T Cell Receptor structure and cytokine responses in lung targeted inflammatory models
A thesis submitted for the degree of Doctor of Philosophy University of London
Catherine Jane Reynolds
Lung Immunology Group National Heart and Lung Institute Sir Alexander Fleming Building Imperial College London SW7 2AZ
Supervised by: Dr Rosemary Boyton Professor Daniel Altmann
2008 Acknowledgements
Over the course of my PhD there have been many people without whom I would never have been able to get to this point. Whether it was the kind donation of reagents, training and advice in lab techniques, scientific input or simply morale support, all help has been invaluable and very much appreciated.
I would particularly like to thank my supervisors, Rosemary Boyton and Danny Altmann. There is definitely no way that this thesis would exist without your unrelenting support, vision and enthusiasm. Your unwavering belief that I would get there in the end, even through the darker times of transgenic founder screening, and the enormous commitment, both in terms of your time and your energy, made my PhD an extremely rewarding and enjoyable experience.
Many people contributed reagents, training and advice to me throughout my PhD and I've tried to list all of these people, to whom I am extremely grateful, below. There have also been lots of people who have contributed less specifically, but no less importantly, particularly in terms of moral support and maintaining my mental well- being, during the course of this thesis. I'd particularly like to thank all members past and present of the Boyton, Altmann and Dallman labs, especially Tracey and Xiaoming who were important extra pairs of hands in many big experiments!
Finally I'd like to thank my partner, Matt. A massive thank you for your never ending support and patience including all the meals cooked, washing done and pep talks delivered! I couldn't have done it without you.
2
Reagents, help and support Transgenesis Helen Bodmer — HEL expression cassette Brian Sauer — floxed stop cassette Jeffrey Whitsett — CC10 promoter Diane Mathis and Christophe Benoist — TCR cassette vectors Maggie Dallman f3m70 Cre transgenic line Laurence Bugeon
Colin Hetherington Pronuclear injections at Nuffield Department of Medicine Robert Sumner (University of Oxford) Karla Watson
Zoe Webster — pronuclear injections at MRC Clinical Sciences Centre (Imperial College)
Keith Murray Daniel Wells South Kensington campus animal facility technicians Darren Bilton Amy Wathen
Technical help and support Kate Choy Lung function studies Sara Mathie Lorraine Lawrence — Lung histology Julia Llewellyn-Hughes — DNA sequencing Katlin Takacs — DNA preparation for pronuclear injection Yogesh Singh — Spectratyping Alan Ahern Molecular biology techniques Jennifer Rowland Gurman Kaur — Real time PCR
3 Abstract
Thl or Th2 type immune responses are an important feature of many human diseases, including several lung pathologies. Multiple factors are involved in determining whether a naïve CD4+ T cell differentiates into a Thl or Th2 effector cell and several lines of evidence point towards an important role for the interaction between the T cell receptor (TCR) and its peptide ligand. A previous study showed that highly polarised Th2 CD4+ T cells selected under Th2 polarising conditions favour a structurally distinct TCR with an elongated TCR a chain complimentarity determining region 3 (CDR3), while those selected under Thl polarising conditions favour a shorter TCR CDR3 a chain. Molecular modelling predicted that this elongated TCR a chain results in a less optimal (lower avidity) interaction between the TCR and peptide/MHC complex. In this thesis, clonotypic analysis was used to identify dominant TCR chains from established Thl and Th2 polarised T cell lines. Dominant TCR a chains were cloned into TCR transgenic expression vectors and lines of mice with transgenic expression of these chains were identified. In vitro and in vivo studies were used to investigate T cell responses in these transgenic lines and the data suggests that expression of the Th2 derived TCR a chain can cause an inherent bias in CD4+ T cell phenotype. A long term aim of this work is to use the Thl and Th2 TCR transgenic animals to develop novel mouse models of lung disease and this thesis also describes the generation of transgenic mice that express the Thl and Th2 TCR cognate epitope, PLP 56-70, inducibly and specifically in the lung. Also implicated in the pathogenesis of many lung diseases is the CXC chemokine, interleukin 8. The final chapter of this thesis describes the generation of transgenic mice overexpressing this human protein constitutively in the lung and reports initial characterisation of protein expression and consequent lung inflammation in these animals.
4 Table of contents
page number Title page 1 Acknowledgements 2 Abstract 4 Table of contents 5 List of figures 10 List of tables 15 List of appendices 16 List of abbreviations 18
Chapter 1. Introduction 1.1 The ar3 T cell receptor 24 1.2 T cell receptor gene rearrangement 25 1.3 T cell receptor sequence diversity 28 1.4 T cell receptor assembly 29 1.5 Thymic selection 34 1.6 Dual TCR expression 36 1.7 TCR editing and revision 37 1.8 Structure of the TCR/CD3 signalling complex 38 1.9 pMHC binding by TCR 44 1.10 TCR binding affinity and conformational change 46 1.11 TCR triggering 49 1.12 CD4+ T cell phenotype 53 1.13 Thl and Th2 cell differentiation 56 1.14 The TCR and CD4+ T cell differentiation 61 1.15 Thl and Th2 responses in human lung disease 64 1.16 Mouse models of human lung disease 70 1.17 Approaches to transgenesis 74 1.18 Interleukin 8 80 1.19 Neutrophil function 83
5 1.20 Interleukin 8 and human lung disease 86 1.21 Aims of this thesis 90
Chapter 2. Materials and methods 2.1 Genomic DNA extraction 94 2.2 RNA extraction 94 2.3 DNase treatment of RNA samples 95 2.4 cDNA synthesis 95 2.5 Polymerase Chain Reaction (PCR) 96 2.6 Restriction enzyme digest 96 2.7 Preparation of XL-Gold competent cells 96 2.8 E-coli transformation 97 2.9 Standard cloning and ligation protocol 97 2.10 Blunt end generation 98 2.11 Oligonucleotide annealing 99 2.12 TA cloning of PCR products 99 2.13 Preparation and screening of plasmid DNA 99 2.14 T cell receptor PCR analysis 100 2.15 Sequencing and T cell receptor sequence analysis 100 2.16 TCR CDR3 spectratyping 101 2.17 Real-time PCR 101 2.18 Preparation of DNA for oocytes pronuclear injection 102 2.19 Genotyping 102 2.20 Southern blotting 103 2.21 Southern blot Digoxigenin (DIG) probe labelling, hybridisation 103 and detection 2.22 Tamoxifen induction 105 2.23 Footpad/flank peptide immunisation 105 2.24 Immediately ex vivo T cell proliferation assay 105 2.25 Culture of T cell lines 106 2.26 Measurement of bronchial hyperreactivity (BHR) 106
6 2.27 Measurement of Resistance (R) and Compliance (Cdyn) 107 2.28 Collection of Bronchoalveolar lavage (BAL) and serum 107 2.29 Cell extraction from whole lung lobe 108 2.30 Differential cell counting 108 2.31 Lung homogenate 108 2.32 Lung histology — tissue preparation 109 2.33 Haematoxylin and Eosin (H+E) staining 109 2.34 Periodic Acid Schiff (PAS) staining and scoring 109 2.35 Immunohistochemistry — tissue fixation 110 2.36 Peroxidase based immunohistochemistry 110 2.37 Immunofluorescence tissue staining 111 2.38 Inflammatory cell scoring 112 2.39 Induction of allergic airway disease using ovalbumin (OVA) 112 2.40 Enzyme Linked ImmunoSorbant Assay (ELISA) 112 2.41 Flow cytometric analysis 113
Chapter 3. Generation of Thl and Th2 TCR a chain transgenic lines Results 3.1 Determination of a and p TCR gene usage in Thl and Th2 lines 114 specific for PLP 56-70 3.2 Construction of Thl and Th2 TCR a chain transgenes 124 3.3 Identification of Thl and Th2 TCR a chain transgenic founder 132 animals 3.4 Determination of TCR a chain transgene expression 136 Discussion 146
Chapter 4. TCR 13 chain selection and cytokine phenotype in Thl and Th2 a chain transgenics Results 4.1 Analysis of TCR p chain usage in unprimed Th2 TCR a chain 153 transgenics
7 4.2 Analysis of TCR 13 chain usage in Th2 TCR a chain transgenic 157 in the context of antigen specificity 4.3 Analysis of PLP (56-70) specific Th2 TCR a chain transgenic 160 T cell lines 4.4 Construction of a Th2 TCR (3 chain transgene 171 4.5 Identification of a Th2 TCR p chain transgenic founder animal 174 4.6 Analysis of a PLP (56-70) specific Thl TCR a chain transgenic 176 T cell line 4.7 Altered cytokine phenotype of an in vivo memory response to antigen 178 in Th2 TCR a chain transgenic animals Discussion 182
Chapter 5. Generation of transgenic lines for inducible, lung targeted, antigen expression Results 5.1 Design and construction of transgenes for inducible, lung targeted, 192 expression of the antigen PLP 56-70 5.2 Identification of MIPLP transgenic founder animal 203 5.3 Determination of stop sequence excision and MIPLP transgene 205 expression 5.4 Re-design of the SIPLP transgene 209 5.5 Identification of SIPLP transgenic founder animals 212 Discussion 216
Chapter 6. Generation and initial characterisation of transgenic lines with lung targeted expression of human interleukin 8 Results 6.1 Design and construction of a transgene for lung targeted expression 222 of human interleukin 8 6.2 Identification of lung targeted hIL-8 transgenic founder animals 226 6.3 Determination of lung specific hIL-8 transgene expression 228
8 6.4 Lung function and lung cell infiltrate in lung targeted hIL-8 233 transgenics 6.5 Investigation of the impact of IL-8 expression in the murine lung 239 during ovalbumin induced lung inflammation Discussion 246
Overview 256
Bibliography 260
Appendices 307
9 List of Figures
Page number Chapter 1. Introduction 1.1 TCR a and p loci gene arrangement and recombination 26 1.2 Timing of TCR gene rearrangement and T cell selection during 30 normal thymocyte development 1.3 Signalling pathways downstream of the T cell receptor 40 1.4 Cytokine environment and CD4+ T cell differentiation 58 1.5 The mechanistic basis of reverse tetracycline-controlled 77 transcriptional activator (rtTA) and Cre/Lox systems of inducible gene targeting 1.6 Transgenic strategies of this thesis 93
Chapter 3. Generation of Thl and Th2 TCR a chain transgenic lines 3.1 The PCR strategy used to determine a and (3 TCR gene usage in Thl 115 and Th2 line cDNA 3.2 A comparison of TCR a and 13 gene usage in Thl and Th2 T cell lines 122 in order to select chains for transgenic expression 3.3 Presence or absence of the dominant Thl and Th2 CDR3 a motifs in 123 Thl and Th2 lines 3.4 The different states of arrangement of TCR a genes 125 3.5 A schematic diagram showing the cloning strategy used to create the 127 Thl a chain construct 3.6 A schematic diagram showing the cloning strategy used to create the 128 Th2 a chain construct 3.7 Assembly of Thl and Th2 TCR a chain constructs 130 3.8 Complete Thl and Th2 TCR a chain constructs 131 3.9 Identification of Th2 TCR a chain transgenic founder animals 134 3.10 Identification of the Thl TCR a chain transgenic founder animal 135
10 3.11 Demonstration of correct Th2 TCR a chain transgene processing 139 and expression by PCR 3.12 Demonstration of correct Thl TCR a chain transgene processing and 140 expression by PCR 3.13 An increased percentage of double negative thymocytes and a 143 decreased CD4:CD8 ratio suggests expression of the TCR a chain transgene at the cell surface early in thymocyte development 3.14 An increased percentage of double negative thymocytes suggests 144 expression of the Thl a chain transgene at the cell surface early in thymocyte development 3.15 Transgenic expression of Thl or Th2 T cell receptor a chains does 145 not affect the levels of TCR at the cell surface
Chapter 4. TCR 13 chain selection and cytokine phenotype in Thl and Th2 a chain transgenics 4.1 TCR 13 chain sequences from splenocytes of unprimed Th2 TCR a 155 chain transgenic and littermate control animals 4.2 Spectratype analysis of TCR 13 chain gene usage in splenocytes of 156 unprimed Th2 TCR a chain transgenic and littermate control animals 4.3 TCR p chain sequences from primed draining lymph node of Th2 158 TCR a chain transgenic and littermate control animals 4.4 Spectratype analysis of TCR 13 chain gene usage in primed draining 159 lymph node T cells of Th2 TCR a chain transgenic and littermate control animals 4.5 Rapid clonal expansion of TCR over successive restimulations of a 161 Th2 TCR a chain transgenic T cell line 4.6 Spectratype analysis of Th2 a chain transgenic and littermate derived 162 T cell lines through successive restimulations 4.7 Cytokine phenotype of Th2 TCR a chain transgenic and littermate T 165
11 cell lines over successive restimulations 4.8 Real time PCR analysis of GATA3 and Tbet transcripts in Th2 TCR a 166 chain transgenic and littermate T cell lines over successive restimulations 4.9 Cytokine phenotype of Th2 TCR a chain transgenic and littermate T 167 cell lines after 15 restimulations 4.10 Clonal expansion of a TCR over successive restimulations of a Th2 169 TCR a chain transgenic T cell line 4.11 Cytokine phenotype of a line 34 Th2 TCR a chain transgenic T cell 170 line 4.12 A schematic diagram showing the cloning strategy used to create the 172 Th2 (3 chain construct 4.13 Cloning of the rearranged Th2 TCR p chain into the TCR (3 expression 173 cassette 4.14 Identification of the Th2 TCR p chain transgenic founder animal 175 4.15 Analysis of a Thl TCR a transgenic derived T cell line 177 4.16 An in vivo memory response to peptide demonstrates a difference in 180 cytokine profile between Th2 TCR a chain transgenic and littermate animals 4.17 TCR analysis of splenocytes from Th2 TCR a transgenic and 181 littermate animals at day 32 after priming
Chapter 5. Generation of transgenic lines for inducible, lung targeted, antigen expression 5.1 The strategy for inducible, lung specific, expression of antigen 195 PLP (56-70) 5.2 The localisation of Cre and CC10 proteins in uninduced and tamoxifen 197 induced lung sections from (3m70 MerCreMer mice 5.3 Co-localisation of Cre and CC10 in the lung of a tamoxifen induced 198 r3m70 MerCreMer mouse
12 5.4 A schematic diagram of the cloning strategy used to create the 200 inducible, lung specific PLP (56-70) transgenes 5.5 Assembly of the inducible, lung specific, membrane bound and secreted 201 PLP (56-70) transgenes 5.6 Complete inducible, lung specific, PLP constructs (membrane [MIPLP] 202 and secreted [SIPLP]) 5.7 Identification of an MIPLP transgenic founder animal 204 5.8 Removal of the floxed stop sequence and expression of MIPLP in lung 207 tissue following induction with tamoxifen 5.9 Complete removal of the floxed stop sequence occurs over many days 208 and persists for many weeks following induction with tamoxifen 5.10 A schematic diagram to demonstrate the potential importance of loxP 210 site orientation 5.11 A schematic diagram of the cloning strategy used to invert the floxed 211 stop sequence of the SIPLP construct 5.12 Identification of SIPLP transgenic founder animals 214 5.13 Removal of the floxed stop sequence and expression of SIPLP in lung 215 tissue following induction with tamoxifen
Chapter 6. Generation and initial characterisation of transgenic lines with lung targeted expression of human interleukin 8 6.1 A schematic diagram of the cloning strategy used to create the lung 224 targeted hIL-8 transgene 6.2 Cloning of human IL-8 cDNA into a lung targeted expression 225 construct 6.3 Identification of lung targeted hIL-8 transgenic founder animals 227 6.4 Tissue specific expression of hIL-8 in both transgenic lines 230 6.5 Levels of hIL-8 cDNA transcripts and hIL-8 protein in the lung of both 231 lines of hIL-8 transgenic mice 6.6 hIL-8 expresion is confined to bronchial epithelial cells of the lung in 232 both lines of transgenic mice
13 6.7 Baseline cell infiltrates in the lungs of IL-8 transgenics and littermate 235 animals 6.8 Neutrophil staining by immunohistochemistry of lung sections from 236 IL-8 transgenic and littermate animals 6.9 Mild inflammation in line 19 transgenic compared to line 33 and 237 littermate animals 6.10 Lung function of IL-8 transgenic and littermate animals 238 6.11 Lung function measurements in IL-8 transgenic and littermate animals 242 following ovalbumin sensitisation and challenge 6.12 Differential BAL and lung cell counts from IL-8 transgenic and 243 littermate animals following ovalbumin sensitisation and challenge 6.13 Lung inflammation in OVA sensitised and challenged IL-8 transgenic 244 and littermate animals 6.14 Prevalence of mucus secreting goblet cells in inflated lung sections 245 from OVA sensitised and challenged IL-8 transgenic and littermate animals
14 List of Tables
Page number Chapter 3. Generation of Thl and Th2 TCR a chain transgenic lines 3.1 TCR a sequences from a Thl polarised NOD.E T cell line against 118 PLP (56-70) 3.2 TCR a sequences from a Th2 polarised NOD.E T cell line against 119 PLP (56-70) 3.3 TCR p sequences from a Thl polarised NOD.E T cell line against 120 PLP (56-70) 3.4 TCR l sequences from a Th2 polarised NOD.E T cell line against 121 PLP (56-70) 3.5 TCR a chain sequences from splenocytes of Th2 TCR a chain 141 transgenic and littermate control animals 3.6 TCR a chain sequences from 2 Thl a chain transgenic animals 142
15 List of Appendices
Page number 1. Stock solutions and buffers 307 2. Antibodies and recombinant proteins 310 3. Restriction enzymes and buffers 311 4. PCR primers for analysis of TCR a and p gene usage 312 5. TCR CDR3r3 spectratyping primers 313 6. Thl and Th2 TCR a chain primers 314 7. MIPLP and SIPLP transgene primers and oligonucleotides 315 8. PCR primers 316 9. Wright-Giemsa stain — cell morphology 317 10. Thl TCR a chain construct - plasmid map 318 11. Th2 TCR a chain construct — plasmid map 319 12. Th2 TCR I chain construct — plasmid map 320 13. MIPLP construct — plasmid map 321 14. SIPLP construct — plasmic! map 322 15. Inverted stop sequence SIPLP construct — plasmid map 323 16. Lung targeted hIL-8 construct — plasmid map 324 17. Thl TCR a complete V-J insert nucleotide sequence 325 18. Thl TCR a rearranged V-J insert nucleotide/protein sequence 326 19. Th2 TCR a complete V-J insert nucleotide sequence 327 20. Th2 TCR a rearranged V-J insert nucleotide/protein sequence 328 21. Th2 TCR 13 complete V-J insert nucleotide sequence 329 22. Th2 TCR 3 rearranged V-J insert nucleotide/protein sequence 330 23. MIPLP construct — complete nucleotide sequence 331 24. Transmembrane HEL/PLP (56-70) nucleotide/protein sequence 337 25. SIPLP construct — complete nucleotide sequence 339 26. Secreted HEL/PLP (56-70) nucleotide/protein sequence 345 27. Inverted stop sequence SIPLP construct — complete nucleotide 346
16 sequence 28. Lung targeted hIL-8 construct — complete nucleotide sequence 352 29. hIL-8 nucleotide/protein sequence 356 30. Inflammatory cell scoring system 357
17 List of abbreviations
AHR Airway hyperresponsiveness AIRE Autoimmune regulator AP Activating protein APC Antigen presenting cell APECED Autoimmune polyendocrinopathy candidiasis ectodermal dystrophy APL Altered peptide ligand ARDS Acute respiratory distress syndrome ATP Adenosine triphosphate
BAL Bronchoalveolar lavage Bax Bc12 associated X protein BCG Bacille Calmette-Guerin (strain of Mycobacterium bovis) Bcl B cell leukaemia protein BHR Bronchial hyperreactivity Blys B lymphocyte stimulator bp base pair BSA Bovine serum albumin
C Constant °C Centigrade CC10 Clara cell protein 10 CD Cluster of differentiation cDNA Complimentary DNA CDR Complimentarity determining region Cdyn Compliance CF Cystic fibrosis CFA Complete Freund's adjuvant CFTR Cystic fibrosis transmembrane conductance regulator
18 CIAP Calf intestinal alkaline phosphatase CMA Cytomegalovirus COPD Chronic obstructive pulmonary disease cTEC Cortical thymic epithelial cells CTLA Cytotoxic T lymphocyte associated antigen CTP Cytidine triphosphate
D Diversity DAG Diacylglycerol DC Dendritic cell DC-SIGN Dendritic cell-specific ICAM3-grabbing nonintegrin DIG Digoxigenin DLN Draining lymph node DN Double negative DNA Deoxyribonucleic acid DP Double positive DPB Diffuse panbronchiolitis DTT Dithiothreitol
E Enhancer EAE Experimental autoimmune encephalomyelitis EBV Epstein barr virus ELISA Enzyme linked immunosorbant assay ER Endoplasmic reticulum ERK Extracellular signal-regulated kinase F Forward FCS Foetal calf serum FITC Fluorescein Isothiocyanate
g gram g gravitational acceleration
19 GATA Gene activator of TCR a GTP Guanosine triphosphate
H+E Haematoxylin and Eosin HCMV Human cytomegalovirus HEL Hen egg lysozyme hIL-8 human Interleukin 8 HPRT Hypoxanthine Phosphoribosyltransferase Hsp Heat shock protein i.m intra-muscular i.p intra-peritoneal ICAM Intracellular adhesion molecule IFA Incomplete Freund's adjuvant IFN Interferon Ig Immunoglobulin IL Interleukin IMGT International immunogenetics IP3 Inositol- 1 ,4,5-triphosphate IPF Idiopathic pulmonary fibrosis IPTG Isopropyl-P-d-thiogalactopyranoside ITAM Immunoreceptor tyrosine based activation motif IU International unit
J Joining
KB Kilobase kD Kilodalton
1 litre LAT Linker for activation of T cells
20
LB Luria-Bertani
Lck Lymphocyte-specific-protein-tyrosine kinase
LFA Lymphocyte function associated antigen
M Molar m meter m milli mAb monoclonal antibody MAPK Mitogen activated protein kinase MBP Myelin basic protein MDNCF Monocyte derived neutrophil chemotactic factor Mer Mutated oestrogen receptor MHC Major histocompatibility complex MIPLP Membrane bound, inducible, proteolipoprotein MONAP Monocyte derived neutrophil activating peptide MPO Myeloperoxidase mRNA messenger ribonucleic acid MS Multiple sclerosis mTEC medullary thymic epithelial cell n nano N random nucleotide NAF Neutrophil activating factor NFAT Nuclear factor of activated T cells NF-KB Nuclear factor K B NK Natural killer NOD Non-obese diabetic NTP Nucleotide triphosphate
OVA Ovalbumin
21 P Promoter PAS Periodic acid Schiff PBMC Peripheral blood mononuclear cell PBS Phosphate buffered saline PCC Pigeon cytochrome c PCD Pulmonary ciliary dyskinesia PCR Polymerase chain reaction PE Phycoerythrin phox phagocyte oxidase PI3K Phosphatidylinositol 3 kinase PIP2 Phosphatidylinositol 3,4-bisphosphate PLC Phospholipase C PLP Proteolipoprotein pMHC peptide/MHC complex pTa pre-TCR a chain
R Resistance R Reverse r recombinant RAG Recombination activating gene reg regulatory RNA Ribonucleic acid RNAi RNA interference RS S Recombination signal sequence rTS reverse transcriptional silencer rtTA reverse tetracycline transcriptional activator
s.c sub-cutaneous SCID Severe combined immunodeficiency disease SD Standard deviation SE Standard error
22 SH Src homology SIPLP Secreted, inducible, proteolipoprotein SLP SH2 domain containing leukocyte protein SLPI Secretory leukocyte protease inhibitor SOCS Suppressor of cytokine signalling SP Single positive SP Surfactant protein STAT Signal transducer and activator of transcription tetO Tetracycline operator TGF Transforming growth factor Th T helper cell TLR Toll like receptor TNF Tumor necrosis factor TRITC Tetramethyl rhodamine iso-thiocyanate TTP Thymidine triphosphate
V Variable
V Volt
ZAP z-chain associated protein kinase
23 Chapter 1
Introduction
1.1 The afi T cell receptor
The af3 T cell receptor (TCR) is a transmembrane heterodimer expressed on the surface of CD4+ and CD8 + T lymphocytes. TCRs on CD4+ and CD8+ T cells recognise peptides bound to class I or class II major histocompatibility complex (MHC) molecules respectively and engagement of the TCR with peptide and MHC can result in activation of the T cell and initiation of an adaptive immune response.
The TCR protein was first identified in the early 1980's using antibodies raised against lymphomas or T cell clones (Allison et al., 1982 and Haskins et al., 1983). It was noted that these antibodies, specific for a component of the T cell, could block antigen recognition and that this blocking or binding did not occur when the antibodies were used against T cells of different antigen specificities. Precipitation of the proteins bound by these antibodies revealed a dimer of approximately 80 kilodaltons (kD), which, on reduction of disulphide bonds, could be separated into two monomers of 39 and 41 kD. Tryptic peptide analysis of the two TCR monomers, now known as the alpha chain and the beta chain, began to reveal the basis of TCR clonality and peptide/MHC specificity (Kappler et al., 1983), with comparisons of peptides derived from TCRs of different specificities suggesting the presence of constant and variable regions in both chains. Understanding of the genetic basis for these constant and variable regions of the TCR became possible following the isolation of alpha and beta chain cDNA (Chien et al., 1984 and Hedrick et al., 1984) which showed the TCR chains to be composed of rearranged variable (V), diversity (D), joining (J) and constant (C) region sequences, a concept previously encountered in studies of the B cell antigen receptor immunoglobulin genes (Hozumi and Tonegawa, 1976).
24 Following the discovery of the a13 TCR, another TCR molecule, known as the y8 TCR, was also described (Brenner et al., 1986).
1.2 T cell receptor gene rearrangement
There are three distinct TCR loci in the genome of both humans and mice, Tcrb, Tcra/Tcrd and Tcrg, containing the V, D, J and C genes necessary for assembly of af3 and y8 T cell receptors. An outline of the murine germline configuration of genes within the Tcrb and Tcra/Tcrd loci is shown in figure 1.1. The process of gene rearrangement and the joining of V, D, J and C genes to form a functional TCR chain occurs in the thymus during lymphocyte development and utilises highly conserved recombination signal sequences (RSS) that flank each gene segment (Akira et al., 1987). The recombination signals consist of conserved heptamer and nonamer sequences that flank relatively non-conserved 12 bp (12RSS) or 23 bp (23RSS) spacers. Point mutations in the conserved sequences, or changes in the length of the spacers, drastically reduce recombination efficiency (Akira et al., 1987) and, although non-conserved, changes in the sequence of the spacer regions have also been shown to have an impact (Montalbano et al., 2003). Recombination between gene segments occurs via a mechanism of double strand breaks (Roth et al., 1992) and is mediated by the recombination activating genes, RAG1 and RAG2 (McBlane et al., 1995). Mice deficient in either RAG1 or RAG2 fail to develop mature T cells, due to an inability to initiate V(D)J recombination (Mombaerts et al., 1992a and Shinkai et al., 1992), and as such, transgenic expression of rearranged TCR alpha and beta chain genes can restore T cell development in these animals (Shinkai et al., 1993). The RAG proteins control the specificity of cleavage events during recombination by binding to the conserved RSS motifs, but also control the configuration in which gene segments can be joined together, by dictating that a gene with a 5' 23RSS can only be joined to a gene with a 3' 12RSS and vice versa (van Gent et al., 1996). This is known as the 12/23 rule of recombination (Akira et al., 1987). However, this seemingly simple mechanism of control over the configuration of TCR genes cannot account for the
25
Va and VS (a) DS Jo ES CS VS Ja Ca Ea genes __ I
PD(31 Vf3 genes DP1 Jf31 Cf31 Dp2 J132 CP2 E(3 V(3 r) ti [ C) I
RAG mediated cleavage (b)
Random nucleotide (N) addition by TdT
NN (c)
—11111111E11— Va Ja N N 4
Vf3 Df3 Jr3 Vf3 DP JP
Figure 1.1 TCR a and 13 loci gene arrangement and recombination. (a) Schematic diagrams of the arrangement of V, D, J and C genes and enhancer elements at the murine Tcra/d and Tcrb loci are shown. (b) Gene segments are combined by a mechanism of double strand breaks, mediated by the RAG recombinase protein complex. Junctional diversity during the joining together of gene segments is brought about by random nucleotide (N) addition by the Terminal deoxynucleotidyl transferase (TdT) enzyme. (c) The order in which gene segments are combined is strictly controlled with DP-J(3 recombination occurring before VP-DP joining. Points at which N nucleotide addition creates junctional diversity in the a and [3 TCR chains are marked (N).
26 strict control imposed on the order in which different genes and indeed different chains are rearranged. Figure 1.1 outlines the basic mechanism of the V(D)J recombination reaction and also shows the order in which gene segments for each TCR chain are recombined. According to the 12/23 rule direct VP-J13 rearrangement should be possible. However, DP-JP rearrangements are found to occur preferentially, followed by VP - D.43 (Born et al., 1985). A greater level of control than simply 12RSS or 23RSS is now known to reside with the recombination signal sequence itself. A study using a modified TCR (3 locus containing just one DP gene segment and one JP gene cluster demonstrated that the 12RSS of the JP was unable to substitute for the 12RSS of the DP in allowing recombination with VP gene segments (Bassing et al., 2000). However, although this finding sheds more light onto how the configuration of gene segments in TCR chains may be controlled, the complex temporal regulation of gene rearrangement is still unexplained. Temporal control of TCR gene rearrangement is important not only in determining the order in which genes of a single chain are rearranged (Born et al., 1985), but also in controlling rearrangement of (3 or y chains prior to rearrangement of a or 8 chains (Raulet et al., 1985) and in controlling allelic exclusion of the TCRP locus, where productive rearrangement of one TCR (3 allele impedes further gene rearrangement on another (Uematsu et al., 1988). To explain these processes, the concept of locus accessibility has emerged whereby multiple mechanisms are employed to alter the accessibility of genes within a TCR locus to the RAG V(D)J recombinase. Experiments have shown the presence of nucleosomes (the simplest form of chromatin packaging) around RSSs to be inhibitory to cleavage by the V(D)J recombinase (Golding et al., 1999) and changes in the chromatin accessibility of VP genes, as measured by sensitivity to DNase I digestion and levels of histone acetylation have been observed upon transition of developing T cells from double negative (DN) to double positive (DP) (Tripathi et al., 2002). As well as acetylation, chromatin accessibility is also affected by methylation. Increased levels of methylation as a consequence of deletion of the promoter PD(31 (figure 1.1) from the TCR (3 locus results in decreased D131 gene rearrangement, although D(32 rearrangement is unaffected (Whitehurst et al., 2000). This suggests that chromatin remodelling may be one mechanism by which promoters
27 within TCR loci exert control over local rearrangements. Longer range control over chromatin structure has been observed for the enhancer sequence (EP) of the TCR P locus (figure 1.1), deletion of which significantly reduces chromatin accessibility throughout the DpJP region (Oestreich et al., 2006). This study also reported direct physical contact between EP and PD131, implying that different control elements within a TCR locus can interact to exert control over TCR gene rearrangement during T cell development.
1.3 T cell receptor sequence diversity
Mathematical estimates of the number of different TCR sequences that can potentially exist are in the range of 1012-1015 (Davis and Chien, 1999). However, through the need for self tolerance, and the processes of negative and positive selection in the thymus, estimates of the number of different aP T cell receptor sequences present in the periphery range from 2 x 106 for a naive mouse (Casrouge et al., 2000) to 2 x 107 in human peripheral blood (Arstila et al., 1999). Diversity of TCRs is achieved in one of three ways. As already discussed, the genomic locus of each TCR chain contains many different V, D and J gene segments which recombine to generate a functional TCR chain. There are therefore many possible combinations of gene sequences that can exist following recombination. Secondly, each TCR is composed of an a and a P chain. Diversity is therefore amplified by receptor heterodimerisation where, for example, a particular p chain sequence is able to form a functional receptor with multiple TCR a chain partners (Listman et al., 1996). The third mechanism by which TCR sequence diversity is achieved is by imprecise joining of gene segments during the recombination process itself. Following cleavage of the TCR locus, coding ends of gene segments, brought into close proximity by the RAG V(D)J recombinase complex, must be joined together to create a functional TCR chain. During the joining phase of rearrangement reactions, random nucleotides (N) are added in a template independent fashion onto the 3' OH ends of the combining gene segments by the terminal deoxynucloetidyl transferase (TdT) enzyme. Regions of N nucleotides at the junctions of gene segments are absent in the TCRs of T lymphocytes that lack this
28 enzyme (Komori T et al., 1993) and the size of the a(3 TCR repertoire in TdT null mice has been estimated to be just 10% of the size of a normal wild-type animal (Cabaniols et al., 2001). However, immune responses appear relatively unimpaired in these animals, which remain able to mount robust responses against a range of different antigens (Gilfillan et al., 1995). Regions of each TCR chain sequence that are subject to N region addition are marked on figure 1.1 and lie in a region termed the CDR3a or CDR313 of the TCR a and 13 chains respectively. The CDR3, along with the germline encoded CDR1 and CDR2 regions of the TCR, plays an important role in peptide specificity and in binding of the TCR to peptide/MHC and will be discussed in more detail in a later section.
1.4 T cell receptor assembly
The assembly of a functional a(3 TCR on the surface of a mature T cell is an ordered process that is subject to strict control measures at multiple stages during T cell development. A schematic diagram of the different stages of T cell development in the thymus and the timing of al3 TCR assembly is shown in figure 1.2. The main requirements of a TCR on the surface of a T cell, exiting the thymus to join the peripheral immune system, are that it should be able to recognise peptides bound to self-MHC molecules but that it should not be reactive to peptides derived from self- proteins. The nature of TCR gene rearrangement in promoting extensive TCR sequence diversity, as discussed in the previous section, means that there is estimated to be potential for the generation of 1012 — 1015 different TCRs. However many of these will not satisfy the self MHC / self peptide requirements mentioned above and so processes of positive and negative selection are employed in the thymus to reduce and restrict the peripheral TCR repertoire to those molecules which will be functional, but not self reactive.
During T cell development, the TCR (3 chain is rearranged before the a chain (Raulet et al., 1985) and indeed use of a TCR p chain transgene in scid mice (Bosma et al., 1983), which carry a mutation in a DNA repair enzyme and so cannot carry out VDJ
29 DN1
DN2
TCR p gene } rearrangement DN3
+
DN4 13 chain selection TCR a gene rearrangement
DP f a chain Positive and SP SP negative selection
Figure 1.2 Timing of TCR gene rearrangement and T cell selection during normal thymocyte development. The main stages of normal thymocyte development are shown, along with cell surface markers used to distinguish each immature cell population. TCR (3 gene rearrangement and cell surface expression occurs before that of the TCR a chain and the TCR (3 chain is stabilised at the cell surface by binding to a surrogate a chain (pTa). Formation of a pTa complex at the cell surface mediates transition of thymocytes from the DN stage to the DP stage and following allelic exclusion at the TCR (3 locus, TCR a gene rearrangement and expression is permitted. On formation of a stable a13 heterodimer, positive and negative selection events ensure that mature SP T cells exiting the thymus are able to recognise foreign peptides bound to self MHC, but are not reactive to peptides derived from self proteins.
30 recombination, demonstrated expression of the TCR (3 chain on the cell surface of DN thymocytes in the absence of the a chain (Hiroyki et al., 1991). Stable cell surface expression of the 13 chain is permitted by the formation of a heterodimer with a 33 kDa glycoprotein known as the pre-TCR a chain (Groettrup et al., 1993). af3 T cell development is found to be severely impaired in animals that lack the pre-TCR a gene (Fehling et al., 1995), with T cell development blocked at the transition between DN and DP thymocytes (figure 1.2), although the block is incomplete compared to that seen in the absence of the 13 chain (Mombaerts et al., 1992b). This finding implies that proteins other than the pre-TCR a (pTa) are able to facilitate transition of thymocytes from DN to DP and indeed in pTa deficient mice, a13 TCR complexes can rescue T cell development and promote maturation and expansion of T cells expressing a productively rearranged (3 chain (Buer et al., 1997). However, the a chain cannot act as a direct substitute for pTa, as T cells manipulated to express a TCR a chain at the point of normal pTa gene expression, but lacking endogenous pTa, demonstrate impaired development, proliferation and differentiation (Borowski et al., 2004). In this study, inefficiencies in T cell development and survival were partly overcome by expression of a hybrid TCR a chain, containing the cytoplasmic domain of pTa, and multiple lines of evidence now point to an important role for pTa in mediating signalling events that promote T cell development and allelic exclusion at the TCR p locus. pTa is a type 1 transmembrane protein (Saint-Ruf et al., 1994) which pairs with the TCR p chain via a disulphide bond. The extracellular portion of the protein is an immunoglobulin (Ig) like domain and the intracellular cytoplasmic tail contains several potential phosphorylation sites and a Src homology 3 (SH3) domain binding sequence. Mutation studies of this cytoplasmic tail have demonstrated an important role in T cell development (Aifantis et al., 2002) and in intracellular Ca2+ mobilisation, an important mediator of intracellular signalling events which has been shown to increase, alongside activation of the transcription factors NF-KB and NFAT, during constitutive signalling through the pre-TCR complex (Aifantis et al., 2001). The process by which a developing lymphocyte expressing a pre-TCR (TCR (3 / pTa) complex is permitted to move from the DN to DP compartment of the thymus, thereby
31 undergoing proliferation and escape from apoptosis, is known as p selection and is accompanied by allelic exclusion at the TCR (3 locus, ensuring that each developing T cell expresses a single TCR (3 chain. Signalling through the pre-TCR is known to be important in this allelic exclusion as thymocytes from mice lacking pTa show an increased number of cells with two rearranged TCR (3 alleles (Aifantis et al., 1997), a finding also observed in mice lacking the signalling pathway adapter, SH2 Domain- containing Leukocyte Protein (SLP)-76 (Aifantis et al., 1999). These SLP-76 knockout mice also show a block at the DN stage of thymocyte development, which cannot be overcome by expression of TCR a and p chain transgenes. However, signalling through the pre-TCR during (3 selection does not occur in isolation and other signalling pathways, such as those initiated by the Notch receptor and its ligands have also been shown to play a role (Ciofani et aL, 2004).
One of the functional outcomes of pre-TCR signalling, leading to allelic exclusion at the TCR (3 locus, is the down regulation of the RAG genes responsible for gene rearrangement (Wilson et al., 1994). Expression levels of RAG-1 and RAG-2 are high at two stages during lymphocyte development. The first is early in DN thymocytes, prior to (3 chain selection, and the second later in DP thymocytes, permitting rearrangement at the TCR a locus (figure 1.2). Unlike the TCR (3 locus, both alleles of the TCR a locus are permitted to undergo rearrangement simultaneously and this rearrangement is not inhibited by expression of an aP TCR at the cell surface (Borgulya et al., 1992). As such, rearrangement at the TCR a locus continues until an a(3 pair on the surface of the T cell successfully engages with a major histocompatibility complex molecule and results in positive selection and downregulation of RAG gene expression (Brandle et al., 1992). A single TCR a allele is able to make multiple rearrangements, so that if the first rearrangement does not result in a functional TCR when paired with the TCR (3 chain expressed by that T cell, the TCR a locus can excise the first rearrangement and recombine different V and J genes upstream and downstream of the original rearrangement respectively in a process termed TCR a chain revision (Marolleau et al., 1988). Mice engineered to
32 express a modified TCR a locus containing a very limited number of V and J genes, which cannot undergo effective TCR cc chain revision, show a reduced number of a(3 T cells in the periphery (Huang et al., 2005), highlighting the importance of this process in normal T cell development. At the point of TCR a chain rearrangement and expression, the pre-TCR complex is downregulated from the cell surface via a mechanism of competitive displacement (Trop et al., 2000). Immature double positive thymocytes (TCRI') often express two cell surface TCR a chains, derived from each TCR a, allele, both forming pairs with the same TCR 13 chain (Alam et al., 1995). However, most mature thymocytes and peripheral T cells express just one cc(3 TCR and this process of selection of one TCR cc chain over another is known as allelic exclusion, although the functional rearrangement of both TCR cc chain alleles that can precede exclusion makes it a functionally different process from that previously described for allelic exclusion at the TCR (3 locus. Several different hypotheses have been proposed to explain allelic exclusion of TCR a chains. The first proposes that competition between the chains for pairing with a limited number of TCR (3 chain molecules dictates which pair becomes dominant. This is supported by experiments demonstrating good expression of both chains intracellularly, despite the presence of just one on the cell surface, arguing against a mechanism of downregulation of one chain (Alam and Gascoigne, 1998). However, T cells engineered to express two independent TCRs, i.e. with different cc and (3 chains, still preferentially express just one receptor at the cell surface, although both TCR proteins can be detected intracellularly and the receptor which dominates is not fixed between T cell clones (Sant'Angelo et al., 2001). This finding makes the competition hypothesis harder to rationalise, but does point to a post-translational mechanism of control. A second hypothesis proposes an active mechanism of exclusion whereby signalling events are required to select one a(3 pair over another. In a study using immature thymocytes expressing two TCR cc chains with different peptide specificities, allelic exclusion was achieved upon ligand recognition with subsequent loss of the non-ligated receptor in mature T cells (Boyd et al., 1998). This receptor specific signal for allelic exclusion was also found to be CD45 dependent, implicating a mechanism of signalling through
33 the TCR, a finding subsequently supported by studies involving other mediators of the TCR signalling pathway (Niederberger et al., 2003).
1.5 Thymic selection
The process of positive selection, whereby an ocr3 TCR demonstrates binding and recognition of self-MHC, occurs in the thymic cortex. Interactions between T cells and cortical thymic epithelial cells (cTECs) have been shown to be dependent upon MHC (Bousso et al., 2002) and lead to the migration of thymocytes towards the thymic medulla, a process mediated by the upregulation of chemokine receptors, such as CCR7, and their ligands (Kwan and Killeen, 2004). In the thymic medulla T cells interact with other cell types, such as dendritic cells (DCs) and medullary thymic epithelial cells (mTECs), which present a diverse array of peptide/MHC complexes with peptides derived from ubiquitously expressed, but also tissue specific proteins (Sospedra et al., 1998). A high affinity interaction between an a(3 TCR and a self peptide/MHC complex results in negative selection and deletion of the thymocyte bearing the autoreactive TCR (Kappler et al., 1987) thus establishing tolerance to self proteins. A recent study highlighting the importance of negative selection in establishing tolerance used mice able to express an MHC molecule (IA") bound to just a single peptide, permitting positive selection of thymocytes but severely impairing the process of negative selection. The authors demonstrated that mature T cells specific for this MHC molecule were highly cross reactive, not only recognising other peptides bound to IA", but also binding other MHC alleles (Huseby et al., 2005).
Expression of peripheral antigens in the thymus was found to be a function of mTECs (Derbrinksi et al., 2001) and in this study, expression of a peripheral protein in these cells was found to be sufficient for the generation of peripheral tolerance. However, although expression of the tissue specific antigen is a function of mTECs, they are not necessarily the cell type that ultimately presents the antigen to the developing lymphocyte. A study of antigen presentation in the thymus, using mice in which mTECs could express ovalbumin (OVA) but not MHC class I, demonstrated that DCs
34 in the thymus could generate tolerance to this protein via a mechanism of indirect antigen presentation (Gallegos and Bevan, 2004). Expression of tissue specific antigens in mTECs is now known to be primarily mediated by the transcription factor AIRE (Anderson et al., 2002), although some genes can still be upregulated in the absence of this protein (Derbinski et al., 2005). Humans with mutations in the AIRE gene suffer from systemic autoimmunity (Finnish-German APECED Consortium, 1997), as do AIRE deficient mice (Anderson et al., 2002). More recently, variations between individuals in thymic expression levels of autoantigens controlled by the AIRE protein, such as insulin, have been correlated with susceptibility to disease (Taubert et al., 2007). However, thymic expression of a protein does not necessarily result in efficient negative selection and tolerance. A study investigating tolerance versus autoimmunity to the membrane protein H+/K+ ATPase, the main autoantigen of autoimmune gastritis, found that although one subunit of the protein (H/Ka) is expressed in the thymus, T cells specific for this molecule are not deleted (Allen et al., 2005). The reason for this failure of negative selection was found to be the absence of the (3 subunit (H/K(3), which is required to stabilise the H/Ka subunit in the membrane. Many proteins are also expressed differentially between tissues as different splice variants of the same gene. This can mean that, despite induction of gene expression in the thymus during T cell development, the epitope associated with disease is not encountered by autoreactive T cells until they reach the periphery (Klein et al., 2000). Therefore, although the expression of tissue specific antigens in the thymus is critical for the generation of self-tolerance, tolerance may be harder to achieve for more complicated proteins with multiple subunits or complex genetic expression mechanisms.
The main mechanism of central tolerance induction in the thymus is negative selection by apoptosis. T cells deficient in two key pro-apoptotic proteins, Bak and Bax demonstrate impaired thymocyte development, including an impaired ability to undergo negative selection (Rathmell et al., 2002), and NOD mice, which display a general susceptibility to autoimmunity, have been shown to have reduced expression of another mediator of apoptosis, the bim protein (Liston et al., 2004). However, an
35 alternative mechanism of central tolerance, where T cells bearing autoreactive TCRs are induced to acquire a regulatory T cell (CD4+CD25±) phenotype has also been described (Jordan et al., 2001). T cells proceeding along this pathway of selection have been shown to require a high affinity interaction with their peptide/MHC complex. That a high affinity interaction between a TCR and self/peptide MHC in the thymus can result in development of a regulatory T cell phenotype in some cases, but apoptosis and negative selection in other cases, and that a low affinity interaction spares the T cell from deletion resulting in positive selection (Alam et al., 1996), raises important, but yet broadly unanswered questions about how the T cell interprets a signal through the TCR to generate different functional outcomes. This issue will be explored further in later sections discussing TCR structure, TCR signalling and T cell differentiation.
1.6 Dual TCR expression
Although most mature CD4+ and CD8+ T cells express just a single type of al3 TCR at the cell surface, allelic exclusion, particularly at the TCR a locus, is not always complete. This results in the expression of two TCR a chains, each pairing with the same TCR p chain to form two independent receptors (Padovan et al., 1993). It is estimated that as many as 30% of peripheral human T cells (Padovan et al., 1993) and 10-30% of peripheral mouse T cells (Elliott and Altmann, 1995 and Sarukhan et al., 1998) may carry dual a chains and although dual TCRs are most commonly associated with incomplete allelic exclusion at the a locus, very low frequencies of T cells expressing two p chains have also been reported (Padovan et al., 1995). Since the demonstration of dual TCR expression on the surface of a single T cell in the periphery, much attention has focussed on the potential implication of this finding in terms of antigen specificity and autoimmunity. It has been postulated that autoreactive TCRs may escape negative selection in the thymus by being expressed at low levels on the surface of a T cell which is then subsequently positively selected based on low affinity self peptide/MHC recognition by a second, more highly expressed, TCR. This idea was supported by a study using dual TCR transgenic mice where one receptor,
36 specific for the natural self-antigen C5, was rescued from negative selection in the thymi of C5+ mice by expression of a second unrelated TCR. Both TCRs were present on the surface of mature T cells in the periphery, but levels of the autoreactive TCR were very low and these CD8+ T cells were only able to mediate killing of a C5 carrying target cell when activated via the second TCR (Zal et al., 1996). That this phenomenon may then lead to increased susceptibility to autoimmunity also has some experimental support (Sarukhan et al., 1998). In this study a TCR transgenic model of autoimmune diabetes was used to demonstrate that, in the context of an active central tolerance mechanism, T cells expressing low levels of autoantigen specific TCR could still be found in the periphery and that these cells also expressed a second TCR molecule and were capable of causing disease. However, other studies in different disease systems using mice hemizygous for the TCR a locus and therefore unable to express dual TCRs have not always supported this link (Elliott and Altmann, 1996 and Corthay et al., 2001). Another proposed implication of dual TCR expressing cells is that they may serve to increase the repertoire of TCRs in the periphery which are capable of binding to foreign peptides by rescuing from deletion those TCRs which do not bind self peptide/MHC with high enough affinity to be positively selected in the thymus (He et al., 2002).
1. 7 TCR editing and revision
Although discussions of negative selection in the thymus usually refer to deletion of a T cell bearing an autoreactive TCR, there is some evidence that T cell apoptosis is not always the default pathway for removing these receptors from the repertoire. As an alternative, a mechanism of receptor editing has been proposed to occur whereby autoreactive TCRs are internalised and further rearrangement at the TCR a locus is permitted (McGargill et al., 2000). This was demonstrated using a transgenic TCR specific for a peptide of OVA in a mouse expressing this peptide specifically in the thymus. Why the binding of some autoreactive TCRs may activate this receptor editing pathway of negative selection compared to the apoptotic pathway initiated by others is not currently understood, but does seem to be an outcome intrinsic to the
37 TCR and antigen being recognised. When a different TCR (2C) and ligand (HY) were used in the system described above, deletion was the main outcome (Mayerova and Hogquist, 2004) and the choice between receptor editing and deletion was found to be unaffected by the cell type involved in presentation of the antigen within the thymus.
When a T cell exits the thymus and enters the peripheral immune system, the TCR(s) it bears on the cell surface are generally considered to be fixed, i.e. no further changes in TCR sequence occur. However, a study using a TCR Vp5 transgenic mouse demonstrated that the RAG genes could be re-expressed in peripheral CD4+ T lymphocytes, and that active V(D)J recombination was detectable in these cells (McMahan and Fink, 1998). In this study, this process of receptor revision was seen to occur over time, with numbers of V135+ cells in the periphery decreasing as mice aged, but it has also been reported to occur in response to stimulation with superantigen (Huang et al., 2002) and the notion that receptor revision is restricted to recent thymic emigrants still undergoing secondary rearrangement events has also been challenged (Cooper et al., 2003). Any changes in the TCR of a T cell once in the periphery and out of reach of thymic selection could be potentially dangerous to self as, although receptor revision may serve as a mechanism of peripheral tolerance and deletion, the generation of autoreactive TCR is also a possibility. In one study using non-obese diabetic (NOD) mice, which are susceptible to autoimmune diabetes, a population of peripheral, autoagressive, CD40+ T cells were seen to express RAG genes and alter their surface expression of Va (Vaitaitis et al., 2003). However, a good understanding of the importance of TCR revision in relation to disease mechanisms, peripheral tolerance or TCR repertoire expansion is still lacking.
