil A (1997b). "Mixed infections with porcine Chlamydia trachomatis/pecorum and infections with ruminant Chlamydia psittaci serovar 1 associated with abortions in swine." Veterinary Microbiology 58(2-4): 251-260.

References 115

Schiller I, Schifferli A, Gysling P and Pospischil A (2004). "Growth characteristics of porcine chlamydial strains in different cell culture systems and comparison with ovine and avian chlamydial strains." Veterinary journal 168(1): 74-80.

Schuurs TA, Verweij SP, Weel JFL, Ouburg S and Morre SA (2013). "Detection of Chlamydia trachomatis and Neisseria gonorrhoeae in an STI population: performances of the Presto CT-NG assay, the Lightmix Kit 480 HT CT/NG and the COBAS Amplicor with urine specimens and urethral/cervicovaginal samples." Bmj Open 3(12).

Skaletsky SRaHJ (2000). " Primer3 on the WWW for general users and for biologist programmers." Krawetz S, Misener S (eds) Bioinformatics Methods and Protocols: Methods in Molecular Biology. Humana Press, Totowa, NJ, pp 365-386.

Solomon AW, Holland MJ, Burton MJ, West SK, Alexander NDE, Aguirre A, Massae PA, Mkocha H, Munoz B, Johnson GJ, Peeling RW, Bailey RL, Foster A and Mabey DCW (2003). "Strategies for control of trachoma: observational study with quantitative PCR." Lancet 362(9379): 198-204.

Stamm WE (1999). "Chlamydia trachomatis infections: Progress and problems." Journal of Infectious Diseases 179: S380-S383.

Stamp JT, Mc EA, Watt JA and Nisbet DI (1950). "Enzootic abortion in ewes; transmission of the disease." The Veterinary record 62(17): 251-254.

Stanton TB, McDowall JS and Rasmussen MA (2004). "Diverse tetracycline resistance genotypes of Megasphaera elsdenii strains selectively cultured from swine feces." Applied and environmental microbiology 70(6): 3754-3757.

Stephens RS, Kalman S, Lammel C, Fan J, Marathe R, Aravind L, Mitchell W, Olinger L, Tatusov RL, Zhao QX, Koonin EV and Davis RW (1998). "Genome sequence of an obligate intracellular pathogen of humans: Chlamydia trachomatis." Science 282(5389): 754-759.

Stephens RS and Lammel CJ (2001). "Chlamydia outer membrane protein discovery using genomics." Current Opinion in Microbiology 4(1): 16-20.

Stephens RS, Sanchez-Pescador R, Wagar EA, Inouye C and Urdea MS (1987). "Diversity of Chlamydia trachomatis major outer membrane protein genes." Journal of Bacteriology 169(9): 3879-3885.

Stine OC, Johnson JA, Keefer-Norris A, Perry KL, Tigno J, Qaiyumi S, Stine MS and Morris JG (2007). "Widespread distribution of tetracycline resistance genes in a confined animal feeding facility." International Journal of Antimicrobial Agents 29(3): 348- 352.

Su H, Watkins NG, Zhang YX and Caldwell HD (1990). "Chlamydia trachomatis-host cell interactions: role of the chlamydial major outer membrane protein as an adhesin." Infection and Immunity 58(4): 1017-1025.

116 References

Subtil A, Wyplosz B, Balana ME and Dautry-Varsat A (2004). "Analysis of Chlamydia caviae entry sites and involvement of Cdc42 and Rac activity." Journal of Cell Science 117(17): 3923-3933.

Suchland RJ, Geisler WM and Stamm WE (2003). "Methodologies and cell lines used for antimicrobial susceptibility testing of Chlamydia spp." Antimicrobial Agents and Chemotherapy 47(2): 636-642.

Suchland RJ, Sandoz KM, Jeffrey BM, Stamm WE and Rockey DD (2009). "Horizontal Transfer of Tetracycline Resistance among Chlamydia spp. In Vitro." Antimicrobial Agents and Chemotherapy 53(11): 4604-4611.

