Identifying Novel Genes Involved in Zinc Homeostasis Using a Fission Yeast Model

Identifying novel genes involved in zinc homeostasis using a fission yeast model

THESIS

Presented in Partial Fulfillment of the Requirements for the Degree Master of Science in the Graduate School of The Ohio State University

Yi-Hsuan Liu

Graduate Program in Human Nutrition

The Ohio State University

2015

Master's Examination Committee:

Amanda Bird, Ph.D. (Advisor)

Earl Harrison, Ph.D.

Kichoon Lee, Ph.D.

Copyrighted by

Yi-Hsuan Liu

2015

Abstract

Metals, such as iron, zinc, copper, and manganese are needed to maintain normal biological and cellular functions and are therefore essential for all organisms. Zinc plays a particularly important role in biological systems as it is a cofactor for many different proteins. However, in excess, zinc is toxic to cell growth. As a consequence, mechanisms to regulate the import, export, and availability of zinc are found in all living organisms to maintain optimal zinc levels. Although zinc is essential for life, knowledge of how zinc homeostasis is regulated at the transcriptional, post-transcriptional, translational, and post-translational level is relatively limited.

In humans, aberrant zinc levels are observed in a large number of disorders, such as acrodermatitis enteropathica and pancreatic cancer (Neldner and Hambidge 1975, Li et al. 2007). Therefore, identifying factors that affect zinc homeostasis is important to understand the connections that exist between zinc and disease. In the fission yeast

Schizosaccharomyces pombe, a protein called Loz1 (for Loss Of Zinc sensing 1) plays an important role in the transcriptional regulation of genes involved in zinc homeostasis and zinc-dependent cellular pathways.

Loz1 is a transcriptional factor that represses target gene expression under zinc- replete conditions. Cells that lack Loz1 constitutively express genes required for zinc uptake and therefore hyperaccumulate zinc. Using this characteristic, I utilized Loz1 as a ii tool to study mechanisms of zinc homeostasis, and identify additional factors involved in zinc-dependent processes.

Genes that Loz1 regulates includes zrt1 and zym1, which encodes a high affinity zinc uptake system and zinc binding metallothionein, respectively (Dainty et al. 2008,

Borrelly et al. 2002). As Loz1 regulates the expression of genes critical to zinc homeostasis, I hypothesized that other Loz1 target genes may also play an important role in zinc homeostasis. In this thesis, I use RNA-seq analysis to identify new Loz1 targets.

In addition, as cells lacking Loz1 hyperaccumulate zinc, I take advantage of this phenotype to identify genes involved in mitochondrial zinc transport.

iii

Dedication

This thesis is dedicated to my family for their unconditional love and support

Acknowledgments

First and foremost, I would like to thank my advisor, Dr. Amanda Bird for recruiting me as her graduate student and her guidance on my research work throughout the past years. I would also like to thank my committee members, Dr. Earl Harrison and

Dr. Kichoon Lee as well as faculty members at OSU. It is my pleasure to work with them during my graduate studies.

I would also like to thank current and past members of the Bird lab and all fellow students in the Human Nutrition program for their assistance and company, especially

Mark Corkins for his help and technical support over the past years.

Besides faculty at OSU, I would like to express my sincere gratitude to Dr. Jeffrey

Blumberg, one of my mentors when I worked as a visiting undergraduate scholar at Tufts

University and his wife, Dr. Julie Buring at Harvard University. Their love and mental support throughout my graduate studies have been giving me lots of positive energy.

Last but not least, I would like to thank my parents for raising me up and always supporting me. I would also like to thank my sister for her company throughout my life.

Also, I would like to thank Si-Han Chen for his support and encouragement.

Vita

February 10, 1990 ...... Born in Taipei, Taiwan

2008 - 2012 ...... B.S., Nutrition and Health Sciences, Taipei Medical University

2012 - 2013 ...... Graduate Research Associate, Department of Human Nutrition,

The Ohio State University

2013 - present ...... Graduate Teaching Associate, Department of Human Sciences,

The Ohio State University

Publications

Corkins ME, May M, Ehrensberger KM, Hu YM, Liu YH, Bloor SD, Jenkins B, Runge

KW, Bird AJ (2013). Zinc finger protein Loz1 is required for zinc-responsive regulation of gene expression in fission yeast. Proc. Natl. Acad. Sci. U.S.A. 110:15371-15376.

Fields of Study

Major Field: Human Nutrition

Table of Contents

Abstract ...... ii

Dedication ...... iv

Acknowledgments...... v

Vita ...... vi

Publications ...... vi

Fields of Study ...... vi

Table of Contents ...... vii

List of Tables ...... xi

List of Figures ...... xii

Chapter 1 ...... 1

Introduction ...... 1

1.1 Why is zinc essential? ...... 1

1.2 Zinc transport in human ...... 2

1.3 Misregulation of intracellular zinc and disease ...... 4

1.4 Maintaining zinc homeostasis in living organism ...... 6 vii

1.5 Research Objective ...... 7

Chapter 2 ...... 9

Materials and Methods ...... 9

2.1 Yeast strains, growth conditions and medium ...... 9

2.2 RNA isolation and northern blot ...... 9

2.3 Site-directed mutagenesis ...... 11

2.4 Transformations and integrations ...... 12

2.4.1 Yeast Transformation ...... 12

2.4.2 E. coli Transformation ...... 12

2.5 β-galactosidase (lacZ reporter gene) assay...... 13

2.6 Serial dilution growth assay ...... 14

2.7 Mitochondria isolation ...... 14

2.8 Protein preparation and western blot ...... 15

2.9 Atomic absorption spectrometry ...... 16

2.10 Primers ...... 17

2.11 Plasmids ...... 17

Chapter 3 ...... 18

Identifying additional Loz1target genes ...... 18

3.1 Introduction ...... 18

viii

3.2 Results ...... 22

3.2.1 The identification of Loz1 target genes by RNA-seq analysis ...... 22

3.2.2 Identifying consensus sequence required for Loz1 binding ...... 27

3.2.3 Additional elements may be responsible for Loz1 DNA binding ...... 28

3.2.4 Defining the minimal Loz1 binding site ...... 33

3.2.5 Determining whether spermidine synthesis and transport pathways are

regulated by zinc ...... 35

3.3 Discussion ...... 39

Chapter 4 ...... 46

Identifying genes involved in mitochondrial zinc transport ...... 46

4.1 Introduction ...... 46

4.2 Results ...... 49

4.2.1 loz1 mutant cells accumulate zinc in the mitochondria ...... 49

4.2.2 Gene SPBC3H7.05c was found to be potentially responsible for mitochondrial

zinc transport ...... 56

4.3 Discussion ...... 59

Chapter 5 ...... 63

Concluding remarks ...... 63

References ...... 65

Appendix ...... 75

Additional tables and figures ...... 75

List of Tables

Table 1. Characteristics of the human ZnT and ZIP proteins ...... 3

Table 2. 56 genes are found to be potential Loz1 targets ...... 25

Table 3. 58 S. pombe bioneer strains screened for analyzing mitochondrial zinc levels .. 53

Table 4. All S. pombe strains used in this study ...... 75

Table 5. All primers used in this study ...... 80

Table 6. All plasmids used in this study ...... 82

Table 7. 3 S pombe. strains that were unable to be obained from Bioneer collection ...... 83

Table 8. 14 S pombe. strains that failed to grow in ZL-EMM with 200 μM zinc supplements...... 84

Table 9. Total and mitochondrial zinc levels of the 58 strains screened ...... 87

List of Figures

Figure 1. Zinc homeostasis in S. pombe...... 7

Figure 2. Mechanism of Loz1 function in S. pombe ...... 19

Figure 3. Transcriptional response of loz1 mutant...... 21

Figure 4. Strategy used to prepare samples for performing RNA-seq analysis ...... 23

Figure 5. Identifying Loz1 target genes ...... 24

Figure 6. Consensus sequence of Loz1 binding site obtained by using Scope motif finder.

...... 28

Figure 7. Loz1 target mRNA levels are regulated by zinc, and loss of Loz1 activity results in increased mRNA levels of target genes...... 30

Figure 8. Expression of the lacZ reporter gene leads to increased levels of β-galactosidase activity...... 30

Figure 9. Schematic diagram of JK-vel1-lacZ reporter constructs generated ...... 31

Figure 10. β-galactosidase activity in wild-type and loz1∆ cells expressing constructs with Loz1 binding site mutation...... 32

Figure 11. Constructs generated to determine minimal Loz1 binding site ...... 34

Figure 12. Polyamine metabolism in yeast...... 37

xii

Figure 13. Spermidine transporter mRNA levels are regulated by zinc and loss of Loz1 activity results in increased mRNA levels ...... 37

Figure 14. Spermidine transporter deletion strains have no obvious zinc-dependent growth defects ...... 38

Figure 15. Proposed mechanism of Loz1 function in several target genes...... 41

Figure 16. Amino acid sequence alignments of spermidine family transmembrane transporters ...... 42

Figure 17. MAPK pathway in S. pombe...... 45

Figure 18. The effects of zinc in healthy and malignant prostate epithelial cells ...... 48

Figure 19. Loz1 mutant strain hyperaccumulates intracellular and mitochondrial zinc levels ...... 50

Figure 20. Strategy used to determine genes screened for mitochondrial zinc levels ...... 52

Figure 21. Fold change of mitochondrial zinc levels compared to wild-type (WT) and loz1 mutant (loz1∆) strains respectively ...... 57

Figure 22. Fold change of total cellular zinc levels compared to wild-type (WT) and loz1 mutant (loz1∆) strains respectively ...... 85

xiii

Chapter 1

Introduction

1.1 Why is zinc essential?

As the body cannot synthesize zinc, it has to be obtained directly from the diet

(Prasad 1993). Zinc is thus essential for life. In enzymes, zinc can have structural and catalytic roles (Vallee and Auld 1990). Enzymes that require a zinc cofactor include alkaline phosphatase and alcohol dehydrogenase (Coleman 1992, Vallee and Hoch 1955,

Costello et al. 1997). Zinc also has a structural role in many regulatory proteins that control gene expression. In these proteins, zinc binding domains often facilitate interactions with DNA (Klug 1999).

Zinc deficiency is a major public health problem in many developing countries

(Engle-Stone et al. 2014). Deficiencies in zinc are correlated with a number of health conditions including growth retardation, immune dysfunction, and an increased risk for a number of cancers (Costello et al. 2005, Prasad 1988, Adlard et al. 2010, Duchateau et al.

1981). In contrast, zinc toxicity may cause neurological disease and copper deficiency

(Mizuno and Kawahara 2013, Nations et al. 2008). Therefore, maintaining optimal zinc levels is critical for human health.

1.2 Zinc transport in human

In the human body, zinc levels are tightly regulated. In response to zinc starvation, cells increase zinc uptake and release zinc from organelle storage. Some non-essential zinc-requiring proteins are also repressed, potentially to conserve zinc for more important functions (Ehrensberger and Bird 2011, King, Shames and Woodhouse 2000). On the other hand, when zinc is in excess, zinc is exported and the levels of metallothionein, a protein that is responsible for zinc buffering, are increased allowing zinc to be stored.

(Ehrensberger and Bird 2011, Jacob, Maret and Vallee 1998). By regulating these processes, cells within the human body are able to maintain optimal zinc levels for normal biological functions.

In mammals, zinc is transported into and out of cells by specific zinc influx and efflux transporters. The two major zinc transporter families are the Zrt- and Irt-like proteins (ZIP) family and Cation Diffusion Facilitator (CDF) family, also known as ZnT family, which are encoded by solute-linked carrier (SLC) gene families, SLC39A and

SLC30A, respectively (Jeong and Eide 2013, Leung et al. 2008, Kambe, Hashimoto and

Fujimoto 2014). Misregulation of the zinc transporter gene expression is associated with a range of disorders and disease development (Hogstrand et al. 2009). (Table 1)

Table 1. Characteristics of the human ZnT and ZIP proteins (adapted from Hogstrand et al., 2009). Protein Gene name Molecular function Gene expression Related disease name ZnT1 SLC30A1 Cytoplasmic zinc Widespread Alzheimer's removal disease, lung tumors ZnT2 SLC30A2 Zinc transport into Small intestine, vesicles kidney, pancreas, testis, seminal vesicles, mammary gland, epithelial cells ZnT3 SLC30A3 Zinc transport into Brain, testis Alzheimer’s synaptic vesicles disease, ZnT4 SLC30A4 Zinc transport into milk Mammary gland, Alzheimer’s and mast cell vesicles brain, small disease, lung intestine, mast tumours cells, placenta, blood, epithelial cells ZnT5 SLC30A5 Zinc transport into Golgi Pancreatic b-cells, and vesicles. Variant b intestine, heart, transports zinc brain, liver, bidirectionally kidney, blood, epithelial cells ZnT6 SLC30A6 Zinc transport into Golgi Small intestine, Alzheimer’s and vesicles brain, liver, blood, disease adipose tissue ZnT7 SLC30A7 Zinc transport into Golgi Small intestine, liver, retina, spleen, blood, epithelial cells ZnT8 SLC30A8 Zinc transport Pancreatic β-cells Diabetes mellitus ZnT9 SLC30A9 Unknown Widespread ZIP1 SLC39A1 Zinc uptake Widespread Prostate cancer ZIP2 SLC39A2 Zinc uptake Prostate, uterus, Prostate cancer cervical epithelium, optic nerve, monocytes ZIP3 SLC39A3 Zinc uptake Prostate, uterus, Prostate cancer cervical epithelium, optic nerve, monocytes Continued

Table 1 continued

ZIP4 SLC39A4 Zinc uptake Small intestine, Acrodermatitis stomach, colon, enteropathica cecum, kidney ZIP5 SLC39A5 Zinc uptake Kidney, liver, spleen, colon, stomach, pancreas ZIP6 SLC39A6 Zinc uptake Widespread Breast cancer, migration, gastrulation ZIP7 SLC39A7 Zinc into cytosol Widespread Tamoxifen- resistant breast cancer ZIP8 SLC39A8 Zinc/cadmium/manganes Widespread Cd testicular e uptake susceptibility locus ZIP9 SLC39A9 Unknown Widespread ZIP10 SLC39A10 Zinc uptake Widespread Breast cancer ZIP11 SLC39A11 Unknown Widespread ZIP12 SLC39A12 Zinc uptake Brain, lung, testis, Asthma, SNP retina linked to schizophrenia ZIP13 SLC39A13 Zinc into cytosol Widespread Ehlers-Danlos syndrome ZIP14 SLC39A14 Zinc and non-transferrin Widespread Asthma, IL-6 bound iron uptake mediated inflammation

1.3 Misregulation of intracellular zinc and disease

Zinc depletion is an early step in prostate malignancy along with reduced expression of ZIP1 (Costello et al. 2011). In a prostate epithelial cell, zinc can induce apoptosis by activating caspase cascades which facilitate the translocation of the cell apoptosis regulator BAX from cytosol to mitochondria to form pores in the mitochondria membrane (Franz et al. 2013). Zinc can also inhibit angiogenesis and invasion by

4 suppressing oncogenic signaling pathway, nuclear factor-κB (NF-κB) transcription factor and down-regulating its target genes, such as vascular endothelial growth factor (VEGF), interleukin-8 (IL-8), and matrix metallopeptidase (MMP-9) (Kim et al. 2013). Moreover, the inhibitory effect of zinc makes prostate cancer cells sensitive to cytotoxic agents

(Uzzo et al. 2002, Golovine et al. 2008, Sztalmachova et al. 2012, Kim et al. 2013, Bao et al. 2012). In a malignant prostate epithelial cell, impaired function of ZIP1 results in decreased intracellular zinc levels in the cell that leads to destroyed NF-κB inhibition by stimulating its expression and enhancing the nuclear translocation that in turn activates the expression of genes involved in tumorigenesis (Franz et al. 2013, Costello et al. 2011).

