Extensive Analysis of the Retinoblastoma Gene in Adult T Cell Leukemia/Lymphoma (ATL) Y Hatta1, Y Yamada2, M Tomonaga2 and HP Koefﬂer1

Home , Oncogene

Extensive analysis of the retinoblastoma gene in adult T cell leukemia/lymphoma (ATL) Y Hatta1, Y Yamada2, M Tomonaga2 and HP Koefﬂer1

1Division of Hematology/Oncology, Department of Medicine, Cedars-Sinai Research Institute, UCLA School of Medicine, Los Angeles, CA, USA; and 2Department of Hematology, Atomic Disease Institute, Nagasaki University, School of Medicine, Nagasaki, Japan

The retinoblastoma susceptibility gene (Rb) plays a key role in Tax;38 a long period of clinical latency (20–30 years) precedes regulating the cell cycle in association with cyclins and cyclin- the development of ATL;39,40 only a small percentage of dependent kinases (CDKs). Alteration of the Rb gene as well 40 as CDK inhibitors (CDKIs) leads to deregulated cellular growth HTLV-I-infected individuals develop this malignancy; and which promotes cancer formation. We examined the genomic ATL cells are monoclonal. configuration of the entire Rb gene in 40 primary adult T cell The missense inactivating mutations of the p53 gene have leukemias/lymphomas (ATL) and two ATL cell lines by South- been observed in ATL.41–44 We tested for the inactivation of ern blotting and also by polymerase chain reaction-single several CDK inhibitors (CDKIs) including p15INK4B, p16INK4A, strand conformation polymorphism (PCR-SSCP) analyses. p18INK4C, p19INK4D and p27KIP1, and have found deletions of Homozygous loss of exon 1 was identified in one of 21 acute the p16INK4A gene in 10 of 37 cases (27%); deletions of the ATL, one of 15 chronic ATL, and none of four lymphomatous INK4B 45 ATL samples. No point mutations were identified. Previously, p15 gene in seven of 37 cases (19%); alterations of the we found that 10 of these same ATL samples had alterations of p27KIP1 gene in two of 42 ATL samples (5%);46 and no abnor- either p16INK4A (homozygous deletion) or p27kip1 (homozygous malities were found in the p18INK4C,78 and p19INK4D genes47 deletion or point mutation). Although the numbers are very low, in 43 samples. none of the samples with an aberrant Rb gene had an altered Altered expression and structural abnormalities of Rb have CDKI and vice versa, suggesting that both genes probably 29,30,48–58 operate in a common pathway and alteration of either can pro- been identified in several hematologic malignancies, vide these cells with a growth advantage. but no information exists regarding inactivation of the Rb gene Keywords: cyclin dependent kinase inhibitor; Rb; ATL; tumor sup- in ATL. The Rb gene is localized to human chromosomal band pressor gene; cell cycle 13q14.8,59 Chromosomal abnormalities of 13q14 have been detected in a variety of tumors including osteosarcomas.60 In contrast, ATL rarely has chromosomal abnormalities at 13q.61 Introduction Nevertheless, studies have shown that mutations and deletions of the Rb gene occur in other types of tumors without a detect- The retinoblastoma susceptibility gene (Rb) encoding a able cytogenetic abnormality at chromosome 13q.48,53,62 nuclear phosphoprotein is a prototype of tumor suppressor Therefore, we performed analysis for alterations of the Rb genes.1,2 The phosphorylation of the Rb gene is regulated in gene using Southern blotting and polymerase chain reaction- a cell cycle-specific manner in association with the cyclin– single strand conformation polymorphism (PCR-SSCP) for 40 cyclin dependent kinase (CDK) complex.3–7 Inactivation of the primary ATL samples and two ATL cell lines. Rb gene has been implicated in the pathogenesis of a wide variety of human solid tumors, including osteosarcomas and soft tissue sarcomas,1,8–15 carcinomas of the breast,16–18 Materials and methods lung,19–23 prostate24 and bladder,25 and of course retinoblastomas.26–28 High level of expression of the Rb protein or Rb Samples gene amplification has also been reported in some tumors.15,29,30 Although development of cancer is a multi-step Cells were collected from 40 Japanese ATL patients before process, these findings suggest that Rb abnormalities com- their treatment and from two ATL cell lines (TSUKA and monly occur in