1.8 Structure of the TCR/CD3 signalling complex
As previously discussed, the ar3 and y8 TCRs are both transmembrane heterodimers whose individual subunits are composed of rearranged V, D, J and C region sequences. Many crystal structures for both al3 TCRs and yo TCRs have now been solved (e.g. Garcia et al., 1996 and Allison et al., 2001). Each TCR chain is revealed
38 to form 2 immunoglobulin (Ig) like domains on the extracellular side of the cell membrane, one composed of rearranged V, D and J sequences and the other formed from part of the C region, although the Ig fold formed by the Ca region is atypical due to the absence of a top (3 sheet. A connecting peptide, the transmembrane domain and a short cytoplasmic tail are also encoded by the C regions and the two chains of each TCR are joined together by disulphide bonds. Cell surface expression of the TCR heterodimer is stabilised by, and is indeed dependent upon, association with another 3 protein dimers (CD3ye, CD38E and CD3t) and a TCR molecule at the cell surface in association with these additional polypeptides is known as the TCR/CD3complex (Samelson et al., 1985, Sussman et al., 1988 and Geisler, 1992). The extracellular domains of the y,E, and 8 chains also form Ig folds (Arnett et al., 2004 and Kjer- Nielsen et al., 2004) while the extracellular domains of the chains are only 9 amino acids in length and are of unknown structure. A schematic diagram of the 4 protein dimers that make up the TCR/CD3 complex is shown in figure 1.3. However, although the identity of the components of the complex are now fairly well established, the lack of a crystal structure for the complex in its entirety means that our understanding of the three dimensional organization of the complex is still incomplete. Although precise interactions between subunits, particularly the extracellular portions are ill defined, acidic and basic charged residues in the transmembrane helices of TCR and CD3 subunits, which are highly conserved, are known to play an important role in complex assembly (Call et al., 2002). In this study, isolation of radiolabelled assembly intermediates from the cell endoplasmic reticulum (ER), and a mutagenesis approach, allowed the exact transmembrane residue requirements of each intermediate to be determined. It was found that the intermediates of (TCRa - CD38E), (TCR(i - CD3yE) and (TCRa - CD3) all required one basic and two acid residues for assembly with the basic residues provided by transmembrane regions of the TCR chains and acidic residues by transmembrane regions of the CD3 chains. This study also provided evidence that each TCR/CD3 complex contained just a single TCR aP heterodimer, a concept that has been controversial, with other groups reporting evidence of multiple aP molecules per complex (Fernandez-Miguel et al., 1999). To date, the exact stoichiometry of the TCR/CD3 complex is still debated, but more
39 TCR CD4
8 6
H
(Raf--1 )
CSIlfjneurin
Transcriptional activation
Figure 1.3 Signalling pathways downstream of the T cell receptor. This schematic diagram shows the major components of the intracellular signalling pathways of T cell activation but does not cover all known proteins and interactions. Phosphorylation of ITAM motifs in the intracellular domains of the CD3 proteins by Lck results in recruitment and activation of ZAP-70. ZAP-70 phosphorylates the adaptor molecule LAT, which is then able to recruit a multitude of other adapter proteins and enzymes ultimately leading to activation of the transcriptional activation by the transcription factors AP-1, NF-xl3 and NFAT
40 recent evidence points towards the existence of both monovalent and multivalent complexes on the cell surface (Schamel et al., 2005) a finding that may have important implications for current models of TCR signalling.
Much is now known about the nature of the intracellular signalling events that occur following ligation of the TCR with a peptide/MHC complex (pMHC). A review of all of the different kinases, phosphatases and adapter molecules currently known to be involved in the propagation of a productive TCR signal will not be attempted here, but the main components of the signalling cascade are shown in figure 1.3. The earliest signalling events following TCR ligation are phosphorylation of immunoreceptor- tyrosine-based activation motif (ITAM) tyrosines in the intracellular domains of CD3 chains by the Src family kinases Lck and Fyn, although the contribution of Fyn under normal physiological conditions is thought to be minimal as it is largely unable to compensate for the loss of a functional Lck molecule (Straus and Weiss, 1992). The CD3 y, 8 and 6 chains each contain 1 ITAM while the CD3 chain contains 3 and phosphorylation of these motifs creates docking sites for the Src homology 2 (SH2) domains of the Syk family kinase ZAP-70 (Chan et al., 1991). Expression of the ITAM containing region of the CD3 chain as a chimeric transmembrane protein that is oligomerized by an extracellular stimulus such as a monoclonal antibody (Irving and Weiss, 1991) or the aggregation of chimeric proteins bearing ZAP-20 and Fyn as their intracellular components (Kolanus et al., 1993) are both able to transduce normal activation signals by themselves, independently of the rest of the TCR complex. Recruitment of ZAP-70 to the TCR/CD3 signalling complex results in phosphorylation of ZAP-70 by Lck at position Tyr-493 (Chan et al., 1995) and the critical importance of this molecule in normal T cell function is clear from the severe immunodeficiencies in both CD8÷ and CD4+ responses in patients which lack a functional ZAP-70 protein (Elder et al., 1994). Activated ZAP-70 then itself phosphorylates the adapter protein LAT (linker for activation of T cells) (Zhang et al., 1998), the multiple phosphotyrosine residues of which act to recruit the many other enzymes and linker proteins involved in the main Ras and Ca2+ mediated pathways of cell signalling (Zhang et al., 1999). Activation of these signalling pathways ultimately
41 lead to the activation of transcription factors such as AP-1 and NFAT (figure 1.3) which then act, often cooperatively (Jain et al., 1992) to direct the expression of the many different genes known to be upregulated during T cell activation. Binding sites for these transcription factors were originally identified in regulatory regions upstream of the interleukin-2 (IL-2) gene (Serfling et al., 1989 and Shaw et al., 1988) but a role in regulation of expression of many other proteins, particularly cytokine genes, is now known. Mice with T cells that lack the main lymphocyte NFAT proteins, NFAT1 and NFAT2, show deficiencies in many of the main effector outcomes of T cell activation (Peng et al., 2001) such as cytotoxicity, due to failure to upregulate effector molecules such as CD40 ligand and Fas ligand, and cytokine production, with production of cytokines such as IL-2, interferon-y (IFN-y), IL-4, IL-10, IL-5, and tumor necrosis factor-a (TNF-a) all severely impaired in these animals. The question of whether these generic T cell activation transcription factors can influence the effector phenotype of an activated T cell, for example in determining whether a T cell differentiates to become a Thl cell, producing predominantly IL-2 and IFN-y, or a Th2 cell, producing cytokines such as IL-4, IL-5 and IL-13, has been much debated. The processes governing Thl and Th2 T cell differentiation will be discussed in more detail in a later section, but important studies addressing this issue include those utilising mice deficient in one or other of the NFAT1 and NFAT2 proteins. Mice lacking NFAT1 show impaired IFN-y production by activated T cells (Kiani et al., 2001), are more susceptible to infections that rely on the development of a Thl effector cell response (Kiani et al., 1997) and show exacerbated Th2 type responses (Ranger et al., 1998a). Conversely, NFAT2 deficient T cells show impaired IL-4 production (Yoshida et al., 1998) and reduced titres of the IL-4 dependent antibody isotypes IgG1 and IgE (Ranger et al., 1998b). However, from more recent data, the simplistic explanation of these knockout studies, that NFAT1 positively regulates Thl cell differentiation but negatively regulates Th2 cell differentiation and that NFAT2 is required for Th2 cell differentiation, has not held true. Expression of constitutively active forms of NFAT1 and NFAT2 are both able to induce transcription of Thl (Porter and Clipstone, 2002) and Th2 cytokines (Monticelli and Rao, 2002) and cooperative binding of NFAT1 with Thl and Th2 lineage specific transcription factors
42 has been demonstrated in vivo at the promoter regions of both the IFN-y and IL-4 genes (Avni et al., 2002).
Although the TCR signalling cascade discussed in brief above was described as being mediated by a series of phosphorylation events, effective control over TCR signalling also requires the coordinated action of tyrosine phosphatases. Upon TCR engagement, increased protein tyrosine phosphorylation within the cell is detectable within a matter of just a few seconds (June et al., 1990). However, to be a well controlled signalling mechanism, the tyrosine residues in question must be kept in an unphosphorylated state prior to TCR ligation. In keeping with this, treatment of T cells with pervanadate, a protein tyrosine phosphatase inhibitor, results in activation of some of the tyrosine kinase mediated signalling events normally associated with ligation of the TCR, such as activation of Lck, and the induction of some effector outcomes of TCR signalling, such as production of IL-2 (Secrist et al., 1993). In relation to T cell signalling, the most well studied tyrosine phosphatase protein to date is CD45 (Tonks et al., 1988). CD45 is a membrane bound protein expressed on the surface of all nucleated hematopoietic cells, a deficiency in which results in profound defects in T cell development and function (Mee et al., 1999 and Weaver et al., 1991). Perhaps counter intuitively to the findings of the pervanadate experiment described above, CD45-/- T cells show an increase in the strength of the TCR stimulus that is required for TCR signalling (Mee et al., 1999). This can be explained by the action of CD45 phosphatase activity on the protein tyrosine kinase, Lck. CD45 activity was found to keep Lck in an easily activated form by removal of a tyrosine phosphate that negatively regulates the kinase activity of this protein (Mustelin et al., 1989). The balance between phosphorylation and dephosphorylation of proteins that make up and surround the TCR/CD3 signalling complex is therefore of paramount importance in dictating whether or not a TCR mediated signalling event is propagated into the T cell. How ligation of the TCR leads to the triggering of these signalling events and how the nature of ligand binding to TCR is interpreted by the signalling machinery to lead to different T cell effector outcomes is still very poorly understood and multiple different models of TCR triggering have been proposed.
43 1.9 pMHC binding by TCR
Although the way in which the TCR activation signal is propagated from TCR ligation to initiation of intracellular signalling events is poorly defined, better understood is the nature of the physical interaction between the TCR and its pMHC, studies of which have helped to shed some light on possible mechanisms of TCR triggering. Despite the technical difficulties involved in crystallising complexes of multiple, multimeric, transmembrane proteins, the crystal structures of at least 24 TCRs bound to either class I or class II pMHC complexes have been solved (Garcia et al., 1996 and Reinherz et al., 1999). In terms of the pMHC structure being recognised by the TCR, the general architecture of class I and class II MHC molecule peptide binding grooves are quite similar, with the floor of the groove formed by a seven stranded (3 sheet and sides of the groove by two long a helices. However, differences in the pMHC surface which must be bound by TCR are brought about by the different lengths of peptide bound preferentially by each class of MHC, with class I molecules tending to bind shorter peptides than those bound by class II molecules (Stern and Wiley, 1994). Class I MHC molecules generally bind peptides of 8-10 residues in length, the termini of which are anchored into the peptide binding groove by conserved, MHC allele specific, pockets (Colbert et al., 1993). These conserved pockets mean that allele specific motifs in peptides binding to a particular MHC molecule have also been identified (Falk et al., 1991). The anchoring of peptide termini in MHC class I complexes results in longer peptides being forced to bulge out of the binding groove (Speir et al., 2001) and, along with generally shallower binding of peptide in the groove, means that peptide residues in MHC class I complexes are generally more accessible to the TCR. However, as the termini of peptides bound to MHC class II molecules are not fixed, and class II molecules are able to bind peptides of significantly longer length, peptide termini extending from the ends of MHC class II peptide binding grooves can also play a major role in interacting with the TCR (Carson et al., 1997). Despite recognition of different MHC molecules bound to peptides of different lengths and conformations, the general orientation of the TCR, with respect to pMHC, upon binding is seen to be relatively similar between
44 complexes. Generally the TCR molecule binds such that its orientation is diagonal with respect to the MHC peptide-binding groove. The Va and VP domains of the TCR lie over the N and C terminal portions of the peptide respectively and the majority of peptide contacts are made via the hypervariable CDR3a and CDR.3(3 loops. Contacts with the MHC a helices that form the walls of the peptide binding groove are made predominantly by the less variable and germline encoded CDR1 and CDR2 regions, although peptide contacts with these loops have also been noted (Garcia et al., 1996). Although, from the structural data obtained to date for different TCR/pMHC complexes, this diagonal mode of binding is by far the most commonly observed, there are notable exceptions. For example, recently solved structures of two autoimmune TCRs binding to their pMHC ligands revealed that compared to other conventional TCR binding positions, these MBP specific autoimmune TCRs were not centred over the pMHC surface, but were shifted towards the N terminus of the peptide (Hahn et al., 2005 and Li et al., 2005). Determining whether an unusual binding pattern is a general feature of autoreactive TCRs requires the resolution of many more structures, not least because the features of a TCR or pMHC that define conventional binding are still not clear. Although at the level of each individual TCR/pMHC whose structure has been solved, the precise residues involved in binding of the TCR in this orientation can be identified, there are as yet no general rules to describe the location and identity of residues involved in this docking and resultant MHC restriction of TCR. Indeed, different TCRs recognising the same pMHC complex have been shown to use assume the same orientation, yet use completely different TCR amino acids for binding (Ding et al., 1998) and in a recent study, the same TCR was shown to utilise different binding residues and adopt an altered orientation when binding to a self versus a foreign MHC molecule (Colf et al., 2007). This data argues against the presence of conserved residues in TCR molecules that dictate binding orientation, although some amino acid positions are suggested to make more frequent contacts than others and analysis of TCR reactivity to MHC from T cells which had not undergone negative or positive selection suggested that MHC reactivity is indeed an inherent feature of TCR germline sequences (Zerrahn et al., 1997). More convincing data to explain MHC restriction comes from study of
45 residues in the MHC molecule itself. When all known structures are compared, several MHC residues are consistently observed to make important contacts, for example residues a65 and a155 of MHC class I molecules. These residues were also recently shown to be 2 of only 3 residues involved in binding to TCR in a complex with a highly bulged peptide which severely restricted possible TCR/MHC interactions (Tynan et al., 2005). The authors of this study proposed binding via these residues to comprise the minimal "generic footprint" of MHC restriction, but in the absence of many more conserved TCR and MHC contacts other mechanisms that drive the docking of the TCR with a pMHC complex have been proposed. To reconcile the need for a TCR to scan many different pMHC complexes on the surface of an APC but then to initiate signalling and T cell activation only when specific binding is achieved, a two step mechanism of TCR binding to pMHC has been put forward (Wu et al., 2002). This study, using a mutagenesis approach and measurement of TCR/pMHC binding interactions using surface plasmon resonance, demonstrated that mutation of MHC contact residues had a profound effect on initial association of the TCR with pMHC but that these residues contributed very little to the overall stability of the interaction. Conversely, mutations of peptide contacts profoundly influenced the stability of the complex, affecting off rates of binding, but made only a minor contribution to complex association. The model therefore proposes that initial interactions between the TCR and MHC guide and position the receptor over the peptide ligand and that the TCR, most likely using the CDR3 loops, then forms a more stable interaction with its ligand which, if of sufficiently high affinity, will allow transmission of a positive signal and activation of the T cell.
1.10 TCR binding affinity and conformational change
Interactions between TCRs and pMHC are usually characterised as being of relatively low affinity with slow association rates and faster dissociation rates (Matsui et al., 1994). That the low affinity of this interaction may be due to insufficient contacts between the TCR and the pMHC is not supported by extensive interactions revealed by structural studies. Instead, the demonstration that the kinetics of binding becomes
46 faster with increased temperature (Boniface et al., 1999) led to an induced fit model of TCR binding where productive binding required the TCR to overcome a large energy barrier. Calculation of binding energies showed that binding was associated with unfavourable changes in entropy (Willcox et al., 1999), which suggests an increase in molecule ordering. This could be brought about by conformational changes, and as a consequence reduced flexibility, of a part of the TCR/pMHC complex itself, or by the incorporation of ordered water molecules at the binding interface. As water molecules are excluded from the TCR/pMHC interface upon binding this does not seem a likely explanation for unfavourable entropy. Instead, structural studies support a model in which parts of the TCR, particularly the CDR3 loops, undergo a conformational change on binding, such that a greater number of contacts are made with the peptide and stability of the complex is increased (Garcia et al., 1998 and Reiser et al., 2002). However, a more recent analysis of the well studied LC13 TCR, specific for an Epstein-Barr virus (EBV) peptide, showed that not all TCR/pMHC interactions conform to this thermodynamic model of binding (Ely et al., 2006). In this study, CDR loops were found to be well ordered in the unliganded state suggesting that in this case, although a conformational change did occur on binding, binding was entropically favoured rather than disfavoured. Another study with the same TCR molecule used mutagenesis and surface plasmon resonance to examine the contribution of binding energy from the CDR1, CDR2 and CDR3 loops of this receptor. Contrary to the two-step mechanism of binding described above, the CDR1 and CDR2 loops were found to contribute only minimally to ligand binding with stabilization of the complex mediated mainly by the CDR3 loops (Borg et al., 2005). Despite increasingly apparent differences in the binding mechanisms employed by different TCR/pMHC complexes, the important contribution made by the CDR3 loops to binding affinity and specificity, but also degeneracy, is clear. That the flexibility of the CDR3 loops, and therefore their ability to undergo conformational change on ligand binding, could explain how a single receptor is able cross react with multiple peptides, has been demonstrated using structural studies where the structure of a single TCR was solved in complex with different peptides bound to the same MHC molecule (Reiser et al., 2003). CDR3 loops were found to adopt very different conformations
47 depending on the ligand bound, although changes in other parts of the molecule were also observed. Indeed, specificity of binding has recently been shown to be influenced by residues of the pMHC molecule that do not make any direct contacts with the TCR molecule at all (Huseby et al., 2006).
Despite the ability of many TCRs to bind multiple ligands, the affinity of this binding is invariably not the same. That this is because the TCR molecule is flexible only up to a point was addressed in a recent study using a single TCR recognising 3 structurally distinct peptides (Mazza et al., 2007). Although overall binding orientations in the 3 structures were comparable, different peptide structures forced some adaptation of the TCR molecule which, when combined with the retention of many TCR/MHCa helix contacts, resulted in suboptimal and lower affinity binding interactions with some peptides compared to others. Suboptimal binding was associated with impaired effector outcomes of T cell activation, such as reduced proliferation and IL-2 production. The observation that TCR/pMHC interactions of different affinity can result in different functional outcomes for the T cell is a well documented one (Sykulev et al., 1994, Matsui et al., 1994). Studies linking TCR binding affinity to effector outcome have been used to investigate processes such as thymocyte positive selection (Alam et al., 1996) and many different groups have reported the ability to generate receptors with increased affinity for pMHC by mutating residues of the TCR, most commonly in the CDR1, CDR2 or CDR3 regions (Chlewicki et al., 2005 and Manning et al., 1999). However, as mentioned previously, the way in which information about the affinity of the TCR binding interaction is transmitted into the cell to initiate the TCR signalling machinery, and how different biological outcomes might arise from the transmission of this information is still poorly understood. Some of the different mechanisms that have been proposed to explain the process of TCR triggering are discussed below.
48 1.11 TCR triggering
The two earliest models of TCR triggering were based on the concepts of multimerization and conformational change. The multimerization model proposed that specific pMHC binding by TCRs would result in clustering of pMHC/TCR complexes at the cell surface, bringing intracellular signalling molecules into close proximity with one another and allowing signalling to be initiated. Evidence was provided by the demonstration that, in solution, TCR/pMHC complexes could oligomerise upon ligand binding (Reich et al., 1997). However, these results were subsequently disputed (Baker and Wiley, 2001) and, as this model requires the simultaneous ligation of multiple TCR molecules, the observation that a T cell could be activated by just a single pMHC could not be explained (Sykulev et al., 1996 and Irvine et al., 2002). To resolve this problem variants of the multimerization model have been proposed (Trautrnann and Randriamampita, 2003), such as the heterodimerization model, where triggering is initiated by simultaneous pMHC binding of the TCR and its CD4 or CD8 co-receptor (Delon et al., 1998), and the pseudo-dimerisation model, where TCR oligomers form by engagement of both specific peptide and self peptide MHC (Irvine et al., 2002). As for the multimerization model however, some data remains unexplained by these mechanisms. Mice that lack co-receptors are still able to mount effector T cell responses (Schilham et al., 1993) and the same is true for T cells with greatly reduced expression of self-peptide MHC (Sporri and e Sousa, 2002). Conformational change has been another mechanism proposed to explain TCR triggering. Small scale conformational changes that occur in the TCR molecule, particularly the CDR loops, upon ligand binding have now been noted from comparisons of non-ligated and ligated structures of several TCRs (Garcia et al., 1998 and Reiser et al., 2002). However, with the exception of one study, where upon ligand binding a conformational change in the TCRa constant domain was observed (Kjer-Nielsen et al., 2003), large conformational changes in the extracellular domains or constant regions of the TCR have not been seen and so argue against a mechanism of signal transduction by conformational changes through the TCRaf3 heterodimer itself. In support of a
49 conformational change mechanism though, thermodynamic data of TCR binding does find a relationship between flexibility at the TCR/pMHC interface and T cell activation (Krogsgaard et al., 2003) and more recently attention has focused on the idea that binding induces changes in the structural relationship between the TCRar3 heterodimer and CD3 components of the signalling complex. A study using a yeast two-hybrid approach, to identify molecules that bind to the CD3 subunits of the signalling complex during T cell activation, showed that an adaptor protein, Nck, binds to a proline-rich sequence present in the cytoplasmic tail of CDR. This sequence was only available for Nck binding following ligation of the TCR and was proposed to be exposed as a consequence of a conformational change induced by ligand binding (Gil et al., 2002). Studies subsequently showed that this conformational change occurred in thymocytes upon presentation by MHC of both positively and negatively selecting peptides (Gil et al., 2005) although more recently conformational change was found to be more associated with thymocytes undergoing negative selection than positive selection (Risueno et al., 2006) suggesting that rather than being an all or nothing event, conformational change could be a mechanism by which the T cell could transmit information about the strength of TCR/pMHC interactions. It remains to be seen whether the cytoplasmic tails of other CD3 proteins may show similar rearrangements upon TCR ligation, and the normal T cell development observed in mice that lack this proline rich sequence of CDR has called into question the real importance of this conformational change in the mechanism of TCR triggering (Szymczak et al., 2005).
A third model of TCR triggering also gaining experimental support is the kinetic segregation model (van der Merwe et al., 2000). This model hypothesises that, in a resting cell, phosphorylation of signalling molecules is maintained at a low level by tyrosine phosphatases such as CD45 and CD148 and signalling is therefore not initiated. Upon ligation of the TCR, proteins at the cell surface passively segregate according to size, with larger molecules such as CD45, CD148 and LFA-1 becoming separated from the smaller proteins that comprise the TCR signalling complex. The exclusion of bulky phosphatases from around TCR signalling molecules means that,
50 once phosphorylated, they are more likely to remain that way and, as TCR/pMHC binding would be likely to prohibit the diffusion of signalling complexes away from these small contact zones, a TCR signal can be potentiated. The advantage of this model over those already discussed is that it is able to explain observations of ligand- independent triggering, for example where CTLA-4 is able to inhibit T cell activation in the absence of its ligand, B7 (Chikuma et al., 2005), as the presence or absence of phosphatases around the signalling machinery is mediated by passive diffusion rather than a specific ligation signal. In support of this kinetic segregation model both CD45 and CD148 are found to be excluded from sites of TCR triggering (Bunnell et al., 2002 and Lin and Weiss, 2003). In the study involving CD148 (Lin and Weiss, 2003), chimeric proteins were used to demonstrate that exclusion was mediated, in large part, by presence of the bulky extracellular domain of the protein and that if the intracellular phosphatase domain was targeted to the immune synapse by creating a fusion protein with the adapter molecule LAT, signalling through the TCR could be inhibited. Further evidence that the segregation of molecules is dependent upon the sizes of their extracellular domains and that this process is important in TCR triggering was also provided by a study in which the size of an MHC class I extracellular domain was increased using immunoglobulin spacers. A larger MHC molecule was associated with reduced TCR triggering with very little depletion of CD45 at the site of cell contact, but no effect on ligation of the TCR with pMHC was observed (Choudhuri et al., 2005). That protein segregation alone is sufficient to mediate TCR triggering has yet to be demonstrated and it is possible that several of the proposed mechanisms discussed here may act together in controlling this process. Indeed a recent study examining the requirement of the CDR conformational change for activation has reported that the conformational change induced in this subunit must be accompanied by TCR/pMHC clustering in order to be productive (Minguet et al., 2007).
Whatever the answer to the question of how TCR triggering is initiated, a slightly separate issue is one of how the TCR signalling complex interprets the variable binding properties of different pMHC ligands in order to generate different effector outcomes, whether that be positive versus negative thymic selection (Alam et al.,
51 1996) or other effector decisions such as CD4+ T cell differentiation (Lezzi et al., 1999). Differences in phosphorylation states of TCR signalling molecules in response to different ligands have been well documented (Sloan-Lancaster et al., 1994 and Madrenas et al., 1995) but several hypotheses exist for how these different signalling patterns may be achieved. The idea that conformational changes may occur in the signalling complex to different extents depending on the nature of the TCR/pMHC binding interaction has been mentioned above, but currently there is very little data to support this idea. More widely accepted is the view that information about binding is transmitted into the cell via serial triggering events (Lanzavecchia et al., 1999) and that signalling is therefore dependent upon the half-life or "dwell time" of the TCR/pMHC complex. This model proposes that a threshold number of TCRs must be engaged for T cell activation and that each pMHC can serially engage multiple TCRs. The shorter the half-life of a pMHC, the less efficient the triggering will be and the longer it will take to reach the required threshold. Equally however, if the half-life of a complex exceeds the time required to trigger the TCR, efficiency of signalling will also be decreased as less serial engagements will occur within a given time period. Consistent with this theory were the findings of a mutagenesis study where mutations in the antigen binding site of a TCR were used to increase or decrease the half-life of the TCR/pMHC complex (Kalergis et al., 2001). Mutations that resulted in decreased and increased half-lives of TCR/pMHC complexes, as measured by binding to pMHC tetramers, both resulted in impaired T cell activation. Additional evidence that TCR/pMHC complexes with a short half-life have been associated with incomplete phosphorylation of the CD3 chain also supports this hypothesis (Kersh et al., 1998) highlighting the importance of binding kinetics and serial phosphorylation events in TCR signalling. Some data however remains unexplained by this model, such as the observation that the binding of TCR/pMHC complexes with very similar half-lives can result in very different functional outcomes (Baker et al., 2000).
Although the preceding discussion has addressed the central role of the TCR and its associated signalling molecules in T cell activation, in a normal biological setting, the complex does not act alone and many other molecules and mechanisms interact to
52 elicit the final effector outcome for the T cell. T cell contact with an antigen presenting cell (APC) can last for many hours (Stoll et al., 2002). During this time TCR/pMHC complexes, but also other receptor/ligand pairs including co-stimulatory molecules (e.g. CD28-B7) and adhesion molecules (e.g. LFA-1-ICAM-1) accumulate and adopt a defined arrangement at the T cell-APC interface which is now referred to as the "immune synapse" (Monks et al., 1998). Although formation of the immune synapse is dependent upon signalling through the TCR, the myriad of other molecules present at this interface serves to highlight the many other mechanisms that must be considered when deciphering the pathway to a functional outcome of T cell activation.
This thesis will attempt to define the role that cq3 TCR structure has in influencing the outcome of CD4+ T cell differentiation into T cells of different effector phenotypes. The nature of the signal that a T cell receives through its TCR is known to have some influence over this process, but many other factors and signalling pathways have also been implicated. The process of CD4÷ T cell differentiation and the mechanisms that may be involved in its control are discussed below.
1.12 CD4+ T cell phenotype
The two major lineages of cq3 TCR bearing T cells that emerge from the thymus are classified according to their expression of co-receptors. Cells bearing the co-receptor CD8 are termed CD8+, but when activated are also referred to as cytotoxic T cells due to their primary function in killing infected target cells (Blanchard et al., 1987). CD8+ T cells will not be discussed further here, but instead attention focussed on cells bearing the co-receptor CD4, termed CD4+ T cells. CD4+ T cells are also known as T helper (Th) cells and have been shown to play a role in many different types of immune response, mainly through their ability to co-ordinate the actions of other cell types into a response appropriate to the initial insult or infection. This functional diversity of CD4+ T cells was partly explained by the findings of Mosmann et al. that mouse CD4+ T cell clones could be classified into distinct populations (named Thl and Th2) on the basis of their patterns of cytokine production. It was subsequently
53 found that these different cytokine patterns could be linked to the different functional properties of these cells (Mosmann and Coffman, 1989). Thl cells produce mainly IL-2 and IFN-y, are involved in cell mediated inflammatory reactions such as those in response to bacterial infections (Andersen et al., 1995) and have been implicated in a variety of autoimmune diseases (Trembleau et al., 1995). Th2 cells can produce IL-4, IL-5, IL-9, IL-10 and IL-13 and are involved in expulsion of extracellular parasites (Bancroft et al., 1994) as well as strong antibody reactions and allergy (Robinson et al., 1992). This fundamental role of Thl and Th2 cells in adaptive immunity, and the finding that populations of these highly polarised cells can be identified in a variety of disease states means that there is much interest in understanding the mechanisms involved in their generation. The many factors now known to be involved in Thl versus Th2 differentiation, including the hypothesis that the structure of the ap TCR may be important, are discussed in the section below. However, since the original classification of CD4+ T cells into one or other of these subsets, other populations of CD4+ T cells that are distinct from Thl or Th2 have also been identified.
Aside from Thl and Th2 effector cells, the CD4+ T cell subset on which the most attention has been focused in recent years is the regulatory CD4+ T cell (Treg). Most commonly, Tregs are now defined by the expression of CD4 and CD25 at the cell surface and by their ability to downregulate the immune responses mediated by other T cell subsets. Depletion of lymph node cells and splenocytes of CD4+CD25+ T cells, and then transfer of the remaining cells into nude BALB/c mice, results in the development of spontaneous autoimmune pathologies (Sakaguichi et al., 1995). However, the mode of action of T„g cells remains ill defined. Cytokines that have been implicated in the suppressive mechanisms of CD4+CD25+ T cells include IL-10 and transforming growth factor p (TGF(3). CD4+CD25+ T cells have been shown to produce IL-10 in vivo (Annacker et al., 2001) and IL-10 production by these cells mediates suppression of some forms of autoimmunity, although others are IL-10 independent (Surf-Payer and Cantor, 2001). For TGFP there is little evidence to suggest that CD4+CD25+ T cells mediate suppression of CD4+ T cells via this cytokine, but TGFP mediated suppression of CD8+ T cells has been documented
54 (Chen M et al., 2005). Other proposed modes of action are based on mechanisms of direct cell-cell contact as T cells deficient in the co-stimulatory molecules CD80 and CD86 are resistant to suppression (Paust et al., 2004). That regulatory T cells may develop during the process of thymic selection has already been mentioned and central to this process is TCR signalling. Mice deficient in two downstream molecules of TCR signalling, Bc1-10 and PKC-O have reduced numbers of Treg cells (Schmidt- Supprian et al., 2004) and understanding the signalling mechanisms and genetics of Treg lineage commitment was greatly advanced by the identification of the supposed CD4+CD25+ T cell specific transcription factor, Foxp3 (Hori et al., 2003 and Fontenot et al., 2005). A recent study in which the Cre recombinase system of gene targeting (discussed later) was used to ablate Foxp3 expression specifically in Treg cells resulted in an altered cytokine expression profile towards Thl cytokines such as IL-2 and IFN- y, an altered pattern of gene expression where genes known to be controlled by Foxp3 such as Socs2 and Ctla-4 were downregulated, and a loss of suppressor function (Williams and Rudensky, 2007). Many gene targets of the Foxp3 transcription factor are now being identified and the recent identification of other transcription factors that cooperate with Foxp3 (Wu et al., 2006 and Ono et al., 2007) should enable rapid identification of the patterns and sequences of gene expression that are required to bestow regulatory cell phenotype and function.
Another CD4+ T cell lineage specific transcription factor recently identified is RORyt, reported to be expressed by the newly described Th17 subset of CD4+ T cells (Ivanov et al., 2006) that have been associated with inflammatory responses such as those seen in autoimmunity (Langrish et al., 2005). Th17 cells were identified as a subset of T cells whose differentiation could be induced by the cytokine IL-23 (Aggarwal et al., 2003) and it is known that mice deficient in IL-23 are resistant to several autoimmune diseases, such as experimental autoimmune encephalomyelitis (EAE) (Cua et al., 2003). This link with IL-17 producing cells and the demonstration that proteolipoprotein (PLP) specific, IL-17 producing T cells could induce EAE when transferred into naive mice while classical Thl cells could not (Langrish et al., 2005) helped to explain why previous data regarding the pathogenicity of Thl responses was
55 confusing. Data showing that ablation of Thl responses can in fact worsen autoimmune disease (Ferber et al., 1996) can now be reconciled with data showing a reciprocal relationship between Thl, Th2, Th17 and indeed Treg cells where cytokines promoting the development of one subset act to prevent the development of others (Park et al., 2005 and Bettelli et al., 2006). This concept of antagonistic development of one subset by another will be discussed further in the section below in relation to Thl and Th2 cell differentiation, but it is becoming ever clearer that the original classification of CD4+ T cells into either Thl or Th2 is no longer by any means the whole picture and it is likely that in the future, important roles of other subsets of CD4+ T cells, in addition to the ones discussed here, will be elucidated.
1.13 Thl and Th2 cell differentiation
One of the most important and well described factors influencing CD4+ T cell differentiation is local cytokine environment. Among the most well characterised Thl promoting cytokines is IL-12. IL-12 is a heterodimer composed of p40 and p35 subunits, and is produced primarily by antigen presenting cells, including macrophages, monocytes and dendritic cells (Macatonia et al., 1995). Mice deficient in IL-12 are impaired, although not completely lacking, in their ability to produce IFN-y and mount an effective Thl response (Magram et al., 1996) and exogenous addition of this cytokine is now used extensively in vitro as a means to generate a Thl phenotype in primary T cells. IL-12 acts via the signal transducer and activator of transcription 4 (STAT4), following binding to the IL-12 receptor on the surface of the T cell and, primarily, activation of this signalling pathway leads to the upregulation of IFN-y expression (Thierfelder et al., 1996). The residual IFN-y production in IL-12 deficient mice also points towards the importance of other cytokines in the development of Thl responses and IFN-y itself, as well as other cytokines such as IL- 18, IL-27 and IFN-a have all been implicated (Schmitt et al., 1994, Kohno et al., 1997 and Hibbert et al., 2003). Important in the understanding of Thl phenotype development was the discovery of the Thl lineage specific transcription factor, Tbet. T-bet is a member of the T-box family of transcription factors and the antagonistic
56 nature of Thl versus Th2 differentiation is exemplified by the demonstration that IFN- y production can be induced, and IL-4 and IL-5 production repressed, by the introduction of Tbet into T cells that were defined as having a Th2 phenotype (Szabo et al., 2000). In addition, mice lacking Tbet spontaneously develop a phenotype similar to that seen in human asthma, a predominantly Th2 mediated disease (Finotto et al., 2002). Lineage specific transcription factors identified in Th2 cells include GATA-3 and c-maf (Zheng and Flavell, 1997 and Ho et al., 1996) and as observed for T-bet, ectopic expression of GATA-3 can induce Th2 cytokine production in committed Thl cells (Lee et al., 2000). GATA-3 expression is induced in Th2 differentiating cells by the transcription factor STAT6, which is activated by T cell binding of the main Th2 promoting cytokine, IL-4. Additionally very recent data suggests that GATA-3 expression is additionally regulated by Notch signals (Fang et al., 2007). T cells from IL-4, STAT6 and GATA-3 knockout mice are all greatly impaired in their ability to undergo differentiation into Th2 cells (Kopf et al., 1993, Shimoda et al., 1996 and Pai et al., 2004). Less is known about the regulation of the c-maf transcription factor, but more recently signalling via IL-6 and the TCR were both implicated (Yang et al., 2005). A schematic diagram of the main cytokines and transcription factors involved in the differentiation of Thl and Th2 cells is shown in figure 1.4. As well as the action of Thl and Th2 associated transcription factors in directly promoting the expression of some cytokines and repression of others, epigenetic mechanisms involving chromatin remodelling and locus accessibility have been proposed to explain the fixed phenotype of fully differentiated T cells and the heritability of phenotype as cells proliferate and clonally expand during the course of an immune response. In support of this, additional DNase I hypersensitivity sites (HS), indicators of increased locus accessibility, appear at the 114 locus and Ifng locus in Th2 and Thl differentiating cells respectively (Agarwal and Rao, 1998) and changes in acetylation and methylation, other markers of chromatin remodelling, have also been observed (Avni et al., 2002 and Lee et al., 2002). There is evidence that lineage specific transcription factors are involved in mediating these epigenetic changes, with ectopic expression of GATA-3 able to mediate chromatin remodelling at the 114 locus, even in Thl cells (Lee et al., 2000). However, a direct role for T-bet in
57 Naïve CD4f T cell
Thl CD4+ T cell Th2 CD4+ T cell
Figure 1.4 Cytokine environment and CD4+ T cell differentiation. Cytokines IL- 12 and IL-4 promote Thl and Th2 cell differentiation respectively. Intracellular signalling pathways activated by TCR and cytokine receptor ligation result in activation of the Stat protein and lineage specific transcription factors Tbet, GATA3 and cMaf. These transcription factors drive the expression of genes for Thl and Th2 CD4+ T cell differentiation, including the cytokines IFN-y and IL-4 which act to potentiate the development of Thl and Th2 cell lineages respectively.
58 modifications at the Ifng locus has recently been questioned with evidence suggesting that previously observed remodelling events at this locus maybe an indirect consequence of GATA-3 downregulation by the Thl transcription factor (Usui et al., 2006).
With the clear importance of cytokines in the process of CD4+ T cell differentiation, it follows that APCs, as the primary source of these cytokines during the initiation phase of an immune response, should also have an important role to play. The types of cytokines that an APC produces are greatly dependent upon the type of pathogen or stimulus that it meets. For example, dendritic cells mature into Th2 promoting effectors (DC2s) in the presence of protein extract from the parasite Schistosoma mansoni, but Thl promoting effectors (DC1s) result from exposure to toxins from intracellular bacteria (de Jong et al., 2002). Differential activation of Toll like receptors (TLRs) is proposed as one mechanism by which these different APC phenotypes arise. In one study, using an OVA based disease induction protocol, TLR2 ligation was associated with promotion of a Th2 type immune response, but TLR9 ligation with a more Thl type response (Redecke et al., 2004) and dendritic cells isolated from BALB/c mice infected with Chlarnydia show increased expression of TLR9 and can inhibit in vivo allergic responses to OVA when adoptively transferred (Han et al., 2004). However, understanding the possible effects of TLR ligation on differentiation are complicated by the presence of TLRs on T cells as well as APCs and a recent study has linked direct ligation of TLR2 on T cells to activation of Thl effector functions in already differentiated T cells (Imanishi et al., 2007). Also to be considered is the timing, cytokine environment and location of APC activation. Highlighting the temporal and historic importance of APC activation, one study showed that mice infected with Influenza virus 30 days before exposure to allergen developed more severe allergic disease than control animals (Dahl et al., 2004). The cytokine environment of the APC itself at the time of activation was also shown to have an influence on T cell differentiation in a murine model of Leishmania infection. BALB/c mice are normally susceptible to this pathogen as a result of a dominant Th2 immune response. When IL-4 was present in vivo during initial activation of DCs,
59 rather than during T cell priming, mice developed a Thl response and were resistant to disease (Biedermann et al., 2001). Other evidence suggests that the site at which the APC encounters antigen is also important and several studies have shown that antigen encountered by APC at mucosal sites, such as the lung and the intestine, preferentially induce Th2 cell differentiation, even in mouse strains that are strongly biased towards the development of Thl CD4 T cells (Constant et al., 2000 and Iwasaki and Kelsall, 1999). That some mouse strains, such as C57BL/6 and BALB/c are biased towards developing Thl and Th2 responses respectively suggests an important genetic component. Studies in this area have mainly focussed on MHC genotype (Murray et al., 1992), although a locus on murine chromosome 11 has also been implicated (Gorham et al., 1996).
As previously mentioned, the immune synapse that develops at the site of T cell-APC contact during activation contains many more proteins than just those of the TCR/pMHC complex. Co-stimulation is an important component of T cell activation and acts not only to deliver a second signal to the T cell on top of the signal received through the TCR, but also to increase the avidity (strength) of the T cell-APC interaction. The two main co-stimulatory molecules upregulated on APCs following encounter with antigen are B7-1 (CD80) and B7-2 (CD86) (Reiser et al., 1992 and Freeman et al., 1993). CD86 has been shown to preferentially induce IL-4 production (Freeman et al., 1995) and distinct regions in the cytoplasmic domain of CD28, the receptor for CD80 and CD86 on the surface of the T cell, that are required for Th2 differentiation have now been identified (Andres et al., 2004). There is also evidence that the co-stimulatory molecule OX40 as well as the CD4 molecule itself can play a supportive role in Th2 development (Ohshima et al., 1998 and Fowell et al., 1997). With the large array of other proteins on the surface of, and secreted by, both T cells and APCs, other molecules proposed to influence CD4+ T cell differentiation are continually being identified (Oosterwijk et al., 2007 and Lund et al., 2007 and Fang et al., 2007), but the challenge will be how to fit these into an already complex picture of decision making at the time of T cell priming.
60 1.14 The TCR and CD4+ T cell differentiation
Despite the importance of co-stimulation, key to the overall avidity of a T cell-APC interaction is the binding of TCR to its pMHC ligand, and there are now multiple lines of evidence pointing towards a role for both avidity and affinity of TCR/pMHC interactions in influencing CD4+ T cell differentiation. Indeed, some recent data tentatively suggests that for some TCR/pMHC interactions, TCR mediated signals alone, in the absence of co-stimulation, or Thl promoting cytokines and even T-bet, are sufficient to drive development of Thl cells (Ariga et al., 2007). That the strength of the signal received through the TCR can influence T cell effector outcome was supported by data on the duration of TCR signalling, where prolonged stimulation of naïve CD4+ T cells in vitro with pMHC and an anti-CD28 antibody was required to induce a Th2 phenotype (Lezzi et al., 1999). It can be imagined that the most simple way in which TCR/pMHC interactions could influence avidity of T cell-APC binding would be the number of binding interactions occurring at any given time, with a greater number of binding events increasing binding avidity. In support of this, both peptide dose and the density of MHC molecules on the surface of an APC have been shown to be important (DiMolfetto et al., 1998). Data on antigen dose are slightly conflicting and depend upon the antigen used in the study but, in general, very high and low doses of antigen elicit Th2 responses, while moderate and high antigen doses favour Thl responses (Constant et al., 1995 and Hosken et al., 1995). Alternatively, strength of TCR signalling could be influenced by the kinetics of binding and affinity for pMHC of each individual TCR molecule, i.e. at the level of structural interactions between the TCR and its pMHC ligand. Early evidence that this may be true came from studies using altered (mutated) peptide ligands (APLs). It was observed that amino acid substitutions in peptide ligands, usually by as little as just a single residue, could shift the effector cell phenotype of CD4+ T cells responding to this antigen from Thl to Th2 (Pfeiffer et al., 1995 and Tao et al., 1997). That these switches in T cell phenotype can alter disease outcome has also been seen in several studies involving the Thl mediated murine autoimmune disease, EAE (Brocke et al., 1996 and Nicholson et al., 1995). In the study by Nicholson et al. SJL mice, normally
61 susceptible to EAE induction using a peptide of PLP (PLP 139-151), were prevented from developing, or displayed greatly reduced severity of disease when immunised with an altered peptide ligand (Q144). Disease could be prevented by immunising with APL alone or in combination with the wild-type peptide and the adoptive transfer of T cell lines specific for APL Q144 could also confer protection. T cells isolated from mice immunised with Q144 were found to secrete the Th2 type cytokines IL-4 and IL-10 and were able to proliferate in response to both Q144 and the native peptide. This suggested that T cells were able generate productive TCR signals in response to the mutated peptide and that Q144 was not simply acting as a competitive MHC blocker inhibiting productive TCR/pMHC interactions. The mutated residue of this APL was known to be the primary contact residue in TCR binding and a subsequent study revealed that the primary contact points of APL Q144 had shifted to residues 141 and 142, towards the N terminal end of the peptide (Das et al., 1997). Others had demonstrated APLs, described as antagonistic in these studies, to have reduced affinity for TCR (Lyons et al., 1996) and the generation of altered affinity TCR/pMHC interactions by mutating residues in the TCR itself has already been discussed. A link between mutations in TCR structure and CD4+ T cell differentiation came with the demonstration that a change in a single amino acid in the CDR2 region of a TCR could shift the immune response from Thl to Th2 (Blander et al., 2000). Taken together, all of this data leads to a hypothesis which suggests that the structure of a TCR and, as a consequence, the binding interaction between TCR and pMHC can bias CD4+ T cell differentiation, with high affinity interactions promoting Thl development and lower affinity interactions favouring a Th2 response.
However, despite this data, all of which involves manipulation of TCR interactions artificially in vitro, what is the relevance in vivo to any role that TCR structure may have in determining the CD4+ T cell phenotype of populations of T cells with a normal and diverse repertoire of TCRs? The finding that TCRs with relatively high affinity can be selected and come to dominate the repertoire during the course of an immune response has been observed both in vivo and in vitro. In an in vitro study, PCR mutagenesis was used to mutate the CDR3a regions of TCRs and through successive
62 rounds of in vitro selection using a yeast expression system, high affinity mutants were found to become dominant (Holler et al., 2000). In vivo, pMHC multimers have been used to demonstrate expansion of both MHC class I and MHC class II restricted, high affinity TCRs, during development of an immune response to pathogen in mouse models of infection (Busch and Pamer, 1999 and Malherbe et al., 2000) and high affinity TCRs, sequences of which are conserved between patients, have also been seen in studies assessing T cell clonal dominance to human cytomegalovirus (HCMV) (Trautmann et al., 2005). In the study by Malherbe et al. looking at expansion of MHC class II restricted CD4+ T cells in mice during the course of infection with the Leishmania major parasite, T cell populations expanding in a resistant strain of mice (D10.D2), which develop a Thl type immune response to the pathogen, were found to bind pMHC with higher affinity and have a different pattern of Va and CDR3a usage to T cell populations expanding in the susceptible BALB/c strain of mouse, which develop a predominantly Th2 type response. Other studies have also observed selection of preferred CDR3 motifs during immune responses (McHeyzer-Williams et al., 1999). In this study, CDR3 sequences from T cells present at time points throughout the course of an immune response to whole pigeon cytochrome c (PCC) protein were analysed. By day 3, 40% of cells analysed were using CDR3 sequences containing at least 6 of 8 conserved features identified, for example a CDR3a length of 8 amino acids or a serine residue at position a95, and this rose to more than 80% after 2 weeks. In a subsequent memory response to PCC, 96% of T cells were using a restricted TCR. As, unlike B cells, T cells do not undergo affinity maturation (mutation of CDR amino acids to generate higher affinity ligand binding), the dominant sequences must have been selected from the original starting repertoire of pMHC specific TCRs. Combined, this data led to the idea that not only could preferred structural motifs be selected for during an immune response, but that the structural features selected may bear some relation to the phenotype of the cells responding, i.e. structural features of TCR selected during a Thl immune response may be different from those selected during a Th2 immune response. This question was addressed by a study in our laboratory, published in 2002, which determined the TCR gene usage, CDR3a and CDR313 sequences from T cell clones and lines selected
63 under Thl versus Th2 polarising conditions in vitro (Boyton et al., 2002). This study found that CD4+ T cell clones selected under Th2 polarising conditions favoured an elongated TCR CDR3a chain and from modelling studies predicted that these elongated TCR a chains may result in less optimal (lower affinity) interactions between the pMHC complex, which in this case was a PLP peptide (PLP 56-70) complexed to the MHC class II molecule I-Ag7, and CDR loops of the TCR. No clear V gene bias between Thl and Th2 cell derived TCRs was observed and there were no differences in the lengths of CDR3(3 regions. In short term Thl and Th2 polarised T cell lines, dominant Thl and Th2 TCR CDR3a sequences could be identified, and when oligonucleotides of these CDR3a sequences were radiolabelled and used to probe cDNA libraries of CDR3a sequences, it was found that the longer Th2 derived CDR3a motif was present only in Th2 lines while the shorter Thl CDR3a motif seemed to be permissible in both, although was more dominant in the Thl lines.
The hypothesis that emerged from this study was that, if structurally distinct TCRs arising from Thl and Th2 polarised T cells, i.e. a TCR bearing an elongated CDR3a region from a Th2 cell and a shorter CDR3a region from a Thl cell, are expressed transgenically, an inherent bias towards Thl or Th2 will be observed in CD4+ T cell responses from these animals. Chapters 3 and 4 of this thesis describe the generation and characterisation of such transgenic animals. Further to this hypothesis is a second question of whether these Thl and Th2 transgenic animals could be used to create new models of Thl and Th2 mediated disease. The lung is one organ in which understanding Thl and Th2 type responses is of much interest. The roles played by Thl and Th2 CD4+ T cells in human lung diseases are discussed below, and chapter 5 of this thesis describes the generation of a new transgenic model that could be of use in the modelling of these diseases in the mouse.
1.15 Thl and Th2 responses in human lung disease
CD4+ T cells in the lung are an area of major interest, as a number of lung diseases are believed to be associated with a bias for either Thl or Th2 type responses. Pulmonary
64 sarcoidosis is an example of a chronic lung disease that has been associated with a predominantly Thl type immune response (Moller et al., 1996) while asthma, bronchopulmonary aspergillosis and cryptogenic fibrosing alveolitis are among other diseases thought to be predominantly Th2 mediated (Robinson et al., 1992, Kurup et al., 1994 and Wallace et al., 1995). In most cases the underlying cause, or nature of the initiating insult to the lung, is not well understood and other major challenges still remaining include a good understanding of the regulation of lung inflammation, and the long term processes of repair and lung remodelling that occur in the context of prolonged, chronic, inflammatory responses.