Decreased intracellular zinc levels also disrupt growth restriction, apoptosis mechanisms, and the tumor suppressor role of zinc (Costello and Franklin 2012). Zinc is important for regulating cellular pathways in the mitochondria. However, how zinc is regulated and transported in the mitochondria is currently unknown.

Zinc also plays a role as an intracellular and extracellular signaling molecule

(Yamasaki et al. 2007). Extracellularly, it is involved in modulating the sensitivity of neurotransmitters by allosterically regulating GABAA receptors (Hosie et al. 2003,

Murakami and Hirano 2008). Intracellularly, zinc is released from intracellular zinc storage resulting in the inactivation of protein tyrosine phosphatases (Hogstrand et al.

2009). Inactivation of tyrosine phosphatases can in turn activate several tyrosine kinases involving in a variety of intracellular signaling pathways. ZIP7 is an endoplasmic reticulum (ER)-located zinc transporter thought to be responsible in controlling the release of zinc from storage. Elevated intracellular zinc release mediated specifically by

ZIP7 is required for activation of tyrosine kinases, suggesting that ZIP7 may be the major regulator of intracellular zinc release from storage. With its possible role in controlling tyrosine kinases which involves in several cancer development, ZIP7 has been implicated in targeting cancer therapy, such as hormone-related breast cancer (Hogstrand et al. 2009).

Despite the fact that increasing evidence has shown zinc is an important factor for disease progression, little is known about how changes in zinc levels affect risk and progression of disease. Understanding the mechanisms regarding zinc homeostasis and identifying cellular pathways that are affected by alterations in zinc levels will provide more insights into zinc-related disease prevention and therapy.

1.4 Maintaining zinc homeostasis in living organism

To determine how zinc regulates cellular pathways and how cells sense and regulate cellular zinc levels, our lab uses the fission yeast, Schizosaccharomyces pombe as a model system. Advantages of using S. pombe to study biological and cellular pathways include that it is easy to use, has a short cell doubling time, and has excellent homologous recombination feature for genetic studies. Also, many cellular pathways that are found in humans are highly conserved in S. pombe (Hayles and Nurse 1992).

The S. pombe genome encodes a number of proteins that are known to have important roles in zinc transport and zinc buffering (Figure 1). These proteins include zrt1, which encodes the major zinc transporter required for the uptake of zinc into the cytosol, and fet4, which encodes a different metal transporter that is able to transport both zinc and iron (Dainty et al. 2008, Pelletier et al. 2002). Fet4 is located on the plasma

6 membrane and plays a minor role in zinc uptake (Pelletier et al. 2002). Other genes important in zinc homeostasis are zym1, which encodes a zinc-metallothionein that is potentially involved in zinc buffering, and zhf1, which encodes a CDF transporter that can pump zinc into the ER for storage (Borrelly et al. 2002).

Figure 1. Zinc homeostasis in S. pombe.

1.5 Research Objective

One goal of my research was to use RNA-seq to determine which genes are regulated by Loz1 and zinc. I hypothesize that genes that are regulated in response to

7 varying zinc concentrations play important roles in cellular and biological pathways. A second goal was to identify genes involved in mitochondrial zinc transport.

My studies will help provide insights into the metabolic pathways and processes that are directly regulated by zinc at a cellular level, and provide directions for understanding which biological pathways are regulated by zinc in human.

Chapter 2

Materials and Methods

2.1 Yeast strains, growth conditions and medium

The Schizosaccharomyces pombe strains used in this study can be found in Table

4 of the Appendix. Strains were grown in either yeast extract + supplements (YES; 0.5% yeast extract, 3% glucose, 112.5 µg/ml adenine, 75 µg/ml uracil,75 µg/ml histidine, 75

µg/ml leucine) or in zinc-limited Edinburgh minimal medium (ZL-EMM) with or without indicated zinc supplement at 31oC (Ehrensberger et al. 2013, Corkins et al. 2013). Cells were pre-grown to exponential phase in YES medium. Cells were then washed twice in

ZL-EMM, and further grown for ~16-18 hours in ZL-EMM with or without indicated zinc supplement (ZnSO4). For cells grown for isolating RNA for RNA-seq analysis, cell cultures were inoculated at a final optical density (OD600nm) of 0.5 in a volume of 30ml and grown for 17 hours in ZL-EMM with or without zinc supplements.

2.2 RNA isolation and northern blot

Unless specified, total RNA was isolated by using hot acidic phenol method

(Collart and Oliviero 2001, Ehrensberger et al. 2013, Corkins et al. 2013). Cell cultures were grown overnight and were spun down to collect cell pellets. Cell pellets were

9 resuspended in 650 µl TES (10 mM Tris-Cl pH 7.4, 10 mM EDTA, 0.5% SDS). 650 µl acidic phenol/chloroform (pH 4.3) was then added before an incubation at 65 oC for 1 hour. Cell mixtures were centrifuged at 12000 rpm for 5 minutes and the aqueous layer was removed and collected in a new tube. 500µl acidic phenol/chloroform (pH 4.3) was then added to the aqueous layer and the mixture was vortexed and then centrifuged at

12000 rpm for 5 minutes. The aqueous layer of the mixture was subsequently washed with 400 µl chloroform, before the RNA sample was precipitated by adding 50 µl 3M sodium acetate (pH5.2) and 900 µl 100% ethanol followed by centrifugation at 12000 rpm for 10 minutes. The supernatant was then discarded and RNA pellets were resuspended in 50-200 µl of ddH2O. The concentrations of RNA (~1-3 µg/µl) were measured by using NanoDropTM 1000 series Spectrophotometer (Thermo Fisher

Scientific). For the RNA samples extracted for RNA-seq analysis, RiboPure™ RNA

Purification Kit, yeast (Ambion) was used to obtain pure total RNA according to the manufacturer's instructions.

For northern blot analysis, 7-15 µg of total RNA was denatured and loaded with equal volume of RNA loading dye on formaldehyde gels. For each gel: 0.7 g agarose dissolved in 75 ml ddH2O, 7.5 ml 37% formaldehyde, 5 ml 10X MOPS buffer (0.2 M

MOPS pH 7.0, 20 mM sodium acetate, 10 mM EDTA pH 8.0). All gels were run overnight at 18-21 V and stained with ethidium bromide for detection of ribosomal RNA.

Capillary method using alkaline transfer buffer (3 M NaCl, 0.01 M NaOH) was used to transfer RNA from the formaldehyde gel to the nylon membrane (Ambion® BrightStar® -

Plus). RNA samples were cross-linked to the nylon membrane using a UV crosslinker

(Stratagene® UV Stratalinker 1800) after capillary transferring for 6 hours.

RNA blots were probed with α- P32 radiolabeled dCTP strand-specific RNA probes generated from purified T7 labeled- PCR products with the MAXIscript T7 kit

(Ambion) according to the manufacturer's instructions. PCR primers used for RNA probe generation are listed in Table 5 of the Appendix, or have been described in the literature

(Corkins et al. 2013, Ehrensberger et al. 2014). RNA probes were hybridized to the blots at 60 oC with rotating using northern hybridization buffer (0.5 M sodium phosphate pH

7.2, 7% SDS, 1 mM EDTA) overnight. RNA blots were then washed twice in 2X SSC

(0.316 M NaCl, 0.03 M sodium citrate dihydrate) / 0.1% SDS and placed in the phosphor screen (Amersham Bioscinces/GE Healthcare Life Sciences) for exposure. RNAs were identified by using the Typhoon PhosphorImager (GE Healthcare Life Sciences).

2.3 Site-directed mutagenesis

All synthetic oligonucleotide primers used for site-directed mutagenesis are listed in Table 5 of the Appendix. Site-directed mutagenesis was conducted by using protocol modified from the Quikchange® site-directed mutagenesis protocol (Stratagene). PCR reaction for site-directed mutagenesis includes: 1 µl plasmid DNA (at a concentration of

~60 ng/μl), 1 µl forward primer (10 µM), 1 µl reverse primer (10 µM), 1 µl dNTPs (10 mM), 5 µl 10x Pfu buffer (Stratagene), 1 µl Pfu turbo DNA polymerase (Stratagene), and

40 µl ddH2O for 50 µl in total. PCR reaction was performed according to the manufacturer's instructions. Restriction enzyme DpnI (NEB) were then used to digest

PCR products in order to delete the methylated, non-mutated template plasmid.

Following digestion, the mutated plasmid would be transformed to E. coli.

2.4 Transformations and integrations

2.4.1 Yeast Transformation

Integrated plasmids were linearized by NruI or BsiWI at the leu1 locus. Yeast transformation was conducted by using modified lithium acetate protocol (Kanter-Smoler,

Dahlkvist and Sunnerhagen 1994). Overnight yeast cultures were centrifuged and resuspended with 1x lithium acetate. 10-15 minutes of cell incubation with plasmid followed by 15 minutes incubation of cell, plasmid, 1x lithium acetate/40% polyethylene glycol (PEG), and boiled salmon sperm DNA. The sample mixture was then heat shocked at 42 oC for 15 minutes. Cells were grown in YES medium at 31 oC with shaking for 1 hour and transformants selected by plating onto leucine- deficient minimal medium. Cell colonies were screened by either an X-gal blue/white screen (for lacZ integrants) or northern blot analysis.

2.4.2 E. coli Transformation

Plasmids were transformed into Escherichia. coli using either chemical method or electroporation. Chemical transformations were performed using DH5α Invitrogen chemically competent cells. For these types of transformation, cells were thawed on ice before plasmid DNA was added. The DNA/cell mix was placed on ice for 20 minutes, followed by 25 seconds heat shock at 42 oC. 900 µl Luria Broth (LB) medium was then

12 added. The mixture of competent cells, plasmid, and LB medium was place in 37 oC incubator with shaking for 1 hour. Cells were spun down at 4000 rpm, and the resuspended pellet was spread onto LB plates supplemented with 100 mg/ml antibiotic ampicillin. For electroporation, self-made XL-Blue competent cells were used. Cells were electroporated with plasmid at 1500 V by using an electroporator (Eppendorf®

Electroporator 2510) followed by incubation with 900 µl LB medium in 37 oC incubator with shaking for 1 hour. Resuspended pellet was then spread on LB plate with antibiotic ampicillin.

Plasmid isolation using Miniprep kit (Qiagen) was performed to extract plasmid from colonies. Correct clones were confirmed by DNA sequencing analysis.

2.5 β-galactosidase (lacZ reporter gene) assay

LacZ reporter gene constructs were generated by fusing the promoter of the gene of interest to the lacZ gene in the JK148 plasmid backbone (Ehrensberger et al. 2013,

Corkins et al. 2013). Cells were grown as described in 2.1 with or without zinc supplements and then centrifuged at 3500 rpm for 3 minutes. Cell pellets were washed once with 3.5 ml cold lacZ buffer (60 mM Na2HPO4 ∙ 7H2O, 40 mM NaH2PO4 ∙ H2O, 10 mM KCl, 1 mM MgCl2). Cells were centrifuged and resuspended with lacZ buffer again followed by measurement of cell density at OD 600 nm. 1.5 ml of cells along with 100 µl chloroform and 100 µl 0.1% SDS were mixed and vortexed for 10 seconds to break the cells.

3 x 500 µl of sample mix (cells, chloroform, and 0.1% SDS) were pipetted to three microcentrifuge tubes and used for the assay in a triplicate manner. 100 µl ortho-

Nitrophenyl-β-galactoside (ONPG, 4 mg/ml) was added to the sample mix to start the assay and the initiation of each tube was perform at a 10-seconds interval. 250 µl 1 M

Na2CO3 was added to each tube at a 10-seconds interval when yellow color was observed to stop the reaction. Sample mixes were centrifuged down at the highest speed for 15 seconds and supernatant was measured at OD 420 nm for further analysis.

β-galactosidase activities were calculated by using the formula: (culture absorbance at OD 420 nm x 1000) / (time (min) x culture absorbance at OD 600 nm).

2.6 Serial dilution growth assay

Cells were grown overnight in YES and plated on specified medium agar plates.

Cells were inoculated to a final optical density (OD600nm) of 1 before four 10-fold serial dilutions were performed. 5 μl of each dilution was plated onto indicated plates.

2.7 Mitochondria isolation

Crude mitochondria were prepared by using modified lyticase method (Glick and

Pon 1995, Cobine et al. 2004). Lyticase (Sigma-Aldrich) was resuspended with phosphate buffer (0.1 M phosphate (KH2PO4, Na2HPO4, pH 7.4), 0.1 M salt (KCl, NaCl),

50% Glycerol, ddH2O) at a final concentration of 1000 units/ml. Cells were grown as described in 2.1, centrifuged at 3500 rpm for 3 minutes, and resuspended with cold ddH2O. Cells were centrifuged again and pellets were resuspended with cold SHP buffer

(1.2 M sorbitol, 20 mM HEPES-KOH (Fisher Scientific), 10 mM DTT) at the volume of

0.5 g cells/ml. Lyticase was then added at the amount of 1000 units/g of cells and incubated at 30 oC water bath for 45 minutes to generate spheroplasts. Following lyticase incubation, spheroplasts were centrifuged at 2000 rpm, 4 oC for 5 minutes and removed.

Pellets were washed with cold SHP buffer and glass beads were added for vortexing 2 minutes for two times with 2 minutes on ice in between. Samples were centrifuged at

1100 rpm, 4 oC for 5 minutes. Supernatant was removed and collected in a new tube followed by centrifugation at 2200 rpm at 4 oC for 5 minutes. Supernatant containing mitochondria was then transferred to a new tube and centrifuged at 10,000 x g at 4 oC for

10 minutes. Final supernatant was discarded and pellets containing mitochondria were stored at -80 oC for further analysis.

2.8 Protein preparation and western blot

Protein preparation in this study was performed using a modified version of the trichloroacetic acid (TCA) protocol from the Herskowitz lab (Peter et al. 1993). Cells were grown as described in 2.1, centrifuged at the highest speed for 30 seconds and cell pellets were resuspended with 500 µl TCA resuspension buffer (0.02 M Tris-Cl pH 7.4,

0.05 M ammonium acetate, 0.002 M EDTA), 500 µl 20% TCA, 500 µl glass beads followed by 2 minutes vortexing for three times with 1 minute on ice in between. Until glass beads settle, liquid portion was transferred to a new tube and centrifuged at the highest speed for 4 minutes. Pellets containing protein of interest were collected and centrifuged at the highest speed for 30 seconds to remove remaining liquid. Cell pellets

15 were resuspended with 150 µl laemmli protein loading dye and then boiled at ~100 oC for

5 minutes. Samples were stored at -20 oC for further analysis.

SDS-PAGE gels contained 10-15% acrylamide were run by using Mini-

PROTEAN® Tetra Cell system (BioRad) with 1x SDS-PAGE running buffer (0.025 M

Tris-base, 0.2 M glycine, 0.02% SDS). SDS-PAGE gels were transferred to PVDF membrane (Biorad) by using Mini Trans-Blot® system (BioRad) with western transfer buffer that contained 10-20% methanol. Blots were blocked with TBST (50 mM Tris-Cl, pH 7.4, 150 mM NaCl, 0.1% Tween) + 5% milk at room temperature with shaking for 30 minutes. Primary antibodies were added after blocking according to manufacturer's instructions and membranes were probed at 4 oC with shaking overnight followed by 15 minutes washing for two times with TBST. Secondary antibodies were then added for probing for 1 hour. Following secondary antibody incubation, blots were washed with

TBST for 15 minutes twice and finally rinsed with TBS. Blots were developed and identified by using LI-COR® system.