many different tumor types and may help to SO4).63 Of the samples from primary ATL patients, 21 cases explain the deregulated growth control associated with malig- were acute leukemias, four were lymphomas, and 15 were nancy. chronic ATL. The clinical subtypes of ATL were based on the Adult T cell leukemia/lymphoma (ATL) is an aggressive, diagnostic criteria proposed by the Lymphoma Study Group of fatal malignancy of mature CD4+ T lymphocytes.31–33 The Japan.64 One sample was obtained from an abdominal mass, human T cell lymphotropic virus type I (HTLV-I) has been another from the tonsil, two from lymph nodes, one from recognized as the etiologic agent of ATL;34–36 and the viral pleural effusion, and the remaining samples were from the factor responsible for the leukemia induction was proposed to peripheral blood. In each of the samples, at least 70% of the be Tax, a regulatory protein encoded by the HTLV-I gen- cells were morphologically ATL cells. As a control, normal ome.37 However, the mechanism by which HTLV-I induces human bone marrow was obtained after informed consent. ATL is not well understood. The following suggests that additional cellular events are required for the development of the malignant phenotype: ATL cells usually do not express Southern blot analysis

After five or 10 ␮g of DNA was digested with HindIII, it was separated on 0.7% agarose gels and transferred to Biotrans Correspondence: Y Hatta, Division of Hematology/Oncology, Depart- ment of Medicine, Cedars-Sinai Research Institute, UCLA School of Nylon Membranes (ICN, Aurora, OH, USA). The Rb probes Medicine, 8700 Beverly Blvd, B-208, Los Angeles, CA 90048, USA were isolated by KpnI and EcoRI digestion of a plasmid con- Received 28 August 1996; accepted 26 February 1997 taining a 4.15 kb cDNA of the Rb gene which was kindly pro- Alterations of Rb in ATL Y Hatta et al 985 vided by Dr T Dryja (Harvard Medical School, Boston, MA, and one of 15 chronic ATL samples) using the 5Ј Rb cDNA USA). The resulting Rb cDNA probes were 1.15 kb (5Ј KpnI– probe (Figure 1). Four lymphomatous ATL samples showed no EcoRI fragment) and 3.8 kb (3Ј EcoRI fragment). Each of the alterations of the gene. No DNA rearrangements or deletions DNA samples were sequentially hybridized with the 3Ј and were observed in any of the cases when the blots were rehy- 5Ј Rb probes. A probe for myeloperoxidase (MPO) was used bridized with the 3Ј cDNA probe (Table 2). as an internal control.65 Southern blot hybridization, 32P-labe- The entire Rb coding sequence and 573 bp of the promoter ling of the probes, and autoradiography were accomplished in region starting at 692 bp upstream of the coding sequence essentially the same manner as previously described.66 Probes were analyzed for point mutations by using PCR-SSCP. were labeled with 32P by the random primer method67 using Aberrant shifts on SSCP were identified in three samples; how- the Random Primers DNA Labeling System (BRL, Life Techno- ever, DNA sequence analysis revealed that all these samples logies, Gaithersburg, MD, USA). Allele losses were ascer- had the base changes in the introns far from the exon–intron tained by visual inspection. When visible reduction of radio- boundaries and the base changes did not code for new intron graphic signal was not obvious, densitometry was performed splice sites. (Ultrascan XL laser densitometer; Pharmacia/LKB, Freiburg, Germany) to confirm our interpretation. A ratio of MPO/Rb hybridizing bands of at least four-fold and two-fold were Discussion required for a sample to be classified as having either a homozygous or hemizygous Rb deletion, respectively. To our knowledge, this is the first study to test for alterations of the entire Rb gene in ATL. Southern blot and SSCP analyses were performed on the entire coding region of Rb in 40 pri- PCR-SSCP analysis mary ATL and two ATL cell lines. Homozygous deletions of exon 1 of Rb were found in samples from two primary cases Oligonucleotide primer pairs were designed to amplify frag- for an incidence of 5%. Samples with homozygous deletions ments containing each of exons 1–27 as well as the promoter of the Rb gene had a normal SSCP pattern. This is not surpris- region of the Rb gene, according