Sykes JE, Allen JL, Studdert VP and Browning GF (2001). "Detection of feline calicivirus, feline herpesvirus 1 and Chlamydia psittaci mucosal swabs by multiplex RT- PCR/PCR." Veterinary Microbiology 81(2): 95-108.

Szeredi L, Schiller I, Sydler T, Guscetti F, Heinen E, Corboz L, Eggenberger E, Jones GE and Pospischil A (1996). "Intestinal Chlamydia in finishing pigs." Veterinary pathology 33(4): 369-374.

Szymanska-Czerwinska M, Niemczuk K and Wojcik A (2011). "Prevalence of Chlamydia Suis in Population of Swine in Poland and Comparison of Complement Fixation Test and Pcr Used in the Diagnosis of Chlamydiosis." Bulletin of the Veterinary Institute in Pulawy 55(3): 381-383.

Tan C, Spitznagel JK, Shou H, Hsia R and Bavoil PM (2006). The Polymorphic Membrane Protein Gene Family of the Chlamydiaceae. Chlamydia: Genomics and Pathogenesis. P. M. Bavoil and P. B. Wyrick. Wymondham, Norfolk.

Tanzer RJ, Longbottom D and Hatch TP (2001). "Identification of polymorphic outer membrane proteins of Chlamydia psittaci 6BC." Infection and Immunity 69(4): 2428- 2434.

Teankum K, Pospischil A, Janett F, Buergi E, Brugnera E, Hoezle K, Polkinghorne A, Weilenmann R, Zimmermann DR and Borel N (2006). "Detection of chlamydiae in boar semen and genital tracts." Veterinary Microbiology 116(1-3): 149-157.

Thejls H, Gnarpe J, Gnarpe H, Larsson PG, Platz-Christensen JJ, Ostergaard L and Victor A (1994). "Expanded gold standard in the diagnosis of Chlamydia trachomatis in a low prevalence population: diagnostic efficacy of tissue culture, direct immunofluorescence, enzyme immunoassay, PCR and serology." Genitourinary medicine 70(5): 300-303.

Thoma R, Guscetti F, Schiller I, Schmeer N, Corboz L and Pospischil A (1997). "Chlamydiae in porcine abortion." Veterinary pathology 34(5): 467-469.

Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F and Higgins DG (1997). "The CLUSTAL_X windows interface: flexible strategies for multiple sequence alignment aided by quality analysis tools." Nucleic Acids Research 25(24): 4876-4882.

References 117

Tondella MLC, Talkington DF, Holloway BP, Dowell SF, Cowley K, Soriano-Gabarro M, Elkind MS and Fields BS (2002). "Development and evaluation of real-time PCR- based fluorescence assays for detection of Chlamydia pneumoniae." Journal of Clinical Microbiology 40(2): 575-583.

Tsakos P, Siarkou V, Guscetti F, Chowdhury H, Papaioannou N, Vretou E and Papadopoulos O (2001). "Experimental infection of pregnant ewes with enteric and abortion-source Chlamydophila abortus." Veterinary Microbiology 82(3): 285-291.

Van Droogenbroeck C, Beeckman DS, Harkinezhad T, Cox E and Vanrompay D (2008). "Evaluation of the prophylactic use of ovotransferrin against chlamydiosis in SPF turkeys." Veterinary Microbiology 132(3-4): 372-378.

Van Droogenbroeck C, Dossche L, Wauman T, Van Lent S, Phan TT, Beeckman DS and Vanrompay D (2011). "Use of ovotransferrin as an antimicrobial in turkeys naturally infected with Chlamydia psittaci, avian metapneumovirus and Ornithobacterium rhinotracheale." Veterinary Microbiology 153(3-4): 257-263.

Vanrompay D, Charlier G, Ducatelle R and Haesebrouck F (1996). "Ultrastructural changes in avian Chlamydia psittaci serovar A-, B-, and D-infected Buffalo Green Monkey cells." Infection and Immunity 64(4): 1265-1271.