2.9 Atomic absorption spectrometry

Mitochondria zinc levels were measured by atomic absorption spectrometry

(Varian® SpectrAA 220FS). Isolated crude mitochondria were resuspended in nitric acid

o and boiled at ~250 C for 45 minutes. Samples were diluted by adding 18 mΩ dH2O to a total volume of 1000 µl. Analysis of zinc levels was performed by using zinc lamp

(Thermo Fisher Scientific® Hollow Cathode Lamp, Zinc) and calibrating with zinc standards (0.05, 0.1, 0.25, 0.5, 1, and 2 mg/L zinc). Quantity of mitochondria was

16 calibrated by protein Bradford assay determined by NanoDropTM 1000 series

Spectrophotometer (Thermo Fisher Scientific).

2.10 Primers

All primers used in this study were ordered from and produced by Sigma-

Aldrich® . Primers used are listed in Table 5 of the Appendix.

2.11 Plasmids

Plasmids used in this study were generated from pJK148 or pTN template. All plasmids used are listed in Table 6 of the Appendix.

Chapter 3

Identifying additional Loz1target genes

3.1 Introduction

Zinc is a required nutrient for many biological functions. Both zinc deficiency and zinc overload result in negative health consequences (Oteiza and Mackenzie 2005,

Mizuno and Kawahara 2013). Therefore, organisms have evolved methods to maintain optimal intracellular zinc levels. These mechanisms include tightly regulating the expression of zinc transport genes at a transcriptional level. Zinc responsive transcription factors that facilitate such changes include Zap1 in Saccharomyces cerevisiae, MTF-1 in mammals, fish and reptiles, and Zur in Escherichia coli (Choi and Bird 2014, Westin and

Schaffner 1988, Brugnera et al. 1994, Auf der Maur et al. 1999, Dalton et al. 2000, Chen et al. 2002, Lindert et al. 2008, Chan and Chan 2008, Ferencz and Hermesz 2009, Qiu et al. 2013, Georgiev et al. 2014, Patzer and Hantke 1998, Zhao and Eide 1997). In

Schizosaccharomyces pombe, zinc-dependent changes in gene expression require the transcriptional repressor Loz1 (Loss Of Zinc sensing 1), which is encoded by gene

SPAC25B8.19c (Corkins et al. 2013). Loz1 contains two C2H2-type zinc finger domains and an accessory domain that are necessary for its zinc-dependent activity (Ehrensberger et al. 2014).

Loz1 is a transcriptional factor that is required for the gene repression under zinc- replete conditions (Figure 2A). In zinc-replete medium, Loz1 binds to the promoter region of its target gene to repress gene expression. However, when it is under zinc- deficient conditions, Loz1 has no repressor effect on target gene expression (Figure 2B).

Figure 2. Mechanism of Loz1 function in S. pombe. (A) Loz1 is active and represses target gene expression under zinc-replete conditions. (B) Loz1 is inactive in zinc- deficient cells. (C) Northern blot analysis to examine Loz1 target gene regulation over a range of zinc concentrations (Zinc-limited minimal media 0, 50, 200 and 500 μM Zinc). Pgk1 RNA probe was used as a loading control. (Corkins et al. 2013) 19

In S. pombe, a number of genes are regulated by zinc (Dainty et al. 2008,

Ehrensberger et al. 2013). The majority of these highly zinc-responsive genes appear to be regulated by Loz1. These genes include zrt1, zym1, and adh4, which encode a zinc uptake transporter, a zinc buffering protein, and an alcohol dehydrogenase (Corkins et al.

2013) (Figure 3). As Loz1’s activity is regulated by zinc, it is very likely that other Loz1 target genes may also play important roles in zinc homeostasis. In an effort to determine how Loz1 controls zinc homeostasis, I set out to find more Loz1 target genes, and the

DNA response element in which Loz1 binds. In this chapter, studies performed to map the Loz1 binding site will be discussed.

Figure 3. Transcriptional response of loz1 mutant (adapted from Corkins et al., 2013). Wild-type, loz1-1, and loz1 knock-out cells were grown in ZL-EMM supplemented with 0, 50, 200, or 500 µM Zn. Total RNA was purified for northern blot analysis. Pgk1 probe was used as a loading control.

3.2 Results

3.2.1 The identification of Loz1 target genes by RNA-seq analysis

In order to identify additional Loz1 target genes, I performed RNA-seq analysis to identify genes regulated by zinc and by Loz1. In these experiments, wild-type and loz1 knock-out strains were cultured in zinc-replete and zinc-deficient conditions as described in 2.1. Total RNA was then purified from the cells, and RNA-seq analysis was performed by Beckman Coulter® (Figure 4).

The RNA-seq analysis revealed that 162 genes were regulated by Loz1 and 111 genes were regulated in response to zinc levels equal to or greater than two fold. By searching for genes that were 1) induced greater than two fold under zinc-limiting conditions and 2) induced greater than two fold in loz1 knock-out cells grown in zinc- replete medium, I identified 56 genes that were regulated by zinc in a Loz1-dependent manner (Figure 5A, Table 2). Gene name, common name and function of these 56 genes are listed in Table 2. These genes included new transporter families, regulatory factors, and enzymes (Figure 5B).

Figure 4. Strategy used to prepare samples for performing RNA-seq analysis. All samples were done in triplicate

Figure 5. Identifying Loz1 target genes. (A) Number of Loz1 target genes (B) Categorization of Loz1 target genes by biological function

Table 2. 56 genes are found to be potential Loz1 targets. The common name is defined at Pombase.org.

Common Gene name Function name SPAC1002.19 urg1 GTP cyclohydrolase II (predicted) SPAC1296.06 lcp1 cyclin L family cyclin SPAC1751.01c gti1 gluconate transporter inducer Gti1 SPAC186.07c hydroxyacid dehydrogenase (predicted)

human AMSH/STAMBP protein homolog, ubiquitin SPAC19B12.10 sst2 specific-protease SPAC19D5.01 pyp2 tyrosine phosphatase Pyp2 SPAC20H4.03c tfs1 transcription elongation factor TFIIS SPAC212.12 S. pombe specific GPI anchored protein family

SPAC22G7.02 kap111 karyopherin Kap111 (predicted) SPAC3A12.14 cam1 calmodulin Cam1 SPAC4F8.08 mug114 sequence orphan

SPAC57A10.03 cyp1 cyclophilin family peptidyl-prolyl cis-trans isomerase Cyp1

SPAC57A10.05c pof1 F-box/WD repeat protein protein Pof1 SPAC5H10.06c adh4 alcohol dehydrogenase Adh4

SPAC5H10.11 gmh1 alpha-1,2-galactosyltransferase Gmh1 (predicted)

SPAC644.12 cdc5 cell division control protein, splicing factor Cdc5 SPAC750.01 aldo/keto reductase family protein

SPAC977.16c dak2 dihydroxyacetone kinase Dak2 SPAPJ760.03c adg1 sequence orphan SPBC12C2.03c methionine synthase reductase (predicted)

SPBC12C2.14c dubious

SPBC1348.06c conserved fungal family

SPBC1348.09 short chain dehydrogenase (predicted)

Continued

Table 2 continued

SPBC146.08c translation initiation factor eIF1A-like (predicted)

SPBC14F5.13c pho8 vacuolar membrane alkaline phosphatase (predicted)

SPBC16D10.06 zrt1 ZIP zinc transporter Zrt1 ribosome biogenesis ATPase, Arb family ABCF2-like SPBC16H5.08c (predicted) SPBC16H5.12c conserved fungal protein

transcription factor, zf-fungal binuclear cluster type SPBC1773.12 (predicted) SPBC1773.13 aromatic aminotransferase (predicted)

SPBC18H10.07 WW domain-binding protein 4 (predicted)

SPBC25H2.10c tRNA acetyltransferase (predicted)

WD repeat protein involved in transcriptional regulation SPBC27B12.05 (predicted) SPBC29A10.17 sequence orphan

SPBC3E7.07c DUF757 family protein

SPBC409.13 6,7-dimethyl-8-ribityllumazine synthase (predicted)

SPBC530.02 membrane transporter (predicted)

SPBC660.05 WW domain containing conserved fungal protein

SPBC660.16 phosphogluconate dehydrogenase, decarboxylating

SPBC800.11 inosine-uridine preferring nucleoside hydrolase (predicted)

SPBC8E4.02c sequence orphan

SPBC902.04 rmn1 RNA-binding protein SPBCPT2R1.03 hypothetical protein

SPBCPT2R1.06c pseudogene

SPBPB2B2.15 conserved fungal family

SPCC1020.03 mitochondrial iron ion transporter (predicted)

Continued

Table 2 continued

SPCC1223.13 cbf12 CBF1/Su(H)/LAG-1 family transcription factor Cbf12

SPCC1322.10 cell wall protein Pwp1

SPCC13B11.01 adh1 alcohol dehydrogenase Adh1 SPCC13B11.02c sequence orphan

SPCC13B11.03c hydroxyacylglutathione hydrolase (predicted)

SPCC306.11 sequence orphan

transcription factor TFIIA complex small subunit SPCC553.11c (predicted) SPCC569.05c spermidine family transporter (predicted)

SPCC794.01c glucose-6-phosphate 1-dehydrogenase (predicted)

SPCC794.02 wtf5 wtf element Wtf5

3.2.2 Identifying consensus sequence required for Loz1 binding

In order to identify a candidate Loz1 binding site, I utilized the software Scope

(Suite for Computational identification Of Promoter Elements) (Carlson et al. 2007) along with experimental reporter gene studies to identify DNA sequences that were commonly found in the promoters of zinc-regulated Loz1 target genes.

By using Scope, a software designed to find common elements among promoters, to search for common cognition elements in the 56 potential Loz1 target genes, the sequence GNMGATC, was found in ~2/3 of the Loz1 target gene promoters (Figure 6). In addition to its high conservation among Loz1 targets, the putative element was found multiple times in the most highly zinc-regulated genes. As an example, it is found ~11

27 times in the zrt1 promoter, ~8 times in the adh4 promoter, and ~4 times in the vel1 promoter.

Figure 6. Consensus sequence of Loz1 binding site obtained by using Scope motif finder.

3.2.3 Additional elements may be responsible for Loz1 DNA binding

To determine if this was the genuine Loz1 consensus, SPBC1348.06c-lacZ (vel1- lacZ) reporter constructs were generated. vel1 is a fungal-specific gene that is strongly regulated by zinc and Loz1 (Figure 7). The in silico generated consensus was found four

28 times in the vel1 promoter which makes vel1 promoter an ideal construct to test this consensus.

In order to determine if Loz1-dependent repression required this consensus, I generated plasmid constructs in which the vel1 promoter was fused to the lacZ gene. The lacZ reporter assay is a good tool to test gene expression because lacZ encodes β- galactosidase, an enzyme that converts the colorless 2-nitrophenyl β-D-galactopyranoside

(ONPG) to the colorless galactose and the yellow compound 2-nitrophenol (ONP). The amount of the yellow compound ONP can then be measured at OD420 which directly correlates with the amount of β-galactosidase present and in return the amount of transcriptional activity seen in the reporter (Figure 8).

To determine if this element was required for Loz1-dependent repression, I changed two nucleotides in each predicted Loz1 binding site to generate a non-consensus sequence. Mutated plasmid constructs were then transformed into wild-type and loz1∆ cells (Figure 9). As shown in Figure 10, Loz1-dependent repression is decreased by the triple binding site mutations. However, in wild-type strains with the triple-mutated Loz1 binding reporter, there was still partial regulation by Loz1, suggesting that there may be other elements in the vel1 promoter that are responsible for Loz1 binding.

Figure 7. Loz1 target mRNA levels are regulated by zinc, and loss of Loz1 activity results in increased mRNA levels of target genes. Loss of Loz1 mRNA target expression is rescued by integrating loz1 plasmid. Ribosomal RNA was used as loading control.

Figure 8. Expression of the lacZ reporter gene leads to increased levels of β- galactosidase activity.

Figure 9. Schematic diagram of JK-vel1-lacZ reporter constructs generated. Nucleotides marked in red were changed from wild-type versions.

Figure 10. β-galactosidase activity in wild-type and loz1∆ cells expressing constructs with Loz1 binding site mutation. Wild-type and loz1∆ cells were grown in ZL-EMM supplemented with 0 or 200 µM Zn. Error bars represent standard deviation. Data was obtained from the average of three independent assays. 32

3.2.4 Defining the minimal Loz1 binding site

One method that can be used to define the minimal Loz1 response element is to introduce the putative Loz1 binding consensus into a minimal yeast cytochrome c1

(CYC1) synthetic promoter to determine whether this sequence is sufficient to mediate gene repression in a manner dependent upon Loz1. The minimal CYC1 promoter contains no upstream activation sequence regulatory elements but the minimal sequences necessary for transcription (Lyons et al. 2000). As Loz1 functions as a transcriptional repressor, any minimal CYC1 construct generated would also need to contain the DNA recognition site for a transcriptional activator. At the present time, the identity of any of the transcriptional activators of Loz1 target genes is not known in S. pombe. As a consequence, S. pombe constructs that constitutively expressed the well-characterized

Gal4 transcriptional activator from Saccharomyces cerevisiae were generated. The constructs generated expressed GAL4 from the constitutive pgk1 or zhf1 promoter and used the terminator sequences from adh4. The Gal4 protein binds to a specific upstream activation sequence (UAS), CGGA(G/C)GAC(A/T)CAG(G/C)AGGC (Johnston 1987)

(Figure 11). Therefore, a promoter construct without the Loz1 consensus was also created to test whether this Gal4/UAS system is functional in S. pombe. The ultimate goal was to introduce the Loz1 consensus obtained from Scope software (Figure 6) into the construct by performing oligonucleotide cloning to examine Loz1-dependent regulation.

Figure 11. Constructs generated to determine minimal Loz1 binding site. (A) Plasmid expressing GAL4 under either pgk1 or zhf1 promoter and adh4 terminator. (B) A minimal CYC1 promoter-lacZ fusion reporter construct.

In my studies, I successfully generated and sequenced constructs with expressed

GAL4 from the S. pombe pgk1 promoter. However, when this pgk1-driven GAL4 construct was transformed into S. pombe, no transformants were obtained, suggesting that expression of GAL4 from strong promoters in S. pombe may be toxic to growth. Thus, further studies could include generating constructs that express GAL4 from a weaker constitutive promoter such as zhf1 (Ehrensberger et al. 2014). If the zhf1-driven GAL4 expression vector is not toxic to growth, it could be used to verify whether the consensus

Loz1 response element is real. Once this construct is confirmed, future studies would include mutating each of the nucleotides in the observed Loz1 response element to determine which nucleotides are essential for Loz1 regulation. We currently do not know 34 if Loz1 response elements function in a specific orientation and whether the distance between the Loz1 binding site and the UAS is essential. As a consequence, these parameters may need to be altered to receive optimal regulation.

With this scientific knowledge, we will be able to understand how the transcriptional repressor Loz1 works and further refine the Loz1 target genes. This assay is a critical step to understand minimal Loz1 binding site. It will provide important information regarding how Loz1 binds and interacts with promoter. In addition, knowledge of the actual response element for Loz1 will allow the identification of additional Loz1 target genes. This is further addressed in the discussion.

A potential problem with this aim is whether the hypothesized Loz1 binding site is not the actual response element for Loz1 binding. In this case, the Loz1 consensus will be expanded to include nucleotides adjacent to the hypothesized Loz1 binding site in different Loz1 target genes. These studies would determine if more nucleotides are required for Loz1 binding.

3.2.5 Determining whether spermidine synthesis and transport pathways are regulated by zinc

A number of the candidate Loz1 target genes that were identified in the RNA-seq encoded proteins predicted to be involved in spermidine transport. These results suggest that alterations in spermidine levels may be important to zinc homeostasis. Polyamines are compounds that can be classified into three categories: putrescine, spermidine, and spermine. Changes of polyamine metabolism can affect a cell's response to different

35 types of stress (Valdes-Santiago and Ruiz-Herrera 2013). Although the importance of polyamine compounds in maintaining normal biological functions in living organisms has been shown, the transport, intracellular distribution, and regulation of metabolism are currently poorly understood (Valdes-Santiago and Ruiz-Herrera 2013).