to recently published ing because PCR will amplify DNA from contaminated normal sequence data.68 Most of the PCR fragments included at least tissue. All of our samples were obtained before treatment; 24 bp of the flanking intron regions surrounding each exon. therefore, therapy did not cause the genetic changes observed. To increase the sensitivity of the SSCP analysis, the PCR frag- Although this frequency of alteration of Rb is almost compara- ments were further digested by appropriate restriction endonu- ble to those of other hematologic malignancies,49,52,53,56,58 it cleases in order to reduce their size to less than 250 bp; sensi- is lower than those of several other tumors (eg 29% in tivity of mutation detection by SSCP is inversely proportional osteosarcoma15). Because loss of expression of Rb protein was to the size of the amplified products.69 The restriction recently identified in five of 10 ATL samples,70 we may have enzymes were added directly to the PCR at 37°C, (30°C for underestimated the frequency of samples with altered SmaI and 65°C for Taq) for 2 h. The primer sequences, Mg expression of Rb. Some investigators have reported ‘dimini- concentrations, annealing temperature, restriction enzymes, shed’ expression of the Rb protein with no apparent abnor- and fragment lengths are listed in Table 1. Each 20 ␮l reaction malities of the Rb gene,8,49,53,56,58 suggesting a non-mutational contained 50 ng of DNA, 10 pmol of each primers, 2 mM of alteration, such as hypermethylation of the gene.71–73 deoxynucleotide triphosphates, and 0.5 U Taq polymerase Although mutations in the promoter region were not identified (GIBCO-BRL, Gaithersburg, MD, USA). 32P-labeled deoxycyti- in our samples, hypermethylation at the RBF-1 and ATF-like dine triphosphate (dCTP) (2 ␮Ci) (3000 ␮Ci/mmol; New binding sites in the promoter region may reduce the promoter England Nuclear/Dupont, Boston, MA, USA) was added to activity of the Rb gene in ATL, as has been reported in retino- each reaction. PCR was performed with 40 cycles for 1 min blastomas.73 Because exon 1 of Rb was deleted in our cases at 94°C, 1 min at 50–65°C, and 30 s at 72°C, using a proof ATL with Rb alterations, we assume no Rb protein was syn- grammable thermal controller. The PCR products were heat- thesized in these samples; however, RNA and protein were denatured, loaded on a 5% polyacrylamide Mutation Detec- not available in these samples to be certain that no unusual tion Enhancement (MDE; JT Baker, Phillipsburg, NJ, USA) gel truncated Rb protein was produced. with and without 10% glycerol, and electrophoresis was per- Several investigators have proposed that inactivation of the formed for 20 h at 400 V. Rb locus may contribute to progression rather than to initiation of many solid tumors.22,74 However, less is known for hematologic malignancies. In chronic lymphocytic leuke- Sequence analysis mia (CLL), the frequency of either weak or non-detectable expression of Rb (18–42%) does not increase with either All the cases with mobility shifts on SSCP were sequenced. increasing stage or time from diagnosis, which suggests that PCR products were purified and subcloned. Individual clones loss of Rb expression is associated more with the development were purified and used for sequencing by the dideoxy chain rather than the progression of CLL.29,56 In our study, the fre- termination method using a 7-DEAZA Sequencing kit (US Bio- quency of Rb deletion was similar in acute ATL (1/21) and chemical, Cleveland, OH, USA). chronic ATL (1/15), suggesting that loss of the Rb gene may not be associated with progression of the disease, but the number of cases of altered Rb gene are too low to make any Results meaningful statement. The cyclin Ds-CDK2, 4, and 6 complexes induce Rb phos- Southern blot analysis of the Rb gene was performed for 40 phorylation and propel cells through G1 into the S phase. The primary ATL samples and two ATL cell lines. Homozygous CDKIs bind and inhibit the cyclin–CDK complexes. Loss of deletions of the 19.0 kb band corresponding to exon 1 of the CDKIs result in the aberrant growth of cells leading to cancer. gene were detected in two cases (5%; one of 21 acute ATL Previously, we tested for the alterations of the CDKIs genes Alterations of Rb in ATL Y Hatta et al 986 Table 1 Primers and PCR conditions used for analysis of the entire Rb coding sequence and 573 bp of the promoter region

