Exploring rapamycin-induced pro-survival pathways in Tuberous Sclerosis Complex and the development of alternative therapies A dissertation submitted to the Graduate School of the University of Cincinnati in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Ph.D.)
In the Department of Pathobiology and Molecular Medicine Of the College of Medicine August 2020
By
Yiyang Lu M.S., Central South University, 2014
Dissertation Committee: Jane J. Yu, Ph.D. (Chair) Mario Medvedovic, Ph.D. Manoocher Soleimani, M.D Tanya V. Kalin, M.D, Ph.D. Yan Xu, Ph.D.
i Abstract
Tuberous Sclerosis Complex (TSC) is an autosomal dominant genetic disease with multi-system manifestations including benign neoplastic growth in the brain, heart, kidneys, and lung. Inactivating gene mutations in either TSC1 or TSC2 result in hyperactivation of mechanistic target of rapamycin complex 1 (mTORC1), which leads to the uncontrolled cell growth and proliferation in TSC. Lymphangioleiomyomatosis (LAM) is the lung manifestation of TSC and can also present as sporadic form. It occurs predominantly in women during their reproductive age and is exacerbated by female hormones including estrogen, progesterone and prolactin. To explore the underlying molecular mechanism of this hormonal predominance, we utilized TSC2-deficient models and showed that estrogen promotes glycolytic metabolism in tumor cells through activation of pyruvate kinase muscle isozyme M2 (PKM2). Accumulation of phosphorylated PKM2 was evident in pulmonary nodule and renal angiomyolipoma cells from LAM patients.
These data suggest that the female predominance of LAM might partially be attributed to estrogen stimulation of PKM2-mediated cellular metabolic alterations.
The clinical application of mTORC1 specific inhibitors (mTORi), including sirolimus
(rapamycin) and everolimus, have been shown to promote tumor regression and stabilize lung function in TSC and LAM patients. However, sustained improvement requires continuous exposure, as refractory growth occurs upon drug cessation, suggesting a cytostatic rather than a cytocidal nature of the medicine. We recapitulated rapamycin- induced refractory response in mouse xenograft tumors. RNA sequencing analysis of xenograft tumors from different growth stages revealed upregulation of pro-survival mitogen activated protein kinase (MAPK) pathway under rapamycin induction. This study
ii revealed a MAPK-evoked positive feedback loop that dampens the efficacy of mTOR inhibition in TSC models. Pharmacological inhibition of MAPK abrogated this feedback loop activation, and combinatorial inhibition of mTOR and MAPK induced death of TSC2- deficient cells.
Collectively, our results revealed novel survival mechanisms in TSC2-deficient models and provide a proof of concept for the development of remission-inducing therapies for TSC and LAM patients.
iii Copyright Notice Chapter II and Chapter III of this dissertation are adaptations of manuscripts published in Orphan Journal of Rare Disease and PLOS ONE. The published works are distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited.
iv Acknowledgements
First and foremost, I wish to express my most sincere gratitude to my PhD advisor
Dr. Jane Yu for her mentorship and support during this journey. I would not be where I am now without her dedication, support and guidance.
I am very grateful for my graduate committee members for the time and effort they have put into my training. I would like to thank Dr. Mario Medvedovic for the collaborative effort on the rapamycin refractory project; Dr. Manoocher Soleimani for the insights and guidance on renal tumor model; Dr. Tatiana Kalin for the constructive suggestions; And
Dr. Yan Xu for the enlightenment on single cell RNAseq analysis.
I would also like to acknowledge all the past and present members of the Yu Lab who have supported my training, especially Alan G. Zhang, Dr. Xiaolei Liu and Dr. Erik
Zhang.
I would also like to acknowledge LAMS for their strong support with mouse procedures; the McCormack Lab for phase contrast microscope imaging and patient specimen collection. Lastly, I would like to acknowledge LAM and TSC patients and their family, who have selflessly provided us with study materials, it is their generosity that have made this research possible.
This thesis is dedicated to my mother, Xinwen Yang (杨新文). Instilled within me are her strength, wisdom and perseverance. Her unconditioned love prepares me to achieve any goals.
v Table of Contents Chapter I. Introduction of Tuberous Sclerosis Complex (TSC) ...... 1 1.1 Background ...... 2 1.2 Current understanding of TSC pathogenesis ...... 4 1.3 Female hormone actions in LAM progression ...... 7 1.3.1 Estrogen and LAM ...... 8 1.3.2 Progesterone and LAM ...... 11 1.3.3 Prolactin and LAM ...... 11 1.3.4 Hormonal-driven preclinical models of LAM ...... 12 1.4 Advancement in TSC management and unsolved mystery ...... 15 Chapter II. Inhibition of the mechanistic target of rapamycin induces cell survival via MAPK in Tuberous Sclerosis Complex ...... 19 Abstract ...... 20 2.1 Introduction...... 20 2.2 Materials and methods ...... 22 2.3 Results...... 26 2.3.1 MAPK signaling pathway is activated in response to rapamycin treatment ..... 26 2.3.2 Tsc2-deficient xenograft tumors become refractory to rapamycin treatment ... 27 2.3.3 Rapamycin is cytostatic but not cytotoxic in TSC2-defcieint cells in vitro ...... 29 2.3.4 Rapamycin promotes MAPK activation in mTORC1-hyperactive tumor cells and pre-clinical model ...... 31 2.3.5 Dual inhibition of mTORC1 and MAPK induces the death of TSC2-deficient patient-derived cells in vitro ...... 35 2.3.6. Development of prognostic biomarker for predicting and monitoring rapamycin resistant and rebound in patient ...... 36 2.4 Discussion ...... 38 Chapter III. Estrogen activates pyruvate kinase M2 and increases the growth of TSC2- deficient cells ...... 45 Abstract ...... 46 3.1 Introduction...... 46 3.2 Materials and methods ...... 48 3.3 Results...... 51 3.3.1 Estrogen promotes the growth of TSC2-deficient cells in a glucose-dependent manner ...... 51 3.3.2 Estrogen regulates PKM2 phosphorylation in TSC2-deficient cells ...... 54 3.3.3 Estrogen induces nuclear localization of phosphorylated PKM2 ...... 56
vi 3.3.4 TSC2 negatively regulates PKM2 expression in rapamycin-insensitive manner ...... 60 3.3.5 PKM2 activation is independent of mTOR in TSC2-null cells ...... 61 3.3.6 Accumulation of phospho-PKM2 is evident in pulmonary LAM nodules from TSC/LAM patients ...... 63 3.3.7 Expression of ERα and ERβ is evident in TSC2-null cells ...... 65 3.4 Discussion ...... 66 Appendices ...... 71 References...... 74
vii List of tables Table 1.1 Manifestation of Tuberous Sclerosis Complex ...... 2 Table 1.2 Cell culture models used in TSC and LAM studies ...... 8 Table 1.3 Effects of female hormones in tuberin-deficient cells ...... 9 Table 1.4 Effects of female hormones in preclinical models of TSC and LAM ...... 13
List of figures Figure 1. TSC1 (hamartin) and TSC2 (tuberin) are tumor suppressor proteins...... 5 Figure 2. Bioinformatics analysis of rapamycin enhanced signaling pathway in TSC deficient cells...... 27 Figure 3. Xenograft tumor of Tsc2-deficient cells become refractory to rapamycin treatment...... 29 Figure 4. Rapamycin is cytostatic but not cytotoxic in TSC-deficient cells in vitro...... 31 Figure 5. Persistent MAPK pro-survival pathway activation in rapamycin induced cytostatic TSC tumor cells...... 35 Figure 6. Dual suppression of mTORC1 and MAPK induces death of TSC2-deficient cells in vitro...... 36 Figure 7. IL-6 as a potential prognostic biomarker for rapamycin insensitivity in TSC treatment...... 38 Figure 8. Estrogen promotes the growth of TSC2-deficient cells via PKM2 in a glucose- dependent manner...... 53 Figure 9. Estrogen induces PKM2 phosphorylation in LAM patient-derived cells...... 56 Figure 10. Estrogen induces nuclear translocation of phosphor-PKM2 [S37] in a TS2- dependent ...... 59 Figure 11. TSC2 negatively regulates PKM2 phosphorylation in an mTORC1- independent manner...... 61 Figure 12. Selective interference of mTORC1/RAPTOR or mTORC2/Rictor does not alter PKM2 expression...... 62 Figure 13. Accumulation of phosphor-PKM2 [Ser37] is evident in pulmonary LAM nodules...... 64 Figure 14. Expression of ERα and ERβ is evident in LAM patient-derived 621-101 and rat leiomyoma-derived ELT3 cells...... 66
List of Abbreviations
4E-BP1 Translational repressor 4E-binding protein 1
AML Angiomyolipoma
DEPTOR DEP domain-containing mTOR-interacting protein
DAPI 4′,6-diamidino-2-phenylindole
viii ELT3 Eker leiomyoma Tumor-3
ERL4 ELT3 cells stably expressing luciferase reporter gene
ESR1 Estrogen receptor 1
ESR2 Estrogen receptor 2
ESRα Estrogen receptor α
ESRβ Estrogen receptor β
FKBP121 FK506 binding protein
GAP GTPase activating protein
IL-6 Interleukin 6
LAM Lymphangioleiomyomatosis
MAPK Mitogen-activated protein kinase mLST8 mammalian lethal with SEC13 protein 8 mTORC mechanistic target of rapamycin complex mTORC1 mechanistic target of rapamycin complex 1 mTORC2 mechanistic target of rapamycin complex 2
PCNA Proliferating cell nuclear antigen
PI3K Phosphoinositide 3 kinase
PKM2 Pyruvate kinase M2
PS6 Phospho-S6 ribosomal protein (Ser235/236)
RAPTOR Regulatory-associated protein of mTOR
Rheb Ras homologue enriched in brain
RICTOR Rapamycin-insensitive companion of mTOR
TSC Tuberous Sclerosis Complex
ix VEGF Vascular endothelial growth factor
x
Chapter I. Introduction of Tuberous Sclerosis Complex (TSC)
1 1.1 Background
Tuberous sclerosis complex (TSC) is an autosomal dominant disease manifesting as a series of benign neoplasms in multiple organs (Table1.1), including brain
(subependymal giant cell astrocytoma/SEGA), lung (lymphangioleiomyomatosis/LAM), kidney (angiomyolipoma/AML), and skin (facial angiofibroma, ungula fibromas, fibrous cephalic plaques, Shagreen patches and Focal hypopigmentation changes). These slow proliferating masses cause functional impairment of respective organs through the physical compression or cystic destruction of normal residential tissues (1-3). TSC- associated neuropsychiatric disorders, such as autism spectrum disorder and cognitive disability have also been reported (1). The origin of the tumor cell is unknown, over the years, studies have suggested possible sources such as neural crest cells, uterus, kidney or lung, but none of these is comprehensive enough to define a common origin (1).
Table 1.1 Manifestation of Tuberous Sclerosis Complex
Organ systems Pathology (2) Manifestation Neurology • Subependymal nodule • Seizures • Subependymal giant cell • Autism spectrum disorder astrocytoma • Learning disability • Cortical tubers • Behavior problem • TSC-Associated Neuropsychiatric Disorder (1) Skin • Shagreen patch • Hypopigmented skin changes • Ash leaf macules (4) • Angiofibroma • Papules of butter fly distribution (5) Cardiovascular • Cardiac rhabdomyomas • Heart failure • Arrhythmia (6) Respiratory • Lymphangioleiomyomatosis • Asymptomatic • Shortness of breath • Respiratory failure (7) Renal • Angiomyolipoma • Asymptomatic • Cystic disease • Life-threatening bleeding • Renal cell carcinoma • Kidney failure (8, 9)
2 Although defined as a benign process, estrogen associated metastasis of TSC2- deficient cells has been reported (10-12). “LAM cell” not only exists in lung, but also in blood, lymph nodes, chylous fluid and uterus (12, 13). The metastatic nature of LAM was supported by disease re-occurrence after lung transplantation (14). Similar cellular characteristics such as resemblance of myocyte and adipocyte, expression of estrogen receptor and angiogenesis are shared among TSC-deficient tumor cells residing in different tissues (1, 15). It has been reported that 60% of the sporadic LAM cases are accompanied by the presence of AML. Additional evidence revealed identical mutations within the TSC genes from concurrent lung and renal lesions (1). Unlike the gender non- selectivity of TSC, LAM affects almost exclusively women and has one of the strongest gender predispositions of any extra-genital human disease (3, 16-19). In constitutive TSC, majority of patients that developed LAM have been female, with only a few male cases reported (20-22), and all of which present with milder symptoms than female (23). In sporadic LAM, women consist of 80% of total patient population recorded by the LAM
Foundation Registry and National Institutes of Health Registry, respectively (21). Clinical observations have also shown that menstrual cycle influences symptoms such as pneumothoraxes, and that decline of lung function slows after menopause or oophorectomy and accelerates with exogenous estrogen use and pregnancy (24-29).
Importantly, numerous cell based and preclinical models have demonstrated the promoting role of estrogen receptor alpha (ESR1) and progesterone receptor (PR) in LAM development and progression (23, 30-32). Anti-estrogen therapies have been trialed in
LAM treatment. Several case reports have documented potential benefits of anti-estrogen therapies (25, 33). However, the phase II clinical trial of aromatase inhibitor letrozole has
3 yet to show robust beneficial effect when administered to a small number of postmenopausal women with LAM (34). To date, the benefit of progesterone therapy has been limited in clinical studies (26, 29, 33, 35-38).
1.2 Current understanding of TSC pathogenesis
The pathogenesis of TSC initiated with “loss of function” mutations in either TSC1 or TSC2 gene. More than 1800 disease causing mutations have been reported throughout the coding region of the two genes, with missense mutation dominating TSC2, nonsense mutation dominating TSC1 (1). The physiological role of TSC1 and TSC2 is to form TSC protein complex together with TBC1 domain family member 7 (39). TSC protein complex inhibits the small GTPase Rheb (Ras homologue enriched in brain), which positively regulates mTORC1 (Figure 1). Therefore, intact expression of TSC1 and TSC2 suppresses mTORC1 and downstream signaling pathways through inhibition of Rheb (40,
41). Vice versa, loss of TSC1 or TSC2 results in upregulation of mTORC1 activity and its downstream targets including ribosomal S6 kinase (S6K) and translational repressor 4E- binding protein 1 (4E-BP1) (42, 43), leading to aberrant cell growth of TSC tumors (1).
The target of rapamycin (TOR) is the central regulator of cell growth, differentiation and apoptosis (44). mTOR functions as a catalytic subunit in two complexes, mTORC1 and mTORC2. Both complex shared common component DEPTOR (DEP domain- containing mTOR-interacting protein) and mLST8 (mammalian lethal with SEC13 protein
8). RAPTOR (regulatory associated protein of mTOR) is a unique component of mTORC1, while RICTOR (rapamycin insensitive companion of mTOR) is unique to mTORC2 (44). Activate Rheb and functional Rag GTPases are necessary for the activation of mTORC1 (44, 45). The mTOR upstream regulator, Rheb, translocates to
4 lysosome surface in the presence of pro-survival signals such as growth factor (46).
Sufficient nutrients, particularly amino acids, trigger the recruitment of mTORC1 to lysosome by Rag GTPases (45), which allows for physical interaction between Rheb and mTORC1, resulting in mTORC1
Figure 1. TSC1 (hamartin) and TSC2 (tuberin) are tumor suppressor proteins. The TSC complex negatively regulates Rheb status by hydrolyzing the GTP-bounded active Rheb to GDP- bounded inactive Rheb, and subsequently inhibits mTORC1 activation.
phosphorylation. Activated mTORC1 subsequently phosphorylates ribosomal protein S6 kinase (S6K) and the translational repressor 4E-binding protein 1 (4E-BP1), both of which promote protein synthesis through initiating translation of protein serving in translational machinery and cell cycle progression, such as ribosome biogenesis (44, 47).
Cell size regulation has been associated closely with mTOR mediated S6K signaling. Diane and colleagues reported mTOR as the central regulator of cell size, which initiate cell growth and proliferation. As cell size expands, activated mTOR complex
5 mediates the conversion from G0 to G1 phase of the cell cycle, thus associating cell size with cell proliferation (48). The complexity of mTOR signaling lays in the balance between the proliferative and anti-proliferative pathways downstream. In the recent decade, mTORC1 hyperactivation has been associated with various types of cancer (49, 50). The concept of metabolic plasticity, which describes a series of adaptive changes taken place in the tumor cells in order to reach a new “agreement” with the environment and promote cellular viability, has been frequently referred in cancer biology, similar notion has been suggested in TSC deficiency associated neoplasms as well (11, 51). These adaptive changes include glucose metabolic reprogramming to glycolysis (Warburg effect), pentose phosphate pathway (52), the increased preference for glutamine (50, 53, 54), and autophagy (52, 55, 56). Numerous parallel oncogenic pathways, such as
Ras/Raf/MEK/ERK pathway and phosphoinositide 3-kinase (PI3K)/AKT(PKB) pathways, have been proven to co-exist, interact with and compensate mTORC1 signaling, potentially contributing to therapy resistance in various tumors (57-60). Specifically to
TSC, mTORC1 hyperactivation is the major contributor that initiates and oversees these metabolic events in TSC deficient cell lines and animal model (51, 61, 62). It has been noted that constitutive activation of mTORC1 significantly suppresses the negative feedback mechanism of Akt signaling (44, 62, 63). Loss of feedback loop inversely promotes cell survival through phosphorylated ribosomal protein S6-induced mTORC2 activation and subsequent Akt phosphorylation (64). Yoon and colleague demonstrated aberrant Akt phosphorylation under long-term treatment of mTOR kinase inhibitor Torin1 in Torin1-resistant melanoma cells, and WT-MEFs, but not in Torin1-sensitive breast
6 cancer cells (65). Combination therapies targeting both mTOR and its feedback loops has been proposed to achieve effective tumor growth inhibition (66).
Robert J. Salmond and colleague elaborated on mTOR independent pro-survival pathways by challenging the classical theory of mTOR-dependent ribosomal protein S6 phosphorylation. Their work showed the indispensable role of MAPK pathway and phosphatidylinositol 3-kinase pathway in phosphorylating ribosomal protein S6 and subsequent effect on CD8 T cell activation upon TCR stimulation. suggesting crosstalk of MAPK, PI3K and mTOR in regulation protein synthesis, cell growth and proliferation
(67). MAPK signaling in TSC2-deficient cells has been studied in an early studies, in which low
MAPK signaling has been reported in tumor cells due to constructive relationship between tuberin and MAPK phosphorylation (68). Besides the hyperactivated mTORC1 induced by TSC2 deficiency, the pro-oncogenic B-Raf kinase and MAPK are targets of inhibition by the activated
Rheb independent of mTOR signaling. And such inhibition was resistant to rapamycin, as evidence showed that Rheb mediated B-raf inhibition and S6 kinase activation are separate activities induced by Rheb protein (2, 68).
1.3 Female hormone actions in LAM progression
Circulating female hormones play important roles during female reproduction and normal homeostasis. These hormones are also associated with development and progression of female cancer. Considering that LAM is a female predominant lung disease, the impact of circulating steroid hormones including estrogen, progesterone, and prolactin on the growth of cells carrying TSC2-inactivating mutations has been investigated at various cellular contexts (Summarized in Table 1.2 and1.3).
7 1.3.1 Estrogen and LAM
Estrogen is the primary female sex hormone and is responsible for the development and regulation of the female reproductive system. The impact of estrogen on cellular events of LAM-derived and TSC2-null cells (Summarized in Table 1.2) have been examined.
Table 1.2 Cell culture models used in TSC and LAM studies
Cell Cell origin References
ELT3 Eker rat uterine leiomyoma Howe et al.1995 (15) 621 Renal angiomyolipoma from S-LAM Yu et al. 2004 (69) 621-101 Immortalized 621 Hong et al. 2012 (146) 621NIS/GFP 621-101 co-expressing NIS/GFP Liu et al. 2012 (70) LAM-D LAM lung nodule Goncharova et al. 2002 (71)
ELT3: Eker rat uterine-leiomyoma-derived cells; S-LAM: Sporadic LAM; NIS: sodium-iodide symporter; GFP: green fluorescent protein; LAM-D: LAM-derived cells
Howe et al. developed Eker rat uterine leiomyoma derived ELT3 cells, and showed that estrogen stimulated the growth of ELT3 cells (15, 72). Studies by multiple groups showed that estrogen simulated the proliferation of ELT3 cells and associated with activation of platelet derived growth factor PDFG (73, 74) and MAPK (73-78) . Studies by
Yu et al showed that estrogen induced MAPK-dependent resistance to anoikis, detachment-induced cell death in ELT3 cells (78). Despite the impact of estrogen on cell proliferation, Sun et al. reported that estrogen reactivated MAPK and Akt, increased membrane translocation of glucose transporter Glut-4, and enhanced glucose uptake
(77). Concomitantly, estrogen upregulated the expression of glucose-6-phosphate dehydrogenase (G6PD) and increased NADPH and ROS production, suggesting that estrogen promotes reprogramming of glucose metabolism. Moreover, Li et al showed that
8 estrogen activated the biosynthesis of prostaglandin, a lipid mediator that contributes to cancer progression and inflammatory responses, and upregulated the expression of cyclooxygenase-2 (COX-2), a key enzyme that is responsible for prostaglandin metabolism (79).