The polyamine metabolism pathway in yeast starts with the metabolite ornithine.

After being converted by ornithine decarboxylase, which is encoded by the gene Spe1, ornithine can be metabolized to putrescine, which can then be further metabolized to spermidine and spermine, by the enzymes S-adenosylmethionine decarboxylase and spermine synthase, respectively (Figure 12).

Based on my preliminary data from northern blot analysis, the gene SPCC569.05c, which encodes a predicted spermidine transporter in S. pombe is regulated by zinc starvation in a Loz1-dependent manner (Figure 13). Another gene SPBC36.02c encoding a predicted spermidine transporter is also a Loz1 target gene according to RNA-seq. The amino acid sequences of these two transporters are 83.4% identical, suggesting that they may be paralogs. Since spermidine has shown to be required in maintaining normal cellular growth (Chattopadhyay, Tabor and Tabor 2002), it is very possible that it is regulated by zinc because of its importance in the regulation of growth and stress response. In order to understand the function of spermidine transporters, I deleted

SPCC569.05c and SPBC36.02c from the genome. No obvious phenotype was observed under zinc-replete and zinc-deficient conditions (Figure 14).

Figure 12. Polyamine metabolism in yeast.

Figure 13. Spermidine transporter mRNA levels are regulated by zinc and loss of Loz1 activity results in increased mRNA levels. Wild-type, loz1 knock-out, SPBC36.02c knock-out, and SPCC569.05c knock-out cells were grown in ZL-EMM supplemented with 0 or 200 µM Zn. Total RNA was purified for northern blot analysis. Ribosomal RNA was used as loading control.

Figure 14. Spermidine transporter deletion strains have no obvious zinc-dependent growth defects. The strains were grown in minimal media, cells were diluted to an OD600 of 1.0, and 10-fold serial dilutions were plated onto minimal media plates with zinc supplements and the metal chelator EDTA.

3.3 Discussion

The experimental results in this chapter suggest that there are ~56 genes regulated by Loz1 which contain a GNMGATC element within their promoter regions. To test whether this was the genuine Loz1 consensus, I used lacZ reporter assay and site-directed mutagenesis to disrupt this element in the vel1 promoter. These studies revealed that mutation of three of the GNMGATC element within the vel1 promoter led to a significant loss of regulation by Loz1. In contrast, mutation of two sites mutation did not affect Loz1 repression. While three mutated Loz1 binding sites in wild-type cells did results in a significant reduction in Loz1-dependent repression, there was still some partial regulation.

This data suggested that mutation of the consensus GNMGATC did not fully disrupt Loz1 repression. Additional regulating elements may also be essential for Loz1 regulation. To understand which DNA sequence besides GNMGATC can Loz1 bind to and further obtain full repression, experimental approach to generate minimal promoter constructs is currently ongoing to study Loz1-DNA binding interaction. However, the zinc-dependent regulation was also observed in loz1∆ cells expressing plasmid with three mutated Loz1 binding sites, which suggests that the vel1 gene might also be regulated by zinc in a

Loz1-independent manner.

The goal of the minimal CYC1 promoter was to determine whether the Loz1 consensus element identified by Scope is sufficient to mediate Loz1-dependent repression.

For these studies, the transcriptional activator Gal4 from S. cerevisiae was expressed from the strong pgk1 promoter in S. pombe wild-type cells, in the presence of a minimal lacZ reporter construct containing two copies of the Gal4 UAS element. Current data 39 results showed that the pgk1-gal4 driven constructs were non-functional in wild-type cells, which suggests that pgk1 promoter may be too strong to overexpress GAL4 and cause toxicity to the cells since pgk1 is a strong and constitutively active promoter. An alternative strategy to generate the zhf1-driven GAL4 construct is currently ongoing.

In addition to Loz1 binding site, the data also showed that the maximum β- galactosidase activity differs from some constructs expressed in wild-type and loz1∆ cells.

Generally, constructs expressed in loz1∆ cells had higher β-galactosidase activity compared to constructs expressed in wild-type cells. This result may indicate that Loz1 is able to repress some factors involved in transcription and result in lower β-galactosidase activity since it acts as a transcriptional repressor to regulate gene expression.

Based on my RNA-seq data, Loz1 may directly regulate target gene expression by binding to the target gene promoter. Loz1 might also indirectly regulate gene expression.

For example, Loz1 may regulate the expression of an activating factor, which in turns controls the expression of an indirect target gene (Figure 15). With the confirmed minimal Loz1 response element, this information can be used to search for direct Loz1 target genes. Using the modified Loz1 consensus, it would be possible to use the DNA motif finder software to generate a revised list of genes that contain at least one consensus binding element for Loz1 repression. By knowing the entire genes regulated by Loz1, many biological pathways in S. pombe, especially pathways conserved in humans, can be better studied and understood.

Figure 15. Proposed mechanism of Loz1 function in several target genes.

The preliminary results obtained from spermidine transporter mutant strains growth assays, indicated that the absence of SPCC569.05c and SPBC36.02c, did not lead to any obvious growth defect in minimal medium, or this medium supplemented with zinc or the zinc chelator EDTA. I hypothesize that the lack-of-phenotype may be due to redundancy of the spermidine transporters. I therefore searched for S. pombe genome database for additional transporters in S. pombe that could also be involved in spermidine transport. Besides the putative Loz1 target genes, SPCC569.05c and SPBC36.02c, there are additional three genes, SPBC36.01c, SPBC530.15c, and SPBC947.06c, which encode proteins that also could be involved in spermidine transport (Figure 16). 41

Figure 16. Amino acid sequence alignments of spermidine family transmembrane transporters. The function of spermidine transporter was defined at Pombase.org and the alignment was performed by Clustal W2 multiple sequence alignment program. 42

To determine whether spermidine synthesis and transport pathways is important to zinc homeostasis, a polymerase chain reaction (PCR)-generated knock-out cassette can be used to delete each of the genes encoding these spermidine transporters from the genome. Additional genetic crosses could be used to generate strains lacking all or combinations of these genes. With a yeast strain lacking all of the spermidine transporters, it would be possible to evaluate the effects of individual genes. Since polyamine metabolism is not widely studied, it is currently not known, how alterations in polyamines levels affect cell growth. Future studies could therefore also vary the levels of spermidine and zinc in the yeast minimal medium to determine if there is any obvious phenotype in certain concentration (Uemura et al. 2005).

Other experiments that could be performed include northern blot analysis to determine whether genes encoding enzymes involved in polyamine metabolism are regulated by Loz1 and zinc in vivo. After understanding whether polyamine metabolism is regulated by zinc, genes, such as spe1, spe2, and sps, enzymes such as ornithine decarboxylase, S-adenosylmethionine decarboxylase, and spermidine synthase, and other factors that may be involved in polyamine metabolism can be further studied to determine whether they are regulated by zinc and their potential roles in cellular pathways. With more knowledge on polyamine, its biological importance can be better applied in research to fill the gap between disease and polyamine.

Other Loz1 target genes included pyp2, which encodes a tyrosine phosphatase involved in mitogen-activated protein kinase (MAPK) pathway. MAPK pathway is responsible for modulating intracellular signaling in response to changing environment

(English et al. 2015). It plays an important role in regulating cell signaling and stress response. This pathway is highly conserved among living organisms, such as plants, fungi, and mammals (Hettenhausen, Schuman and Wu 2015, English et al. 2015,

Carracedo et al. 2008).

MAPK, which is encoded by gene sty1 can be phosphorylated by MAPKK wis1 when cells sense environmental stress. Activation of MAPK will then directly trigger a cellular stress response or indirectly activate the transcription factor, Atf1, which induces stress-related gene expression (Figure 17). The tyrosine phosphatases that are encoded by the genes pyp1 and pyp2, both regulate the MAPK pathway. They can inhibit MAPK by dephosphorylating its phosphate groups. Tyrosine phosphatase activity is regulated by zinc in humans (Bellomo et al. 2014). However, how zinc regulates this enzyme activity is currently not well-understood.

Since MAPK pathway is initiated in response to stress, I hypothesize that this pathway is regulated by high levels of zinc, which is a stress. To determine whether

MAPK pathway is regulated by zinc and Loz1, northern blot analysis can be first conducted to confirm which genes involved in MAPK pathway are regulated by zinc at the transcriptional level. Since pyp2 encodes a tyrosine phosphatase, its activity can also be regulated at the post-translational level. As a consequence, western blot analysis can be conducted to determine whether Pyp2 and other proteins are regulated by zinc at the post-translational level. A PCR- knock out to test whether there is growth deficiency phenotype when losing specific genes can also be performed. If western blot is not sufficient to determine whether these enzymes (kinases and phosphatases) are regulated

44 by zinc, a protein kinase assay can be used to determine these enzyme activities and responses to various zinc concentrations (Favata et al. 1998, Dudley et al. 1995). After knowing the role and regulation factors of each gene involved in MAPK pathway, the

MAPK pathway in S. pombe can be further refined and the results will be important references for applying to research regarding zinc and MAPK pathways in humans for discovering disease treatment.

Figure 17. MAPK pathway in S. pombe.

Chapter 4

Identifying genes involved in mitochondrial zinc transport

4.1 Introduction

Misregulation of mitochondria zinc levels is observed in a number of diseases suggesting that the appropriate regulation of zinc homeostasis in the mitochondria may be an important step for disease prevention and control.

Among living organisms, the mitochondrion is a highly conserved organelle that functions as an energy factory. In the mitochondria, zinc is required in the matrix for the normal protein functions (Eide 2006). This suggests that there must be one or more transporters responsible for transporting intracellular zinc into the mitochondria. The mechanisms of how the mitochondria transport and maintain zinc levels are important in the development of prostate cancer. However, there is currently no identified mitochondria zinc transporter.

The epithelial cells of the prostate gland have a unique relationship with zinc besides the general requirements that are found in all cells. Prostate gland is an exocrine organ in the male reproductive system that functions to generate prostatic fluid. This fluid is slightly acidic in part due to containing large amounts of citrate. The citrate is produced in the epithelial cells in the peripheral zone of the prostate (Costello and Franklin 2011,

Franz et al. 2013). In cells, citrate is generated in the mitochondria via the Krebs cycle and is normally metabolized into isocitrate by the iron-sulfur requiring enzyme aconitase

(Eswarappa and Fox 2013) (Figure 18).

In prostate epithelial cells, zinc plays an important role in regulating citrate metabolism (Costello and Franklin 2006). In healthy prostate cells, high levels of zinc are transported into the prostate. This hyperaccumulation of zinc results in it being transported into the mitochondria by a currently unknown mechanism (Franz et al. 2013).

High levels of zinc in the mitochondria results in zinc replacing the iron-sulfur cluster in the aconitase protein, which in turn inhibits aconitase activity. When aconitase function is inhibited, citrate is unable to be metabolized into isocitrate and in turn accumulates to high levels. The high levels of citrate allow it to be secreted into the prostatic fluid

(Franklin et al. 2005). (Figure 18)

Figure 18. The effects of zinc in healthy and malignant prostate epithelial cells (modified from Franz et al., 2013). 48

As mentioned above, an unusual property of healthy prostate epithelial cells is that they accumulate high levels of intracellular and mitochondrial zinc. Importantly, this ability to accumulate zinc is disrupted during prostate cancer development. As a major phenotype of loz1 mutant cells is that they hyperaccumulate intracellular zinc levels, the goal of the research in this chapter was to determine if loz1 mutant cells also hyperaccumulate zinc in the mitochondria, and if so, whether this could be used as a tool to screen for genes critical for mitochondrial zinc transport. In this chapter, assays performed to identify mitochondria zinc-responsive transporters will be discussed.

4.2 Results

4.2.1 loz1 mutant cells accumulate zinc in the mitochondria

In order to determine whether loz1∆ cells accumulate zinc in the mitochondria, wild-type and loz1∆ cells were grown in ZL-EMM with 200 μM zinc supplements. Cells were harvested and the mitochondria were purified by standard procedures. Zinc levels in total cell extracts and mitochondria were measured by atomic absorption spectrometry.

A comparison of zinc levels in the mitochondria purified from wild-type and loz1∆ cells revealed that loz1∆ cells accumulate higher levels of zinc in the mitochondria, suggesting that a Loz1 target gene may be involved in transporting zinc into the mitochondria (Figure 19). One of the Loz1 target genes, SPCC1020.03 (common name: mmt1), encodes a mitochondrial iron transporter (Pierrel, Cobine and Winge 2007). As a number of iron transporters can transport zinc, and a number of zinc transporters can

49 transport iron (see discussion), I hypothesized that the loz1-dependent regulation of mmt1 would lead to increased mitochondrial zinc accumulation in loz1∆ cells

Figure 19. Loz1 mutant strain hyperaccumulates intracellular and mitochondrial zinc levels. Wild-type and loz1 knock-out cells were grown in ZL-EMM with 200 μM zinc supplements. Whole cells and mitochondria were measured using atomic absorption spectrometry. Amounts of mitochondria were calibrated by Bradford assay as μg protein per ml. Error bars represent standard deviation. Data was obtained from the average of eight independent assays.

In order to test this hypothesis, I attempted to perform a PCR-knockout to delete the gene SPCC1020.03 from the genome. However, I was unable to obtain any correct colony from this assay.

As an alternative approach to identify genes critical for mitochondrial transport, a genetic screen was performed to identify yeast mutant strains with impaired

50 mitochondrial zinc levels. In this screen, zinc levels were measured in purified mitochondria from S. pombe deletion strains that lacked mitochondria-related proteins

(Steinmetz et al. 2002).

I identified candidate genes to be screened using three criteria. Utilizing S. pombe genetic database, I generated a list of genes found in the mitochondria, and genes that encode proteins with transmembrane domain. This list was then cross-referenced with a list of strains that exist in the Bioneer S. pombe deletion collection. The S. pombe genome is annotated to contain 758 mitochondria-oriented genes, 1018 genes encode proteins with transmembrane domain. The Bioneer pombe deletion collection contains 2812 gene deletions. Among these genes, 75 genes were in the deletion collection, which encoded mitochondrial proteins containing a transmembrane domain. These 75 genes were chosen as candidate genes for initial genetic screen (Figure 20).

When the 75 strains were plated from -80 oC onto YES agar plates containing 100

μg/ml of the antibiotic G418, 3 strains failed to grow (listed in Table 7 of the Appendix).

A further 14 strains did not grow in ZL-EMM with 200 μM zinc supplements (listed in

Table 8 of the Appendix). Crude mitochondria preparations and mitochondrial zinc levels analysis were therefore performed on the remaining 58 strains. These strains are listed in

Table 3.

Figure 20. Strategy used to determine genes screened for analyzing mitochondrial zinc levels. 75 genes were identified as candidates for screening.

Table 3. 58 S. pombe bioneer strains screened for analyzing mitochondrial zinc levels. The common name is defined at Pombase.org.