Vanrompay D, Ducatelle R and Haesebrouck F (1992). "Diagnosis of Avian Chlamydiosis - Specificity of the Modified Gimenez Staining on Smears and Comparison of the Sensitivity of Isolation in Eggs and 3 Different Cell-Cultures." Journal of Veterinary Medicine Series B-Zentralblatt Fur Veterinarmedizin Reihe B-Infectious Diseases and Veterinary Public Health 39(2): 105-112.

Vanrompay D, Geens T, Desplanques A, Hoang TQT, De Vos L, Van Loock M, Huyck E, Mirry C and Cox E (2004). "Immunoblotting, ELISA and culture evidence for Chlamydiaceae in sows on 258 Belgian farms." Veterinary Microbiology 99(1): 59- 66.

Vazquezcisneros C, Wilsmore AJ and Bollo E (1994). "Experimental Infections of Pregnant Sows with Ovine Chlamydia psittaci Strains." Veterinary Microbiology 42(4): 383- 387.

Verminnen K, Duquenne B, De Keukeleire D, Duim B, Pannekoek Y, Braeckman L and Vanrompay D (2008). "Evaluation of a Chlamydophila psittaci infection diagnostic platform for zoonotic risk assessment." Journal of Clinical Microbiology 46(1): 281- 285.

Verminnen K, Van Loock M, Hafez HM, Ducatelle R, Haesebrouck F and Vanrompay D (2006). "Evaluation of a recombinant enzyme-linked immunosorbent assay for detecting Chlamydophila psittaci antibodies in turkey sera." Veterinary research 37(4): 623-632.

118 References

Villemonteix P, Agius G, Ducroz B, Rouffineau J, Plocoste V, Castets M and Magnin G (1990). "Pregnancy Complicated by Severe Chlamydia psittaci Infection Acquired from a Goat Flock - a Case-Report." European Journal of Obstetrics Gynecology and Reproductive Biology 37(1): 91-94.

Voulhoux R, Bos MP, Geurtsen J, Mols M and Tommassen J (2003). "Role of a highly conserved bacterial protein in outer membrane protein assembly." Science 299(5604): 262-265.

Walder G, Hotzel H, Brezinka C, Gritsch W, Tauber R, Wurzner R and Ploner F (2005a). "An unusual cause of sepsis during pregnancy - Recognizing infection with Chlamydophila abortus." Obstetrics and Gynecology 106(5): 1215-1217.

Walder G, Hotzel H, Brezinka C, Gritsch W, Tauber R, Wurzner R and Ploner F (2005b). "An unusual cause of sepsis during pregnancy: recognizing infection with chlamydophila abortus." Obstetrics and gynecology 106(5 Pt 2): 1215-1217.

Walder G, Meusburger H, Hotzel H, Oehme A, Neunteufel W, Dierich MP and Wurzner R (2003). "Chlamydophila abortus pelvic inflammatory disease." Emerging Infectious Diseases 9(12): 1642-1644.

Wan C, Loader J, Hanger J, Beagley KW, Timms P and Polkinghorne A (2011). "Using quantitative polymerase chain reaction to correlate Chlamydia pecorum infectious load with ocular, urinary and reproductive tract disease in the koala (Phascolarctos cinereus)." Australian Veterinary Journal 89(10): 409-412.

Wang SA, Papp JR, Stamm WE, Peeling RW, Martin DH and Holmes KK (2005). "Evaluation of antimicrobial resistance and treatment failures for Chlamydia trachomatis: A meeting report." Journal of Infectious Diseases 191(6): 917-923.

Ward M (1988). The chlamydial developmental cycle. Microbiology of Chlamydia. Fl., USA, CRC Press: Boca Raton: 71–95.

Watson MW, Lambden PR, Everson JS and Clarke IN (1994). "Immunoreactivity of the 60- Kda Cysteine-Rich Proteins of Chlamydia trachomatis, Chlamydia psittaci and Chlamydia pneumoniae Expressed in Escherichia coli." Microbiology-Sgm 140: 2003-2011.

Watson MW, Lambden PR, Ward ME and Clarke IN (1989). "Chlamydia trachomatis 60 Kda Cysteine Rich Outer-Membrane Protein - Sequence Homology between Trachoma and Lgv Biovars." Fems Microbiology Letters 65(3): 293-298.