Table 1.3 Effects of female hormones in tuberin-deficient cells
Phenotype Cells Assay References Estrogen Enhanced growth 621 Alamar blue Yu et al., 2004 (69) 621-101 MTT Sun et al., 2014 (80)
ELT3 Cell counter Finlay et al. 2003, 2004 (73), (75) Thymidine Yu et al., 2009 (12) incorporation Resistant to anoikis ELT3 Growth in Yu et al., 2009 (12) detachment 621-101 Growth in Li et al., 2016 (81) detachment Increased invasion 621-101 Matrigel Sun et al., 2014 (80)
Increased migration LAM-D Transwell Gu et al., 2009 (82) Pentose phosphate 621-101 NADPH Sun et al. 2014 (80) addiction Prostaglandin ELT3 and 621- ELISA Li et al., 2014 (79) production 101 Progesterone Increased invasion ELT3 Matrigel Sun et al., 2014 (80) Increased migration 621-101 Transwell Sun et al., 2014 (80) Prolactin Enhanced proliferation EEF BrdU incorporation Terasaki et al., 2010 (83) Mouse sarcoma CV assay Alkharusi et al., 2016 (84) cells S-LAM: Sporadic LAM; MTT: 3-(4, 5-dimethylthiazolyl-2)-2, 5-diphenyltetrazolium bromide); LAM- D: LAM-derived cells; ELISA: enzyme-linked immunosorbent assay; EEF: Eker rat embryonic fibroblasts; BrdU: bromodeoxyuridine incorporation; CV: crystal violet assay
9 Genetic studies have demonstrated that LAM is a metastatic disease (85-87).
Metastasis is multiple step event that is associated with tumor growth at the origin, remodeling of extracellular matrix (ECM), tumor cell dissemination into circulation, increased survival of disseminated cells, and homing to distal organ to form metastatic lesions (88). Several lines of studies showed that estrogen increased the expression and activity of matrix metalloproteinases (MMP2 and MMP9) in Tsc2-null ELT3 cells (78, 89) and in LAM-patient-derived (LAM-D) cells (90) developed by Goncharova et al (71). Yu et al established a sporadic LAM-associated renal angiomyolipoma-derived 621 cell line
(69). This primary cell line carries TSC2 mutation and chromosome 16 loss of heterozygosity (69, 86). Estrogen treatment increased the proliferation associated with upregulation of cyclin D1 and C-Myc (69) . Interestingly, tamoxifen, an estrogen antagonist, stimulated the growth of 621 cells. This observation, opposing to classical action of anti-estrogen, suggests that anti-estrogen agents exert stimulatory activities to
LAM cell growth. Huang et al. immortalized 621 cells using human telomerase reverse transcriptase (hTERT) and the human papillomavirus (HPV) early genes E6 and E7 (91)
. Using these 621 isogenic cells, Sun et al has reported that estrogen stimulated the proliferation of LAM patient-derived cells (80). Studies by Gu et al. demonstrated that estrogen activated ERK1/2, increased proliferation, and promoted epithelial to mesenchymal transition (76). Estrogen also induced the resistance to anoikis and enhanced the survival of LAM patient-derived cells in detachment conditions via the proapoptotic protein Bim, an activator of anoikis (81), consistent with the findings in ELT3 cells (78). Collectively, these observations support that estrogen induces the metastatic potentials of TSC2-deficient cells in vitro.
10 1.3.2 Progesterone and LAM
Progesterone is another female hormone that plays an important role in menstrual cycle and maintaining pregnancy. Studies by Sun et al. reported that progesterone single treatment or progesterone plus estrogen activated Akt and p44/42-MAPK signaling pathways in LAM patient-derived cells (80). Progesterone alone or in combination with estrogen increased the migration and invasion of TSC2-deficient cells (Table 1.3).
Moreover, combinatorial treatment of progesterone and estrogen decreased the cellular levels of reactive oxygen species (ROS), and enhanced cell survival under oxidative stress more strongly than single treatment (80). Collectively, these findings support the important role of progesterone in LAM progression.
1.3.3 Prolactin and LAM
Prolactin is a female hormone that functions to promote milk production in mammals. Higher levels of prolactin and prolactin receptor mRNA and protein accumulation were found in pulmonary LAM lesions relative to adjacent vascular smooth muscle cells (83). Importantly, serum levels of prolactin were elevated in LAM patients and associated with faster FEV1 decline and higher incidence of pneumothorax, indicative of the role of prolactin in LAM progression. Mechanistically, prolactin activated the signal transducer and activator of transcription-1 (STAT1), STAT3, p44/42-MPAK, and p38-MAPK in Tsc2-null Eker rat embryonic fibroblasts relative to Tsc2-expressing cells. Phenotypically, prolactin increased the proliferation of Tsc2-null cells. Alkharusi et al. reported similar findings in other studies (84, 92).
11 1.3.4 Hormonal-driven preclinical models of LAM
Despite the advancement of understanding of steroid hormone action in TSC2-null cells in cell-based models, their roles have not been extensively investigated in vivo, in part due to the limitation of mouse models that closely recapitulate LAM lung phenotypes.
As summarized in Table 1.4, in early studies by Howe et al., ELT3 cells were subcutaneously injected into flanks of female nude mice. Estrogen and progesterone supplementation enhanced the growth of flank tumors (15, 72). These reports showed for the first time that female hormones exhibited in vivo actions, although the presence of
ELT3 cells in other organ of those mice was not examined. In a study by Yu et al., ELT3 cells were injected into immunodeficient CB17-SCID mice, and estrogen treatment stimulated the growth of xenograft tumors of ELT3 cells (78), consistent with the finding by Howe et al. Importantly, estrogen promoted the lung metastasis of ELT3, associated with elevated levels of circulating ETL3 cells (78). This is the first mouse model in which estrogen promotes the lung metastasis of Tsc2-null cells. Additional preclinical studies have also reported that estrogen promotes the lung metastasis of Tsc2-deficient cells (10,
70, 78, 80, 89) and stimulates Akt phosphorylation in ELT3 (75) and LAM patient-derived cells. Importantly, Faslodex, a pure estrogen receptor antagonist, attenuated ECM remodeling in primary tumors and strongly suppressed estrogen-induced lung metastasis of ELT3 cells (89). In Tsc1 heterozygous mouse model, estrogen promoted whereas tamoxifen suppressed the development of liver hemangiomas (93). Liu et al. engineered
621-101 cells by co-expressing sodium-iodide symporter (NIS) and green fluorescent protein (GFP). 621NIS/GFP cells were intraparenchymal injected, intravenously, or intratracheally into immunodeficient nude mice. Cell colonization was tracked and
12 quantified using single photon emission computed tomography (SPECT) and computed tomography (CT). TSC2-deficient cells administered intratracheally disseminated to systemic lymph node basins the lung. Estrogen treatment enhanced the tumor growth and dissemination (70).
Table 1.4 Effects of female hormones in preclinical models of TSC and LAM
Hormones Cell Mouse Model Abnormality Metastasis Citation strain Estrogen ELT3 Athymic Subcutaneo Enhanced n.a. Howe et NCr nu/nu us tumor growth al., 1995 (15) ELT3 CB17- Subcutaneo Metastasis lung Yu et al., SCID us 2009 (12) Intravenous Tsc2 PR/Cre Uterine- Uterine lung Prizant et KO specific enlargement, al., 2016 Tsc2 myometrial (23) knockout tumor growth, Growth MMP expression/in vasion 621N Athymic Intraparen- Metastasis Lymph Liu et al., IS/G NCr nu/nu chymal and node and 2012 (70) FP Intravenous proliferation lung Intratracheal Progesterone ELT3 CB17- Subcutaneo Lymphocyte no Sun et al., SCID us infiltration and 2014 (80) alveolar wall thickening Progesterone ELT3 CB17- Subcutaneo Metastasis lung Sun + Estrogen SCID us Xenograft et al., Intravenous tumor growth 2014 (80) n.a.: not examined; CB17-SCID: Severe combined immunodeficiency; Cre: Cre recombinase; Tsc2KO: Tsc2 knockout; PR: Progesterone receptor; NIS: Sodium and Iodine symporter; GFP: Green fluorescent protein. nu/nu: Immunodeficient nude mouse.
In another study, treatment of progesterone plus estrogen promoted the growth of xenograft tumors; however, progesterone alone did not affect the progression of xenograft tumors of ELT3 cells (80). Importantly, the dual treatment of progesterone plus estrogen
13 promoted the lung metastasis of ELT3 cells more strongly compared with estrogen single treatment. Interestingly, progesterone treatment recruited immune cell infiltration and induced alveolar wall thickening. In addition, Prizant et al. reported that estrogen or estrogen plus progesterone increased the growth and lung metastasis of myometrial tumors in a uterine-specific Tsc2 knockout mouse model; however, progesterone single treatment did not affect these phenotypes (10, 23). Together, these preclinical data demonstrate that progesterone, in addition to estrogen, increases the metastatic potential of Tsc2-null tumor cells in vivo, supporting the notion that targeting progesterone- mediated cellular events may be beneficial for LAM patients.
The gender specificity of LAM highly indicates important roles of female hormones in promoting LAM pathogenesis and progression. Despite numerous advances in understanding TSC2-loss and mTOR-dependent and -independent signaling pathway alteration [include a most recent review article here], there are critical unmet needs for development of more optimal therapeutic strategy for LAM. Clinical trials of the mTORC1 inhibitor showed that the treatment stabilizes lung function during the therapy; however, lung function decline resumed upon drug discontinuation [include a few trials]. Thus, the ultimate goal is to identify novel molecular targets that can inform the future development of curable strategy that can eliminate abnormal LAM cells without affecting normal lung cells. It will be important to further investigate the molecular mechanisms responsible for the action of female hormones in LAM progression and test the efficacy of inhibition of female hormone actions and their steroid hormone receptors, single or in combination with sirolimus. It is anticipated that targeting female hormone-regulated signaling molecules may be beneficial in the treatment for LAM patients.
14 1.4 Advancement in TSC management and unsolved mystery
Upon the elucidation of TSC etiology and its association with mTORC1 hyperactivity, targeted therapy of mTORi have emerged and revolutionized TSC patient management in recent decade (94-98). More than 60 clinical trials have been registered to evaluate the efficacy and safety of mTORi in ameliorating TSC-associated symptoms
(96, 97). mTOR1i, specifically sirolimus and everolimus were approved by FDA for the treatment of TSC associated subependymal giant cell astrocytoma in brain (everolimus), renal angiomyolipoma (everolimus) and pulmonary lymphangioleiomyomatosis
(sirolimus) (99). Rapamycin (or equivocally known as sirolimus) was first isolated from
Streptomyces hygroscopicus as a potent anti-fungal agent against Candida species (100,
101). It was initially approved by the FDA in 1999 as an immunosuppressant for treating acute renal allograft rejection or restenosis (57, 102). As a first generation rapalog, rapamycin acts by forming complex with the intracellular binding protein FK506-bindng protein (FKBP121). Such complex binds to the FKBP12-rapamycin binding (FRB) domain of the mTORC1 molecule, thus inhibiting its downstream activity (57, 103).
Despite being the most available therapy that targets the entire spectrum of TSC associated manifestations, the drawback of mTORi has been documented (103-105). As indicated consistently in clinical trials, achieving optimal therapeutic effect requires continuous exposure of mTORi, and that discontinuation of the medicine results in tumor volume restoration and functional deterioration (96, 97). Unfortunately, prolonged treatment has been associated with deleterious adverse effects including diabetes (106), stomatitis, mouth ulceration, infection, pneumonitis and latent malignancy (97). In addition, clinical observations have revealed subgroups of TSC/LAM patients who
15 develop resistance to rapamycin while actively receiving the medicine (107). In vitro studies have demonstrated that rapamycin treatment decreases cell proliferation and growth and manipulates cell apoptosis (105, 108-110). The relationship between rapamycin-induced growth arrest and rapamycin resistance have been studied in several colon carcinoma cell lines (111). The paradoxical effects of rapamycin are preservation of the re-proliferative potential in non-proliferating or arresting cells and induction of anti- proliferation in rapidly proliferating cells (112). Consistently, rapamycin induced cytostasis has been noted in TSC2-deficient cell and animal models (104). We have observed that rapamycin decreased proliferation and apoptosis in vitro and sustained the growth of xenograft tumor of TSC2-deficient cells in vivo. These evidences suggest a suppressive rather than remission-inducing effect of rapamycin towards the neoplasms and disease symptoms.
mTORC1 inhibition associated pro-survival mechanisms in cancer and TSC have been reported (113). Akt is a phosphorylation target of mTORC2 (114, 115). Constitutive activation of mTOR significantly suppresses the negative feedback mechanism of Akt signaling (44, 62, 63). mTORC1 inhibition leads to aberrant activation of Akt signaling as the mTORC1 dependent-feedback mechanism becomes suppressed (116, 117). A recent study demonstrated that the long-term treatment of mTOR kinase inhibitor Torin1 failed to inhibit Akt phosphorylation in Torin1-resistant melanoma cells, and WT-MEFs, which was not seen in Torin1-sensitive breast cancer cells (65). Proposed therapies targeting both mTOR and the feedback loops have shown inhibitory effective on tumor growth (66). mTOR inhibition also lead to activation of autophagy (52, 55, 56, 107), which is a self- renewal mechanism utilized to sustain cell survival. Autophagy inhibition using
16 chloroquine and spautin-1 has been tested to achieve synergistical effect with rapamycin in eliminating tumor growth in Tsc2-deficient ELT3 xenograft models (51, 52, 56).
Importantly, the autophagy inhibitor hydroxychloroquine is under clinical trials for several cancer (118) and LAM (52, 119-121).
We have demonstrated that estrogen promotes the viability and motility of
LAM/AML tumor cells through activation of mitogen-activated protein kinase (MAPK) (12,
69, 77, 81, 82, 105). We have shown that estrogen-stimulated MAPK activity is indispensable for the anchorage-independent survival of 621-101 cells and ELT3 cells
(12, 81). In the in vitro model, estrogen-activated MAPK phosphorylates and inhibits Bcl-
2-like protein 11 (BIM), resulting in decreased loss-of-anchorage induced cell death (78,
81). In a TSC tumor model, we demonstrated that MEK1/2 inhibitor CI-1040 suppresses the estrogen-dependent lung metastasis of ELT3 cells (12, 69). The MAPK signaling pathway is a conserved in all eukaryotes. Physiologically, MAPK pathway activation can be triggered by receptor binding to mitogens, cytokines and growth factor. Upon activation, MAPK phosphorylates a series of downstream kinases known as MAPK- activated protein kinases (MAPKAPKs). These activated kinases phosphorylate cytoplasmic target and transcriptional factors which subsequently regulate proteins involved in cell proliferation, differentiation, motility, stress response, apoptosis and survival (58, 67). Crosstalk between the mTOR and MAPK pathways has been demonstrated in numerous studies (58, 60, 67, 122). In breast cancer therapy, single treatment with MEK inhibitor led to cytostatic tumor cells maintained by sustained AKT activity while tumor regression was observed under the dual inhibition of MEK and PI3K
(123). Similar anti-tumor effect under dual inhibition has been reported in Pontine Glioma
17 cells (124). Serving as positive regulators of cell proliferation and survival, MAPK and mTOR pathway synergize and compensate each other during tumor formation (125, 126).
Thus, it is reasonable to hypothesize that targeted inhibition of mTORC1 pathway in TSC- deficient cells predispose the tumor cell to unbalanced intracellular homeostasis that presents either as compensatory hyper-activation of pro-survival signals or suppression of apoptotic signals parallel pathways.
18
Chapter II. Inhibition of the mechanistic target of rapamycin induces cell survival via MAPK in Tuberous Sclerosis Complex
19 Abstract
Tuberous sclerosis complex (TSC) is a genetic disorder that cause tumors to form in many organs. These lesions may lead to epilepsy, autism, developmental delay, renal, and pulmonary failure. Loss of function mutations in TSC1 and TSC2 genes by aberrant activation of the mechanistic target of rapamycin (mTORC1) signaling pathway are the known causes of TSC. Therefore, targeting mTORC1 becomes a most available therapeutic strategy for TSC. Although mTORC1 inhibitor rapamycin and Rapalogs have demonstrated exciting results in the recent clinical trials, however, tumors rebound and upon the discontinuation of the mTORC1 inhibition. Thus, understanding the underlying molecular mechanisms responsible for rapamycin-induced cell survival becomes an urgent need. Identification of additional molecular targets and development more effective remission-inducing therapeutic strategies are necessary for TSC patients. We have discovered a Mitogen-activated protein kinase (MAPK)-evoked positive feedback loop that dampens the efficacy of mTORC1 inhibition. Mechanistically, mTORC1 inhibition increased MEK1-dependent activation of MAPK in TSC-deficient cells. Pharmacological inhibition of MAPK abrogated this feedback loop activation. Importantly, the combinatorial inhibition of mTORC1 and MAPK induces the death of TSC2-deficient cells. Our results provide a rationale for dual targeting of mTORC1 and MAPK pathways in TSC and other mTORC1 hyperactive neoplasm.
2.1 Introduction
Tuberous sclerosis complex (TSC) is a genetic disorder that is associated with tumors to form in many organs, primarily in the brain, eyes, heart, kidney, skin and lungs
(3). These lesions cause morbidity and mortality in patients with TSC, as they may lead
20 to epilepsy, autism, developmental delay, renal, and pulmonary failure (127). Loss of function mutations in TSC1 and TSC2 genes are the known causes of TSC. The TSC1 and TSC2 gene products combine with TBC1D7 to form a ternary complex which have
GTPase activating protein (GAP) activity for the GTPase Ras homologue enriched in brain (Rheb), therefore inhibiting mTOR complex 1 (mTORC1) kinase activity (39, 128).
Therefore, targeting mTORC1 becomes a most available therapeutic strategy for TSC.
The mechanistic target of rapamycin (mTOR) is a serine/threonine protein kinase that regulates cell growth, proliferation, cell motility, cell survival, protein synthesis, autophagy, and transcription (129). The mTOR functions as a catalytic subunit in two distinct multiprotein complexes, mTORC1 and mTORC2 (44). mTORC1, a complex including regulatory-associated protein of mTOR (RAPTOR), phosphorylates and controls, at least, two regulators of protein synthesis, the 40S ribosomal protein subunit
S6 kinase (S6K) and the translational repressor 4E-binding protein 1, referred as 4E-BP1. mTORC2, characterized by rapamycin-insensitive companion of mTOR (RICTOR), phosphorylates several AGC protein kinases, including AKT at Ser473. Deregulation of mTORC1 has been observed with various human diseases (130). Thus, this renders mTORC1 as an attractive drug target for cancer therapy. Although mTORC1 inhibitors showed very convincing results in some TSC clinical studies, tumors or lung function returned to their original states when drugs were discontinued, addressing the cytostatic instead of cytotoxic effects of mTORC1 inhibition (131-133). Thus, there is an urgent need to identify additional molecular targets and develop novel combinatorial therapies with mTORC1 inhibitors that could render tumor cell death.
21 To explore the possibility of selectively killing tumor cells with high mTORC1 activity, we performed RNAseq analysis and identified signaling pathways that were activated in response to rapamycin treatment, including focal adhesion, adherent junction,
Jak-Stat, and MAPK signaling pathways. Recently, the FAK inhibitor and JAK-STAT inhibitor have shown benefits in mTORC1 inhibitor-resistant pancreatic cancer and breast cancer, respectively (134, 135). MAPK inhibitors have been studied with a synergistic effect with mTOR inhibitors in several cancers (123, 136). However, the mechanism of
MAPK inhibitor-attenuated resistance to mTORC1 inhibition in cancers and especially in
TSC have not been extensively explored.
Here, we recapitulated mTOR inhibitor associated cytostasis in TSC2-deficient models and showed compensatory activation of MAPK signaling pathway under mTORC1 inhibition. Meanwhile, we tested the impact of combinational treatment in
TSC2-deficient models. Taken together, our study reveals a novel approach of combined suppression of pro-survival signaling pathways that informs future preclinical studies and potential clinical application of remission-inducing therapies for TSC and other mTOR1 hyperactive neoplasms.
2.2 Materials and methods
Gene set enrichment analysis. Re-analysis of publicly available expression array data
(GEO accession number GSE16944 (137), GSE21755 (138), GSE5332 (139),
GSE27982 (140), GSE28021 (140), GSE67529, GSE28992 (141), GSE18571 (142),
GSE7344 (143), GSE37129 (144) and GSE17662 (145)) was performed using the online tool Gene Pattern (Broad Institute).