Gene Common Function knocked-out name mitochondrial S-adenosylmethionine transporter SPAC12B10.09 pet801 (predicted) SPAC139.02c oac1 mitochondrial anion transporter (predicted) mitochondrial inner membrane protein involved in SPAC1486.08 cox16 cytochrome c oxidase assembly Cox16 (predicted) SPAC1565.01 conserved fungal protein

SPAC1610.04 mug99 conserved fungal protein Mug99 mitochondrial outer membrane voltage-dependent anion- SPAC1635.01 selective channel (predicted) TIM23 translocase complex-associated motor subunit SPAC167.04 pam17 Pam17 (predicted) SPAC1782.07 qcr8 ubiquinol-cytochrome-c reductase complex subunit 7

SPAC17A2.11 Schizosaccharomyces pombe specific protein

SPAC17G6.15c MTC tricarboxylate transporter (predicted)

mitochondrial cytochrome c-heme linkage protein Cyc2 SPAC17H9.12c (predicted) mitochondrial NAD transmembrane transporter SPAC227.03c (predicted) mitochondrial hydrogen/potassium transport system SPAC23H3.12c protein (predicted) SPAC25B8.07c hypoxia induced family protein

SPAC29A4.17c mitochondrial FUN14 family protein

SPAC2C4.09 mitochondrial calcium uniporter regulator (predicted)

mitochondrial 2-oxoadipate and 2-oxoglutarate transporter SPAC328.09 (predicted) SPAC3G6.05 Mpv17/PMP22 family protein 1 (predicted)

SPAC3H1.08c mitochondrial calcium uniporter regulator (predicted)

Continued

Table 3 continued

SPAC3H5.09c conserved eukaryotic mitochondrial protein (predicted)

SPAC4D7.02c glycerophosphoryl diester phosphodiesterase (predicted)

SPAC4G8.08 mitochondrial iron ion transporter (predicted)

SPAC4G9.14 mitochondrial Mpv17/PMP22 family protein 2 (predicted)

mitochondrial carrier with solute carrier repeats, organic SPAC4G9.20c acid transmembrane transporter (predicted) SPAC513.04 Schizosaccharomyces pombe specific protein

SPAC56F8.04c ppt1 para-hydroxybenzoate--polyprenyltransferase Ppt1

SPAC57A10.12c ura3 dihydroorotate dehydrogenase Ura3

SPAC823.13c mitochondrial inner membrane protein (predicted)

SPAC8C9.12c mitochondrial iron ion transporter (predicted)

SPAC9G1.04 oxa101 mitochondrial inner membrane translocase Oxa101

SPAP14E8.04 oma1 metallopeptidase Oma1 (predicted)

SPAP27G11.14c Schizosaccharomyces pombe specific protein

SPAPB1A10.12c alo1 D-arabinono-1,4-lactone oxidase (predicted)

SPAPB2B4.06 conserved fungal protein

SPAPB8E5.10 conserved fungal protein, with meiosis specific splicing

mitochondrial inner membrane organizing system protein SPAPJ691.03 (predicted) SPBC1215.01 shy1 SURF-family protein Shy1 (predicted)

SPBC1289.09 tim21 TIM23 translocase complex subunit Tim21 (predicted)

SPBC13E7.11 rbd1 mitochondrial rhomboid protease (predicted) ubiquinol-cytochrome-c reductase complex subunit 8, SPBC16C6.08c qcr6 hinge protein (predicted)

Continued

Table 3 continued

SPBC16E9.07 mug100 Schizosaccharomyces pombe specific protein Mug100

SPBC16H5.04 pho88 family protein (predicted)

SPBC17A3.02 conserved fungal protein

mitochondrial endonuclease, possibly DNA damage SPBC19F8.04c lcl3 related (predicted) SPBC21C3.03 ABC1 kinase family protein

SPBC25H2.08c mrs2 magnesium ion transporter Mrs2 (predicted) mitochondrial inner membrane peptidase complex SPBC2D10.07c catalytic subunit (predicted) SPBC3E7.05c human mitofilin ortholog (predicted)

mitochondrial Membrane Bound O-Acyl Transferase SPBC3H7.05c (MBOAT) family SPBC530.10c anc1 mitochondrial adenine nucleotide carrier Anc1

SPBC582.09 pex11 peroxisomal biogenesis factor 11 (predicted) mitochondrial TOM complex assembly protein Mim1 SPBC713.08 mim1 (predicted) tspO homolog, involved in the cytoplasmic to SPBC725.10 mitochondrial transport of haem (predicted) SPBC83.05 mitochondrial RNA-binding protein (predicted)

SPBC83.16c conserved eukaryotic protein

SPBC9B6.09c mdl1 mitochondrial peptide-transporting ATPase

SPBP22H7.04 sre1 human TMEM186 ortholog succinate dehydrogenase (ubiquinone) cytochrome b SPCC330.12c sdh3 subunit (predicted)

4.2.2 Gene SPBC3H7.05c was found to be potentially responsible for mitochondrial zinc transport

In order to identify genes that may be required for mitochondria zinc transport, crude mitochondria of those 58 strains (Table 3) were purified from cells grown in minimal medium supplemented with 200 μM zinc according to the method described by

(Meisinger, Pfanner and Truscott 2006). Mitochondria were also purified from control wild-type and loz1∆ cells to determine if specific mutant strains hyper- or hypo- accumulated zinc in the mitochondria. Atomic absorption spectrometry was utilized to determine total cellular zinc levels and mitochondrial zinc levels.

The majority of the strains contained similar mitochondrial zinc levels compared to wild-type strain (Figure 21). The only strain that hyperaccumulated mitochondrial zinc was the SPBC3H7.05c∆ strain. The SPBC3H7.05c∆ strain showed ~5 fold more mitochondrial zinc level accumulation than wild-type, and ~2 fold more compared to loz1 mutant. Importantly, SPBC3H7.05c∆ contained similar total cellular zinc levels compared to wild-type, suggesting that this mutation specifically affected mitochondrial zinc levels (Figure 21 and Figure 22 of the Appendix). The phenotype was observed in two independent assays. These results suggest that SPBC3H7.05c encodes a protein that facilitates transport of zinc out of the mitochondria.

Continued Figure 21. Fold change of mitochondrial zinc levels compared to wild-type (WT) and loz1 mutant (loz1∆) strains respectively. Cells were grown in ZL-EMM with 200 μM zinc supplements. Values near 1.00 represent that zinc levels were similar to controls. Original data representing zinc contents can be found in Table 9 of the Appendix.

Figure 21 continued

4.3 Discussion

Zinc is a required cofactor in a number of mitochondrial proteins, including Adh4 and Cu-Zn superoxide dismutase (Ehrensberger et al. 2013, Van Raamsdonk and Hekimi

2012). By screening for genetic mutations that affect mitochondrial zinc levels, here I show that loz1∆ cells and SPBC3H7.05c∆ cells hyperaccumulate zinc in the mitochondria.

Gene SPBC3H7.05c, which encodes a mitochondrial membrane bound o- acyltransferase, is a member of the membrane bound o-acyltransferase (MBOAT) family.

The MBOAT family is conserved in bacteria, plants, and eukaryotes, and encodes a range of acyltransferases involved in neutral lipid biosynthesis, protein/peptide acylation, and membrane phospholipid remodeling (Wang et al. 2013, Matsuda et al. 2008, Chang 2011).

The general role of acyltransferases is to catalyze the transfer of the acyl group from fatty acids to the substrate, such as glycerophosphate acyltransferase and acylglycerophosphate acyltransferase (Yamashita et al. 2014).

Zinc has been shown to be involved in the regulation of phospholipid synthesis

(Iwanyshyn, Han and Carman 2004). The mitochondria inner and outer membranes are composed of phospholipids, including phosphatidylcholine, phosphatidylethanolamine, and phosphatidic acid (Schenkel and Bakovic 2014). Since the main component of mitochondrial membranes is phospholipid and hyperaccumulation of mitochondrial zinc levels was observed in SPBC3H7.05c∆ cells, I hypothesize that changes in mitochondrial lipid membrane composition affect its zinc transport. Additional experiments that could be performed include introducing the wild-type SPBC3H7.05c gene into SPBC3H7.05c- knock-out cells to confirm that the zinc-accumulating phenotype is rescued, and testing 59 whether the protein encoded by SPBC3H7.05c is actually involved in the mitochondria zinc transport. Following these experiments, the next step could be to determine whether this protein also plays a role in facilitating the transport of other metals in the mitochondria, such as iron, copper, cadmium, silver, and calcium, by performing a metal competition assay (Jeong et al. 2012). The substrate specificity of this mitochondrial membrane bound o-acyl transferase can be therefore assessed. The localization of this protein should also be confirmed. Constructs can be generated which fuse the green fluorescent protein (GFP) to the opening reading frame in order to study the localization of the protein encoded by SPBC3H7.05c.

The results also revealed that loz1∆ cells accumulate zinc in their mitochondria.

The gene SPCC1020.03, which encodes a mitochondria iron transporter, is a putative

Loz1 target gene and is conserved in budding yeast Saccharomyces cerevisiae (Li and

Kaplan 1997). There is evidence showing that some metal transporters are responsible for transporting more than one kind of metal. For example, ZIP14 was found to be a zinc uptake transport but it can also transport iron, manganese, and cadmium (Liuzzi et al.

2006). ZIP8 is also a zinc transporter that is able to transport iron (Wang et al. 2012).

Another example is that Fet4 is an iron transport but it also transports zinc (Rutherford and Bird 2004). Therefore, one possibility is that the mitochondria iron transporter encoded by SPCC1020.03 is responsible for both zinc and iron transport.

Based on the above evidence, we hypothesized that SPCC1020.03, a putative

Loz1 target gene might be responsible for the increased levels of mitochondrial zinc observed in loz1 cells. To test this hypothesis, I attempted to delete the SPCC1020.03.

However, I was not able to obtain a mutant using standard procedures. All cell colonies obtained from this attempt contained SPCC1020.03, as confirmed by northern blot analysis. In further studies, overlapping PCR could be used to generate knock-out primers with increased sequence homology to the flanking regions of SPCC1020.03 to increase the probability of successfully deleting this gene from the genome.

3 candidate strains, SPAC644.07∆, SPBC11G11.01∆, and SPBP23A10.16∆ did not growth up from the Bioneer deletion collection. Plasmids overexpressing each of these genes could be generated to determine whether they are involved in mitochondrial zinc transport (Green and Olson 1990, Ramer, Elledge and Davis 1992).

Comparing zinc levels in the mitochondria in wild-type and loz1 mutant strains is the first step in understanding whether the zinc that hyperaccumulates in loz1 mutant cells is pumped into mitochondria. In order to study how zinc regulates biological and cellular pathways within the mitochondria, the distribution of zinc in the mitochondria needs to be determined. For this, pure mitochondria with and without outer membrane should be generated and further confirmed their purity by western blot analysis probed with mitochondrial-specific antibodies. Zinc levels can potentially be measured by a mitochondrial-targeted Fluorescence resonance energy transfer (FRET) sensor (Dittmer et al. 2009). In this experiment, zinc accumulating within mitochondria matrix is my expected result. If this hypothesis is not correct, a FRET sensor targeted to mitochondrial intermembrane space could be used to determine whether zinc is distributed in this region of the mitochondria.

Zinc inhibits aconitase activity in healthy prostate epithelial cells in order to maintain high citrate levels. Decreased inhibition of mitochondrial aconitase activity by zinc is thus a required step in altering citrate metabolism in prostate cancer development

(Singh et al. 2006). Therefore, an interesting question would be to determine if aconitase activity is altered in loz1 mutant strains. Aconitase activity in response to zinc can be determined by measuring citrate and isocitrate levels (Bulteau, Ikeda-Saito and Szweda

2003). Alternative strategy to measure aconitase activity may be measuring NADPH formation since lags of NADPH formation is observed in low aconitase activity (Gardner,

Nguyen and White 1994, Krebs and Holzach 1952).

The interaction between zinc and mitochondrial aconitase which is involved in the

Krebs cycle producing energy has long been studied but has not yet been elucidated.

Identifying genes critical for mitochondrial zinc transport, will help to further our knowledge of the role that mitochondrial zinc homeostasis plays in diseases.

Chapter 5

Concluding remarks

Zinc is essential for all life. In the human body, zinc is a cofactor in a large number of enzymes and regulatory factors, and can act as a signaling molecule. Although zinc is essential for life, it can be toxic in excess. Negative health outcomes may result from deficiency or excess of zinc. As a consequence, it is important to understand how cells maintain zinc homeostasis.

In S. pombe, the transcriptional repressor Loz1 inhibits target gene expression in zinc-replete cells. The primary goal of this thesis research was to define Loz1 DNA binding recognition and further identify potential Loz1 target genes. For this, I performed

RNA-seq analysis to identify Loz1 targets. From these results, I identified a new consensus sequence GNMGATC, and demonstrated that this sequence was necessary for the zinc-dependent regulation of vel1 expression. Based on the RNA-seq data, candidate

Loz1 targets include genes that encode metal transporters, spermidine transporters, transcription factors, and metabolic enzymes. I have found that some of these genes for example, gene encoding spermidine transporter are regulated by zinc in a Loz1- dependent manner. Other research is ongoing to further determine these results.

The second half of my research work focused on determining the mechanisms involved in mitochondrial zinc transport. My research revealed that loz1 mutant cells 63 hyperaccumulate zinc in the mitochondria, suggesting that a yet to be identified Loz1 target gene may be involved in mitochondrial zinc ion transport or accumulation. A genetic screen was also performed to identify potential gene that is required for mitochondrial zinc transport. Gene SPBC3H7.05c that encodes a mitochondrial membrane bound o-acyltransferase was found to be potentially required for mitochondrial zinc export.

The goal of this research work was to identify genes and biological pathways that are regulated by zinc in a Loz1-dependent manner in addition to understand mitochondrial zinc homeostasis. My research will provide insight and future research directions into the metabolic pathways and processes that are regulated by zinc or by

Loz1 at a cellular level. The findings can be utilized to carry out research in other living organisms and for medical application as an ultimate goal.

References

Adlard, P. A., J. M. Parncutt, D. I. Finkelstein & A. I. Bush (2010) Cognitive loss in zinc transporter-3 knock-out mice: a phenocopy for the synaptic and memory deficits of Alzheimer's disease? J Neurosci, 30, 1631-6.

Auf der Maur, A., T. Belser, G. Elgar, O. Georgiev & W. Schaffner (1999) Characterization of the transcription factor MTF-1 from the Japanese pufferfish (Fugu rubripes) reveals evolutionary conservation of heavy metal stress response. Biol Chem, 380, 175-85.

Bao, B., A. Thakur, Y. Li, A. Ahmad, A. S. Azmi, S. Banerjee, D. Kong, S. Ali, L. G. Lum & F. H. Sarkar (2012) The immunological contribution of NF-kappaB within the tumor microenvironment: a potential protective role of zinc as an anti-tumor agent. Biochim Biophys Acta, 1825, 160-72.

Bellomo, E., A. Massarotti, C. Hogstrand & W. Maret (2014) Zinc ions modulate protein tyrosine phosphatase 1B activity. Metallomics, 6, 1229-39.

Borrelly, G. P., M. D. Harrison, A. K. Robinson, S. G. Cox, N. J. Robinson & S. K. Whitehall (2002) Surplus zinc is handled by Zym1 metallothionein and Zhf endoplasmic reticulum transporter in Schizosaccharomyces pombe. J Biol Chem, 277, 30394-400.

Brugnera, E., O. Georgiev, F. Radtke, R. Heuchel, E. Baker, G. R. Sutherland & W. Schaffner (1994) Cloning, chromosomal mapping and characterization of the human metal-regulatory transcription factor MTF-1. Nucleic Acids Res, 22, 3167-73.

Bulteau, A. L., M. Ikeda-Saito & L. I. Szweda (2003) Redox-dependent modulation of aconitase activity in intact mitochondria. Biochemistry, 42, 14846-55.

Carlson, J. M., A. Chakravarty, C. E. DeZiel & R. H. Gross (2007) SCOPE: a web server for practical de novo motif discovery. Nucleic Acids Res, 35, W259-64.

Carracedo, A., L. Ma, J. Teruya-Feldstein, F. Rojo, L. Salmena, A. Alimonti, A. Egia, A. T. Sasaki, G. Thomas, S. C. Kozma, A. Papa, C. Nardella, L. C. Cantley, J. Baselga & P. P. Pandolfi (2008) Inhibition of mTORC1 leads to MAPK pathway activation through a PI3K-dependent feedback loop in human cancer. J Clin Invest, 118, 3065-74.