Allergic asthma is probably the best studied lung disease thought to be associated with Th2 type responses. Many different allergens have been associated with asthma, but among the most common and well studied include proteins from the house dust mite, grass pollen and cat dander. Allergic asthma is characterised by airway hyperreactivity, which for the most part is reversible, high levels of IgE antibodies and airway inflammation. The main cell types found in the asthmatic lung are CD4+ T cells, eosinophils, mast cells, basophils and neutrophils, and cytokines found to be elevated in the lungs of asthmatics are predominantly of the Th2 type (Robinson et al., 1992). Since the discovery of a role for CD4+ T cells and Th2 cytokine production in allergy, much effort has gone into understanding the mechanisms by which they act to cause disease. A major function of IL-4 and IL-13 is to mediate IgE antibody class switching by B cells (Lebman and Coffman, 1988 and Punnonen et al., 1993). These cytokines function though activation of the transcription factor STAT6, which can synergise with the transcription factor NF-KB to promote germline transcription of IgE. The process of IgE transcription is also mediated by signalling through CD40 (Kawabe et al., 1994), the ligand for which is transiently expressed on T cells following antigen stimulation, and polymorphisms in the IL-4, IL-13 and CD40 genes have all been associated with high IgE levels in patients with asthma (Suzuki et al., 2000, Hunninghake et al., 2007, Park et al., 2007). IgE class switching is a process mediated by a germline recombination event, similar to those described above for TCR gene rearrangement, although it is RAG independent (Lansford et al., 1998). It
65 is proposed to occur predominantly in lymphoid tissue (Muramatsu et al., 1999) although active class switching in the bronchial mucosa of asthmatics has also been demonstrated (Takhar et al., 2007). IgE acts by binding to high affinity receptors (FCERI) on the surface of mast cells and basophils, and crosslinking of this IgE by specific antigens leads to the release of inflammatory mediators such as histamine, leukotrienes, enzymes and cytokines (Segal et al., 1977). Mast cell and basophil degranulation, and the release of these inflammatory mediators by specific IgE crosslinking in the lungs of asthmatics upon exposure to allergen, is proposed to be the initiating sequence of events in an asthmatic response. Consequences include mucus secretion, smooth muscle contraction and the recruitment of other effector cells to the lung, some of which contribute to the observed increase in airway hyperresponsiveness (AHR) that is synonymous with asthma. In keeping with an essential role for IgE in the early phase of an asthmatic response, administration of an anti-IgE antibody to asthmatic patients has been shown to inhibit allergen induced AHR (Fahy et al., 1997), although mouse models of asthma have demonstrated development of AHR and eosinophilia in the absence of IgE (Mehlhop et al., 1997). As such, the exact nature of the mechanisms behind the development of AHR are not yet fully understood and the roles played by inflammatory cells, such as the eosinophil, are still controversial. Recruitment of eosinophils to the lung is mediated by chemokines such as eotaxin (Ganzalo et al., 1996), and cytokines such as IL-5. Mice deficient in IL-5 fail to develop lung eosinophilia and AHR (Foster et al., 1996), and although this may be interpreted as evidence for a role for IL-5 and eosinophils in AHR development this has been complicated by the subsequent demonstration that this effect was dependent upon the genetic background of the IL-5-/- mice (Hogan et al., 1998). The key roles of the prototypic Th2 cytokines, IL-4, IL-5, and IL-13 discussed so far in the context of asthma serves to highlight the important role of Th2 type, allergen specific, CD4+ T cells in the pathogenesis of this disease, and with evidence that Thl cytokines are antagonistic towards the development of T cells with a Th2 phenotype (Wynn et al., 1995), the prospect that promotion of a Thl type environment may ameliorate Th2 mediated disease in the lung has provoked much interest. However, results have been conflicting and while some groups have
66 demonstrated reduced airway inflammation and AHR upon transfer of antigen specific Thl T cells in established mouse models of asthma (Huang et al., 2001), others have not, but have instead seen enhanced inflammatory cell recruitment to the lung (Hansen et al., 1999). In a recent study where IFN-y was overexpressed in the mouse lung, levels of IL-5 and IL-13 were found to be increased upon induction of allergic airway inflammation (Koch et al., 2006). Some studies have reported increased number of T cells expressing IFN-y in the lungs of patients with asthma (Krug et al., 1996) and viral infections, immune responses to which are predominantly Thl mediated, have been associated with an increased risk of developing this disease (Sigurs et al., 2005).
In the Thl associated lung disease of pulmonary sarcoidosis, although the pathology of the disease is well characterised in terms of the presence of granulomas, accumulation of activated CD4+ T lymphocytes and macrophages and production of Thl type cytokines (Moller et al., 1996), the antigen(s) to which the immune system is responding is not yet known. The presence of activated CD4+ T cells at the sites of disease has led to much research to try to identify the antigens for which these T cells are specific but, although some studies have reported some V gene bias in the TCRs of these lymphocytes, with bias being linked to MHC class II genotype (Grunewald et al., 2002), the activating peptides remain elusive. Some studies have pointed towards mycobacterial antigens as possible targets of T cell responses in sarcoidosis (Song et al., 2005 and Hajizadeh et al., 2007), although attempts to identify mycobacterium tuberculosis in sarcoid biopsies have been unsuccessful (Marcoval et al., 2005) and the possibility that Thl T cells in sarcoidosis may be responding to endogenous rather than bacterial antigens still remains. Additionally, the finding that patients with sarcoidosis are deficient in, or have greatly reduced numbers of, a recently described subset of CD 1 d-restricted NKT cells, which have immunoregulatory functions, has also led to the suggestion that defects in immune regulation may play a role in the development of this disease (Ho et al., 2005).
Despite the Thl type nature of immune responses during development of sarcoidosis, severe fibrosis is a common end point (Moller, 2003). Fibrosis is more commonly
67 associated with Th2 type responses, with cytokines IL-4, IL-5 and IL-13 all implicated in pathogenesis and in a common mouse model of fibrosis, promotion of Thl type immunity using IL-12 was seen to markedly reduce fibrotic disease development (Wynn et al., 1995). How the Thl environment of sarcoidosis may then lead to fibrosis is therefore unclear, although other pro-fibrotic mediators such as TGF-p are found to be expressed in the sarcoidosis lung (Zissel et al., 1996) and more recently polymorphisms in the gene for TGF-133 have been implicated in progression to fibrosis in sarcoid patients (Kruit et al., 2006). Fibrosis is a mechanism of tissue repair and occurs when connective tissue grows in place of normal parenchymal tissue. If limited to small areas of an organ, fibrosis is beneficial, as it can reverse tissue damage. However, if the process of fibrosis becomes continuous and progressive, organ function, particularly of those such as the lung, where tissue architecture is delicate, can become severely compromised and can ultimately cause organ failure.
A common fibrotic lung disease in humans is cryptogenic fibrosing alveolitis, one of a group of interstitial lung diseases that are characterised by lung inflammation and fibrosis. Lung infiltrates include activated T cells, macrophages, B cells and, in keeping with the Th2 nature of the disease, eosinophils and a Th2 like pattern of cytokines (Haslam et al., 1980 and Wallace et al., 1995). Similar to sarcoidosis, the exact nature of the lung antigens that initiate the disease process is unknown, however, the inflammatory pathways that lead to fibrosis are becoming better defined. Key roles for the cytokines IL-13 and TGF-P have been proposed. Overexpression of both of these cytokines in transgenic animals leads to severe fibrosis (Sime et al., 1997 and Zhu et al., 1999), while neutralisation can attenuate disease (Belperio et al., 2002). That this is not just a feature of all Th2 type cytokines was demonstrated by the lack of airway fibrosis seen in transgenic mice that overexpressed IL-4 (Rankin et al., 1996). Signalling pathways that mediate fibrosis and are initiated by these cytokines are still being elucidated, but IL-13 has been proposed to act in both a TGF-p dependent (Lee et al., 2001) and independent manner (Kaviratne et al., 2004). Signalling molecules shown recently to be upregulated by IL-13 include the chemokine receptor CCR5 and IL-11Ra and blocking the functions of both of these receptors ameliorated IL-13
68 induced inflammation and fibrosis (Ma et al., 2006 and Chen Q et al., 2005). The Smad3 signalling pathway has been implicated in TGF-13 mediated pulmonary fibrosis, with Smad3 mice shown to be resistant to the severe fibrosis induced by overexpression of TGF-13 in the lung (Bonniaud et al., 2004) and more recently, importance of the mitochondrial mediated pathway of apoptosis, involving the apoptosis proteins Bax and Bid has also been suggested (Kang et al., 2007). This demonstration of a link between TGF-I3 signalling and pathways of apoptosis provide an explanation for the dependence on epithelial cell apoptosis previously observed for TGF-13 induced fibrosis (Lee et al., 2004). Although fibrosis is the main pathology observed in lung diseases such as cryptogenic fibrosing alveolitis, that it is observed as a chronic component of other lung diseases, such as sarcoidosis, COPD and asthma, serves to highlight the interrelated nature of the many inflammatory and repair processes that can be initiated in the lung in response to a wide range of insults.
There is therefore still much to be learnt about the consequences of Thl and Th2 type immune responses in the lung and it is becoming increasingly clear that, far from being exclusively one type or the other, the pathogenesis of many lung diseases, particularly those that are chronic in nature, probably involves interplay between many different Thl and Th2 cytokine mediated mechanisms. A further level of complexity now arises from the description of Treg cells and more recently Th17 cells, a subset of CD4÷ T cells whose development can be antagonised by both Thl and Th2 type cytokines, and there will undoubtedly be many examples in the coming months of how these other T cell subsets may play a role in lung inflammation. IL-17 mRNA has been reported to be elevated in the sputum of asthmatic patients (Bullens et al., 2006) and in a study using Tbet /- mice discussed previously as having a spontaneous asthma like phenotype, increased neutrophilia in the airways of these mice has now been linked to a greater propensity of T cells from these mice to develop into IL-17 producing cells (Fujiwara et al., 2007). As a result, effective treatments for many of these diseases are unlikely to be achieved by blocking a single pathway. However, much of what is currently known about lung inflammation, and the apparent dependence of some pathologies on single mediators, has come from mouse models
69 using manipulation of single entities using transgenesis or monoclonal antibodies, and the induction of disease through conditions that may be far from physiologically normal. Some of the mouse models commonly used in the study of human lung disease are discussed below.
1.16 Mouse models of human lung disease
Many different mouse models now exist for the study of human lung disease. Some mimic specific disease pathologies such as granuloma formation, while others have achieved modelling of multiple disease outcomes, such as the AHR, lung inflammation and the high IgE levels that result from antigen challenge in several mouse models of asthma. The disease outcomes associated with the chronic Thl type and IFN-y mediated lung inflammation of diseases such as sarcoidosis and bronchiectasis have proved the hardest to model. Bronchiectasis is characterised by irreversible airway dilation and is found in association with chronic bronchial infection and inflammation. There are currently no good animal models of bronchiectasis, and while bacterial lung infection can be easily induced in the mouse (Cole et al., 2005), the irreversible changes in lung structure that occur in humans over long periods of time have proved harder to mimic. No spontaneous models have been described and our lack of understanding surrounding the processes involved in chronic airway structural change makes it difficult to arrive at a starting point in trying to establish an in vivo model. Likewise, there are currently no good models of sarcoidosis, although some protocols to induce granuloma formation in the mouse have been described. Early models investigated the use of human sarcoid tissue itself as an inducing agent, with granuloma formation in mice observed following inoculation with sarcoid tissue homogenate (Mitchell et al., 1976). However, results were not consistent, with others reporting similar granulomas when control tissue homogenates were used (Belcher and Reid, 1975) and this model as since fallen out of favour. Other approaches include the intravenous injection of complete Freund' s adjuvant in rats (Bergeron et al., 2001) and Schistosome mansoni or Propionibacterium acnes infection in mice (Wynn et al., 1993 and Nishiwaki et al.,
70 2004). However, the mechanisms of granuloma formation in these models remain poorly defined and indeed elucidation of mechanisms that are occurring in response to antigens irrelevant to the human disease of sarcoidosis may be misleading. This may be particularly true of Schistosome mansoni infection, where formation of granulomas is seen to be accompanied by a Th2 type pattern of cytokine expression (Wynn et al., 1993). However, in keeping with the Th2 nature of this disease model, S. mansoni infection is also used as a model of fibrosis (Wynn et al., 1995). In the S.mansoni model, fibrosis and granuloma formation occur in the liver. To model fibrosis in the lung, the most common protocols involve the infliction of lung injury using toxins or drugs. The antibiotic bleomycin is used most commonly (Adamson and Bowden, 1974) but the acute nature of the fibrotic disease caused by these agents raises doubts over whether they are faithful mimics of the slower but progressive tissue remodelling observed in diseases such as idiopathic pulmonary fibrosis. Another infection model that has been used to cause fibrosis in the lung uses Aspergillus fumigatus (Blease et al., 2002). Models using this pathogen are of particular interest as this fungus is known to be the cause of allergic bronchopulmonary aspergillosis and is associated with asthma. As such, many features of human asthma, such as AHR, eosinophilia and high levels of IgE, can be modelled in mice by exposure to this pathogen (Kurup et al., 1992).
Aside from the aspergillosis model, several different and well characterised murine systems now exist for the study of the more acute phases of allergic lung immune responses. The most commonly cited of these is the ovalbumin (OVA) model of murine asthma (Kung et al., 1994). Protocols for disease induction using the OVA model vary slightly, but the overall scheme of sensitisation to OVA by intraperitoneal (i.p) injection followed by exposure of the airways to the allergen, either as an aerosol or by intranasal administration, 2 or 3 weeks after the initial priming, is similar across most studies. Strains of mouse commonly used are BALB/c and C57BL/6 and mice sensitised and challenged with antigen demonstrate airway hyperresponsiveness, lung infiltrates dominated by allergen specific CD4+ T cells and eosinophils, Th2 type cytokines in the BAL and lung such as IL-4, IL-5 and IL-13, and high levels of
71 allergen specific serum IgE. The existence of transgenic mice that express a TCR (D011.10), specific for a peptide of OVA (OVA323-339) (Murphy et al., 1990) has made the use of this model even more widespread. These TCR transgenic mice have facilitated the development of adoptive transfer models of lung inflammation where lymphocytes from immunised TCR transgenic mice are cultured in vitro, often in Thi or Th2 polarising conditions, before being transferred by intravenous injection to naïve mice that are subsequently challenged with OVA (Randolph et al., 1999). In this way, allergen specific T cells can be tracked in vivo and this approach has allowed for a better understanding of the role of both Thl and Th2 CD4+ T cells in the development of allergy. In the context of human asthma, and indeed murine allergy, as no natural mouse allergens have been described, OVA is an irrelevant protein. The success of the model in generating a Th2 type disease profile is mediated in part by the inclusion of the Th2 promoting adjuvant, alum, in the priming stages of disease induction (Grun and Maurer, 1989). In this way, the OVA model of asthma is non-ideal as it predisposes the immune response towards a Th2 phenotype in a way that is independent of allergen, which in the case of OVA is also physiologically irrelevant to the human disease. The non-physiological nature of the immune response is also highlighted by the large doses of protein, administered over a period of many days, that are required to induce significant disease, compared to the relatively small doses of antigen that human asthmatics are proposed to be exposed to (Arshad et al., 1998). In order to more closely mimic human disease, other models that use human allergens have been developed, for example, the house dust mite allergen, DerP1 (Lee et al., 1999). However, disease induction protocols with DerP1 also require priming with alum and high antigen doses. More complicated attempts to create humanised mouse models of asthma have also used house dust mite allergy as their basis, with SCID mice reconstituted with peripheral blood mononuclear cells (PBMCs) from house dust mite allergic patients showing evidence of human cell inflammatory infiltrates and specific human IgE responses following challenge with antigen (Duez et al., 1996). Another drawback of original OVA and DerP1 disease induction protocols is that they fail to mimic the progressive fibrotic and remodelling processes that are seen to occur over the long term in the lungs of patients with more severe asthma. To try to model
72 these changes, existing protocols have been modified to include extended periods of allergen challenge. Signs of airway remodelling, such as goblet cell hyperplasia and collagen deposition, have been observed (McMillan and Lloyd, 2004) although similar to criticisms of acute airway inflammation, in these models, the doses of antigen required to elicit these pathologies in the murine lung are extremely high and unlikely to be physiologically similar to the human disease.
In addition to the use of exogenous agents, such as pathogens, drugs or proteins, transgenic mice have been used extensively, both in combination with the models so far described, and alone, to decipher more specifically the roles of individual molecules or pathways in the mechanisms and potential treatments of disease. For example, most of the cytokines associated with CD4+ T cell immune responses have now been overexpressed in the lung. Overexpression of IL-4, IL-5, IL-13, and IL-9 all result in spontaneous recruitment of inflammatory cells, particularly eosinophils and lymphocytes, to the airways and are also associated with other pathologies such as mucus hypersecretion, airway hyperresponsiveness, collagen deposition and fibrosis to varying degrees (Rankin et al., 1996, Lee et al., 1997, Zhu et al., 1999, and Temann et al., 1998). Overexpression of IFNI leads to infiltrates of macrophages and neutrophils, and alveolar enlargement, characteristic of emphysema, is also observed (Wang et al., 2000). The opposite approach has been to knockout proteins of interest. The spontaneous asthma like phenotype of Tbefi" mice has already been discussed (Finotto et al., 2002), as has the lack of eosinophilia and AHR in IL-5-/- animals (Foster et al., 1996), and a great many molecules have now been manipulated in these ways. However, results should be interpreted with caution, bearing in mind potential genetic background effects and also the presence or absence of these proteins from birth, which could result in abnormal lung or lymphoid tissue development. To circumvent the problems of abnormal lung development and enable genetic intervention purely at the point of disease induction, inducible transgenic animals are now being increasingly employed (Cheng et al., 2007). However, having stated this caveat to the timing of gene overexpression, the phenotypes observed when IL-13 is
73 inducibly targeted to the lung are found to be very similar to those that result in mice that express this cytokine constitutively (Zheng et al., 2000).
Chapter 5 of this thesis describes the generation of an inducible transgenic model of lung disease, where induction results not in the overexpression or ablation of endogenous protein but in the expression of a peptide antigen for CD4+ T cells. The peptide in question is the cognate antigen for the T cell receptors used in the generation of the TCR transgenic animals described in chapters 3 and 4 of this thesis. Commonly employed strategies in the generation of transgenic animals, along with the transgenic approaches that have been used in the generation of the mouse models in this thesis are discussed in the section below.
1.17 Approaches to transgenesis
Transfer of foreign DNA into the mouse genome by injection of a plasmid into the pronuclei of fertilised mouse oocytes, a technology now known as transgenesis, was first achieved in 1980 (Gordon et al., 1980). That this transfer of genetic material could lead to an altered phenotype in genetically modified animals was demonstrated a couple of years later (Palmiter et al., 1982) and since this time, the use of transgenic mice in research has become widespread and routine. Improvements in transgene design have led to better and more predictable expression levels of the proteins of interest, but pronuclear injection of oocytes remains the most common technique by which genetic modification of the mouse is achieved, and it has now been employed in many other species of animal including rats, rabbits, sheep, pigs and cows. Other approaches to DNA integration that have been tried and which are becoming more widely used include the use of transposons (DNA sequences that trigger integration) (Dupuy et al., 2002) and the use of retroviral vectors (Lois et al., 2002). Of these approaches, retroviral vectors probably hold the most promise, and very high efficiencies from low titre preparations of virus are now being reported (Ritchie et al., 2007). Although random recombination events are the most straightforward way to introduce new genetic material into the genome, modification of endogenous gene
74 function by gene knockout or mutation cannot be achieved in this way. This approach requires a homologous recombination event at the endogenous loci of the gene of interest and is achieved using embryonic stem (ES) cells as, in these cells, for unknown reasons, homologous recombination is the most efficient. Although more efficient in ES cells, homologous recombination is still a rare event and cells in which this has occurred must be selected and further used to generate a living embryo. Only two mouse lines have proven useful in the development of chimeric embryos, which then transmit the recombined gene to their progeny, and most chimeric mice have been generated using 129/SV ES cells. The difficulty of this technique is additionally highlighted by the failure to date to achieve transgenesis by homologous recombination in any species other than the mouse.
One of the benefits of homologous recombination over random integration of a transgene is that factors influencing transgene expression are better understood. If the position of the transgene in the genome is known and controlled, then so are the corresponding promoter and enhancer elements surrounding the integrated DNA. When a transgene is integrated randomly into the genome, control over expression may be mediated not only by the promoter that has been engineered into the transgene itself, but also by promoter, enhancer and silencer elements that now surround it (Cranston et al., 2001). Approaches to minimise the influence of surrounding genetic elements have included the use of so called insulator sequences (Taboit-Dameron et al., 1999) and the inclusion of long genomic DNA fragments in the transgene itself (Giraldo and Montoliu, 2001), but removing bacterial sequences prior to pro-nuclear injection and the inclusion of intronic sequences immediately before coding sequences are among some straight forward rules now employed in the design of transgenes to aid correct expression. Aside from the coding sequence of the gene of interest, crucial to the function of the transgene is the choice of promoter. The promoter used will determine the timing and tissue specificity of transgene expression and the use of a wide variety of different promoters have been reported in transgenic mice, from ubiquitous and constitutive, such as the chicken (3 actin promoter (Wiekowski et al., 2001a) to the tissue specific and developmentally controlled, such as the CD4
75 promoter (Salmon et aL, 1996). There is also a growing interest in inducible gene expression technology, where tissue specific or ubiquitous gene expression/ablation can be exogenously controlled at the most appropriate time point for the scientific question being addressed. For gene knockout studies this approach was demanded by the embryo lethal phenotype of many constitutive knockouts and in overexpression studies it has become important to separate abnormal developmental processes from those really involved in the biological pathway of interest. Several systems for inducible gene targeting have now been described with the tetracycline and Cre systems being the most commonly employed and schematic diagrams that outline the mechanistic basis behind these two approaches are shown in figure 1.5
In the tetracycline system of inducible gene targeting a ubiquitous or tissue specific promoter directs expression of a reverse tetracycline transcriptional activator (rtTA). Temporal control is achieved because this molecule can only initiate transcription of the target gene by binding an upstream tetracycline operator (tetO) sequence in the presence of doxycycline (Zhu Z et al., 2002). The main drawback to this approach has been the low baseline levels of target gene expression found in the absence of induction, as rtTA can exhibit a degree of residual affinity to tetO in the absence of the drug. To minimise this problem, some groups have used another transgene coding for a transcriptional silencer (rTS). rTS binds to tetO only in the absence of doxycyline and so transcriptional repression is lifted on administration of the drug (Zhu et al., 2001). An additional problem with this system was highlighted more recently in a study of rtTA transgene use in the lung (Sisson et al., 2006). This study found that expression of simply the rtTA protein alone in the lung, in the absence of any target gene, could cause pulmonary pathology consistent with an emphysema like phenotype in these mice. This study highlights one of the many dangers of interpreting data derived from transgenic animals and makes a strong case for the need to control for all aspects of a particular genetic manipulation.
The Cre/lox system involves a mechanism of site-specific recombination that derives from bacteriophage P 1. Cre recombinase recognises, and catalyses recombination
76
(a) Tetracycline system
Promoter rtTA
• • Addition of No Doxycycline • Doxycycline
target gene Q• Filo- target gene (et° Promoter
No expression of target gene DO Expression of target gene
(b) Cre/Lox system I*Mer Cre Mer Promoter V A
Complex retained in the cytoplasm Hsp90 Addition of Tamoxifen Nuclear translocation U
)c* target gene target gene Promoter p STOP 1...... "..."••••••1 Promoter STOP p E. • • • • • ..• loxP loxP Recombination No expression of target gene between lox? sites target gene Promoter Ip
Expression of target gene 4'e El
Figure 1.5 The mechanistic basis of reverse tetracycline-controlled transcriptional activator (rtTA) and Cre/Lox systems of inducible gene targeting. In both systems, spacial control is achieved with the use of one or more tissue specific promoters. (a) In the tetracycline system a transcriptional activator (rtTA) is only active in the presence of the tetracycline derivative, doxycycline. Upon binding to doxycycline, rtTA can bind an operator sequence (tet0) and activate target gene expression. (b) In the Cre/Lox system, the Cre recombinase mutated oestrogen receptor complex must bind tamoxifen and translocate to the cell nucleus in order to activate target gene expression. Gene expression is permitted by the excision of a translational stop sequence. Alternatively, engineering of loxP sites to flank the gene of interest itself can result in temporal control over gene ablation. Cre mediated recombination is prevented in the absence of tamoxifen by Hsp90 retention of the MerCreMer complex in the cytoplasm.
77 between, 34 base pair sequences known as loxP sites. Excision of a stretch of DNA located between two loxP sites can either knockout a gene or permit expression of an adjacent gene (figure 1.5) and the system becomes inducible when two mutated hormone-binding domains of the murine oestrogen receptor are engineered to flank the Cre protein (MerCreMer) (Metzger et al., 1995). These hormone binding domains complex with Hsp90 to retain the Cre recombinase in the cell cytoplasm until administration of the drug tamoxifen. On binding tamoxifen the MerCreMer complex is able to move to the cell nucleus and mediate recombination. Spatial control over this system can be achieved by tissue specific expression of Cre and/or the gene of interest and it has been suggested that further control over specificity may be possible by expressing the Cre protein as two halves, under the control of two different promoters (Casanova et al., 2003). Cre toxicity is the most widely reported problem of this system (Loonstra et al., 2001). It occurs because mammalian genomes contain pseudo loxP sites whose sequence can deviate considerably from the consensus loxP sites present in the transgene, but which can still act as functional recognition sites for the Cre protein. The inducible MerCreMer system does minimise this problem by reducing the amount of time for which cells are exposed to the Cre protein, but the possibility of phenotypes arising from cell toxicity means that proper experimental controls, where animals carry the Cre transgene but not the target gene, should always be included.
An emerging area in the field of gene targeting is the use of RNA interference (RNAi) and a recent study has combined RNAi technology with the inducible tetracycline system of gene expression to achieve inducible, tissue specific and reversible gene knockdown in transgenic mice (Dickins et al., 2007). In this study, a short hairpin RNA (shRNA) targeting the mouse Trp53 gene was expressed transgenically under the control of a tetracycline responsive CMV promoter with rtTA under the control of a liver specific promoter. Efficient, tissue specific and reversible knockdown of Trp53 was observed upon administration of doxycycline that could be demonstrated to have functional consequences in an established model of tumoregenesis, where knockdown of Trp53 led to more rapid disease progression. The Cre system of gene targeting does not led itself so well to this approach as induction is not reversible, but the use of the
78 tetracycline system and RNAi in this way represents a promising new approach to controlling endogenous gene expression in vivo.
Chapter 5 of this thesis describes the use of the MerCreMer system of inducible gene targeting to create a transgenic system in which a T cell epitope (PLP 56-70) is expressed inducibly and specifically in the lung. There are currently no reports in the literature of other peptides being targeted for expression in the lung in this way, but the inducible targeting of proteins to cardiac tissue (Xiong et al., 2007) and tumor cells (Spiotto et al., 2003) are examples of other studies that have successfully employed the MerCreMer system of gene expression.
The peptide (PLP56-70), used in the inducible mouse model described in chapter 5, is the cognate epitope for the T cell receptors used for the generation of the TCR transgenic animals described in chapters 3 and 4. TCR transgenic animals were first described in 1988, when mice bearing transgenes encoding the a and (3 chains of a TCR specific for the male H-Y antigen were generated (Kisielow et al., 1988). Studies with these animals served to answer important questions about T cell tolerance and thymic selection. The authors observed that, while in female mice peripheral CD8+ T cells bearing the transgenic TCR were capable of lysing male target cells, fewer transgenic TCR bearing cells were present in the periphery of male mice, and those that were present were unable to react to antigen. Since the publication of these first TCR transgenic animals, a great many more TCR transgenic models have been described, serving to answer many more questions about T cell development and function as well as providing valuable new disease models. The integral role that TCR transgenic animals have played in the understanding of T cell development has been discussed earlier in this thesis. Expression of a and (3 chain transgenes, both independently and together, was pivotal to understanding the way in which TCR molecules are assembled (Uematsu et al., 1988) and these models have also played an important role in our understanding the role of the TCR in, and the timing of, negative selection in the thymus (Douek et al., 1996). In this study by Douek et al., the timing of negative selection in several different TCR transgenic lines were compared. The
79 site at which negative selection occurred in the thymus, i.e. thymic cortex or thymic medulla, was found to be influenced by the nature of the antigen recognised by the TCR. Negative selection as a consequence of superantigen recognition was found to occur in the medulla, while presentation of cognate self-peptide could induce deletion in either compartment. TCR transgenics have also been used to answer important questions about T cell function in the periphery and there are now numerous examples in the literature of the use of TCR transgenics to investigate T cell function in the context of a disease. The use of mice bearing a transgenic TCR (D011.10) specific for an epitope of the ovalbumin protein, in combination with the commonly used ovalbumin model of allergic airways disease, has already been described in the context of mouse models of lung disease. Other examples of the use of TCR transgenesis in disease models include mouse models of multiple sclerosis (MS) (Ellmerich et al., 2005) and autoimmune gastritis (Candon et al., 2004). In the study by Ellmerich et al., the TCR in question was a human sequence derived from myelin basic protein specific T cells of MS patients and was used in conjunction with a human HLA class II transgenic mouse. Mice expressing both the human TCR and human HLA class II were shown to develop spontaneous MS like pathologies. The TCR transgenic mice described in chapters 3 and 4 of this thesis have been used to try to answer basic biological questions about the role of the TCR in determining CD4+ T cell phenotype, but are also linked to the inducible transgenic model described in chapter 5, which uses the MerCreMer inducible system of gene expression. A long-term aim of the work in this thesis is to combine the TCR transgenic models (chapters 3 and 4) with the inducible lung gene expression system (chapter 5) to create a new mouse model of lung inflammation.
1.18 Interleukin 8
Previous discussion surrounding lung diseases and attempts to understand the processes of lung inflammation has included the mention of many proteins that have been both ablated and overexpressed in the lung. One cytokine not normally directly associated with Thl or Th2 type immune responses per se, but nevertheless implicated
80 in the pathogenesis of several human lung diseases, is IL-8. To date there are no reports in the literature of IL-8 having been overexpressed in the mouse lung and chapter 6 of this thesis, along with discussion in the following sections, describes current understanding of this cytokine in the context of lung inflammation and the generation of transgenic mouse lines with lung targeted, but constitutive, expression of IL-8.
Interleukin-8 (IL-8) was first identified in 1987 through its role as a neutrophil activating cytokine. Identification of this protein by several different groups at around the same time meant that it was assigned different names, being referred to as monocyte derived neutrophil chemotactic factor (MDNCF) (Yoshimura et al., 1987), monocyte derived neutrophil activating peptide (MONAP) (Schroder et al., 1987) and neutrophil activating factor (NAP) (Walz et al., 1987). The name IL-8 was subsequently proposed and adopted but since that time a whole family of structurally related cytokines, known also as chemokines, have been identified, and in much of the current literature IL-8 is referred to as CXCL8. Chemokines are so called because of the leukocyte chemotactic properties displayed by most. Members of this family are low molecular weight proteins with cysteine residues at well conserved positions and it is these cysteine residues that define their nomenclature (Zlotnik and Yoshie, 2000). IL-8 belongs to the CXC subgroup of chemokines, which are so called because the first two cysteine residues at the N terminus of the functional protein are separated by a single amino acid. This is compared to 3 amino acids or adjacent cysteine residues in the CX3C and CC subgroups respectively. CXC chemokines can be further classified into ELR+ or ELR- based on the presence or absence of a tripeptide motif (Glu-Leu-Arg) directly before the first cysteine residue at the N terminus of the protein. IL-8 is an ELR+ chemokine (appendix 29) that correlates with a potent chemotactic effect, particularly on neutrophils, (Yoshimura et al., 1987), angiogenic activity (Strieter et al., 1995) and high affinity binding to the chemokine receptors CXCR1 and CXCR2 (Holmes et al., 1991 and Murphy and Tiffany, 1991).
81 The cDNA of IL-8 encodes a 99 amino acid precursor protein (appendix 29), the N terminal signal sequence of which is cleaved extracellularly to yield predominantly 77 or 72 amino acid versions of the protein (Matsushima et al., 1988). Processing is carried out by extracellular proteases and the form that dominates depends upon the cellular environment. In vitro cultures of fibroblasts and endothelial cells produce mainly the 77 amino acid form, while the 72 amino acid form is produced by leukocytes (Padrines et al., 1994, Hebert et al., 1990 and Nakagawa et al., 1991). Different forms of the protein exhibit different neutrophil chemoattraction activities with the 72 amino acid form more potent than the 77 amino acid protein and it is the 72 amino acid protein that is identified at sites of inflammation in vivo (Ko et al., 1993). Crystallographic studies revealed that at high concentrations IL-8 exists as a homodimer (Baldwin et al., 1991), however at nanomolar concentrations, which most likely reflects conditions in vivo, this cytokine is predominantly monomeric (Burrows et al., 1994) and indeed mutation of the protein to prevent dimerization does not prevent receptor binding or neutrophil activation (Rajarathnam et al., 1994).
IL-8 can be produced by leukocytes such as T cells, monocytes, neutrophils and natural killer (NK) cells but also by somatic cells such as endothelial cells, fibroblasts and epithelial cells. However, expression is not generally constitutive and production is induced by inflammatory cytokines such as IL-1 and TNF-a (Matsushima et al., 1988). Bacterial proteins and viruses can cause upregulation of IL-8 expression (Martich et al., 1991 and Johnston et al., 1997), as well as environmental conditions such as hypoxia (Xu et al., 1999), and the transcription factors NF-K13 and AP-1 have been shown to bind the IL-8 gene, implicating these proteins in the control of IL-8 gene transcription (Murayama et al., 1997 and Thompson et al., 2006). The biological activities of IL-8 are mediated through binding to the G protein coupled receptors, CXCR1 and CXCR2. These receptors are more than 80% homologous at the amino acid sequence level and differ only in their NH2 terminal portions, giving rise to slightly different binding specifies of other chemokines. Binding of IL-8 induces receptor internalisation, although receptors are subsequently recycled to the cell surface (Samanta et al., 1990) and signalling is mediated by the receptor coupled G
82 proteins which activate pathways such as those mediated by PI3K-y and MAPK (Hirsch et al., 2000 and Km11 et al., 1996). CXCR1 and CXCR2 receptors have been identified on the surface of several different cell types such as neutrophils, monocytes and NK cells (Morohashi et al., 1995), and while the role of IL-8 in NK cell migration remains slightly controversial, with some studies reporting IL-8 to be chemotactic to NK cells and others not (Campbell et al., 2001 and Loetscher et al., 1996), neutrophil chemotaxis in response to IL-8 is better defined. In order for IL-8 produced by a tissue, for example in response to a bacterial infection, to attract neutrophils, the cytokine is first internalised by vascular endothelial cells, transcytosed and then presented to neutrophils at the luminal surface of the vessel (Middleton et al., 1997). This transcytosis and presentation on the luminal surface is mediated by the C terminal end of the protein, and cleavage of this C terminal region by a Streptococcus pyogenes bacterial proteinase has been proposed as a mechanism of immune evasion by this pathogen (Edwards et al., 2005). On binding to the CXCR1 and CXCR2 receptors on the surface of passing neutrophils, IL-8 induces the shedding of adhesion molecule L- selectin and alters the expression levels and avidity of integrins such as CD11 b and CD1 1 c, stimulating migration across endothelial and epithelial cell layers (Detmers et al., 1990, Huber et al., 1991 and Mul et al., 2000). Additionally, IL-8 can activate some of the effector mechanisms employed by neutrophils, such as degranulation and the respiratory burst (Walz et al., 1987) and migration of other cell types such as basophils, eosinophils and T cells, both directly and indirectly, has also been reported (Geiser et al., 1993, Bruijnzeel et al., 1993, Larsen et al., 1989 and Chertov et al., 1996).
1.19 Neutrophil function
High levels of IL-8 protein are found to be associated with several different diseases (discussed later), often in conjunction with large neutrophil infiltrates. With the potent chemotactic and neutrophil activating properties of IL-8, and the important role that neutrophils are known to play in innate defence mechanisms and in direction of the adaptive immune response, there is much interest in the relevance of the high levels of
83 IL-8 protein and neutrophils in these disease pathologies. Neutrophils are most commonly thought of as phagocytes that accumulate at, and are rapidly recruited to, sites of bacterial infection where they ingest and kill invading microbes. Neutrophils produce a wide variety of antimicrobial compounds which are stored within the cell to kill ingested pathogens, but which are also secreted during the processes of degranulation and the respiratory burst, which occur as a result of neutrophil activation. Neutrophil granules contain many antimicrobial molecules, such as lactoferrin, lysozyme and matrix metalloproteinases (Faurschou and Borregaard, 2003) and products of the respiratory burst, such as hydrogen peroxide, hypochlorous acid and reactive oxygen intermediates are also toxic to invading pathogens. First to be discharged upon activation of the neutrophil are the peroxidase-negative secondary and tertiary granules. As well as the matrix metalloproteinases MMP8, MMP9 and MMP25, which are thought to have an important role in facilitating neutrophil recruitment and tissue breakdown (Faurschou and Borregaard, 2003), these granules contain the antimicrobial proteins lactoferrin, lipocalin, lysozyme and LL37, which act to kill microorganisms. Lactoferrin, for example, is an iron binding protein that acts to sequester iron thereby removing an essential microbial growth factor from the extracellular environment, and transgenic mice that overexpress the human form of lactoferrin are found to have enhanced immune responses to bacterial infection (Guillen et al., 2002). Following the release of secondary and tertiary granules, next to be released by the neutrophil are the peroxidase-positive primary granules. These contain additional antibiotic proteins, such as cathepsin G, neutrophil elastase, protease 3, and Azurocidin (Campanelli et al., 1990) as well as myeloperoxidase. Myeloperoxidase is an iron containing enzyme that converts hydrogen peroxide into the much more powerful antiseptics, hypochlorous acid, hypobromous acid and hypoiodous acid. The hydrogen peroxide that serves as a substrate for myeloperoxidase derives from production of reactive oxygen intermediates by the neutrophil, the primary mediator of which is a phagocyte oxidase (phox). A deficiency of this enzyme is fatal as patients are unable to control bacterial infection (Good et al., 1968). Neutrophils are therefore an essential and powerful first line of defence against invading pathogens, but the chemicals that they release are also
84 damaging to host cells and if uncontrolled can cause enormous damage to the local tissue. A small level of tissue damage around a site of infection is probably beneficial to the host as it may help to isolate microbes and prevent spread of infection, however, in the longer term neutrophils also generate signals to suppress their own activation, promote apoptosis and initiate repair processes. Anti-inflammatory compounds secreted by neutrophils include lipoxins, and both neutrophils and macrophages secrete the anti-inflammatory factor, secretory leukocyte protease inhibitor (SLPI) (Jin et al., 1997) that acts to neutralise some of the antimicrobial proteases secreted during the process of neutrophil degranulation. This protease inhibitor also acts to protect the epithelial-cell-growth-promoting cytokine, proepithelin, from neutrophil elastase thereby enabling repair processes to be initiated. If proepithelin is instead degraded by neutrophil elastase, products of this degradation act to promote IL-8 release by epithelial cells and the recruitment of activated neutrophils to the site of injury continues (Zhu J et al., 2002).
Neutrophils are produced continuously by the bone marrow and traffic though the peripheral blood stream until recruited to sites of infection by chemokines such as IL- 8. As such, they are one of the first cell types to be found at the site of a wound and there is growing interest in the role that neutrophils may have in directing later stages of the immune response. That activated neutrophils themselves can be a source of IL-8 has already been mentioned, but other examples include TNF-a, B lymphocyte stimulator (BLys) and IFN-y. TNF-a drives DC and macrophage differentiation and activation (Bennouna et al., 2003) and neutrophils can additionally mediate DC activation by cell-cell contact through engagement of the CD11 b integrin on neutrophils by the DC specific adhesion molecule, DC-SIGN (van Gisbergen et al., 2005). BLys secretion by neutrophils promotes the activation of B cells and in a recent study, levels of BLys secreted by neutrophils from patients with rheumatoid arthritis were found to be greater than those from healthy control subjects (Scapini et al., 2005). Incidentally, rheumatoid arthritis is an example of a human disease that has been associated with elevated levels of IL-8 at the site of disease (Troughton et al., 1996). A further link between neutrophils and the adaptive immune system comes
85 from the demonstration that in the presence of IL-12, neutrophils can produce IFN-y (Ethuin et al., 2004) and as well as through the secretion of inflammatory mediators, another way in which neutrophils may act to initiate adaptive immune responses was reported in a recent study using a Mycobacterium bovis strain Bacille Calmette-Guerin (BCG) model of infection (Abadie et al., 2005). In this study by Abadie et al. they used transgenic BCG expressing enhanced green fluorescent protein to show that neutrophils rather than dendritic cells carried BCG from a site of infection in the skin into the draining lymph node. However, there are also examples in the literature of neutrophils functioning to suppress rather than activate the adaptive immune response (Schmielau and Finn, 2001) and so a picture is emerging of a role for neutrophils in both the positive and negative regulation of many aspects of the immune response to a pathogen, some aspects of which are likely to be intimately linked to the presence or absence of IL-8 at the site of inflammation.
1.20 Interleukin-8 and human lung disease
High levels of IL-8 are found in association with several human lung diseases. One well studied example is bronchiectasis (Richman-Eisenstat et al., 1993). Bronchiectasis is characterised by irreversible airway dilation and is found in association with chronic bronchial infection and inflammation. As the respiratory organ of the body, the lung is constantly exposed to airborne microbes and as such has had to develop a multitude of innate and adaptive defence mechanisms to deal with these pathogens. To allow for sufficient and efficient gas exchange, the epithelial surface of the lung is vast and, in humans, much of this epithelial surface is covered by a layer of mucus. Mucus acts to trap incoming bacteria, and these can then be cleared from the lung by the action of motile cilia which line the surface of airway epithelial cells. It therefore follows that an impairment in mucus production, or the function of cilia, will result in susceptibility to infection, and in the diseases of cystic fibrosis (CF) and primary ciliary dyskinesia (PCD), which are both known causes of bronchiectasis, this is indeed the case (Matsui et al., 2006 and Bush et al., 1998). In this recent study by Matsui et al. the concentrated airway mucus that results from the deficiencies in ion
86 transport seen in CF was found to not only impede clearance of mucus from the airways, but also provide a favourable environment for bacterial growth and biofilm formation. In some cases of bronchiectasis, such as those caused by CF and PCD, the cause of persistent infection is understood. In many cases however, the disease is idiopathic (of unknown cause). Failure to clear bacteria from the airways in the first instance by ciliary movement results in bacterial contact with, and activation of, the lungs innate defence system of which neutrophils are an important component. The main mechanisms by which neutrophils clear invading microbes has been discussed in the previous section and the importance of the multitude of antimicrobial peptides secreted by these cells during a bacterial infection are highlighted by various disease models such as the disease protection conferred on mice manipulated to express lysozyme constitutively in the lung (Akinbi et al., 2000), and more recently by the impaired bacterial clearance observed in mice deficient in this protein (Cole et al., 2005). It is the persistent nature of infection that lies behind the pathophysiology of bronchiectasis, as sustained inflammatory responses inevitably lead to tissue damage, impairing the ability of the lung to fight infection, and creating a vicious cycle of IFN- y mediated immunity.
As previously mentioned, CF patients suffer from chronic bacterial infections and elevated levels of IL-8 protein have been found in BAL, sputum and in the bronchial epithelial cells of these patients (Muhlebach et al., 1999, Sloane et al., 2005 and Muhlebach et al., 2004), along with pronounced neutrophilic infiltrates (Konstan et al., 1994). Whether the observed high levels of IL-8 are purely a function of chronic inflammatory reactions occurring in the lung, increasing IL-8 expression as a consequence of high levels of inflammatory cytokines and bacterial proteins, or whether the reason for high IL-8 expression is intrinsic to CF itself is not quite clear. However, two recent studies have suggested that the mutation in CF transmembrane conductance regulator (CFTR) gene alone, proposed to be the genetic basis for disease, is sufficient to cause elevated IL-8 gene expression in the airways (Perez et al., 2007 and Chan et al., 2006).
87 Another lung disease characterised by large neutrophil infiltrates and high levels of IL- 8 is acute respiratory distress syndrome (ARDS). Caused by a variety of direct or indirect insults to the lung such as pneumonia, smoke inhalation or surgery, several groups have reported a correlation between neutrophilia and levels of IL-8 in patients with ARDS (Aggarwal et al., 2000) and indeed an association between high levels of IL-8 and an increased risk of subsequently developing this condition has also been reported (Donnelly et al., 1993). A role for IL-8 in mediating the pathogenesis of this acute disease, aside from simply recruiting and activating the neutrophils which amplify lung inflammation and cause tissue damage, has been suggested to be mediated by anti-interleukin-8 autoantibodies (Kurdowska et al., 2001). This group reported a significant correlation between concentrations of IL-8:anti-IL-8 antibody complexes in the lung and the onset of ARDS. More recently, they have also demonstrated that these IL-8:anti-IL-8 antibody complexes are indeed attached to FcyRIIa receptors and are therefore likely to be mediating pro-inflammatory signals in the lung (Allen et al., 2007).
Other diseases for which IL-8 has been found to be a marker of disease severity include idiopathic pulmonary fibrosis (IPF), COPD and diffuse panbronchiolitis (DPB) (Cane et al., 1991, Yamamoto et al., 1997 and Koga, 1993). Indeed, anti-IL-8 therapy has been suggested as a possible therapeutic approach for the treatment of COPD (Mahler et al., 2004). Aside from neutrophil recruitment, additional roles for IL-8 in the pathogenesis of each of these diseases is currently unclear, but polymorphisms in the IL-8 gene have been reported in association with DPB (Emi et al., 1999) and in the COPD study by Yamamoto et al. IL-8 levels were closely correlated with lung function measurements. A more recent study has attempted to elucidate a role for IL-8 in directly affecting airway structure and function (Govindaraju et al., 2006). In this study, smooth muscle cells from human airways were analysed for expression of the IL-8 receptors, CXCR1 and CXCR2. Both receptors were found to be present on the surface of these cells and blocking of the receptors using neutralising antibodies could prevent changes in intracellular Ca2+ observed upon IL-8 stimulation. IL-8 was also found to cause contraction of the
88 muscle cells as well as stimulating cell migration. This data suggests that the lung function changes observed in many of the lung diseases discussed here could, in part, be mediated by the high levels of IL-8 found within the lung.
Although asthma is normally considered to be associated with eosinophilic lung infiltrates, neutrophil influx is found to be a common feature of persistent asthma and this neutrophilia has also been associated with elevated levels of IL-8 (Gibson et al., 2001). Increased levels of IL-8 have also been found in sputum samples directly before late phase exacerbations in acute asthma (Kurashima et al., 1996) and in keeping with the more recent results of the airway smooth muscle study by Govindaraju et al., IL-8 inhalation has been shown to directly provoke bronchoconstriction in guinea pigs, which was observed in the absence of any leukocyte recruitment into the airways (Fujimura et al., 1999). A positive role for IL- 8 in the regulation of asthma has been proposed following the finding that IL-8 can selectively inhibit IL-4 induced IgE production (Kimata et al., 1992) and the treatment of human lungs with IgE results in the release of IL-8 (Erger and Casale, 1998). However, there must then be a trade off between IgE downregulation and the neutrophil and eosinophil chemoattractant properties of this cytokine. Aside from IgE, the reason for elevated IL-8 levels in the airways of asthmatic is not yet clear, but that the initial source of this cytokine maybe the airway epithelium in response to allergen is supported by the finding that pulmonary epithelial cells can produce high levels of IL-8 in the presence of diesel exhaust particles (Takizawa et al., 1999). However the wide range of toxic chemicals present in diesel exhaust fumes means that this finding is not necessarily applicable to other more classical allergens.
The neutrophilia observed in many human lung diseases, the central role of IL-8 in neutrophil recruitment and also emerging roles for IL-8 in disease pathogenesis that are separate from neutrophil recruitment and activation, all make IL-8 an attractive target for manipulation in animal models of lung disease. There are currently no reports in the literature of IL-8 having been overexpressed in the airways of mice, although this may not be an intuitive experiment as in the mouse genome, the IL-8
89 gene and the gene for its receptor, CXCR1, have been deleted. However, the CXCR2 receptor is expressed, and this receptor is able to mediate neutrophil chemotaxis in response to the two proposed murine homologues of IL-8, KC and MIP-2 as well as in response to human IL-8 itself (Bozic et al., 1994). The chemoattractant properties of human IL-8 have been demonstrated using neutrophils for a variety of different species, including monkeys, rabbits, dogs and mice (Rot, 1991). Although the potency of human IL-8 varied between species and was lower than that observed for human neutrophils, these findings nevertheless suggest that interleukin-8, if expressed in the murine lung, should be biologically active. Various studies have manipulated the mouse CXCR2 receptor and its ligands in vivo and in keeping with the role of IL-8 and its receptors in human studies, mice overexpressing KC in a variety of tissues, including the lung, do show evidence of neutrophil infiltrates (Lira, 1996). Mice overexpressing KC in the lung also demonstrate increased resistance to infection (Tsai et al., 1998), while neutralising the CXCR2 receptor results in increased disease susceptibility (Tsai et al., 2000). These studies suggest that, as in humans, ELR+ CXC chemokines are critical mediators of neutrophil mediated host defence mechanisms. However, as has been discussed in this section, there is increasing evidence that IL-8 mediates lung pathology in ways other than those involving neutrophil recruitment and additionally, to study potential therapeutic approaches to IL-8 mediated lung pathology in the mouse, using the human IL-8 protein rather than the mouse homologues, which are similar but not equivalent, would be preferable. There is therefore merit in the approach to overexpress human IL-8 in the murine lung and the generation and initial characterisation of such transgenic animals is described in chapter 6 of this thesis.