Watts AM and Kennedy RC (1999). "DNA vaccination strategies against infectious diseases." International Journal for Parasitology 29(8): 1149-1163.

Welti M, Jaton K, Altwegg M, Sahli R, Wenger A and Bille J (2003). "Development of a multiplex real-time quantitative PCR assay to detect Chlamydia pneumoniae, Legionella pneumophila and Mycoplasma pneumoniae in respiratory tract secretions." Diagnostic Microbiology and Infectious Disease 45(2): 85-95.

References 119

WHO (2008). Report on the meeting on post-endemic surveillance for blinding trachoma. Geneva, Switzerland, World Health Organization.

Willigan DA and Beamer PD (1955). "Isolation of a transmissible agent from pericarditis of swine." Journal of the American Veterinary Medical Association 126(935): 118-122.

Wilson PA, Phipps J, Samuel D and Saunders NA (1996). "Development of a simplified polymerase chain reaction-enzyme immunoassay for the detection of Chlamydia pneumoniae." Journal of Applied Bacteriology 80(4): 431-438.

Wittenbrink MM (1991). "Detection of antibodies against Chlamydia in swine by an immunofluorescent test and an enzyme immunoassay." Berliner Und Munchener Tierarztliche Wochenschrift 104(8): 270-275.

Wittenbrink MM, Wen XT, Bohmer N, Amtsberg G and Binder A (1991). "Bacteriological Investigations into the Incidence of Chlamydia psittaci in Organs from Swine and in Aborted Porcine Fetuses." Journal of Veterinary Medicine Series B-Zentralblatt Fur Veterinarmedizin Reihe B-Infectious Diseases and Veterinary Public Health 38(6): 411-420.

Wong SY, Gray ES, Buxton D, Finlayson J and Johnson FWA (1985). "Acute Placentitis and Spontaneous-Abortion Caused by Chlamydia psittaci of Sheep Origin - a Histological and Ultrastructural-Study." Journal of Clinical Pathology 38(6): 707-711.

Woollen N, Daniels EK, Yeary T, Leipold HW and Phillips RM (1990). "Chlamydial Infection and Perinatal-Mortality in a Swine Herd." Journal of the American Veterinary Medical Association 197(5): 600-601.

Wyrick PB, Choong J, Davis CH, Knight ST, Royal MO, Maslow AS and Bagnell CR (1989). "Entry of Genital Chlamydia trachomatis into Polarized Human Epithelial-Cells." Infection and Immunity 57(8): 2378-2389.

Xu MJ, He Y, Liang R, Zhou DH, Lin RQ, Yin CC, He XH, Liang M and Zhu XQ (2010). "Seroprevalence of Chlamydia Infection in Pigs from Intensive Farms in Southern China." Journal of Animal and Veterinary Advances 9(7): 1143-1145.

Yeruva L, Spencer N, Bowlin AK, Wang Y and Rank RG (2013). "Chlamydial infection of the gastrointestinal tract: a reservoir for persistent infection." Pathogens and Disease 68(3): 88-95.

Yuan Y, Lyng K, Zhang YX, Rockey DD and Morrison RP (1992). "Monoclonal-Antibodies Define Genus-Specific, Species-Specific, and Cross-Reactive Epitopes of the Chlamydial 60-Kilodalton Heat-Shock Protein (Hsp60) - Specific Immunodetection and Purification of Chlamydial Hsp60." Infection and Immunity 60(6): 2288-2296.

Yuan Y, Zhang YX, Watkins NG and Caldwell HD (1989). "Nucleotide and deduced amino acid sequences for the four variable domains of the major outer membrane proteins of the 15 Chlamydia trachomatis serovars." Infection and Immunity 57(4): 1040-1049.

120 References

Zahn I, Szeredi L, Schiller I, Kunz US, Burgi E, Guscetti F, Heinen E, Corboz L, Sydler T and Pospischil A (1995). "Immunohistological Determination of Chlamydia psittaci/Chlamydia pecorum and C. trachomatis in the Piglet Gut." Journal of Veterinary Medicine Series B-Zentralblatt Fur Veterinarmedizin Reihe B-Infectious Diseases and Veterinary Public Health 42(5): 266-276.