Exon Oligonucleotide Mg (mM) Annealing (°C) Enzyme Fragment size (bp)

promoter (Rb5xP) GATCCCAAAAGGCCAGCAAGTGTCT 2.5 59 SmaI 26, 114, 203, 230 (Rb3xP) TCAACGTCCCCTGAGA- GAAAAACCGGA 1 (1F2) TCCTCCACAGCTCGCTGGCT 2.0 65 HhaI 24, 59, 140, 218 (1R1) AACTGCACCTGTCACTTCGC 2 (2F2) GATTTATAAGTATATGCC 1.5 50 HincII 106, 135 (2R2) GTATAGTGATTTGAAGTTG 3 (3F1) AGTTTTAACATAGTATCCAG 1.5 55 HinfI 103, 125 (3R1) TTTCCTTTTATGGCAGAGGC 4 (4F1) GAATTGAAATATCTATGATT 2.5 55 RsaI 128, 137 (4R1) CTAATTGTGAACAATGACAT 5 (5F2) ACTATGACTTCTAAATTACG 3.5 55 no digestion 181 (5R2) GAAACGTGAACAAATCTG 6 (6F1) TGGAAAACTTTCTTTCAGTG 1.5 55 no digestion 207 (6R1) GAATTTAGTCCAAAGGAATG 7 (7F1) CCTGCGATTTTCTCTCATAC 1.5 55 no digestion 227 (7R1) GCAACTGCTGAATGAGAAAG 8 (8F1) ATTTTATATGATGGATGTAC 2.0 55 Taq1 84, 159 (8R1) ATCTAAATCTACTTTAACTG 9 (9F1) AGTCAAGAGATTAGATTTTG 2.0 55 no digestion 202 (9R1) CAATTATCCTCCCTCCACAG 10 (10F1) GACATGTAAAGGATAATTGT 1.5 55 BglII 89, 142 (10R1) AGCTAAAGACTATATAAATCT 11 (11F2) CAGTATGTGAATGACTTCACT 1.0 50 no digestion 191 (11R2) GAAACGTGAACAAATCTG 12 (12F2) CTTCATTGCTTAACACATTTTCC 2.5 55 no digestion 178 (12R2) GTTTCTTTGCCAAGATATTAC 13 (RB13U1) CTGCACAGTGAATCCAAAAG 1.5 55 no digestion 188 (RB13IVS1) ATACGAACTGGAAAGATGCT 14 (14F1) AAACAGTGAGACTCCATCTC 1.0 65 MspI 86, 183 (14R1) AGGATGATCTTGATGCCTTG 15/16 (15/16F2) CAATGCTGACACAAATAAG 1.5 50 HhaI 93, 226 (15/16R2) CAAACACACCACATTTTAAC 17 (17U1) GGAAGTACATCTCAGAATCT 1.5 55 no digestion 198 (17D1) TGAGAGCCATGCAAGGGATT 18 (18U1) CAATCAAAGGACCGAGAAGG 1.5 55 no digestion 163 (18IVS1) ATGTTACATTGCACTTATGC 19 (18IVS2) GTACAACCTTGAAGTGTATG 1.5 55 no digestion 211 (19D1) CAGTGAAAGAGAGGTAGATT 20 (RB19IVS1) GAGGTTTCTGTTAAAATGCT 1.5 55 no digestion 242 (RB20D1) AGTTCATACTCATTCTGCAG 21 (21F1) ATTCTGACTACTTTTACATC 2.0 55 no digestion 192 (21R1) TTATGTTATGGATATGGAT 22 (22F1) ATATGTGCTTCTTACCTGT 2.0 55 DdeI 131, 171 (22R1) TTGGTGGACCCATTACATTA 23 (23F1) TCTAATGTAATGGGTCCACC 1.5 55 TaqI 95, 185 (23R1) TCAAAATAATCCCCCTCTCA 24 (24F1) GAATGATGTATTTATGCTCA 2.0 55 no digestion 165 (24R1) TTCTTTTATACTTACAATGC 25 (25F2) GAGGTTGCTAACTATGAAA- 1.0 55 EcoRI 47, 206 CACTGGC (25R2) AGATGACCATCTCAGCTACTG 26 (26F1) TCCATTTATAAATACACATG 3.5 60 no digestion 167 (26R1) TAACGAAAAGACTTCTTGCA 27 (27F1) TACCCAGTACCATCAATGCT 1.5 55 no digestion 161 (27R1) TCCAGAGGTGTACACAGTG

(p15INK4B, p16INK4A, p18INK4C, p19INK4D and p27Kip1) in our the CDKIs and Rb proteins are working in a common pathway ATL samples45–47,78 and the results are summarized in Table 2. of controlling the S phase of the cell cycle; and inactivation Those ATL samples and cell lines with either homozygous of one part of this pathway alleviates the need for inactivation deletions or mutations of the p16INK4A and p27Kip1 gene do of another gene in the pathway in the development of ATL. not have alterations of the Rb gene and vice versa. A similar Although we analyzed whether the alterations of either Rb inverse relationship of p16INK4A and Rb in their genomic alter- or CDKIs affected the survival times of ATL patients, the result ations and/or protein levels has been reported in other types did not reach statistical signiﬁcance. The duration of survival of malignancies as well as ATL.70,75–77 Although our case of the acute/lymphomatous type-patients was quite short. numbers are small, taken together, the results emphasize that In conclusion, this study demonstrates that structural alter- Alterations of Rb in ATL Y Hatta et al 987 References