1.21 Aims of this thesis
Much of the discussion in this chapter has centred around the T cell receptor molecule and around the Thl and Th2 type immune responses that are an important feature of many human diseases, including several lung pathologies. Multiple factors are involved in determining whether a naive CD4+ T cell differentiates into a Thl or Th2
90 effector cell and several lines of evidence point towards an important role for the interaction between the T cell receptor (TCR) and its peptide ligand. A previous study by Boyton et al. (Boyton et al., 2002) showed that highly polarised Th2 CD4+ T cells selected under Th2 polarising conditions favour a structurally distinct TCR with an elongated TCR a chain complimentarity determining region 3 (CDR3), while those selected under Thl polarising conditions favour a shorter TCR CDR3 a chain. Molecular modelling predicted that this elongated TCR a chain results in a less optimal (lower avidity) interaction between the TCR and peptide/MHC complex and gave rise to the hypothesis that, if structurally distinct TCRs arising from Thl and Th2 polarised T cells, i.e. a TCR bearing an elongated CDR3a region from a Th2 cell and a shorter CDR3a region from a Thl cell, are expressed transgenically, an inherent bias towards Thl or Th2 will be observed in CD4+ T cell responses from these animals. Much of the data in this study by Boyton et al. was derived from T cell responses of H2-E transgenic NOD (NOD.E) mice to the peptide epitope PLP 56-70. PLP 56-70 is an epitope used to induce EAE in NOD and NOD.E mice. A deletion in the promoter region of the I-E a chain gene means that NOD mice only express the MHC class II molecule I-A and are known to spontaneously develop type 1 diabetes. However, expression of an I-E a chain transgene protects NOD.E mice from diabetes (Lund et al., 1990), but makes them more susceptible to EAE (Tackas et al., 1995). In this study by Tackas et al. I-E expression in NOD.E animals was associated with a shift away from IL-4 production and towards greater IFN-y production in T cell responses to PLP 56-70, suggesting an association between Thl responses and disease in this model, whilst describing Th2 responses in association with protection. In the study by Boyton et al., multiple NOD.E T cell lines and clones specific for the peptide PLP 56- 70 were grown and polarised in vitro towards a Thl or Th2 phenotype. In all cases, the peptide response was found to be I-Ag7 rather than I-E restricted. It is Thl and Th2 T cell lines grown during the course of this study, which are specific for the peptide epitope PLP 56-70, that serve as the starting point for the work described in chapters 3 and 4 of this thesis, where the aim is to express dominant TCRs from Thl and Th2 polarised T cell lines transgenically to determine whether a structurally distinct TCR can cause an innate bias in CD4+ T cell phenotype (figure 1.6)
91 Further to this hypothesis is a second question of whether these Thl and Th2 TCR transgenic animals could be used to create new models of Thl and Th2 mediated disease. The lung is one organ in which understanding Thl and Th2 type responses is of much interest and a second aim of this thesis is to establish a mouse model whereby the peptide epitope for these Thl and Th2 TCRs (PLP 56-70) can be expressed inducibly and specifically in the lung. Chapter 5 of this thesis describes the generation of this model using a lung specific promoter and the MerCreMer system of inducible gene expression and a schematic diagram detailing the way in which these mice would be used to generate novel lung disease models is shown in figure 1.6.
The final aim of this thesis is to generate another mouse model of lung disease, where lung pathology is as a consequence of overexpression of the human cytokine IL-8 (figure 1.6). Elevated levels of IL-8 protein are found associated with several different human lung diseases, but the precise role that IL-8 plays in the pathologies of these diseases has yet to be elucidated. Chapter 6 of this thesis describes the generation of mice overexpressing the human IL-8 protein in the lung and initial characterisation of lung pathology in these animals.
92
(a) (b) Lung targeted (c)
Antigen specific Antigen CD4+ T cell lines Lung targeted
1 IL-8 f
• Inducible and lung targeted
Antigen
Lung pathology? CD4+ T cell phenotype?
Thi or Th2 derived TCR
Thl or Th2 type lung inflammation? Figure 1.6 Transgenic strategies of this thesis. A schematic diagram of the transgenic strategies proposed for the three main aims of this thesis. (a) The use of TCR transgenics to answer questions about a possible role for the TCR in determining CD4+ T cell phenotype. (b) The targeting of antigen inducibly and specifically to the lung to generate, in combination with the TCR transgenics, models of Thi and th2 type lung inflammation. (c) Targeting of human interleukin 8 to the lung to elucidate the role of this cytokine in lung inflammation and pathology. Chapter 2
Materials and methods
2.1 Genomic DNA extraction 400 µ1 of digestion buffer (appendix 1) and 10 [,t1 of 20 mg/ml proteinase K (Sigma-P- 6556) were added to each tissue sample and samples incubated at 56°C overnight. After complete digestion, 200 µ1 of 6M (saturated) NaC1 were added and the sample mixed well by vigorous shaking before centrifuging at 16000 x g for 15 minutes. The supernatant was removed to a fresh tube and DNA precipitated by the addition of 600 µI of isopropanol. The sample was mixed well by inversion and spun at 16000 x g for 10 minutes to pellet the DNA. The DNA pellet washed once in 70 % EtOH before being briefly air-dried and dissolved in 50-80 1_11 of TE buffer (appendix 1). Samples were incubated briefly at 56°C for 15 minutes to ensure the DNA pellet was fully in solution and samples were then stored at 4°C for up to one week or -20°C for more long term storage.
2.2 RNA extraction For tissue samples or samples of greater than 5 x 106 cells, RNA was extracted using Trizol (Invitrogen-15596-018) a phenol and guanidine thiocyanate based extraction reagent. Prior to addition of Trizol reagent, tissue samples were homogenized using a manual glass-glass homogenizer. Samples were lysed by repeated pipetting with 1 ml of Trizol reagent. If not processed to RNA immediately, samples were stored at 4°C overnight or at -20°C for up to 1 month. Following cell lysis, 2000 of chloroform was added, the sample mixed by vigorous shaking for 30 seconds and then incubated on ice for 5 minutes. Samples were centrifuged at 12,000 x g for 15 minutes at 4°C and the upper aqueous layer removed to a new tube. RNA was precipitated by addition of 500 Ill of isopropanol. Samples were mixed by inversion and incubated at room temperature for 10 minutes before centrifugation at 12,000 x g to pellet the RNA. RNA pellets were washed once with 75% EtOH, air-dried briefly and dissolved
94 in 20-30 t1,1 of RNase free water (Sigma-W4502). RNA samples were stored at -20°C in the presence of 20 U RNase OUT (Invitrogen-10777-019).
RNA from cell line samples of less than 5 x 106 cells was extracted using an RNA binding spin column (Stratagene-400805).
2.3 DNase treatment of RNA samples To remove contaminating DNA from some RNA preparations prior to cDNA synthesis, samples were treated with an RNase free DNase (Promega-M610A). 3-51.1g of RNA in a reaction volume of 20 tx1 containing 2 Ill 10X reaction buffer (400 mM Tris-HC1 pH 8.0, 100 mM MgSO4 and 10 mM CaC12) and 1 U of DNase per Rg of RNA were incubated at 37°C for 30 minutes. The DNase was then removed from the sample by phenol:chloroform (Sigma-P1944) extraction. All traces of phenol were removed by an additional chloroform:isoamylalcohol (24:1) extraction and RNA precipitated using 2.5 volumes of 100% EtOH. RNA pellets were washed once with 70% EtOH before being briefly air-dried and dissolved in 10 µ1 of RNase free water. cDNA synthesis reactions were then set up both with and without the reverse transcriptase enzyme to ensure that subsequent PCR results obtained were not due to contaminating DNA.
2.4 cDNA synthesis RNA was quantitated by spectrophotometer and 10Ong - ltA,g used per cDNA reaction. The RNA in a volume of 13 1A.1 of sterile water containing 50 ng random hexamers (Invitrogen-48190-011) and 1 IA of 10 mM dNTPs (Invitrogen-18427-013) was heated to 65°C for 5 minutes and then placed on ice. 4 iil of 5X cDNA synthesis buffer (Invitrogen-18080-044), 1 !Al of 0.1M DTT (Invitrogen-18080-044), 40 U of RNase OUT and 200 U of Superscript III (Invitrogen-18080-044) were added. The mixture was heated at 25°C for 5 minutes, followed by 50°C for 60 minutes and 70°C for 15 minutes. 1 [11 of completed cDNA reaction mixture was used as a template for each subsequent PCR reaction. cDNA was stored at -20°C.
95 2.5 Polymerase Chain Reaction (PCR) A general PCR protocol is described below. All oligonucleotide primer sequences, reaction product sizes and any reaction conditions that varied from those described in this section are listed in appendices 6, 7 and 8.
PCR reactions were carried out in a reaction volume of 25 µI containing 50-100 ng of template DNA, 16 mM (NH4)2SO4, 67 mM Tris-HC1 (pH 8.8), 0.01% Tween-20, 1.5 mM MgC12, 200 µM dATP, dCTP, dGTP, and dTTP (Bioline-BIO-39025), 0.5 ILIM of each oligonucleotide primer (Sigma Genosys) and 0.6 units of Taq polymerase. The reaction mixture was incubated at 95°C for 5 minutes, 30 cycles of 95°C for 1 minute, 55°C for 1 minute, and 72°C for 1 minute, and a final cycle at 72°C for 8 minutes. The result of each PCR was then determined by running the reaction on a 1% agarose TAE (appendix 1) gel stained with EtBr (Sigma-E1510).
2.6 Restriction enzyme digest Restriction enzyme digests were carried out in a volume of 20 µI containing 0.5-2 µg of plasmid DNA, 1 U of appropriate restriction enzyme(s), and 2µl of 10X buffer (appendix 3). Reactions were incubated at 37°C or 50°C (appendix 3) for at least 1 hour. Digests were run alongside a DNA ladder with markers of known molecular weight (Promega-G5711) on 1% agarose TAE gels at 90V.
2.7 Preparation ofXL-Gold competent cells XL-Gold cells from a previous preparation were streaked onto a Luria-Bertani (LB) agar (Sigma-L2897) plate containing 50 µg/m1 tetracycline (Sigma-T8032) and incubated at 37°C overnight. The following day a single XL-Gold colony was inoculated into 10 ml of LB broth (Sigma-L3022) containing 50 lag/m1 tetracycline and incubated at 37°C overnight on a shaker (225 rpm). The 10 ml overnight culture was inoculated into 200 ml of LB broth containing 0.015M MgC12 and grown until the optical density Q = 600 nm) of the culture reached 0.6. The culture flask was then placed on ice for 10 minutes before spinning 100 ml of the culture in a pre-cooled
96 centrifuge (4°C) at 1600 x g for 10 minutes. The supernatant was discarded and the remaining culture volume spun down in the same tubes. The cell pellets were resuspended by swirling and gentle pipetting in a total volume of 60 ml of ice cold solution A (appendix 1) and incubated on ice for 20 minutes. Samples were then centrifuged again, the supernatant discarded, and the pellets resuspended in a total volume of 12 ml of ice cold solution B (appendix 1). Competent cells were stored at - 80°C in 200 µ1 aliquots.
2.8 E-coli transformation All transformations were performed using XL-Gold (see above) or INVaF' competent cells (Invitrogen-C2020-03). The same transformation protocol was used for both strains. 2111 of a ligation reaction or 1µl of a plasmid preparation were added to 50 [al of competent cells. The mixture was incubated on ice for 30 minutes before heat shock at 42°C for 30 seconds. 250 pi of SOC medium (supplied with INVaF' competent cells) or LB broth warmed to room temperature were added and the cells were then incubated with shaking (225 rpm) at 37°C for 1 hour. Bacteria were spread onto LB agar plates containing 50 µg/ml of ampicillin (Sigma-A9518). Plates were inverted and incubated at 37°C overnight. For TA cloning ligations, plates were also spread with 40 ial of a 40 mg/ml stock solution of 5-bromo-4-chloro-3-indolyl-b-D- galactopyranoside (X-Gal) (Bioline-Bio37035) and 8R1 of a 100 mM stock solution of Isopropyl 13-D-1-thiogalactopyranoside (IPTG) (Sigma-16758) 30 minutes before plating of the bacteria. This allowed successfully ligated plasmids to be identified by blue/white screening of the bacterial colonies. Colonies containing a plasmid with a PCR product correctly ligated appear white.
2.9 Standard cloning and ligation protocol With the exception of one step, which used a synthetic oligonucleotide insert, the fragments for all other cloning steps were obtained by single or double restriction enzyme digests of the appropriate plasmids. These restriction digests were carried out overnight in a volume of 40 111. For single enzyme digests it was necessary to dephosphorylate the ends of the vector fragment after digestion to prevent re-ligation.
97 This was achieved by adding 0.01 U of Calf Intestinal Alkaline Phosphatase (CIAP) (Promega-M1821) per pmol of DNA ends in the reaction (where 1 !is of 1000 bp DNA = 3.03 pmol of DNA ends) and incubating at 37°C for 1 hour. All DNA fragments used for cloning were purified by separation on a 1% agarose (Sigma- A9539) TAE gel followed by gel extraction using silica beads (Qbiogene-1001-600). The amount of each purified fragment recovered was quantitated by running 1 [xl of each sample on an agarose gel alongside a quantitative DNA ladder (Bioline- BI033025). As optimal ligation conditions for each cloning step were unknown, a number of reactions using different ratios of vector to insert were set up each time. The amount of each fragment required to achieve each ratio was calculated using the equation below. amount of vector (ng) x size of insert (bp) x molar ratio of insert = amount of insert (ng) size of vector (bp) vector
Standard ratios of vector to insert used were 1:1, 1:3, 1:6 and 1:12. Control reactions of 1:0 and 1:0 with no ligase added were also set up to assess levels of re-ligated and uncut vector respectively. Ligation reactions were set up in a volume of 10 [AI containing 5 U of T4 DNA ligase (Promega-M1801) and 2 [11 of 5 x reaction buffer (250 mM Tris-HC1 pH 7.6, 50 mM MgC12, 5 mM ATP, 5 mM DTT and 25% w/v polyethylene glycol-8000). Reactions were incubated at 16°C overnight before transformation into XL-Gold E-coli (see above).
2.10 Blunt end generation A restriction digest (see above) of the appropriate plasmid and restriction enzyme was inactivated by heating to 65°C for 15 minutes. Blunt ends were generated using T4 DNA polymerase (Promega-M4211). The reaction volume of the original restriction digest was increased to 50 1,t1 using sterile water, and contained 6 U of T4 DNA polymerase, 100 mM of each dNTP and 3 ill of promega 10X multi-core buffer (250 mM Tris acetate, pH 7.8, 1 M potassium acetate, 100 mM Magnesium acetate and 10 mM DTT). Reactions were incubated at 37°C for 5 minutes before inactivation at
98 75°C for 10 minutes. The plasmid was then purified by agarose gel extraction and blunt ends ligated using T4 DNA ligase.
2.11 Oligonucleotide annealing Each oligonucleotide was made up to a concentration of 1 mg/ml in sterile water. 1 121 of each oligonucleotide was then added to 18 itil of TE buffer and the mixture heated at 70°C for 5 minutes. The tube was placed into a beaker of water at 65°C and left to cool to room temperature before placing on ice. No further purification of this annealed product was required before ligation.
2.12 TA cloning of PCR products PCR products amplified using Taq polymerase (Bioline-BIO-21040) were cloned into the plasmid pCle2.1 by TA cloning (Invitrogen-K2000-01). Vector DNA did not require any purification before ligation, but PCR products were separated by agarose gel electrophoresis and gel purified using a silica matrix protocol to preserve the A overhangs. 10-20 ng of PCR product were ligated into 25 ng of pCle2.1 vector in a reaction volume of 10 pi containing 4 U of T4 DNA ligase (Invitrogen-15224-041) and 1 1,t1 of 10 x reaction buffer (60 mM Tris-HC1 pH 7.5, 60 mM MgC12, 50 mM NaCl, 1 mg/ml BSA, 70mM (3-mercaptoethanol, 1 mM ATP, 10 mM spermidine and 20 mM DTT). Ligation reactions were incubated at 16°C overnight.
2.13 Preparation and screening of plasmid DNA Successfully transformed bacterial colonies were picked from agar plates using sterile pipette tips and grown up in 8 ml of LB broth containing ampicillin (50 p.g/m1) at 37°C overnight. Bacteria were pelleted by spinning at 1500 x g for 4 minutes and plasmid DNA extracted and purified by alkaline lysis (Qiagen-27106 or Sigma PLN350). Successfully ligated plasmids were identified by restriction enzyme digest and PCR.
99 2.14 T cell receptor PCR analysis T cell receptor (TCR) a and (3 chain cDNA transcripts were amplified using sets of primers previously described by Candeias et al. (Candeias et al., 1991). Three rounds of PCR are required to obtain a chain products while two rounds are required for (3. The 5' primers for both a and 13 are degenerate and designed to bind all TCR families. 5' primers for a and (3 chain amplification are NW36, NW37, NW38 and NK121, NK122, NK123 respectively. They were used as an equimolar mixture for all rounds of amplification. 3' primers are derived from a and (3 constant regions. For the a chain, 3' primer NJ108 was used in the first round of amplification, followed by NJ109 and NJ110. For the (3 chain, MQ284 was the first 3' primer used, followed by MS175. Primer sequences are listed in appendix 4. All PCR rounds were set up as described in the section above using an annealing temperature of 53°C for 2 minutes and amplifying for 28 cycles. Products obtained were 300-400 bp in size and were TA cloned as described. Successfully ligated PCR products were identified by EcoR1 digestion of plasmid DNA and sequenced using the M13 primer (appendix 4).
2.15 Sequencing and T cell receptor sequence analysis All sequencing reactions were performed at the Natural History Museum sequencing facility. Plasmid DNA containing the sequence of interest was sequenced using a sequence specific primer and the Big Dye Terminator v1.1 Cycle Sequencing Kit (Applied Biosystems). Sequencing reaction products were analysed on an Applied Biosystems 3130x1 DNA analyser and sequence data obtained was manipulated using GeneJockeyll software. Raw sequence data files were read by EditView (Perkin Elmer).
T cell receptor sequences and CDR3 region lengths were identified based on the classifications of the International Immunogenetics (IMGT) information system database (http://imgt.cines.fr) (Ruiz et al., 2000). CDR3 length was taken as the number of amino acids between, and not including, the conserved cysteine residue (C) at the 3' end of the V gene segment and the conserved phenylalanine residue (F) at the 5' end of the J segment.
100 2.16 TCR CDR3 Spectratyping The sequences of the specific Vf3 gene primers and the constant Cr3 primer conjugated to the fluorescent dye 6-carboxyflurorescein-amino-hexy (6-FAM) are shown in appendix 5. PCR reactions were set up as described above with a final MgCl2 concentration of 3.5 mM. For a given cDNA template, each V13 primer was set up as a separate PCR reaction with the constant C13-6FAM primer. PCR reaction mixtures were incubated at 95°C for 10 minutes followed by 36 cycles of 94°C for 20 seconds, 55°C for 40 seconds, 72°C for 40 seconds and a final extension step of 72°C for 5 minutes. 10 til of each PCR reaction was run on a 1% agarose TAE gel to confirm that the reaction had been successful before proceeding. PCR products were then run on an ABI Prism 3100 Genetic Analyzer in ABI Prism 96 well optical reaction plates (Applied Biosystems-403012) where each well of the plate contained 5 IA of PCR product, 1011,1 of Hi-Di Formamide (Applied Biosystems-4311320) and 0.50 of a Genescan 500 ROX standard (Applied Biosystems-401734). Data was collected and analysed by Gene Mapper ID Software version 3.2 (Applied Biosystems).
2.17 Real- time PCR RNA and cDNA were prepared as described. 500 ng of DNase treated RNA was used as a template in each cDNA reaction. PCR reactions were carried out in a volume of 20 Ill containing 1 !al of cDNA, 8 [Al of RNase free water, 1µ1 of 20x gene specific primer mix (Applied Biosystems — Assays-on-DemandTM Gene Expression Assay) (appendix 8) and 10 ttl of 2x TaqMan® Universal PCR Master Mix (Applied Biosystems - 4304437). Reactions were incubated at 50°C for 2 minutes, 95°C for 10 minutes and then 40 cycles of 95°C for 15 seconds and 60°C for 1 minute. PCR reactions were set up in triplicate for each set of primers used, and CT values (the PCR cycle number at which the fluorescence passes a fixed threshold) were obtained using a Stratagene MX3000P real-time PCR machine and software. Variability in the amount of RNA used for each cDNA reaction was controlled for by running a PCR for 18s RNA for each sample. PCR of a dilution series of a single sample showed the 18s and all other primer sets to have different amplification efficiencies. It was therefore
101 not possible to use the 2-mc` mathematical expression for fold change. CT values for PCR reactions were instead converted to numerical values, using the equation for the appropriate efficiency curve before normalising each gene of interest value with respect to the 18s value for the same sample. The sample with the lowest level of gene expression was assigned a value of 1. Levels of gene expression in all other samples were expressed as a value relative to 1.
2.18 Preparation of DNA for oocyte pronuclear injection Plasmid DNA purified using a commercial alkaline lysis based purification kit (Qiagen-12162) was digested overnight with the appropriate restriction enzyme. Restriction digests were performed in a volume of 60 Ill containing 15 [t.g of plasmid DNA and at least 30 U of restriction enzyme. The required band was separated by running the sample on a 0.8% low melting point agarose (Promega-V2831) TAE gel at 70 V for 6 hours. The fragment for injection was excised and gel purified using a DNA binding column (Qiagen-28704). An additional wash step of 5 minutes was added to the recommended protocol. DNA was eluted from the column in embryo grade water (Sigma—W1503) and the DNA solution sterilised by passing though a 0.22um Costar spin filter (Fisher Scientific —MPA150010C). Purified DNA fragments were quantitated using a spectrophotometer (Nanodrop® ND-1000) and by running of the preparation on a 1% agarose TAE gel alongside a quantitative DNA ladder. Purified DNA fragments were stored at 4°C until the day of injection when they were diluted to a concentration of 2-4 ng/p,1 in embryo grade water in a final volume of 50 pl. Oocyte pronuclear injections were performed at the Nuffield Department of Medicine (University of Oxford) or the MRC Clinical Sciences Centre (Hammersmith campus of Imperial College London)
2.19 Genotyping Genomic DNA from a small sample of tail tissue was extracted using a high salt DNA extraction method (see above). Mice were assigned a number for identification based on cage number and ear marking at the time of tail biopsy. Mice carrying the transgene of interest were identified by PCR. The genotypes of transgenic founder
102 animals and of animals used for subsequent breeding were also confirmed by Southern blot (see below).
2.20 Southern blotting Restriction digests of genomic DNA were carried out in a reaction volume of 50 0 containing 10-15 [tg of genomic DNA, 50 U of appropriate restriction enzyme, 5 !al of 10X buffer supplied with enzyme (appendix 3), 1 mM Spermidine (Sigma-S2501), 100 µg/ml Ribonuclease A (Sigma-R4875) and 100 µg/ml BSA (Promega-R396D). Reactions were incubated at 37°C overnight. Digests were run alongside a standard ladder on a large 1% agarose TAE gel for 18 hours at 45V. Prior to blotting, the gel was photographed alongside a ruler to allow determination of band size on the final blot. Size markers and excess gel were trimmed away and the remaining gel incubated in depurination solution (appendix 1) for 10 minutes at room temperature. Following a brief wash in distilled water the gel was incubated in denaturing buffer (appendix 1) for 45 minutes at room temperature and then in neutralising buffer (appendix 1) for a further 45 minutes. The DNA was blotted overnight onto Hybond N+ (Amersham Biosciences RPN203B), a positively charged nylon transfer membrane, using 20X SSC (appendix 1) as the transfer buffer. DNA was irreversibly bound to the membrane by exposure to UV light for 2 minutes. The membrane could then be washed briefly in distilled water to remove any excess agarose, air-dried and stored at 4°C.
2.21 Southern blot Digoxigenin (DIG) probe labelling, hybridisation and detection DNA fragments to be DIG labelled and used as Southern probes were generated by PCR from plasmid DNA using primers specific to each transgene. PCR products were purified by gel extraction and quantitated by running on a 1% agarose TAE gel alongside a quantitative DNA ladder. 1-3 pg of DNA template was made up to a volume of 16 0 with sterile water and boiled for 10 minutes to separate strands before placing immediately on ice. 4 1A1 of DIG high prime mix (Roche-1 585 606) containing digoxygenin labelled dUTP was added and the reaction incubated at 37°C for 20 hours. The mixture was cleaned using a spin column (Bioline-BIO-28030) after
103 labelling to remove any unincorporated labelled nucleotides that could cause high background. The amount of probe successfully labelled was quantitated by dot blotting a dilution series of the probe, along with a dilution series of control labelled DNA (Roche-1 585 738) onto a nylon membrane, cross linking with UV and then carrying out the detection procedure described below.
The Southern blotted genomic DNA membrane was incubated with 10 ml of pre- warmed DIG Easy Hyb hybridisation solution (Roche-1 796 895) with gentle rotation at 42°C for 30 minutes. This solution was then discarded and the membrane incubated at 42°C overnight with 8 ml of pre-warmed hybridisation solution containing 20 ng/ml of denatured probe. The probe was denatured by boiling in 20 iil of water for 5 minutes and then placing immediately on ice. This hybridisation solution could be re- used by storing at -20°C and heating to 68°C for 10 minutes immediately before use. Following hybridisation the membrane was washed twice for 5 minutes in 2X SSC containing 0.1% SDS at room temperature and then twice for 20 minutes in 0.5X SSC containing 0.1% SDS at 65°C with gentle agitation.
For detection of the labelled probe, the membrane was rinsed briefly in maleic acid wash buffer (appendix 1) before incubation in blocking solution (Roche-1 096 176) for 30 minutes with gentle agitation at 37°C. This blocking solution was discarded and the membrane incubated for a further 30 minutes in blocking solution containing a 1:10,000 dilution of an anti-digoxigenin alkaline phosphatase conjugated antibody (Roche-1 093 274). The membrane was washed twice for 15 minutes in maleic acid wash buffer and then the membrane adjusted to the correct pH by equilibration for 5 minutes in detection buffer (appendixl). The membrane was then placed between two sheets of soft plastic and 1 ml of the alkaline phosphatase chemiluminescent substrate, CSPD, (Roche- 1 755 633) applied drop wise to the surface of the membrane. The membrane was covered with the plastic sheet to distribute the substrate evenly over the surface and then incubated for 5 minutes at room temperature before removing all air bubbles and sealing the edges of the plastic by heat. The membrane was exposed
104 to light sensitive film (Sigma-Z37351650EA) for 15-120 minutes to achieve the desired signal strength.
2.22 Tamoxifen induction Cre nuclear localisation in MerCreMer (Bm70) transgenic animals was induced using Tamoxifen (Sigma-T5648). Tamoxifen was administered at a dose of 1 mg/mouse//day for 5 consecutive days and was prepared by combining 10 mg tamoxifen with 100 d EtOH and 2 ml of sunflower oil (Tesco pure sunflower oil). The mixture was incubated in a sonic water bath at room temperature for 30 minutes. 200 [1,1 per mouse of the sonicated mixture was administered by i.p injection each day.
2.23 Footpad /flank peptide immunisation The peptide PLP 56-70 (DYEYLINVIHAFQYV) was used for immunisation and in vivo priming of T cell responses in NOD.E mice (Lund et al., 1990 and Takacs et al., 1995). 50 IA.g of peptide, as an emulsion with either Complete Freund's Adjuvant (CFA) (Sigma-F5881) or Incomplete Freund's Adjuvant (IFA) (Sigma-F5506), was administered per immunisation in the footpad or the flank. 50 µ.1 or 100 pi of peptide emulsion were injected into the footpad or flank respectively. Emulsions were a 1:1 mixture of peptide solution and CFA or IFA and were prepared by vortexing for 30 minutes, followed by incubation in an iced sonic water bath for 1 -2 hours.
2.24 Immediately ex vivo T cell proliferation assay 10 days (unless otherwise stated) after immunisation with peptide, the draining lymph node (s) (DLN) and spleen were harvested. The popliteal lymph node drains from the footpad and the inguinal lymph node drains from the flank. Single cell suspensions were prepared in HL-1 medium (Cambrex-BE344017) supplemented with 2 mM L- glutamine (Gibco-25030024), 25 Wm' Penicillin G (Gibco-15070063) and 25 µg/m1 Streptomycin sulfate (Gibco-15070063). Cells were counted using a haemocytometer and were cultured in triplicate in 96- well plates (SLS-161093) with 3 x 105 cells per well in the presence of different concentrations of peptide PLP 56-70 (DKEKLINVIHAFQYV). A substituted (Y-'K) version of the peptide PLP 56-70
105 was used for in vitro assays as the un-substituted peptide is very insoluble. After 2 days of culture, 100 Ill of supernatant was removed from each well. Supernatants from triplicates were pooled and stored at —20 °C for subsequent cytokine analysis by ELISA. 100 µ1 of fresh HL-1 culture medium was added to each well along with 5 [Xi of [3H] Thymidine (MP-2405905). Cells were cultured for an additional 18 hours before plates were harvested (MACH III M Harvester 96) for beta scintillation counting (Wallac 1450 microbeta TRILUX).
2.25 Culture of T cell lines T cell lines from immunised footpad draining lymph nodes were set up with 3 x 106 DLN cells / ml in the presence of 25 [tg/ ml of PLP 56-70 (substituted). After 48 hours, IL-2 (10 IU/ml) (R&D systems-402-ML-020) was added to the culture medium and the cultures incubated for an additional 8 days. Cells were then resuspended in RPMI 1640 medium containing 10% Foetal Calf Serum (FCS) (Globepharm-batch F30610), 50 I_LM beta mercaptoethanol (Sigma-M7522), 2 mM L-Glutamine 50 U/ml Penicillin G and 50 µg/ml Streptomycin sulfate, and restimulated with 25 µg/ml of peptide in the presence of 3 x 106 /ml of irradiated NOD.E splenocytes. The ratio of T cells to irradiated APC in restimulation cultures was 1:25. Splenocytes were irradiated by exposure to 3000 RADs of gamma radiation (Gammacell® 3000 Elan, Nordion International Inc.). All T cell lines were repeatedly restimulated every 9-11 days and maintained in 10 IU/ml IL-2. Proliferation assays were set up for each line at each restimulation to check peptide specificity and cytokine production. Proliferation assays were performed as described above with 3 x 105 irradiated splenocytes and 2 x 104 T cells in RPMI 1640 medium per well. RNA was also isolated from each cell line at each restimulation.
2.26 Measurement of bronchial hyperreactivity (BHR) Measurement of BHR was performed by recording respiratory pressure curves by whole body plethysmography, calculated as Penh (Enhanced Pause, Buxco, USA). Mice were placed, fully conscious, into individual plethysmograph chambers and changes in air pressure between these chambers and a control chamber measured by a
106 differential pressure transducer to give a lung function measurement for each individual mouse. Penh is a calculated value, which correlates with measurement of airway resistance, impedance, and intrapleural pressure in the same mouse (Hamelmann et al., 1997). Penh = ((Te-Tr)/Tr x PEP/PIP (Te = expiration time, Tr = relaxation time, PEP = peak expiratory pressure, PIP= peak inspiratory pressure). Following a baseline measurement, Penh measurements were taken for each mouse in response to increasing doses (3, 10, 30 and 100 mg/ml) of methacholine (Sigma- A2251).
2.27 Measurement of Resistance (R) and Compliance (Cdyn) Mice were anaesthetised by sub-cutaneous (s.c) injection of 100 ILL1 of a 1:0.55:0.42 mix of PBS, Medetomidine hydrochloride (Pfizer-Domitor®) and ketamine (Fort Dodge Animal Health Ltd-Ketaset®). After 15 minutes, a further 150 RI of anaesthetic was administered by intra-muscular (i.m) injection before cannulation of the trachea. Mice were placed onto an artificial ventilator and, following a baseline reading, resistance and compliance measurements taken (Buxco, USA lung function equipment) in response to PBS and increasing doses (3, 10, 30 and 100 mg/ml) of methacholine.
2.28 Collection of Bronchoalveolar lavage (BAL) and serum Unless mice had already undergone resistance and compliance lung function measurement, in which case they were already unconscious, mice were anaesthetised by intra-peritoneal (i.p) injection of 80 pi of a 2:1 mix of ketamine (Fort Dodge Animal Health Ltd-Ketaset®) and xylazine (Bayer-Rompune). Mice were exsanguinated by cardiac puncture followed by cannulation of the trachea. Lungs were lavaged 3 times with 0.4 ml Phosphate Buffered Saline (PBS) (Invitrogen-10010- 015) using a 1 ml syringe and all BAL fluid for each mouse was pooled. BAL fluid was centrifuged at 260 x g for 8 minutes. The supernatant was removed to a new tube and stored at —80 °C for subsequent cytokine analysis by ELISA (see below). Blood collected from cardiac puncture was left to coagulate at room temperature overnight
107 before centrifugation at 12,000 x g and collection of the serum fraction. Serum was stored at -80 °C for subsequent analysis by ELISA.
2.29 Cell extraction from whole lung lobe One lung lobe was finely chopped and placed into 5 ml of RPMI 1640 medium (Gibco-31870-025) containing 0.15 mg/ml Collagenase D (Roche-11088858001) and 25 lig/m1DNase I (Roche-11284932001). The lung tissue was incubated with shaking for 1 hour at 37°C and the mixture passed through a 70 pan cell strainer. Cells were washed twice in RPMI 1640 medium before differential cell counting (see below).
2.30 Differential cell counting Following centrifugation of BAL fluid or lung cells, cells were re-suspended in 250 .d of RPMI culture medium. A small aliquot of this cell suspension was diluted 1:2 in Turks stain (appendix 1) to lyse red blood cells, and white blood cells were counted on a haemocytometer. Samples were adjusted to 5 x 105 cells / ml and 100 1A,1 (5 x 104 cells) spun onto a polysine glass microscope slide (VWR-6310107). Cytospins were performed by centrifugation (Shandon-Cytospin 3) at 400 rpm for 4 minutes. Slides were allowed to air dry for 5 minutes before fixing in methanol for 3 minutes. Wright Giemsa staining of BAL cytospins allowed different cell types to be distinguished on the basis of morphology (appendix 9). Slides were stained by immersing in Wright Giemsa stain (Sigma-WG16) for 1 minute, followed by distilled water for 6 minutes without agitation. Slides were rinsed briefly in running distilled water to stop stain development and then allowed to air dry before addition of a cover slip and cell counting. A total of 300 cells were counted on each slide and the total number of each cell type recovered calculated by multiplying the percentage of each cell type by the total number of cells isolated in each sample.
2.31 Lung homogenate One lung lobe was weighed and placed into Hank's Balanced Salt Solution (HBSS) without MgC12 or CaC12 (Invitrogen-14175-046), containing a mixture of protease inhibitors (Roche-11836153001), at a concentration of 100 mg of lung per 1 ml of
108 HBSS solution. The lung was homogenised using an electric homogeniser before centrifugation (1500 x g) and collection of the supernatant for analysis by ELISA. If it was not possible to process the lung tissue immediately after harvesting, lung lobes were snap frozen using liquid nitrogen and stored at -80 °C.
2.32 Lung histology - Tissue preparation Lungs and heart were removed from the chest cavity en bloc prior to lung inflation or harvesting of lung for RNA / cell extraction. If lung tissue was required for RNA or cell extraction it was necessary isolate and prevent inflation of several lobes by tying main bronchi with sewing cotton. Remaining lobes were inflated by intra-tracheal infusion of a 1:1 mixture of PBS and Optimal Cutting Temperature (OCT) embedding medium (Cell Path-KMA010000A). Inflated lung tissue was snap frozen in OCT using a dry ice/isopentane (BDH-103614T) slurry and stored at -80°C. Sections were cut on a cryostat (Bright) at a thickness of 5 IAM and mounted onto polysine glass microscope slides. Sections were allowed to air dry for 15 minutes before staining or storage at -20°C.
2.33 Haematoxylin and Eosin (H+E) staining Slides were immersed in Harris Haematoxylin (VWR-351945S) for 20 seconds and then held in running tap water until the sections were visibly blue. Slides were then immersed in 1% Eosin (VWR-341973R) for 5 seconds before dehydration and cover slip mounting. Sections were dehydrated by immersing, consecutively, for 30 seconds with gentle agitation, in 70%, 90%, 100% and 100% Industrial Methylated Spirit (IMS) (Fisher Scientific-M/4400/17) followed by 3 x 5 minute incubations in Histoclear (National Diagnostics-HS200). Cover slips were applied with DPX mountant (BDH-360294H).
2.34 Periodic Acid Schiff (PAS) staining and scoring Immediately after sectioning, lung tissue was fixed by incubating slides in ice-cold acetone for 15 minutes. Slides were allowed to air dry at room temperature before oxidising for 5 minutes in 1% periodic acid (MP Biomedicals-102595). Slides were
109 rinsed briefly in distilled water and then immersed in Schiff's reagent (Fisher Scientific-J/7300/PB08), in a fume hood, for 15 minutes. Slides were rinsed again in distilled water and then held under running tap water for 5 minutes to terminate the reaction. Nuclei were counterstained with Haematoxylin before dehydration and cover slip mounting (see above). To score PAS stained sections, the percentage of cells surrounding the lumen of each airway that were positively staining with PAS was calculated. Each airway was assigned a score from 0 to 4 where: 0 = less than 5% of cells are positively stained 1 = 5-25% of cells are positively stained 2 = 26-50% of cells are positively stained 3 = 51-75% of cells are positively stained 4 = greater than 75% of cells are positively stained The average airway score in each section was then calculated.
2.35 Immunohistochemistry - tissue fixation A hydrophobic barrier (Vector-H4000) was drawn around each tissue section to allow incubation of the section in small volumes (100-150 µl per section) of staining solutions. Tissue sections were fixed using 4% paraformaldehyde (Sigma-P6148) made up in PBS (Sigma-P4417). Sections were incubated with this fixative for 10 minutes before washing twice for 10 minutes in PBS. Peroxidase based or fluorescence antibody staining was then performed.
2.36 Peroxidase based immunohistochemistry Following fixation with paraformaldehyde, sections were incubated in 0.5% H202 (BDH laboratory supplies-101284N), made up in PBS, for 10 minutes. Sections were washed twice for 10 minutes with PBS and then incubated in blocking solution (appendix 1) for 30 minutes before rinsing in PBS. Sections were incubated for 15 minutes in Avidin block (Vector—SP2001) and 15 minutes in Biotin block (Vector- SP2001), rinsing with PBS in between, before application of the primary antibody. The primary and biotinylated secondary antibodies used for the detection of Cre, CC10, IL-8 and myeloperoxidase proteins are shown in appendix 2. Antibodies were
110 diluted in block solution and sections incubated at room temperature overnight. Sections were washed twice for 10 minutes in PBS and the secondary antibody applied for 40 minutes at room temperature. Sections were washed twice for 10 minutes in PBS, followed by application of an avidin/biotinylated peroxidase enzyme complex, solution ABC (Vector-SP2001) for 30 minutes, and two further PBS washes. To visualise antibody staining, solution AEC (Vector-SP2001) containing a peroxidase enzyme substrate was applied and colour development monitored under a light microscope. When the desired staining intensity was achieved, AEC solution was removed and slides washed several times in distilled water to terminate the reaction. Sections were then counterstained with hematoxylin to allow visualisation of tissue morphology and cover slips mounted using a glycerol based mounting medium (DAKO-00563). Images of tissue sections were captured using a light microscope and digital camera (Leica MPS 60 with IM1000 software).
2.37 Immunofluorescence tissue staining Following fixation in paraformaldehyde, sections were incubated in block solution for 30 minutes. Sections were washed twice for 10 minutes in PBS before application of the primary antibody overnight at room temperature. Primary antibodies used for fluorescence staining were as described for peroxidase staining. Sections were washed twice for 10 minutes in PBS and then incubated with secondary antibody for 1 hour at room temperature. For Cre staining, a TRITC conjugated donkey anti-rabbit antibody (SantaCruz-SC2095) was used at a dilution of 1:400. For CC10 staining, a FITC conjugated donkey anti-goat antibody (Jackson-705-095-147) was used at a dilution of 1:50. When double staining the same section for both Cre and CC10, the CC10 primary antibody was applied for 4 hours before incubation with the Cre primary antibody overnight. Secondary antibodies were also applied sequentially for 1 hour each, with the CC10 secondary antibody being applied first. Sections were washed twice for 10 minutes in PBS and cover slips mounted using Vectashield (Vector- H1200) to preserve the fluorescence lifetime. Images of fluorescence staining were captured using a fluorescence microscope and digital camera (Leica MPS 60 with IM1000 software).
111 2.38 Inflammatory cell scoring The same inflammatory scoring system was used to assess levels of inflammation around bronchi and blood vessels in both H+E and MPO stained lung sections. Each airway and blood vessel in a section was assigned a score from 0 to 3 where: 0 = Bronchi or blood vessel is not surrounded by any inflammatory cells 1 = Bronchi or blood vessels is surrounded by the occasional inflammatory cell 2 = Inflammation completely surrounds and is 1-4 cells in diameter from the edge of the bronchi or vessel 3 = Inflammation completely surrounds and is 5 or more cells in diameter from the edge of the bronchi or vessel Examples of bronchi and blood vessels assigned each score are shown in appendix 30. The average score for all bronchi and the average score for all blood vessels in a section was then calculated.
2.39 Induction of allergic airway disease using ovalbumin (OVA) Groups of hIL-8 transgenic and littermate control mice were sensitised by i.p injection of OVA (Sigma -A5503) (0.01 mg / mouse) in 0.3 ml of alum (Au-Gel-S, Serva Electrophoresis, Heidelberg, Germany) (AMS Biotechnology-12261.01) on days 0 and 12. Control mice received the same volume of PBS in alum. All mice were challenged on days 19, 20, 21, 22 and 23 with a 5% solution of OVA in PBS, administered as a 20 minute aerosol (PART Medical Ltd — TurboBoyN compressor). BHR was measured on day 24. Resistance and compliance measurements were taken on day 25 and lung tissue and peripheral blood were harvested for analysis.
2.40 Enzyme Linked ImmunoSorbant Assay (ELISA) Levels of cytokine production in cell culture supernatants and BAL were determined by ELISA, measuring against linear standard curves. 100 1A,1 of capture antibody (appendix 2) were added to wells of an ELISA plate (SLS-442404), the plate sealed and incubated overnight at room temperature. The next day, wells were washed 3 times with 400 [11 of wash buffer (appendix 1) and plates blotted against paper towel to
112 remove all liquid. 300 11,1 of block solution (appendix 1) were added to each well and plates incubated at room temperature for 1 hour. Wells were washed again and 50 pi of the appropriate dilution of standard (appendix 2) or sample added. Plates were covered and incubated at room temperature for 2 hours. Wells were washed again and 100 µ1 of the appropriate biotinylated detection antibody (appendix 2) added to each well. Plates were covered and incubated at room temperature for another 2 hours before another wash and addition of 100 !al of a 1/200 dilution of streptavidin Horse Radish Peroxidase (HRP) (R&D systems-DY998). Plates were incubated with streptavidin HRP for 20 minutes at room temperature before another wash step and addition of 100m1 of substrate solution (R&D systems-DY999). Plates were incubated at room temperature in the dark for 20-25 minutes before terminating the reaction with of 50 µl of stop solution (1M H2SO4). The optical density of each well at 450nm was determined using an ELISA plate reader (TECAN Sunrise) with wavelength correction set to 570 nm.
2.41 Flow cytometric analysis Fluorescence activated cell sorting (FACS) was performed on a BD Biosciences FACSCalibur, with CellQuest software (Becton Dickinson UK LTD) and fluorochrome-labelled antibodies. Single cell suspensions of thymocytes and splenocytes were prepared and washed once with PBS containing 10% FCS. Red blood cells in splenocyte preparations were lysed by resuspending briefly in distilled water followed by an additional PBS wash. Cells were stained with Phycoerythrin (PE) conjugated anti-mouse CD4 (eBioscience-12004183) and Fluorescein isothiocyanate (FITC) conjugated anti-mouse CD8 (eBioscience-11008182) or with FITC conjugated anti-mouse TCR (eBioscience-115961-81). Isotype matched controls, FITC Rat IgG2a (eBioscience 11-4321-81) and PE Rat IgG (eBioscience 12- 4301-81) were also used. Cells were stained for 45 minutes in the dark at 4 °C and washed twice with PBS containing 10% FCS before analysis.
113 Chapter 3
Generation of Thl and Th2 TCR a chain transgenic lines
Results
3.1 Determination of a and /3 TCR gene usage in Thl and Th2 lines specific for PLP 56-70
Short term Thl and Th2 polarised T cell lines derived from NOD.E mice and specific for the peptide epitope PLP 56-70 had been previously generated in our laboratory. The Thl line was maintained in IL-2 (330 IU/ml), IL-12 (100 IU/ml) and anti-IL-4 (10 µg/ml). The Th2 line was maintained in IL-2 (330 IU/ml), IL-4 (100 IU/ml) and anti- IFN-y (10 µgimp. The lines were strongly polarised and highly peptide specific and both had undergone three restimulations with NOD.E splenocytes and PLP 56-70. cDNA from both lines was available for analysis.
TCR gene usage in the Thl and Th2 cell lines described above was determined using a PCR strategy first described by Candeias et al. (Candeias et al., 1991). This strategy uses sets of degenerate primers, designed to bind all known TCR a and TCR p sequences, in combination with primers specific for the TCR constant regions. The strategy allows all TCR a or TCR 13 genes expressed by a population of T cells to be identified from a single nested PCR experiment. The PCR strategy and PCR products obtained from the Thl and Th2 T cell line cDNA are shown in figure 3.1.
114
(a)
Rearranged TCR a chain cDNA Rearranged TCR 13 chain cDNA
NW36 NK121 NW37 NK122 NW38 NK123 —IP- --110- --IP- -110. ___00. —110-
V J C V D J C 111111W/7 A I 4— 4— 4— if-- Al— NJ110 NJ109 NJ108 MS175 MQ284 (adapted from Candeias et al., 1991)
(b) (c) 0 z z Z 0 1--i bp Q bp o Z' H
1000—* 750-10- 750 —III. 500-0- 500 --110 250-0- 250
Figure 3.1 The PCR strategy used to determine a and p TCR gene usage in Thl and Th2 line cDNA. (a) A nested PCR strategy was used, involving 3 rounds of amplification for the TCR a chain and 2 for the TCR 13 chain. V region primers for both TCR a and TCR (3 chains are degenerate oligonucleotides designed to bind all known V genes. These primers were used in all PCR rounds. For the (3 chain, the C region primer MQ284 was used in the 1st round of amplification, followed by MS175. For the a chain, C region primers NJ108, NJ109 and NJ110 were used successively. The gel photos in (b) and (c) show the PCR products obtained from Thl and Th2 line cDNA using the TCR a chain and TCR p chain PCRs respectively. These PCR products are approximately 300bp in length and were TA cloned and sequenced in order to determine TCR gene usage for each T cell line.
115 TCR gene sequences amplified by PCR were identified by TA cloning and sequencing. 29 TCR a clones were sequenced for both the Thl and Th2 T cell lines. 30 and 31 TCR p clones were sequenced for the Thl and Th2 lines respectively. Dominant TCR a sequences were found in both cell lines. 48% of a clones sequenced from the Thl line were identified as using the a chain variable region gene TRAV1OD with the a chain joining region gene TRAJ58 (table 3.1). The CDR3 region of this TCR a chain was 12 amino acids in length (CAASREGTGSKLSF). 31% of a clones sequenced from the Th2 line were identified as using the a chain variable region gene TRAV17 with the a chain joining region gene TRAJ50 (table 3.2). The CDR3 region of this TCR a chain was 14 amino acids in length (CALEGIASSSFSKLVF). These dominant Thl and Th2 TCR a chains were selected for transgenic expression. Although both lines had a dominant TCR a chain sequence, the gene usage and CDR3 region sequences were more heterogeneous in the Th2 line. 6 different combinations of variable and joining a chain genes and 6 different CDR3 a sequences were identified in the Thl line compared with 9 different gene combinations and 12 different CDR3 a sequences in the Th2 line (figure 3.2). In keeping with the data previously published by our laboratory (Boyton et al., 2002), there was a statistically significant difference in CDR3 a length between Thl and Th2 derived sequences. The Thl line had a mean CDR3 a length of 11.4 + 0.2 compared to 12.5 + 0.2 for the Th2 line. Comparison of these two mean values gives a P value of <0.0005.
There was no statistical difference in CDR3 p length between Thl and Th2 derived sequences, which had mean values of 12.3 + 0.2 and 12.4 + 0.3 respectively (P = 0.974). No TCR p chain appeared dominant in either line (tables 3.3 and 3.4), although as seen for the a chain genes, p gene usage and CDR3 region sequences were more heterogeneous in the Th2 line (figure 3.2). The lack of a dominant TCR p chain in either line made it impossible, at this stage, to determine which 13 chain was pairing with the dominant Thl and Th2 TCR a chains. Indeed the heterogeneity of the 13 chains, particularly in the Th2 line, suggests that the dominant a chains are able to pair with more than one (3.
116 Previously published data (Boyton et al., 2002) suggested that the dominant 14 amino acid CDR3 a motif identified in the Th2 line would not be present in the Thl line, but that the shorter, Thl derived, 12 amino acid CDR3 a motif would be permissible in both Thl and Th2 cells. PCR primers specific to these CDR3 regions were used to confirm this finding in these cell lines (figure 3.3). This data confirmed the selection of these Thl and Th2 derived dominant TCR a chains as good candidates for transgenic expression. No beta chain pair for either TCR a chain had been determined. Therefore, only transgenes for expression of TCR a chains were constructed. The intent was to identify beta chain pairs for each a chain in vivo and also to use these animals to answer questions about the impact of the structurally different Thl and Th2 a chains alone on T cell responses and beta chain selection.