Zhang F, Li S, Yang J, Yang L and He C (2009). "Induction of a protective immune response against swine Chlamydophila abortus infection in mice following co-vaccination of omp-1 DNA with recombinant MOMP." Zoonoses and public health 56(2): 71-76.

Zhang XX, Li RC, Liu GH, Cong W, Song HQ, Yu XL and Zhu XQ (2014). "High seroprevalence of Chlamydia infection in sows in Hunan province, subtropical China." Tropical animal health and production 46(4): 701-704.

Zhang YX, Stewart S, Joseph T, Taylor HR and Caldwell HD (1987). "Protective Monoclonal-Antibodies Recognize Epitopes Located on the Major Outer-Membrane Protein of Chlamydia trachomatis." Journal of Immunology 138(2): 575-581.

Zhong GM and Brunham RC (1992). "Antibody-Responses to the Chlamydial Heat-Shock Proteins Hsp60 and Hsp70 Are H-2 Linked." Infection and Immunity 60(8): 3143- 3149.

Dankwoord

Oef, eindelijk aangekomen bij het schrijven van het allerlaatste stukje van mijn boekje. De voorbije 4 jaar zijn niet de makkelijkste geweest en ik ben heel blij dat de eindstreep nu eindelijk in zicht is. En dit zou ondenkbaar geweest zijn zonder al de mensen die mij geholpen en gesteund hebben. Om zeker te zijn dat ik niemand vergeet, alvast een dikke merci aan iedereen die op de een of andere manier heeft bijgedragen aan mijn doctoraat. Als eerste dank ik mijn promotor, Prof. dr. Daisy Vanrompay. Daisy, bedankt om mij de kans te geven om een doctoraat te beginnen in jouw labo. Toen ik vier jaar geleden solliciteerde wist ik niet dat je twee plaatsjes had en ik sprong dan ook een gat in de lucht dat mijn zus en ik samen een doctoraat konden starten op hetzelfde project. Bedankt voor het vertrouwen dat je in mij gesteld hebt en je creatieve oplossingen om toch telkens de deadlines van ons project te halen. Ook wil ik je bedanken om mijn artikels en dit doctoraat na te lezen. Ik wil ook mijn co-promotor Prof. dr. Eric Cox bedanken voor de begeleiding bij mijn onderzoek en het gebruik van de stallen en de infrastructuur in het labo voor Immunologie. Verder wil ik zeker ook alle leden van de lees- en examencommissie (Daisy, Prof. Cox, Prof. dr. Anita Van Landschoot, Prof. dr. Bruno Goddeeris, Prof. dr. Frank Pasmans, Prof. dr. ir. Nico Boon, Dr. ir. Hein Imberechts en Dr. ir. Joris Michiels) bedanken om tijd vrij te maken om mijn doctoraatsthesis na te lezen en voor het leveren van de constructieve opmerkingen. Dankzij jullie is de kwaliteit van dit boekje er zeker en vast op vooruit gegaan. Daarnaast ben ik ook Prof. dr. Servaas Morré een dikke merci verschuldigd voor het verbeteren van mijn derde hoofdstuk. Ook alle leden van mijn FOD commissie, en in het bijzonder dr. Dominique Vandekerchove en Patrick Delava (Nuscience), wil ik bedanken voor hun interesse in mijn project en hun bijdrage aan mijn onderzoek.