1 Friend SH, Bernards R, Rogelj R, Weinberg RA, Rapaport JM, Albert DM, Dryja TP. A human DNA segment with properties of the gene that predisposes to retinoblastoma and osteosarcoma. Nature 1986; 323: 643–646. 2 Weinberg RA. Tumor suppressor genes. Science 1991; 254: 1138–1146. 3 Buchkovich K, Duffy LA, Harlow E. The retinoblastoma protein is phosphorylated during specific phase of the cell cycle. Cell 1989; 58: 1097–1105. 4 Chen P-L, Scully P, Shew J-W, Wang JYJ, Lee W-H. Phosphoryl- ation of the retinoblastoma gene product is modulated during the cell cycle and cellular differentiation. Cell 1989; 58: 1193–1198. 5 Mihara K, Cao XR, Yen A, Chandler S, Driscoll B, Murphree AL, T’Ang A, Fung Y-K. Cell cycle-dependent regulation of phosphorylation of the human retinoblastoma gene product. Science 1989; 246: 1300–1303. Figure 1 Southern blot analysis for Rb. DNAs were digested with 6 Ludlow JW, Shon J, Pipas JM, Livingston DM, DeCaprio JM. The HindIII and hybridized to the 5Ј probe of the Rb cDNA. Lane 3 retinoblastoma susceptibility gene product undergoes cell cycle- (sample No. 18) shows homozygous deletion of Rb of the 19.0 kb frag- dependent dephosphorylation and binding to and release from ment. Lanes 1 and 2 were ATL samples from patients Nos 16 and 17. SV40 large T. Cell 1990; 60: 387–396. Human normal bone marrow DNA (lane N) served as a control. 7 Hirama T, Koeffler HP. Role of the cyclin-dependent kinase inhibitors in the development of cancer. Blood 1995; 86: 841–854. 8 Fung YKT, Murphree AL, T’Ang A, Qian J, Hinrichs SH, Benedict WF. Structural evidence for the authenticity of the human retino- a Table 2 Structural alterations of Rb and CDKI genes in ATL blastoma gene. Science 1987; 236: 1657–1661. 9 Weischselbaum R, Beckett M, Diamond A. Some retinoblastomas, Sample Phase Rb p15 p16 p18 p19 p27 osteosarcomas, and soft tissue sarcomas may share a common eti- No. ology. Proc Natl Acad Sci USA 1988; 85: 2106–2109. 10 Toguchida J, Ishizaki K, Sasaki MS, Ikenaga M, Sugimoto M, 2 acute homo hemi hemi N N N Kotoura Y, Yamamuro T. Chromosomal reorganization for the 3 acute N homo homo N N N expression of recessive mutation of retinoblastoma susceptibility 6 acute N hemi hemi N N N gene in the development of osteosarcoma. Cancer Res 1988; 48: 8 acute N hemi hemi N N N 3939–3943. 19A acute N homo homo N N N 11 Xu H-J, Hu S-X, Hashimoto T, Takahashi R, Benedict WF. The 32 acute N homo homo N N N retinoblastoma susceptibility gene product: a characteristic pattern 38 acute N N hemi N N N in normal cells and abnormal expression in malignant cells. Onco- 13 lymphoma N N N N N homo gene 1989; 4: 807–812. 14 lymphoma N homo homo N N N 12 Reissman PT, Simon MA, Lee W-H, Slamon DJ. Studies of the 42 lymphoma N N N N N mut retinoblastoma gene in human sarcomas. Oncogene 1989; 4: 15 chronic N N hemi N N N 839–843. 18 chronic homo N N N N N 13 Shew JY, Ling N, Yang X, Fodstad O, Lee WH. Antibodies 33 chronic N N homo N N N detecting abnormalities of the retinoblastoma susceptibility gene TSUKA cell line N N homo N N N product (pp110RB) in osteosarcoma and synovial sarcomas. SO4 cell line N N homo N N N Oncogene Res 1989; 1: 205–214. 14 Araki N, Uchida A, Kimura T, Yoshikawa H, Aoki Y, Ueda T, Takai S, Miki T, Ono K. Involvement of the retinoblastoma gene Only the samples with alterations are listed. a 78 in primary osteosarcoma and other bone and soft-tissue tumors. Mutation results of the CDKI genes are from our earlier studies Clin Orhthopaed Rel Res 1991; 270: 271–277. and Refs 45–47. 15 Wadayama B, Toguchida J, Shimizu T, Ishizaki K, Sasaki MS, homo, homozygous deletion; hemi, hemizygous deletion; mut, Kotoura Y, Yamamuro T. Mutation spectrum of the retinoblastoma mutation; N, intact. gene in osteosarcomas. Cancer Res 1994; 54: 3042–3048. 16 T’Ang A, Varley JM, Chadrabotry S, Murphree AL, Fung YK. Struc- tural rearrangement of the retinoblastoma gene in human breast ations of the Rb gene are present in about 5% of ATL cases. carcinoma. Science 1988; 242: 263–266. Furthermore, those cases with Rb deletions do not have alter- 17 Lee E-H, To H, Shew JY, Bookstein R, Scully P, Lee WH. Inacti- vation of the retinoblastoma gene in human breast carcinoma. ations of CDKIs and vice versa. Taken together with our p53 Science 1988; 241: 218–221. and CDKI data, inactivation of tumor suppressor genes asso- 18 Varley JM, Armour J, Swallow JE, Jeffreys AJ, Ponder BAJ, T’Ang ciated either directly or indirectly with the cell cycle appears A, Fung Y-K, Brammar WJ, Walker RA. The retinoblastoma gene important for the development of ATL. is frequently altered leading to loss of expression in primary breast tumors. Oncogene 1989; 4: 725–729. 19 Harbour JW, Lai S-L, Whang-Peng J, Gazdar AF, Minna JD, Kaye FJ. Abnormalities in structure and expression of the human retino- Acknowledgements blastoma gene in SCLC. Science 1988; 241: 353–357. 