117 Table 3.1 TCR a sequences from a Thl polarised NOD.E T cell line against PLP (56-70)
TA clone TRAV CDR3a amino acid sequence TRAJ CDR3 length Th1 A1.5 10D CAASREGTGSKLSF 58 12 A1.10 A1.11 A1.16 A1.19 A1.20 A1.33 A1.42 A1.43 A1.44 A1.47 A1.48 A1.61 A1.62 A1.23 CAASKPNNRIFF 31 10 A1.4 17 CALEGRGGRALIF 15 11 A1.15 A1.18 A1.34 A1.45 A1.46 A1.49 A1.51 A1.9 4D-3 CAALPGTGSNRLTF 28 12 A1.17 A1.55 A1.8 CAAETNSAGNKLTF 17 A1.27 CAADSNYQLIW 33 9 A1.60
Mean Thl CDR3a length = 11.4 + 0.2 (SE)
118 Table 3.2 TCR a sequences from a Th2 polarised NOD.E T cell line against PLP (56-70)
TA clone TRAY CDR3a amino acid sequence TRAJ CDR3 length Th2 A2.13 17 CALEGIASSSFSKLVF 50 14 A2.15 A2.16 A2.20 A2.21 A2.33 A2.39 A2.41 A2.54 A2.10 12-2 CALSDANNYAQGLTF 112-2 13 A2.31 A2.38 A2.42 A2.32 13-4 CAMERQDNYAQGLTF A2.3 6-6 CALGEDTNAYKVIF 30 12 A2.17 CALVRDTGYQNFYF 49 A2.49 A2.53 CALGFQGGRALIF 15 11 A2.48 CALGSQGGRALIF A2.22 10 CAASRGNMGYKLTF 9 12 A2.25 A2.58 A2.14 3-3 CAVRGTNAYKVIF 30 11 A2.40 A2.55 A2.34 CAAGDTNTGKLTF 27 A2.35 A2.36 CAALNTNTGELTF A2.43 CAALNTNTGKLTF
Mean Th2 CDR3a length = 12.5 + 0.2 (SE)
119 Table 3.3 TCR 3 sequences from a Thl polarised NOD.E T cell line against PLP (56-70)
TA clone TRBV CDR3P amino acid sequence TRBJ CDR3 length Thl B1.14 2 CASSQGPLSNERLFF 1.4 13 B1.36 B1.41 B1.81 B1.82 B1.83 B1.98 B1.57 CASSKAGTGEDTQYF B1.1 CASSQEMQGQDTQYF B1.94 B1.95 B1.37 CASSQQGDQDTQYF 12 B1.60 CASSQEGTGVQDTQYF 14 B1.3 , CASSRDWGDTQYF 11 B1.21 B1.85 B1.90 B1.70 CASSPWGVQDTQYF 2.5 12 B1.93 B1.10 : CASSQAGTDTQYF 11 B1.18 19 CASSRSGDQDTQYF 12 B1.58 B1.88 B1.92 B1.96 B1.97 B1.77 16 CASSNQNYAEQFF 2.1 11 B1.84 CASSLAGQGARSQNTLY] 2.4 16 B1.89 CASSSRDWGDEQYF 2.7 12 B1.8 15 CASSLVGAEQFF 2.4 10
Mean Thl CDR3p length = 12.3 + 0.2 (SE)
120 Table 3.4 TCR 13 sequences from a Th2 polarised NOD.E T cell line against PLP (56-70)
TA clone TRBV CDR3[3 amino acid sequence TRBJ CDR3 length Th2 B2.2 16 CASSFQTGGAETLYF 2.3 13 B2.7 B2.5 CASSVRDWGDTQYF 2.5 12 B2.84 CASSLRGHTEVFF 1.1 11 B2.53 CASSLRNTEVFF 10 B2.4 : CASSQEAGGVDTQYF 13 B2.8 B2.56 CASSQEGWGPYEQYF 2.7 B2.61 CASSQGLGNYAEQFF 2.1 B2.66 CASSQEGTGGYAEQFF 14 B2.82 CASSQDGTGGYAEQFF B2.78 CASSLGTGDAEQFF 12 B2.30 CASSPANSDYTF 1.2 10 B2.46 CASSQGIYEQYF 2.7 B2.74 CASSLRDNGDTQYF 2.5 12 B2.13 19 CASSPRTTSGNTLYF 1.3 13 B2.71 B2.31 CASSSPTGGWNAWQFF 2.1 14 B2.50 CASSSPTGGWNAEQFF B2.86 B2.76 CASSPPTGSPNERLFF 1.4 B2.79 B2.85 CASSIEDSGTEVFF 1.1 12 B2.26 4 CASSPRGLYAEQFF B2.43 CASSNYAEQFF 9 B2.68 13-3 CASSGRTTANTEVFF 13 B2.75 20 CGARDLWGGKNTLYF 2.4 B2.83 B2.80 1 CTCSADGSYEQYF 2.7 11 B2.24 17 CASSSGGFAETLYF 2.3 12 B2.63 CASRDWGETLYF 10
Mean Th2 CDR3(3 length = 12.4 + 0.3 (SE)
121
(a) Thl line
TCR a gene usage TCR 13 gene usage
V2 - 31.4 V19 - 32.1 VlOD - 358 V4 - 31.4 V17 - 315 V4 - 32.5 V4D3 - 328 V5 - 32.5 V4D3 - 333 _ V16 - 32.1 V4D3 - 317 • V16 - 32.4 V10 - 358 E V16 - 32.7 • V15 - 32.4
(b) Th2 line TCR a gene usage TCR 13, gene usage
EV16 - 32.3 riV2 - 31.1 V19-31.3 :7,V19 - 32.1 E V17 - 350 EV19 -31.4 'V12-2 - 3112-2 ,V20 - 32.4 V10 - 39 E V2 -32.1 V3-3 - 330 EV16 - 31.1 V6-6 - 349 E V2 - 32.7 V3-3 - 327 55V17 - 32.3 • V6-6 - 315 E V4 - 31.1 V6-6 - J30 V2 - 31.2 E V13-4 - 3112-2 EIV2 - 32.5 V16 - 32.5 EIV19 - 32.1 E V19 - 31.1 V13-3-31.1 E V1 - 32.7
Figure 3.2 A comparison of TCR a and gene usage in Thl and Th2 T cell lines in order to select chains for transgenic expression. TCR gene usage in a Thl and Th2 T cell line are shown in (a) and (b) respectively. Each segment of a pie chart represents an individual CDR3 sequence, while V-J gene combinations are differentiated by colour. The percentage of each a repertoire made up by the most dominant TCR chain is also shown. The dominant a chains for both the Thl and Th2 lines were selected to be expressed transgenically, but diverse gene usage and CDR3 regions in TCR 13 chain repertoires meant that (3 chain pairs could not be identified.
122 Thl CDR3a motif Th2 CDR3a motif
a.) bp .0 .0 .0 .0 — 4 0 4 z H H.
500
250-'10.
Figure 3.3 Presence or absence of the dominant Thl and Th2 CDR3 a motifs in Thl and Th2 lines. Primers specific for the dominant Thl 12 amino acid CDR3 motif and Th2 14 amino acid CDR3 a motif were used with C region primer NJ108 to determine presence of these motifs in Thl and Th2 line cDNA. The shorter Thl motif is present in both Thl and Th2 lines, while the longer Th2 motif is only present in the Th2 line.
123 3.2 Construction of Thl and Th2 TCR a chain transgenes.
Several different cassette vectors have been used to achieve transgenic expression of TCR genes. Promoter sequences that have been used in these vectors to drive TCR expression include CD2 (McHugh et al., 2001) and MHC class I (Kb) (Mendel et al., 2004). However, as expression of TCR genes is not an endogenous function of these promoters, TCRs under the control of these vectors can be subject to abnormal timing and regulation of expression. The vector used in this study (pTa) was designed by Kouskoff et al. (Kouskoff et al., 1995) and utilises endogenous mouse TCR promoter and enhancer elements. As such, the vector contains many kilobases of non- coding sequence cloned from regions upstream and downstream of the mouse TCR locus. The aim is to ensure that TCR expression is, as far as possible, under the control of its natural regulatory elements. The vector also contains the mouse TCR Ca gene and associated regulatory sequences. To express a TCR a chain transgenically it is necessary to clone into the vector the rearranged V-J coding sequence of interest.
Many TCR transgenics have been created using TCR a or I chain cDNA. However, although in the genome of a T cell, TCR genes have been rearranged and spliced together, some intronic sequences remain. Intronic sequence is present at the 5' and 3' ends of the rearranged V-J segment, but also separates a coding leader sequence from the remainder of the V gene (figure 3.4). To express a TCR a chain using the pTa cassette vector it is essential to include a short section of intronic sequence 3' to the rearranged J gene. This allows splicing of the V-J coding segment to the Ca gene also present in the vector. It is unknown exactly what role the other intronic sequences may play in the regulation and processing of the TCR, but it is thought advisable to include them in the construct. Therefore, the T cell genomic configuration of the V-J segment, rather than that found in cDNA should be used to create the TCR transgene.
124
fa) Non-T cell genome
Intron LP1 V J C // //
(b) T cell genome
Intron LP1 V C umoma:zzzmu---//
CDR3
(c) T cell mRNA
LP1 V C
CDR3
(d) Required TCR gene arrangement in transgenic expression vector
Intron LP1 V il= r af i I- '—r--) CDR3
Figure 3.4 The different states of arrangement of TCR a genes. (a) No rearrangement of TCR a genes occurs in non-T cells. Germ-line configuration is maintained. (b) In the thymus, rearrangement of TCR a genes occurs in T cells such that a V gene is spliced to a J gene at the level of genomic DNA, to create a variable CDR3 a region. Intronic sequence remains between the V leader region (LP1) and the rest of the V gene and also between the J and C regions. (c) These intronic sequences are removed by splicing at the level of mRNA prior to expression of a functional TCR a chain on the surface of the T cell. (d) To express a TCR a chain transgenically, the arrangement of TCR a genes should resemble that found in the T cell genome, as intronic sequences present in this configuration facilitate correct processing and expression of the TCR.
125 For the T cell lines and T cell receptor sequences being used in this study, only cDNA samples were available. It was therefore not possible to obtain the correct T cell genomic configuration of the Thl and Th2 TCR V-J segments by a single PCR strategy.
The only region of each required TCR a V-J segment not present in non-T cell genomic DNA was the junction between the rearranged V and J gene (CDR3 region). The CDR3 region is present in cDNA and so it was possible to create the required configuration of each V-J segment by cloning together fragments derived from non-T cell NOD.E genomic DNA and Thl or Th2 line cDNA. The cloning strategies, including PCR primers and restriction enzyme sites, used for both the Thl and Th2 TCR a chain constructs are shown in figures 3.5 and 3.6.
Three PCR fragments were used to create each TCR a V-J segment. The 2 intron containing fragments were derived from non-T cell NOD.E genomic DNA and fragments containing the rearranged 12 amino acid and 14 amino acid CDR3 regions were derived from Thl and Th2 cDNA respectively. The sequences of all PCR primers used for these cloning strategies, along with the PCR conditions and product sizes are shown in appendix 6. The PCR products cloned, and the joining together of these PCR fragments to create the Thl and Th2 TCR a transgenes, are shown in figure 3.7. For both the Thl and Th2 strategies it was necessary to create a Hind III restriction site in the J region in order to join the PCR fragments. In both cases the change was a single base pair mutation from G to T, introduced using the PCR primers used to obtain the PCR fragments. Mutations were silent and resulted in the creation of an alternative codon for the amino acid leucine. All fragments generated by PCR were verified by sequencing prior to proceeding with subsequent stages of the cloning strategy. The nucleotide and amino acid sequences of the Thl and Th2 TCR a V-J segments are shown in appendices 17 and 18 and appendices 19 and 20 respectively.
126
(ii) (iii)
NOD.E genomic DNA Thl line cDNA NOD.E genomic DNA
TRA V10 ThlintronF HindIIITh IF Nco- I Hind III Hind- III Xma 1 Nco I Sac II
LP1 V10 V10 J58 J58
Th1LP1/2IntronR ThlHindIIIR TRAJ58
Fragments joined using Nco I V Nco I Hind III (b) Xma I 11..2MAI LP1 VIO J58 Fragments joined using Hind III
Nco I Xma I immi Hind III Sac II (c) I LP1 V10 J58
Complete Thl VI 0/J58 Xma I fragment cloned into the pTa expression vector using Xma I Sac II and Sac II (d) Sal I pTa Sal I --...... ,cassette vector
Thl a construct is linearised for injection using Sal I Figure 3.5 A schematic diagram showing the cloning strategy used to create the Thl a chain construct. It was only possible to obtain the correct CDR3 a region from Thl line cDNA. However, cDNA derived TCR sequence does not contain the required intronic regions (figure 3.4). (a) The TCR a chain was therefore created using 2 intron containing fragments (i) and (iii) derived from NOD.E genomic DNA and one CDR3 a containing fragment (ii) obtained by PCR from Thl line cDNA. (b) The 5' intronic fragment and that containing the CDR3 region were cloned together using a unique and endogenous NcoI site. (c) It was necessary to introduce a unique HindIII site into the sequence of J58 by PCR in order to join the 3' intronic fragment. The G-*T mutation introduced does not alter the amino acid sequence of the final protein. (d) XmaI and SacII sites were introduced by PCR at the 5' and 3' ends of the a chain respectively to allow directional cloning into the pTa cassette vector. Bacterial sequences were removed from the vector, by digestion with Sall, prior to pronuclear injection. All PCR primers and conditions are shown in appendix 6. 127
(ii) (iii)
NOD.E genomic DNA Th2 line cDNA NOD.E genomic DNA
TRAV 17 Th2intronF Th2HindIIIF Sac I Hind III Hind III Xma I Sac I Sac II Adomr2=1] LP1 V17 V17 J50 J50 Th2LP 1 /2IntronR Th2HindIIIR TRAJ50
Fragments joined using Sac I V Sac I Hind III (b) Xma I I 11011=.11 1 LP1 V17 J50 Fragments joined using Hind III
Xma I Sac I Hind III (c) Sac II LP1 V17 J50 Complete Th2 V17/J50 fragment is cloned into the pTa Xma I expression vector using Xma I Sac II and Sac II
Th2 a construct is linearised for injection using Sal I Figure 3.6 A schematic diagram showing the cloning strategy used to create the Th2 a chain construct. It was only possible to obtain the correct CDR3 a region from Th2 line cDNA. However, cDNA derived TCR sequence does not contain the required intronic regions (figure 3.4). (a) The TCR a chain was therefore created using 2 intron containing fragments (i) and (iii) derived from NOD.E genomic DNA and one CDR3 a containing fragment (ii) obtained by PCR from Th2 line cDNA. (b) The 5' intronic fragment and that containing the CDR3 region were cloned together using a unique and endogenous Sad site. (c) It was necessary to introduce a unique HindIII site into the sequence of J50 by PCR in order to join the 3' intronic fragment. The G---*T mutation introduced does not alter the amino acid sequence of the final protein. (d) XmaI and SacII sites were introduced by PCR at the 5' and 3' ends of the a chain respectively to allow directional cloning into the pTa cassette vector. Bacterial sequences were removed from the vector, by digestion with Sall, prior to pronuclear injection. All PCR primers and conditions are shown in appendix 6. 128 To enable each complete V-J segment to be inserted into the pTa cassette vector, XmaI and SacII restriction sites were introduced by PCR at the 5' and 3' ends respectively (figure 3.7). Screening for successfully ligated clones by restriction enzyme digest was possible due to the difference in size between the V-J a segment being removed and that being introduced (figure 3.8). The large size of the pTa cassette vector, and the tendency of this plasmid to undergo rearrangements and deletions during manipulation, meant that it was also necessary to check patterns of digest with other restriction enzymes, such as EcoRl (figure 3.8). Observation of the same patterns of digest before and after manipulation meant that the cassette vector was intact. That the Thl and Th2 TCR a V-J segments were correct within the final constructs was also confirmed by sequencing. Plasmid maps of the Thl and Th2 TCR a constructs are shown in appendices 10 and 11 respectively.
Introducing bacterial sequences from the cloning vector into the mouse genome during transgenesis is not recommended and can result in greatly reduced levels of transgene expression or even no expression of the transgene at all. (Kjer-Nielsen et al., 1992). Bacterial sequences of the pTa cassette vector were therefore removed from both the Thl and Th2 TCR a constructs, by digestion with Sal I, prior to pronuclear injection. The 15,000 bp fragment of each construct purified for injection is shown in figure 3.8.
129 Th l Th2
(a) (b) < < < z z z 0 z z bp .... bp z z z z. :.. 0 .... z. :.
750 —* 750 —10 500 —0. 500-0. 250 —* 250
(c) (d) II) Sac / (EcoR1) (EcoR1) I Xma
bp ( c
1000-0' 1000-0 750-10 750 500 500
Figure 3.7 Assembly of Thl and Th2 TCR a chain constructs. All gel lane labels refer to fragments described in figures 3.5 and 3.6 for Thl and Th2 constructs respectively. (a) and (b) show the 3 PCR fragments required for assembly of the Thl and Th2 TCR a chains respectively. (c) and (d) show the joining of these fragments and the successful introduction of XmaI and SacII sites at either end of these constructs. All construct fragments shown in (c) and (d) are in the cloning vector pCRe2.1, and within this vector are flanked by EcoR1 sites.
130 (a) Original pTa Thl Th2
cd o cn v) $... --- --.. "0N T' 'c.71 r4 bp "0 X E o X
10000 6000 3000
1000 750 500
(b)
Thl Th2
o o tu 8 bp cd a
10000 6000
3000 2000
Figure 3.8 Complete Thl and Th2 TCR a constructs. Thl and Th2 VJ fragments were inserted into the pTa cassette vector by directional cloning using XmaI and SacII. (a) XmaI/SacII digests of the final Thl and Th2 constructs show the presence of the respective VJ regions (661 and 622 bp) replacing a larger VJ fragment (approx. 950 bp) used previously in this vector. The pTa vector is very large (20,000 bp) and so can be prone to rearrangements during manipulation. EcoRI digests of the Thl and Th2 constructs, and of the original vector, demonstrate that no rearrangements or deletions have occurred. (b) It was necessary to remove the 5000 bp bacterial sequence from the Thl and Th2 vectors prior to pronuclear injection. This was achieved for both constructs by digestion with Sall and purification of the upper 15,000 bp band.
131 3.3 Identification of Thl and Th2 TCR a chain transgenic founder animals.
The inbred mouse strains used most frequently for pronuclear injection are FVB/N and C57BL/6. These strains respond well to super-ovulation and pronuclear embryos are generally larger and less fragile than those of other mouse strains, making them technically easier to inject and giving better rates of embryo survival and transgene integration (Brinster et al., 1985). However, the Thl and Th2 cell lines, from which the transgenic TCR a chains were identified, were originally derived from NOD.E mice. In NOD and NOD.E mouse strains, the peptide epitope for which the TCR a chains are specific, PLP 56-70, is presented in the context of the MEIC class II molecule I-Age. Transgenic mice carrying either TCR a chain transgene must therefore also express I-Age in order for T cell responses to PLP 56-70 to be studied, and TCR I chain pairs to be identified in these animals. To circumvent the need to cross the transgenic founder animals onto a NOD.E background, the Thl and Th2 TCR a chain transgenes were initially injected into NOD oocytes. Despite their fragility, NOD oocytes have successfully been used to generate transgenic lines (O'Shea et al., 2006 and Birk et al., 1996). However, multiple attempts to inject the TCR constructs into these pronuclear embryos failed to generate any litters. Therefore, to achieve transgenesis, it was necessary to use C57BL/6 or FVBN oocytes.
48 potential founder animals obtained from pro-nuclear injection of FVB/N oocytes at the Nuffield department of Medicine in Oxford were screened for the presence of the Th2 TCR a chain transgene. An initial PCR screen, using genomic DNA extracted from a tail biopsy, identified 2 founder animals (figure 3.9). These founder animals are subsequently referred to as Th2 a line 20 and Th2 a line 34, based on numbers assigned to each animal at the point of tail biopsy. The transgenic status of these two founder animals was confirmed by Southern blotting. The entire rearranged V-J segment present in the construct was used to probe genomic DNA that had been digested using the restriction enzyme EcoRI (figure 3.9). EcoRl does cut within the construct itself, but sites are only 3' to the V-J segment with the most 5' site 3013 bp from the 5' end of the construct. Integration of a transgene into the genome can occur
132 at one or multiple sites and at each site, multiple copies of the transgene are often found as head to tail concatamers. On the Th2 TCR a line Southern blot, bands present in transgenic and littermate samples are due to binding of the probe to endogenous, unrearranged, TRAV17 and TRAJ50 sequences. Bands that are differential between the two transgenic lines represent different sites of integration into the genome, while the most intense band, which is 6 kilobases in size, is due to the head to tail concatamers present at one or more of the integration sites.
23 potential founder animals obtained from pronuclear injection of C57BL/6 oocytes at the MRC Clinical Sciences Centre, Imperial college, were screened for the presence of the Thl TCR a chain transgene. An initial PCR screen identified 1 founder animal, Thl a line 30 (figure 3.10). The transgenic status of this animal was confirmed by Southern blot using the same strategy as that described for the Th2 TCR a chain, but using the Thl rearranged V-J segment as a probe (figure 3.10).
The sequence and product sizes of all PCR and Southern primers used for screening of Thl and Th2 TCR a chain transgenic founder animals are shown in appendix 6.
NOD.E mice were used as breeding partners for subsequent breeding of all TCR a chain transgenic founder animals. New generations of each line were also backcrossed onto NOD.E. As NOD.E mice are homozygous for the MHC class II molecule I-M7, all TCR a chain transgenic animals subsequent to the founder will express the transgene and I-Ag7.
133 TRAV 17 Th2lntronF Xma I (a) Sac II
LP I V17 J50 Th2HindIIIR TRA,150
rn (b) . 0 a,z 8 Potential founders 1-19 21-28 29-33 •2 35-48 bp 3 r-A---•
1000 500 250
der der n un fou 4 (c) 3 Line kb
10 E E 8 —0. 6 —+ V 5-4 4 -4 DIG labelled probe 3 2.5—+ 2--+
Figure 3.9 Identification of Th2 TCR a chain transgenic founder animals. Transgenic founders were identified by PCR and by Southern blot. The location of primers used for PCR screening (Th2lntronF and Th2HindIIIR) and for generation of the Southern probe (TRAV17 and TRAJ50) are shown in (a). Two transgenic animals were identified from an initial PCR screen of 48 potential founders (b). The transgenic status of these two animals (numbers 20 and 34) was then confirmed by Southern blot (c). The restriction enzyme used to digest genomic DNA for Southern blotting was EcoRI (E). This enzyme only cuts the integrated construct on the 3' side of the V-J region being used as a probe (c), giving information about construct integration sites and copy number.
134
TRAV 1 0 ThllntronF Xma I (a) Sac II
LP1 TRAVIO TRAJ58
ThlHindIIIR TRA,158
M4::, (b) < cli .,18 Z qZ Potential founders 16-29 1 31-39 bp 2 r.._____—•1/4—._._Th 1 r______—A_____‘
1000 500 250
der n fou
(c) kb 30 Line
12-11. 8 —IP. EEE E 6—O. V J C 5 4 —111 DIG labelled probe
3 —110.
Figure 3.10 Identification of the Thl TCR a chain transgenic founder animal. The transgenic founder was identified by PCR and by Southern blot. The location of primers used for PCR screening (ThllntronF and Thl HindIIIR) and for generation of the Southern probe (TRAV10 and TRAJ58) are shown in (a). One transgenic animal was identified from an initial PCR screen of 23 potential founders (b). The transgenic status of this animal (number 30) was then confirmed by Southern blot (c). The restriction enzyme used to digest genomic DNA for Southern blotting was EcoRI (E). This enzyme only cuts the integrated construct on the 3' side of the V-J region being used as a probe (c), giving information about construct integration sites and copy number.
135 3.4 Determination of TCR a chain transgene expression.
The TCR a chain transgenes contain multiple regions of intronic sequence as well as coding regions for the Thl and Th2 rearranged V-J segments and the mouse Ca gene. For correct expression, all intronic regions should be removed and the V-J coding segment spliced to the Ca gene.
A PCR strategy was used to demonstrate that correct processing of the transgenic TCR a chain, by removal of intronic sequence, and expression of the TCR a chain coding sequence, at the level of mRNA, was occurring in T cells from both of the Th2 TCR a chain transgenic lines (figure 3.11) and the Thl TCR a chain transgenic line (figure 3.12). Removal of the intronic sequence at the 5' end of the V gene results in a shorter V-J segment and therefore a smaller PCR product when cDNA is used as a template compared to genomic DNA.
Correct splicing of the TCR a V-J segments to the Ca gene present in the transgene was demonstrated by using the nested PCR strategy described in figure 3.1 to look at TCR a chain usage in these animals. The strategy uses primers specific for mouse V genes in combination with a primer specific for the mouse Ca gene. In the transgene, the J region and C region are separated by many kilobases of intronic sequence. A PCR product of the correct size will only be obtained if splicing has occurred. Splenocyte cDNA was used as a template for PCR and the sequences obtained from each line are shown in tables 3.5 and 3.6. From Th2 a line 20, all a sequences obtained were transgenic. From Th2 a line 34, most sequences were transgenic but a small number of endogenous TCR a sequences were also seen. From Thl a line 30 the percentage of the repertoire made up by the transgenic TCR alpha chain was more variable. In one animal 16% of the sequences obtained were transgenic compared to 54% for another. This data suggest that in the Th2 a chain transgenic lines levels of expression of the transgenic TCR are high, but are not completely exclusive of endogenous TCR. In the Thl a chain transgenic line expression levels may be more
136 variable and a significant number of T cells bear endogenous T cell receptors in these animals.
Although data presented thus far confirms correct processing and high levels of expression of the TCR a chain transgenes at the level of mRNA, they do not provide evidence for expression of the TCR chains at the surface of the T cell. Direct evidence for this is difficult to obtain as no antibodies exist against either TRAV10 or TRAV17. Other single TCR a chain transgenic models do exist and studies with these mice have demonstrated that mice expressing a TCR a chain transgene have an increased percentage of double negative (DN) thymocytes compared to wild-type mice (Huang and Kanagawa, 2004). During normal thymocyte development, the TCR p locus is the first to rearrange (Mombaerts et al., 1992b). Successfully rearranged p chains then pair with a surrogate a chain known as the pre-TCR a. This pre-TCRa/r3 complex mediates the differentiation of the thymocyte from CD4-CD8- (double negative) to CD4+CD8÷ (double positive) (Fehling et al., 1995). Studies of TCR a chain transgenic mice suggest that premature expression of a rearranged a chain at the DN stage of thymocyte development precludes the formation of pre-TCRa/f3 complexes. This results in less efficient transition of thymocytes from DN to DP and an increased percentage of DN thymocytes. Staining of thymocytes with antibodies against CD4 and CD8 showed this to be true for both lines of Th2 TCR a chain transgenic mice (figure 3.13). Additional evidence for altered TCR expression at the cell surface also comes from the observation that Th2 TCR a chain transgenic animals have a reduced CD4+: CD8+ ratio in the thymus. However, this difference in ratio was not observed in splenocytes (P = 0.9977 and P = 0.1999 for lines 34 and 20 compared to littermates respectively) and so the CD4+: CD8+ ratio of T cells in the periphery seems to be unaffected by Th2 TCR a chain transgene expression. An increased percentage of double negative thymocytes was also observed in Thl TCR a chain transgenic mice (figure 3.14). However, there was no change in the CD4+: CD8+ ratio in the thymi or splenocytes of these animals.
137 Despite high levels of transgene expression in Th2 TCR a chain transgenic animals, and significant levels of expression in some Thl TCR a chain transgenics, staining of splenocytes with an antibody directed against the constant region of the TCR demonstrated normal levels of a/13 TCR at the cell surface (figure 3.15).
138
527bp
(a) Transgenic genome Th2lntronF Th2HindIIIR
—.111111-1111 LP1 V17 J50
391bp
Th2lntronF Th2HindIIIR (b) Transgenic T cell cDNA —1
LP1 V17 J50
(c) (d)
-i-R 71- c.) - 1- < 0N cn :4 N cn ,- 4 '1) a) *.,a) -,:,c) CI ..-.= a.'+ .,- ,-,.:, bp ,4 by _..1ct
1000 1000 750 750 500 500 250 250
Figure 3.11 Demonstration of correct Th2 TCR a chain transgene processing and expression by PCR. Splicing out of intronic sequence should occur during correct processing and expression of the TCR a chain transgene. PCR using primers shown in (a) and (b) should demonstrate a size difference in PCR product between the genomic configuration of the construct (a) and that obtained from transgenic T cells where intronic sequence has been removed (b). An HPRT control PCR demonstrates successful reverse transcription from transgenic and littermate control splenocyte RNA (c). Expression of the transgene and correct splicing of intronic sequence has been demonstrated by PCR from splenocyte cDNA in both Th2 TCR a chain transgenic lines (d).
139 538bp
(a) Transgenic genome ThlIntronF ThlHindIIIR -111=-- 77/7/7/A LP1 V10 J58
372bp 4111 ► ThlIntronF (b) Transgenic T cell cDNA ThlHindIHR
LP1 V10 J58
0 (c) • DNA
g 0 ic -rt Cyd en bp -cf ccs Transg
1000 750 500
250
Figure 3.12 Demonstration of correct Thl TCR a chain transgene processing and expression by PCR. Splicing out of intronic sequence should occur during correct processing and expression of the TCR a chain transgene. PCR using primers shown in (a) and (b) should demonstrate a size difference in PCR product between the genomic configuration of the construct (a) and that obtained from transgenic T cells where intronic sequence has been removed (b). (c) Expression of the transgene, and correct splicing of intronic sequence, has been demonstrated by PCR in the Thl TCR a chain transgenic line using splenocyte cDNA. A low level of expression of this V10/J58 TCR sequence was also detected in the littermate cDNA sample.
140 Table 3.5 TCR a chain sequences from splenocytes of Th2 TCR a chain transgenic and littermate control animals.
TA clone TRAV CDR3a amino acid sequence TRAJ CDR3 length Th2 a line 20 20-2 Al 17 CALEGIASSSFSKLVF 50 14 20-2 A3 20-2 A4 20-2 A8 20-2 A9 20-2 A10 20-2 All 20-2 Al2 20-2 A13 20-2 A14
Th2 a line 34 34-20 AI 17 CALEGIASSSFSKLVF 50 14 34-20 A2 34-20 A4 34-20 A5 34-20 A7 34-20 A10 34-20 All 34-20 A6 4D-3 CAAVNYGGSGNKLIF 32 13 34-20 A9 CASSGSWQLIF 22 9
Littermate 34-21A15 4D-3 CAAETNTDKVVF 34 10 34-21A16 CAAPDSNYQLIW 33 34-21A17 CAAYIASSSFSKLVF 50 13 34-21 A3 CAADNTNTGKLTF 27 11 34-21 A2 4D-4 CAAGLPNYNVLYF 21 34-21Al2 CAARNSGYNKLTF 11 34-21 A5 4-4 CAAENTGNYKYVF 40 34-21 A9 CAAEITGNTRKLIF 37 12
141 Table 3.6 TCR a chain sequences from 2 Thl TCR a chain transgenic animals.
TA clone TRAY CDR3a amino acid sequence TRAJ CDR3 length Thl a line 30 Th1-56 Al4 10D CAASREGTGSKLSF 58 12 Th1-56 A8 Th1-56 A5 CAALGAGNTRKLIF 37 Thl-56 A6 Thl-56A4 4D-3 CAAPPNYGNEKITF 48 Th1-56 Al6 CAAETGTGGYKVVF 12 Th1-56 Al7 CAAEATRGNNKLTF 56 Th1-56 A3 4-3 CAAEIMGTYQRF 13 10 Th1-56 Al5 CAAEGVNTGNYKYVF 40 13 Th1-56 Al 4D-4 CAAVNTGNYKYVF 11 Th1-56 A7 4-4 CAAEAKNTGYQNF 49 13 Thl-56A10 4-2 CAAEDANNRIFF 31 10
Th1-63 A2 10D CAASREGTGSKLSF 58 12 Thl-63 A3 Thl-63 A8 Thl-63 All Thl-63 Al2 Thl-63 A13 Thl-63 A16 Th1-63 Al 4-4 CAAEAGGADRLTF 45 11 Th1-63 A20 Th1-63 Al9 CAAEKDSGTYQRF 13 Th1-63 A4 4D-3 Th1-63 Al8 CAAEEDMGYKLTF 9 Th1-63 Al0 CVAEDYGGSGNKLIF 32 13
142
Littermate Line 34 Tg Line 20 Tg
O O 16.4% 71.7% O O
TV Ct".0 LL LL :i•N .... 0 4:1,f. .,:•• a...... '..5;., o .0 N.--4-2 • • •••••..3 • ...n” 1 101 102 3 1 ^ 0 1 3 10o 101 10 10 10 —.10 0 10 10 10 10 102 10 104 FL 1-H FL1-H FL I-H - CD8
(b) 40
•• 46 10 • •• • • 0 littermates line 34 line 20
(c) (d) 5 • • • 4 •
0 io * t
a • • TS2 3 • • * 3 co 8 r • ■ O 0 2 2- • -4- 4/CD • 0 CD 1 • •• • ■
0 0 littermates line 34 line 20 littermates line 34 line 20
Figure 3.13 An increased percentage of double negative thymocytes and a decreased CD4:CD8 ratio suggests expression of the Th2 a chain transgene at the cell surface early in thymocyte development. (a) Thymocytes from both lines of Th2 TCR a chain transgenic animals and littermate control animals were stained with CD4-PE and CD8-FITC antibodies. FACS analysis showed an increased percentage of double negative thymocytes in transgenic animals compared to controls (b). The CD4:CD8 ratio was also decreased in thymocytes from transgenic animals (c) but no change in CD4:CD8 ratio was observed in splenocytes (d). Data points for individual animals are shown and mean values + SD are also marked. The statistical significance of differences between transgenic and littermate groups were tested using a non-paired t test, ***P < 0.001, **** P < 0.0001, and data shown is representative of two independent experiments.
143
(a) Littermate Thl 30 Tg
A 6.66% . . .'72.76% 7.94% ... 65.92% •:./
•sA. .. , ''' ' f: • o ......
• e: '' . ... 3.68% )5.90% : . 3.396/0 - . 2.76% 2 3 161 10 10 104 FL1-H FL1-1-1 CD8
(b) 40 **
30- o
.c 20- z
46 10-
0 litterrnates Th1 line 30
(c) (d) 4 4-
io
t •
io 3 3 t ra
D8 2
/CD8 ra 2-
• CD4JC CD4 1- 1-
0 0 littermates Thl line 30 litterinates Th1 he 30
Figure 3.14 An increased percentage of double negative thymocytes suggests expression of the Thl a chain transgene at the cell surface early in thymocyte development. (a) Thymocytes from Thl TCR a chain transgenic and litter mate control animals were stained with anti CD4 PE and anti CD8 FITC antibodies. FACS analysis showed an increased percentage of double negative thymocytes in transgenic animals compared to controls (b). There was no difference in the CD4:CD8 ratio observed between the two groups in either thymocytes (c) or splenocytes (d). Data points for individual animals are shown and mean values + SD are also marked. The statistical significance of differences between transgenic and littermate groups were tested using a non-paired t test, **P < 0.01, and data shown is representative of a single experiment.
144 (a) Th2
Isotype control Littermate Th2 line 20 Th2 line 34
U
2 0 10 10 10 FL1.H
(b) Thl
Isotype control Littermate Thl line 30
...... 100 10 10 2 '103 -104 FL I -H
Figure 3.15 Transgenic expression of Thl or Th2 T cell receptor a chains does not affect the levels of TCR at the cell surface. Splenocytes from TCR oc chain transgenic and littermate control animals were stained with an anti TCR [3 chain FITC conjugated antibody. No differences in levels of TCR at the cell surface were observed in either Th2 TCR a chain transgenic line (a) or the Thl TCR a chain transgenic line (b) when compared to littermate control animals.
145 Discussion
Many factors are known to influence CD4+ T lymphocyte differentiation and there is a growing body of evidence to suggest that the avidity and affinity of the TCR/pMHC interaction is important. Most studies suggest that a low affinity interaction between the TCR and pMHC complex will favour a Th2 response, while a high affinity interaction promotes Thl development (Malherbe et al., 2000). A study from our laboratory in 2002 observed that CD4+ T cells selected under Th2 polarising conditions favoured an elongated TCR CDR3a chain and predicted that these elongated TCR a chains may result in less optimal (lower affinity) interactions between the class II pMHC complex and CDR loops of the TCR (Boyton et al., 2002). As a continuation of this work, the aim of this study was to express these elongated Th2 and shorter Thl TCR a chains transgenically to determine if TCR structure can cause an inherent Thl or Th2 bias in CD4+ effector cell phenotype. This chapter has described identification of TCR a chains derived from polarised T cell lines and the generation of Thl and Th2 TCR a chain transgenic mice.
A PCR strategy was used to determine the profile of TCR a and TCR r3 gene usage in the cDNA of short term polarised NOD.E Thl and Th2 cell lines, both of which were specific for an antigen (PLP 56-70) used in the previous study. Dominant TCR a chains were present in both cell lines and there was a statistically significant difference in CDR3a length between Th 1 and Th2, with the CDR3a regions of the Th2 line being longer than those of the Thl. This data is in keeping with the findings of the original study from which these lines derive, as was the observation that there was no significant difference in CDR3 (3 length and that the Th2 CDR3 motif could not be identified in the Thl line by PCR. No clonal expansion of a dominant TCR p chain was observed in either line, suggesting that the dominant TCR a chains were able to form peptide specific heterodimers with more than one p chain. However, as the dominant TCR a chains identified made up a significant proportion, but the not the entirety, of each line no single TCR (3 chain partner for either a chain could be
146 confidently identified. Selective expansion of TCR sequences, which then become dominant during the course of an immune response has been well documented in studies of both mice and humans and for both CD4 and CD8 responses (Wedderburn et al., 1993, Fasso et al., 2000 and Zhong and Reinherz, 2004). However, these studies mostly report the presence of dominant TCR a and p chain pairs or have observed narrowing of the TCR (3 chain repertoire. That a TCR a chain, using a conserved CDR3 a region, i.e. not just a V gene bias, should come to dominate a TCR repertoire in the absence of any simultaneous TCR p sequence expansion is perhaps unexpected. During normal T cell development in the thymus, TCR p chain rearrangement and cell surface expression occurs before that of the a chain (Kishi et al., 1991). Transition of thymocytes from double negative to double positive denotes successful (3 chain rearrangement and selection and is accompanied by cell proliferation (Hoffman et al., 1996). Many T cells bearing the same TCR p chain with an identical CDR3 (3 region will therefore be present in the thymus, and populations of mature T cells exiting the thymus with the same TCR (3 chain, but pairing with different TCR a chains are likely. However, that exactly the same TCR a chain will be generated by different T cells as they undergo TCR a chain rearrangement is a random event and therefore T cells exiting the thymus carrying the same TCR a chain but different TCR p chains are likely to occur at a much lower frequency. The TCR a chain bias observed in the lines used for this study may therefore be of great significance, in terms of providing peptide specific structural features to the TCR heterodimer that are selected for under Thl or Th2 polarising conditions, and lends further weight to the argument that an inherent bias may be observed upon transgenic expression of these TCR a chains. However, transgenic expression of the TCR a chain alone is unlikely to yield an inherent peripheral repertoire of T cells with the correct antigen specificity. One approach to finding TCR (3 chain partners that formed antigen specific receptors with the expanded a chains would have been to use a T cell transfection technique. In vitro expression and analysis of TCRs has been described by many other groups (Sugiyama et al., 2004) and transfecting T cells lacking endogenous TCR with the Thl and Th2 TCR a chains, along with TCR (3 chains
147 identified from the diverse repertoire of each line, would have allowed identification of [3 chain partners which were able to form stable heterodimers with the required specificity for the antigen PLP 56-70. However, given the unexpected, but striking, TCR a chain bias observed in both Thl and Th2 cell lines, further questions arise about whether indeed the dominant TCR a chains alone could be responsible for any observed phenotype bias. As such it was decided that the Thl and Th2 TCR a chains should be expressed transgenically in the absence of an identified antigen specific TCR 13 chain pair, and that pairing would be subsequently established from in vitro and in vivo studies of these TCR a chain transgenic mice.
Following construction of transgenes for both Thl and Th2 TCR a chains, mice transgenic for each chain were identified by both PCR and Southern blot. 2 lines of mice for the Th2 TCR a chain were established, and one line of mice carried the Thl TCR a chain. Founder animals were crossed, and then each subsequent generation backcrossed, onto the NOD.E strain of mice as this strain expresses the MHC class II molecule, I-Ag7, to which the peptide specificity of the original Thl and Th2 cell lines was restricted. At each generation, mice for subsequent breeding were identified by both PCR and Southern blot, as germline transmission of transgenes can sometimes result in loss of transgene copies (Kim et al., 2004). As it was not practical to examine levels of transgene expression in each line at each new generation, transgene copy number by southern blot was taken as a surrogate marker that the new generation was the same as the previous.
The most straightforward way to determine expression of a TCR transgene would be to use a V region specific antibody. However, although many antibodies exist against V(3 sequences, very few Va antibodies are available. Cell surface staining of T cells from transgenic animals was therefore not possible as a means of determining transgene expression in these mice. Direct observation of transgene expression at the level of cDNA was possible however, and a PCR strategy demonstrated transgene expression, and indeed correct splicing out of intronic sequences present in the V region of each transgene, for each line of transgenic mice. Transgenes for both Thl
148 and Th2 TCR a chains were derived from endogenous mouse TCR a promoter and enhancer elements contained within the transgenic cassette vectors designed by Kouskoff et al. (Kouskoff et al., 1995), NOD.E genomic DNA and Thl or Th2 cell line cDNA. In using these endogenous elements from the TCR a locus, as far as possible, expression patterns of the transgenic TCR chains should be normal. However, it is well documented that mice expressing a TCR a chain transgene have an increased percentage of DN thymocytes compared to wild-type mice (Huang and Kanagawa, 2004). This is a consequence of the necessity to include pre-rearranged V and J gene segments in the transgenic construct and altered percentages of thymocyte populations result from early expression of the transgenic TCR a chain compared to endogenous a chains. This consequence of TCR a chain transgenesis was alluded to in the original paper by Kouskoff et al. where the transgenic vectors used in this study were first described. In this study, high expression levels of transgenes were documented in double negative thymocytes. The impact of this premature TCR expression on T cell development and selection was addressed in a recent study by Baldwin et al. In this study, correct timing of TCR a chain expression was achieved using the Cre/lox system of conditional gene targeting where Cre was expressed under the control of the CD4 promoter/enhancer and a TCR a chain transgene was under the control of a constitutively active promoter, but preceded by a foxed stop sequence (Baldwin et al., 2005). TCR a chain expression was therefore restricted to DP and SP thymocytes. The authors report that, when the TCR a chain was expressed in DP thymocytes, no perturbations of thymocyte DN and DP populations were observed and, by using a well characterised HY TCR transgenic line, they demonstrated that in male mice negative selection of HY specific thymocytes occurred at the single positive (SP) stage of thymocyte development rather than at the DP stage reported in conventional HY transgenic animals. Thus, the unphysiological expression pattern of TCR a chains observed in studies using conventional TCR expression vectors are non- ideal and potential consequences for normal T cell development and selection should be born in mind. However, in this study, the expected block in thymocyte development observed serves to answer an important question regarding transgene expression. Increased percentages of double negative thymocytes were observed in all
149 3 lines of TCR a chain transgenic animals and because thymocyte development is perturbed by early expression of the TCR a chain at the cell surface, that the Thl and Th2 TCR a chain transgenes are indeed being expressed at the cell surface can be surmised.
As both the Thl and Th2 TCR a chains were derived from CD4+ T cells, which are restricted to antigen recognition in the context of MHC class II molecules, a shift towards the dominance of CD4+ T cells in the periphery may have been predicted. Other studies using a13 transgenic mice have seen a large shift in ratio towards CD4+ or CD8+ T cells both in the thymus and the periphery depending on whether the TCR in question was MHC class II or MHC class I restricted respectively (Lobito et al., 2002). This was observed in the study by Lobito et al. using an MHC class II restricted TCR, although they reported a small increase in CD8+ T cells when the TCR a chain of the receptor was expressed alone. In our study, no statistically significant shift in CD4/CD8 ratio was observed in the periphery of either Th 1 or Th2 TCR a chain transgenic animals, although a small apparent shift towards CD8+ T cells in the Th2 TCR a transgenics, particularly line 20, may have become more apparent if more mice were included in the analysis. There is however, a significant shift towards CD8+ T cells in the thymi of these mice. That the same shift is not observed in the Thl TCR a chain transgenic line suggests that this difference is inherent to the different TCR a chains being expressed rather than a consequence of transgene expression per se, but the lack of CD4+ T cell bias in either line suggests that MHC class restriction is not mediated by either TCR a chain alone and that the transgenic TCR a chains are likely to be present on the surface of both CD4+ and CD8+ T cells.
In the absence of an antibody and despite some evidence that both TCR a chain transgenes were being expressed at the cell surface, levels of transgene expression in the periphery could only be assessed by TCR sequence analysis. However, for all 3 transgenic lines, normal levels of TCR expression on peripheral T cells, whether endogenous or transgenic, were demonstrated using an antibody specific for the constant region of the TCR. This finding is particularly important in light of findings
150 about T cell phenotype and is discussed in chapter 4. Sequence analysis of TCRs expressed by peripheral T cells from splenocytes of both Th2 TCR a chain transgenic lines and the Thl TCR a chain transgenic line revealed the presence of transgenic sequences in all samples. However, the percentage of the repertoire comprising the transgenic sequence was very different between Thl and Th2 animals. From Th2 TCR a chain transgenic animals, almost all sequences obtained derived from the transgene, with only the occasional endogenous sequence identified. In contrast, no more than 50% of sequences from Thl TCR a chain transgenic animals were transgenic and percentages between animals were highly variable. There are several possible reasons for these variations. Expression levels of transgenes are known to be highly variable depending on the site of transgene integration (Robertson et al., 1995) and so the Thl TCR a chain transgene may be integrated into a locus of the genome permitting weaker expression of the transgene than those in which the Th2 a chain transgene has integrated. However, if the block at the DN stage of thymocyte development is any indication of the level of transgene expression, then the thymocytes of Thl and Th2 transgenic animals appear to be very similar. Another possibility is that many T cells bearing the transgenic Thl TCR a chain are negatively selected in the thymus and therefore do not proceed to become part of the peripheral T cell repertoire. The Thl a chain was originally identified from a highly specific, but also highly polarized T cell line, whose TCRs were predicted to display a high affinity for pMHC. T cells with a high affinity for self pMHC are known to be negatively selected in the thymus (Alam et al., 1996) and it may be that T cells bearing this shorter CDR3 a region of the Thl TCR a chain are more likely to make high affinity interactions with self pMHC compared to those bearing the longer CDR3 a region of the Th2 TCR a chain. This hypothesis would be most easily tested by sorting different populations of T cells as they proceed through the different stages of T cell development, i.e. DN, DP, SP and mature T cells and analysing the repertoire of TCR a chains at each stage, although the picture will be complicated by the appearance of endogenous TCR a at a different time point to that of the transgene. Perhaps a cleaner system in which to analyse thymic selection of this TCR a chain would be to use mice
151 in which the endogenous TCR a locus is disrupted. Also a possibility is transgene deletion as there is some evidence that TCR transgenes can become deleted in peripheral T cells (Komori S et al., 1993). This issue could be resolved by single cell sorting of peripheral T cells and using PCR to detect the presence or absence of the transgene at the level of genomic DNA and cDNA. A final explanation for apparent low levels of expression in the Thl TCR a chain transgenic line is that many T cells are expressing the transgenic a chain as well as endogenous a chains, i.e. that there are many dual a expressing cells in these animals. This may equally apply to endogenous TCR a sequences detected in samples from Th2 TCR a chain transgenics. Again, single cell sorting could determine whether some T cells from these animals were expressing two TCR a chains. These latter two possibilities would also help to explain the variability observed between animals of the same line.
Data in this chapter has described the identification of dominant Th 1 and Th2 cell derived TCR a chains and the strategy used to express these TCR chains transgenically. In vitro and in vivo studies using these animals to try to determine antigen specific TCR 13 chain pairing, and to determine whether T cells expressing these chains display any inherent effector phenotype bias are described in the next chapter.
152 Chapter 4
TCR 6 chain selection and cytokine phenotype in Thl and Th2 TCR a chain transgenics
Results
4.1 Analysis of TCR /3 chain usage in unprimed Th2 TCR a chain transgenics.
Previous analysis of TCR a chain usage in the Th2 TCR a chain transgenic animals had shown that, in both transgenic lines, most T cells in the periphery bear the transgenic TCR a chain (table 3.5). Using the PCR strategy described previously (figure 3.1) splenocytes from unprimed mice were used to examine TCR 13 chain usage in these animals (figure 4.1). The aim was to determine whether dominance of this transgenic TCR a chain generates any innate bias in the TCR (3 chain repertoire of these animals in the absence of exogenous priming with the antigen (PLP 56-70) for which the TCR, from which the a chain derives, was specific. However, no preference for a particular TCR (3 chain was observed in either line, and the pattern of TCR (3 chain genes used was very similar between transgenic and littermate samples. There were also no differences in the length of CDR3 regions seen in the TCR (3 chains. From this sequence data it seems that the peripheral TCR (3 chain repertoire is unaffected by the dominant expression of the transgenic Th2 TCR a chain. However, as the number of sequences obtained for any one sample represent just a tiny fraction of TCR (3 chains present in the periphery, any subtle impact of the Th2 TCR a chain on the 13 chain repertoire may be hard to detect using this approach. CDR3 spectratype analysis was therefore used in order to build a more global picture of TCR (3 chain usage in the periphery of these animals. CDR3 spectratype analysis was originally developed and described by Pannetier et al. (Pannetier et al., 1993). It uses TRBV gene specific primers in combination with either a fluorescently labelled constant
153 region primer or fluorescently labelled TRBJ gene specific primers to amplify all TCR p chain sequences in a given sample. Products from each PCR reaction are then analysed according to size. A typical profile of product sizes for any given primer combination usually consists of 4 or more discrete peaks, spaced 3 nucleotides apart, that follow a Gaussian (normal) distribution. Clonal expansion or bias towards a particular TCR p chain is observed as a dominant peak or skewing of the peak profile away from a normal Gaussian distribution. To analyse TCR p chain usage in the periphery of the Th2 TCR a chain transgenic animals, TRBV gene specific primers were used in combination with a fluorescently labelled constant region primer. Profiles obtained for each TRBV gene were then compared between transgenic and littermate animals (figure 4.2). No major differences were observed between the spectra of transgenic and littermate animals. There was also no evidence of clonal expansion for any TRBV gene, with all spectra displaying a normal distribution of product sizes. Good spectra were not obtained for all TRBV genes. These genes (e.g. TRBV 23, TRBV 21, TRBV 30 and TRBV 24) were also never observed from sequence analysis of transgenic or littermate splenocytes samples and so as a consequence of genetic background are probably poorly represented in the periphery of these animals. It is not possible from this spectratyping data to determine the CDR3 lengths represented by individual peaks as they represent combinations of each TRBV gene with many different TRBJ genes, but the similarity in spectra between transgenic and littermate samples suggests that there are no differences in average TCR I CDR3 length or TRBV gene usage as a consequence of transgenic Th2 TCR a chain expression.