22 Cell culture and reagents. Cell culture media and supplements were from GIBCO
(Frederick, MD). Tsc2-/-p53-/- and Tsc2+/+p53-/- mouse embryonic fibroblasts (MEFs) were developed previously (62). Mouse expression arrays of Tsc2-/-p53-/- and Tsc2+/+p53-/-
MEFs were preformed (138, 140). An immortalized TSC2-deficient human cell line derived from angiomyolipoma of a LAM patient (69), and its corresponding TSC2-rescued control cell line has been described previously (137). In brief, patient-derived cells were transfected with pcDNA3.1zeo-hTSC2 or its corresponding empty vector control pcDNA3.1zeo. Stable clones expressing TSC2 were selected using Zeocin for two weeks as described previously (146). Eker rat uterine leiomyoma-derived Tsc2-deficient cells
(ELT3) were developed by Howe et al. (15, 72). ELT3 cells were transduced with a retroviral plasmid pMSCVneo-hTSC2 or its corresponding empty vector pMSCVneo, and then selected with neomycin for two weeks. Stable clones were characterized for TSC2 expression (147). Cells were cultured in DMEM supplemented with 10% fetal bovine serum (FBS), and 1% penicillin-streptomycin-amphotericin B (PSA). Experiments were performed in triplicate for biochemical analyses. Cells were seeded at a density of 2 x105 cells/ml in 6-well plates in regular growth media for 24 hr. Six or 24 hr later, cell lysates were prepared using RIPA buffer supplemented with protease inhibitor cocktail (Sigma) and phosphatase inhibitor cocktail (Sigma). Protein concentration was determined using
Bradford assay (Bio-Rad Laboratories Inc. Hercules, CA).
Cell viability assay. Cells were seeded at a density of 5 x104/ml in a 96-well plate for 24 hr and then treated with inhibitors or vehicle control for 24 hr. Cell numbers were quantified using CyQuant (Invitrogen, Carlsbad, CA) or crystal violet staining assay.
Values are expressed as mean ± SEM; n = 8/group.
23 Animal studies. The University of Cincinnati Institutional Animal Care and Use
Committee approved all procedures described according to standards as outlined in The
Guide for the Care and Use of Laboratory Animals. For xenograft tumor study, 2×106
ERL4-luciferase-tagged (TSC2-null) cells were inoculated bilaterally into the posterior back region of female intact CB17-SCID mice (Taconic) as previously described (78, 79).
For the current study, 9-10-week-old CB-17 SCID mice were treated with vehicle control or 2mg/kg rapamycin (dissolve in 0.25% Tween 80, 0.25% polyethylene glycol 400, i.p.) every day for three weeks. The tumors were harvested three weeks post cell inoculation.
Tumor growth were monitored weekly using a non-invasive imaging by IVIS (Perkin
Elmer). All efforts were made to reduce suffering of the animals and minimize the number of animals used in the study.
Bioluminescent reporter imaging. Ten minutes before imaging, animals were injected with luciferin (Xenogen) (120 mg/kg, i.p.). Bioluminescent signals were recorded using the Xenogen IVIS System. The total photon flux of tumors was analyzed (78).
Immunohistochemistry. Immunohistochemistry (IHC) was performed on paraffin- embedded 10 μm-sections. Slides were deparaffinized, and antigen retrieval was performed using Dako Target Retrieval Solution pH 6 (Dako, Carpinteria, CA). Sections were stained by the immunoperoxidase technique using DAB substrate (Dako EnVision
System HRP) and counterstaining with hematoxylin. After staining, slides were viewed on a Nikon Eclipse E400 microscope, and images captured using Spot Insight digital camera with Spot software (Diagnostic Instruments, Sterling Heights, MI).
Western blotting. Protein samples were analyzed by SDS-PAGE using 4-12% NuPAGE
Gel (Invitrogen, Carlsbad, CA), and transferred to a nitrocellulose membrane.
24 Immunoblotting was performed by standard methods using HRP-conjugated secondary antibodies, and chemiluminescence using Supersignal West Pico Chemiluminescent substrate (Thermo Scientific) and exposure using Syngene G:Box. All antibodies were purchased from Cell Signaling (Danvers, MA).
Enzyme-linked immunosorbent assay. Conditioned medium from cell culture were collected on ice and centrifuged to remove any debris. IL-6 protein secretion were measured by enzyme-linked immunosorbent assay (Peprotech #900-TM16).
Measurements were normalized to respective protein concentration.
Real time quantitative PCR. mRNA was extracted according to protocol by RNeasy Mini kit (Qiagen). mRNA concentration was measured immediately by Nano drop (Bio-Rad). 1
μg-2 μg mRNA were used for cDNA synthesis using high capacity cDNA reverse transcription kit (Applied biosystem). Real time PCR were performed using StepOne plus
RT-PCR (University of Cincinnati imaging core). For data analysis, RQ (relative quantity) is manually calculated. -actin were used as internal control. mRNA transcriptome analysis. Xenograft tumors were harvested at different growth stages and prepared for RNA sequencing. The average alignment rate is 87.2% where the average number of reads were 26.2 million and average number of aligned reads were 22.9 million. Sequence reads were aligned to the rat reference genome (rn5) using the TopHat2 aligner (148). Trimmed mean of M-values (TMM) method from edgeR (149) was used for data normalization. All the analyses were based on counts per million (CPM) values and genes were filtered with a cutoff of CPM>1 for all samples in at least one of the groups. The differential expression analyses between groups were performed using
25 negative binomial generalized linear models as implemented in edgeR Bioconductor package (149).
Statistical analyses. All data are shown as the mean ± S.E.M. Measurements at single time points were analyzed by ANOVA and then using a two-tailed t-test (Student’s t test).
Time courses were analyzed by repeated measurements (mixed model) ANOVA and
Bonferroni post-t-tests. All statistical tests were performed using GraphPad Prism 5.0
(GraphPad Software, San Diego, CA, USA) and p< 0.05 indicated statistical significance
2.3 Results
2.3.1 MAPK signaling pathway is activated in response to rapamycin treatment
To explore the possibility of selectively killing tumor cells with high mTORC1 activity, we performed bioinformatic analysis using various tumor cells including TSC1 and TSC2-deficient cells (GEO accession number GSE16944 (137), GSE21755 (138),
GSE5332 (139), GSE27982 (140), GSE28021 (140), GSE67529, GSE28992 (141),
GSE18571 (142), GSE7344 (143), GSE37129 (144) and GSE17662 (145) (Figure 2A).
Gene set enrichment analysis identified top ten up-regulated signaling pathways in resposne to rapamycin treatment that were conserved in all cell types analysed (Figure
2B). MAPK signaling pathway is one of the upregulated pathways induced by rapamycin treatment. Its interaction with mTOR pathway has been widely studied in many cancers
(60, 122, 126). The two parallel and interacting pathways have shown to cross-talk and compensate each other on many levels(58). Other rapamycin-upregulated pathways include axon guidance, notch signaling pathway, small cell lung cancer, adherent
26 junction, B cell receptor signaling pathway, chemokine signaling pathway, ECM receptor interaction, focal adhesion, and JAK/STAT signaling pathway.
Figure 2. Bioinformatics analysis of rapamycin enhanced signaling pathway in TSC deficient cells. (A) Publicly available gene expression datasets were re-analyzed. (B) Gene set enrichment analysis was performed. Top 10 upregulated signaling pathways in response to rapamycin treatment relative to vehicle- treatment were indicated. (Performed by Yu lab member)
2.3.2 Tsc2-deficient xenograft tumors become refractory to rapamycin treatment
To determine the in vivo efficacy of rapamycin on tumor growth, we first generated xenograft tumors of Tsc2-deficient Eker Rat uterine leiomyoma-derived luciferase-tagged
27 cells (15, 72, 78). The tumor growth was recorded by non-invasive imaging. Rapamycin treatment for one-week resulted in drastic decrease of tumor volume dramatically due to one-week rapamycin treatment. However, tumor rebounded rapidly despite rapamycin treatment was continued for one week (Figure 3A). The tumor growth was monitored for five weeks during rapamycin treatment. Interestingly, xenograft tumors persistently progressed from week 2 of the treatment (Figure 3B). By week 5 of rapamycin treatment, tumors became ulcerated and reached the study endpoints. We performed immunohistochemistry using cell proliferative marker proliferating cell nuclear antigen
(PCNA) and found that rapamycin-treated xenograft tumors exhibited high levels of nuclear PCNA staining, comparable to those detected in control tumors (Figure 3C), indicating that rapamycin does not affect cell proliferative status. To determine the effect of rapamycin on tumor cell death, TUNEL staining was performed in the same set xenograft tumor specimens used for PCNA staining. We did not observe positive TUNEL staining in xenograft tumors of control vehicle-treated or rapamycin-treated mice (Figure
3C), indicating that rapamyicn does not induce the death of tumor cells. To assess the effect of rapamycin on mTORC1 inhibition in xenograft tumors, we performed immunoblotting analysis and found that S6 phosphorylation was markedly decreased in response to rapamycin treatment in xenograft tumors relative to vehicle control (Figure
3D). Collectively, our data show that long-term effective inhibition of mTORC1 by rapamycin promotes tumor refractory growth in TSC.
28 D
Figure 3. Xenograft tumor of Tsc2-deficient cells become refractory to rapamycin treatment. (A) Female CB17-scid mice were inoculated with ELT3-luciferase cells subcutaneously. Mice were treated with either vehicle or rapamycin for five weeks (B) Bioluminescent intensity in xenograft tumors was recorded and quantified weekly. The left Y-axis indicated the relative tumor growth versus the baseline quantification before drug treatment. (C) Immunohistochemistry staining of PCNA and TUNEL. (D) Immunoblotting analysis of phospho-S6 (S235/236) of xenograft tumors. (Performed by Yu lab member)
2.3.3 Rapamycin is cytostatic but not cytotoxic in TSC2-defcieint cells in vitro
To determine whether rapamycin affects cell proliferation and death in vitro, we use TSC2-deficient patient-derived cells (69, 91), Tsc2-deficient rat uterine leiomyoma- derived cells (15, 72), and Tsc2-/-p53-/- mouse embryonic fibroblasts (MEF) and their
29 TSC2-exressing counterpart controls (62). Crystal Violet staining showed that rapamycin treatment up to 96 hours (1 nM to 100 nM) significantly decreased cell proliferation relative to vehicle control (Figure 4A). Phase-contrast microscopy showed rapamycin slowed the growth of TSC2-deficient cells without inducing the death of TSC2-deficient patient- derived cells, rat uterine-leiomyoma-derived cells, or Tsc2-/- MEFs (Figure 4B).
Furthermore, Propidium iodide exclusion assay showed that rapamycin treatment (1 nM
– 100 nM) did not induce the death of TSC2-deficient patient-derived 621-101 cells
(Figure 4C). Collectively, our data demonstrate that rapamycin exhibits cytostatic effect but not cytocidal effect on TSC2-deficient cells in vitro.
30 Figure 4. Rapamycin is cytostatic but not cytotoxic in TSC-deficient cells in vitro. (A) Cell proliferation of TSC2-deficient patient-derived cells treated with escalating concentrations of rapamycin. (B) Phase contrast microscopy of TSC2-deficient patient-derived, rat uterine leiomyoma- derived, Tsc2-/- MEFs and Tsc1-/- MEFs treated with rapamycin. (C) Propidium iodide exclusion assay of TSC2-deficient patient-derived cells treated with escalating concentrations of rapamycin as indicated. ** P < 0.01, the Student's t-test. (Performed by Yu lab member)
2.3.4 Rapamycin promotes MAPK activation in mTORC1-hyperactive tumor cells and pre-clinical model
In addition to the bioinformatic analysis described previously (Figure 2). We performed RNA seq on rat leiomyoma derived ELT3 xenograft tumors. Differentially
31 expressed genes between rapamycin sensitive tumors and rapamycin refractory tumors were categorized into pathways according to KEGG (Kyoto encyclopedia of genes and genomes). We found more than 250 significant differentially expressed genes associated with the mitogen-activated protein kinase (MAPK) pathway, which also has the lowest
Benjamini-Hochberg adjusted P-value among the top 15 most significant pathway for this comparison (Figure 5A). MAPK is a well-characterized pro-survival kinase as discussed previously, thus we hypothesize that rapamycin treatment might reversely activates pro- survival MAPK pathways in cytostatic TSC deficient cells as a compensatory mechanism to buffer the anti-proliferative effect of mTORC1 inhibition. Paradoxically, such feedback mechanism is prone to unregulated over-activation, resulting in elevated pro-survival responses overall.
We recapitulated the increased expression of phospho-MAPK level in LAM patient derived 621-101 xenograft tumors receiving rapamycin treatment compared to vehicle treatment (Figure 5B). Consistently with tumor growth pattern, there is significant decrease of PCNA expression in rapamycin sensitive tumor, and the restoration of the it in rapamycin refractory tumors. Interestingly, we observed robust elevation of phosphorylated MAPK in both rapamycin sensitive and refractory tumors, suggesting that
MAPK signaling was induced upon initial rapamycin treatment and persisted at high level in refractory tumors.
Additionally, we performed immunoblotting analysis of MAPK phosphorylation in
TSC2-deficient patient-derived cells, Tsc2-deficient rat uterine-leiomyoma-derived cells,
Tsc2-/- mouse embryonic fibroblast (MEFs), and Tsc1-/- MEFs, and their TSC2- or TSC1- reexpressing counterparts cultured in nutrient-rich medium containing 10% FBS or
32 nutrient-deprived FBS-free medium, repersenting two basal levels of MAPK phosphorylation. We showed that rapamycin selectively promoted MAPK phosphorylation in TSC1- or TSC2-deficient cells but not in TSC1- or TSC2 re-expressing cells (Figure
5C-D). We also observed that rapamycin treatment decreased S6 phosphorylation as expected.
33 AD ). We also observed that rapamycin treatment decreasedB S6 phosphorylation as
C
D
E
F
34 Figure 5. Persistent MAPK pro-survival pathway activation in rapamycin induced cytostatic TSC tumor cells. (A) Bar plot shows top 15 most significant KEGG pathway categories between rapamycin sensitive tumors vs rapamycin resistant tumors. X-axis shows number of genes in the pathway and the color represents Benjamini-Hochberg adjusted P-value. (B) Immunohistochemistry staining of patient derived xenograft tumors from vehicle, rapamycin sensitive and rapamycin refractory groups. Tissues were stained with PCNA, P-MAPK and imaged by Phase Contrast Microscopy (n=3). Representative images are shown. Immunoblots of TSC2-deficient (C) patient-derived cells, (D) rat uterine leiomyoma-derived cell, (E) Tsc2- /- MEFs, and (F) Tsc1-/- MEFs, treated with rapamycin at indicated time points. Immunoblotting analyses of TSC2, phospho-MAPK (T202/Y204), and phospho-S6 (S235/236) were shown. (Performed by Yiyang Lu and Yu lab member)
2.3.5 Dual inhibition of mTORC1 and MAPK induces the death of TSC2-deficient patient-derived cells in vitro
To test whether dual inhibition of mTORC1 and MAPK synergistically affects cell survival, we first examined cell viability using crystal violet staining. Rapamycin single treatment decreased the viability of TSC2-deficient patient-derived cells (Figure 6A), but not TSC2-reexpressing cells (Figure 6B). Importantly, dual treatment of rapamycin and
CI-1040, an MEK1/2 inhibitor, significantly decreased the viability of TSC2-deficient cells, and moderately reduced the viability of TSC2-reexpressing patient-derived cells, relative to rapamycin treatment alone (Figure 5A, B). However, rapamycin plus AZD6244, an
MEK1 inhibitor, did not affect the viability of TSC2-deficient or TSC2-reexpressing patient- derived cells (Figure 6A, B), indicative of a differential effect of MEK1/2 and MEK1 on cell viability in TSC2-deficient patient-derived cells.
To determine the combinatorial effect of rapamycin and MEK1/2 inhibitor on cell survival, we preformed Propidium iodide exclusion assay and found that CI-1040 in combination with rapamycin substantially induced cell death relative to rapamycin treatment in TSC2-deficient and TSC2-reexpressing patient-derived cells (Figure 6C, D).
AZD6244 in combination with rapamycin moderately induced the death of TSC2-deficient and TSC2reexpresing patient-derived cells (Figure 6C, D), further indicating the
35 differentially effect of MEK1/2 and MEK1 on the survival of TSC2-deficient patient-derived cells.
Figure 6. Dual suppression of mTORC1 and MAPK induces death of TSC2-deficient cells in vitro. TSC2-deficient or TSC2 re-expressing patient-derived cells were treated with vehicle control, rapamycin, or rapamycin combined with AZD6244 or CI-1040. (A-B) Cell viability was exmained using crystal violet staining assay (n=8). (C-D) Cell death was quantified using Propidum iodine excursion assay (n=8). * P < 0.05; ** P < 0.01, the Student's t-test. (Performed by Yu lab member)
2.3.6. Development of prognostic biomarker for predicting and monitoring rapamycin resistant and rebound in patient
Over the past decades, tremendous efforts and progresses have been made in the field of TSC, which included the revolutionary application of rapamycin for targeted
36 therapy. However, the lack of non-invasive assay for monitoring disease progression and drug responses poses major concern and frustration in TSC patient management. In a randomized, double blinded trial with 89 LAM subjects of moderate lung impairment, the author reported the potential of VEGF-D (Vascular endothelial growth factor D) as serum marker for predicting disease severity and treatment responses, which were shown to be positively correlated with the treatment effect of rapamycin in some patient. However, no conclusion was drawn (97). To continue this mission, we want to determine whether the observed activation of MAPK upon Rapamycin treatment promotes the secretion of any soluble factors that are known to induce cell survival. We collected conditioned medium from LAM patient derived 621-101 cells in the presence and absence of 24h rapamycin treatment and analyzed cytokine profile. Considerable changes in several cytokines were found, the most consistent being upregulation of IL-6. Cytokines, including IL-6 are signaling proteins that regulate a wide range of biological functions including cell proliferation and survival (150, 151). ELISA further confirmed robust increase of IL-6 in conditioned medium from TSC2-null cells compare to TSC2 overexpressed cell (Figure
7B). Although IL-6 protein expression and transcript level in TSC2-deficient 621-101 cells were increased under rapamycin treatment, they were markedly attenuated with the addition of MEK1 inhibitor AZD6244 (Figure 7A, B). Rapamycin and AZD6244 dual treatment depleted IL-6 receptor expression on 621-101 cells (Figure 7C). These results are consistent with the critical role of MAPK pathway in mediating rapamycin-induced compensatory pro-survival of TSC2-null cell, and it rises the potential of using it as a biomarker for predicting rapamycin responses in TSC patient.
37
A B
✱
✱✱ ✱ ✱✱✱ ) l ✱✱✱ ✱ ✱✱✱ 1500
2.0 m
/
g
)
p
n y
(
t
o
n
i
i
t m
t 1.5 o
i
n
u
p t
i 1000
i
a
r
e
d u
r
c
e
c
q
s
1.0 e n
m
e
s
a
v
d
r
i t
t
6 e
500
-
a
l
n
6 L
-
I e
0.5 o
i
L
t
I
R
i
( d
n
0.0 o 0 c 3 1 in 4 4 03 01 in 44 44 0 0 c 4 4 1 1 c 2 2 -1 -1 y 2 2 TSC2 -+ - - y - 6 - 6 - 1 1 m 6 6 1 1 m 2 + 2 - a - D - D - 2 2 a D D 6 6 p Z Z 6 6 p Z Z a A A a A A r + + r + + + 1 n - - 1+ 1 - in 1 0 i Rapamycin 0 + 0 c + 0 1 yc 1 -1 y - - -1 - - - 1 m 1 +1 m + 1 2 a 2 2 a 2 6 p 6 6 p 6 a ra r + AZD6244 - - - + + + 1 01 - - - 0 + + 1 -1 - 1 1 2 62 6
C 621-103 621-101 (TSC+) (TSC-)
Rapamycin - - + - + AZD6244 - - - + +
TSC2
P-S6 (S235/236)
IILL-66RRaα P-MAPK (Thr202/Tyr204)
b-Actin
Figure 7. IL-6 as a potential prognostic biomarker for rapamycin insensitivity in TSC treatment. TSC2-deficient 621-101 or TSC2 re-expressing 621-103 cells were treated with vehicle control, rapamycin (20nM), AZD6244 (0.25M), or rapamycin combined with AZD6244 for 24 hours. Conditioned media was collected, and RNA and protein were isolated. (A) The transcript levels of IL-6 were assessed by real-time RT-PCR (n=3). (B) IL-6 secretion into conditioned media were measured by ELISA and normalized viable cell number (n=3). (C) Protein levels of IL-6 receptor were determined by immunoblot (n=2). *P< 0.05; **P<0.01 *** P< 0.001 ANOVA and Tukey’s multiple comparison test.