20 Yokota J, Akiyama T, Fung YKT, Benedict WF, Namba Y, Hanaoka We wish to thank Dr Thaddeus P Dryja for generously provid- M, Wada M, Terasaki T, Shimosato Y, Sugimura T, Terada M. Alt- ing the plasmid containing Rb cDNA. We thank National ered expression of the retinoblastoma (RB) gene in small-cell car- Institute of Health Grants No. CA26038, CA42710, CA43277, cinoma of the lung. Oncogene 1988; 3: 471–475. CA70675-01, and DK42792, the Concern Foundation, and 21 Mori N, Yokota J, Akiyama T, Sameshima Y, Okamoto A, Mizogu- chi H, Toyoshima K, Sugimura T, Terada M. Variable mutations the Parker Hughes Fund for financial support. H Phillip of the RB gene in small-cell lung carcinoma. Oncogene 1990; 5: Koeffler holds the Mark Goodson Chair in Oncology Research 1713–1717. and is a member of the Jonsson Cancer Center. 22 Benedict WF, Xu H-J, Hu S-X, Takahashi R. Role of the retinoblas- Alterations of Rb in ATL Y Hatta et al 988 toma gene in the initiation and progression of human cancer. J in adult T-cell leukemia and HTLV-I-infected cells. Jpn J Cancer Clin Invest 1990; 85: 988–993. Res 1993; 84: 4–8. 23 Hensel CH, Hsieh CL, Gazdar AF, Johnson BE, Sakaguchi AY, 44 Nishimura S, Asou N, Suzushima H, Okubo T, Fujimoto T, Osato Naylor SL, Lee WH, Lee YE. Altered structure and expression of M, Yamasaki H, Lisha L, Takatsuki K. p53 gene mutation and loss the human retinoblastoma susceptibility gene in small cell lung of heterozygosity are associated with increased risk of disease pro- cancer. Cancer Res 1990; 50: 3067–3072. gression in adult T-cell leukemia. Leukemia 1995; 9: 598–604. 24 Bookstein R, Shew JY, Chen PL, Scully P, Lee WH. Suppression 45 Hatta Y, Hirama T, Miller CW, Yamada Y, Tomonaga M, Koeffler of tumorigenicity of human prostate carcinoma cells by replacing HP. Homozygous deletions of the p15 (MTS2) and p16 a mutated RB gene. Science 1990; 247: 712–715. (CDKN2/MTS1) genes in adult T-cell leukemia (ATL). Blood 1995; 25 Horowitz JM, Yandell DW, Park S-H, Canning S, Whyte P, Buch- 85: 2699–2704. kovich KJ, Harlow E, Weinberg RA, Dryja TP. Point mutational 46 Morosetti R, Kawamata N, Gombert AF, Miller CW, Hatta Y, Hir- inactivation of the retinoblastoma antioncogene. Science 1989; ama T, Said JW, Tomonaga M, Koeffler HP. Alterations of the 243: 937–940. p27Kip1 gene in non-Hodgkin’s lymphoma and adult T-cell 26 Sakai T, Ohtani N, McGee TL, Robbins PD, Dryja TP. Oncogenic leukemia/lymphoma. Blood 1995; 86: 1924–1930. germ-line mutations in Sp1 and ATF sites in the human retinoblas- 47 Shiohara M, Spirin K, Said JW, Gombart AF, Nakamaki T, Takeu- toma gene. Nature 1991; 353: 83–86. chi S, Hatta Y, Morosetti R, Tasaka T, Seriu T, Bartram C, Miller 27 Shimizu T, Toguchida J, Kato MV, Kaneko A, Ishizaki K, Sasaki CW, Tomonaga M, Koeffler HP. Molecular analysis of the cyclin- MS. Detection of mutations of the Rb1 gene in retinoblastoma dependent kinase inhibitor p19INK4D in hematopoietic malig- patients by using exon-by-exon PCR-SSCP analysis. Am J Hum nancies. Leukemia 1996; 10: 1897–1900. Genet 1994; 54: 793–800. 48 Cheng J, Scully P, Shew J-Y, Lee W-H, Vila V, Haas M. Homo- 28 Liu Z, Song Y, Bia B, Cowell JK. Germline mutations in the RB1 zygous deletion of the retinoblastoma gene in an acute lympho- gene in patients with hereditary retinoblastoma. Genes Chromo- blastic leukemia (T) cell line. Blood 1990; 75: 730–735. som Cancer 1995; 14: 277–284. 49 Ginsberg AM, Raffeld M, Cossman J. Inactivation of the retinoblas- 29 Kornblau SM, Chen A, del Giglio A, O’Brien S, Deisseroth AB. toma gene in human lymphoid neoplasms. Blood 1991; 77: Retinoblastoma protein expression is frequently altered in chronic 833–840. lymphocytic leukemia. Cancer Res 1994; 54: 242–246. 50 Raghoebier S, van Krieken JHJM, Kluin-Nelemans JC, Gillis A, van 30 Paggi MG, de Fabritiis P, Bonetto F, Amadio L, Santrelli G, Spadea Ommen GJB, Ginsberg AM, Raffeld M, Kluin PM. Oncogene A, Gentile FP, Floridi A, Felsani A. The retinoblastoma gene pro- rearrangements in chronic B-cell leukemia. Blood 1991; 77: duct in acute myeloid leukemia: a possible involvement in promy- 1560–1564. elocytic leukemia. Cancer Res 1995; 55: 4552–4556. 