154
TA clone TRBV CDR3(3 amino acid sequence TRBJ CDR3 length Th2 a line 20 20-2 B1 2 CASSQDSQNILYF 2-4 11 20-2 B7 CASSPDRGRNTLYF 12 20-2 B9 CASSQGQGSYEQYF 2-7 20-2 B2 20 CGARLGLNQDTQYF 2-5
20-2 B5 13-2 CASGDAGFNQDTQYF 13
20-2 B4 CASGDWGSGNTLYF 1-3 12
20-2 B6 16 CASSFRDRGF 2-7 8
20-2 B8 17 CASSPDNYEQYF 10
20-2 B10 19 CATLGQNYAEQF F 2-1 11 Mean CDR3 length 11.2
Th2 a line 34 34-23 B1 17 CASSRTGGQDTQYF 2-5 12 34-23 B9 CASSRLGTGDTQYF 34-23 B3 2 CASSQERRINQDTQYF 14 34-23 B10 13-2 CASGDARWGGSQDTQl 15 34-23 B8 19 CASSILTGSNQDTQYF 14 34-23 B5 CASSILSQNTLYF 2-4 11 34-23 B6 15 CASSSGQQNTLYF
29 CASGTNTEVFF 1-1 9 34-23 B2 34-23 B11 CASSPPTGRSAETLYF 2-3 14
34-23 B7 4 CASSSGQGDNQAPLF 1-5 13 Mean CDR3 length 12.5
Littermate 20-31 B1 29 CASSSRQGMDSPLYF 1-6 13 20-31 B12 CASRDQGANTGQLYF 2-2 20-31 B6 CASSRTGYEQYF 2-7 10 20-31 B2 15 CASSLDRDEQYF 20-31 B3 13-1 CASSLWGNQDTQYF 2-5 12 20-31 B11 20-31 B4 CASSDWGASYEQYF 2-7 20-31 B8 2 CASSQDRDYEQYF 11 20-31 B9 13-3 CASGVLGGGAETLYF 2-3 13 20-31 B10 16 CASSLGTGGYEQYF 2-7 12 Mean CDR3 length 11.8
Figure 4.1 TCR 13 chain sequences from splenocytes of unprimed Th2 TCR a chain transgenic and littermate control animals. A PCR strategy (figure 3.1) was used to determine TCR (3 chain usage in Th2 TCR a chain transgenic and littermate splenocytes.
155
TRBV 1 TRBV 2 TRBV 4 TRBV 5 TRBV 12-1 TRBV 13-1 TRBV 13-2 TRBV 13-3
Th2 TCR a transgenic
Littermate
TRBV 14 TRBV 15 TRBV 16 TRBV 17 TRBV 19 TRBV 20 TRBV 29 TRBV 31
147 10 150 170 160 170 200 271
Th2 TCR transgenic A ft 1'11, ft\ IAA ))
Littermate I\A
Figure 4.2 Spectratype analysis of TCR 13 chain gene usage in splenocytes of unprimed Th2 TCR a chain transgenic and littermate control animals. TRBV gene specific primers were used with a fluorescently labelled constant region primer to amplify TCR (3 chain sequences from splenocyte cDNA. Analysis of product sizes obtained from each PCR reaction showed no major differences in spectra obtained for transgenic compared to littermate control animals and no evidence of clonal expansion for any TCR (3 chain in the presence of a dominant Th2 TCR a chain. Numbers at the top of each spectra indicate the size of PCR product in base pairs. Data shown is representative of 2 animals per group. 4.2. Analysis of TCR fi chain usage in Th2 TCR a chain transgenics in the context of antigen specificity.
The data from unprimed animals suggests no bias in TCR 13 chain repertoire in the context of a dominant transgenic Th2 TCR a chain and that the transgenic a chain is able to form a functional TCR with many different TCR 13 chains with different lengths of CDR3. However, the TCRs present in the periphery of the animals used to generate this data have an enormous range of antigen specificities. Structural constraints on which TCR 13 chains may be able to pair with the transgenic Th2 TCR a chain may be more apparent in the context of an antigen specific response. PLP (56- 70) is the antigen for which the original TCR, from which the transgenic Th2 TCR a chain was derived, was specific. Th2 TCR a chain transgenic and littermate animals were immunised in the footpad with PLP 56-70. The peptide was administered as an emulsion with Complete Freund's Adjuvant (CFA) in order to generate an immune response and 10 days after immunisation, popliteal draining lymph nodes from these animals were harvested and peptide specificity and TCR [3 chain usage determined. Good proliferation in response to antigen was seen from both transgenic and littermate lymph node T cells, but neither sequence analysis (figure 4.3) nor CDR3 spectratype analysis (figure 4.4) showed any evidence of clonal expansion, TRBV gene bias or differences in TRBV gene usage and CDR3 length between Th2 TCR a chain transgenic and littermate animals.
157 TA clone TRBV CDR3p amino acid sequence TRBJ CDR3 length Th2 a line 20 20-131311 13-2 CASGSGGPNQDTQYF 2-5 13 M 70000— 20-13B13 CASGDAGGRDTQYF 12 g 80000- 20-13 B5 CASGGLGDEQYF 2-7 10 .50000- 20-13 B9 CASGDALGASAETLYF 2-3 14 40000. 20-13 B1 19 CASSPDSAETLYF 11 30000. 2 20000. 20-13 B4 CASRQTGGDQDTQYF 2-5 13 10000- 20-13 B7 13-1 CASSDGGGPEVFF 1-1 11 g. 0 10 10 20 30 40 50 20-13 BIO CASSPGENTLYF 2-4 peptide concentration (p.almli 20-13 B6 31 CAWTTGGTTGWLYF 2-2 12 20-13 B8 4 CASSWDWEQDTQYF 2-5 Mean CDR3 11.8
Th2 a line 34
34-3 BIO 16 CASSPRQGENTGQLYF 2-2 14 8000 34-3 B11 CASSLVDAANSDYTF 1-2 13 700 34-3 B7 CASSLTGGVQDTQYF 2-5 800 5000 34-3 B8 15 CASSLAPGLGKDTQYF 14 o 4000 34-3 B9 CASSRQGNTEVFF 1-1 11 E 3000 34-3B12 13-1 CA SSDAYRGGTEVFF E zoos 13 1000 34-3 B1 CASSDEGYTLYF 2-4 10 10 20 30 40 50 34-3 B3 5 CASSQQGEQYF 2-7 9 peptide concentration (p0/m1) 34-3 B5 19 CASSIEDQGARTERLFF 1-4 15 Mean CDR3 12.4
Littermate 34-1 B7 13-2 CASGGRDRASERLFF 1-4 13
34-1B11 1-4 5000
34-1 B2 13-1 CASSDVWDWGYEQYF 2-7 S 4000 34-1 B15 CASSDGQGDNQAPLF 1-5 3000 34-1 B8 CASSDSRLGGAETLYF 2-3 14 2000 34-1 B13 CASSDQGANTEVFF 1-1 12 a 34-1 B3 2 CASSQDLSNQAPLF 1-5 1000 34-1 B5 CASSQQNSDYTF 1-2 10 10 20 30 40 50 34-1 B6 20 CGARDWGGAYAEQFF 2-1 13 peptide concentration (µ0/m1) 34-1 B14 19 CASSILGGEETLYF 2-3 12 Mean CDR3 12.5
Figure 4.3 TCR I chain sequences from primed draining lymph node of Th2 TCR a chain transgenic and littermate control animals. Mice were primed with the peptide PLP 56-70 by footpad immunisation. The draining popliteal lymph node was harvested at day 10 and peptide specificity of T cells determined by proliferation assay. TCR (I chain usage was determined by PCR. The proliferation data shown corresponds to the draining lymph node from which each set of sequence data is derived.
158 TRBV 1 TRBV 2 TRBV 4 TRBV 5 TRBV 12-1 TRBV 13-1 TRBV 13-2 TRBV 13-3 1. 160 00 000 130 140 170 80 210 220
Th2 TCR a transgenic A A V
Littermate m I I) _A
TRBV 14 TRBV 15 TRBV 16 TRBV 17 TRBV 19 TRBV 20 TRBV 29 TRBV 31
160 150 160 170 100 130 ISO 200 510 14) 150 110 180
Th2 TCR transgenic A )
Littermate
Figure 4.4 Spectratype analysis of TCR 13 chain gene usage in primed draining lymph node T cells of Th2 TCR a chain transgenic and littermate control animals. TRBV gene specific primers were used with a fluorescently labelled constant region primer to amplify TCR 13 chain sequences from draining lymph node cell cDNA. Analysis of product sizes obtained from each PCR reaction showed no major differences in spectra obtained for transgenic compared to littermate control animals and no evidence of clonal expansion for any TCR [3 chain in the context of a dominant Th2 TCR a chain and PLP peptide specificity. Numbers at the top of each spectra indicate the size of PCR product in base pairs. Data shown is representative of 2 animals per group. 4.3. Analysis of PLP (56-70) specific Th2 TCR a chain transgenic T cell lines.
The lack of a dominant TCR (3 chain in the draining lymph nodes of PLP 56-70 immunised transgenic animals suggests that a single priming with antigen and 10 days between priming and harvesting of the lymph node was not sufficient for a clonal expansion to occur. Antigen specific T cell lines were therefore established from Th2 TCR a chain transgenic and littermate draining lymph nodes and grown in vitro over many weeks with repeated exposure to antigen and APC in growth medium containing 10U/m1 IL-2. T cell lines were restimulated with antigen (PLP 56-70) every 9-11 days and splenocytes from NOD.E mice were used to present the peptide at each restimulation, as APCs from this mouse strain carry the MHC class II molecule I-Ag7, against which the original Th2 TCR was restricted. TCR p chain usage in these PLP 56-70 specific cell lines was analysed over successive restimulations. Figure 4.5 shows TCR p chain sequence data for Th2 TCR a chain transgenic (derived from transgenic line 20) and littermate T cell lines grown over 6 restimulations. A clonal expansion of a TCR (3 chain was apparent at the 4th restimulation of the transgenic T cell line and this 13 chain (TRBV 31 / TRBJ 2-3) with a CDR3 p length of 12 amino acids, comprised 100 % of all sequences obtained at the 6th restimulation. In contrast, the littermate derived line showed no evidence of clonal expansion at the 4th restimulation and the most significant expansion at the 6th restimulation comprised just 21% of the sequenced repertoire. However, despite the major differences in TRBV gene usage between the two lines, CDR3 (3 lengths remained similar throughout.
The rapid narrowing of the TCR p chain repertoire in the transgenic line compared to the littermate line was also seen from CDR3 spectratyping data (figure 4.6). For each of the TRBV genes shown, even at the 2nd restimulation, the number of peaks in each spectra was greater in the littermate line than in the transgenic line where all spectra rapidly narrow or disappear completely. Narrowing of the repertoire was also evident in the littermate line by the 6th restimulation but for this line the kinetics of this change in (3 chain usage was much slower.
160
2°d restimulation 4th restimulation 6th restimulation
TA clone TRBV CDR3IO amino acid sequence TRBJ CDR3 length TA clone TRBV CDR30 amino acid sequence TRBJ CDR3 length TA clone TRBV CDR313 amino acid sequence TRIM CDR3 length
Th2 a transgenic Th2 a transgenic Th2 a transgenic 6°20131 31 CAWSLGGGAETLYF 2.3 12 2°20814 2 CAS SQRL VNQDTQYF 2-5 13 4° 20 131 31 CAWS LGGGAETLYF 2-3 12 4°2003 e20B2 2° 20 1316 4° 20 136 6°20 B3 2° 20 135 CA S S LGT ANTGQLYF 2-2 4° 20 B8 6°2084 2°20 B13 4120E19 6° 20 B5 2°20818 CAS S LGT ANTGQP YF 4° 20 1310 6° 20 B6 2° 20 B8 CASSQEERTNSDYTE 1-2 4° 20811 e 20 87 2° 20021 CAS SQDGQFLNERLFF 1-4 14 4°20013 6'2088 2° 20 B4 13-2 CASGDPD W TETLY F 2-3 12 020B14 6° 20 B9 2°20 B23 4° 20E16 (201310 6°20611 2°20 B17 CASGDRDRGNNSPLYF 1-6 14 4° 20 B21 (20 B12 2° 20 Ell 13.1 CAS SAGTNSNERLFF 1-4 13 4°20137 13-1 CASSDAWGQGNTEVFF 1.1 14 4° 20 1317 e 20 513 2° 20 1312 CAS S DAGD 1NNQAPLF 1-5 14 020 1318 6°20814 2° 20 B20 CASSDAWGQGNTEVFF 1-1 4°20E123 CAS SG PPGQSSGNTLYF 1-3 15 6°20E115 2° 2082 4 CAS SGTGGNTLYF 2-4 20 1316 4°20 B2 13-3 CAS RRDNQAPLF 1-5 10 e 6°201317 2° 20 B22 31 CALGHRINERLFF 1-4 4°2004 6°20 BIS 2° 20 B7 29 CA S SPGTGVDTQYF 2-5 12 (201320 5 CASSQTFLNSDYTF 1-2 12 6°201320 Mean CDR3 12.8 Mean CDR3 12.6 6'20521 Mean CDR3 12 Littermate Littermate 2° WT B3 16 CASSTTSYEQYF 2-7 10 e wrm 13-1 CASSDAGGARDAETLYF 2-3 15 Littermate WT B12 2° WT1320 (IVT134 16 CASSRDWGDEQYF 2.7 4° WT131 CAS SPRTTSQNTLYF 2-4 13 2° WTB1 CASS LDGT TNSDY TF 1-2 13 6° WT 136 4° WT 86 CAS R PDWGGAGAEQ IF 2-1 14 2° WT B2 CAS S LQGA 1 S NEGLEF 1-4 14 6° Wr 07 WT Bit 15 CASSLGGSGNTLYF 1-3 12 2° WT B13 CAS SLVGSNERLF F 12 ewTBI9 4° WT 820 6°Avr 85 C AS SLE WG DEQ VF 2° WT B17 CASSSDWGSTLYF 2-4 11 WT BIO 17 CASSSRDNQDTQYF 2-5 12 6° WT 03 CASSRDWGDTQYF 2.5 2° WT B4 13-1 CAS S DEWGETDTQYF 2-5 13 4° WT BI6 6" WT139 CASSLDDANTEVFF 1-1 12 CAS S DAGTGSYEQY F 2-7 13 2° WTB11 4° WT B2 16 CAS SLELGQSNQDTQYF 15 6° WT BIO C AS S FQG YNE RL FF 1-4 2° WT B14 CASSALGGRSYEQYF 13 4°WT 114 CAS RDWGSNTGQLYF 2-2 13 6° 18T1315 CASSLv1FSNF.RLFF 13 2° WT B6 CAS RPDWG GAGAEQFF 2-1 14 4° WT 135 CASSLGGVTEVFF 1-1 1 6° WT 1318 2 CASSQEGTGGAGAEQFF 2.1 15 2° WT B12 CASSDAGGARDAETLYF 2-3 15 WT B21 CASSLDDANTEVFF 12 6" WT1320 21 WT 139 2 CASSQDRDFYAEQFF 2-I 13 4° 337 813 CASSRDWGDEQYF 2-7 II eurrI311
2° WT B21 CAS SQEGGVG AEQFF 13 4° W1"1314 CASSLVIFSNE RIFF 1-4 13 6° WT 82 13-1 CASSDAGGARDAETLYF 2-3 4°WT 87 12-2 CASSLDNNQDTQYF 2-5 2 2° WT B20" CAS S PRDNQ NTLY F 2-4 12 6° WT 822 WT 89 2 CASSQEGLGETQYF 1118817 CAS SD VG KDTE VFF 1-1 112 2° WT B24 CA S S QDM GGAHQDTQYF 2-5 15 6° 4° WT 1317 14 CASSSREDTQYF 10 WT 131 13-2 CASGESANTEVFF 2° WT 137 19 CASTPGQGNSPLYF 1-6 12 4° s/17 B15 31 CAWSSRDWGDKQYF 2-7 12 ex7521 CAS CPT ANTE VFF 2° WT B18 24 CA SSPSGTGGNTL YF 2-4 13 (WT1119 20 CGARDRDWGDEQYF 61%71316 C AS GDAGG AET L CF 2-3 12 rwr 819 31 CAWSPGGGAETLYF 2-3 12 WT BR 13-2 CASGGDWGLALYF 2-4 II 6° WT138 29 CASSFSGTGENERLFF 1-4 14 Mean CDR3 12.8 Me. CDR3 12.4 Mean CDR3 123
Figure 4.5 Rapid clonal expansion of TCR over successive restimulations of a Th2 TCR a chain transgenic T cell line. T cell lines were established from PLP 56-70 primed draining lymph nodes of transgenic and littermate control animals. T cells were restimulated with peptide in the presence of NOD.E splenocytes every 9-11 days. RNA was extracted from cell lines at each restimulation and TCR beta usage determined by PCR. A clonal expansion in the transgenic T cell line is apparent from the 4th restimulation and this TCR comprises 100% of the repertoire by the 6th restimulation. No significant expansion was observed in the littermate line.
restimulation 4th restimulation 6th restimulation
Transgenic TRBV 31
Littermate
TRBV 16
IAA % \.- kr'
U: TRBV 13-1
TRBV 2
Figure 4.6 Spectratype analysis of Th2 a chain transgenic and littermate derived T cell lines through successive restimulations. T cell lines were restimulated every 9-11 days with peptide (PLP 56-70) and NOD.E splenocytes. RNA was extracted from cell lines at each restimulation. TRBV gene specific primers were used with a fluorescently labelled constant region primer to amplify TCR 13 chain sequences from T cell line cDNA. Analysis of product sizes obtained from each PCR reaction showed narrowing of the TCR 13 chain repertoire in both T cell lines over successive restimulations. Narrowing of the repertoire was more rapid in the Th2 a chain transgenic line with complete disappearance of some TRBV genes by the 6th restimulation.
162 Given the enormous differences observed in TCR usage, proliferation in response to antigen and cytokine phenotype of the two lines were examined. Proliferation assays with multiple doses of peptide at each restimulation showed that both cell lines were highly peptide specific and that rates of proliferation in response to antigen were roughly equivalent between the two lines (figure 4.7). However, cytokine profiles revealed marked differences. In the Th2 TCR a chain transgenic line levels of the Thl cytokine IFN-y were decreased between the 2❑d and the 6th restimualtion while levels of the Th2 cytokines IL-4 and particularly IL-5 were increased. In the littermate control line IFN-y production remained high and IL-4 and IL-5 remain low throughout the timecourse. This apparent phenotype difference between the two lines was also seen at the level of Thl and Th2 transcription factors by real time PCR for Tbet (Thl) and GATA3 (Th2) transcripts (figure 4.8). At all time points, levels of Tbet transcripts were higher in the littermate line than in the transgenic line and, from the 4th restimulation, levels of GATA3 transcripts show the opposite trend. Taken together, the sequence, cytokine, and real time PCR data suggest that, by the 6th restimulation, the Th2 TCR a chain transgenic T cell line has undergone a rapid clonal expansion such that the line now comprises a dominant TCR and that the line has a Th2 type phenotype compared to the more heterogeneous TCR repertoire of the littermate line which has a predominantly Thl type phenotype.
The original hypothesis of this study asked whether the structure of the TCR could cause an inherent Thl or Th2 bias in T cell phenotype. As it was not possible to identify a TCR (3 chain pair for the Th2 TCR a chain used to make the transgenics in this study, it would be necessary to use the a chain only transgenic lines to identify a 13 chain that pairs with this alpha chain in the context of peptide specificity and a Th2 phenotype. The data for the transgenic cell line described here suggested that the clonally expanded TRBV 31/TRBJ 2-3 TCR (3 chain may be a suitable P chain pair for transgenic expression. The picture of TCR usage and cytokine profile over 6 restimulations of this transgenic T cell lines is a rapidly changing one. However, if cytokine phenotype here is linked to the clonal expansion of the TCR you would expect that once a single TCR is present, the cytokine phenotype should remain stable.
163 The cell lines were therefore grown over many more restimulations. Figure 4.9 shows the cytokine phenotype and relative abundance of Tbet and GATA3 transcripts for the transgenic and littermate T cell lines after 15 restimulations with antigen. The transgenic T cell line was still producing high levels of Th2 cytokines IL-4 and IL-5, but low levels of IFN-y while the littermate line produced only IFN-y. Levels of Tbet transcripts were still higher in the littermate line while GATA3 transcripts were more abundant in the transgenic line. The Th2 type phenotype of this Th2 TCR a chain cell line therefore appears to be stable.
164 2nd restimulation 4th restimulation 6th restimulation
(a) proliferation
0 20 10 000112. moo...1110n 0..1)
IFN-y
0 10 20 10 40 50 pop1101..c.o00o• h/p/m1) 1.011115 Danc•ntratIon 0.101m1)
20110 IL-4 3
0 10 20 30 40 10 /0 30 40 10 20 00 40 50 0.00010 a c.ntr tb. (.5.1) 00001. .002.11. 000000.110n (..11
500 400 IL-5 300
100
10 10 30 40 50 20 50 40 50 0.1101. c.t.ntrtbn 1,400,09 p0011011100Kontra11011 (11020)
(b) proliferation
IFN-y
10 20 31 40 50 0 10 20 30 40 0 10 21 30 40 SO .21. Conan.. W.) 1.10110•100nCentr1000n 100121101) pe0010 C00.101111011 2021110 200 200
IL-4 1 1 100
1D 20 JO 40 50 10 10 10 40 /D 10 40 0000. concontrotlen 419.1) (p09.) 11•010111Coneentr.n (01/1101)
7 00
IL-5 xp Op 2. q S 100
10 20 10 40 50 20 . 40s0 10 10 40 00 1.13.0 DOnc0114011011 0.111D gollde.n0entrzt100 200029 got. 00nc«wtlon (1.1119
Figure 4.7 Cytokine phenotype of Th2 TCR a chain transgenic and littermate T cell lines over successive restimulations. Th2 TCR a chain transgenic (a) and littermate (b) T cell lines were restimulated every 9-11 days with peptide (PLP 56-70) and NOD.E splenocytes. At each restimulation, proliferation assays were performed with multiple doses of antigen. After 48 hours of culture, supernatants were harvested and wells pulsed with [3H] thymidine to determine proliferation. Cytokines in cell culture supernatants were quantitated by ELISA.
165
(a) (b)
c
• 4 ;3<• 2 2nd restimulation •u 3
re re 2 E 1 D 1 c 22 0 0
4th restimulation
e 0 0 I •; 4 a- 2 - a. 6th restimulation o 3 z cc zcc 2 E - `> d o o n
Figure 4.8 Real time PCR analysis of GATA3 and Tbet transcripts in Th2 TCR a chain transgenic and littermate T cell lines over successive restimulations. T cell lines were restimulated every 9-11 days with peptide (PLP 56-70) and NOD.E splenocytes. RNA was extracted from cell lines at each restimulation. Real time PCR analysis was used to compare levels of GATA3 (a) and Tbet (b) transcripts between the Th2 TCR a transgenic line (grey bars) and the littermate line (black bars) at each restimulation. RNA levels in each sample were normalised to 18s. At each time point, and for each gene of interest, the sample with the lowest level of gene expression was assigned a value of 1 and gene expression levels in other samples expressed as a value relative to 1.
166
(a) (b)
proliferation 1.00
ID so 10 le 30 40 a. 10 ID pe....entrellen(.1.1) peptide conceninition
IFN-y 310
0 10 20 30 40 60 10 30 20 dO p.600 conoentration (p2/m11 pisptide Doncentralion(i./211)
IL-4
10 20 30 40 60 10 20 . 10 50 peptide concentration 1.1.0) pepIcit concentration (pyng)
IL-5
10 20 30 60 10 20 40 50
acnoentration pap.. concentration (µ0/01)
(c) (d)
c 14-
0 ion 7n 1 2-
.o.42 10- ress
rt 6 RNA exp m
4- e iv 2- t la
e re
Figure 4.9 Cytokine phenotype of Th2 TCR a chain transgenic and littermate T cell lines after 15 restimulations. T cell lines were restimulated every 9-11 days with peptide (PLP 56-70) and NOD.E splenocytes. At the 15th restimulation RNA was extracted from each line and proliferation assays were performed with multiple doses of antien. After 48 hours of culture, supernatants were harvested and wells pulsed with [ thymidine to determine proliferation. Cytokines in the cell culture supernatants of the Th2 TCR a chain transgenic line (a) and the littermate line (b) were quantitated by ELISA. Relative abundance of GATA3 (c) and Tbet (d) transcripts in the Th2 TCR a chain transgenic line (grey bars) compared to the littermate line (black bars) were determined by real time PCR. RNA levels in each sample were normalised to 18s. For each gene of interest the sample with the lowest level of gene expression was assigned a value of 1 and gene expression levels in other samples expressed as a value relative to 1.
167 The transgenic T cell line described above was derived from the primed draining lymph nodes of Th2 TCR a chain line 20 transgenic animals. Another example of a Th2 TCR a chain transgenic T cell line with a rapid TCR (3 chain clonal expansion and a Th2 type cytokine phenotype was derived from line 34 transgenic animals. TCR (3 chain sequence data in figure 4.10 shows that, over 9 restimulations, a single TCR (3 chain expanded to comprise the majority of the T cell line, with this TCR already making up 50% of the repertoire by the 5th restimulation. The TCR 13 chain expanded in this line (TRBV 13-1/TRBJ 2-7) had a long CDR3 (3 of 15 amino acids. This T cell line produced no IFN-y (figure 4.11) but made high levels of Th2 cytokines IL-4 and IL-5. A switch in cytokine phenotype towards a Th2 type profile between the 1St and 5th restimulation was also apparent from Tbet and GATA3 real time PCR data with Tbet transcripts more abundant at the 1st restimulation and low levels of Tbet transcripts but high levels of GATA3 transcripts at the 5th and 9th restimulations. Cytokine phenotype data from this line 34 derived T cell line therefore confirmed previous findings from the line 20 derived T cell line discussed earlier.
Although in the line 34 derived transgenic T cell line the kinetics of TCR (3 chain expansion are slightly slower, in both examples one TCR ultimately dominates the line, which displays a predominantly Th2 type phenotype with low levels of the Thl type cytokine IFN-y and high levels of the Th2 type cytokines IL-4 and IL-5. Both expanded TCR (3 chains would therefore be good candidates for transgenic expression. Transgenic constructs for both Th2 TCR 13 chains were created, but technical difficulties verifying the final line 34 derived TRBV 13-1/TRBJ 2-7 construct meant that only the line 20 derived TRBV 31/TRBJ 2-3 (3 chain was subsequently used for transgenesis. The generation of transgenic animals carrying this Th2 TCR (3 chain are described below.
168
10t restimulation 5th restimulation 9th restimulation
TA clone TRBV CDA3p amino acid sequence TRBJ CDR3 length TA clone TRBV CDR33 amino acid sequence TRBJ CDR3 length TA clone TRBV CDR3tI amino acid sequence TRBJ CDR3 length
1° 34132 16 CASSPDWGETLYF 2-3 5° 34 132 13-I CASSDTGGAQSSYEQYF 2-7 15 9°34 131 I3-1 CASSDTGGAQSSYEQYF 2-7 15 1° 34 B3 5° 34 B3 9° 34 B2 1° 34 135 5' 34 B4 9° 34 133 I° 34 B7 CASSLDWGSDYT F 1-2 r 34 135 9° 34 B7 1° 34 1316 5" 34 06 r 34 I38 1° 34 BI CASSEGKGTNTEVFF I-1 13 r 34 B14 9° 34 119 1° 34 BIS CASSLDPAGGYEQY F 2-7 5° 34 1315 9° 34 1310 I° 34 B21 CASSGDWGDEQYF 11 r 34 B16 r 34 B12 1° 34 1317 13-1 CASSGDSTEVFF 1-1 10 5° 34 1318 r 34 BI3 1° 34 BI9 5° 34 1321 9° 34 B25 I° 34 B4 CASSDAGGTEVF F 11 r 34 BI9 2 CASSQDGLGGLDTQYF 2-5 14 9° 34 B26 I° 34 B6 CASSDAGTGRDTEVFF 14 5° 34 B9 r 34 B27 I° 34 BI2 CASSDAGTSANTEVFF 5° 34 B20 9° 34 13213 I° 34 013 CASTQGPTNERLFF 1-4 12 5° 14 B1 CASSQPPTI1NQDTQYF r 34 B29 I' 34 BI5 CASSQTNNYAEQFF 2-1 r 34 1310 r 34 B30 I° 34 B20 CASSDVGRGNAF.TLYF 2-3 14 5° 34 013 r 34 B31 r 34 BI2 16 CASSLDGLVDSNSDYTF 1-2 15 1° 34 B8 12-2 CASSLEGWGGAGDTQYF 2-5 15 9° 34 B32 r 34 Bl7 CASSLEW GAEQF F 2-I II I° 34 1111 19 CASSPPGTTYSGNTLYF 1-3 9° 34 1333 ON 5° 34 BI8 5 CASSRHRADTEVFF I-I 12 r 34 B34 Mean CDR3 12.6 .f:3 Mean CDR3 13.5 9° 34 BI4 13-2 CASGDAGGEQDTQY F 2-5 13 i--1 Mean CDR3 14
Figure 4.10 Clonal expansion of a TCR over successive restimulations of a Th2 TCR a chain transgenic T cell line. The T cell line was established from PLP 56-70 primed draining lymph nodes from line 34 Th2 TCR a chain transgenic animals. The line was restimulated with peptide and NOD.E splenocytes every 9-11 days. RNA was extracted at each restimulation and TCR beta chain usage determined by PCR. A clonal expansion was apparent at the 5th restimulation of this line and this TCR comprises the majority of the TCR beta chain repertoire by the 9th restimulation.
(a) 15t restimulation 5th restimulation 9th restimulation
#14000.. proliferation 6000. 1 2SOOD.
Slr ID 0 39 40 SO ccccc .410on
IFN-y
10 20 30 40 40 0 10 39 30 40 10 10 20 31 40 SO 110910.11 000000.900 1102009 peptide concenbattOn (WM 20121151 ConCantratIon (2001)
3000
HOD IL-4 I I 1000 31 1000
.0 A 30 40 A 111 20 30 40 sp 10 30 30 40 50
p•ptitle 509290.19n (..9 990105 conemlnklon (I00 90511510 9999050011On 929/2110
15009 15004 MOO 13400 12500 IL-5 .1 10,000. 5000 .rj 4000 1/1 2500 3504 0. 0 10 20 30 40 0 0 10 20 30 40 GO 11 A A MI 10
ppIldeconcomtrstlan 002/02) peptide concrnien "Okla concsalretIon 950/0111
(b) (c)
c 90-
.2 50- •N• 80- ra (5 ct) a) 70- 0.2 40- x cx` 60- 0 < 30- <• 50- z Z 40• re E 20- E
> 20. ri co 10- a.) r.) • 0 ""T"" 0 1st 5th 9111 1;t 5th 9th
Figure 4.11 Cytokine phenotype of a line 34 Th2 TCR a chain transgenic T cell line. The T cell line was restimulated with peptide (PLP 56-70) and NOD.E splenocytes every 9-11 days. At each restimulation a proliferation assay was performed with multiple doses of antigen. After 48 hours of culture, supernatants were harvested and plates pulsed with [3H] thymidine to determine proliferation (a). Cytokines in cell culture supernatants were quantitated by ELISA (a). Relative abundance of GATA3 (b) and Tbet (c) transcripts in cDNA samples from successive restimulations were determined by real time PCR. RNA levels in each sample were normalised to 18s. For each gene of interest the sample with the lowest level of gene expression was assigned a value of 1. Gene expression levels in all other samples are expressed as a value relative to 1.
170 4.4. Construction of a Th2 TCR p chain transgene.
The cassette vector used in the construction of the Thl and Th2 TCR a chain transgenes has already been described. The TCR p chain vector (pT(3) was also designed by Kouskoff et al. (Kouskoff et al., 1995) and is based upon the same principle of using endogenous mouse TCR [3 promoter and enhancer elements to drive gene expression. To express a TCR (3 chain transgenically it is necessary to insert into the vector the rearranged TCR p V-J coding region of interest. Also described in the previous chapter was the importance of using the genomic DNA configuration rather than the cDNA configuration of the rearranged TCR chain. However, unlike the situation described for the generation of the TCR a chain constructs, genomic DNA was available from the T cell line from which the TCR p chain of interest was identified. It was therefore possible to obtain the full sequence of the required TCR (3 chain V-J segment by a single PCR strategy, whereby PCR was used to generate restriction sites at either end of the V-J segment which could then be inserted directly into the cassette vector (figure 4.12). The nucleotide and amino acid sequence of the Th2 TCR p chain used to make the transgene are shown in appendices 21 and 22 respectively. PCR primers used to clone the V-J segment from cell line genomic DNA are listed in appendix 8.
The PCR product that was cloned into the pT(3 cassette vector and verification of the final construct by restriction digest are shown in figure 4.13. The sequence of the TCR (3 chain V-J segment in the final construct was also verified by sequencing prior to preparation for pronuclear injection. Bacterial sequences were removed from the vector prior to pronuclear injection by digestion of the construct with Kpnl and purification of the upper 17,700 bp band (figure 4.13). A plasmid map of the complete Th2 TCR (3 chain construct is shown in appendix 12.
171
VB31F (a) Xhol L_. ME - LP1 VB3I JB2-3 \-1 SacII JB2-3R
(b) Xho I 7.777,77 Sac II I NMI LP1 VB31 JB2-3
(c) Xho I
Kpn I
Kpn I
Th2 (3 construct is linearised for injection using Kpn I
Figure 4.12 A schematic diagram showing the cloning strategy used to create the Th2 13 chain construct. (a) Genomic DNA from the Th2 a transgenic cell line was used to isolate the required VB31/JB2-3 fragment containing the appropriate intronic regions for correct transcript processing. PCR primers (VB31F and VJ2-3R) were used to introduce Xho I and Sac II restriction sites to the 5' and 3' ends of the VJ fragment respectively. (b) The Th2 p VJ fragment was then inserted into the pTp cassette vector by directional cloning using Xho I and Sac II. (c) Bacterial sequences were removed from the vector, by digestion with Kpn I, prior to pronuclear injection.
172 Z rearranged (a) bp TRBV31-TRBJ2-3
1000 750 500 —111"
,—, 0 at $.4 bp a) V) —••, ^c1 0 0 bp ad = U at >,.. 0 o. (b) ,—] 0 W Ca (c)
10000 10000 5000 3000 2000 1000 --Po- 500 —110.
Figure 4.13 Cloning of the rearranged Th2 TCR f chain into the TCR 13 expression cassette. (a) The rearranged configuration of the Th2 TCR p chain was cloned from T cell line genomic DNA by PCR. The cloned VJ fragment was sequenced and then inserted into the TCR (3 expression cassette using restriction enzymes XhoI and SacII. (b) Prior to digestion and purification for pronuclear injection, the complete construct was checked by restriction digest to ensure that no rearrangement of the plasmid had occurred during cloning. (c) Bacterial sequences were removed from the construct before injection by digestion with KpnI and purification of the upper 17,000 bp band.
173 4.5. Identification of a Th2 TCR fl chain transgenic founder animal
The Th2 TCR (3 chain transgene was injected into C57BL/6 oocytes at the MRC Clinical Sciences Centre of Imperial College, London. 20 potential founder animals were screened for the presence of the Th2 TCR (3 chain transgene. An initial PCR screen, using genomic DNA extracted from a tail biopsy, identified 1 founder animal (figure 4.14). This founder was subsequently referred to as Th2 TCR [3 line 4 based on the number assigned to the animal at the point of tail biopsy. Technical difficulties with the technique have meant that, so far, the transgenic status of this animal has not been confirmed by Southern blot.
The founder animal (Th2 TCR [3 line 4) was male. Th2 TCR a chain line 20 transgenic females were therefore used as breeding partners to obtain the next generation of this line, which may be transgenic for both a and p chains of the Th2 TCR. Normal rates of germline transmission of the Th2 TCR a chain were observed in the progeny of this mating. However, transmission of the Th2 TCR p chain transgene was very poor. Of 54 progeny screened by PCR for the Th2 TCR a and p chain transgenes, 27 animals carried the a chain compared to just 3 carrying the p chain. 2 mice carrying both transgenes have now been set up as the next generation breeding pair for this transgenic line, but the small number of Th2 TCR (3 chain positive animals identified means that experiments to characterise these animals are not reported here as they are not within the timecourse of this thesis.
174 (a) 20TCRI3F1 Xho I Sac II
LP1 TRBV31 TRBJ2-3 20TCRPR1
(b) Potential .1.6 < O.) I- 4 founders -0 bp --i't) , E-, 1-3 0= 5-20 ,fi r—A---, PZ
1000 —111,'
750 —0. 500 —11. 250 —IP.
Figure 4.14 Identification of the Th2 TCR 13 chain transgenic founder animal. The transgenic founder was identified by PCR. The location of primers used for PCR screening (20TCR13F1 and 20TCR(3R1) are shown in (a). One transgenic animal was identified from an initial PCR screen of 20 potential founders.
175 4.6 Analysis of a PLP (56-70) specific Thl TCR a chain transgenic T cell line.
To determine whether rapid clonal expansion of a TCR p chain would also occur in T cell lines derived from Thl TCR a chain animals, T cell lines were established from PLP 56-70 primed draining lymph nodes of these mice. As described for the Th2 TCR a chain transgenic lines, T cells were grown in vitro in growth medium containing 10U/m1 IL-2 by restimulation with peptide and NOD.E splenocytes every 9-11 days. Proliferation in response to antigen, and cytokine phenotype, were determined at successive restimulations. Figure 4.15 shows that over 6 restimulations the Thl TCR a chain transgenic line was highly antigen specific and displayed a predominantly Thl type phenotype, producing high levels of IFN-y. Sequence analysis of TCR (3 chain usage at the 6th restimulation showed a small clonal expansion, comprising 26% of the repertoire. However, sequence analysis of TCR a usage by this line failed to identify the transgenic Thl TCR a chain (figure 4.15). A PCR for the rearranged Thl TCR a chain in cDNA from the line at the 6th restimulation suggested that the transgenic a chain was being expressed by this line. However, sequence data suggests that T cells bearing this transgenic a chain are not present at any significant level and are not likely to be pairing with the expanding TCR p chain. This finding is consistent with the low level of expression of the Thl TCR a chain transgene found in unprimed splenocytes of this TCR transgenic line (table 3.6). Further T cell lines derived from Thl TCR a chain transgenic animals are currently being characterised.
176
2' restimulation 4th restimulation 6th restimulation (a)
proliferation
40000— 4000 IFN-y o 1:0
10000. 1000
10 20 34 40 10 10 20 30 4 0 0,35154 conoentr•tion 100/m1) peptide concentration inonnI) 30001
IL-4 2300 :000,. 100e ,.
1 20 30 io A io io 50 10 20 30 10 SO concontra000 (1410110 0.110000ncentratIon 040001) peptide COnCentratiOn 04/010 15000 1500 12500 1250 IL-5 tl "1;00 I 750° 3 5050 1 500 2500 260
To 2.0 30 411 60 10 20 30 40 05 0 10 30 30 40 60 pryal100 001.0ntrallon 04003) 3•0010a concanIntlan 101111.0 peptide concentration (WM
(b) (c)
TA clone TRBVCDR313 amino acid sequence TRBJCDR3 length
CDR3 6°Thl 1311 13-1 CASSDAPGQGAGNTLYF 1-3 15 TA clone TRAY CDR3a amino acid sequence TRAJ length 6°Thl 1311 6°Thl B2( 6°Thl B24 CAVTNTNAYKVIF 30 11 6thThl Al 3-3 6"Thl 1321 6thThl Al( 6°Thl B1( CASSDLGTAGNTLYF 13 6thThl A21 6°Thl 131. 6thTh1A22 6°Thl B2 CASSEPGTGRSGNTLYF 15 6thThlA2 4D-3 CAAPSGSFNKLTF 4 6°Thl 134 2 CASSQEGWGAWEQYF 2-7 13 6thThIA6 6°Thl Blf CASSQDGGGAYEQYF 13 6thThIA17 6°Thl B3 CASSQVDRPYEQYF 12 6thThlAl9 CAAMNYNQGKLIF 23 6°Thl B8 CASSQEGTGGYAEQFF 2-I 14 6thTh1 A20 6°Thl B21 19 CASSILGGHTGQLYF 2-2 13 6thThlA3 CAAGARNNNNRIFF 31 12 6°Thl B21 CASSLGNTGQLYF 11 6thThIA4 CAAEKHNNRIFF 10 6"ThI B5 4 CASSLRDWGDEQYF 2-7 12 6thThlA5 4D-4 CAAEGENNNAPRF 43 11 6°Thl B7 1 CTCSGRDWGDEQYF 6°Thl B9 31 CAWSLGGGAETLYF 2-3 12 6°Thl 1311 16 CASSFGTDYEQYF 2-7 11 6°Thl 1323 17 CASS RAGDSNERLFF 1-4 13
Figure 4.15 Analysis of a Thl TCR a transgenic derived T cell line. A T cell line was established from PLP 56-70 primed draining lymph nodes of Thl TCR a transgenic animals. The T cell line was restimulated every 9-11 days with peptide (PLP 56-70) and NOD.E splenocytes. At each restimulation a proliferation assay was performed with multiple doses of antigen and supernatants harvested for cytokine analysis by ELISA (a). RNA was also extracted at each restimulation and TCR alpha chain (b) and beta chain (c) usage at the 6th restimulation determined by PCR.
177 4.7. Altered cytokine phenotype of an in vivo memory response to antigen in Th2 TCR a chain transgenic animals.
The Th2 TCR a chain transgenic T cell lines described in this chapter were grown in vitro in growth medium containing 10 U/ml IL-2. This growth medium should be non-polarising (i.e. should not promote a Thl or Th2 phenotype bias). Not all Th2 TCR a chain transgenic cell lines grown in vitro during the course of this study developed a Th2 type phenotype, or indeed demonstrated a rapid TCR clonal expansion. However, the expansions and Th2 type phenotype of the 2 lines described here, which were derived from different transgenic lines, are quite striking and quite surprising given the lack of any exogenous polarising cytokines in the growth medium. The implication is that expression of the Th2 TCR a chain can, in the context of specificity to antigen (PLP 56-70) predispose to selection of a TCR 1 chain pair, which can then bias the T cell response towards a Th2 phenotype. A peptide priming experiment was therefore designed to test whether the same bias, observed so far in an in vitro system, could also be observed in vivo. Figure 4.16 outlines the experimental protocol. Mice were primed with 50 [ig of peptide (PLP 56-70), which was administered in the footpad as an emulsion with CFA. Mice were then re-primed in the flank with the same dose on day 28. Splenocytes were harvested from groups of animals (4 transgenics and 4 littermates) at each time point shown in figure 4.16. At each time point, proliferation in response to antigen and cytokine phenotype were determined. The proliferative response of splenocytes to peptide (PLP 56-70) at each time point was similar between transgenic and littermate groups and demonstrated a good memory response to antigen (figure 4.16). At day 10 there was no major difference in IFN-y production between transgenics and littermates. However at days 28 and 32 animals in the transgenic group produced very little, or no IFN-y in response to antigen. At day 28 the difference in IFN-y production between the transgenic and littermate groups was statistically significant. This was not the case at day 32, but animal numbers in groups were small and the difference is still apparent. Neither group produced IFN-y in any significant amount at day 38. No splenocytes produced IL-4 or IL-5 at any time point of this experiment. From this data it appears that the in
178 vivo memory response to antigen in Th2 TCR a chain transgenic animals is shifted to a less Thl type profile than for littermate animals, but that this shift does not extend to appearance of a Th2 type profile.
CDR3 spectratype analysis of TCR l chain usage in splenocyte samples from days 28 and 32 of this experiment was used to try to determine whether any clonal expansions had occurred. Figure 4.17 shows that for a few TRBV genes there was some evidence of possible clonal expansions in Th2 TCR a chain transgenic compared to littermate samples. These clonal expansions are suggested by the presence of a dominant peak in the spectra for these TRBV genes, where the dominant peak comprises greater than 35% of the total area. However, sequence analysis of TCR 13 chains in these splenocytes samples failed to find any evidence of these expansions (figure 4.17). Although the spectra for some TRBV genes show the emergence of a dominant peak, this does not mean that this expansion within a particular TRBV gene family equates to an expansion in the context of all TRBV genes being used in that splenocytes sample. To detect these expansions it may be necessary to just sequence TCR 1 chains using the TRBV gene in question. A further complication is the problem of using a whole splenocyte cDNA sample to detect a peptide specific clonal expansion. The memory T cells in the spleens of these animals will have many different specificities, and although the proliferation and cytokine data can be attributed to PLP 56-70 specific T cells, the splenocyte sequence and CDR3 spectratype data cannot.
179
50 ug of PLP 56-70 given 50 ug of PLP 56-70 given (a) as a footpad immunisation as a flank immunisation with CFA with CFA
I 1 r I day 6 10 28 32 38 + + + + Splenocyte Splenocyte Splenocyte Splenocyte assay assay assay assay
m) 10000 (b) Acp ( n -I. io
t 7500 ra o 5000 incorp
2500 ine id
m I i I
hy 0 1 1 1 1 t Day 10 Day 28 Day 32 Day 38 H 3
40000
:_-... 30000 E (c) 1M a 20000 * t- z l'-`- 10000
Day 10 Day 28 Day 32 Day 38
Figure 4.16 An in vivo memory response to peptide demonstrates a difference in cytokine profile between Th2 TCR a chain transgenic and littermate animals. (a) Mice were primed with a peptide (PLP 56-70) / CFA emulsion on day 0 and day 28. Splenocytes were harvested at days 10, 28, 32 and 38 and proliferation assays performed with multiple doses of antigen. After 48 hours of culture, supernatants were harvested and wells pulsed with [3H] thymidine to determine proliferation. (b) Proliferation of splenocytes to 50 µg/m1 of peptide from Th2 TCR a chain transgenic (grey bars) and littermate (black bars) animals at each time point are shown. Data shown are mean values (minus background) for the 4 animals in each group + SE (c) Levels of IFN-y in supernatants from cells cultured with 50 µg/m1 of peptide were quantitated by ELISA. Data shown are mean values for the 4 animals in each group ± SE. The statistical significance of differences between transgenic (grey bars) and littermate (black bars) groups were tested using a Mann-Whitney U test. *P <0.05.
180
(a) TRBV 3 TRBV 17
0 180 150
Th2 TCR a chain transgenic ik-fl •V kA,r‘ \ • P-• A, A,
Littermate
(b)
TA clone TRBV CDR3I3 amino acid sequence TRBJ CDR3 length
34-196B2 13-2 CASGEQGGTGQLYF 2-2 12 34-196 B4 34-196 B5 CASGDTDWGDPNTGQLYF 16 34-196B13 CASGDATGVYEQYF 2-7 12 34-196B6 2 CASSQGLDYEQYF 11 34-196 B8 CASSQELGPSAETLYF 2-3 14 34-196B10 CASSQERRADTQYF 2-5 12 34-196B15 CASSPQISNERLFF 1-4 34-196B21 CASSQVRGRRGNTLYF 2-4 14 34-196B3 13-1 CASRDSSNERLFF 1-4 11 34-196B14 CASSDDRTGQLYF 2-2 34-196B17 CASSPGETLYF 2-3 9 34-196B19 CASSGNWEQDTQYF 2-5 12 34-196B11 5 CASSRDWGYAEQFF 2-1 34-196B18 CASSRRDWGYEQYF 2-7 34-196 B7 17 CASSPGTGGDTQYF 2-5 34-196B12 20 CGARDRKNTGQLYF 2-2
Figure 4.17 TCR analysis of splenocytes from Th2 TCR a transgenic and littermate animals at day 32 after priming. (a) Spectratype analysis using splenocyte cDNA obtained from animals at day 32 of the in vivo priming protocol (figure 4.16) showed some evidence of possible clonal expansions for some TRBV genes in Th2 TCR a chain transgenic compared to littermate samples. However, these expansions were not apparent when TCR (3 chains were sequenced from these samples (b).
181 Discussion
A previous study demonstrated that CD4+ T cells selected under Th2 polarising conditions favoured an elongated CDR3a region and that this longer CDR loop may result in less optimal (lower affinity) interactions with the pMHC complex (Boyton et al., 2002). This finding led to the hypothesis that, under Th 1 or Th2 polarising conditions, different TCR structural motifs are preferred, and that if TCRs bearing these motifs were to be expressed transgenically, an inherent Thl or Th2 bias in T cell phenotype would be observed. The previous chapter of this thesis described the identification of TCR a chains for transgenic expression, and the generation of animals expressing these chains on peripheral T cells. Data presented in this chapter has described analysis of the TCR p chain repertoire of these animals and experiments to try to determine an antigen specific TCR (3 chain partner, as well as any phenotype bias that may result from expression of structurally distinct Thl and Th2 derived TCR a chains.