2.4 Discussion
The mTORC1 is a serine/threonine protein kinase and plays crucial roles in transcriptional regulation, initiation of protein synthesis, ribosome biogenesis, metabolism, and apoptosis. The deregulation of mTORC1 signaling pathway is frequently
38 observed in cancers and other diseases due to aberrant expression of numerous oncogenes and tumor suppressors (129, 152). mTORC1 signaling pathway has been the key targets for cancer treatment (153-155). Although mTORC1 inhibitors have activity in some cancer types, only small population of patients treated with these agents exhibited substantial clinical benefit (113).
mTOR1 pathway is the main therapeutic target for TSC and LAM patients. mTORC1 inhibitors, sirolimus (rapamycin) and everolimus (RAD001), have been approved by FDA for the treatment of TSC-associated subependymal Giant cell astrocytoma in brain (everolimus) (127, 156), renal angiomyolipoma (everolimus) (157), and pulmonary lymphangioleiomyomatosis (sirolimus) (133). Everolimus has also been approved for the treatment of TSC-associated SEGA and renal angiomyolipoma (158).
Rapamycin (sirolimus) acts by forming complex with the intracellular binding protein
FK506-binding protein (FKBP121), such complex in turn binds to the FKBP12-rapamycin binding (FRB) domain of the mTORC1 molecule to inhibit mTORC1 activity (57, 159). mTORC2 function is intact under acute inhibition, however, it has been noted that long- term rapamycin treatment decreases mTORC2 signaling in primary human dermal microvascular endothelial cells (160) and several cell lines (161). Everolimus, known as
RAD001, is a derivative of sirolimus that acts via similar mechanism (162). It shares the central macrolide chemical structure with sirolimus, which allows for interaction with
FKBP12 (163, 164). The tissue selectivity of everolimus has also been noted, preferably accumulated in brain mitochondria relative to sirolimus (164).
Currently, there is no single study that directly compares the therapeutic effect of sirolimus and everolimus in TSC management (159, 164, 165). Clinical decisions are
39 based on clinical trial experiences in the setting of certain TSC manifestations. Sirolimus is generally used to manage TSC-LAM (133), while Everolimus is favored over sirolimus in treating SEGA (99, 164). Although our current studies focus on the impact of rapamycin on pro-survival of TSC mutant cells, it will be interesting to examine the effect of everolimus on the survival of TSC mutant cells.
Recently, the therapeutic benefit of cannabidiol has been proposed in TSC associated epilepsy (166). Cannabidiol is a marijuana plant extract that has been studied as an anticonvulsant medicine for treatment-resistant epilepsy with acceptable tolerance
(167, 168). Hess and colleague observed decreased weekly seizure frequency in TSC patients with refractory epilepsy under cannabidiol treatment. In addition to the fact that cannabidiol is yet to be FDA approved, there is no conclusive evidence supporting the effect of cannabidiol exceeding traditional anti-seizure therapy such as the benzodiazepine, GABA analog vigabatrin and ketogenic diet in the management of TSC associated epilepsy (169-172). Moreover, the specificity of cannabidiol to target the unique mechanism of TSC pathogenesis has not been elucidated.
Preclinical studies including ours have demonstrated the effectiveness of sirolimus, an mTORC1 inhibitor, in multiple animal models of TSC (78, 94, 173-176). The effect of mTOR inhibitors on TSC tumors in these experiments has been consistently cytostatic rather than cytotoxic, and is variable in efficacy; tumors typically regrow upon the cessation of treatment (88, 177). Therefore, these preclinical models have become powerful tools in the assessment of potential therapies for TSC. However, the molecular mechanism of the sirolimus-induced cytostatic effect on TSC tumors is not totally elucidated. Our recent study reported that xenograft tumors of Tsc2-deficient rat uterine
40 leiomyoma-derived ELT3 cells became resistant to rapamycin treatment (104). In this study, we observed that xenograft tumors of ELT3 cells potently responded to rapamycin within one week of treatment, however, tumors became refractory from week 2 of rapamycin treatment. This rapamycin resistant growth is consistent with the study by
Valianou et al. (104). In our xenograft tumor study, we used bioluminescent imaging approach to quantify the tumor growth in response to rapamycin treatment, enabling quantification of viable tumor cells in vivo.
Treatment with sirolimus alone has a suppressive rather than remission-inducing effect in majority of tumor models with dysregulated mTORC1 (178, 179). mTORC1 inhibition leads to upregulation of pro-survival mediators including autophagy and paradoxically increases the growth of Tsc2-null cells (176, 180-182). Specifically, inhibition of mTORC1 leads to MAPK pathway activation through a PI3K-dependent feedback loop in human cancer (126). Using bioinformatic approach and immunoblotting analyses, we identified activation of MPAK signaling pathway among other pro-survival pathways in a panel of TSC-deficient cells, and rapid and sustained activation of MAPK in TSC-deficient cells, in agreement with other findings in prostate cancer cells (126).
High-throughput chemical screens in mTORC1-hyperactive patient renal angiomyolipoma-derived and Tsc2-/- MEFs cells identified compounds that selectively induce cell death through oxidative stress-dependent mechanisms within 72 hours of drug treatment (183, 184). Thus, there is an unmet need for identifying agents that act with chronic sirolimus treatment to kill mTORC1-hyperactive cells. Our identification of rapamycin-induced MAPK activation prompted us to perform studies of dual inhibition of
41 MAPK and mTORC1 in TSC-deficient cells. We found that MAPK inhibition attenuated rapamycin-induced cytostasis and promoted the death of TSC-deficient cells in vitro.
A potential mechanism by which active-site mTOR or dual inhibitors of PI3K/mTOR promotes MEK1/2-MAPK signaling pathway activation is via enhanced EGFR activity. A recent RNAseq analysis by Valianou et al. identified rapamycin-induced upregulation of
EGFR signaling pathway in rapamycin-resistant ELT3 cells (104). The EGFR tyrosine kinase activity and affinity for its ligands are negatively regulated by protein kinase C
(PKCα) via phosphorylation at Thr654 (185). Studies indicate that mTORC2 mediates
PKCα phosphorylation (186, 187). Interestingly, the mTORC2-dependent phosphorylation of PKCα plays an important role in its maturation, stability, and signaling
(186, 187). It is plausible, therefore, that suppression of mTORC2-mediated post- translational processing of PKCα interferes with negative feedback of PKCα on EGFR, thereby leading to hyperactivation of EGFR and activation of MAPK signaling in response to EGFR agonists or GPCR transactivation (188). Future studies of the impact of EGFR- mediated MAPK activation on the survival of mTROC1 hyperactive cells will provide novel mechanistic targets for therapeutic application for TSC.
Lastly, the urge to monitor drug response and predict disease outcome has motivated scientist to develop biomarkers. The vascular endothelial growth factor D
(VEGF-D) has been reported to correlate positively with rapamycin treatment, which carries some significance in predicting resistance (97). Here, we showed significantly elevated IL-6 protein and transcripts level in LAM patient derived TSC2-deficient cells compare to TSC2 re-expressing counterpart. Additionally, IL-6 transcript level is subjected to elevation under rapamycin treatment, suggesting alternative pro-survival
42 signaling that is not subjected to mTOR inhibition. IL-6 is a widely studied pro- inflammatory cytokine produced by various cells (189). Its role in cancer progression and multidrug resistance has also been indicated in various studies (150, 151, 190). Upon binding to surface receptors, IL-6 receptor dimerizes and activates JAKs, which is capable of phosphorylating themselves and the receptor. The phosphorylated receptor and JAKs serve as docking sites for Stat3, MAP kinase and PI3K/Akt to activate downstream molecule by phosphorylation(191). Consistently, we showed significant decrease in IL-6 protein and transcript level, as well as receptor level upon mTOR and MAPK dual inhibition compare to mTOR single inhibition. Since IL-6 is readily detectable in plasma, it carries the potential of becoming a biomarker, with further studies required to ensure adequate specific and sensitivity.
In the past decade, remarkable progress has been made in demonstrating the efficacy of sirolimus and everolimus in management of TSC and LAM patients.
Rapamycin and Rapalogs that target mTOR activity offer an additional value which would help in the treatment of TSC and LAM. However, the effect of sirolimus and everolimus on reducing tumor size or improving symptoms has been consistently cytostatic rather than cytotoxic; tumors typically re-grow and symptoms resume upon the cessation of treatment. In this study, we have revealed that mTORC1 inhibition using rapamycin results in a compensatory activation of MAPK in TSC1- and TSC2-deficient cells. This enhanced MAPK signaling pathway was associated with enhanced survival of TSC- deficient cells in vitro. Dual inhibition of mTORC1 and MAPK triggers the death of TSC2- deficient cells. Taken together, our study reveals a novel approach of dual targeting of
43 mTORC1 and MAPK pathways to induce tumor remission in TSC and other mTORC1 hyperactive neoplasms.
This study has been published in Orphan Journal of Rare Disease (192).
44
Chapter III. Estrogen activates pyruvate kinase M2 and increases the growth of TSC2-deficient cells
45 Abstract
Lymphangioleiomyomatosis (LAM) is a devastating lung disease caused by inactivating gene mutations in either TSC1 or TSC2 that result in hyperactivation of the mechanistic target of rapamycin complex 1 (mTORC1). As LAM occurs predominantly in women during their reproductive age and is exacerbated by pregnancy, the female hormonal environment, and in particular estrogen, is implicated in LAM pathogenesis and progression. However, detailed underlying molecular mechanisms are not well understood. In this study, utilizing human pulmonary LAM specimens and cell culture models of TSC2-deficient LAM patient-derived and rat uterine leiomyoma-derived cells, we tested the hypothesis that estrogen promotes the growth of mTORC1-hyperactive cells through pyruvate kinase M2 (PKM2). Estrogen increased the phosphorylation of
PKM2 at Ser37 and induced the nuclear translocation of phospho-PKM2. The estrogen receptor antagonist Faslodex reversed these effects. Restoration of TSC2 inhibited the phosphorylation of PKM2 in an mTORC1 inhibitor-insensitive manner. Finally, accumulation of phosphorylated PKM2 was evident in pulmonary nodule from LAM patients. Together, our data suggest that female predominance of LAM might be at least in part attributed to estrogen stimulation of PKM2-mediated cellular metabolic alterations.
Targeting metabolic regulators of PKM2 might have therapeutic benefits for women with
LAM and other female-specific neoplasms.
3.1 Introduction
Lymphangioleiomyomatosis (LAM) is a disease that develops almost exclusively in females of reproductive age and predominantly involves the lungs. Although the genetic basis is known, specifically mutations in either tuberous sclerosis 1 (TSC1) or the
46 tuberous sclerosis 2 (TSC2) genes, the pathophysiology is poorly understood. It is hypothesized that smooth-muscle-like cells of uncertain origin, but likely the uterus, and with inactivating mutations in TSC1 or TSC2 genes disseminate via the lymphatics primarily to the lungs followed by proliferation and progressive cystic destruction of lung parenchyma. Cells within the cystic LAM lesions produce matrix metalloproteases and growth factors, such as vascular endothelial growth factor D (VEGF-D), which contribute to lung remodeling (193). Although the exact mechanisms for the strong female predominance remain elusive, sex hormone dependence is clear as symptoms are exacerbated during pregnancy (194-196) and sex steroid hormone receptors are present in LAM nodules (32, 197-199).
A possible insight into the mechanism of action of estrogen in LAM derives from studies on energy, lipid and substrate metabolism regulated by the mechanistic target of rapamycin complex 1 (mTORC1). Cells with mutations in the TSC genes have increased expression of genes encoding the enzymes for lipid and sterol biosynthesis, glycolysis, and the pentose phosphate pathway (138), all pathways critical for cell growth.
Hyperactive mTORC1 stimulates pyruvate kinase muscle isozyme M2 (PKM2) (200), the rate limiting glycolytic enzyme, which catalyzes the final step in glycolysis. PKM2 plays a central role in the metabolic reprogramming of cancer cells, cell cycle progression, and gene transcription (201). PKM2-stimulated glycolysis contributes to the development of tumors caused by hyperactive mTORC1 (200), and, in part, this is mediated through induction of HIF-1α expression (200). The phosphorylation of PKM2 at Ser37, by extracellular signal-regulated kinase (ERK), promotes PKM2 translocation to the nucleus, where it affects regulation of genes involved in glycolysis (202, 203). Our previous studies
47 showed that estrogen treatment is associated with further elevation of pentose phosphate pathway intermediates and the proliferation of TSC2-deficient cells (204). Specifically, estrogen treatment increased glucose uptake and the levels of pentose phosphate pathway signatures including glucose-6-phosphate, fructose-6-phosphate, ribose, ribose-
5-phosphate and ribulose-5-phosphate, in TSC2-deficient ELT3 and 621-101 cells (204).
Moreover, estrogen treatment significantly induced Erk1/2 phosphorylation in Tsc2- deficient ELT3 cells (12, 204-207).
In this study, we addressed further the mechanism of estrogen action on PKM2.
We report that estrogen increases the phosphorylation of PKM2 at Ser37 and induces the nuclear translocation of phospho-PKM2. Treatment with the estrogen receptor antagonist
Faslodex blocks estrogen-induced nuclear translocation of phospho-PKM2. Re- expression of TSC2 decreases the protein levels and phosphorylation of PKM2 in an mTORC1 inhibitor-insensitive manner. Accumulation of phosphorylated PKM2 was evident in pulmonary nodule cells, from TSC/LAM patients. Collectively, our study reveals that PKM2-mediated glucose metabolic reprogramming may contribute to estrogen- dependent LAM cell growth and the pathogenesis of LAM. Thus, targeting metabolic regulators of PKM2 might have therapeutic benefits for women with LAM and other female-specific mTORC1-hyperactive neoplasms.
3.2 Materials and methods
Cell culture and reagents. MCF7 and A589 cells were obtained from ATCC and cultured in DMEM supplemented with 10%FBS. ELT3 cells were provided by Dr. C. Walker (15,
72). ELT3-V3 (Tsc2-), ELT3-T3 (TSC2+) (147), 621-101 and 621-103 cells were provided by Dr. E.P. Henske (208). Cells were cultured in IIA complete medium supplemented with
48 sodium selenite 5 × 10−8 mol/L, insulin 25 μg/mL, hydrocortisone 2 × 10−7 mol/L, transferrin 10 μg/mL, T3 10−9 mol/L, vasopressin 10 μU/mL, cholesterol 10−8 mol/L, ferrous sulfate 1.6 × 10−6 mol/L, EGF 10 ng/mL, and 10% FBS. Advanced DMEM/F-12
(Thermo Fisher Scientific) was used as glucose-free basal medium. 17-β-estradiol (E2)
(10 nM, Sigma-Aldrich), Faslodex (Fulvestrant, 10 μM, Sigma-Aldrich), PD98059 (50 µM,
Sigma-Aldrich), and Rapamycin (10 nM, Enzo Life Sciences, Inc) were used.
Immunofluorescence and immunohistochemistry analysis. Cells seeded in chambers of Millicell EZ slides (Millipore) were fixed and incubated with primary antibody against phospho-PKM2 [Ser37] using a 1:100 dilution, Alexa Fluor dye-conjugated secondary antibodies and SlowFade® Gold reagent for mounting were from Invitrogen
Life Science Technologies. Immunohistochemistry was performed on paraffin-embedded
10 μm sections using antibodies against Phospho-PKM2 [Ser37], phospho-S6
[Ser235/236], and -smooth muscle actin. Images were captured using Olympus
CellSens imaging software.
Lentiviral infection. shRNA lentiviral constructs were obtained from Lenti-shRNA Library
Core at the Cincinnati Children’s Hospital Medical Center. Envelope pMD2.G and packaging psPAX2 were co-transfected into HEK293T cells using Lipofectamine 2000 transfection reagent (Invitrogen). Lentiviral particles were collected 24 hours post transfection to infect 621-101 cells in the presence of 8 mg/mL polybrene. Stable clones were selected with 10 g/mL puromycin.
Nucleofection. The plasmids of pcDNA3.1(+)-TSC2 or empty vector pcDNA3.1(+) were transfected in 621-101 cells using 4D-NucleofectorTM X Kit L (#V4XC-2024, Lonza).
49 1x106 cells were suspended in 100 µl nucleofection solution containing plasmids, and then subjected to electrical pulse in Lonza 4D–NucleofectorTM Core/X Unit (Lonza).
Measurement of cell growth. Cells were seeded in 96-well plates, treated with E2 (10 nM) or vehicle for the indicated times and in the indicated medium, followed by crystal violet staining and measurement in a microplate reader (BioTek).
Quantitative real-time PCR. Total RNA was extracted using the RNeasy mini kit
(Qiagen). cDNA was synthesized from 2 g of total RNA using a high-capacity cDNA reverse transcription kit (Applied Biosystems) with random primers (80). Gene expression was quantified using SYBR green real-time PCR Master Mixes kit (Life Technologies) in the Applied Biosystems Real-Time PCR System and normalized to -actin or tubulin. The human primers used were:
ESR1 (ER): Forward: 5’-GCTTACTGACCAACCTGGCAGA-3’.
Reverse: 5’-GGATCTCTAGCCAGGCACATTC-3’.
ESR2 (ER): Forward: 5’-AGCTGGGCCAAGAAGATTCC-3’.
Reverse: 5’-TGCCAGGAGCATGTCAAAGA-3’.
-actin: Forward: 5’-CACCATTGGCAATGAGCGGTTC-3’.
Reverse: 5’-AGGTCTTTGCGGATGTCCACGT-3’.
The rat primers used were:
Esr1 (ER): Forward: 5’-AGGCTGCAAGGCTTTCTT-3’.
Reverse: 5’-CAACTCTTCCTCCGGTTCTTATC-3’.
Esr2 (ER): Forward: 5’-ATGTACCCCTTGGCTTCTGC-3’.
Reverse: 5’-TCTGTAGTCTGTCCGCCTCA-3’.
Tubulin: Forward: 5’-GAGGAGATGACTCCTTCAACACC-3’.
50 Reverse: 5’-TGATGAGCTGCTCAGGGTGGAA-3’.
Subcellular fractionation and western blotting. Cytoplasmic and nuclear fractions were isolated using the Subcellular Protein Fractionation Kit (Thermo Scientific). Anti-
Phospho-PKM2 [Ser37] was from Signalway Antibody. Anti-β-Actin (AC-15) was from
Sigma. Antibodies to PKM2, Tuberin (TSC2), Raptor, Rictor, Phospho-ERK1/2, Phospho-
Akt [Ser473], phospho-S6 [Ser235/236], and phospho-S6K [Thr389] were from Cell
Signaling. Anti-SMA was from Abcam Antibodies to NUPL1 and S6 were from Santa Cruz
Biotechnology.
Human samples. Pulmonary LAM tissues from TSC/LAM patients were obtained from the National Disease Research Interchange (NDRI).
Statistical analyses. Statistical analyses were performed using two-sided Student’s t- test when comparing two groups. Results are presented as means ± SEM.
3.3 Results
3.3.1 Estrogen promotes the growth of TSC2-deficient cells in a glucose- dependent manner
To elucidate pro-survival mechanisms regulated by estrogen in LAM cells (12, 72,
209), we used the well-established, estrogen-responsive Tsc2-deficient rat ELT3 cell line, which was engineered to express an empty vector (TSC2-) or TSC2 add-back (TSC2+)
(147). Consistent with our findings (12) and those of others (72, 205), estrogen modestly promoted the growth of ELT3 (TSC2-) cells by 12%, 25%, and to 35% in a time-dependent manner from day 3 to day 5, respectively (p < 0.01; Figure 8A). However, estrogen treatment had no measurable effect on the growth of ELT3 cells expressing TSC2
(TSC2+) (Figure 8B). We also tested estrogen responsiveness in LAM patient-derived
51 TSC2-deficient 621-101 cells that exhibit constitutively active mTORC1, and in TSC2- expressing 621-103 cells. Consistently, crystal violet assay showed that estrogen significantly increased cell number by approximately 33% (p < 0.01) but only in glucose- rich medium (Figure 8C). In contrast, and consistent with the results shown in Fig. 1B, estrogen treatment did not affect the growth of TSC2-addback 621–103 (TSC2+) cells regardless of glucose concentrations (Figure 8D). These data indicate that estrogen selectively promotes the growth of TSC2- cells in a glucose-dependent manner.
To examine the effect of PKM2 knockdown on glucose- and estrogen-dependent growth of TSC2-null cells, we depleted PKM2 using two independent shRNAs in 621-101 cells. Immunoblot analysis showed that the protein levels of PKM2 were reduced by
95.1% (PKM2 shRNA#1) and 80.4% (PKM2-shRNA#2), relative to pLKO.1 vector control, respectively (Figure 8E). Importantly, E2 treatment for 4 days did not stimulate the growth of 621-101-PKM2-shRNA#1 (Figure 8F) or 621-101-PKM2-shRNA#2, relative to vehicle control, respectively (Figure 8H). Moreover, E2 treatment did not affect the growth of 621-
101 cells depleted with PKM2 (shRNA#1 and #2) in glucose-rich (Glc 17.5 mM) and glucose-free conditions (Figure 8G, 1I). Together, our data strongly support a specific role for PKM2 in glucose- and estrogen-dependent growth of TSC2-null cells.