51 Towatari M, Adachi K, Kato H, Saito H. Absence of the human 31 Uchiyama T, Yodoi J, Sagawa K, Takatsuki K, Uchino H. Adult T- retinoblastoma gene product in the megakaryoblastic crisis of cell leukemia: clinical and hematologic features of 16 cases. chronic myelogenous leukemia. Blood 1991; 78: 2178–2181. Blood 1977; 50: 481–492. 52 Ahuja HG, Jat PS, Foti A, Bar-Eli M, Cline MJ. Abnormalities of 32 Yamaguchi K, Takatsuki K. Adult T cell leukaemia–lymphoma. the retinoblastoma gene in the pathogenesis of acute leukemia. Baillie`res Clin Haematol 1993; 6: 899–915. Blood 1991; 78: 3259–3268. 33 Gascoyne RD, Kim SM, Oger JIF, Melosky BL, Dekaban GA. 53 Liu Y, Grander D, Soderhall S, Juliusson G, Einhorn S. Retinoblas- HTLV-I associated adult T cell leukemia/lymphoma: report of two toma gene deletions in B-cell chronic lymphocytic leukemia. cases from an American population in coastal northwest British Genes Chromosom Cancer 1992; 4: 250–256. Columbia. Leukemia 1996; 10: 552–557. 54 Kornblau SM, Xu H-J, del Giglio A, Hu S-H, Zhang W, Calvert L, 34 Miyoshi I, Kubonishi T, Yoshimoto S, Akagi I, Ohtsuki Y, Shiraishi Beran M, Estey E, Andreeff M, Trujillo J, Cork MA, Smith TL, Y, Nagata K, Hinuma Y. Type C virus particles in a cord T-cell Benedict WF, Deisseroth AB. Clinical implications of decreased line derived by co-cultivation of normal human cord leukocytes retinoblastoma protein expression in acute myelogenous leuke- and human leukemic T-cells. Nature 1981; 294: 770–771. mia. Cancer Res 1992; 52: 4587–4590. 35 Popovic M, Sarin PS, Robert-Guroff M, Kalyanraman VS, Mann 55 Weide R, Parviz B, Pfluger K-H, Havemann K. Altered expression D, Minowada J, Gallo RC. Isolation and transmission of human of the human retinoblastoma gene in monocytic leukemia. Br J retrovirus (human T-cell leukemia virus). Science 1983; 219: Haematol 1993; 83: 428–432. 856–859. 56 Neubauer A, de Kant E, Rochlitz C, Laser J, Zanetta AM, Gallardo 36 Yoshida M, Seiki M, Yamaguchi K, Takatsuki K. Monoclonal inte- J, Oertel J, Herrmann R, Huhn D. Altered expression of the retino- gration of human T-cell leukemia provirus in all primary tumors blastoma susceptibility gene in chronic lymphocytic leukaemia. of adult T-cell leukemia suggests causative role of human T-cell Br J Haematol 1993; 85: 498–503. leukemia virus in the disease. Proc Natl Acad Sci USA 1984; 81: 57 Zhu Y-M, Bradbury D, Russel N. Decreased retinoblastoma pro- 2534–2537. tein expression in acute myeloblastic leukemia is associated with 37 Kiyokawa T, Seiki M, Imagawa K, Shimizu F, Yoshida M. Identifi- the autonomous proliferation of clonogenic blasts. Br J Haematol cation of a protein (p40x) encoded by a unique sequence pX of 1994; 86: 533–539. a human T-cell leukemia virus type I. Gann 1984; 75: 747–751. 58 Preudhomme C, Vachee A, Lepelley P, Vanrumbeke M, Zandecki 38 Yip MT, Chen IS. Modes of transformation by the human T-cell M, Quesnel B, Cosson A, Fenaux P. Inactivation of the retinoblas- leukemia viruses. Mol Biol Med 1990; 7: 33–44. toma gene appears to be very uncommon in myelodysplastic syn- 39 Kondo T, Kono H, Nonaka H, Miyamoto N, Yoshida R, Bando F, dromes. Br J Haematol 1994; 87: 61–67. Inoue H, Miyoshi I, Hinuma Y, Hanaoka M. Risk of adult T-cell 59 Lee WH, Bookstein R, Hong F, Young LJ, Shew JW, Lee EYHP. leukemia/lymphoma in HTLV-1 carriers. Lancet 1987; 2: 159. Human retinoblastoma susceptibility gene: cloning, identification, 40 Tokudome S, Tokunaga O, Shimamoto Y, Miyamoto Y, Sumida I, and sequence. Science 1987; 235: 1394–1399. Kikuchi M, Takeshita M, Ikeda T, Fujiwara K, Yoshihara M, Yana- 60 Hoogerwerf WA, Hawkins AL, Perlman EJ, Griffin CA. Chromo- gawa T, Nishizumi M. Incidence of adult T-cell some analysis of nine osteosarcoma. Genes Chromosom Cancer leukemia/lymphoma among human T-lymphotropic virus type 1 1994; 9: 88–92. carriers in Saga, Japan. Cancer Res 1989; 49: 226–228. 61 Sadamori N. Cytogenetic implication in adult T-cell leukemia: a 41 Sakashita A, Hattori T, Miller CW, Suzushima H, Asou N, Takat- hypothesis of leukemogenesis. Cancer Genet Cytogenet 1991; 51: suki K, Koeffler HP. Mutation of p53 gene in adult T-cell leukemia. 131–136. Blood 1992; 79: 477–480. 