As antigen specific TCR (3 chain partners for the dominant a chains had not been identified, TCR transgenic animals, described in chapter 3, were expressing the Thl or Th2 TCR a chain only. To exit the thymus as a mature T cell, positive selection events dictate that the cell must be expressing an a13 heterodimer at the cell surface (Mombaerts et al., 1992b). Cells expressing the transgenic TCR a chain in the periphery must, therefore, be pairing with endogenous TCR p chains. To determine whether expression of the Th2 TCR a chain during T cell development had any impact on the peripheral repertoire of TCR (3 chains, in the absence of peptide specificity, sequence analysis and spectratype analysis were employed to look at TCR usage in splenocytes. TCR a chain transgenics made by other groups have previously been reported to show normal V(3 usage in the periphery (Huang and Kanagawa, 2004) implying that these transgenic a chains are capable of pairing with a broad spectrum of endogenous 13 chains. In addition, other studies have implied that it is the CDR3a region rather than the CDR3(3 region that dictates TCR repertoire diversity in the
182 recognition of foreign antigens and the formation of the preimmune TCR repertoire (Yokosuka et al., 2002). In the study by Yokosuka et al, an in vitro transfection system was used to analyse hundreds of potential ap heterodimers for their ability to recognise foreign antigen. It was found that for a given antigen, very few a chains were permissible, but that any one particular a chain could use a wide variety of TCR 13 chains to achieve peptide specificity. Consistent with these findings, no particular bias in VP repertoire, either in terms of the V[3 genes used, or the CDR3f3 region lengths observed, were seen in either Th2 TCR a chain transgenic line by sequence analysis or by spectratyping. The VP gene families identified by sequencing were similar between littermate animals and transgenics and the CDR313 lengths were also comparable. No obvious bias in the amino acids used in the CDR3P regions were seen and spectra obtained for each VP family showed a normal Gaussian distribution, suggesting that no significant expansions of any one sequence were present. This analysis suggests that the transgenic Th2 TCR a chain is able to form stable a(3 heterodimers with a wide variety of different endogenous P chains that bind self- pMHC with sufficient affinity to be positively selected, although this data does not provide evidence that the diverse receptors are able to respond normally to a diverse array of foreign antigens.
The concept of repertoire diversity, however, is not a straightforward one and is highly dependent upon the peptide antigen in question. For some peptide antigens, the TCR a chain has been seen to be highly restrictive in determining which TCR 13 chains are permissible (Turner et al., 1996). Therefore, although in the peripheral T cell repertoire of the Th2 TCR a chain transgenic mice a diverse array of TCR sequences are observed, this is in the context of many self pMHC having been presented in the thymus and the situation may be different in the context of specificity to single antigen. The antigen of interest in this study is the proteolipoprotein peptide PLP 56-70. The T cells from which the transgenic TCR a chains derive were highly specific for this peptide. In order to generate a peptide specific immune response, mice were primed with an emulsion of PLP 56-70 and CFA. However, sequence and
183 spectratype analysis of T cells in draining lymph nodes of these animals revealed a similar picture to that seen in unprimed mice, where many different TCR (3 chains from different gene families were identified and symmetrical spectratype profiles revealed no obvious clonal expansions within each V(3 gene family. V(3 gene usage and spectratype profiles were comparable between transgenic and littermate animals and it is also worth noting that proliferative responses of DLN cells to antigen in vitro were also similar between transgenics and non transgenics, indicating that T cells bearing the transgenic TCR a chain are able to form PLP peptide specific heterodimers with endogenous TCR (3 chains and mount an effective response to this antigen.
Although no obvious TCR 13 chain bias was observed in DLN T cells of primed mice, it should be born in mind that in order to provoke an immune response to antigen, mice are primed with CFA. The ability of CFA to provoke an immune response is mediated by the mycobacterial components it contains and as such, although many T cells in the DLN will be specific for the peptide, others are also likely to be specific for these bacterial antigens. To look at TCR (3 chain usage in a population of truly peptide specific T cells, T cell lines derived from the DLN cells of PLP 56-70 primed mice were grown in vitro. This approach also allowed selection and change in the V13 repertoire to be examined over successive restimulations with antigen. The data from two Th2 TCR a chain transgenic T cell lines were presented in this chapter. One line was derived from mouse line 20 and the other from mouse line 34. Both T cell lines demonstrated a clonal expansion of a dominant TCR (3 chain through successive peptide restimulations. The expansion was particularly rapid in the T cells derived from mouse line 20 where, by the 6th restimulation, 100% of TCR (3 sequences obtained were identical. Both transgenic T cell line expansions were in contrast to the absent or very limited expansions observed in a littermate derived T cell line. The marked rate of clonal expansion in the TCR a chain transgenic T cell lines could also be observed from spectratype profiles of selected V13 families. Small quantities of cDNA available from each line at each restimulation meant that a full spectratype analysis across all V(3 gene families was not possible. However, using V(3 families
184 known from sequence analysis to be present in the repertoire at very early restimulations, spectra reveal that even as early as the 2nd restimulation, the diversity of the V13 repertoire in the littermate derived T cell line is far greater than that seen for the TCR a chain transgenic line. This data suggests that, in the context of specificity to the cognate antigen PLP 56-70, the diversity of the TCR p chain repertoire is limited by the expression of the transgenic Th2 TCR a chain.
The dominant TCR (3 chain sequences selected in the two transgenic lines presented here are not the same. They use different V[3 genes, have different CDR3(3 regions and indeed have different CDR3 (3 region lengths. Therefore, although influencing TCR (3 chain diversity, the transgenic TCR a chain appears not to mediate selection of a common, or "public" TCR (3 sequence. A "public" TCR sequence is one that is identified as common between different individuals and is probably the least common type of TCR bias. One of the most well studied public TCRs is LC13, a human TCR specific for an antigen of the Epstein-Barr virus (EBV) (Argaet et al., 1994). In many individuals, CD8+ T cells recognising this antigen use the same TRAV26-2/TRBV 7-6 TCR with identical CDR3 regions. The sequence of this TCR is not the only one able to recognise antigen, as individuals expressing the MHC class I molecule HLA- B*4402 are found to use other receptors different from LC13 (Burrows et al., 1995), but structural studies of this TCR have revealed exquisite complimentarity between the antigen and peptide binding pockets formed by CDR loops of the TCR (Kjer- Nielsen et al., 2003). However, aside from complete sequence homology, other forms of public TCR bias have also been documented. Some studies document preference of particular V(3 genes, for example, the use of V(38 and V(37 genes in murine responses to different antigens of the influenza virus (Belz et al., 2000). Others have reported the selection of conserved amino acid sequences within CDR3 regions (Trautmann et al., 2005). When reviewing the large numbers of TCR (3 sequences obtained during the course of this thesis, it is of note that one amino acid motif in the CDR3 region is particularly common in the context of antigen specific T cells. Sequences containing the amino acid motif, SRDWG, in the CDR3(3 region were observed in both of the original Thl and Th2 T cell lines from which the transgenic TCR a chains were
185 cloned. This motif was then also sequenced in peptide specific lines from littermate animals and indeed is part of the CDR3I3 region most dominant in this line following 6 restimulations with peptide. The motif becomes even more common if seen as SXDWG although this motif was also isolated from T cells of unprimed mice. The SRDWG motif in the CDR3(3 region of a TCR may therefore be predicted to make some important contribution towards pMHC recognition to account for this bias, although it was not observed in either of the TCR p chains seen to rapidly clonally expand in the Th2 TCR a chain transgenic lines. The contributions that the CDR3a and CDR3p regions of a TCR make to peptide recognition are known to be dependent upon the peptide being recognised and to involve different residues of the peptide. In a study by Jorgensen et al. (Jorgensen et al., 1992) mice transgenic for either an a or a p chain were immunised to peptide variants in order to determine the relative contribution of each chain to the binding of specific residues. This study found that the a and p chains contact independent parts of the peptide and so that preferred motifs are observed in one chain in conjunction with more heterogeneity in the other is not an unexpected finding.
One of the main aims of this study was to explore the possibility that the transgenic expression of structurally distinct Thl and Th2 TCRs results in an inherent Thl or Th2 bias in T cell phenotype. Transgenic expression of peptide specific Thl and Th2 TCR heterodimers has not yet been achieved to permit the ultimate test of this hypothesis, but, as discussed in chapter 3, the dominance of the Thl and Th2 TCR a chains in the original T cell lines, in the absence concomitant TCR (3 expansion, raises interesting questions about the role of the TCR a chain alone. Cytokine production by the antigen specific Th2 TCR a chain transgenic and littermate T cell lines was therefore determined. As expected, particularly from T cells originally primed using CFA, the dominant cytokine produced by the littermate derived T cell line was IFN-y. This was in stark contrast to the cytokine profile of both Th2 TCR a chain transgenic lines, where high levels of the Th2 cytokines, IL-4 and IL-5 were observed. Production of these cytokines was seen to increase through progressive restimulations with cytokine
186 and indeed this phenotype was stable, with the line 20 derived T cells producing significant amounts of IL-4 and IL-5, although also a small amount of IFN-y, after 15 restimulations. At 15 restimulations, the littermate derived T cell line was still producing only IFN-y. That T cells expressing the transgenic Th2 TCR a chain had spontaneously acquired a Th2 like phenotype was further supported by real time PCR data of Tbet and GATA3 transcription factor expression. The enormous number of variables involved in CD4+ T cell differentiation can make the relative contribution of individual factors hard to assess. However, in this system, transgenic and littermate mice were primed identically and T cells restimulated at identical time points using the same APCs and the same dose of peptide. Additionally, data presented in chapter 3 demonstrated that levels of TCR heterodimers on the surface of peripheral T cells were similar between transgenic and littermate animals. T cells were cultured in the absence of any polarising cytokines, with only a low dose of IL-2 added to the culture medium and so as far as possible, the only differences between the T cells present in the different lines are the TCR a chains that they express.
This cytokine and real-time PCR data, while convincing in its demonstration of a Th2 phenotype, is derived from T cell lines grown over a long period of time in vitro. In vitro studies will always be open to criticism surrounding the role of a particular variable in normal physiological conditions where interactions and signals are more complex. More convincing would be a demonstration of phenotype differences between Th2 TCR a chain transgenic and littermate animals in vivo. To begin to address this, data presented in this chapter described reduced IFN-y production by immediately ex vivo T cells bearing the transgenic TCR a chain, in an experiment designed to investigate the consequences of antigen restimulation in vivo. This data suggests that, similar to results obtained from in vitro culture, successive restimulation of transgenic T cells with antigen results in an altered cytokine phenotype, with respect to littermate animals, with a shift away from a Thl phenotype and IFN-y production. No Th2 type cytokines were detectable in the immediately ex vivo responses of transgenic T cells seen to be making less IFN-y, but given the Th 1 promoting environment of CFA immunisation, this is perhaps not surprising. It may
187 be that in these animals, spontaneous induction of a Th2 type phenotype will not occur in vivo but rather T cell phenotype bias will manifest as a shift away from a polarised Thl phenotype as the outcome. If this is the case, it may be of interest to determine whether this inherent bias will have any impact in the context of an IFN-y driven disease model, such as EAE. In a previously study, Thl T cell responses to the antigen PLP 56-70 were associated with susceptibility disease, while deviation away from Thl cytokine responses were associated with protection (Takacs et al., 1995).
Data presented in this chapter appears to support a role for the TCR a chain in determining CD4+ T cell phenotype and when put back into context with the original study (Boyton et al., 2002), where molecular modelling predicted that elongated CDR3a regions of Th2 TCR a chains would make lower affinity interactions with the pMHC complex, fits with other data suggesting that lower affinity TCR/pMHC interactions favour Th2 type responses (Malherbe et al., 2000) and that interventions that impede optimal TCR/pMHC binding, such as the use of APLs, can result in a switch in T cell phenotype from Thl to Th2 (Nicholson et al., 1995). Altered signalling through the TCR, as explained by the serial triggering hypothesis previously discussed, remains the most likely explanation for the link between TCR structure / affinity and effector outcome. A model where the elongated CDR3a loops of the transgenic Th2 TCR a chain forces a lower affinity interaction with the pMHC regardless of the TCR p chain sequence, although where only a limited number of 13 chains can functionally pair to give good antigen specificity, would suggest that this lower affinity interaction then results in suboptimal signalling, and an altered pattern of phosphorylation events downstream of the TCR which ultimately result in preferential induction of Th2 differentiation pathways. Altered patterns of phosphorylation signalling molecules, for example ZAP70 and Lck, have been observed upon TCR ligation with APLs (Boutin et al., 1997) and more prolonged signalling, perhaps via a higher affinity interaction, has been shown to be required for full mitogen-activated protein kinase (MAPK) activation and Thl differentiation (Badou et al., 2001). More recent data looking at thymic selection, another T cell signalling scenario where the affinity of the TCR/pMHC interaction is proposed to
188 play a major role in dictating the outcome of TCR signalling, has shown that the signalling proteins Ras and MAPK are segregated into different subcellular regions depending on the affinity of the TCR/ligand interaction (Daniels et al., 2006).
Efforts to identify whether any bias in the TCR [3 chain repertoire had occurred during antigen restimulation in vivo were limited and the experimental system not sensitive enough to detect this. Although spectratype analysis appeared to show some evidence of clonal expansions this was not supported by sequencing data. However, sequencing data was obtained from whole splenocytes and so is highly unlikely to reflect the antigen specific TCR repertoire. Further experiments are currently underway to try to select antigen specific T cells from the spleen following antigen restimulation. The ideal way to achieve this would be through the use of pMHC tetramers, although selecting T cells activated in response to peptide presentation on the basis of activation markers such as CD69, may also be of use. The ultimate test for the role of TCR structure in CD4+ T cell phenotype bias will be to look at the T cell responses of Thl and Th2 TCR ar3 transgenic animals, which have been crossed onto a RAG"'" background and thus do not express any endogenous TCR. The Th2 phenotype of the antigen specific transgenic T cell lines described in this chapter and the concomitant clonal expansion of TCR p chains observed through successive restimulation makes these TCR 13 chains good candidates for transgenic expression. The construction of a transgene for one of these chains and identification of a founder animal were described in this chapter and a programme of breeding is currently ongoing to generate mice carrying both the Th2 TCR a and I chains.
Chronologically, the two independent lines of Th2 TCR a chain mice were established before the Thl TCR a chain transgenic line and as such, much of the data obtained to date refers to the Th2 TCR a chain animals. However, expression data presented in the previous chapter and towards the end of this chapter highlight potential pitfalls in the analysis of the Thl TCR a chain line. Sequence analyses of TCR sequences from peripheral T cells of Thl TCR animals were presented in the previous chapter and showed that less than 50% of sequences obtained were derived from the transgene.
189 Percentages were also highly variable between animals and in one sample, transgenic sequences made up less than 10% of the repertoire. To examine whether the transgenic a chain may be more favoured and thus become more dominant in the context of antigen specificity, mice were primed with antigen (PLP 56-70) and T cell lines derived from the primed draining lymph nodes (DLNs) of these animals grown in vitro. This was also with the view to identifying an antigen specific TCR (3 chain partner for this Thl TCR a chain. However, following 6 restimulations with antigen, TCR sequence analysis revealed a complete lack of transgenic TCR a chains in the line. This finding has now been reproduced for 4 separate Thl TCR a chain transgenic derived T cell lines and suggests that in the context of antigen specificity, the transgenic TCR a chain is highly disfavoured in preference for endogenous chains. The reason for this bias is unclear and needs further investigation. From previous studies it has been predicted that Th 1 TCRs bind pMHC with high affinity (Malherbe et al., 2000). Given that high affinity TCRs show a preference for expansion during immune responses (Busch and Pamer, 1999), why would a TCR a chain from a high affinity receptor be disfavoured in responses to its cognate antigen? One possibility is that the answer may lie in the relationship between the polarising environment and costimulation. The T cell line from which the TCR a chain was originally identified was a short term T cell line, grown in vitro under highly Thl polarising conditions (Boyton et al., 2002) i.e. high levels of the Thl polarising cytokine IL-12, and an anti- IL-4 monoclonal antibody (mAb) were present in the culture medium. Cytokines secreted during the course of an immune response, whether particularly polarising or not, will influence expression of costimulatory molecules (Creery et al., 1996) and whether through modulating the avidity of the T cell-APC interaction, or through signalling, costimulatory molecules can have an enormous impact on the outcome of T cell activation (Graf et al., 2007). It may be that under non-polarising conditions, such as those used in this study where only a low concentration of IL-2 was added to the culture medium, conditions of costimulation are such that high affinity interactions are disfavoured e.g. by increasing the dwell time of the TCR/pMHC complex such that rates of TCR signalling and T cell activation are suboptimal (Kalergis et al., 2001). Under these conditions, T cells bearing TCRs with lower affinity endogenous TCR a
190 chains may proliferate faster and consequently become dominant. To circumvent the problem of endogenous TCR a chain expansion, Thl TCR a chain animals could be crossed with animals carrying a disrupted TCR a chain locus. These animals would not express any endogenous TCR a chains and so questions of selection, costimulatory requirements and phenotype bias could more easily be addressed. Alternatively, it would be of interest to grow transgenic T cell lines in the same highly polarising culture medium used to grow the short term Thl cell line in the first place, to determine whether the transgenic TCR a chain is more favoured under these conditions.
With data presented in this chapter serving to confirm the hypothesis that TCR structure can influence T cell phenotype, also of interest is whether TCR transgenic mice could be used to develop models of Th 1 and Th2 mediated disease. The lung is one site at which populations of polarised Thl and Th2 T cells are found associated with disease pathology and the following chapter describes the generation of a novel model, using lung targeted expression of the antigen PLP 56-70, which could be combined with the TCR transgenics discussed in this chapter to create new models of Thl and Th2 mediated lung disease.
191 Chapter 5
Generation of transgenic lines for inducible, lung targeted, antigen expression.
Results
5.1 Design and construction of transgenes for inducible, lung targeted, expression of the antigen PLP56-70.
The antigen PLP 56-70 is the peptide epitope for which the Thl and Th2 TCRs, described in chapter 3, are specific. One long-term aim is to use these TCR transgenic lines to study inflammatory responses in the lung, by expressing antigen (PLP56-70) in a tissue specific and inducible manner. The inducible system chosen for this study is the Cre/Lox system (figure 1.5). Figure 5.1 outlines the overall expression strategy.
In an uninduced animal, expression of the peptide is prevented by the presence of a stop sequence in the transgene. The stop sequence is flanked by two loxP sites and was first described by Lakso et al. (1992) as a way of temporally controlling oncogene expression in mice. Transgenic mice were generated that carried a transgene containing the simian virus 40 large tumor antigen gene driven by a murine lens specific promoter but where the tumor antigen gene was separated from the promoter by a floxed stop sequence. These mice showed no sign of tumor development, but when crossed with another transgenic line carrying the Cre recombinase protein under the control of the same lens specific promoter, Cre mediated deletion of the stop sequence resulted in all double transgenic offspring developing lens tumors (Lakso et al., 1992). The stop sequence comprises the 550 bp C-terminal sequence of the yeast His3 gene, 823 bp of the SV40 polyadenylation signal region and a DNA
192 oligonucleotide that contains a false translational initiation signal. The sequence was kindly supplied by Brian Sauer for use in this study.
Upon administration of the drug tamoxifen the bacteriophage enzyme Cre recombinase excises the stop sequence by catalysing recombination between the two flanking loxP sites. This allows expression of the peptide, driven by the lung specific promoter CC10. The vector used for this strategy means that the peptide will be expressed within the protein Hen Egg Lysozyme (HEL). Antigen processing within APCs will cleave the HEL protein to yield the peptide PLP 56-70 which can then be presented in the context of the MHC class II molecule I-Age. Correct expression of the HEL/PLP fusion protein is aided by the presence of rabbit 13 globin intronic and PolyA sequence at the 5' and 3' ends of the coding region respectively. This HEL expression cassette has been used successfully by Vowles et al. (Vowles et al., 2000) to express a peptide of Myelin Basic Protein (MBP 84-105). In that study they showed that the HEL/MBP fusion protein could be expressed as a secreted or membrane bound protein, depending on whether the membrane domain of the influenza virus A hemagglutinin protein (HA) was present at the C terminus of the coding region and that, particularly in the case of the membrane bound version of the protein, transgenic expression resulted in resistance of these mice to EAE induction using the MBP peptide. It is not known whether membrane bound or secreted forms of the HEL/PLP protein will result in the PLP peptide being processed and presented most efficiently and so both membrane bound and secreted forms of the expression cassette were kindly supplied by Helen Bodmer for use in this study.
Several different promoters have been used to target transgene expression to the lung. The three most common are CC10, K18 and SP-C. The promoter of pulmonary surfactant protein C (SP-C) drives lung specific expression in mature alveolar type II cells (Glasser et al., 2000) with little or no expression observed in more proximal bronchiolar structures. Conversely, CC10 and K18 promoters direct transgene expression to the trachea and all levels of the bronchial tree with no expression observed in alveoli (Stripp et al., 1992 and Chow et al., 1997). As many chronic lung
193 diseases affect larger airway structures, the CC10 promoter was selected for this study. It is well characterised and has been more widely used than the K18 promoter, for example in targeting expression of the Th2 type cytokines IL-4 and IL-13 to the mouse lung in order to study the role of these cytokines in Th2 type lung inflammation (Zheng et al., 2000 and Rankin et al., 1996). The DNA sequence of the CC10 promoter used for this study is derived from rat. This DNA sequence was characterised as the genetic element responsible for cell specific regulation of the CC10 gene by linking stretches of DNA sequence upstream of the CC10 coding region to a reporter gene and transfecting a lung cell line in vitro. Transgenic mice carrying a transgene containing this regulatory sequence and the reporter gene were then generated and lung specific expression using this promoter was confirmed (Stripp et al., 1992). The DNA sequence used in this study was kindly supplied by Jeffrey Whitsett.
194
Hen egg lysozyme (HEL) (a)
(3 globin 'HI globtn CC10 lung promoter STOP Intron PolyA
Transmembrane anchor PLP (56-701
IQ4erCreMer Tamoxifen J V
PLP (56-70) expressed (b) within HEL loxP CC 10 lung promoter
Figure 5.1 The strategy for inducible, lung specific, expression of antigen PLP (56-70). Lung specific expression is achieved using the clara cell specific promoter, CC10. Clara cells are found only in the bronchi and bronchioles of the lung. The peptide PLP (56-70) is expressed within the protein Hen egg lysozyme (HEL), and correct mRNA processing is achieved using intronic and poly A sequence from rabbit p globin. 2 constructs were created. One construct contains a transmembrane anchor sequence and results in the expression of membrane bound HEL/PLP (56-70). In the construct not containing this anchor the HEL/PLP protein is secreted. (a) In an uninduced animal, expression of HEL and PLP (56-70) is prevented by the presence of a translational stop sequence flanked by 2 loxP sites. (b) On administration of tamoxifen, Cre recombinase previously sequestered in the cytoplasm (figure 1.5) moves to the nucleus and excises the stop sequence by recombination between the two loxP sites. Expression of HEL and PLP (56-70) is therefore induced only on administration of tamoxifen and only in clara cells of the lung.
195 The expression strategy outlined in figure 5.1 depends upon both the Cre recombinase and the CC10 promoter being active within the same cell. The strain of MerCreMer transgenic mouse available in our laboratory ((3m70) (created by L. Bugeon and M. Dallman) expresses the MerCreMer protein under the control of the chicken 13 actin promoter. The MerCreMer protein expressed in these animals is known to be functional (unpublished data), but expression in the lung is not characterised. In an uninduced mouse the MerCreMer protein should be present diffusely in the cell cytoplasm. On administration of tamoxifen the Cre protein translocates to the cell nucleus where it should be detectable by immunohistochemistry. Inflated lung sections from uninduced and tamoxifen induced (3m70 mice were stained with an antibody specific for the Cre protein (figure 5.2). No specific staining was observed in the uninduced mouse, but widespread nuclear staining can be seen upon induction with tamoxifen. Not all cells are positive for nuclear localised Cre protein, but some staining was observed in all structures of the lung. An antibody specific for the CC10 protein was also used (figure 5.2). As expected, staining was only observed in the bronchiolar structures of the lung. Staining of the CC10 protein was the same in uninduced and induced animals indicating that the activity of the CC10 promoter is unaffected by the tamoxifen induction protocol.
Although, from the biotin based immunohistochemistry shown in figure 5.2, the nuclear Cre protein appears to be present in CC10 positive bronchiolar structures of the lung, it was important to establish that both proteins were present within exactly the same cell. Inflated lung sections from induced animals were therefore stained with Cre and CC10 specific antibodies at the same time, and co-localisation of these proteins visualised using fluorescently labelled secondary antibodies (figure 5.3). The data shows that some, but not all, CC10 positive cells also contained nuclear localised Cre protein and that activity of the CC10 promoter was unaffected by the presence of the Cre protein within the nucleus. Excision of the stop sequence in the transgene and expression of PLP 56-70 in the lung should therefore be possible using the (3m70 transgenic line.
196 (a) CC10 (b) Cre
Uninduced
bronchi
alveoli Tamoxifen induced
blood vessel
Secondary antibody only
Figure 5.2 The localisation of Cre and CC10 proteins in uninduced and tamoxifen induced lung sections from iii m70 MerCreMer mice. Mice were induced with tamoxifen i.p. for 5 days prior to harvesting of the lung. The binding of primary antibodies specific for Cre and CC10 proteins was visualised using biotin labelled secondary antibodies. (a) CC10 staining is confined to the bronchi and bronchiole structures of the lung and expression of the CC10 protein is not affected by the tamoxifen induction protocol. (b) No nuclear Cre staining can be seen in the uninduced lung, but on induction with tamoxifen, nuclear localised Cre is observed in both bronchiolar and alveolar structures of the lung. All photos are at x20 original magnification and the main structures of the lung are marked.
197 (a) x20 magnification x40 magnification
bronchi (b)
(c)
Figure 5.3 Co-localisation of Cre and CC10 in the lung of a tamoxifen induced 13m70 MerCreMer mouse. (a) CC10 was visualised using a FITC labelled secondary antibody and is confined to the bronchi and bronchioles of the lung. (b) Cre was visualised using a TRITC labelled antibody and nuclear staining is observed in both alveolar and bronchiolar structures. (c) Co-localisation of CC10 and Cre stains shows that some but not all cells expressing CC10 also contain nuclear localised Cre protein. Photos are at x20 or x40 original magnification and main lung structures are marked.
198 The cloning strategies used to create the membrane bound and secreted versions of the inducible, lung targeted, PLP 56-70 constructs are shown in figure 5.4. A synthetic oligonucleotide sequence of PLP 56-70 was inserted into both the membrane and bound and secreted HEL expression cassettes by directional cloning, replacing the MBP peptide used previously in the constructs. PCR was used to confirm correct insertion of the PLP 56-70 oligonucleotide into both constructs and presence of the HA transmembrane domain in the membrane bound version of the transgene (figure 5.5). To join the HEL expression cassettes to the floxed stop component it was necessary to introduce SfiI sites, by PCR, to the 5' and 3' ends of the rabbit 13 globin sequences. The SfiI PCR fragments and restriction digests used to confirm successful joining of HEL and stop sequence fragments are shown in figure 5.5.
The final step in the assembly of each transgene was the joining of the lung specific CC1 0 promoter using NotI. The final sequence of each transgene was contained within the cloning vector pBluescript II. A PCR using primers specific for the CCI 0 promoter and rabbit 13 globin sequence, and a XhoI restriction digest, demonstrate that the transgenes are complete (figure 5.6). Both transgenes were also verified by sequencing. Complete secreted and membrane bound, inducible, lung PLP constructs are subsequently referred to as SIPLP and MIPLP respectively. Full nucleotide sequences of membrane bound and secreted PLP transgenes are shown in appendices 23 and 25. Coding nucleotide and amino acid sequences are shown in appendices 24 and 26.
Bacterial sequence was removed from the pBluescript II vectors, by digestion with BssHII, prior to pronuclear injection. The 6000 bp fragments of each transgene purified for injection are shown in figure 5.6. Final plasmid maps of the MIPLP and SIPLP constructs are shown in appendices 13 and 14 respectively.
199 PLP (56-70) MBP peptide exchanged for (a) 122 PLP (56-70) oligonucleotide using Narl and SacII Nar I S Sac II
Intron HEL MBP HEL PoIyA
Sf I SfiIBamHIBodF Not I N ot I loxP loxP II" STOP P"I (b) Intron HEL PLP HEL PolyA
BodXhoSfiR Sfi I sites introduced at either end of PLP construct by PCR and the construct joined to foxed stop sequence using Sfi I
Not I (c) —I CC I 0 promoter
Floxed stop-PLP fragment joined to CC10 promoter using Not I (d) BssHII BssHII Not I Not I loxP loxP PLP CCIO promoter STOP 0101-1
Constructs linearised for injection using BssHII
Figure 5.4 A schematic diagram of the cloning strategy used to create the inducible, lung specific PLP (56-70) transgenes. (a) The peptide PLP (56-70) was introduced into the HEL expression cassette (Vowles et al., 2000) using Nan and SacII, replacing an MBP peptide used previously. (b) SfiI sites were introduced at either end of the HEL construct by PCR and SfiI then used to join this fragment to the floxed stop sequence (Lakso et al., 1992) (c). The lung specific promoter of CC10 (Stripp et al., 1992), was joined using NotI (d). Bacterial sequences were removed from the vector by digestion with BssHII prior to pronuclear injection.
200
(a) HELA / PLPB HELA / TMCYTOB cc a. a. P.0 a. Z z a, bp O 8 6 Z VD v) ZD cip
1000 750-0- 500 250
EcoRI _.A....___ r a (b) S fi I PCR at4 al.,.) r—A—AT. ..-1 P-I P. 6 C) • v) -oCU▪ a. .46 bp -o a. ias-, o 6I) .q— o 0 )-- CID CIO
3000 2000
1000-0. 750 500
Figure 5.5 Assembly of the inducible, lung specific, membrane bound and secreted PLP (56-70) transgenes. (a) PCRs using primers specific to HEL and PLP (56-70) demonstrate successful introduction of this peptide into the HEL expression cassette. The presence of the transmembrane anchor is also demonstrated using a primer specific to this region. (b) PCR was used to introduce SfiI sites at either end of the PLP constructs and products are 1755 bp and 1888 bp for the secreted and membrane forms respectively. These products were TA cloned and then joined to the floxed stop sequence using SfiI. EcoRI digests demonstrate correct joining of these two fragments and also the presence of the transmembrane anchor, as EcoRI sites flank the HEL coding sequence (see appendices 13 and 14). HEL fragments are 548 bp and 681 bp for secreted and membrane forms respectively.
201 (a) CCI0/13globin PCR Xho I r__..k—t tuI-I f --- A 774 a bp -ct: j 'ci) cil
4000—* 3000 2500 2000-*
(b) SIPLP MIPLP
bp a) .0 E -0 k: .f)0 E 4:1
6000 --Po.
3000 2500-0.
Figure 5.6 Complete inducible, lung specific, PLP constructs (membrane [MIPLP] and secreted [SIPLP]) (a) A PCR using primers specific to the CC10 promoter and rabbit 13 globin sequence demonstrates complete assembly of the construct. Products are 3239 bp and 3372 bp for the secreted and membrane constructs respectively. A XhoI digest also demonstrates that all components are present in the correct configuration. Fragments should be (3505 bp, 3006 bp, and 2175 bp) or (3505 bp, 3006 bp and 2378 bp) for SIPLP and MIPLP respectively (see appendices 13 and 14). (b) Prior to pronuclear injection bacterial sequence was removed from each vector. This was achieved by digestion with BssHII and purification of the upper 6000 bp band.
202 5.2 Identification of an MIPLP transgenic founder animal.
The MIPLP construct was injected into FVB/N oocytes at the Nuffield department of Medicine in Oxford. 24 potential founder animals were screened for the presence of the MIPLP transgene. An initial PCR screen, using genomic DNA extracted from a tail biopsy, identified 1 founder animal (figure 5.7). This animal is subsequently referred to as MIPLP line 11, based on a number assigned to the animal at the point of tail biopsy. Southern blot also confirmed the transgenic status of this animal (figure 5.7). A single intense band seen on the Southern blot for this transgenic line suggests that multiple copies of the transgene have integrated at a single locus. The sequence and product sizes of all PCR and Southern primers used for screening of the MIPLP transgenic founder animal are shown in appendix 7.
Prior to generation of the MIPLP transgenic line, Pm70 MerCreMer transgenic animals had been backcrossed for at least 3 generations onto a NOD.E genetic background. The MHC class II molecule I-Ag7 expressed by the NOD.E strain is required for presentation of the peptide PLP 56-70. These NOD.E backcrossed I3m70 transgenic animals were used for subsequent breeding of MIPLP line 11.
203 3rdexonF CC101500F (a) loxP loxP PLP CC l0 promoter STOP
CC10210OR BetaglobinB
Potential founders 1-10 "c 12-18 (b) 'CS 2 bp 3233
3000 2000 1000 750 500 250
r de
(c) foun 11 ine
kb L
EcoRV
600bp DIG 4 --11o. labelled probe
3 —*
Figure 5.7 Identification of an MIPLP transgenic founder animal. The transgenic founder was identified by PCR and by Southern blot. The location of primers used for PCR screening (3rdexonF and BetaglobinB) and for generation of the Southern probe (CC101500F and CC102100R) are shown in (a). One transgenic animal was identified from an initial PCR screen of 24 potential founders (b). The transgenic status of this animal (number 11) was then confirmed by Southern blot (c). The restriction enzyme used to digest genomic DNA for Southern blotting was EcoRV. This enzyme only cuts the integrated construct once, on the 3' side of the CC10 promoter region being used as a probe (c), giving information about construct integration sites and copy number.
204 5.3 Determination of stop sequence excision and MIPLP transgene expression.
Lung expression of the antigen PLP 56-70 requires that the stop sequence present in the transgene be removed. Cre recombinase is activated to excise the stop sequence following administration of the drug tamoxifen. Animals carrying both the MIPLP and Cre transgenes were identified. Following administration of tamoxifen, lung tissue was harvested, and a PCR strategy used to determine whether stop sequence excision had occurred (figure 5.8). A change in size of PCR product in tamoxifen induced animals carrying both the MIPLP and Cre transgenes demonstrated that removal of the stop sequence had occurred in the lung tissue of these animals and that the CC10 promoter and HEL expression cassette were subsequently juxtaposed. No stop sequence excision was observed in animals that had not received tamoxifen or in induced animals carrying the MIPLP transgene alone. PCR was also used to demonstrate expression of the HEL/PLP protein at the level of cDNA in lung tissue following tamoxifen induction (figure 5.8). To detect expression of the HEL/PLP transgene at the level of protein, immunohistochemistry of inflated lung sections from induced and uninduced animals using an anti-HEL antibody was attempted. However, no positive staining was observed (data not shown).
Lung tissue was harvested from transgenic animals at different time points following tamoxifen induction. PCR demonstrates that removal of the stop sequence from the transgene does start to occur immediately following administration of tamoxifen, but takes many days to be removed from all copies in the lung (figure 5.9). 2 days after tamoxifen induction, many copies of the transgene still contain the stop sequence. No HEL/PLP protein was detectable in lung mRNA from these animals. Removal of the stop sequence from the transgene is irreversible. However, following clearance of tamoxifen from the circulation, new cells formed as a consequence of normal lung cell turnover will carry the full length transgene and will therefore not express the HEL/PLP protein. Estimates of the rate of turnover of lung epithelial cells are quite varied and probably depend upon many factors such as the age, strain and pathogen status of the animal. The most consistent studies have used pulse/chase experiments
205 with tritiated thymidine ([3H]) to calculate airway cell turnover and the consensus is that the turnover time of tracheal-bronchial epithelium of adult rodents is more than 100 days (4 months) (Kauffman, 1980). The PCR data, shown in figure 5.9, show that most copies of the stop sequence in the lung are still deleted more than 100 days after tamoxifen induction. This suggests a very slow rate of cell turnover.
206
1647bp 10- stopfloxedF loxP loxP PLP (a) stooiloxedR
HELA lax]) PLP CC10 promoter
110- PLPB 264hp
a., a., (b) 5 2
U a. C.)I
2000 --It. 4— 1647bp 1500 P
500 —111,- 250 --110- I 264bp
a. (d) a. (c) a a a aa a a,_.1 P.i_a a a a z a 5 2 2 DNA a 2 5 C a a > 2000 —IP. 1000 500 500 -÷ 250 Figure 5.8 Removal of the foxed stop sequence and expression of MIPLP in lung tissue following induction with tamoxifen. (a) PCR strategies were used to demonstrate removal of the fluxed stop sequence (using primers stopfloxedF and stopfloxedR) and expression of PLP (using primers HELA and PLPB) in lung tissue from transgenic animals that had been induced with tamoxifen for 5 days. (b) Following tamoxifen induction, lung genomic DNA was used as a template to demonstrate removal of the floxed stop sequence in animals carrying both the Cre and MIPLP transgenes. No change in size of PCR product was observed in animals carrying the MIPLP transgene alone. Lung cDNA was then used to demonstrate low levels of expression of HEL/PLP. (c) HPRT was used as positive control for successful cDNA synthesis and cDNA reactions with (+) and without (-) the reverse transcriptase enzyme were used to control for any contaminating genomic DNA in lung RNA preparations. PLP expression was observed only in those animals shown to have deleted the stop sequence (d). 207 (a) a) MIPLP bp 7:1 x Cre d ce (c) du a. in a. bp z M un a. V 9 x O z Cre 5U 2000 —0.- 1600 500 —OP- 220 Figure 5.9 Complete removal of the foxed stop sequence occurs over many days and persists for many weeks following induction with tamoxifen. (a) Genomic DNA from lung tissue harvested 2 days after completion of the tamoxifen induction protocol contains copies of the transgene in which the stop sequence has been removed, but many copies of the transgene still remain unfloxed. (b) 2 weeks after completion of the tamoxifen induction protocol, almost all copies of the stop sequence in the lung have been deleted. (c) Copies of the transgene that do not contain the stop sequence remain present in the lung at least 100 days after tamoxifen induction. 208 5.4 Re-design of the SIPLP transgene. Initial data from the MIPLP line 11 founder animal demonstrates that the lung expression constructs designed are functional, i.e. correct deletion of the stop sequence is observed and that HEL/PLP 56-70 mRNA transcripts can be detected in the lung. However, levels of expression seen are very low (figure 5.8). One possible explanation for the low levels of expression observed is that the sequence of the loxP site, which remains in the transgene following stop sequence excision, contains an ATG triplet and may act as a false translational start site (figure 5.10). The simplest solution is to invert the stop cassette such that the loxP sites are still functional but are in the reverse orientation. No SIPLP transgenic founders were generated from an initial round of pronuclear injections. As re-injection of the construct was required, a new SIPLP construct was generated containing an inverted stop cassette. The cloning strategy used to create the new SIPLP transgene is shown in figure 5.11. The complete nucleotide sequence and final plasmid map of the new SIPLP construct are shown in appendices 27 and 15 respectively. Bacterial sequence was removed from the construct prior to pronuclear injection as described previously. 209 (a) fi x► loxP loxP PLP Cre mediated recombination loxP I PLP CC 10 promoter ATAACTTCGTATAATGTATGCTATACGAAGT x ► (b) PLP loxP loxP CC10 promoter WE Cre mediated recombination loxP r:,P CC 10 promoter ATAACTTCGTATAGCATACATTATACGAAG Figure 5.10 A schematic diagram to demonstrate the potential importance of loxP site orientation. (a) Recombination between loxP sites in a forward orientation results in the presence of an ATG triplet upstream of the coding region, which has the potential to act as a false translational start site. Use of this false start site may affect the efficiency of translation from the intended start site and protein expression levels may be low. Potential start sites are marked (*). (b) If loxP sites are in the reverse orientation, no ATG triplet will remain following recombination and translation of the protein of interest should be unaffected by the remaining loxP sequence. 210 PBluescriptll vector modified to destroy Rabbit 13 globin /PLP fragment cloned the KpnI site using T4 DNA polymerase into the shuttle vector pCle2.1 using BamHI and XhoI (a) InI HindIII BssHII XbaI BamHI XhoI HindIII BssHII KpnI XbaI I I I Mr/A. Intron HEL PLP HEL PolyA Directional cloning using HindIII and XbaI (b) HindIII BamHI V XhoI BssHII KpnI XbaI BssHII 1 1.4.1 1 Intron HEL PLP HEL PolyA HindlII HindlII CC 10 promoter joined using HindIII CCIO promoter • (c) HindIII HindIII KpnI BamHI XhoI BssHII XbaI BssHII CC I 0 promoter WAN Stop sequence cloned, using NotI, into a pBluescriptll vector that has been modified, using Nod Nod an oligonucleotide linker, to contain two KpnI sites. KpnI Stop sequence then joined to CCIO promoter and KpnI PLP fragment using KpnI 4 STOP 4 V (d) HindIII HindIII BamHI XhoI XbaI BssHII BssHII KpnI KpnI CC I 0 promoter __LAI STOP PLP inducible lung construct linearised for injection using BssHII Figure 5.11 A schematic diagram of the cloning strategy used to invert the foxed stop sequence of the SIPLP construct. (a) A pBluescriptll shuttle vector was modified to remove a KpnI restriction site and the Rabbit 13 globin/PLP fragment inserted into this vector using HindIII and XbaI (b). The CC10 promoter was joined using HindIII (c). The floxed stop sequence was cloned into a modified pBluescriptll vector such that it was flanked by KpnI sites which were then used to clone the stop sequence into the final vector, with loxP sites in the opposite direction to those in the previous inducible PLP constructs (d). Bacterial sequence was removed from the vector by digestion with BssHII prior to pronuclear injection. 211 5.5 Identification of SIPLP transgenic founder animals. The new SIPLP construct was injected into C57BL/6 oocytes at the MRC Clinical Sciences Centre of Imperial College, London. 56 potential founder animals were screened for the presence of the SIPLP transgene. An initial PCR screen, using genomic DNA extracted from a tail biopsy, identified 4 founder animals (figure 5.12). These animals are subsequently referred to as SIPLP line 48, SIPLP line 50, SIPLP line 60 and SIPLP line 69, based on numbers assigned at the point of tail biopsy. The transgenic status of each of these animals was then confirmed by Southern blot (figure 5.12). No positive band was seen on the Southern blot of SIPLP line 50. Based on this data, SIPLP line 50 was not selected for further breeding. Positive bands on the Southern blot for SIPLP line 69 are more intense than those for lines 48 and 60. This suggests that the number of copies of the transgene integrated into the genome is the greatest in line 69. Two bands are visible on the blot for SIPLP line 48 suggesting several sites of integration of the construct in this line. All SIPLP transgenic founders were crossed with (3m70 MerCreMer transgenic animals that had been backcrossed for at least 6 generations onto a NOD.E genetic background. 3 litters derived from SIPLP line 60 were screened by PCR for the presence of the SIPLP transgene. From a total of 18 pups, no positive mice were identified. The transgenic status of the breeding founder animal was confirmed by PCR from a 2nd tail biopsy but, as no germ line transmission of the transgene was observed, the line was terminated. To date, a single transgene positive animal has been identified from a total of 20 mice derived from the breeding of SIPLP line 69. Therefore, no further analysis of this line has so far been possible. The frequency of germ line transmission of the SIPLP transgene has been the greatest for litters derived from the breeding of SIPLP line 48 (19 positive animals from a total of 40). Litters derived from SIPLP line 48 were screened by PCR for the presence of 212 the SIPLP and Cre transgenes. To demonstrate expression of the SIPLP construct in lung tissue of these animals, mice were induced with tamoxifen and after 14 days, lung tissue was harvested and RNA and DNA extracted. As described for the MIPLP transgenic line, administration of tamoxifen to animals carrying both the Cre and PLP transgenes should result in excision of the foxed stop sequence, which can be detected by PCR. Figure 5.13 shows removal of the stop sequence in a tamoxifen induced animal carrying both the SIPLP and Cre transgenes. This demonstrates that, despite inversion of the stop cassette during the re-design of the SIPLP transgene, the loxP sites are still functional. Additionally very low levels of HEL/PLP transcripts were detected in lung cDNA from these mice by PCR and as such expression levels detected from the MIPLP or SIPLP transgenes appear to be similar regardless of loxP site orientation. The SIPLP line from which this data derives (line 48) had the lowest number of transgene copies by Southern blot. SIPLP line 69 contains many more copies of the transgene in the genome than line 48 and experiments are currently ongoing to determine floxing and expression upon tamoxifen induction in these mice. 213 3rdexonF CC101500F (a) loxP loxP PLP CC 10 rornoter STOP 4 CC10210OR BetaglobinB cc-,,r u-) 7.. (b) ¢ V 6? Potential founders 39-47 -= = 51-59 ,... Z 0-, e = a.) Qa bp 5 . 1.::: 2 1000 500 61-68 70-75 bp 0 1000 HO. 500 —1111. (e) EcoRV CC 10 STOP HEL/PLP — 600bp DIG labelled probe Figure 5.12 Identification of SIPLP transgenic founder animals. The transgenic founders were identified by PCR and by Southern blot. The location of primers used for PCR screening (3rdexonF and BetaglobinB) and for generation of the Southern probe (CC101500F and CC102100R) are shown in (a). Three transgenic animals were identified from an initial PCR screen of 56 potential founders (b). The transgenic status of these animals (numbers 48, 50, 60 and 69) was then confirmed by Southern blot (c). The location of bands on the Southern blot are marked by grey arrows. The restriction enzyme used to digest genomic DNA for Southern blotting was EcoRV. This enzyme only cuts the integrated construct once, on the 3' side of the CC10 promoter region being used as a probe (c), giving information about construct integration sites and copy number. Based on the result of Southern analysis, founder animal 50 was not selected for further breeding. 214 (a) 1736 bp stopfloxe loxP loxP PLP cciop noter 4 STOP 4 —E111 SUPLPstoptioxedR HELA loxP PLP CC1CproMoter 4 —1=1/11 44-00. PLPB 353 bp d (b) (c) duce in n Cre u Cre z Cre bp SIPLPx O IPLPx z SIPLPx 2000 1600 500 —11—P.-1,. 340 —IP' Figure 5.13 Removal of the floxed stop sequence and expression of SIPLP in lung tissue following induction with tamoxifen. (a) PCR strategies were used to demonstrate removal of the foxed stop sequence (using primers stopfloxedF and stopfloxedR) and expression of PLP (using primers HELA and PLPB) in lung tissue from transgenic animals that had been induced with tamoxifen for 5 days. (b) Following tamoxifen induction, lung genomic DNA was used as a template to demonstrate removal of the foxed stop sequence in animals carrying both the Cre and SIPLP transgenes. No change in size of PCR product was observed in animals carrying the MIPLP transgene alone. Lung cDNA was then used to demonstrate very low levels of expression of HEL/PLP. (c) cDNA reactions with (+) and without (-) the reverse transcriptase enzyme were used to control for any contaminating genomic DNA in lung RNA preparations. PLP expression was observed only in those animals shown to have deleted the stop sequence. 