52
Figure 8. Estrogen promotes the growth of TSC2-deficient cells via PKM2 in a glucose-dependent manner. Cell growth was compared in (A) TSC2-deficient (Tsc2-) ELT3 cells and (B) TSC2-add back (Tsc2+) ELT3 cells, at the indicated time points over a range of 5 days after E2 treatment. Data were normalized by non- treatment control (n=8). Cell growth was measured by crystal violet assay in TSC2-deficient 621-101 cells (C) and TSC2-addback 621-103 cells (D) after 24 h of E2 treatment and culture in glucose-free (Glc -) or glucose-rich (Glc 17.5 mM) medium (n=8). (E) Immunoblot analysis of PKM2 in 621-101 cells infected with lentiviral particles of shRNA-PKM2 (#1 and #2) targeting different regions within the same gene or of empty vector pLKO.1 as control. (F, H) shRNA-PKM2 (#1 and #2) 621-101 cells were treated with E2 (10 nM) or vehicle over a range of 4 days. Cell growth was measured by crystal violet assay; data were normalized to vehicle control at day 0 (n=8). (G, I) shRNA-PKM2 (#1 and #2) 621-101 cells were cultured in glucose-rich (Glc 17.5 mM) or glucose-deprived (Glc 0 mM), and then treated with 10 nM E2 or vehicle for 24 hours (n=8). Cell growth was measured using crystal violet staining; data were normalized to the vehicle treatment and glucose-rich group. Data are represented as mean ± SEM, **p<0.01, ns: not significant, two-sided Student’s t-test. (Performed by Yu lab member)
53 3.3.2 Estrogen regulates PKM2 phosphorylation in TSC2-deficient cells
Although PKM2-stimulated glycolysis contributes to the development of tumors caused by hyperactive mTORC1 (200), the impact of PKM2 on HIF-1α transcription, and ultimately cell proliferation, requires phosphorylation of PKM2 at Ser37 by extracellular signal-regulated kinase (ERK1/2). Phosphorylated-PKM2 translocates from the cytoplasm to the nucleus and regulates the expression of genes involved in glycolysis
(202, 203).
We speculated that estrogen induces the phosphorylation of PKM2 at Ser37 through activating the ERK1/2 pathway. Estrogen treatment for 2 hours markedly increased the levels of phospho-PMK2 [Ser37], but had no effect on the protein levels of
PKM2, relative to the vehicle control, in 621-101 cells (Figure 9A). Quantitative densitometry of three biological replicates showed the significant increase of 2.8-fold for phospho-PMK2, whereas no significant difference for PKM2 (Figure 9B). Importantly, E2- induced PKM2 phosphorylation was concomitant with robust phosphorylation of ERK1/2 in 621-101 cells (Figure 9A). Collectively, these results indicate that estrogen induced
PKM2 phosphorylation is unequivocal and, moreover, is associated with ERK1/2 activation in 621-101 cells.
Next, we assessed the effect of TSC2 expression on PKM2 phosphorylation. We found that the basal level of phospho-PKM2 [Ser37] was significantly lower in TSC2- corrected 621-103 cells relative to that in TSC2-null 621-101 cells (Figure 9A, 2B).
Moreover, the level of E2-induced PKM2 phosphorylation was substantially higher in 621-
101 (TSC2-) relative to that in 621-103 (TSC2+) cells. Our data indicate that TSC2
54 negatively regulates PKM2 phosphorylation and suppresses E2-induced PKM2 phosphorylation in LAM-derived cells.
To further investigate the effect of estrogen inhibition on activation of PKM2, we treated 621-101 TSC2-null cells with Faslodex, a pure estrogen receptor antagonist, for
24 hours. Faslodex treatment markedly decreased E2-induced PKM2 phosphorylation at
Ser37, although the protein levels of PKM2 were not significantly affected (Figure 9C).
To examine the effect of glucose and estrogen on PKM2 phosphorylation, we cultured
621-101 cells in glucose-rich or glucose-free conditions for 24 hours, and then treated cells with 10 nM E2 for 2 hours. Under glucose-rich conditions (Glc 17.5 mM), E2 stimulation largely increased the level of phospho-PKM2 [Ser37] relative to vehicle control
(Figure 9C, left panel). Moreover, treatment with faslodex, an estrogen receptor alpha
(ER) antagonist, completely prevented E2-induced PKM2 phosphorylation (Figure 9C, left panel). Furthermore, E2 stimulation did not increase the levels of phospho-PKM2 in
621-101 cells under glucose-free (Glc 0 nM) conditions (Figure 9C, right panel), further supporting the important impact of glucose and estrogen on PKM2 phosphorylation in
TSC2-null LAM patient-derived cells.
55
Figure 9. Estrogen induces PKM2 phosphorylation in LAM patient-derived cells. (A) 621-101 and 621-103 cells in triplicate after E2 (10 nM) treatment for 2 hours. Immunoblot analysis of phospho-PKM2 [Ser37], PKM2 and Phospho-ERK1/2 [Thr202/Tyr204]. (B) Densitometry analysis of phospho-PKM2 [Ser37] and PKM2 normalized to β-actin, respectively (n=3). Results are representative of three experiments, and data are represented as mean ± SEM. **p<0.01, two-sided Student’s t-test. (C) 621-101 cells were treated with vehicle, E2 (10 nM), Faslodex (10 µM), or E2 (10 nM) plus Faslodex (10 µM) for 24 hours in glucose-rich (Glc 17.5 mM) or glucose-free medium (Glc 0 nM), followed by immunoblot analysis of phospho-PKM2 [Ser37] and PKM2. β-actin as a loading control. (Performed by Yu lab member).
3.3.3 Estrogen induces nuclear localization of phosphorylated PKM2
Next, we examined the influence of estrogen on subcellular localization of phospho-PKM2 [Ser37] in TSC2-null 621-101 cells. The phospho-PKM2 [Ser37] was detected clearly as fluorescent puncta in the nucleus after 30 min estrogen treatment,
56 relative to vehicle control (Figure 10A, I-II). Phospho-PKM2 [Ser37] puncta in nuclei were still found after estrogen treatment for 24 hours (Figure 10A, III), indicating its stability in nuclei in response to estrogen. Importantly, the estrogen-induced nuclear localization of phospho-PKM2 [Ser37] was abrogated or reduced upon treatment with the potent and selective inhibitor of the estrogen receptor Faslodex (Figure 10A, IV), or MAPK inhibitor
PD98059 (Figure 10A, V). These results suggest that the phosphorylation of PKM2 at
Ser37 and its nuclear translocation are estrogen-dependent in 621-101 cells.
Next, we treated TSC2-null 621-101 cells with 10 nM E2, E2 plus 10 µM Faslodex,
E2 plus PD98059, or vehicle for 30 minutes or 24 hours, harvested cells, and performed subcellular fractionation. Immunoblot analysis showed that E2 treatment for 30 minutes and 24 hours apparently induced the nuclear localization of phospho-PKM2 [Ser37]
(Figure 10C). Concomitantly, E2 treatment for 30 minutes and 24 hours decreased cytoplasmic localization of phospho-PKM2 [Ser37], consistent with findings of immunofluorescent staining. Importantly, Faslodex or PD98059 treatment markedly reduced E2-induced nuclear localization of phospho-PKM2. Together, our data using two independent methods demonstrate that E2 promotes nuclear translocation of phospho-
PKM2 [Ser37] in part via MAPK pathway in TSC2-null cells.
To examine the effect of TSC2 in subcellular localization of phospho-PKM2
[Ser37], we performed immunofluorescent staining and subcellular fractionation in 621-
103 cells. E2 treatment for 15 minutes and 24 hours moderately increased nuclear localization of phospho-PKM2 [Ser37] (Figure 10B, I-III). Moreover, immunoblot analysis of cellular fractions showed that levels of phospho-PKM2 [Ser37] were 85% lower in
NUPL1-positive nuclear fraction of TSC2-corrected 621-103 cells relative to that of TSC2-
57 null 621-101 cells (Figure 10D). Cytoplasmic levels of phospho-PKM2 were also lower by 36% in TSC2-corrected 621-103 cells relative to that of TSC2-null 621-101 cells. With this additional data regarding TSC2-addback line 621-103, our results strongly suggest that TSC2 negatively regulates E2-induced subcellular localization of phospho-PKM2
[Ser37].
58
Figure 10. Estrogen induces nuclear translocation of phosphor-PKM2 [S37] in a TS2-dependent Estrogen induces nuclear translocation of phospho-PKM2 [S37] in a TSC2-dependent manner. (A) Immunofluorescence staining of phospho-PKM2 [Ser37] in 621-101 cells with the treatment of (I) Vehicle, (II) E2 (10 nM) for 0.5 hours, (III) E2 (10 nM) for 24 hours, and combination of E2 (10 nM) with (IV) Faslodex (10 µM) or (V) PD98059 (50 µM) for 24 hours. (B) Immunofluorescence staining of phospho- PKM2 [Ser37] in TSC2-reexpressing 621-103 (TSC2+) cells treated with (I) Vehicle, (II) E2 (10 nM) for 0.5 hours, and (III) E2 (10 nM) for 24 hours. Nuclei were stained with DAPI. Scale bar represents 20 µm. (C) Immunoblot analysis of phospho-PKM2 [Ser37], NUPL1 and S6 in cytoplasmic and nuclear fractions isolated from 621-101 cells in the same treatment as (A). (D) Immunoblot analysis of phospho-PKM2 [Ser37], TSC2, NUPL1 and S6 in cytoplasmic and nuclear fractions isolated from 621-101 (TSC2-) and 621-103 (TSC2+) cells. (Performed by Yu lab member)
59
3.3.4 TSC2 negatively regulates PKM2 expression in rapamycin-insensitive manner
To determine how PKM2 expression is regulated, we first investigated the effect of TSC2 gene expression on the protein level and phosphorylation of PKM2. We found that TSC2-reexpression markedly decreased PKM2 protein levels by 59% and PKM2 phosphorylation [Ser37] by 85% in 621-101 cells (Figure 11A, B). However, to address a related authentication issue pertaining the potential clonal variation in 621-101 isogenic lines, we transiently transfected 621-101 cells with wild-type TSC2 (pcDNA3.1+TSC2) and empty vector pcDNA3.1+. Immunoblot analysis showed that TSC2 overexpression decreased S6 phosphorylation, (Figure 11C), as expected. Importantly, TSC2 overexpression markedly reduced levels of PKM2 phosphorylation by 64% and PKM2 protein by 76% relative to vector control, respectively (Figure 11C). Together, our data indicate that TSC2 negatively regulates PKM2 phosphorylation.
To further investigate whether the specific regulation of PKM2 in TSC2-deficient cells depends on mTORC1 activity, the mTORC1 inhibitor rapamycin was used to treat
621-101 cells lacking TSC2, at indicated time points, followed by immunoblotting.
Rapamycin treatment did not affect the protein levels or Ser37 phosphorylation of PKM2, whereas phosphorylation of S6 [Ser235/236] was strongly suppressed (Figure 11D, left panel), as expected. To determine whether glucose availability affects the sensitivity of
PKM2 phosphorylation to rapamycin, we cultured 621-101 cells in glucose-free (Glc 0 mM) or E2-free conditions. In addition, cells were treated with 10 nM rapamycin for 24 and
48 hours. Rapamycin treatment potently reduced S6 phosphorylation, as expected.
However, rapamycin did not affect PKM2 phosphorylation (Figure 11D, middle and right
60 panel). Together, our data indicate that PKM2 phosphorylation is insensitive to rapamycin treatment in either glucose-rich or glucose-free conditions.
Figure 11. TSC2 negatively regulates PKM2 phosphorylation in an mTORC1-independent manner. (A) Immunoblot analysis of TSC2, phospho-PKM2 [Ser37], PKM2 and Phospho-S6 [Ser235/236] in 621- 101 (TSC2-) and 621-103 (TSC2+) cells (n=3); β-actin as a loading control. (B) Densitometry analysis of phospho-PKM2 [Ser37] was performed (n=3). Data are represented as mean ± SEM, **p<0.01, two-sided Student’s t-test. (C) 621-101 (TSC2-) cells were transiently electroporated with wild-type TSC2 pcDNA3.1+TSC2 or empty vector pcDNA3.1+, followed by immunoblot analysis of TSC2, phospho-PKM2 [Ser37], PKM2 and Phospho-S6 [Ser235/236] were performed. (D) Immunoblot analysis of TSC2, phospho-PKM2 [Ser37], PKM2 and Phospho-S6 [Ser235/236] in 621-101 cells treated with rapamycin (10 nM) for 0, 24, 48, and 72 hours in the culture medium containing 17.5 mM Glc and 10 nM E2 (left panel), or the Glc deprivation medium (middle panel) and E2 deprivation medium (right panel). (Performed by Yu lab member)
3.3.5 PKM2 activation is independent of mTOR in TSC2-null cells
To determine whether mTORC1 or mTORC2 specifically regulates PKM2 expression, we used two independent shRNAs to deplete Raptor or Rictor, respectively.
As expected, knockdown of Raptor by 58% (#1 shRaptor) and 73% (#2 shRaptor) led to decreased levels of phospho-S6K1 [Thr389], a direct target of mTORC1 (Figure 12A, B).
Knockdown of Rictor by 76% (#1 shRictor) and 83% (#2 shRictor) lowered levels of
61 phospho-Akt [Ser473], a direct target of mTORC2 (Figure 12C, D), demonstrating their knockdown efficiency. However, neither Raptor knockdown nor Rictor knockdown altered the protein levels of phospho-PKM2 [Ser37] or PKM2. Collectively, our data reveal that
TSC2 negatively regulates PKM2 expression in an mTORC1- and mTORC2-independent manner.
Figure 12. Selective interference of mTORC1/RAPTOR or mTORC2/Rictor does not alter PKM2 expression. (A) 621-101 cells were infected with lentiviral particles of shRNA-Raptor (#1 and #2) targeting different regions within the same gene or of empty vector pLKO.1. Immunoblot analysis of Raptor, phospho-PKM2 [Ser37], PKM2 and Phospho-S6K1 [Thr389]; β-actin as a loading control. (B) Densitometry analysis of Raptor, phospho-PKM2 [Ser37] and PKM2 from repeating the whole experiment independently three times (n=3). (C) 621-101 cells were infected with lentiviral particles of shRNA-Rictor (#1 and #2) targeting different regions within the same gene or of empty vector pLKO.1. Immunoblot analysis of Rictor, phospho-PKM2 [Ser37], PKM2 and Phospho-Akt [Ser473]; β-actin as a loading control. (D) Densitometry analysis of Rictor, phospho-PKM2 [Ser37] and PKM2 from repeating the whole experiment independently three times (n=3). Data are represented as mean ± SEM, **p<0.01, two-sided Student’s t-test. (Performed by Yu lab member)
62 3.3.6 Accumulation of phospho-PKM2 is evident in pulmonary LAM nodules from
TSC/LAM patients
To determine the clinical relevance of phospho-PKM2, we assessed the abundance of phospho-PKM2 [Ser37] using immunohistochemical staining in two cases of pulmonary LAM lungs. Phospho-PKM2 [Ser37] accumulation was prominent in pulmonary LAM nodule cells that were positive for smooth muscle actin (SMA) and phospho-S6 [Ser235/236] (Figure 13A). Low levels of phospho-PKM2 were observed in
SMA-positive bronchial smooth muscle cells in normal lung (Figure 13B). In contrast, immunofluorescent confocal microscopy showed that pulmonary LAM lesion cells accumulated both nuclear and cytoplasmic phospho-PKM2 in the two LAM lungs (Figure
13C). These data indicate that phosphorylation of PKM2 is likely associated with specific tumor growth in LAM lesions.
63
Figure 13. Accumulation of phosphor-PKM2 [Ser37] is evident in pulmonary LAM nodules. Immunohistochemical staining of SMA, phospho-S6 [Ser235/236] and phospho-PKM2 [Ser37] in (A) pulmonary LAM lungs from two LAM subjects (LAM-1 and LAM-2). Scale bar represents 100 µm. Immunofluorescent co-staining of phospho-PKM2 [Ser37] and SMA in (B) normal lung tissue, (C) and two cases of pulmonary LAM lungs (LAM-1 and LAM-2). Nuclei were stained with DAPI. Scale bar represents 20 µm. (Performed by Yu lab member)
64 3.3.7 Expression of ER and ER is evident in TSC2-null cells
Studies have shown that LAM patient-derived 621-101 cells and rat uterine leiomyoma-derived ELT3 cells express ER and respond to estrogen stimulation (15, 69,
77, 80). To examine the status of the expression of ER and ER expression in these cell models, we measured their transcript levels using quantitative real-time RT-PCR. The relative transcript level of ER (ESR1) was significantly higher in 621-101 cells (CT =
30.7) relative to lung adenocarcinoma A549 cells (CT = 36.4) (p < 0.001; Figure 14A), although TSC2-reexpression (621-103 cells) did not affect ESR1 expression. However, the transcript level of ESR1 was much lower in 621-101 cells than that in breast cancer
MCF-7 cells, similar to previous findings (80). Importantly, the transcript level of ERβ
(ESR2) was higher in 621-101 cells (CT = 30.8) relative to 621-103, MCF-7 and A549 cells (CT ~ 32) (Figure. 14A). Moreover, the transcript level of ER (Esr2) (CT = 36.6) was much lower than ER (Esr1) (CT = 32.0) in Tsc2-null ELT3-V3 cells, although TSC2- reexpression did not affect the expression of Esr1 or Esr2 in ELT3-T3 cells (Figure 14B).
65 A B
Figure 14. Expression of ERα and ERβ is evident in LAM patient-derived 621-101 and rat leiomyoma- derived ELT3 cells. The relative transcript levels of ERα and ERβ in (A) LAM patient-derived cells 621-101 (TSC2-) and 621- 103 (TSC2+), (B) rat-derived cells ELT3-V3 (TSC2-) and ELT3-T3 (TSC2+), breast cancer MCF-7 cells, and lung adenocarcinoma A549 cells. The actual mean CT values (n=3-4/cell type) of the ERα and ERβ transcript were shown in the tables. ** p < 0.01, *** p < 0.001, Student t test.
3.4 Discussion
LAM is a devastating lung disease affecting young women that is characterized by metastasis of smooth muscle cells to the lungs and emphysema-like destruction of the lung parenchyma (30, 210-212). LAM is associated with TSC2 mutations (86) resulting in activation of the mechanistic target of rapamycin complex 1 (mTORC1) (71), A seminal clinical trial showed that the mTORC1 inhibitor sirolimus stabilizes lung function and improves symptoms in LAM patients while drug exposure continues (213), but long-term benefit and toxicity are unknown, and some patients do not respond. This limitation of
66 sirolimus has engendered multiple efforts to attempt to develop better, or at least complementary, treatment approaches. Despite many advances in our understanding of the importance of mTORC1-dependent and -independent signaling pathways that are central to LAM pathogenesis, the underlying basis of the sexual dimorphism for symptomatic LAM is essentially unknown. In this study, we show evidence that this may at least in part be mediated by estrogen regulation of PKM2. We show that estrogen treatment increases the phosphorylation of PKM2 at Serine 37 and induces the nuclear translocation of phospho-PKM2; treatment with the estrogen receptor antagonist
Faslodex blocks these actions. Moreover, accumulation of phosphorylated PKM2 was increased in pulmonary nodule cells from TSC/LAM patients.
Faslodex disrupts ligand binding, receptor dimerization and nuclear translocation, and degradation of both ER and ER (214, 215). Studies including ours have shown the expression of both ER and ER in LAM cells (69, 90), suggesting the interplay between
ER and ER in LAM progression. Opposing effects of estrogen receptor subtypes ER and ER have been implicated in breast cancer cells (216). ERα plays a pro-proliferative role and ERβ can exert an anti-proliferative action by controlling cell-cycle regulators in most cell types, depending on the differential expression of ER subtypes (217, 218). In our cell-based models, the transcript levels of ER were higher than that of ER in ELT3-
V3 cells, but comparable in 621-101 (Figure 14). Our previous studies have demonstrated that Faslodex inhibits the estrogen-promoted lung metastasis of ELT3 cells in vivo (89), although the specific role of ER or ER was not addressed. In the present study, we observed that Faslodex treatment decreased estrogen-induced phosphorylation of PKM2 and nuclear translocation of phospho-PKM2 (Figure. 10A, IV).
67 We speculate that both ER and ER mediate estrogen actions on PKM2 phosphorylation and proliferation of TSC2-null cells. Because agonists and antagonists to both ER and ERare available, it would be of particular interest to assess the specific impact of ER subtypes on cellular functions, which have not been explored in LAM. We postulate that ER-specific agonist would decrease, and ER-specific antagonists would increase proliferation and PKM2 activation in LAM cells, which could be addressed in future studies.