Chan, W. W. & K. M. Chan (2008) Cloning and characterization of a tilapia (Oreochromis aureus) metallothionein gene promoter in Hepa-T1 cells following the administration of various heavy metal ions. Aquat Toxicol, 86, 59-75.

Chang, C. C. Y., Sun, J., Chang, T.Y. (2011) Membrane-bound O-acyltransferases (MBOATs). Front. Biol., 6, 177-182.

Chattopadhyay, M. K., C. W. Tabor & H. Tabor (2002) Absolute requirement of spermidine for growth and cell cycle progression of fission yeast (Schizosaccharomyces pombe). Proc Natl Acad Sci U S A, 99, 10330-4.

Chen, W. Y., J. A. John, C. H. Lin & C. Y. Chang (2002) Molecular cloning and developmental expression of zinc finger transcription factor MTF-1 gene in zebrafish, Danio rerio. Biochem Biophys Res Commun, 291, 798-805.

Choi, S. & A. J. Bird (2014) Zinc'ing sensibly: controlling zinc homeostasis at the transcriptional level. Metallomics, 6, 1198-215.

Cobine, P. A., L. D. Ojeda, K. M. Rigby & D. R. Winge (2004) Yeast contain a non- proteinaceous pool of copper in the mitochondrial matrix. J Biol Chem, 279, 14447-55.

Coleman, J. E. (1992) Structure and mechanism of alkaline phosphatase. Annu Rev Biophys Biomol Struct, 21, 441-83.

Collart, M. A. & S. Oliviero (2001) Preparation of yeast RNA. Curr Protoc Mol Biol, Chapter 13, Unit13 12.

Corkins, M. E., M. May, K. M. Ehrensberger, Y. M. Hu, Y. H. Liu, S. D. Bloor, B. Jenkins, K. W. Runge & A. J. Bird (2013) Zinc finger protein Loz1 is required for zinc- responsive regulation of gene expression in fission yeast. Proc Natl Acad Sci U S A, 110, 15371-6.

Costello, L. C. & R. B. Franklin (2006) The clinical relevance of the metabolism of prostate cancer; zinc and tumor suppression: connecting the dots. Mol Cancer, 5, 17.

Costello, L. C. & R. B. Franklin (2011) Zinc is decreased in prostate cancer: an established relationship of prostate cancer! J Biol Inorg Chem, 16, 3-8.

Costello, L. C. & R. B. Franklin (2012) Cytotoxic/tumor suppressor role of zinc for the treatment of cancer: an enigma and an opportunity. Expert Rev Anticancer Ther, 12, 121- 8.

Costello, L. C., R. B. Franklin, P. Feng, M. Tan & O. Bagasra (2005) Zinc and prostate cancer: a critical scientific, medical, and public interest issue (United States). Cancer Causes Control, 16, 901-15.

Costello, L. C., R. B. Franklin, J. Zou, P. Feng, R. Bok, M. G. Swanson & J. Kurhanewicz (2011) Human prostate cancer ZIP1/zinc/citrate genetic/metabolic relationship in the TRAMP prostate cancer animal model. Cancer Biol Ther, 12, 1078-84.

Costello, L. C., Y. Liu, R. B. Franklin & M. C. Kennedy (1997) Zinc inhibition of mitochondrial aconitase and its importance in citrate metabolism of prostate epithelial cells. J Biol Chem, 272, 28875-81.

Dainty, S. J., C. A. Kennedy, S. Watt, J. Bahler & S. K. Whitehall (2008) Response of Schizosaccharomyces pombe to zinc deficiency. Eukaryot Cell, 7, 454-64.

Dalton, T. P., W. A. Solis, D. W. Nebert & M. J. Carvan, 3rd (2000) Characterization of the MTF-1 transcription factor from zebrafish and trout cells. Comp Biochem Physiol B Biochem Mol Biol, 126, 325-35.

Dittmer, P. J., J. G. Miranda, J. A. Gorski & A. E. Palmer (2009) Genetically encoded sensors to elucidate spatial distribution of cellular zinc. J Biol Chem, 284, 16289-97.

Duchateau, J., G. Delepesse, R. Vrijens & H. Collet (1981) Beneficial effects of oral zinc supplementation on the immune response of old people. Am J Med, 70, 1001-4.

Dudley, D. T., L. Pang, S. J. Decker, A. J. Bridges & A. R. Saltiel (1995) A synthetic inhibitor of the mitogen-activated protein kinase cascade. Proc Natl Acad Sci U S A, 92, 7686-9.

Ehrensberger, K. M. & A. J. Bird (2011) Hammering out details: regulating metal levels in eukaryotes. Trends Biochem Sci, 36, 524-31.

Ehrensberger, K. M., M. E. Corkins, S. Choi & A. J. Bird (2014) The double zinc finger domain and adjacent accessory domain from the transcription factor loss of zinc sensing 1 (loz1) are necessary for DNA binding and zinc sensing. J Biol Chem, 289, 18087-96.

Ehrensberger, K. M., C. Mason, M. E. Corkins, C. Anderson, N. Dutrow, B. R. Cairns, B. Dalley, B. Milash & A. J. Bird (2013) Zinc-dependent regulation of the Adh1 antisense transcript in fission yeast. J Biol Chem, 288, 759-69.

Eide, D. J. (2006) Zinc transporters and the cellular trafficking of zinc. Biochim Biophys Acta, 1763, 711-22.

Engle-Stone, R., A. O. Ndjebayi, M. Nankap, D. W. Killilea & K. H. Brown (2014) Stunting prevalence, plasma zinc concentrations, and dietary zinc intakes in a nationally representative sample suggest a high risk of zinc deficiency among women and young children in Cameroon. J Nutr, 144, 382-91.

English, J. G., J. P. Shellhammer, M. Malahe, P. C. McCarter, T. C. Elston & H. G. Dohlman (2015) MAPK feedback encodes a switch and timer for tunable stress adaptation in yeast. Sci Signal, 8, ra5.

Eswarappa, S. M. & P. L. Fox (2013) Citric acid cycle and the origin of MARS. Trends Biochem Sci, 38, 222-8.

Favata, M. F., K. Y. Horiuchi, E. J. Manos, A. J. Daulerio, D. A. Stradley, W. S. Feeser, D. E. Van Dyk, W. J. Pitts, R. A. Earl, F. Hobbs, R. A. Copeland, R. L. Magolda, P. A. Scherle & J. M. Trzaskos (1998) Identification of a novel inhibitor of mitogen-activated protein kinase kinase. J Biol Chem, 273, 18623-32.

Ferencz, A. & E. Hermesz (2009) Identification of a splice variant of the metal- responsive transcription factor MTF-1 in common carp. Comp Biochem Physiol C Toxicol Pharmacol, 150, 113-7.

Franklin, R. B., B. Milon, P. Feng & L. C. Costello (2005) Zinc and zinc transporters in normal prostate and the pathogenesis of prostate cancer. Front Biosci, 10, 2230-9.

Franz, M. C., P. Anderle, M. Burzle, Y. Suzuki, M. R. Freeman, M. A. Hediger & G. Kovacs (2013) Zinc transporters in prostate cancer. Mol Aspects Med, 34, 735-41.

Gardner, P. R., D. D. Nguyen & C. W. White (1994) Aconitase is a sensitive and critical target of oxygen poisoning in cultured mammalian cells and in rat lungs. Proc Natl Acad Sci U S A, 91, 12248-52.

Georgiev, O., V. Gunther, K. Steiner, K. Schonrath & W. Schaffner (2014) The legless lizard Anguis fragilis (slow worm) has a potent metal-responsive transcription factor 1 (MTF-1). Biol Chem, 395, 425-31.

Glick, B. S. & L. A. Pon (1995) Isolation of highly purified mitochondria from Saccharomyces cerevisiae. Methods Enzymol, 260, 213-23.

Golovine, K., R. G. Uzzo, P. Makhov, P. L. Crispen, D. Kunkle & V. M. Kolenko (2008) Depletion of intracellular zinc increases expression of tumorigenic cytokines VEGF, IL-6 and IL-8 in prostate cancer cells via NF-kappaB-dependent pathway. Prostate, 68, 1443- 9.

Green, E. D. & M. V. Olson (1990) Systematic screening of yeast artificial-chromosome libraries by use of the polymerase chain reaction. Proc Natl Acad Sci U S A, 87, 1213-7.

Hayles, J. & P. Nurse (1992) Genetics of the fission yeast Schizosaccharomyces pombe. Annu Rev Genet, 26, 373-402.

Hettenhausen, C., M. C. Schuman & J. Wu (2015) MAPK signaling: A key element in plant defense response to insects. Insect Sci, 22, 157-64.

Hogstrand, C., P. Kille, R. I. Nicholson & K. M. Taylor (2009) Zinc transporters and cancer: a potential role for ZIP7 as a hub for tyrosine kinase activation. Trends Mol Med, 15, 101-11.

Hosie, A. M., E. L. Dunne, R. J. Harvey & T. G. Smart (2003) Zinc-mediated inhibition of GABA(A) receptors: discrete binding sites underlie subtype specificity. Nat Neurosci, 6, 362-9.

Iwanyshyn, W. M., G. S. Han & G. M. Carman (2004) Regulation of phospholipid synthesis in Saccharomyces cerevisiae by zinc. J Biol Chem, 279, 21976-83.

Jacob, C., W. Maret & B. L. Vallee (1998) Control of zinc transfer between thionein, metallothionein, and zinc proteins. Proc Natl Acad Sci U S A, 95, 3489-94.

Jeong, J. & D. J. Eide (2013) The SLC39 family of zinc transporters. Mol Aspects Med, 34, 612-9.

Jeong, J., J. M. Walker, F. Wang, J. G. Park, A. E. Palmer, C. Giunta, M. Rohrbach, B. Steinmann & D. J. Eide (2012) Promotion of vesicular zinc efflux by ZIP13 and its implications for spondylocheiro dysplastic Ehlers-Danlos syndrome. Proc Natl Acad Sci U S A, 109, E3530-8.

Johnston, M. (1987) A model fungal gene regulatory mechanism: the GAL genes of Saccharomyces cerevisiae. Microbiol Rev, 51, 458-76.

Kambe, T., A. Hashimoto & S. Fujimoto (2014) Current understanding of ZIP and ZnT zinc transporters in human health and diseases. Cell Mol Life Sci.

Kanter-Smoler, G., A. Dahlkvist & P. Sunnerhagen (1994) Improved method for rapid transformation of intact Schizosaccharomyces pombe cells. Biotechniques, 16, 798-800.

Kim, Y. R., I. J. Kim, T. W. Kang, C. Choi, K. K. Kim, M. S. Kim, K. I. Nam & C. Jung (2013) HOXB13 downregulates intracellular zinc and increases NF-kappaB signaling to promote prostate cancer metastasis. Oncogene.

King, J. C., D. M. Shames & L. R. Woodhouse (2000) Zinc homeostasis in humans. J Nutr, 130, 1360S-6S. 70

Klug, A. (1999) Zinc finger peptides for the regulation of gene expression. J Mol Biol, 293, 215-8.

Krebs, H. A. & O. Holzach (1952) The conversion of citrate into cis-aconitate and isocitrate in the presence of aconitase. Biochem J, 52, 527-8.

Leung, K. W., M. Liu, X. Xu, M. J. Seiler, C. J. Barnstable & J. Tombran-Tink (2008) Expression of ZnT and ZIP zinc transporters in the human RPE and their regulation by neurotrophic factors. Invest Ophthalmol Vis Sci, 49, 1221-31.

Li, L. & J. Kaplan (1997) Characterization of two homologous yeast genes that encode mitochondrial iron transporters. J Biol Chem, 272, 28485-93.

Li, M., Y. Zhang, Z. Liu, U. Bharadwaj, H. Wang, X. Wang, S. Zhang, J. P. Liuzzi, S. M. Chang, R. J. Cousins, W. E. Fisher, F. C. Brunicardi, C. D. Logsdon, C. Chen & Q. Yao (2007) Aberrant expression of zinc transporter ZIP4 (SLC39A4) significantly contributes to human pancreatic cancer pathogenesis and progression. Proc Natl Acad Sci U S A, 104, 18636-41.

Lindert, U., L. Leuzinger, K. Steiner, O. Georgiev & W. Schaffner (2008) Characterization of metal-responsive transcription factor (MTF-1) from the giant rodent capybara reveals features in common with human as well as with small rodents (mouse, rat). Short communication. Chem Biodivers, 5, 1485-94.

Liuzzi, J. P., F. Aydemir, H. Nam, M. D. Knutson & R. J. Cousins (2006) Zip14 (Slc39a14) mediates non-transferrin-bound iron uptake into cells. Proc Natl Acad Sci U S A, 103, 13612-7.

Lyons, T. J., A. P. Gasch, L. A. Gaither, D. Botstein, P. O. Brown & D. J. Eide (2000) Genome-wide characterization of the Zap1p zinc-responsive regulon in yeast. Proc Natl Acad Sci U S A, 97, 7957-62.

Matsuda, S., T. Inoue, H. C. Lee, N. Kono, F. Tanaka, K. Gengyo-Ando, S. Mitani & H. Arai (2008) Member of the membrane-bound O-acyltransferase (MBOAT) family encodes a lysophospholipid acyltransferase with broad substrate specificity. Genes Cells, 13, 879-88.

Meisinger, C., N. Pfanner & K. N. Truscott (2006) Isolation of yeast mitochondria. Methods Mol Biol, 313, 33-9.

Mizuno, D. & M. Kawahara (2013) The molecular mechanisms of zinc neurotoxicity and the pathogenesis of vascular type senile dementia. Int J Mol Sci, 14, 22067-81.

Murakami, M. & T. Hirano (2008) Intracellular zinc homeostasis and zinc signaling. Cancer Sci, 99, 1515-22.

Nations, S. P., P. J. Boyer, L. A. Love, M. F. Burritt, J. A. Butz, G. I. Wolfe, L. S. Hynan, J. Reisch & J. R. Trivedi (2008) Denture cream: an unusual source of excess zinc, leading to hypocupremia and neurologic disease. Neurology, 71, 639-43.

Neldner, K. H. & K. M. Hambidge (1975) Zinc therapy of acrodermatitis enteropathica. N Engl J Med, 292, 879-82.

Oteiza, P. I. & G. G. Mackenzie (2005) Zinc, oxidant-triggered cell signaling, and human health. Mol Aspects Med, 26, 245-55.

Patzer, S. I. & K. Hantke (1998) The ZnuABC high-affinity zinc uptake system and its regulator Zur in Escherichia coli. Mol Microbiol, 28, 1199-210.

Pelletier, B., J. Beaudoin, Y. Mukai & S. Labbe (2002) Fep1, an iron sensor regulating iron transporter gene expression in Schizosaccharomyces pombe. J Biol Chem, 277, 22950-8.

Peter, M., A. Gartner, J. Horecka, G. Ammerer & I. Herskowitz (1993) FAR1 links the signal transduction pathway to the cell cycle machinery in yeast. Cell, 73, 747-60.

Pierrel, F., P. A. Cobine & D. R. Winge (2007) Metal Ion availability in mitochondria. Biometals, 20, 675-82.

Prasad, A. S. (1988) Zinc in growth and development and spectrum of human zinc deficiency. J Am Coll Nutr, 7, 377-84.

Prasad, A. S. (1993) Essentiality and toxicity of zinc. Scand J Work Environ Health, 19 Suppl 1, 134-6.

Qiu, J., Y. Liu, M. Yu, Z. Pang, W. Chen & Z. Xu (2013) Identification and functional characterization of MRE-binding transcription factor (MTF) in Crassostrea gigas and its conserved role in metal-induced response. Mol Biol Rep, 40, 3321-31.