En dan ben ik toegekomen aan mijn collega’s, de immuno’s (Delphine Beeckman, Katelijn Schautteet, Veerle Dickx, Stefanie Lagae, Lizi Yin, Annelien Dumont, Sarah Van Lent, Isabelle Kalmar, Julie Geldhof, Matthias Van Gils, Cindy De Boeck, Eamy Yaacob, Thi Minh Tho Dam en Bakr Ahmed Abdelrahman Mohamed). Julie verdienen zeker en vast een bedanking voor alle steun, de leuke babbels en de leuke middagpauzes die veel te vlug voorbij vlogen. Ik heb veel geluk gehad dat ik in een groep terechtkwam waar iedereen voor elkaar klaar stond. Jullie hebben dikwijls de lange lastige dagen opgevrolijkt en zorgden ervoor dat ik ook na de vakantie weer met goeie moed naar het werk kwam. Ik ben dan ook blij dat we onze etentjes en activiteiten alvast niet stopzetten. Delphine, jij verliet het labo net

voordat ik aan mijn doctoraat begon. Toch ben je erin geslaagd om een grote indruk op mij na te laten door jouw vele protocols, richtlijnen en stocks die ik dagelijks in het labo tegenkwam. Jouw materiaal stond voor mij synoniem voor betrouwbaar en zal ongetwijfeld nog veel immuno’s goed van pas komen. Veerle, je vertrok al een paar maanden nadat ik begon, maar toch bedankt voor de goede raad en de leuke babbels. Katelijn, toen ik startte was jij de senior van het labo, onze rots in de branding. Bedankt voor de vele tips, je grenzeloze geduld voor onze duizenden vragen, je kalmte en je relativeringsvermogen. Toen we het nieuws hoorden van je vertrek zaten we toch wel eventjes in de put, want bij wie gingen we nu terecht kunnen met al onze praktische vragen? Dit brengt mij dan automatisch bij Stefanie, de volgende senior van dienst. Ik denk dat je wel de vrolijkste immuno mag genoemd worden. Bedankt dat ik altijd met vragen bij jou terecht kon, voor de vele hulp en vooral ook de leuke verhalen! En nog heel veel succes bij het afronden van jouw doctoraat, nog een paar duwkes en ge zijt er ook vanaf! Annelien, voor jou was nooit iets te veel gevraagd, je stond altijd klaar en bent ondertussen onmisbaar geworden voor de groep. Bedankt dat ik altijd op jou kon rekenen en met een gerust hart mijn stalen aan jou kon toevertrouwen. Als jij in het labo rondliep waren er nooit veel stille momenten waardoor de uren voorbij vlogen! Sarah, jij hebt zeker extra leven in ons varkenskotje gebracht! Hoewel we het niet altijd eens waren over de stand van de verwarming ;-), was het meteen duidelijk dat je goed in de groep paste. Ik wil je ook nog heel veel succes wensen met jouw doctoraat! Evelien(tje), de medebewoner van ons privéhoekje en lotgenoot. Al snel had ik door dat we uit hetzelfde hout gesneden zijn en meestal direct op dezelfde golflengte zaten. Ik zal vooral onze google translate momenten niet gauw vergeten, je bezorgde ons heel dikwijls bijna een natte broek ;-). Bedankt om ons maatje te zijn de voorbije vier jaar! Bedankt ook dat ik je mocht lastigvallen met mijn duizenden vragen de laatste maanden. Ik zal je zeker en vast missen en ik ben dan ook heel blij dat we je zeker nog terug zullen zien! Julie, toen jij kwam werd er nog een vijfde bureau in ons kleine varkenskotje beneden bijgepropt. Maar we hebben het ons niet beklaagd! Door je vrolijkheid en optimisme paste je heel goed in ons immuno-team. Het was dan ook spijtig dat je besloot om ons te verlaten en andere oorden op te zoeken. Bedankt voor die leuke maanden! Isabelle, bedankt dat ik altijd op jou kon rekenen als ik hulp nodig had bij de varkens. Matthias, met al dat vrouwelijk geweld in de groep heb je al je mannetje moeten staan, maar dat bleek geen probleem ;-). Bedankt voor de vrolijke noot en al de hulp bij de varkens! Cindy, ook al hebben wij niet zo veel samen in het labo gestaan, bedankt voor de leuke babbels en nog veel succes met jouw doctoraat.