Alterations in cellular energy metabolism are a hallmark of cancer (219), and metabolic reprogramming is particularly critical for the survival of Tsc2-deficient tumor cells (52, 204, 220, 221). TSC2 deficiency leads to increased transcription of glucose metabolism genes (138) and the cells with mTORC1 activation express high levels of the glycolytic protein PKM2 (200). The glucose dependent survival of TSC2-deficient cells has been reported (220), suggesting that glucose metabolism is essential for the growth of TSC2-deficient cells. However, the mTORC1 inhibitor, rapamycin (or sirolimus) reduces lactate production but does not affect cellular ATP levels in Tsc2-/- MEF cells
(221). It has been reported that TSC2-deficient cells exhibit autophagy-dependent alteration of glucose metabolism rewiring to pentose phosphate pathway (52). Together, these reports highlight connections between cellular metabolic alterations and glucose utilization that likely impact the survival of TSC2-deficient cells.
It has been demonstrated that epidermal growth factor receptor (EGFR)-activated
ERK2 phosphorylates PKM2 at Serine 37, thereby promoting nuclear translocation of
PKM2 (202). Previous studies including ours have shown that estrogen increases ERK1/2 phosphorylation in TSC2-deficient LAM-derived cells (69, 204, 207) and rat uterine
68 leiomyoma-derived ELT3 cells (12, 30, 72, 205, 206, 222, 223). We have previously shown that estrogen promotes the lung metastasis of Tsc2-deficient ELT3 tumors in an
MEK1/2-ERK1/2-dependent manner (12). Moreover, TSC2 appears to negatively regulate the expression of PKM2 in an mTORC1- and mTORC2-independent manner, although studies have demonstrated that mTORC1 and mTORC2 are required for proliferation and survival of TSC2-null LAM-derived cells (71, 224).
Importantly, our study shows that phosphorylated PKM2 is evident in the nucleus of LAM patient-derived cells in vitro and in pulmonary LAM nodule cells in vivo.
Phosphorylated PKM2 [S37] and its nuclear translocation promote the Warburg effect and tumorigenesis (202). Monomeric PKM2 translocates into the nucleus, where it functions as a transcriptional co-activator of -catenin and upregulates the expression of c-Myc and cyclin D1 (225), thereby promoting the Warburg effect and cell cycle progression, respectively (203). These findings will warrant future investigation of the important role of
PKM2 in estrogen-driven LAM progression.
LAM can lead to respiratory failure and death (16, 226, 227). The Multicenter
International LAM Efficacy of Sirolimus Trial (MILES Trial) demonstrated that the mTORC1 inhibitor sirolimus (rapamycin) stabilizes lung function and improves the symptoms in women with LAM. However, lung function decline resumed upon drug cessation (213). Therefore, despite advances in the clinical care of women with LAM, there remains a critical need for improved therapeutic options. PKM2 expression can only be suppressed by TSC2 reconstitution and is not significantly affected by the mTORC1 inhibitor rapamycin, or Raptor depletion using shRNA, suggesting that TSC2 deficiency upstream of the mTORC1 pathway is the leading cause of PKM2 upregulation.
69 Interestingly, we also showed that knockdown of mTORC2 component Rictor does not affect the protein of levels or phosphorylation of PKM2, indicative of mTORC2-indepent regulation of PKM2 expression and activation in TSC2-deficient cells. In this study, our data suggest that PKM2 upregulation is likely a direct consequence of TSC2 loss.
Collectively, our data suggest that inhibiting estrogen-dependent cellular metabolic pathways could block the pro-survival effects of estrogen on LAM cells without need to ablate the entire hormonal signaling axis. Hormonal ablation therapy for breast cancer patients decreases circulating hormone levels and increases the development of osteoporosis and bone fracture (228, 229). Thus, in the long term, it is possible that, compared to hormonal ablation, metabolically-focused strategies in LAM could have preferable side effect profiles with regard to bone health and biochemical parameters including serum calcium, serum phosphorus and bone specific isoform of alkaline phosphatase (230). Recent studies have demonstrated therapeutic potentials of targeting dysregulated cellular metabolic pathways including glucose metabolism and autophagy addication using hydroxychloroquine or resveratrol in LAM (77, 119, 181, 231, 232).
However, additional pre-clinical and clinical studies will be needed to test this concept.
This study has been published in PLOS ONE (233).
70 Appendices
Table A1. Antibodies used in all studies Name Company Catalog # Dilution Phospho-S6 Ribosomal Protein (ser Cell signaling 4858S 1:1000 235/235) β-actin Sigma A3853 1:1000 IL-6 receptor Santa Cruz SC-373708 1:150 Tuberin/TSC2 (D93F12) Cell signaling 4308S 1:1000 Phospho-p44/42 MAPK Cell signaling 4370s 1:1000 (Erk1/2)(Thr202/Tyr204) 1: 200 PCNA Cell signaling 2586s 1:200-1:300 Ki67 Abcam Ab66155 1:200-1:500
Table A2. Compounds used in all studies
Compound Company Catalog# Stock Working concentration Dissolvent Rapamycin Enzo BML-A275- 50 mg/ml 20nM DMSO 0025
AZD6244 Cayman 11599 0.25 mM 0.25M DMSO
Table A3 Primers
Name Sequence IL-6 F: AGACAGCCACTCACCTCTTCAG R: TTCTGCCAGTGCCTCTTTGCTG ESR1 F: GCTTACTGACCAACCTGGCAGA R: GGATCTCTAGCCAGGCACATTC ERS2 F: AGCTGGGCCAAGAAGATTCC R: TGCCAGGAGCATGTCAAAGA β-actin F: CACCATTGGCAATGAGCGGTTC. R: AGGTCTTTGCGGATGTCCACGT. Esr1 F: AGGCTGCAAGGCTTTCTT. R: CAACTCTTCCTCCGGTTCTTATC. Esr2 F: ATGTACCCCTTGGCTTCTGC. R: TCTGTAGTCTGTCCGCCTCA. Tubulin F: GAGGAGATGACTCCTTCAACACC. R: TGATGAGCTGCTCAGGGTGGAA.
71 Table A4. Cell lines used in all studies
Mycoplasma Cell line Derived Modification Reference test date Yu et al. 08/16/2019 2004 (69) E6/E7 (pLXSN 16E6E7-neo); Hong et al. Human renal human 2008 (146) 621-101 angiomyolipoma telomerase Furukawa et (pLXSN hTERT- al. 1996 hyg) (234)
Re-expression Yu et al. of wild-type Human Renal 2004 (69) 621-103 TSC2 angiomyolipoma (pcDNA3.1 TSC2-zeo) S. R. Howe, et al. 1995 Eker rat uterine ELT3 None (15) leiomyoma
Luciferase Yu et al. Eker rat uterine ERL4 reporter gene PNAS 2009 leiomyoma (pCMV-Luc) (12)
Transduced with Astrinidis, et Eker rat uterine empty(V3) al. ELT3-V3 leiomyoma vector Oncogene. (pMSCVneo) 2002 (147)
72 Transduced with human TSC2(T3) Astrinidis, et Eker rat uterine al. ELT3-T3 vector leiomyoma (pMSCVneo- Oncogene. hTSC2) 2002 (147)
Zhang, et al. Tsc2-/- Mouse embryonic Tsc2+/- TP 53-/- J Clin Invest. MEFs fibroblasts intercrosses 2003 (62)
• Zhang, et al. +/+ +/- -/- Tsc2 Mouse embryonic Tsc2 TP 53 J Clin Invest. MEFs fibroblasts intercrosses 2003 (62)
Embryonic stem Mouse cell line with embryonic Kwiatkowski, Tsc1 deletion Tsc1-/- fibroblasts with et al. Hum injected into MEFs deletion of Mol Genet. blastocysts of exons 17 and 2002 (235) pseudopregnant 18 of Tsc1 female mice
Mouse Kwiatkowski, embryonic Tsc1+/+ et al. Hum fibroblasts from None MEFs Mol Genet. Tsc1+/- 2002(235) intercrosses
73 References
1. Henske EP, Jozwiak S, Kingswood JC, Sampson JR, Thiele EA. Tuberous sclerosis complex. Nat Rev Dis Primers. 2016;2:16035. 2. Neuman NA, Henske EP. Non-canonical functions of the tuberous sclerosis complex-Rheb signalling axis. EMBO Mol Med. 2011;3(4):189-200. 3. Crino PB, Nathanson KL, Henske EP. The tuberous sclerosis complex. N Engl J Med. 2006;355(13):1345-56. 4. Northrup H, Krueger DA, International Tuberous Sclerosis Complex Consensus G. Tuberous sclerosis complex diagnostic criteria update: recommendations of the 2012 Iinternational Tuberous Sclerosis Complex Consensus Conference. Pediatr Neurol. 2013;49(4):243-54. 5. Vasani RJ. Facial angiofibromas of tuberous sclerosis treated with topical sirolimus in an Indian patient. Indian J Dermatol. 2015;60(2):165-9. 6. Frudit P, Vitturi BK, Navarro FC, Rondelli I, Pozzan G. Multiple cardiac rhabdomyomas in tuberous sclerosis complex: case report and review of the literature. Autops Case Rep. 2019;9(4):e2019125. 7. Sclafani A, VanderLaan P. Lymphangioleiomyomatosis. N Engl J Med. 2018;378(23):2224. 8. Lam HC, Siroky BJ, Henske EP. Renal disease in tuberous sclerosis complex: pathogenesis and therapy. Nat Rev Nephrol. 2018;14(11):704-16. 9. Lin C, Jin L, Yang Y, Ding Y, Wu X, Ni L, et al. Tuberous sclerosis-associated renal angiomyolipoma: A report of two cases and review of the literature. Mol Clin Oncol. 2017;7(4):706-8. 10. Prizant H, Sen A, Light A, Cho SN, DeMayo FJ, Lydon JP, et al. Uterine-specific loss of Tsc2 leads to myometrial tumors in both the uterus and lungs. Mol Endocrinol. 2013;27(9):1403-14. 11. Krymskaya VP, McCormack FX. Lymphangioleiomyomatosis: A Monogenic Model of Malignancy. Annu Rev Med. 2017;68:69-83. 12. Yu JJ, Robb VA, Morrison TA, Ariazi EA, Karbowniczek M, Astrinidis A, et al. Estrogen promotes the survival and pulmonary metastasis of tuberin-null cells. P Natl Acad Sci USA. 2009;106(8):2635-40. 13. Pacheco-Rodriguez G, Kumaki F, Steagall WK, Zhang Y, Ikeda Y, Lin JP, et al. Chemokine-enhanced chemotaxis of lymphangioleiomyomatosis cells with mutations in the tumor suppressor TSC2 gene. J Immunol. 2009;182(3):1270-7. 14. Zaki KS, Aryan Z, Mehta AC, Akindipe O, Budev M. Recurrence of lymphangioleiomyomatosis: Nine years after a bilateral lung transplantation. World J Transplant. 2016;6(1):249-54. 15. Howe SR, Gottardis MM, Everitt JI, Goldsworthy TL, Wolf DC, Walker C. Rodent model of reproductive tract leiomyomata. Establishment and characterization of tumor- derived cell lines. Am J Pathol. 1995;146(6):1568-79. 16. Henske EP, McCormack FX. Lymphangioleiomyomatosis - a wolf in sheep's clothing. The Journal of clinical investigation. 2012;122(11):3807-16.
74 17. Juvet SC, McCormack FX, Kwiatkowski DJ, Downey GP. Molecular pathogenesis of lymphangioleiomyomatosis: lessons learned from orphans. American journal of respiratory cell and molecular biology. 2007;36(4):398-408. 18. Krymskaya VP. Therapeutic Strategies for Treatment of Pulmonary Lymphangioleiomyomatosis (LAM). Expert opinion on orphan drugs. 2014;2(10):1063- 74. 19. Taveira-DaSilva AM, Moss J. Management of lymphangioleiomyomatosis. F1000Prime Rep. 2014;6:116. 20. Aubry MC, Myers JL, Ryu JH, Henske EP, Logginidou H, Jalal SM, et al. Pulmonary lymphangioleiomyomatosis in a man. Am J Respir Crit Care Med. 2000;162(2 Pt 1):749-52. 21. McCormack FX. Lymphangioleiomyomatosis. MedGenMed. 2006;8(1):15. 22. Miyake M, Tateishi U, Maeda T, Kusumoto M, Satake M, Arai Y, et al. Pulmonary lymphangioleiomyomatosis in a male patient with tuberous sclerosis complex. Radiat Med. 2005;23(7):525-7. 23. Prizant H, Taya M, Lerman I, Light A, Sen A, Mitra S, et al. Estrogen maintains myometrial tumors in a lymphangioleiomyomatosis model. Endocrine-related cancer. 2016;23(4):265-80. 24. Kinoshita M, Yokoyama T, Higuchi E, Yano H, Watanabe H, Rikimaru T, et al. Hormone receptors in pulmonary lymphangiomyomatosis. Kurume Med J. 1995;42(3):141-4. 25. Ohori NP, Yousem SA, Sonmez-Alpan E, Colby TV. Estrogen and progesterone receptors in lymphangioleiomyomatosis, epithelioid hemangioendothelioma, and sclerosing hemangioma of the lung. Am J Clin Pathol. 1991;96(4):529-35. 26. Johnson SR, Tattersfield AE. Decline in lung function in lymphangioleiomyomatosis: relation to menopause and progesterone treatment. Am J Respir Crit Care Med. 1999;160(2):628-33. 27. McCormack FX. Lymphangioleiomyomatosis: a clinical update. Chest. 2008;133(2):507-16. 28. Taveira-DaSilva AM, Pacheco-Rodriguez G, Moss J. The natural history of lymphangioleiomyomatosis: markers of severity, rate of progression and prognosis. Lymphat Res Biol. 2010;8(1):9-19. 29. Taveira-DaSilva AM, Stylianou MP, Hedin CJ, Hathaway O, Moss J. Decline in lung function in patients with lymphangioleiomyomatosis treated with or without progesterone. Chest. 2004;126(6):1867-74. 30. Prizant H, Hammes SR. Minireview: Lymphangioleiomyomatosis (LAM): The "Other" Steroid-Sensitive Cancer. Endocrinology. 2016;157(9):3374-83. 31. Chen Q, Gao S, He W, Kou X, Zhao Y, Wang H, et al. Xist repression shows time-dependent effects on the reprogramming of female somatic cells to induced pluripotent stem cells. Stem Cells. 2014;32(10):2642-56. 32. Logginidou H, Ao X, Russo I, Henske EP. Frequent estrogen and progesterone receptor immunoreactivity in renal angiomyolipomas from women with pulmonary lymphangioleiomyomatosis. Chest. 2000;117(1):25-30. 33. Schiavina M, Contini P, Fabiani A, Cinelli F, Di Scioscio V, Zompatori M, et al. Efficacy of hormonal manipulation in lymphangioleiomyomatosis. A 20-year-experience in 36 patients. Sarcoidosis Vasc Diffuse Lung Dis. 2007;24(1):39-50.
75 34. Lu C, Lee HS, Pappas GP, Dilling DF, Burger CD, Shifren A, et al. A Phase II Clinical Trial of an Aromatase Inhibitor for Postmenopausal Women with Lymphangioleiomyomatosis. Ann Am Thorac Soc. 2017;14(6):919-28. 35. Seyama K, Kira S, Takahashi H, Ohnishi M, Kodama Y, Dambara T, et al. Longitudinal follow-up study of 11 patients with pulmonary lymphangioleiomyomatosis: diverse clinical courses of LAM allow some patients to be treated without anti-hormone therapy. Respirology. 2001;6(4):331-40. 36. Denoo X, Hermans G, Degives R, Foidart JM. Successful treatment of pulmonary lymphangioleiomyomatosis with progestins: a case report. Chest. 1999;115(1):276-9. 37. McCarty KS, Jr., Mossler JA, McLelland R, Sieker HO. Pulmonary lymphangiomyomatosis responsive to progesterone. N Engl J Med. 1980;303(25):1461- 5. 38. Urban T, Lazor R, Lacronique J, Murris M, Labrune S, Valeyre D, et al. Pulmonary lymphangioleiomyomatosis. A study of 69 patients. Groupe d'Etudes et de Recherche sur les Maladies "Orphelines" Pulmonaires (GERM"O"P). Medicine (Baltimore). 1999;78(5):321-37. 39. Dibble CC, Elis W, Menon S, Qin W, Klekota J, Asara JM, et al. TBC1D7 is a third subunit of the TSC1-TSC2 complex upstream of mTORC1. Mol Cell. 2012;47(4):535-46. 40. Marygold SJ, Leevers SJ. Growth signaling: TSC takes its place. Curr Biol. 2002;12(22):R785-7. 41. Tee AR, Fingar DC, Manning BD, Kwiatkowski DJ, Cantley LC, Blenis J. Tuberous sclerosis complex-1 and -2 gene products function together to inhibit mammalian target of rapamycin (mTOR)-mediated downstream signaling. Proc Natl Acad Sci U S A. 2002;99(21):13571-6. 42. Baharudin A, Zainuddin AA, Manickam MA, Ambak R, Ahmad MH, Naidu BM, et al. Factors associated with physical inactivity among school-going adolescents: data from the Malaysian School-Based Nutrition Survey 2012. Asia Pac J Public Health. 2014;26(5 Suppl):27S-35S. 43. Fingar DC, Richardson CJ, Tee AR, Cheatham L, Tsou C, Blenis J. mTOR controls cell cycle progression through its cell growth effectors S6K1 and 4E- BP1/eukaryotic translation initiation factor 4E. Mol Cell Biol. 2004;24(1):200-16. 44. Zoncu R, Efeyan A, Sabatini DM. mTOR: from growth signal integration to cancer, diabetes and ageing. Nat Rev Mol Cell Biol. 2011;12(1):21-35. 45. Kim E, Goraksha-Hicks P, Li L, Neufeld TP, Guan KL. Regulation of TORC1 by Rag GTPases in nutrient response. Nat Cell Biol. 2008;10(8):935-45. 46. Saucedo LJ, Gao X, Chiarelli DA, Li L, Pan D, Edgar BA. Rheb promotes cell growth as a component of the insulin/TOR signalling network. Nat Cell Biol. 2003;5(6):566-71. 47. Stromberg T, Dimberg A, Hammarberg A, Carlson K, Osterborg A, Nilsson K, et al. Rapamycin sensitizes multiple myeloma cells to apoptosis induced by dexamethasone. Blood. 2004;103(8):3138-47. 48. Fingar DC, Salama S, Tsou C, Harlow E, Blenis J. Mammalian cell size is controlled by mTOR and its downstream targets S6K1 and 4EBP1/eIF4E. Gene Dev. 2002;16(12):1472-87.
76 49. Easton JB, Houghton PJ. mTOR and cancer therapy. Oncogene. 2006;25(48):6436-46. 50. Mossmann D, Park S, Hall MN. mTOR signalling and cellular metabolism are mutual determinants in cancer. Nat Rev Cancer. 2018;18(12):744-57. 51. Medvetz D, Priolo C, Henske EP. Therapeutic targeting of cellular metabolism in cells with hyperactive mTORC1: a paradigm shift. Mol Cancer Res. 2015;13(1):3-8. 52. Parkhitko AA, Priolo C, Coloff JL, Yun J, Wu JJ, Mizumura K, et al. Autophagy- dependent metabolic reprogramming sensitizes TSC2-deficient cells to the antimetabolite 6-aminonicotinamide. Mol Cancer Res. 2014;12(1):48-57. 53. Choo AY, Kim SG, Vander Heiden MG, Mahoney SJ, Vu H, Yoon SO, et al. Glucose addiction of TSC null cells is caused by failed mTORC1-dependent balancing of metabolic demand with supply. Mol Cell. 2010;38(4):487-99. 54. Kim SG, Hoffman GR, Poulogiannis G, Buel GR, Jang YJ, Lee KW, et al. Metabolic stress controls mTORC1 lysosomal localization and dimerization by regulating the TTT-RUVBL1/2 complex. Mol Cell. 2013;49(1):172-85. 55. Yu J, Parkhitko A, Henske EP. Autophagy An 'Achilles' heel of tumorigenesis in TSC and LAM. Autophagy. 2011;7(11):1400-1. 56. Parkhitko A, Myachina F, Morrison TA, Hindi KM, Auricchio N, Karbowniczek M, et al. Tumorigenesis in tuberous sclerosis complex is autophagy and p62/sequestosome 1 (SQSTM1)-dependent. P Natl Acad Sci USA. 2011;108(30):12455-60. 57. Xie J, Wang X, Proud CG. mTOR inhibitors in cancer therapy. F1000Res. 2016;5. 58. Mendoza MC, Er EE, Blenis J. The Ras-ERK and PI3K-mTOR pathways: cross- talk and compensation. Trends Biochem Sci. 2011;36(6):320-8. 59. Hua H, Kong Q, Zhang H, Wang J, Luo T, Jiang Y. Targeting mTOR for cancer therapy. J Hematol Oncol. 2019;12(1):71. 60. Albert L, Karsy M, Murali R, Jhanwar-Uniyal M. Inhibition of mTOR Activates the MAPK Pathway in Glioblastoma Multiforme. Cancer Genomics Proteomics. 2009;6(5):255-61. 61. El-Hashemite N, Zhang H, Henske EP, Kwiatkowski DJ. Mutation in TSC2 and activation of mammalian target of rapamycin signalling pathway in renal angiomyolipoma. Lancet. 2003;361(9366):1348-9. 62. Zhang H, Cicchetti G, Onda H, Koon HB, Asrican K, Bajraszewski N, et al. Loss of Tsc1/Tsc2 activates mTOR and disrupts PI3K-Akt signaling through downregulation of PDGFR. J Clin Invest. 2003;112(8):1223-33. 63. Huang J, Manning BD. A complex interplay between Akt, TSC2 and the two mTOR complexes. Biochem Soc Trans. 2009;37(Pt 1):217-22. 64. Yano T, Ferlito M, Aponte A, Kuno A, Miura T, Murphy E, et al. Pivotal role of mTORC2 and involvement of ribosomal protein S6 in cardioprotective signaling. Circ Res. 2014;114(8):1268-80. 65. Yoon SO, Shin S, Karreth FA, Buel GR, Jedrychowski MP, Plas DR, et al. Focal Adhesion- and IGF1R-Dependent Survival and Migratory Pathways Mediate Tumor Resistance to mTORC1/2 Inhibition. Mol Cell. 2017;67(3):512-27 e4.