Ramer, S. W., S. J. Elledge & R. W. Davis (1992) Dominant genetics using a yeast genomic library under the control of a strong inducible promoter. Proc Natl Acad Sci U S A, 89, 11589-93.

Rutherford, J. C. & A. J. Bird (2004) Metal-responsive transcription factors that regulate iron, zinc, and copper homeostasis in eukaryotic cells. Eukaryot Cell, 3, 1-13.

Schenkel, L. C. & M. Bakovic (2014) Formation and regulation of mitochondrial membranes. Int J Cell Biol, 2014, 709828.

Singh, K. K., M. M. Desouki, R. B. Franklin & L. C. Costello (2006) Mitochondrial aconitase and citrate metabolism in malignant and nonmalignant human prostate tissues. Mol Cancer, 5, 14.

Steinmetz, L. M., C. Scharfe, A. M. Deutschbauer, D. Mokranjac, Z. S. Herman, T. Jones, A. M. Chu, G. Giaever, H. Prokisch, P. J. Oefner & R. W. Davis (2002) Systematic screen for human disease genes in yeast. Nat Genet, 31, 400-4.

Sztalmachova, M., M. Hlavna, J. Gumulec, M. Holubova, P. Babula, J. Balvan, J. Sochor, V. Tanhauserova, M. Raudenska, S. Krizkova, V. Adam, T. Eckschlager, R. Kizek & M. Masarik (2012) Effect of zinc(II) ions on the expression of pro- and anti-apoptotic factors in high-grade prostate carcinoma cells. Oncol Rep, 28, 806-14.

Uemura, T., K. Tachihara, H. Tomitori, K. Kashiwagi & K. Igarashi (2005) Characteristics of the polyamine transporter TPO1 and regulation of its activity and cellular localization by phosphorylation. J Biol Chem, 280, 9646-52.

Uzzo, R. G., P. Leavis, W. Hatch, V. L. Gabai, N. Dulin, N. Zvartau & V. M. Kolenko (2002) Zinc inhibits nuclear factor-kappa B activation and sensitizes prostate cancer cells to cytotoxic agents. Clin Cancer Res, 8, 3579-83.

Valdes-Santiago, L. & J. Ruiz-Herrera (2013) Stress and polyamine metabolism in fungi. Front Chem, 1, 42.

Vallee, B. L. & D. S. Auld (1990) Zinc coordination, function, and structure of zinc enzymes and other proteins. Biochemistry, 29, 5647-59.

Vallee, B. L. & F. L. Hoch (1955) Zinc, a Component of Yeast Alcohol Dehydrogenase. Proc Natl Acad Sci U S A, 41, 327-38.

Van Raamsdonk, J. M. & S. Hekimi (2012) Superoxide dismutase is dispensable for normal animal lifespan. Proc Natl Acad Sci U S A, 109, 5785-90.

Wang, C. Y., S. Jenkitkasemwong, S. Duarte, B. K. Sparkman, A. Shawki, B. Mackenzie & M. D. Knutson (2012) ZIP8 is an iron and zinc transporter whose cell-surface expression is up-regulated by cellular iron loading. J Biol Chem, 287, 34032-43.

Wang, P., Z. Wang, Y. Dou, X. Zhang, M. Wang & X. Tian (2013) Genome-wide identification and analysis of membrane-bound O-acyltransferase (MBOAT) gene family in plants. Planta, 238, 907-22.

Westin, G. & W. Schaffner (1988) A zinc-responsive factor interacts with a metal- regulated enhancer element (MRE) of the mouse metallothionein-I gene. EMBO J, 7, 3763-70.

Yamasaki, S., K. Sakata-Sogawa, A. Hasegawa, T. Suzuki, K. Kabu, E. Sato, T. Kurosaki, S. Yamashita, M. Tokunaga, K. Nishida & T. Hirano (2007) Zinc is a novel intracellular second messenger. J Cell Biol, 177, 637-45.

Yamashita, A., Y. Hayashi, N. Matsumoto, Y. Nemoto-Sasaki, S. Oka, T. Tanikawa & T. Sugiura (2014) Glycerophosphate/Acylglycerophosphate acyltransferases. Biology (Basel), 3, 801-30.

Zhao, H. & D. J. Eide (1997) Zap1p, a metalloregulatory protein involved in zinc- responsive transcriptional regulation in Saccharomyces cerevisiae. Mol Cell Biol, 17, 5044-52.

Appendix

Additional tables and figures

Table 4. All S. pombe strains used in this study

ABY Strain name database Genotype Reference number JW81 001 h- ade6-M210 leu1-32 ura4-D18 Wu et al, 2003

SPAC1093.01∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC1093.01∆::kanMX4 Bioneer SPAC12B10.09∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC12B10.09∆::kanMX4 Bioneer SPAC139.02c∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC139.02c∆::kanMX4 Bioneer SPAC1486.08∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC1486.08∆::kanMX4 Bioneer SPAC1565.01∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC1565.01∆::kanMX4 Bioneer SPAC1610.04∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC1610.04∆::kanMX4 Bioneer SPAC1635.01∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC1635.01∆::kanMX4 Bioneer SPAC167.04∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC167.04∆::kanMX4 Bioneer SPAC1782.07∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC1782.07∆::kanMX4 Bioneer SPAC17A2.11∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC17A2.11∆::kanMX4 Bioneer SPAC17G6.15c∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC17G6.15c∆::kanMX4 Bioneer SPAC17H9.08∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC17H9.08∆::kanMX4 Bioneer SPAC17H9.12c∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC17H9.12c∆::kanMX4 Bioneer SPAC227.03c∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC227.03c∆::kanMX4 Bioneer SPAC23H3.12c∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC23H3.12c∆::kanMX4 Bioneer SPAC24B11.09∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC24B11.09∆::kanMX4 Bioneer SPAC25B8.07c∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC25B8.07c∆::kanMX4 Bioneer SPAC29A4.17c∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC29A4.17c∆::kanMX4 Bioneer SPAC2C4.09∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC2C4.09∆::kanMX4 Bioneer SPAC328.09∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC328.09∆::kanMX4 Bioneer SPAC3G6.05∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC3G6.05∆::kanMX4 Bioneer SPAC3H1.04c∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC3H1.04c∆::kanMX4 Bioneer Continued 75

Table 4 continued

SPAC3H1.08c∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC3H1.08c∆::kanMX4 Bioneer SPAC3H5.09c∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC3H5.09c∆::kanMX4 Bioneer SPAC4D7.02c∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC4D7.02c∆::kanMX4 Bioneer SPAC4G8.08∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC4G8.08∆::kanMX4 Bioneer SPAC4G8.11c∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC4G8.11c∆::kanMX4 Bioneer SPAC4G9.14∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC4G9.14∆::kanMX4 Bioneer SPAC4G9.20c∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC4G9.20c∆::kanMX4 Bioneer SPAC513.04∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC513.04∆::kanMX4 Bioneer SPAC56F8.04c∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC56F8.04c∆::kanMX4 Bioneer SPAC57A10.12c∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC57A10.12c∆::kanMX4 Bioneer SPAC644.07∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC644.07∆::kanMX4 Bioneer SPAC6B12.12∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC6B12.12∆::kanMX4 Bioneer SPAC823.10c∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC823.10c∆::kanMX4 Bioneer SPAC823.13c∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC823.13c∆::kanMX4 Bioneer SPAC8C9.06c∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC8C9.06c∆::kanMX4 Bioneer SPAC8C9.12c∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC8C9.12c∆::kanMX4 Bioneer SPAC9G1.04∆ h+ ade6-M210 leu1-32 ura4-D18 SPAC9G1.04∆::kanMX4 Bioneer SPAP14E8.04∆ h+ ade6-M210 leu1-32 ura4-D18 SPAP14E8.04∆::kanMX4 Bioneer SPAP27G11.14c∆ h+ ade6-M210 leu1-32 ura4-D18 SPAP27G11.14c∆::kanMX4 Bioneer SPAPB1A10.12c∆ h+ ade6-M210 leu1-32 ura4-D18 SPAPB1A10.12c∆::kanMX4 Bioneer SPAPB2B4.06∆ h+ ade6-M210 leu1-32 ura4-D18 SPAPB2B4.06∆::kanMX4 Bioneer SPAPB8E5.10∆ h+ ade6-M210 leu1-32 ura4-D18 SPAPB8E5.10∆::kanMX4 Bioneer SPAPJ691.03∆ h+ ade6-M210 leu1-32 ura4-D18 SPAPJ691.03∆::kanMX4 Bioneer SPBC11G11.01∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC11G11.01∆::kanMX4 Bioneer SPBC1215.01∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC1215.01∆::kanMX4 Bioneer SPBC1289.09∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC1289.09∆::kanMX4 Bioneer SPBC13E7.11∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC13E7.11∆::kanMX4 Bioneer SPBC16C6.08c∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC16C6.08c∆::kanMX4 Bioneer SPBC16E9.07∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC16E9.07∆::kanMX4 Bioneer SPBC16H5.04∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC16H5.04∆::kanMX4 Bioneer SPBC16H5.06∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC16H5.06∆::kanMX4 Bioneer SPBC17A3.02∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC17A3.02∆::kanMX4 Bioneer SPBC19F8.04c∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC19F8.04c∆::kanMX4 Bioneer

Continued 76

Table 4 continued

SPBC21C3.03∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC21C3.03∆::kanMX4 Bioneer SPBC25H2.08c∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC25H2.08c∆::kanMX4 Bioneer SPBC27.06c∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC27.06c∆::kanMX4 Bioneer SPBC27B12.10c∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC27B12.10c∆::kanMX4 Bioneer SPBC2D10.07c∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC2D10.07c∆::kanMX4 Bioneer SPBC336.13c∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC336.13c∆::kanMX4 Bioneer SPBC365.16∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC365.16∆::kanMX4 Bioneer SPBC3E7.05c∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC3E7.05c∆::kanMX4 Bioneer SPBC3H7.05c∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC3H7.05c∆::kanMX4 Bioneer SPBC530.10c∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC530.10c∆::kanMX4 Bioneer SPBC582.09∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC582.09∆::kanMX4 Bioneer SPBC713.08∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC713.08∆::kanMX4 Bioneer SPBC725.10∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC725.10∆::kanMX4 Bioneer SPBC83.05∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC83.05∆::kanMX4 Bioneer SPBC83.16c∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC83.16c∆::kanMX4 Bioneer SPBC9B6.09c∆ h+ ade6-M210 leu1-32 ura4-D18 SPBC9B6.09c∆::kanMX4 Bioneer SPBP22H7.04∆ h+ ade6-M210 leu1-32 ura4-D18 SPBP22H7.04∆::kanMX4 Bioneer SPBP23A10.16∆ h+ ade6-M210 leu1-32 ura4-D18 SPBP23A10.16∆::kanMX4 Bioneer SPCC1235.11∆ h+ ade6-M210 leu1-32 ura4-D18 SPCC1235.11∆::kanMX4 Bioneer SPCC330.12c∆ h+ ade6-M210 leu1-32 ura4-D18 SPCC330.12c∆::kanMX4 Bioneer Corkins et al, zrt1∆ 087 h- ade6-M210 leu1-32 ura4-D18 zrt1∆::kanMX6 2013 This study; SPCC569.05c∆ 509 h- ade6-M210 leu1-32 ura4-D18 SPCC569.05cΔ::kanMX6 generated by YHL Corkins et al, loz1∆ 540 h- ade6-M216 leu1-32 ura4-D18 loz1Δ::kanMX6 2013 This study; loz1∆ h+ ade6-M2? leu1-32 ura4-D18 loz1Δ::kanMX6 545 generated by SPCC569.05c∆ SPCC569.05cΔ::kanMX6 YHL This study; WT JK-vel1-lacZ h- ade6-M210 leu1-32 ura4-D18 pJK-vel1-lacZ SDM 780 generated by LBS#1 SDM LBS#1::leu1+ YHL This study; WT JK-vel1-lacZ h- ade6-M210 leu1-32 ura4-D18 pJK-vel1-lacZ SDM 781 generated by LBS#2 SDM LBS#2::leu1+ YHL This study; SPBC36.02c∆ 782 h+ ade6-M216 leu1-32 ura4-D18 SPBC36.02cΔ::kanMX6 generated by YHL Continued

Table 4 continued

This study; loz1∆ JK-vel1-lacZ h- ade6-M216 leu1-32 ura4-D18 loz1Δ::kanMX6 pJK-vel1- 789 generated by LBS#1 SDM lacZ SDM LBS#1::leu1+ YHL This study; loz1∆ JK-vel1-lacZ h- ade6-M216 leu1-32 ura4-D18 loz1Δ::kanMX6 pJK-vel1- 790 generated by LBS#2 SDM lacZ SDM LBS#2::leu1+ YHL This study; WT JK-vel1-lacZ h- ade6-M210 leu1-32 ura4-D18 pJK-vel1-lacZ LBS #1,2 799 generated by LBS#1, 2 SDM SDM::leu1+ YHL This study; loz1∆ JK-vel1-lacZ h- ade6-M216 leu1-32 ura4-D18 loz1Δ::kanMX6 pJK-vel1- 801 generated by LBS#1, 2 SDM lacZ LBS #1,2 SDM::leu1+ YHL This study; SPCC569.05c∆ h+ ade6-M216 leu1-32 ura4-D18 SPCC569.05cΔ::kanMX6 806 generated by SPBC36.02c∆ SPBC36.02cΔ::kanMX6 YHL This study; loz1∆ h+ ade6-M216 leu1-32 ura4-D18 loz1Δ::kanMX6 807 generated by SPBC36.02c∆ SPBC36.02cΔ::kanMX6 YHL WT JK-vel1-lacZ This study; h- ade6-M210 leu1-32 ura4-D18 pJK-vel1-lacZ LBS triple LBS triple 819 generated by SDM::leu1+ mutations YHL This study; WT JK-vel1-lacZ h- ade6-M210 leu1-32 ura4-D18 pJK-vel1-lacZ LBS #3 821 generated by LBS#3SDM SDM::leu1+ YHL This study; loz1∆ JK-vel1-lacZ h- ade6-M216 leu1-32 ura4-D18 loz1Δ::kanMX6 pJK-vel1- 822 generated by LBS#3SDM lacZ LBS #3 SDM::leu1+ YHL loz1∆ JK-vel1-lacZ This study; h- ade6-M216 leu1-32 ura4-D18 loz1Δ::kanMX6 pJK-vel1- LBS triple 823 generated by lacZ LBS triple SDM::leu1+ mutations YHL This study; loz1∆SPCC569.05c h? ade6-M210 leu1-32 ura4-D18 loz1Δ::kanMX6 826 generated by ∆SPBC36.02c∆ SPCC569.05cΔ::kanMX6 SPBC36.02cΔ::kanMX6 YHL This study; cbf12∆ JK-vel1- h- ade6-M210 leu1-32 ura4-D18 cbf12Δ::kanMX6 pJK-vel1- 872 generated by lacZ lacZ::leu1+ YHL cbf12∆ JK-vel1- This study; h- ade6-M210 leu1-32 ura4-D18 cbf12Δ::kanMX6 pJK-vel1- lacZ LBS triple 873 generated by lacZ LBS triple SDM::leu1+ mutations YHL This study; cbf11∆ JK-vel1- h- ade6-M210 leu1-32 ura4-D18 cbf11Δ::kanMX4 pJK-vel1- 874 generated by lacZ lacZ::leu1+ YHL cbf11∆ JK-vel1- This study; h- ade6-M210 leu1-32 ura4-D18 cbf11Δ::kanMX4 pJK-vel1- lacZ LBS triple 875 generated by lacZ LBS triple SDM::leu1+ mutations YHL