Ik wil zeker ook mijn thesisstudenten Lien De Vogelaere, Line Devlieger en Laura Van Hauwe bedanken voor de hulp bij het analyseren van de vele stalen. Bakr, many thanks for the valuable support to handle the pigs. Rudy Cooman, hoewel ik je verwoede pogingen om menig boerenzoon te overtuigen van mijn kwaliteiten niet enthousiast toejuichte ;-), mag ik je zeker niet vergeten bedanken voor de vele trips naar de varkensbedrijven en vooral je snoerexpertise die ons toen heel goed van pas is gekomen! Ook ben ik Fien De Block en Sofie De Schynkel zeker en vast een dikke merci verschuldigd voor het regelen van alle administratieve zaken en bestellingen. Maar zeker ook bedankt voor de leuke en bemoedigende babbels. Geert Meesen, bedankt voor al de technische ondersteuning en interessante weetjes ;-). Ook alle andere mobi-collega’s wil ik bedanken voor de toffe sfeer en de vlotte samenwerking!

Een dikke merci ook aan Ellen Audenaert en Liesbeth Allais, die de afgelopen jaren voor de nodige verstrooiing, gezellige etentjes, leuke uitstapjes en hilarische spelletjesmomenten hebben gezorgd. En vooral ook bedankt voor het nodige geduld als het door onze drukke planning weer eens een moeilijke opdracht bleek om onze agenda’s te verzoenen ;-).

Mijn grootste bedanking is gereserveerd voor mijn familie. Mama en papa, zonder jullie zou ik hier nooit geraakt zijn. Dankuwel dat jullie altijd in mij geloofden en mij alle kansen hebben gegeven. Dankuwel voor de onvoorwaardelijke steun, de warme thuis, de vele knuffels, de goeie raad, en het grenzeloze geduld als we weer eens laat thuis waren. Lieve mama, jij bent de verstandigste, warmste en meest optimistische persoon die ik ken en ik kan niet uitdrukken hoe zeer ik naar jou opkijk. Ik kan alleen maar hopen en mijn best doen om later een even goede mama te zijn voor mijn kroost! Papa, jij staat altijd klaar om te helpen en bent onze rots in de branding. Dankuwel voor je bezorgdheid en al die kleine dingen waarmee je op jouw manier onmisbaar bent voor ons. Veronic, mijn grootste zus, dankuwel dat ik altijd welkom was met mijn vragen over real-time PCR of statistiek. En vooral ook nen dikke merci voor de gastvrijheid en alle patisserie en lekkernijen die ik maar al te graag mag voorproeven ;-). Senne en Mirthe, jullie maken van mij een heel fiere tante en kunnen mij als geen ander doen smelten met jullie guitige lach. Dankjewel om de saaie schrijfdagen op te vrolijken! Senne, merci om me te helpen bij het schrijven van dit dankwoord ;-), en ja hoor, jullie mogen nog heel veel op de trampoline komen springen . Annemieke, mijn kleine grote zus, dankuwel om mij telkens weer op te peppen als ik in de put zat en alles te leren relativeren. Dankjewel voor je besmettelijke vrolijkheid, je optimisme, de knuffeltjes en je

duizenden ideeën die me op tijd en stond ook eens doen wegdromen. Ik mag ook zeker mijnen tofsten schonen broeder Kim niet vergeten bedanken. Ondertussen ben je al onze grote broer geworden, zodus ja, op zich zegt dat al genoeg ;-). Dankuwel om de boel altijd op te vrolijken en ons te helpen om onze doctoraatszorgen even te vergeten. Goya, bedankt voor je eeuwig goed humeur en je vele pogingen om mij vanachter mijn bureau te halen. En dan rest mij nog mijn allergrootste bedanking aan mijn lieve Lotie, mijn wederhelft. Jij bent er letterlijk en figuurlijk altijd voor mij geweest. Ik kan niet uitdrukken hoe blij en fier ik ben dat jij mijn tweelingzus bent. We hebben de voorbije vier jaar samen doorgeploeterd en het was een immense geruststelling dat jij er echt altijd voor me was. Jij hebt geen woorden nodig om mij te begrijpen en je verdient een heel speciaal plaatsje in mijn hart. Bedankt voor jouw aanmoedigingen, jouw onvoorwaardelijke steun en liefde en nog zo teveel meer om op te noemen. Nog eventjes doorbijten en we zijn er vanaf! Weet dat je altijd onvoorwaardelijk op mij kan rekenen en ik altijd wel te vinden ben voor een tripje naar Disneyland .