77 66. Sathe A, Chalaud G, Oppolzer I, Wong KY, von Busch M, Schmid SC, et al. Parallel PI3K, AKT and mTOR inhibition is required to control feedback loops that limit tumor therapy. PLoS One. 2018;13(1):e0190854. 67. Salmond RJ, Emery J, Okkenhaug K, Zamoyska R. MAPK, Phosphatidylinositol 3-Kinase, and Mammalian Target of Rapamycin Pathways Converge at the Level of Ribosomal Protein S6 Phosphorylation to Control Metabolic Signaling in CD8 T Cells. Journal of Immunology. 2009;183(11):7388-97. 68. Karbowniczek M, Cash T, Cheung M, Robertson GP, Astrinidis A, Henske EP. Regulation of B-Raf kinase activity by tuberin and Rheb is mammalian target of rapamycin (mTOR)-independent. J Biol Chem. 2004;279(29):29930-7. 69. Yu J, Astrinidis A, Howard S, Henske EP. Estradiol and tamoxifen stimulate LAM-associated angiomyolipoma cell growth and activate both genomic and nongenomic signaling pathways. Am J Physiol Lung Cell Mol Physiol. 2004;286(4):L694-700. 70. Liu F, Lunsford EP, Tong J, Ashitate Y, Gibbs SL, Yu J, et al. Real-time monitoring of tumorigenesis, dissemination, & drug response in a preclinical model of lymphangioleiomyomatosis/tuberous sclerosis complex. PLoS One. 2012;7(6):e38589. 71. Goncharova EA, Goncharov DA, Eszterhas A, Hunter DS, Glassberg MK, Yeung RS, et al. Tuberin regulates p70 S6 kinase activation and ribosomal protein S6 phosphorylation. A role for the TSC2 tumor suppressor gene in pulmonary lymphangioleiomyomatosis (LAM). The Journal of biological chemistry. 2002;277(34):30958-67. 72. Howe SR, Gottardis MM, Everitt JI, Walker C. Estrogen stimulation and tamoxifen inhibition of leiomyoma cell growth in vitro and in vivo. Endocrinology. 1995;136(11):4996-5003. 73. Finlay GA, Hunter DS, Walker CL, Paulson KE, Fanburg BL. Regulation of PDGF production and ERK activation by estrogen is associated with TSC2 gene expression. Am J Physiol Cell Physiol. 2003;285(2):C409-18. 74. Finlay GA, Thannickal VJ, Fanburg BL, Kwiatkowski DJ. Platelet-derived growth factor-induced p42/44 mitogen-activated protein kinase activation and cellular growth is mediated by reactive oxygen species in the absence of TSC2/tuberin. Cancer Res. 2005;65(23):10881-90. 75. Finlay GA, York B, Karas RH, Fanburg BL, Zhang H, Kwiatkowski DJ, et al. Estrogen-induced smooth muscle cell growth is regulated by tuberin and associated with altered activation of platelet-derived growth factor receptor-beta and ERK-1/2. J Biol Chem. 2004;279(22):23114-22. 76. Gu X, Yu JJ, Ilter D, Blenis N, Henske EP, Blenis J. Integration of mTOR and estrogen-ERK2 signaling in lymphangioleiomyomatosis pathogenesis. Proc Natl Acad Sci U S A. 2013. 77. Sun Y, Gu X, Zhang E, Park MA, Pereira AM, Wang S, et al. Estradiol promotes pentose phosphate pathway addiction and cell survival via reactivation of Akt in mTORC1 hyperactive cells. Cell Death Dis. 2014;5:e1231. 78. Yu JJ, Robb VA, Morrison TA, Ariazi EA, Karbowniczek M, Astrinidis A, et al. Estrogen promotes the survival and pulmonary metastasis of tuberin-null cells. Proc Natl Acad Sci U S A. 2009;106(8):2635-40.
78 79. Li C, Lee PS, Sun Y, Gu X, Zhang E, Guo Y, et al. Estradiol and mTORC2 cooperate to enhance prostaglandin biosynthesis and tumorigenesis in TSC2-deficient LAM cells. J Exp Med. 2014;211(1):15-28. 80. Sun Y, Zhang E, Lao T, Pereira AM, Li C, Xiong L, et al. Progesterone and estradiol synergistically promote the lung metastasis of tuberin-deficient cells in a preclinical model of lymphangioleiomyomatosis. Horm Cancer. 2014;5(5):284-98. 81. Li C, Li N, Liu X, Zhang EY, Sun Y, Masuda K, et al. Proapoptotic protein Bim attenuates estrogen-enhanced survival in lymphangioleiomyomatosis. JCI Insight. 2016;1(19):e86629. 82. Gu X, Yu JJ, Ilter D, Blenis N, Henske EP, Blenis J. Integration of mTOR and estrogen-ERK2 signaling in lymphangioleiomyomatosis pathogenesis. Proc Natl Acad Sci U S A. 2013;110(37):14960-5. 83. Terasaki Y, Yahiro K, Pacheco-Rodriguez G, Steagall WK, Stylianou MP, Evans JF, et al. Effects of prolactin on TSC2-null Eker rat cells and in pulmonary lymphangioleiomyomatosis. Am J Respir Crit Care Med. 2010;182(4):531-9. 84. Alkharusi A, Lesma E, Ancona S, Chiaramonte E, Nystrom T, Gorio A, et al. Role of Prolactin Receptors in Lymphangioleiomyomatosis. PLoS One. 2016;11(1):e0146653. 85. Bittmann I, Rolf B, Amann G, Lohrs U. Recurrence of lymphangioleiomyomatosis after single lung transplantation: new insights into pathogenesis. Hum Pathol. 2003;34(1):95-8. 86. Carsillo T, Astrinidis A, Henske EP. Mutations in the tuberous sclerosis complex gene TSC2 are a cause of sporadic pulmonary lymphangioleiomyomatosis. Proc Natl Acad Sci U S A. 2000;97(11):6085-90. 87. Karbowniczek M, Astrinidis A, Balsara BR, Testa JR, Lium JH, Colby TV, et al. Recurrent lymphangiomyomatosis after transplantation: genetic analyses reveal a metastatic mechanism. Am J Respir Crit Care Med. 2003;167(7):976-82. 88. Yu J, Henske EP. mTOR activation, lymphangiogenesis, and estrogen-mediated cell survival: the "perfect storm" of pro-metastatic factors in LAM pathogenesis. Lymphat Res Biol. 2010;8(1):43-9. 89. Li C, Zhou X, Sun Y, Zhang E, Mancini JD, Parkhitko A, et al. Faslodex inhibits estradiol-induced extracellular matrix dynamics and lung metastasis in a model of lymphangioleiomyomatosis. Am J Respir Cell Mol Biol. 2013;49(1):135-42. 90. Glassberg MK, Elliot SJ, Fritz J, Catanuto P, Potier M, Donahue R, et al. Activation of the estrogen receptor contributes to the progression of pulmonary lymphangioleiomyomatosis via matrix metalloproteinase-induced cell invasiveness. J Clin Endocrinol Metab. 2008;93(5):1625-33. 91. Huang J, Dibble CC, Matsuzaki M, Manning BD. The TSC1-TSC2 complex is required for proper activation of mTOR complex 2. Mol Cell Biol. 2008;28(12):4104-15. 92. Alkharusi A, Yu S, Landazuri N, Zadjali F, Davodi B, Nystrom T, et al. Stimulation of prolactin receptor induces STAT-5 phosphorylation and cellular invasion in glioblastoma multiforme. Oncotarget. 2016;7(48):79572-83. 93. El-Hashemite N, Walker V, Kwiatkowski DJ. Estrogen enhances whereas tamoxifen retards development of Tsc mouse liver hemangioma: a tumor related to renal angiomyolipoma and pulmonary lymphangioleiomyomatosis. Cancer Res. 2005;65(6):2474-81.
79 94. Lee L, Sudentas P, Donohue B, Asrican K, Worku A, Walker V, et al. Efficacy of a rapamycin analog (CCI-779) and IFN-gamma in tuberous sclerosis mouse models. Genes Chromosomes Cancer. 2005;42(3):213-27. 95. Curatolo P, Bjornvold M, Dill PE, Ferreira JC, Feucht M, Hertzberg C, et al. The Role of mTOR Inhibitors in the Treatment of Patients with Tuberous Sclerosis Complex: Evidence-based and Expert Opinions. Drugs. 2016;76(5):551-65. 96. Bissler JJ, McCormack FX, Young LR, Elwing JM, Chuck G, Leonard JM, et al. Sirolimus for angiomyolipoma in tuberous sclerosis complex or lymphangioleiomyomatosis. New Engl J Med. 2008;358(2):140-51. 97. McCormack FX, Inoue Y, Moss J, Singer LG, Strange C, Nakata K, et al. Efficacy and Safety of Sirolimus in Lymphangioleiomyomatosis. New Engl J Med. 2011;364(17):1595-606. 98. Bissler JJ, Kingswood JC, Radzikowska E, Zonnenberg BA, Frost M, Belousova E, et al. Everolimus for angiomyolipoma associated with tuberous sclerosis complex or sporadic lymphangioleiomyomatosis (EXIST-2): a multicentre, randomised, double- blind, placebo-controlled trial. Lancet. 2013;381(9869):817-24. 99. Palavra F, Robalo C, Reis F. Recent Advances and Challenges of mTOR Inhibitors Use in the Treatment of Patients with Tuberous Sclerosis Complex. Oxid Med Cell Longev. 2017;2017:9820181. 100. Sehgal SN, Baker H, Vezina C. Rapamycin (AY-22,989), a new antifungal antibiotic. II. Fermentation, isolation and characterization. J Antibiot (Tokyo). 1975;28(10):727-32. 101. Vezina C, Kudelski A, Sehgal SN. Rapamycin (AY-22,989), a new antifungal antibiotic. I. Taxonomy of the producing streptomycete and isolation of the active principle. J Antibiot (Tokyo). 1975;28(10):721-6. 102. Hartford CM, Ratain MJ. Rapamycin: Something old, something new, sometimes borrowed and now renewed. Clin Pharmacol Ther. 2007;82(4):381-8. 103. Curatolo P, Moavero R. mTOR Inhibitors in Tuberous Sclerosis Complex. Curr Neuropharmacol. 2012;10(4):404-15. 104. Valianou M, Filippidou N, Johnson DL, Vogel P, Zhang EY, Liu X, et al. Rapalog resistance is associated with mesenchymal-type changes in Tsc2-null cells. Sci Rep. 2019;9(1):3015. 105. Li C, Zhang E, Sun Y, Lee PS, Zhan Y, Guo Y, et al. Rapamycin-insensitive up- regulation of adipocyte phospholipase A2 in tuberous sclerosis and lymphangioleiomyomatosis. PLoS One. 2014;9(10):e104809. 106. Lamming DW, Ye L, Katajisto P, Goncalves MD, Saitoh M, Stevens DM, et al. Rapamycin-induced insulin resistance is mediated by mTORC2 loss and uncoupled from longevity. Science. 2012;335(6076):1638-43. 107. Yu J, Parkhitko AA, Henske EP. Mammalian target of rapamycin signaling and autophagy: roles in lymphangioleiomyomatosis therapy. Proc Am Thorac Soc. 2010;7(1):48-53. 108. Castedo M, Ferri KF, Kroemer G. Mammalian target of rapamycin (mTOR): Pro- and anti-apoptotic. Cell Death and Differentiation. 2002;9(2):99-100. 109. Ravikumar B, Berger Z, Vacher C, O'Kane CJ, Rubinsztein DC. Rapamycin pre- treatment protects against apoptosis. Hum Mol Genet. 2006;15(7):1209-16.
80 110. Wang YD, Su YJ, Li JY, Yao XC, Liang GJ. Rapamycin, an mTOR inhibitor, induced apoptosis via independent mitochondrial and death receptor pathway in retinoblastoma Y79 cell. Int J Clin Exp Med. 2015;8(7):10723-30. 111. Dilling MB, Germain GS, Dudkin L, Jayaraman AL, Zhang X, Harwood FC, et al. 4E-binding proteins, the suppressors of eukaryotic initiation factor 4E, are down- regulated in cells with acquired or intrinsic resistance to rapamycin. J Biol Chem. 2002;277(16):13907-17. 112. Blagosklonny MV. Rapamycin, proliferation and geroconversion to senescence. Cell Cycle. 2018;17(24):2655-65. 113. Carew JS, Kelly KR, Nawrocki ST. Mechanisms of mTOR inhibitor resistance in cancer therapy. Target Oncol. 2011;6(1):17-27. 114. Sarbassov DD, Guertin DA, Ali SM, Sabatini DM. Phosphorylation and regulation of Akt/PKB by the rictor-mTOR complex. Science. 2005;307(5712):1098-101. 115. Rodrik-Outmezguine VS, Chandarlapaty S, Pagano NC, Poulikakos PI, Scaltriti M, Moskatel E, et al. mTOR kinase inhibition causes feedback-dependent biphasic regulation of AKT signaling. Cancer Discov. 2011;1(3):248-59. 116. O'Reilly KE, Rojo F, She QB, Solit D, Mills GB, Smith D, et al. mTOR inhibition induces upstream receptor tyrosine kinase signaling and activates Akt. Cancer Res. 2006;66(3):1500-8. 117. Courtois-Cox S, Genther Williams SM, Reczek EE, Johnson BW, McGillicuddy LT, Johannessen CM, et al. A negative feedback signaling network underlies oncogene- induced senescence. Cancer Cell. 2006;10(6):459-72. 118. Wolpin BM, Rubinson DA, Wang X, Chan JA, Cleary JM, Enzinger PC, et al. Phase II and pharmacodynamic study of autophagy inhibition using hydroxychloroquine in patients with metastatic pancreatic adenocarcinoma. Oncologist. 2014;19(6):637-8. 119. El-Chemaly S, Taveira-Dasilva A, Goldberg HJ, Peters E, Haughey M, Bienfang D, et al. Sirolimus and Autophagy Inhibition in Lymphangioleiomyomatosis: Results of a Phase I Clinical Trial. Chest. 2017;151(6):1302-10. 120. Tang Y, El-Chemaly S, Taveira-Dasilva A, Goldberg HJ, Bagwe S, Rosas IO, et al. Alterations in Polyamine Metabolism in Patients With Lymphangioleiomyomatosis and Tuberous Sclerosis Complex 2-Deficient Cells. Chest. 2019;156(6):1137-48. 121. Chude CI, Amaravadi RK. Targeting Autophagy in Cancer: Update on Clinical Trials and Novel Inhibitors. Int J Mol Sci. 2017;18(6). 122. Muranen T, Selfors LM, Hwang J, Gallegos LL, Coloff JL, Thoreen CC, et al. ERK and p38 MAPK Activities Determine Sensitivity to PI3K/mTOR Inhibition via Regulation of MYC and YAP. Cancer Res. 2016;76(24):7168-80. 123. Zhao H, Cui K, Nie F, Wang L, Brandl MB, Jin G, et al. The effect of mTOR inhibition alone or combined with MEK inhibitors on brain metastasis: an in vivo analysis in triple-negative breast cancer models. Breast Cancer Res Treat. 2012;131(2):425-36. 124. Wu YL, Maachani UB, Schweitzer M, Singh R, Wang M, Chang R, et al. Dual Inhibition of PI3K/AKT and MEK/ERK Pathways Induces Synergistic Antitumor Effects in Diffuse Intrinsic Pontine Glioma Cells. Transl Oncol. 2017;10(2):221-8. 125. Chappell WH, Steelman LS, Long JM, Kempf RC, Abrams SL, Franklin RA, et al. Ras/Raf/MEK/ERK and PI3K/PTEN/Akt/mTOR inhibitors: rationale and importance to inhibiting these pathways in human health. Oncotarget. 2011;2(3):135-64.
81 126. Carracedo A, Ma L, Teruya-Feldstein J, Rojo F, Salmena L, Alimonti A, et al. Inhibition of mTORC1 leads to MAPK pathway activation through a PI3K-dependent feedback loop in human cancer. J Clin Invest. 2008;118(9):3065-74. 127. Krueger DA, Care MM, Holland K, Agricola K, Tudor C, Mangeshkar P, et al. Everolimus for subependymal giant-cell astrocytomas in tuberous sclerosis. N Engl J Med. 2010;363(19):1801-11. 128. Manning BD, Tee AR, Logsdon MN, Blenis J, Cantley LC. Identification of the tuberous sclerosis complex-2 tumor suppressor gene product tuberin as a target of the phosphoinositide 3-kinase/akt pathway. Mol Cell. 2002;10(1):151-62. 129. Hay N, Sonenberg N. Upstream and downstream of mTOR. Genes Dev. 2004;18(16):1926-45. 130. Laplante M, Sabatini DM. mTOR signaling in growth control and disease. Cell. 2012;149(2):274-93. 131. Li J, Kim SG, Blenis J. Rapamycin: one drug, many effects. Cell Metab. 2014;19(3):373-9. 132. Bissler JJ, McCormack FX, Young LR, Elwing JM, Chuck G, Leonard JM, et al. Sirolimus for angiomyolipoma in tuberous sclerosis complex or lymphangioleiomyomatosis. N Engl J Med. 2008;358(2):140-51. 133. McCormack FX, Inoue Y, Moss J, Singer LG, Strange C, Nakata K, et al. Efficacy and safety of sirolimus in lymphangioleiomyomatosis. N Engl J Med. 2011;364(17):1595-606. 134. Britschgi A, Andraos R, Brinkhaus H, Klebba I, Romanet V, Muller U, et al. JAK2/STAT5 inhibition circumvents resistance to PI3K/mTOR blockade: a rationale for cotargeting these pathways in metastatic breast cancer. Cancer Cell. 2012;22(6):796- 811. 135. Francois RA, Maeng K, Nawab A, Kaye FJ, Hochwald SN, Zajac-Kaye M. Targeting Focal Adhesion Kinase and Resistance to mTOR Inhibition in Pancreatic Neuroendocrine Tumors. J Natl Cancer Inst. 2015;107(8). 136. Posch C, Moslehi H, Feeney L, Green GA, Ebaee A, Feichtenschlager V, et al. Combined targeting of MEK and PI3K/mTOR effector pathways is necessary to effectively inhibit NRAS mutant melanoma in vitro and in vivo. Proc Natl Acad Sci U S A. 2013;110(10):4015-20. 137. Lee PS, Tsang SW, Moses MA, Trayes-Gibson Z, Hsiao LL, Jensen R, et al. Rapamycin-insensitive up-regulation of MMP2 and other genes in tuberous sclerosis complex 2-deficient lymphangioleiomyomatosis-like cells. Am J Respir Cell Mol Biol. 2010;42(2):227-34. 138. Duvel K, Yecies JL, Menon S, Raman P, Lipovsky AI, Souza AL, et al. Activation of a metabolic gene regulatory network downstream of mTOR complex 1. Mol Cell. 2010;39(2):171-83. 139. Cunningham JT, Rodgers JT, Arlow DH, Vazquez F, Mootha VK, Puigserver P. mTOR controls mitochondrial oxidative function through a YY1-PGC-1alpha transcriptional complex. Nature. 2007;450(7170):736-40. 140. Pena-Llopis S, Vega-Rubin-de-Celis S, Schwartz JC, Wolff NC, Tran TA, Zou L, et al. Regulation of TFEB and V-ATPases by mTORC1. Embo J. 2011;30(16):3242-58.