Continued

Table 4 continued

This study; WT JK-vel1-lacZ h- ade6-M210 leu1-32 ura4-D18 pJK-vel1-lacZ cbf12#1 891 generated by cbf12#1 SDM SDM::leu1+ YHL This study; WT JK-vel1-lacZ h- ade6-M210 leu1-32 ura4-D18 pJK-vel1-lacZ cbf12#2 892 generated by cbf12#2 SDM SDM::leu1+ YHL WT JK-vel1-lacZ This study; LBS triple h- ade6-M210 leu1-32 ura4-D18 pJK-vel1-lacZ LBS triple 893 generated by mutations cbf12#1 mutations cbf12#1 SDM::leu1+ YHL SDM WT JK-vel1-lacZ This study; LBS triple h- ade6-M210 leu1-32 ura4-D18 pJK-vel1-lacZ LBS triple 894 generated by mutations cbf12#2 mutations cbf12#2 SDM::leu1+ YHL SDM This study; loz1∆ JK-vel1-lacZ h- ade6-M216 leu1-32 ura4-D18 loz1Δ::kanMX6 pJK-vel1- 895 generated by cbf12#1 SDM lacZ cbf12#1 SDM::leu1+ YHL This study; loz1∆ JK-vel1-lacZ h- ade6-M216 leu1-32 ura4-D18 loz1Δ::kanMX6 pJK-vel1- 896 generated by cbf12#2 SDM lacZ cbf12#2 SDM::leu1+ YHL loz1∆ JK-vel1-lacZ This study; LBS triple h- ade6-M216 leu1-32 ura4-D18 loz1Δ::kanMX6 pJK-vel1- 897 generated by mutations cbf12#1 lacZ LBS triple mutations cbf12#1 SDM::leu1+ YHL SDM loz1∆ JK-vel1-lacZ This study; LBS triple h- ade6-M216 leu1-32 ura4-D18 loz1Δ::kanMX6 pJK-vel1- 898 generated by mutations cbf12#2 lacZ LBS triple mutations cbf12#2 SDM::leu1+ YHL SDM

Table 5. All primers used in this study

Primer name Sequence (5' to 3') Function

SPCC569prom CTAGCGACTGGTCGCTTAC Genotyping

KAN B CTGCAGCGAGGAGCCGTAAT Genotyping

SPCC569prom 2F CATGGCTAATTGTGCTTACAAATC Genotyping

SPCC569prom 3F GGCGTTATGATGTCATATATGC Genotyping

SPCC569 term R CCATCCAATAATCGTGAATATG Genotyping

SPBC36.02cprom CGAAACCATACGATCTTTCAC Genotyping

pyp2 prom CTCCATCTTCTGTCTAAAGACG Genotyping GAGGTAAAATTTTTTCCCTCTGTTTTATTTCATTTCCACAGCATTCA SPCC569F TTAGAGTAGTAATAATTCTAGATTGGCAGATCCCCGGGTTAATTA Knockout A GGAGACAGAGAAAATTAAATTAAGTCAAAAAGTGAATTAAAGTC SPCC569R TAACCATTTTGTTGACGCCTCACAATACAACGAATTCGAGCTCGTT Knockout TAAAC GCCTTTTTTCTTTTTTCTTGTTTAATCCCCTTCTCCGTCACTCATTAG SPBC36.02cF Knockout ATTAAAAAAGTTCCGGATTCACACGGATCCCCGGGTTAATTAA GGTTAAGTCTTATTGTTACACGTCTTAAAAATCGACGGCCATCTTG SPBC36.02cR Knockout CTCATTCGACGAATCTTTCTTCGAATTCGAGCTCGTTTAAAC PCR Gal4 F EcoRI TCAACGAATTCATGAAGCTACTGTCTTCTATCGAAC amplication PCR Gal4 R BamHI TGATTGGATCCTTACTCTTTTTTTGGGTTTGGTGGGGTATC amplication

SPCC569.05cF CATACGTAACTTTTTCCCTAC RNA probe TAATACGACTCACTATAGGGAGGAATTCGTTAATGGTTGTATACC SPCC569.05cRT7 RNA probe G SPBC36.02cF GCTACCATCTACTGGGTTTATATAC RNA probe

SPBC36.02cRT7 TAATACGACTCACTATAGGGCTGGCAGAAGTTGAGAAATTG RNA probe

Gal4 F GTGCTCCAAAGAAAAACCGAAGTG RNA probe

Gal4 RT7 TAATACGACTCACTATAGGGCTTCCGATGATGATGTCGCAC RNA probe

Adh4F GACGCTTCAGAATATTCCAATTC RNA probe

Adh4RT7 TAATACGACTCACTATAGGGAGCTCGCTTAACGAACACTTATCG RNA probe

Zrt1F GGCAGCTGGTTTAGGTGTTCGTG RNA probe Continued

Table 5 continued

Zrt1RT7 TAATACGACTCACTATAGGGAGCACCAAATCAAGCCCATTTACC RNA probe

Pgk1F GGAGGATGCTCTTTCCCACGTC RNA probe

Pgk1RT7 TAATACGACTCACTATAGGGAGCAAATTCACGAATGTTAGAGAAC RNA probe

Vel1F GTCCGCATTGTGGTACGTATC RNA probe

Vel1RT7 TAATACGACTCACTATAGGGAGCGTTGTAAATGTCAAGGGAG RNA probe Site-directed Vel1ZRS1F GAAATTGCGACGATCATCCTCTACGCGAAAATATCTC mutagenesis Site-directed Vel1ZRS1R GAGATATTTTCGCGTAGAGGATGATCGTCGCAATTTC mutagenesis Site-directed Vel1ZRS2F GAAAATCAGAGGGAACCTCTACACAACAAAAAGAGC mutagenesis Site-directed Vel1ZRS2R GCTCTTTTTGTTGTGTAGAGGTTCCCTCTGATTTTC mutagenesis Site-directed vel1LRESmF GTTTGAAATTGCGACCCTCATGATCTACGC mutagenesis Site-directed vel1LREAmR GCGTAGATCATGAGGGTCGCAATTTCAAAC mutagenesis Site-directed vel1triplemutF GTTTGAAATTGCGACCCTCATCCTCTACGC mutagenesis Site-directed vel1triplemutR GCGTAGAGGATGAGGGTCGCAATTTCAAAC mutagenesis Site-directed Velcbf12SDM1F GTTGATAACAATGGCAGGGAAACCGCAAATTTTG mutagenesis Site-directed Velcbf12SDM1R CAAAATTTGCGGTTTCCCTGCCATTGTTATCAAC mutagenesis Site-directed Velcbf12SDM2F GTATTCGTTATTGACTACAGGGAAAACCACGTTAC mutagenesis Site-directed Velcbf12SDM2R GTAACGTGGTTTTCCCTGTAGTCAATAACGAATAC mutagenesis

Table 6. All plasmids used in this study

AJB Plasmid name database Function Reference number pJK148 012 Plasmid backbone Keeney and Boeke, 1994 pFA6a-kanMX6 016 Plasmid backbone Bähler et al, 1998 pJK-vel1-lacZ 122 lacZ construct Ehrensberger et al, 2013 This study; generated by pJK-vel1-lacZ SDM LBS#2 439 lacZ construct YHL This study; generated by pJK-vel1-lacZ SDM LBS#1 444 lacZ construct YHL This study; generated by pJK-vel1-lacZ LBS #1,2 SDM 448 lacZ construct YHL This study; generated by pJK-vel1-lacZ LBS triple SDM 450 lacZ construct YHL This study; generated by pJK-vel1-lacZ LBS #3 SDM 452 lacZ construct YHL This study; generated by pJK-vel1-lacZ cbf12#1 SDM 466 lacZ construct YHL pJK-vel1-lacZ LBS triple mutations cbf12#1 This study; generated by 467 lacZ construct SDM YHL pJK-vel1-lacZ LBS triple mutations cbf12#2 This study; generated by 468 lacZ construct SDM YHL pTN-CYC1-Gal4UAS-lacZ 469 lacZ construct This study; generated by AJB This study; generated by pJK-vel1-lacZ cbf12 #2 SDM 476 lacZ construct YHL This study; generated by ppgk1-Gal4-adh4T 507 Expression plasmid YHL

Table 7. 3 S pombe. strains that were unable to be obained from Bioneer collection. The common name is defined at Pombase.org.

Gene Common Function knocked-out name mitochondrial Rieske ISP assembly ATPase SPAC644.07 (predicted) SPBC11G11.01 fis1 mitochondrial fission protein Fis1 (predicted) TIM22 inner membrane protein import complex SPBP23A10.16 sdh4 anchor subunit Tim18

Table 8. 14 S pombe. strains that failed to grow in ZL-EMM with 200 μM zinc supplements. The common name is defined at Pombase.org.

Gene Common Function knocked-out name SPAC1093.01 ppr5 mitochondrial PPR repeat protein Ppr5 SPAC17H9.08 mitochondrial coenzyme A transporter (predicted)

mitochondrial pyruvate transmembrane transporter SPAC24B11.09 mpc2 Mpc2 (predicted) mitochondrial inner membrane protein Mdm31 SPAC3H1.04c mdm31 (predicted) SPAC4G8.11c atp10 F1-F0 ATPase assembly protein (predicted) mitochondrial TOM complex subunit Tom70 SPAC6B12.12 tom70 (predicted) mitochondrial carrier with solute carrier repeats SPAC823.10c (predicted) SPAC8C9.06c ppr4 mitochondrial translation regulator Ppr4 SPBC16H5.06 rip1 ubiquinol-cytochrome-c reductase complex subunit 5 SPBC27.06c mgr2 mitochondrial membrane protein Mgr2 (predicted) mitochondrial TOM complex subunit Tom7 SPBC27B12.10c tom7 (predicted) mitochondrial inner membrane peptidase complex SPBC336.13c catalytic subunit 2 (predicted) SPBC365.16 conserved protein

mitochondrial pyruvate transmembrane transporter SPCC1235.11 mpc1 subunit Mpc1 (predicted)

Continued Figure 22. Fold change of total cellular zinc levels compared to wild-type (WT) and loz1 mutant (loz1∆) strains respectively. Cells were grown in ZL-EMM with 200 μM zinc supplements. Values near 1.00 represent that zinc levels were similar to controls. Original data representing zinc contents can be found in Table 9 of the Appendix.

Figure 22 continued

Table 9. Total and mitochondrial zinc levels of the 58 strains screened. Mitochondrial zinc levels were calibrated by Bradford assay as μg protein per ml. Mitochondrial AJB Total cellular Common zinc levels Strain name Plate Well Refreeze zinc levels name (mg/L/unit of number (mg/L) protein) Assay 1 Wild-type 8.73 0.00039 loz1∆ 30.94 0.00164 SPAC12B10.09∆ pet801 S03 H07 226 6.15 0.00024 SPAC4G9.20c∆ S03 H05 222 6.37 0.00034 SPAC56F8.04c∆ ppt1 S04 A12 224 8.38 0.00018 SPAC823.13c∆ S01 E12 228 6.88 0.00025 SPAP14E8.04∆ oma1 S01 H10 227 8.10 0.00016 SPBC13E7.11∆ rbd1 S03 H10 230 8.32 0.00029 SPBC3E7.05c∆ S03 H08 229 5.74 0.00011 SPBP22H7.04∆ sre1 S12 B10 36 4.10 0.00013 Assay 2 Wild-type 6.80 0.00041 loz1∆ 29.09 0.00083 SPAC1635.01∆ S01 C12 232 4.90 0.00025 SPAC17G6.15c∆ S01 C04 233 4.87 0.00029 SPAC8C9.12c∆ S03 H04 231 5.92 0.00036 SPAC9G1.04∆ oxa101 S07 F10 238 5.23 0.00029 SPAP27G11.14c∆ S07 G06 237 5.58 0.00027 SPBC1215.01∆ shy1 S02 E04 236 4.85 0.00029 SPBC1289.09∆ tim21 S08 B01 239 4.80 0.00044 SPBC19F8.04c∆ lcl3 S02 F04 234 5.58 0.00049 SPBC582.09∆ pex11 S01 E06 235 5.30 0.00035 Assay 3 Wild-type 9.32 0.00046 loz1∆ 44.33 0.00136 SPAC2C4.09∆ S06 B08 242 8.48 0.00076 SPAC3G6.05∆ S06 D07 246 10.51 0.00028 SPAC4D7.02c∆ S06 E11 245 9.34 0.00045 SPAC513.04∆ S06 G07 244 10.31 0.00040 SPBC16H5.04∆ S02 E08 247 9.37 0.00054 SPBC25H2.08c∆ mrs2 S02 F08 248 7.00 0.00058 SPBC83.05∆ S05 A02 250 7.26 0.00073 Continued 87

Table 9 continued

Assay 4 Wild-type 6.87 0.00155 loz1∆ 32.25 0.00488 SPAC1782.07∆ qcr8 S18 B04 284 7.18 0.00091 SPAC227.03c∆ S17 C01 282 7.69 0.00140 SPAC328.09∆ S17 G06 283 7.05 0.00152 SPAPB8E5.10∆ S15 C12 279 9.49 0.00131 SPBC16E9.07∆ mug100 S18 G10 286 7.94 0.00153 SPBC725.10∆ S16 E02 280 7.30 0.00185 Assay 5 Wild-type 5.10 0.00178 loz1∆ 36.05 0.00328 SPAC139.02c∆ oac1 S24 C06 292 7.59 0.00147 SPAC1565.01∆ S24 E11 293 8.04 0.00117 SPAC167.04∆ pam17 S28 C07 296 9.47 0.00130 SPAC3H5.09c∆ S29 G05 298 8.39 0.00142 SPAC4G9.14∆ S20 G07 301 9.18 0.00105 SPAPB2B4.06∆ S15 C11 291 7.13 0.00118 SPBC16C6.08c∆ qcr6 S29 B06 299 8.23 0.00135 SPBC17A3.02∆ S18 H06 287 6.57 0.00105 SPBC2D10.07c∆ S21 G02 289 6.74 0.00200 SPBC713.08∆ mim1 S12 B09 309 7.65 0.00201 SPBC83.16c∆ S19 D09 300 7.49 0.00131 Assay 6 Wild-type 9.41 0.00246 loz1∆ 67.33 0.00429 SPAC1486.08∆ cox16 S30 A05 308 8.52 0.00153 SPAC1610.04∆ mug99 S14 D04 258 9.82 0.00222 SPAC17A2.11∆ S10 H11 260 10.53 0.00186 SPAC23H3.12c∆ S14 D07 259 11.06 0.00247 SPAC29A4.17c∆ S06 B05 261 10.01 0.00186 SPAC3H1.08c∆ S14 D08 256 11.44 0.00231 SPAC57A10.12c∆ ura3 S14 E05 257 10.17 0.00112 SPAPB1A10.12c∆ alo1 S02 E01 252 8.82 0.00267 SPBC21C3.03∆ S30 A02 310 7.62 0.00225 SPBC3H7.05c∆ S14 G07 254 12.88 0.01105 Continued

Table 9 continued SPBC530.10c∆ anc1 S30 G03 307 8.88 0.00209 SPBC9B6.09c∆ mdl1 S31 B06 306 9.08 0.00178 SPCC330.12c∆ sdh3 S13 D06 255 7.90 0.00147 Assay 7 Wild-type 5.17 0.00212 loz1∆ 38.16 0.00738 SPAC17H9.12c∆ S30 G11 311 4.56 0.00192 SPAC25B8.07c∆ S22 G07 121 4.08 0.00194 SPAC4G8.08∆ S03 H06 225 5.55 0.00243 SPAPJ691.03∆ S07 H01 240 3.37 0.00293 Assay 8 Wild-type 9.99 0.00115 Repeat loz1∆ 19.27 0.00400 SPAC4G8.08∆ S03 H06 225 9.32 0.00105 SPAPJ691.03∆ S07 H01 240 9.23 0.00113 SPBC3H7.05c∆ S14 G07 254 12.51 0.00654