Kristien

April 2015

Curriculum Vitae

Personal Information

Name Kristien De Puysseleyr Date of birth 31/03/1987 Place of birth Sint-Niklaas, Belgium Nationality Belgian

Current home address: Current work address: Shondstraat 19 Coupure Links 653 9170 Sint-Pauwels, Belgium 9000 Ghent, Belgium [email protected] [email protected] Tel.: +32(0)499 40 58 47 Tel.: +32(0)9 264 60 65 Fax: +32(0)9 264 62 19

Education

2010 – 2015 PhD Applied Biological Sciences: Cell and Gene Biotechnology, Ghent University 2005 – 2010 Master in Biochemistry and Biotechnology, Ghent University 1999 – 2005 Science-Mathematics (8h), Heilige Familie, Sint-Niklaas

Extra Courses

2014 Academic English: Writing a Research Article 2012-2013 Q-PCR experiment design and data-analysis, Biogazelle, Leuven 2011-2012 Basic course in laboratory animal science, Ghent University: Part I, general topics FELASA Cat. B Part II, specific topics FELASA Cat. C

Experience – Research skills

Writing of scientific reports and articles. Laboratory experience, acquired during my master and PhD thesis: cell and bacterial culture, DNA extraction, real-time PCR, micro-arrays, gene cloning, plasmid purification, transfection, production of recombinant proteins, ELISA, western blotting, immunofluorescense staining, fluorescence microscopy, animal experiments. Working in biosafety level 3 laboratories and handling of hazardous and bio-hazardous organisms (Chlamydiaceae).

Thesis students: 2012-2013: Laura Van Hauwe: “Studie naar de groei van Chlamydia suis in celcultuur. 2012-2013: Line Devlieger: “Molecular epidemiologic research of the transmission of Chlamydia suis infections from pigs to humans”. 2011-2012: Lien De Vogelaere: “Moleculair epidemiologisch onderzoek naar de overdracht van Chlamydia suis infecties van varkens naar de mens”.

Languages

Dutch: mother tongue English: good French: basic German: basic

Software

Good knowledge of MS Office (Word, Excel, PowerPoint) and Endnote. Basic knowledge of Vector NTI, BioEdit and Image J.

Publications

De Puysseleyr K, De Puysseleyr L, Geldhof J, Cox E, Vanrompay D (2014). Development and Validation of a Real-Time PCR for Chlamydia suis Diagnosis in Swine and Humans. PLoS One 9: e96704.

De Puysseleyr K, De Puysseleyr L, et al. (2014). "Evaluation of the presence and zoonotic transmission of Chlamydia suis in a pig slaughterhouse." Bmc Infectious Diseases 14: 560.

Beeckman D S, De Puysseleyr L, De Puysseleyr K et al. (2014). "Chlamydial biology and its associated virulence blockers." Critical reviews in microbiology 40(4): 313-328.

Abstracts

De Puysseleyr L, De Puysseleyr K, Dhondt H, et al. “Prevalence of Chlamydia suis in Pigs and Zoonotic Risk Assessment in a Pig Slaughterhouse.” Deutscher Chlamydienworkshop 2014.

De Puysseleyr K, De Puysseleyr L, Geldhof J, et al. “Development and Validation of a Real- time PCR for Chlamydia suis Diagnosis in Swine and Humans.” Deutscher Chlamydienworkshop 2014.

De Puysseleyr L, De Puysseleyr K, Morré S A, et al. “Presence of Chlamydia suis in Pig Farmers.” Deutscher Chlamydienworkshop 2014.

Meetings

With poster presentation Deutscher Chlamydienworkshop, Berlin, Germany, April, 2 - 4 2014

Without presentation First International ECMIS Symposium, E. Coli and the mucosal immune system, Ghent, Belgium, July 2 – 5, 2011 Eighth annual Amsterdam Chlamydia meeting (AACM). Amsterdam, The Netherlands. December 9, 2011.