82 141. Muranen T, Selfors LM, Worster DT, Iwanicki MP, Song L, Morales FC, et al. Inhibition of PI3K/mTOR leads to adaptive resistance in matrix-attached cancer cells. Cancer Cell. 2012;21(2):227-39. 142. Akcakanat A, Zhang L, Tsavachidis S, Meric-Bernstam F. The rapamycin- regulated gene expression signature determines prognosis for breast cancer. Mol Cancer. 2009;8:75. 143. Cloughesy TF, Yoshimoto K, Nghiemphu P, Brown K, Dang J, Zhu S, et al. Antitumor activity of rapamycin in a Phase I trial for patients with recurrent PTEN- deficient glioblastoma. PLoS Med. 2008;5(1):e8. 144. Thomas HE, Mercer CA, Carnevalli LS, Park J, Andersen JB, Conner EA, et al. mTOR inhibitors synergize on regression, reversal of gene expression, and autophagy in hepatocellular carcinoma. Sci Transl Med. 2012;4(139):139ra84. 145. Jimenez RH, Boylan JM, Lee JS, Francesconi M, Castellani G, Sanders JA, et al. Rapamycin response in tumorigenic and non-tumorigenic hepatic cell lines. PLoS One. 2009;4(10):e7373. 146. Hong F, Larrea MD, Doughty C, Kwiatkowski DJ, Squillace R, Slingerland JM. mTOR-raptor binds and activates SGK1 to regulate p27 phosphorylation. Mol Cell. 2008;30(6):701-11. 147. Astrinidis A, Cash TP, Hunter DS, Walker CL, Chernoff J, Henske EP. Tuberin, the tuberous sclerosis complex 2 tumor suppressor gene product, regulates Rho activation, cell adhesion and migration. Oncogene. 2002;21(55):8470-6. 148. Kim D, Pertea G, Trapnell C, Pimentel H, Kelley R, Salzberg SL. TopHat2: accurate alignment of transcriptomes in the presence of insertions, deletions and gene fusions. Genome Biol. 2013;14(4):R36. 149. Robinson MD, McCarthy DJ, Smyth GK. edgeR: a Bioconductor package for differential expression analysis of digital gene expression data. Bioinformatics. 2010;26(1):139-40. 150. Ghandadi M, Sahebkar A. Interleukin-6: A Critical Cytokine in Cancer Multidrug Resistance. Curr Pharm Des. 2016;22(5):518-26. 151. Kumari N, Dwarakanath BS, Das A, Bhatt AN. Role of interleukin-6 in cancer progression and therapeutic resistance. Tumour Biol. 2016;37(9):11553-72. 152. Schmelzle T, Hall MN. TOR, a central controller of cell growth. Cell. 2000;103(2):253-62. 153. Baldo P, Cecco S, Giacomin E, Lazzarini R, Ros B, Marastoni S. mTOR pathway and mTOR inhibitors as agents for cancer therapy. Curr Cancer Drug Targets. 2008;8(8):647-65. 154. Li A, Hardy R, Stoner S, Tuckermann J, Seibel M, Zhou H. Deletion of mesenchymal glucocorticoid receptor attenuates embryonic lung development and abdominal wall closure. PLoS One. 2013;8(5):e63578. 155. Lim HJ, Crowe P, Yang JL. Current clinical regulation of PI3K/PTEN/Akt/mTOR signalling in treatment of human cancer. J Cancer Res Clin Oncol. 2015;141(4):671-89. 156. Franz DN, Belousova E, Sparagana S, Bebin EM, Frost M, Kuperman R, et al. Efficacy and safety of everolimus for subependymal giant cell astrocytomas associated with tuberous sclerosis complex (EXIST-1): a multicentre, randomised, placebo- controlled phase 3 trial. Lancet. 2013;381(9861):125-32.
83 157. Bissler JJ, Kingswood JC, Radzikowska E, Zonnenberg BA, Frost M, Belousova E, et al. Everolimus for angiomyolipoma associated with tuberous sclerosis complex or sporadic lymphangioleiomyomatosis (EXIST-2): a multicentre, randomised, double- blind, placebo-controlled trial. Lancet. 2013;381(9869):817-24. 158. Summary of the risk management plan for Afinitor and Votubia (everolimus). European Medicines Agency. 2011:Online. 159. Curatolo P, Moavero R. mTOR Inhibitors in Tuberous Sclerosis Complex. Curr Neuropharmacol. 2012;10(4):404-15. 160. Phung TL, Ziv K, Dabydeen D, Eyiah-Mensah G, Riveros M, Perruzzi C, et al. Pathological angiogenesis is induced by sustained Akt signaling and inhibited by rapamycin. Cancer Cell. 2006;10(2):159-70. 161. Sarbassov DD, Ali SM, Sengupta S, Sheen JH, Hsu PP, Bagley AF, et al. Prolonged rapamycin treatment inhibits mTORC2 assembly and Akt/PKB. Mol Cell. 2006;22(2):159-68. 162. Hasskarl J. Everolimus. Recent Results Cancer Res. 2018;211:101-23. 163. Granata S, Dalla Gassa A, Carraro A, Brunelli M, Stallone G, Lupo A, et al. Sirolimus and Everolimus Pathway: Reviewing Candidate Genes Influencing Their Intracellular Effects. Int J Mol Sci. 2016;17(5). 164. MacKeigan JP, Krueger DA. Differentiating the mTOR inhibitors everolimus and sirolimus in the treatment of tuberous sclerosis complex. Neuro Oncol. 2015;17(12):1550-9. 165. Henske EP, Jóźwiak S, Kingswood JC, Sampson JR, Thiele EA. Tuberous sclerosis complex. Nature Reviews Disease Primers. 2016;2:16035. 166. Hess EJ, Moody KA, Geffrey AL, Pollack SF, Skirvin LA, Bruno PL, et al. Cannabidiol as a new treatment for drug-resistant epilepsy in tuberous sclerosis complex. Epilepsia. 2016;57(10):1617-24. 167. Devinsky O, Marsh E, Friedman D, Thiele E, Laux L, Sullivan J, et al. Cannabidiol in patients with treatment-resistant epilepsy: an open-label interventional trial. Lancet Neurol. 2016;15(3):270-8. 168. Gloss D, Vickrey B. Cannabinoids for epilepsy. Cochrane Database Syst Rev. 2012(6):CD009270. 169. Jennesson M, van Eeghen AM, Caruso PA, Paolini JL, Thiele EA. Clobazam therapy of refractory epilepsy in tuberous sclerosis complex. Epilepsy Res. 2013;104(3):269-74. 170. Kossoff EH, Thiele EA, Pfeifer HH, McGrogan JR, Freeman JM. Tuberous sclerosis complex and the ketogenic diet. Epilepsia. 2005;46(10):1684-6. 171. Krueger DA, Wilfong AA, Mays M, Talley CM, Agricola K, Tudor C, et al. Long- term treatment of epilepsy with everolimus in tuberous sclerosis. Neurology. 2016;87(23):2408-15. 172. Nickels K. Cannabidiol in Patients With Intractable Epilepsy Due to TSC: A Possible Medication But Not a Miracle. Epilepsy Curr. 2017;17(2):91-2. 173. El-Hashemite N, Walker V, Zhang H, Kwiatkowski DJ. Loss of Tsc1 or Tsc2 induces vascular endothelial growth factor production through mammalian target of rapamycin. Cancer Res. 2003;63(17):5173-7. 174. Karbowniczek M, Zitserman D, Khabibullin D, Hartman T, Yu J, Morrison T, et al. The evolutionarily conserved TSC/Rheb pathway activates Notch in tuberous sclerosis
84 complex and Drosophila external sensory organ development. J Clin Invest. 2010;120(1):93-102. 175. Kenerson HL, Aicher LD, True LD, Yeung RS. Activated mammalian target of rapamycin pathway in the pathogenesis of tuberous sclerosis complex renal tumors. Cancer Res. 2002;62(20):5645-50. 176. Parkhitko A, Myachina F, Morrison TA, Hindi KM, Auricchio N, Karbowniczek M, et al. Tumorigenesis in tuberous sclerosis complex is autophagy and p62/sequestosome 1 (SQSTM1)-dependent. Proc Natl Acad Sci U S A. 2011;108(30):12455-60. 177. Kwiatkowski DJ. Animal models of lymphangioleiomyomatosis (LAM) and tuberous sclerosis complex (TSC). Lymphat Res Biol. 2010;8(1):51-7. 178. Ilagan E, Manning BD. Emerging role of mTOR in the response to cancer therapeutics. Trends Cancer. 2016;2(5):241-51. 179. Sahin M, Henske EP, Manning BD, Ess KC, Bissler JJ, Klann E, et al. Advances and Future Directions for Tuberous Sclerosis Complex Research: Recommendations From the 2015 Strategic Planning Conference. Pediatr Neurol. 2016;60:1-12. 180. Efeyan A, Sabatini DM. mTOR and cancer: many loops in one pathway. Curr Opin Cell Biol. 2010;22(2):169-76. 181. Parkhitko AA, Priolo C, Coloff JL, Yun J, Wu JJ, Mizumura K, et al. Autophagy- Dependent Metabolic Reprogramming Sensitizes TSC2-Deficient Cells to the Antimetabolite 6-Aminonicotinamide. Mol Cancer Res. 2013. 182. Xu J, Pham CG, Albanese SK, Dong Y, Oyama T, Lee CH, et al. Mechanistically distinct cancer-associated mTOR activation clusters predict sensitivity to rapamycin. J Clin Invest. 2016;126(9):3526-40. 183. Li J, Shin S, Sun Y, Yoon SO, Li C, Zhang E, et al. mTORC1-Driven Tumor Cells Are Highly Sensitive to Therapeutic Targeting by Antagonists of Oxidative Stress. Cancer Res. 2016;76(16):4816-27. 184. Medvetz D, Sun Y, Li C, Khabibullin D, Balan M, Parkhitko A, et al. High- throughput drug screen identifies chelerythrine as a selective inducer of death in a TSC2-null setting. Mol Cancer Res. 2015;13(1):50-62. 185. Santiskulvong C, Rozengurt E. Protein kinase Calpha mediates feedback inhibition of EGF receptor transactivation induced by Gq-coupled receptor agonists. Cell Signal. 2007;19(6):1348-57. 186. Facchinetti V, Ouyang W, Wei H, Soto N, Lazorchak A, Gould C, et al. The mammalian target of rapamycin complex 2 controls folding and stability of Akt and protein kinase C. EMBO J. 2008;27(14):1932-43. 187. Ikenoue T, Inoki K, Yang Q, Zhou X, Guan KL. Essential function of TORC2 in PKC and Akt turn motif phosphorylation, maturation and signalling. EMBO J. 2008;27(14):1919-31. 188. Rozengurt E. Mitogenic signaling pathways induced by G protein-coupled receptors. J Cell Physiol. 2007;213(3):589-602. 189. Rose-John S. IL-6 trans-signaling via the soluble IL-6 receptor: importance for the pro-inflammatory activities of IL-6. Int J Biol Sci. 2012;8(9):1237-47. 190. Mauer J, Denson JL, Bruning JC. Versatile functions for IL-6 in metabolism and cancer. Trends Immunol. 2015;36(2):92-101.
85 191. Mihara M, Hashizume M, Yoshida H, Suzuki M, Shiina M. IL-6/IL-6 receptor system and its role in physiological and pathological conditions. Clin Sci (Lond). 2012;122(4):143-59. 192. Lu Y, Zhang EY, Liu J, Yu JJ. Inhibition of the mechanistic target of rapamycin induces cell survival via MAPK in tuberous sclerosis complex. Orphanet J Rare Dis. 2020;15(1):209. 193. Sullivan EJ. Lymphangioleiomyomatosis - A review. Chest. 1998;114(6):1689- 703. 194. Brunelli A, Catalini G, Fianchini A. Pregnancy exacerbating unsuspected mediastinal lymphangioleiomyomatosis and chylothorax. Int J Gynecol Obstet. 1996;52(3):289-90. 195. Hughes E, Hodder RV. Pulmonary lymphangiomyomatosis complicating pregnancy. A case report. The Journal of reproductive medicine. 1987;32(7):553-7. 196. Mitra S, Ghosal AG, Bhattacharya P. Pregnancy unmasking lymphangioleiomyomatosis. The Journal of the Association of Physicians of India. 2004;52:828-30. 197. Matsui K, Takeda K, Yu ZX, Valencia J, Travis WD, Moss J, et al. Downregulation of estrogen and progesterone receptors in the abnormal smooth muscle cells in pulmonary lymphangioleiomyomatosis following therapy. An immunohistochemical study. Am J Respir Crit Care Med. 2000;161(3 Pt 1):1002-9. 198. Brentani MM, Carvalho CR, Saldiva PH, Pacheco MM, Oshima CT. Steroid receptors in pulmonary lymphangiomyomatosis. Chest. 1984;85(1):96-9. 199. Mccarty KS, Mossler JA, Mclelland R, Sieker HO. Pulmonary Lymphangiomyomatosis Responsive to Progesterone. New Engl J Med. 1980;303(25):1461-5. 200. Zhang Y, Dai Y, Wen J, Zhang W, Grenz A, Sun H, et al. Detrimental effects of adenosine signaling in sickle cell disease. Nat Med. 2011;17(1):79-86. 201. Christofk HR, Vander Heiden MG, Wu N, Asara JM, Cantley LC. Pyruvate kinase M2 is a phosphotyrosine-binding protein. Nature. 2008;452(7184):181-U27. 202. Yang W, Zheng Y, Xia Y, Ji H, Chen X, Guo F, et al. ERK1/2-dependent phosphorylation and nuclear translocation of PKM2 promotes the Warburg effect. Nature cell biology. 2012;14(12):1295-304. 203. Yang WW, Lu ZM. Nuclear PKM2 regulates the Warburg effect. Cell Cycle. 2013;12(19):3154-8. 204. Sun Y, Gu X, Zhang E, Park MA, Pereira AM, Wang S, et al. Estradiol promotes pentose phosphate pathway addiction and cell survival via reactivation of Akt in mTORC1 hyperactive cells. Cell Death Dis. 2014;5. 205. Finlay GA, Hunter DS, Walker CL, Paulson KE, Fanburg BL. Regulation of PDGF production and ERK activation by estrogen is associated with TSC2 gene expression. Am J Physiol-Cell Ph. 2003;285(2):C409-C18. 206. Finlay GA, York B, Karas RH, Fanburg BL, Zhang HB, Kwiatkowski DJ, et al. Estrogen-induced smooth muscle cell growth is regulated by tuberin and associated with altered activation of platelet-derived growth factor receptor-beta and ERK-1/2. J Biol Chem. 2004;279(22):23114-22.
86 207. Sun Y, Zhang E, Lao T, Pereira AM, Li CG, Xiong L, et al. Progesterone and Estradiol Synergistically Promote the Lung Metastasis of Tuberin-Deficient Cells in a Preclinical Model of Lymphangioleiomyomatosis. Horm Cancer-Us. 2014;5(5):284-98. 208. Yu J, Astrinidis A, Howard S, Henske EP. Estradiol and tamoxifen stimulate LAM-associated angiomyolipoma cell growth and activate both genomic and nongenomic signaling pathways. Am J Physiol-Lung C. 2004;286(4):L694-L700. 209. Johnson S. Rare diseases - 1 - Lymphangioleiomyomatosis: clinical features, management and basic mechanisms. Thorax. 1999;54(3):254-64. 210. Johnson SR, Taveira-DaSilva AM, Moss J. Lymphangioleiomyomatosis. Clinics in chest medicine. 2016;37(3):389-403. 211. McCormack FX, Gupta N, Finlay GR, Young LR, Taveira-DaSilva AM, Glasgow CG, et al. Official American Thoracic Society/Japanese Respiratory Society Clinical Practice Guidelines: Lymphangioleiomyomatosis Diagnosis and Management. American journal of respiratory and critical care medicine. 2016;194(6):748-61. 212. McCormack FX, Travis WD, Colby TV, Henske EP, Moss J. Lymphangioleiomyomatosis Calling It What It Is: A Low-Grade, Destructive, Metastasizing Neoplasm. American journal of respiratory and critical care medicine. 2012;186(12):1210-2. 213. McCormack FX, Lee HS, Trapnell BC. Efficacy and Safety of Sirolimus in Lymphangioleiomyomatosis REPLY. New Engl J Med. 2011;365(3):272-. 214. Howell A, Osborne CK, Morris C, Wakeling AE. ICI 182,780 (Faslodex): development of a novel, "pure" antiestrogen. Cancer. 2000;89(4):817-25. 215. Johnston SR. Fulvestrant (AstraZeneca). Curr Opin Investig Drugs. 2002;3(2):305-12. 216. Manna S, Holz MK. Tamoxifen Action in ER-Negative Breast Cancer. Sign Transduct Insights. 2016;5:1-7. 217. Thomas C, Gustafsson JA. The different roles of ER subtypes in cancer biology and therapy. Nat Rev Cancer. 2011;11(8):597-608. 218. Warner M, Gustafsson JA. The role of estrogen receptor beta (ERbeta) in malignant diseases--a new potential target for antiproliferative drugs in prevention and treatment of cancer. Biochem Biophys Res Commun. 2010;396(1):63-6. 219. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell. 2011;144(5):646-74. 220. Inoki K, Zhu TQ, Guan KL. TSC2 mediates cellular energy response to control cell growth and survival. Cell. 2003;115(5):577-90. 221. Choo AY, Kim SG, Heiden MGV, Mahoney SJ, Vu H, Yoon SO, et al. Glucose Addiction of TSC Null Cells Is Caused by Failed mTORC1-Dependent Balancing of Metabolic Demand with Supply. Molecular cell. 2010;38(4):487-99. 222. Gu XX, Yu JJ, Ilter D, Blenis N, Henske EP, Blenis J. Integration of mTOR and estrogen-ERK2 signaling in lymphangioleiomyomatosis pathogenesis. P Natl Acad Sci USA. 2013;110(37):14960-5. 223. Hammes SR, Krymskaya VP. Targeted Approaches toward Understanding and Treating Pulmonary Lymphangioleiomyomatosis (LAM). Horm Cancer-Us. 2013;4(2):70- 7.
87 224. Goncharova EA, Goncharov DA, Li H, Pimtong W, Lu S, Khavin I, et al. mTORC2 Is Required for Proliferation and Survival of TSC2-Null Cells. Mol Cell Biol. 2011;31(12):2484-98. 225. Prakasam G, Iqbal MA, Bamezai RNK, Mazurek S. Posttranslational Modifications of Pyruvate Kinase M2: Tweaks that Benefit Cancer. Front Oncol. 2018;8. 226. McCormack FX, Travis WD, Colby TV, Henske EP, Moss J. Lymphangioleiomyomatosis: calling it what it is: a low-grade, destructive, metastasizing neoplasm. Am J Respir Crit Care Med. 2012;186(12):1210-2. 227. Glasgow CG, Steagall WK, Taveira-DaSilva A, Pacheco-Rodriguez G, Cai XO, El-Chemaly S, et al. Lymphangioleiomyomatosis (LAM): Molecular insights lead to targeted therapies. Resp Med. 2010;104:S45-S58. 228. Aapro MS. Long-term implications of bone loss in breast cancer. Breast. 2004;13 Suppl 1:S29-37. 229. Lipton A, Smith MR, Ellis GK, Goessl C. Treatment-induced bone loss and fractures in cancer patients undergoing hormone ablation therapy: efficacy and safety of denosumab. Clin Med Insights Oncol. 2012;6:287-303. 230. Redlich K, Ziegler S, Kiener HP, Spitzauer S, Stohlawetz P, Bernecker P, et al. Bone mineral density and biochemical parameters of bone metabolism in female patients with systemic lupus erythematosus. Ann Rheum Dis. 2000;59(4):308-10. 231. Lam HC, Baglini CV, Lope AL, Parkhitko AA, Liu HJ, Alesi N, et al. p62/SQSTM1 Cooperates with Hyperactive mTORC1 to Regulate Glutathione Production, Maintain Mitochondrial Integrity, and Promote Tumorigenesis. Cancer Res. 2017. 232. Alayev A, Sun Y, Snyder RB, Berger SM, Yu JJ, Holz MK. Resveratrol prevents rapamycin-induced upregulation of autophagy and selectively induces apoptosis in TSC2-deficient cells. Cell Cycle. 2013;13(4). 233. Lu Y, Liu X, Zhang E, Kopras EJ, Smith EP, Astreinidis A, et al. Estrogen activates pyruvate kinase M2 and increases the growth of TSC2-deficient cells. PLoS One. 2020;15(2):e0228894. 234. Furukawa T, Duguid WP, Rosenberg L, Viallet J, Galloway DA, Tsao MS. Long- term culture and immortalization of epithelial cells from normal adult human pancreatic ducts transfected by the E6E7 gene of human papilloma virus 16. Am J Pathol. 1996;148(6):1763-70. 235. Kwiatkowski DJ, Zhang H, Bandura JL, Heiberger KM, Glogauer M, el-Hashemite N, et al. A mouse model of TSC1 reveals sex-dependent lethality from liver hemangiomas, and up-regulation of p70S6 kinase activity in Tsc1 null cells. Hum Mol Genet. 2002;11(5):525-34.
88