62 Stilgenbauer S, Dohner H, Bulgay-Morschel M, Weitz S, Bentz 42 Nagai H, Kinoshita T, Imamura J, Murakami Y, Hayashi K, Mukai M, Lighter P. High frequency of monoallelic retinoblastoma gene K, Ikeda S, Tobinai K, Saito H, Shimoyama M, Shimotohno K. deletion in B-cell chronic lymphocytic leukemia revealed by Genetic alteration of p53 in some patients with adult T-cell leuke- interphase cytogenetics. Blood 1993; 81: 2118–2124. mia. Jpn J Cancer Res 1991; 82: 1421–1427. 63 Yamada Y, Fujita M, Suzuki H, Atogami S, Sohda H, Murata K, 43 Yamato K, Oka T, Hiroi M, Iwahara Y, Sugito S, Tsuchida N, Tsukasaki K, Momita A, Kohno T, Maeda T, Joh T, Kamihira S, Miyoshi I. Aberrant expression of the p53 tumor suppressor gene Shiku H, Tomonaga S. Established IL-2-dependent double-nega- Alterations of Rb in ATL Y Hatta et al 989 tive (CD4−CD8−) TCRab/CD3+ ATL cells: induction of CD4 Epigenetic changes may contribute to the formation and spon- expression. Br J Haematol 1994; 88: 234–241. taneous regression of retinoblastoma. Hum Genet 1989; 83: 64 Shimoyama M and members of the Lymphoma Study Group 155–185. (1984–87). Diagnostic criteria and classification of clinical sub- 72 Sakai T, Toguchida J, Ohtani N, Yandell DW, Rapapport JM, Dryja types of adult T-cell leukemia–lymphoma. Br J Haematol 1991; TP. Allele-specific hypermethylation of the retinoblastoma tumor- 79: 428–437. suppressor gene. Am J Hum Genet 1991; 48: 880–888. 65 Johnson KR, Nausseef WM, Care A, Wheelock MJ, Shane S, Hud- 73 Ohtani-Fujita N, Fujita T, Aoike A, Osifchin NE, Robbins PD, son S, Koeffler HP, Selsted M, Miller CW, Rovera G. Characteriz- Sakai T. CpG methylation inactivates the promoter activity of the ation of cDNA clones for human MPO: predicted amino acid human retinoblastoma tumor-suppressor gene. Oncogene 1993; sequence and evidence for multiple mRNA species. Nucleic Acids 8: 1063–1067. Res 1987; 15: 2012–2028. 74 Scrable HJ, Sapienza C, Cavenee WK. Genetic and epigenetic 66 Hatta Y, Hirama T, Takeuchi S, Lee E, Pham E, Miller CW, losses of heterozygosity in cancer predisposition and progression. Strohmeyer T, Wilczynski SP, Melmed S, Koeffler HP. Alterations Adv Cancer Res 1990; 54: 25–62. of the p16 (MTS1) gene in testicular, ovarian, and endometrial 75 Tam SW, Shay JW, Pagano M. Differential expression and cell malignancies. J Urol 1995; 154: 1954–1957. cycle regulation of the cyclin-dependent kinase 4 inhibitor 67 Feinberg AP, Vogelstein B. A technique for radiolabeling DNA p16INK4. Cancer Res 1994; 54: 5816–5820. restriction endonuclease fragments to high specific activity. Anal 76 Okamoto A, Demetrick DJ, Splillare EA, Hagiwara K, Hussain SP, Biochem 1983; 132: 6–13. Bennett WP, Forrester K, Gerwin B, Serrano M, Beach D, Harris 68 Toguchida J, McGee TL, Paterson JC, Eagle JR, Tucker S, Yandell CC. Mutations and altered expression of p16INK4 in human cancer. DW, Dryja TP. Complete genomic sequence of the human retino- Proc Natl Acad Sci USA 1994; 91: 11045–11049. blastoma susceptibility gene. Genomics 1993; 17: 535–543. 77 Okamoto A, Hussain SP, Hagiwara K, Spillare EA, Rusin MR, 69 Sheffield VC, Beck JS, Kwitek AE, Sandstrom DW, Stone EM. The Demetrick DJ, Serrano M, Hannon GJ, Shiseki M, Zariwala M, sensitivity of single-strand conformation polymorphism analysis Xiong Y, Beach DH, Yokota J, Harris C. Mutation in the for the detection of single base substitution. Genomics 1993; 16: p16INK4/MTS1/CDKN2, p15INK4B/MTS2, and p18 genes in primary 325–332. and metastatic lung cancer. Cancer Res 1995; 55: 1448–1451. 70 Hangaishi A, Ogawa S, Imamura N, Miyawaki S, Miura Y, Uike N, Shimazaki C, Emi N, Takeyama K, Hirosawa S, Kamda N, Kobayashi Y, Takemoto Y, Kitani T, Toyama K, Ohtake S, Yazaki Reference added in proof Y, Ueda R, Hirai H. Inactivation of multiple tumor-suppressor genes involved in negative regulation of the cell cycle, 78 Hatta Y, Spirin K, Tasaka T, Morosetti R, Said JW, Yamada Y, MTS1/p16INK4A/CDKN2, MTS2/p15INK4B, p53, and Rb genes in pri- Tomonaga M, Koeffler HP. Analysis of p18INK4C in adult T-cell mary lymphoid malignancies. Blood 1996; 87: 4949–4958. leukemia (ATL) and non-Hodgkin’s lymphoma. Br J Haematol 71 Greger V, Passarge E, Ho¨pping W, Messmer E, Horsthemke B. (submitted).