215 Discussion Polarised populations of Thl or Th2 CD4+ T cells, and the cytokines that they produce, are an important inflammatory component of a number of different lung diseases. Thl type cytokines such as IL-12 and IFN-y, and Thl mediated immune responses, have been found associated with chronic lung diseases such as sarcoidosis, while Th2 type responses, involving cytokines such as IL-4, IL-5 and IL-13, are thought to be involved in the pathogenesis of lung diseases such as cryptogenic fibrosing alveolitis and asthma. One of the main aims of this thesis was to explore the hypothesis that the structure of the TCR could lead to an inherent Thl or Th2 bias in CD44- T cell phenotype, and chapters 3 and 4 have described the generation and characterisation of TCR transgenic animals to test this hypothesis. An extension of this main hypothesis however is an additional question of whether TCR transgenic animals, displaying inherent bias towards Thl or Th2 type immune responses, could be used to generate new models of Thl and Th2 mediated lung disease. Data presented in this chapter has described the generation of inducible transgenic mice with lung targeted expression of the Thl and Th2 TCR cognate epitope, PLP 56-70. The inducible system selected for this study was the Cre/lox system (figure 1.5) and lung targeted expression was achieved using the lung specific CC10 promoter. Two versions of the transgene were created. In both versions the PLP peptide is expressed as part of the hen egg lysozyme (HEL) protein, but one version contains a membrane anchor sequence at the 3' end of the coding region and so results in the antigen being membrane bound rather than secreted. Administration of the drug tamoxifen to transgenic animals results in nuclear translocation of a ubiquitously expressed Cre recombinase, which catalyses the removal of a translational stop sequence situated 5' to the start of the coding sequence. Immunohistochemistry was used to demonstrate that the Cre recombinase would become nuclear localised in Clara cells of the lung, the cell type in which the CC10 promoter is specifically activated, validating the use of the pm70 line of Cre mice selected for this study. One important issue of this transgenic approach, mentioned previously in discussions of the Cre/lox system, is the 216 issue of Cre toxicity. Cre toxicity has been widely reported in mammalian cells (Loonstra et al., 2001) and while in this inducible Cre system toxicity is unlikely to be an issue until administration of tamoxifen, the possibility that any lung pathologies observed in these mice might be due to the Cre protein itself must be considered. Indeed the ubiquitous expression pattern of the Cre protein means that effects in tissues other than the lung are also possible. While the issue of Cre toxicity is unavoidable in this system and will persist for the lifetime of the drug within the mouse, it is straightforward to control for by using animals carrying the Cre transgene but not the inducible lung constructs. Any secondary effects of the Cre protein on lung tissue and in causing lung pathology will also be observed in these animals. Data presented in this chapter have described the cloning of secreted (SIPLP) and membrane bound (MIPLP) lung constructs and the identification of transgenic animals carrying each of these transgenes. A PCR strategy was used to demonstrate that tamoxifen induction resulted in correct excision of the floxed stop sequence in lung tissue and low levels of transgene expression were detected in lung cDNA from the MIPLP line and SIPLP line 48. Poor germline transmission of the transgene in SIPLP line 60 meant that this line was not carried forward for characterisation and experiments are currently ongoing to determine transgene floxing and expression levels in SIPLP line 69. Yet to be demonstrated in any transgenic line is the presence of the HEL/PLP in the lung at the protein level. Attempts to visualise the protein intracellularly using immunohistochemistry and an anti-HEL antibody have been unsuccessful. One likely explanation for this is that the HEL protein present in the lungs of these animals is not the native form. The coding sequence of PLP 56-70 is inserted into the centre of the protein and as such is likely to affect the structure of this molecule. The antibody used was polyclonal, but if the structural impact of PLP 56-70 addition to the protein is severe enough, normal antibody binding epitopes may be destroyed. Another approach currently ongoing is to try to demonstrate the presence of antigen using antigen specific T cell lines. If the HEL/PLP antigen is being expressed in the SIPLP lines then protein should be present in the BAL of induced animals. However, the presence of the membrane anchor in the MIPLP transgene 217 means that this will not be true for MIPLP transgenic mice and disruption of the lung tissue to release intracellular protein would be required. Indeed, membrane bound expression of antigen, and data presented in this chapter showing large numbers of foxed transgene copies present in the lung more than 100 days following tamoxifen induction, raises important questions about how efficiently this protein will be presented to T cells in the lung. Presentation of PLP 56-70 in the lungs of induced MIPLP animals will rely on natural breakdown of the airway epithelium to release the protein. As turnover of the airway epithelium is low (Kaufmann, 1980), the amount of antigen presented by lung APCs to resident T cells may be tiny. It may be that in this system, infliction of mild lung injury, for example by low dose LPS exposure (Rojas et al., 2005), may be required in order to potentiate death of airway epithelial cells, release of antigen and initiation of an inflammatory response in the lung. From PCR data obtained to date for both MIPLP and SIPLP lines, levels of expression appear to be low although, from PCR data of the floxed transgene, expression should persist for many days. In previous discussion of different lung diseases, difficulties in modelling the chronic nature of many of these diseases, and also the unknown nature of the antigens to which the immune system is responding, were mentioned. When the SIPLP and MIPLP transgenic lines have been crossed with the TCR transgenic animals bearing Thl or Th2 antigen specific TCRs, it may be that the low levels of expression of the TCR antigen over an extended period of time that can be induced in these animals is an effective model for some of these disease processes, particularly if some of the antigens yet to be identified in these diseases derive from endogenous lung proteins. Immune responses to weakly expressed endogenous antigens in the lung, perhaps following an initial mild insult or injury, would provide an explanation for the chronic and progressive nature of many of these lung pathologies. However, an alterative outcome of low levels of peptide expression in the lung may turn out to be tolerance rather than inflammation. Central tolerance to the PLP 56-70 antigen would not be expected as the transgene is inducible and as such, especially given the presence of the translational stop sequence 5' to the coding sequence, should not be presented as part of the repertoire of self antigens during thymic selection. However, 218 as was noted in the original OVA TCR transgenic mice, subsequent presence of the peptide antigen, in the case of the OVA study, by giving peptide intraperitoneally, can result in clonal deletion of T cells bearing the OVA specific TCR in the thymus (Murphy et al., 1990). Additionally, following tamoxifen induction and removal of the floxed stop sequence in all tissue, i.e. not just in the lung, the potential for Aire protein mediated tolerance induction in the thymus would exist, and recent evidence for the existence of gene microclusters expressed by Aire suggest that this may depend on the site of transgene integration in the genome (Derbinski et al., 2005). In the periphery, it is well established that TCR ligation in the absence of APC-derived costimulatory signals, such as those of the CD28 or CD4OL pathways, leads to functional inactivation and anergy (Howland et al., 2000). This idea has been explored in the field of allergen immunotherapy, where administration of therapeutic doses of protein or peptide can lead to tolerance and attenuation of the normal immune response to allergen. Peptide studies have administered antigens subcutaneously (Norman et al., 1996), intradermally (Alexander et al., 2005) orally (Takagi et al., 2005) and intranasally (Hall et al., 2003) and have all demonstrated improvements in outcome measures of allergic airways disease, suggesting that the peptides have indeed induced tolerance to the allergen. However, although many of these studies have described using low doses of peptide, in the study of peptide tolerance by intranasal peptide administration, therapeutic doses of peptide were quite high (100 !Ag), and such levels are unlikely to be reached in this inducible system, especially given the low levels of transcription observed from PCR data. However, as there are currently no reports in the literature of inducible peptide antigens in the lung, the outcome of either low or high levels of expression on potential tolerance induction is unknown. Peptide expression levels are likely to be a key determinant of which immune mechanisms are initiated in these mice and the time course of any response will also be of interest. In mouse models of lung inflammation, chronic exposure to antigen actually decreases inflammatory responses and a suppressed, or more tolerant, immune response is observed (Yiamouyiannis et al., 1999). Again, antigen dose is probably a key issue and in mouse models of asthma, doses used to initiate disease are very high. It would be interesting to observe whether the chronic stages of any 219 inflammation induced by peptide expression in the lung in this model are different and perhaps better reflect the ongoing chronic inflammation observed in many human diseases. The nature of the inflammation induced using this model, in combination with the Thl and Th2 TCR transgenic models, will depend very much on the phenotype of the TCR transgenic T cells that traffic to the site of antigen expression. Whether prior priming of TCR transgenic T cells with antigen and adjuvant, or as previously mentioned, the generation of some form of mild inflammation in the lung, before T cells will traffic there, remains to be seen. Ideally no adjuvant or other inflammatory stimulus would be required as this will inevitably bias the Thl/Th2 nature of the subsequent inflammatory reaction. If the TCR structural hypothesis holds true then Thl and Th2 TCR transgenic T cells in vivo will have an inherent phenotype bias. If phenotypes observed in vitro are similar to those subsequently seen in vivo, then you would expect T cells from the Th2 TCR transgenic line, chains for which have now both been expressed transgenically and mice lines of which are currently being crossed together, to express predominantly IL-5, with some IL-4 and low levels of IFN-y. In the context of lung inflammation, one major action of the cytokine IL-5 is in the recruitment of eosinophils. Eosinophilic inflammation may therefore be a predicted outcome in these mice, as might several other Th2 immune pathologies, as mice constitutively expressing high levels of IL-5 in the lung have evidence of goblet cell hyperplasia, collagen deposition, eosinophil infiltration and airway hyperresponsiveness (Lee et al., 1997). As cytokine signalling pathways both antagonise and synergise in the context of immune responses in the lung, exactly what pathologies may arise in the transgenic mice and models of this study are unknown. However, that polarised CD4+ T cell responses may be generated without having to artificially manipulate one cytokine, e.g. IL-5 (Lee et al., 1997) or component of T cell differentiation, e.g. Tbet (Finotto et al., 2002) in the context of continuous antigen presentation in the lung without having to administer a biasing adjuvant or exceptionally high dose of antigen, means that the 220 transgenics described in this chapter and in chapters 3 and 4 of this thesis may lead to valuable new models of Thl and Th2 mediated pulmonary pathology, particularly in the context of chronic lung disease. 221 Chapter 6 Generation and initial characterisation of transgenic lines with lung targeted expression of human interleukin 8. Results 6.1 Design and construction of a transgene for lung targeted expression of human interleukin 8. A schematic diagram of the cloning strategy used to construct a transgene for lung targeted expression of human interleukin 8 (hIL-8) is shown in figure 6.1. The lung specific promoter of CC10, and the rabbit beta globin expression cassette, are the same as those used for the inducible lung targeted antigen transgenes discussed in chapter 5. Use of the CC10 promoter means that the human IL-8 protein will only be expressed within bronchial epithelial cells. In human cells, the IL-8 protein is expressed as a 99 amino acid precursor (Matsushima et al., 1988). Following removal of a 20 amino acid signal peptide, this precursor is secreted, and then cleaved extracellularly at the N-terminus into several possible biologically active forms of the protein (Padrines et al., 1994). To ensure secretion and correct subsequent processing of the hIL-8 protein it was therefore necessary to use the coding sequence for the entire 99 amino acid precursor protein in this transgene. Low levels of hIL-8 cDNA transcripts are found in normal human peripheral blood mononuclear cells (PMBCs) (Matsushima et al., 1988). RNA was therefore isolated from a human PBMC sample and, following cDNA synthesis, PCR was used to clone the coding sequence of hIL-8 (figure 6.2). The cloned PCR product was verified by sequencing prior to proceeding with the cloning strategy. The nucleotide and amino acid sequence of hIL-8 used in this construct is shown in appendix 29. The hIL-8 coding sequence was inserted into an expression cassette that uses rabbit beta globin derived intronic and polyA sequences, at the 5' and 3' ends of the cassette respectively, to aid correct processing and mRNA 222 stability of the gene of interest. The hIL-8 sequence replaced the coding sequence of Hen Egg Lysoszyme (HEL) and the antigen PLP 56-70, used in a previous construct (chapter 5). Removal of the HEL/PLP sequence and insertion of hIL-8 required the use of the restriction enzyme EcoRl. An endogenous EcoR1 restriction site is present at the 3' end of the hIL-8 sequence and so a single base pair mutation (T-->C) was introduced by PCR at the time of cloning from cDNA such that there was no change in amino acid sequence of the protein but that the EcoRl site was destroyed. Joining of the lung specific CC10 promoter to the hIL-8 expression cassette was by directional cloning using BamHI and XbaI restriction enzymes. The final construct was checked by restriction digest (figure 6.2) and also by sequencing. The complete sequence of the lung targeted hIL-8 transgene is shown in appendix 28. A plasmid map of the construct is shown in appendix 16. Bacterial sequences were removed from the construct, prior to pronuclear injection, by digestion of the construct with Xho I and purification of the upper 3930 bp band. This injection fragment is shown in figure 6.2. 223 Endogenous EcoR1 site destroyed by point Xba 1 EcoRl BamHl EcoRl EcoRl hIL-8 mutation Xho 1 cDNA (a) 40-• • • I I \-7(-1 Rabbit beta HEL cDNA PolyA tail EcoR1 globin intron hIL-8 cDNA cloned into rabbit beta globin expression cassette using EcoR1 Xba 1 Xbal BamH1 EcoR1 EcoRl (b) Xhol BamHl Xho 1 I IL-8 I CC 10 promoter I MA I Fragments joined using BamHl and Xbal (c) Xbal Xho 1 B amH 1 EcoRl EcoRl Xhol IL-8 CC I 0 promoter Construct linearised for injection using Xhol Figure 6.1 A schematic diagram of the cloning strategy used to create the lung targeted hIL-8 transgene. (a) Human IL-8 cDNA was cloned from human PBMC cDNA using PCR primers specific for IL-8 (IL-8F and IL-8R) modified to contain EcoR1 sites at each end of the transcript and to destroy an endogenous EcoRl site. The point mutation (T—>C) did not alter the amino acid sequence of the protein. (b) hIL-8 cDNA was inserted into a rabbit beta globin expression cassette using EcoRl. (c) The rabbit beta globin expression cassette containing hIL-8 cDNA was joined to the lung specific promoter of CC10, contained in the shuttle vector pBluescriptII, using BamHl and Xbal. Bacterial sequences were removed from the vector, by digestion with Xhol, prior to pronuclear injection. 224 (a) (b) tase ip transcr e bp 0 bp ..z revers o 6000 —Ow 2000 —010- 4000 —11,- 3000 —10' 1000-10. 750 2000 --110- 500 1500 250 1 000 --Ow t (c) men frag ion bp t jec In 4000 2000 Figure 6.2 Cloning of human IL-8 cDNA into a lung targeted expression construct (a) The coding sequence of human IL-8 was cloned by PCR from human PBMC cDNA. The cloned PCR product inserted into a lung expression construct containing the rat lung specific promoter, CC10, and intronic sequence from rabbit beta globin. (b) The final construct was verified by restriction digest. A BamHI/XbaI digest gives expected restriction fragments of 5516 bp and 1500 bp. A XhoI digest gives expected restriction fragments of 3930 bp and 3086 bp. (c) Bacterial sequences were removed from the construct prior to pronuclear injection by digestion of the construct with XhoI and purification of the upper 3930 bp band. 225 6.2 Identification of lung targeted hIL-8 transgenic founder animals. The lung targeted hIL-8 construct was injected into FVB/N oocytes at the Nuffield department of Medicine in Oxford. 36 potential founder animals were screened for the presence of the hIL-8 transgene. An initial PCR screen, using gDNA extracted from tail biopsy, identified 2 founder animals (figure 6.3). These animals are subsequently referred to as hIL-8 line 19 and line 33 based on numbers assigned to each animal at the point of tail biopsy. Following the PCR screen, the transgenic status of animals 19 and 33 was confirmed by Southern blotting (figure 6.3). EcoRV was the restriction enzyme selected to cut genomic DNA used for Southern blotting, as this enzyme cleaves the transgene only once. The Southern blot for hIL-8 lines 19 and 33 show that in both lines the transgene has integrated at more than one locus. These integration sites are represented by bands that are differential between the two transgenic lines. The EcoRV restriction site is located 2473 bp from the 5' end of the transgene. The intense band present in both lanes represents multiple copies of the transgene that have inserted as head to tail concatamers at one or more of the integration loci. The sequence and product sizes of all PCR and Southern primers used for screening of lung targeted hIL-8 transgenic founder animals are shown in appendix 8. Both transgenic founders were subsequently bred with C57BL/6 animals to obtain lung targeted hIL-8 transgenics for further analysis. 226 1L-8F CC101500F IL-8 (a) CCIO promoter CC1021001R. IL-8R (b) -o Potential founders 20 - 32 34-36 bp o 1000 750 --10- 500 —10- 250 —÷ r de der n n fou fou z 19 33 oc (c) ine L Line EcoRV CC I 0 IL-8 600bp DIG labelled probe Figure 6.3 Identification of lung targeted hIL-8 transgenic founder animals. Transgenic founders were identified by PCR and by Southern blot. The location of primers used for PCR screening (IL-8F and IL-8R) and for generation of the Southern probe (CC101500F and CC102100R) are shown in (a). Two transgenic animals were identified from an initial PCR screen of 36 potential founders (b). The transgenic status of these animals (numbers 19 and 33) was then confirmed by Southern blot (c), using rat genomic DNA as a positive control for the CC10 sequence. The restriction enzyme used to digest genomic DNA for Southern blotting was EcoRV. This enzyme only cuts the integrated construct once, on the 3' side of the CC10 promoter region being used as a probe (c), giving information about construct integration sites and copy number. 227 6.3 Determination of lung specific hIL-8 transgene expression. The lung specific promoter used in the transgene is derived from the rat CC10 gene and should direct expression of the gene of interest (hIL-8) in epithelial cells lining the trachea, bronchi and bronchioles of the murine lung (Stripp et al., 1992). PCR was used to determine the presence of hIL-8 cDNA transcripts in lung tissue from both hIL-8 transgenic lines (figure 6.4). No hIL-8 cDNA transcripts were detected in lung tissue from littermate control animals. In line 33 animals, hIL-8 cDNA transcripts were only detected in the lung. In line 19, very low levels of hIL-8 transcripts were also detected in brain tissue. The CC 10 sequence used in this transgene is well characterised as a promoter for lung specific expression of a target gene. Expression of hIL-8 cDNA transcripts in brain tissue is therefore unlikely to be driven by this promoter. The observation of hIL-8 transcripts in brain tissue from line 19 but not line 33 suggests that in line 19, one or more copies of the transgene has integrated close to a strong promoter that is active in the brain. The data shown in figure 6.4 demonstrates that hIL-8 cDNA transcripts are present in lung tissue of both hIL-8 transgenic lines. Real-time PCR was then used to investigate whether there was a difference in relative levels of transcripts between line 19 and line 33 (figure 6.5). The data shows that line 19 animals have a greater number of hIL-8 cDNA transcripts in the lung compared to line 33 animals (P = 0.0005). A difference in level of hIL-8 expression between the two lines was also observed at the level of protein. hIL-8 levels in bronchoalveolar lavage (BAL) fluid (P = 0.0005) and in lung homogenate (P = 0.0098) were higher in line 19 than in line 33. The BAL data also confirms that the hIL-8 protein is being secreted by the lung cells expressing the transgene, and failure to detect any hIL-8 protein in serum samples from these animals suggested that the secreted hIL-8 protein remained in the local lung environment and was not present in the peripheral circulation. Activity of the rat CC10 promoter has been shown to be localised to bronchial epithelial cells of the lung rather than lung alveoli. This pattern of expression for the transgenic hIL-8 protein was confirmed for both lines of mice using immunohistochemistry (figure 6.6). In keeping with the cDNA transcript and protein data shown in figure 6.5, more IL-8 staining was observed in lung sections 228 from line 19 animals. However, for both lines, IL-8 staining was patchy suggesting that, at any one time, the transgene is not being expressed by all bronchial epithelial cells in the lung. 229 (a) Line 19 bp 750 —10. 500-0. 18s IL-8 250-0. ine t r=4 (b) Line 33 0 tes 0 >, 0 • ll in 0 $...▪ . - 0 a 0 0 cat -0 by 0 a. z V) 6-..i Sm -4—I8s o o O 0 (c) Litterm ate • —• •• 4-.> o - • • —• .0 •—• tao bp 77-1) E " E Figure 6.4 Tissue specific expression of hIL-8 in both transgenic lines. (a) and (b) RNA was isolated from a range of different tissues, and primers specific for hIL-8 cDNA (IL-8F and IL-8R) were used to demonstrate lung specific expression of the transgene in both transgenic lines. cDNA reactions where no reverse transcriptase (RT) enzyme had been included were used as negative controls to ensure that any PCR product seen was not due to genomic DNA carried over during the RNA isolation procedure. (c) No hIL-8 transcripts were detectable in littermate control samples. Primers specific for 18s RNA (Ambion-1716) were used as an internal control for each sample. (a) Low levels of hIL-8 expression were also detected in brain tissue from line 19. Gels shown are representative of 3 animals per group. 230 * * * (a) ion ss re RNA exp m ive t la re Line 19 Line 33 LittermI ates (b) (c) * * * * * 10000- 1200 1000 _ 7500- --.. E 800 E. a) 7:1) a. 5000- ra. 600 c° J_ _1 400 2500- 200 0 I 0 Line 19 Line 33 Littermates Line 19 Line 33 Littermates Figure 6.5 Levels of hIL-8 cDNA transcripts and hIL-8 protein in the lung of both lines of hIL-8 transgenic mice. (a) Real-time PCR was used to compare levels of hIL-8 cDNA transcripts in lung tissue from hIL-8 line 19 and line 33 transgenic animals. Levels of IL-8 protein in BAL fluid (b) and lung homogenate (c) were determined by ELISA. hIL-8 cDNA transcripts and protein were both shown to be more abundant in lung tissue from line 19 animals. Data shown represent means + SE for each group. n = 9 for line 19, n = 11 for line 33, n = 8 for littermate controls. Statistical significance of differences between line 19 and line 33 were tested using a Mann-Whitney U test. ** P < 0.01, *** P < 0.001. 231 CC10 hIL-8 Secondary antibody only Line 19 bronchi Line 33 alveoli Littermatc Figure 6.6 hIL-8 expression is confined to bronchial epithelial cells of the lung in both lines of transgenic mice. Inflated lung sections from line 19, line 33 and littermate control mice were stained using primary antibodies specific for the CC10 protein and hIL-8. Staining was visualised using a peroxidase based immunohistochemistry protocol. CC10 staining was observed in bronchiolar epithelial cells of all mice. hIL-8 staining was observed in some bronchiolar epithelial cells of lungs from both lines of transgenic animals while no staining was observed in littermate control samples. More staining was observed in samples from line 19 animals than from line 33. Images shown are representative of staining observed for more than 5 animals per group and are x20 normal magnification. The main structures of the lung are marked. 232 6.4 Lung function and lung cell infiltrate in lung targeted hIL-8 transgenics. Having established lung specific expression of hIL-8 in both lines of transgenic mice, the impact of constitutive expression of hIL-8 in the murine lung on lung function and lung cell infiltrate was investigated. hIL-8 is a neutrophil chemoattractant and the ability of hIL-8 to be chemotactic for the neutrophils of other species, including mouse, has previously been demonstrated (Rot, 1991). Analysis of the numbers and types of cells infiltrating both the BAL and lung of hIL-8 transgenic and littermate animals revealed that while the total number of cells in the lung was not elevated in the presence of hIL-8, the percentage of infiltrating cells that were neutrophils was significantly increased (figure 6.7). The observed increase in the percentage of neutrophils infiltrating the lung was greatest in line 19 animals (P = 0.0002), the line previously shown to be expressing the highest levels of the hIL-8 protein, although a significant difference was also seen in the lavage of line 33 animals (P = 0.0345). The percentage increase in neutrophils was most apparent in the BAL, as in normal healthy animals most cells recovered from BAL are macrophages and the percentage of cells that are neutrophils is very low. However, in the lung, where normally at least 50 % of cells are neutrophils, the percentage increase in neutrophils in the lungs of hIL-8 line 19 transgenic animals was still significant (P = 0.0091). Staining of inflated lung sections with an antibody against myeloperoxidase (MPO), an enzyme that serves as a specific marker for neutrophils (Schmekel et al., 1990), confirmed increased numbers in line 19 animals, but also showed the location of neutrophils in the lung tissue of these animals to be clustered around bronchi and blood vessels compared to a more diffuse pattern of staining seen for line 33 and littermates (figure 6.8). When consecutive lung sections from line 19 animals were stained with antibodies against hIL-8 and myeloperoxidase, areas of neutrophil clustering next to bronchi were seen to be associated with areas of intense hIL-8 staining (figure 6.8). The clustering of cells around some airways and blood vessels in the lungs of line 19 animals was also evident from the staining of lung sections with Haemotoxylin and Eosin (H+E). This stain does not allow the different types of cells infiltrating the lung to be distinguished, but when a general inflammatory scoring system was used, mild inflammation was 233 evident around some bronchi and vessels in the lungs of line 19 animals, compared to very little or no inflammation in the lungs of line 33 or littermate mice (figure 6.9). Mice used to examine cell infiltrates and lung pathology in hIL-8 transgenics compared to littermates were 20 to 30 weeks in age and despite some evidence of mild inflammation around bronchi and blood vessels of the transgenic line expressing the highest levels of hIL-8, lung histology by H+E staining showed no evidence of other lung pathology. Lung diseases associated with high levels of IL-8 such as asthma and chronic obstructive pulmonary disesase (COPD) (Nocker et al., 1996) are also invariably associated with altered lung function (Cherniack, 1956). The three main measurements of lung function used routinely in other mouse models of lung disease, bronchial hyperreactivity (Penh), resistance and compliance were measured in the hIL- 8 transgenic lines and littermate animals. Neither hIL-8 transgenic line showed any difference, compared to littermates, in bronchial hyperreactivity or airway resistance in response to the muscarinic receptor agonist methacholine (figure 6.10). However, line 19 animals and to a lesser extent, line 33 animals showed decreased airway compliance compared to littermates although the difference was not statistically significant. 234 (a) BAL Lung 10.0 100-, ) 4) 4 10 10 7.5- 75- (x (x ber ber 5.0- 50- ll num ll num 2.5- 25- ce ce 0.0 0 Line 19 Line 33 Liftamates Line 19 Line 33 Littermates * * * (b) * * * 40- 75- -J 01 C Ca 30- •_ 50- o .c 20- * C. a.0 0 25- 10- o C FTTI 0 Line 19 Line 33 Littamates Line 19 Line 33 Littermates Figure 6.7 Baseline cell infiltrates in the lungs of IL-8 transgenics and littermate animals. (a) The total number of cells recovered from the bronchoalveolar lavage (BAL) and whole lung lobe of IL-8 transgenic and littermate mice were determined by cell counting. (b) Differential cell counts of cytospins from BAL and lung were used to determine the percentage neutrophils in each sample. Mice used were 20-30 weeks of age and the data shown represents the mean values for 9 animals for line 19, 11 animals for line 33 and 8 littermate animals + SE. The statistical significance of differences between line 19, line 33 and littermate groups were tested using a Mann- Whitney U test. * P <0.05, ** P < 0.01, *** P < 0.0005 235 3 (a) =lbronchi score 2 =vessels O MP e verag a 0 Line 19 Line 33 Littermate (b) Line 19 Line 33 Littermate (c) IL-8 Myeloperoxidase Figure 6.8 Neutrophil staining by immunohistochemistry of lung sections from IL-8 transgenic and littermate animals. Inflated frozen lung sections from IL-8 transgenic and littermate control animals aged 20 -30 weeks were stained using a primary antibody specific for the neutrophil marker myeloperoxidase. Staining was visualised using a peroxidase based immunohistochemistry protocol. (a) The number of neutrophils surrounding bronchi and blood vessels in each section were assessed using an inflammatory score system (appendix 30). The data is presented as a mean value + SE for each group and represents 9 line 19, 9 line 33 and 3 littermate animals. The statistical significance of differences between transgenic and littermate groups was tested using a Mann-Whitney U test. *P <0.05, **P <0.005. (b) Line 19 animals were found to have a greater number of neutrophils around both bronchi and blood vessels compared to line 33 and littermate animals. (c) Staining of consecutively cut sections with myeloperoxidase and IL-8 antibodies showed a relationship between clustering of neutrophils around bronchi and secretion of IL-8 by bronchial epithelial cells in line 19 animals. All photos are x20 normal magnification. 236 (a) re 3 =J bronchi sco =vessels ion t 2 flamma in e averag 0 line 19 line 33 littermate (b) Line 19 Line 33 Littermate Figure 6.9 Mild inflammation in line 19 transgenics compared to line 33 and littermate animals. Inflated frozen lung sections from IL-8 transgenic and littermate animals aged 20-30 weeks were stained with Haematoxylin and Eosin (H+E). (a) Cell infiltrates around bronchi and blood vessels were assessed using an inflammatory score system. Data is presented as mean values per group + SE and represents 9 line 19, 9 line 33 and 3 littermate animals. The statistical significance of differences between groups was tested using a Mann-Whitney U test. ** P < 0.01. (b) Lung sections from line 19 animals showed evidence of mild cell infiltrates around some bronchi and vessels. Very few or no cell infiltrates were present in the lung sections from line 33 and littermate animals. All photos are x20 normal magnification. 237 (a) 25 50 75 100 Methacholine (mg/ml) (b) (c) 0.020 6 o cu 0 0.015 c cs • 4 a 0.010 o ctU 2 0.005 0.000 25 50 75 100 0 25 50 75 100 Methacholine (mg/ml) Methacholine (mg/ml) Figure 6.10 Lung function of IL-8 transgenic and littermate animals. Mice aged 20-30 weeks were used to obtain Penh (a), resistance (b) and compliance (c) lung function measurements for IL-8 transgenic and littermate animals. Penh data shown is shown as mean values for 14 line 19 (0), 16 line 33 (A) and 8 littermate animals (0) + SE and is representative of three independent experiments. Resistance and compliance data is shown as mean values for 4 line 19, 5 line 33 and 3 littermate animals + SE and is representative of a single experiment. 238 6.5 Investigation of the impact of hIL-8 expression in the murine lung during ovalbumin induced lung inflammation. Lung data obtained for the hIL-8 transgenic lines thus far was obtained in the absence of any external inflammatory stimulus. To examine the effect of hIL-8 expression in the lung, in the context of an inflammatory response, an ovalbumin (OVA) model of lung inflammation was used. Mice used for this experiment were 20-30 weeks in age and were sensitised to OVA antigens by intra-peritoneal (i.p) injection of OVA, using alum as an adjuvant. Control mice received PBS and alum. All mice were then exposed to aerosolised OVA for 5 consecutive days before analysis of lung function and lung tissue. Lung function measurements showed greater bronchial hyperreactvity, greater resistance and reduced compliance in OVA sensitised mice compared to controls, but differences were small and not statistically significant (figure 6.11). In the OVA sensitised groups no significant differences were observed between transgenic and littermate control animals for Penh, resistance or compliance measurements. Line 33 OVA sensitised animals appeared to show increased resistance compared to line 19 and littermate controls but this difference did not reach statistical significance. However, of note was an apparent difference in bronchial hyperreactivity between hIL-8 transgenic and littermate animals that had received just alum as part of the sensitisation protocol. hIL-8 transgenic animals showed increased bronchial hyperreactivity compared to littermate controls with the difference reaching statistical significance in the case of line 33 animals (P=0.0159) (figure 6.11). Despite the lack of significant changes in lung function between OVA sensitised and alum control groups upon antigen challenge, there were differences in lung cell infiltrates and pathology. Figure 6.12 shows differential cell counts for BAL and lung in all groups. In the BAL of control mice, dominant cell types were macrophages and lymphocytes although some neutrophils and eosinophils were also present. The percentage of neutrophils in the BAL of these animals followed the same pattern as seen previously in the absence of any antigen challenge, with the greatest percentage in the line 19 hIL-8 transgenic group. This was also true in the BAL of mice 239 sensitised to OVA, although in all groups of OVA sensitised mice, the dominant cell type was the eosinophil and actual neutrophil numbers found in the lung were not greatly increased. In the lung tissue of control mice the most dominant cell type was the neutrophil. Again, the greatest percentage was in the line 19 hIL-8 transgenic group, although this was not the case in lung tissue of mice sensitised to OVA. In all OVA sensitised groups, the dominant cell type was the eosinophil, numbers of which were greatly increased compared to controls. The number of neutrophils in the lungs of these mice remained largely unchanged even in hIL-8 transgenic lines. Inflammation scores for H+E and myeloperoxidase (MPO) (figure 6.13) stained lung sections from all groups of mice revealed significant differences in severity of inflammation and pathology between control and OVA sensitised groups, but very little difference between hIL-8 transgenic groups and littermates. The biggest, although not statistically significant difference, was in the H+E inflammation scores of bronchi and vessels for the hIL-8 line 33 transgenic control group which appeared to show a greater degree of mild inflammation. However, the same trend was not observed in the MPO inflammation score and so any differential inflammation that may be present in this group is not due to neutrophils. Equivalent inflammation by H+E and MPO staining was seen around the bronchi and blood vessels in all groups of OVA sensitised animals. Periodic Acid Schiff (PAS) staining was also performed. PAS is used to identify cells containing high levels of glycoproteins. Glycoproteins known as mucins are the major component of mucus which is secreted by airway epithelial goblet cells (Rogers 1994). Unlike in humans, goblet cells are not found in murine airways in the absence of an inflammatory stimulus (Pack et al., 1981), however, goblet cell mucus hypersecretion is a common characteristic of airway inflammation in both species. PAS staining of lung tissue from hIL-8 transgenic and littermate animals following OVA challenge showed increased numbers of mucus secreting globlet cells in the airways of hIL-8 transgenic animals in both control and OVA sensitised groups compared to littermates (figure 6.14). No mucus secreting cells at all were found in the airways of littermate 240 control animals and while OVA sensitisation and challenge did induce globlet cell mucus secretion in some airways of littermate animals, the number of airways secreting mucus and the average number of globlet cells in each airway was greater in hIL-8 transgenic animals. Statistical significance was not reached with this data however, and so further experiments are necessary. 241 (a) —N— Line 19 OVA —o— Line 33 OVA —*— Littermate OVA —a— Line 19 Alum —o— Line 33 Alum —it— Littermate Alum 0 25 50 75 100 Methacholine (mg/ml) (b) 10 8 nce 6 ta is 4 Res 2 0 0 25 50 75 100 Methacholine (mg/ml) (c) 0.020 0.015 c., c co Q 0.010 E 0 0 0.005 0.000 0 25 50 75 100 Methacholine (mg/ml) Figure 6.11 Lung function measurements in IL-8 transgenic and littermate animals following ovalbumin sensitisation and challenge. Mice were sensitised to ovalbumin by i.p injection of ovalbumin and alum on days 0 and 12. Control mice received PBS and alum. All mice received an ovalbumin aerosol on days 19, 20, 21, 22 and 23. (a) Penh lung function measurements were obtained on day 24. Resistance (b) and compliance (c) measurements were obtained on day 25. Data shown represents mean values for a minimum of 3 animals per group + SE. 242 BAL 'Lung (a) 100- co NM. 80- I Neutrophils =Eosinophils Macrophages 5553 Lymphocytes 111111 .111 — 0 4111 Line 19 Line 33 Littermate Line 19 Line 33 Littermate Line 19 Line 33 Littermate Line 19 Line 33 Littermate PBS OVA PBS OVA (b) 400 300 Neutrophils 300 =Eosinophils 71- cV 200 =Macrophages -0 200 _o 5553 Lymphocytes E E •e 100 = 100 a) V Line 19 Line 33 Littermate Line 19 Line 33 Littermate Line 19 Line 33 Littermate Line 19 Line 33 Littermate PBS OVA PBS OVA Figure 6.12 Differential BAL and lung cell counts from IL-8 transgenic and littermate animals following ovalbumin sensitisation and challenge. Cytospins of BAL and lung cells were stained with Wright Geimsa and numbers of neutrophils, eosinsophils, macrophages and lymphocytes counted in each sample. The percentage of each cell type (a) was calculated and converted to a total number of cells in BAL or lung (b) by multiplying the cell percentage by the total number of cells isolated for each sample. Data shown represents a minimum of 3 animals per group and is presented as a mean value for the group ± SE. (a) (b) e 3- 3 cor =lbronchi s ion =vessels t 2- 2 MPO score flamma e 1- 1 in e Averag averag 0 0 Line 19 Line 33 Littermate Line 19 Line 33 Littermate Line 19 Line 33 Littermate Line 19 Line 33 Littermate PBS OVA PBS OVA (c) bronchi Line 19 Line 33 Littermate PBS blood vessels OVA Figure 6.13 Lung inflammation in OVA sensitised and challenged IL-8 transgenic and littermate animals. IL-8 transgenic and littermate animals were sensitised by i.p injection of OVA and alum on days 0 and 12. Control mice received PBS and alum. All mice were challenged with aerosolised OVA on days 19 to 23. Lung tissue was harvested on day 25 and frozen lung sections stained with H+E (a) or an antibody specific for the neutrophil marker myeloperoxidase (b). Cell infiltrates around bronchi and blood vessels were assessed using an inflammatory score system (appendix 30). Data is presented as mean values per group ± SE and represents a minimum of 3 animals per group. The statistical significance of differences between groups was tested using a Mann-Whitney U test. (c) H+E stained lung sections from line 33 PBS control animals showed evidence of mild cell infiltrates around some bronchi and vessels but equivalent inflammation was seen in lung sections from all groups of OVA sensitised animals. 244 (a) 2 AS score P e 1 erag av 0 Line 19 Line 33 Littermate Line 19 Line 33 Littermate PBS OVA (b) Line 19 Line 33 Littcrmate PBS OVA Figure 6.14 Prevalence of mucus secreting goblet cells in inflated lung sections from OVA sensitised and challenged IL-8 transgenic and littermate animals. IL- 8 transgenic and littermate animals were sensitised by i.p injection of OVA and alum on days 0 and 12. Control mice received PBS and alum. All mice were challenged with aerosolised OVA on days 19 to 23. Lung tissue was harvested on day 25 and frozen lung sections stained with PAS to identify mucus secreting goblet cells (bright purple staining). (a) A score system based on the percentage of each airway containing goblet cells was used to assess the prevalence of goblet cells in each sample. Data is presented as mean values per group + SE and represents a minimum of 3 animals per group. The statistical significance of differences between groups was tested using a Mann-Whitney U test. (b) Small numbers of goblet cells were found in the airways of PBS control IL-8 transgenic animals. In animals that had been sensitised to OVA, goblet cells were most prevalent in the airways of line 19 animals and the least prevalent in the airways of littermate animals. 245 Discussion IL-8 is a CXC chemokine with potent chemoattractant properties. It is secreted by many different cell types including T cells, neutrophils and NK cells, as well as by somatic cells such as endothelial cells, fibroblasts and epithelial cells. It acts predominantly to recruit and activate neutrophils at sites of infection or injury and high levels of IL-8 have been detected in a variety of disease states including lung diseases such as cystic fibrosis, bronchiecstasis, COPD and asthma. There are currently no reports in the literature of human IL-8 having been overexpressed in the mouse lung, but the reported associations between high levels of this protein and disease and increasing evidence for neutrophil independent roles of this cytokine in disease processes make IL-8 an attractive target for transgenesis. Data presented in this chapter has described the generation of two mouse lines with lung targeted expression of human IL-8 and initial basic characterisation of their phenotype. The IL-8 transgene created for this study contained the human IL-8 (hIL-8) cDNA sequence, intronic and polyA sequences from the rabbit beta globin protein and the rat lung specific CC10 promoter. Two founder animals carrying this transgene were identified by PCR and southern blot, which revealed both lines to be carrying multiple copies of the transgene at multiple integration loci. Transgene expression levels in each line were assessed by PCR, ELISA and antibody staining. Each revealed line 19 animals to be expressing higher levels of hIL-8 than those of line 33 and in both lines expression was restricted to lung tissue, although in line 19 low levels of expression were also detected in the brain. The CC10 promoter has been used extensively in lung targeted transgenesis and is well characterised as a lung specific promoter whose activity is restricted to Clara cells of the airway epithelium (Hagen et al., 1990). The promoter regions surrounding the CC10 gene that confer lung specific expression have been characterised (Stripp et al., 1992) and while exactly how this tissue specific expression is achieved is not yet completely understood, negative regulators thought to repress CC10 expression in non-Clara cells have been identified (Navab et al., 2002). There are no reports in the literature of the CC10 protein being expressed, or the CC10 246 promoter being active, in brain tissue and so the low levels of expression found in the brain tissue of line 19 animals are most likely to be due to position effects at the site of transgene integration in this line. Brain expression of IL-8 in line 19 animals was not explored further in this study, but it may be worthwhile to do so in the future. IL-8 is known to be expressed by neural cells, such as microglia, and upregulation has been associated with some inflammatory pathologies in the brain, such as that mediated by the amyloid beta peptide in Alzheimer's disease (Walker et al., 2006). Whether constitutive hIL-8 expression in brain tissue of these mice causes any kind of inflammatory cell recruitment or other pathology to be observed may therefore be of interest. Different integration loci between the two lines are also the most likely explanation for the higher levels of expression seen in line 19 compared to line 33 and that transgene expression can be affected by the flanking 5' and 3' chromosomal regions at an integration locus has been well documented (Cranston et al., 2001). Although immunohistochemical staining of inflated lung sections demonstrated that lung expression in both lines was restricted to the bronchial epithelium, expression patterns in both lines were patchy. This may reflect the impact of 5' and 3' chromosomal regions on the activity of the transgenic CC10 promoter or perhaps suggests that some elements that control endogenous CC10 gene expression are missing from the sequence used in the transgene. The CC10 protein, also known as the Clara cell secretory protein (CCSP) is the predominant protein product of Clara cells (Patton et al., 1986) and has been proposed to function as a downregulator of airway inflammation. Indeed, altered levels of this protein have been associated with some lung diseases, such as sarcoidosis, where lower levels of the CC10 protein in serum and in BAL were found in patients with progressive compared to regressive disease (Shijubo et al., 2000). However, inflammatory cytokines are also major secretory products of the bronchial epithelium with lung insults or infection being potent inducers of production. For example, exposure to cigarette smoke, the main known cause of COPD, is known to induce high levels of IL-8 production by human bronchial epithelial cells (Mio et al., 1997) and recently the bacterial compound LPS was found to induce production of the murine IL-8 homologue KC in Clara cells 247 (Elizur et al., 2007). IL-8 expression therefore constitutes a normal function of the airway epithelium. As discussed previously, the major function of IL-8 is in mediating chemoattraction and activation of leukocytes, particularly neutrophils. That hIL-8 is able to mediate chemotaxis of mouse neutrophils has been described (Rot, 1991) and although mice do not possess an IL-8 gene, murine proteins with potent neutrophil chemoattractant properties which bind the murine CXCR2 receptor have been identified (Bozic et al., 1994). The murine CXC chemokine KC has been overexpressed in the murine lung under the control of the CC10 promoter and has been reported to result in enhanced neutrophil migration within the lungs of transgenic animals, although the neutrophils were not activated and no tissue damage was apparent (Lira, 1996). Given that mouse neutrophils can respond to hIL-8 and the similarities in function between KC and IL-8, it might be predicted that overexpression of hIL-8 in the lungs of the two mouse lines described in this study would also result in elevated numbers of neutrophils in the lungs of these animals. Differential cell counts from BAL and lung tissue of IL-8 transgenic and littermate animals showed that IL-8 expression in the mouse lung did result in an increased percentage of neutrophils in the lungs of transgenic animals and this increase was observed to be the greatest in line 19 animals, the line also reported to have the highest levels of IL-8 protein expression. However, perhaps unexpectedly, no real differences were observed in terms of absolute cell numbers, although scoring of transgenic and littermate inflated lung sections did suggest that some bronchi and vessels showed signs of inflammation with the degree of inflammation being the greatest in the lungs of line 19 animals. Although no large infiltrates of neutrophils were observed in either line, the increased percentage of neutrophils in both BAL and lung tissue suggests that the hIL-8 expressed by the lung epithelial cells in this model is biologically active. This was also implied by immunohistochemistry staining for neutrophils in inflated lung sections where areas of neutrophil clustering in the lungs of transgenic mice were found to be associated with areas of greatest IL-8 protein expression. This suggests that hIL-8 can indeed bind to and activate the CXCR2 receptor expressed by murine neutrophils and as expression is limited to bronchial 248 epithelial cells, the IL-8 protein secreted into airways of these mice is likely to be capable of endothelial transcytosis in order to mediate neutrophil recruitment from vessels into the lung tissue and BAL fluid. This is also supported by studies in which recombinant hIL-8 has been administered directly into an organ and neutrophil infiltration reported (Singer and Sansonetti 2004). However, this study by Singer and Sansonetti, which reports colitis type pathology in mice given intracolonic rhIL-8 concomitantly with bacterial infection, also reports a lack of pathology or infiltrate when rhIL-8 was administered alone. The authors speculate that lack of neutrophilic infiltrates in mice given rhIL-8 alone may be due to the short half life of the protein in the gut or due to a low affinity for murine CXCR2 compared to the murine homologues, KC and MIP-2. In relation to the data presented in this chapter, where expression of hIL-8 in the lung results in only mild inflammatory cell infiltrates, short half-life of the protein is an unlikely explanation as IL-8 expression is constitutive. However, it is possible that low affinity binding of hIL-8 to the mouse CXCR2 receptor means that much higher levels than those reported in lines 19 and line 33 of this study would be required to mediate infiltration of large numbers of neutrophils into the lung. This hypothesis is supported by the increased percentage of neutrophils found in BAL and lung of line 19 animals compared to the lower expressing line 33 and the increased numbers of neutrophils and greater levels of lung inflammation found in BAL and lung of some, although not all, line 19 animals. However, an alternative explanation, which also has some support in the literature, is that constitutive expression of the IL-8 protein results in downregulation of trafficking, perhaps though altered adhesion molecule expression or reduced expression of the chemokine receptor itself on the surface of circulating leukocytes. In support of reduced neutrophil chemotaxis, a recent study of neutrophils from COPD patients who also display high levels of IL-8 protein in the lung over long periods of time, found COPD patient neutrophils to have reduced chemotactic responsiveness compared to cells from healthy controls (Yoshikawa et al., 2007). Although there are no previous reports of hIL-8 overexpression in the mouse lung, hIL-8 has been targeted to other organs. The first report of a hIL-8 transgenic mouse described hIL-8 under the control of a liver specific promoter (Simonet et al., 1994). In this study by Simonet et al. high 249 levels of circulating neutrophils in the peripheral blood were observed, but neutrophil migration in response to localised administration of rhIL-8 was impaired. It is of note that concentrations of rhIL-8 used in this study to induce local neutrophil trafficking when given intraperitoneally are similar and often lower than those used by Singer and Sansonetti, (2004) intracolonically, where no infiltrates were reported, suggesting that mechanisms dictating levels of neutrophil trafficking may be different depending on the site of IL-8 administration. In the transgenic study by Simonet et al. where impaired neutrophil migration was reported, peripheral blood neutrophils were found to have reduced levels of the adhesion molecule L-selectin. L-selectin is an important mediator of neutrophil recruitment as it supports rolling of leukocytes along the vascular endothelium. Downregulation of this molecule was proposed to be mediated by the long term elevation of hIL-8 in the serum of these transgenic mice. With constitutive expression of hIL-8 in the lungs of the two IL-8 transgenic lines described in this chapter, that some IL-8 protein may reach the peripheral circulation is not implausible and may have meant that a similar mechanism of adhesion molecule downregulation was occurring. However, there were no detectable levels of hIL-8 protein in serum from either transgenic line described in this study. Other studies have described receptor desensitisation as a mechanism of reducing neutrophil migration (Wiekowski et al., 2001b). In this study by Wiekowski et al. inducible expression of KC was targeted to many different tissues using the chicken beta actin promoter. No inflammatory cell infiltrates were observed in any organ expressing KC and CXCR2 mediated signals were found to be attenuated in peripheral blood neutrophils compared to cells from non transgenic animals. In keeping with the study by Simonet et al. high levels of KC were detectable in serum, a finding not consistent with data obtained from the lung targeted hIL-8 mice described in this study. However IL-8 is known to regulate receptor expression on the cell surface (Samanta et al., 1990) and the observation of downmodulation of CXCR1 and CXCR2 on peripheral blood and also sputum neutrophils from COPD and asthmatic patients suggests that high levels of local as well as systemic IL-8 protein may be able to mediate this mechanism of regulation (Pignatti et al., 2005). To determine the reason for the lack of inflammatory cell infiltrates in the mice described in this chapter several different 250 approaches are possible. If concentration of hIL-8 is the issue then intranasal administration of rhIL-8 should induce neutrophil trafficking into the lungs of these mice. However, additional evidence against this hypothesis includes a report into the effects of rhIL-8 in guinea pigs where intranasal administration of this protein induced bronchoconstriction but with no evidence of leukocyte accumulation (Fujimura et al., 1999). Additionally, peripheral blood neutrophils and indeed neutrophils from the lungs of these animals should migrate normally to rhIL-8 in in vitro chemotaxis assays. If neutrophil migration has in some way become impaired, through the constitutive expression of IL-8 over a long period of time, then in vitro neutrophil chemotaxis should also be impaired. In addition you would expect neutrophils transferred from a non transgenic animal to traffic normally to the lung in response to IL-8 expression there. Analysis of the cell surface expression levels of adhesion molecules such as L-selectin, CD11 b and CD11c and the CXCR2 receptor on neutrophils from these transgenic animals would also be of interest as would intranasal administration of KC or MIP-2 to determine whether impaired migration is also in response to endogenous CXC chemokines. Although at a baseline level, neutrophil accumulation in the lungs of both line 19 and line 33 transgenic animals is not induced or is impaired, other studies have reported that even when neutrophils are recruited in response to overexpression of CXC chemokines, they do not appear to be activated (Lira, 1996 and Kucharzik et al., 2005). Further experiments presented in this chapter attempted to determine whether patterns of neutrophil recruitment would be different between transgenic and littermate animals in the context of an inflammatory response. The well characterised ovalbumin model of allergic airway inflammation was used in this study as it is a potent inducer of inflammation in the lung and although neutrophilic infiltrates and elevated IL-8 levels are a common feature of chronic asthma, the inflammation observed in the ovalbumin model is predominantly eosinophilic. Any subtle changes in neutrophil infiltration into the lungs of the IL-8 transgenic mice of this study should therefore be more apparent, but the effect of hIL-8 on the other disease outcome measures of this model of asthma could also be measured. However, despite seeing 251 the same increased percentage of neutrophils in the BAL of transgenic animals compared to littermates as was reported previously in the baseline data, no significant increase in neutrophil numbers was observed in any group following sensitisation and exposure to ovalbumin. In both transgenic and littermate groups the lung infiltrate was predominantly and equally eosinophilic and no major differences in general inflammation scores or neutrophilic inflammation scores were found. From this data, any impairments in neutrophil accumulation in the lung targeted hIL-8 transgenic mice cannot be overcome by inflammatory signals in the ovalbumin lung disease model and the migration of eosinophils to the lung is not impaired or indeed augmented by the presence of the IL-8 protein. However, impaired neutrophil migration is difficult to assess here as no significant neutrophilic infiltrate is expected in normal non- transgenic animals. It would be of interest to determine whether migration in response to a well characterised neutrophil activating stimulus, such as LPS, is perturbed. However, a study by Remick et al. showing normal recruitment of neutrophils in response to acid induced lung injury in transgenic mice with high levels of serum IL-8, previously described as having impaired neutrophil migration, suggests that it might not be (Remick et al., 2001). In that study, neutrophil migration was found to be mediated normally by the endogenous murine chemokines KC and MIP-2. If neutrophil migration is indeed impaired in the lung targeted hIL-8 transgenic mice described in this chapter, then this effect could be circumvented with the use of conditional transgenic mice. There are now several reports in the literature of conditional IL-8 expression. In one study an adenoviral vector was used to overexpress hIL-8 in the cornea (Oka et aL, 2006) and in another the tetracycline system was used to induce hIL-8 expression in the intestine (Kucharzik et al., 2005). In both cases, significant infiltration of neutrophils to the site of hIL-8 expression was induced. However, it may be of interest to study the impact of hIL-8 in the lung in the absence of large numbers of neutrophils and neutrophil driven inflammation and damage as there is increasing evidence for potential neutrophil independent roles for IL-8 in human lung pathology. One important study recently published concerned a potential role for IL-8 in impaired lung function and lung remodelling with evidence 252 that IL-8 could induce Ca2+ release in human airway smooth muscle cells as well as causing cell contraction and inducing cell migration (Govindaraju et al., 2006). Lung responses to methacholine, measured as Perth, resistance and compliance are the most commonly used markers of lung function in the mouse and so these parameters were determined in the two lung targeted hIL-8 transgenic lines and compared to littermate animals. No differences in lung function by any of these measures were observed however, except perhaps for lower compliance measurements particularly in line 19 compared to littermates, although differences were not significant. From this data it appears that constitutively high levels of IL-8 in the mouse lung do not affect lung responses to methacholine, i.e. there is no apparent increase in bronchial hyperreactivity, as might have been suggested from studies with guinea pigs (Fujimura et al., 1999). However, in the study by Fujimura et al. IL-8 was not expressed by the lung but delivered as a single dose at a single time point and the constitutive nature of IL-8 expression in this study may have a major impact, for example by decreasing CXCR2 expression levels on the surface of murine airway smooth muscle. Of interest however were the findings of differences in bronchial hyperreactivity between hIL-8 transgenic mice and littermate controls that had been sensitised with alum alone but then exposed to aerosolised OVA. Reasons for increased bronchial hyperreactivity in transgenic animals compared to littermate controls in this situation, but not in the absence of antigen challenge, are not clear but it may be that chronic exposure to hIL- 8 over long periods of time in these mice somehow predisposes to impaired lung function upon challenge with antigen in a way that is independent of a T cell mediated immune response e.g. by directly impacting on the lung tissue itself in terms of airway remodelling or smooth muscle reactivity, the consequences of which are more pronounced in the context of aerosolised exposure to a foreign protein Despite this small difference in lung function between alum treated transgenic and littermate control groups, differences in lung function measurements between transgenic and littermate control disease groups were not observed. Also importantly, although in all transgenic and littermate groups sensitisation and exposure to 253 ovalbumin was associated with slightly worse lung function measurements, differences between disease and alum only control groups were very slight. As other parameters, such as eosinophilic lung inflammation and goblet cell scoring suggested that disease had indeed been successfully induced, the lack of large changes in lung function is most likely due to the genetic background of mice used in this study. Ovalbumin protocols involving lung function measurements most commonly use BALB/c mice as they show good susceptibility and marked outcomes of disease compared to other strains. Strain dependent variations in lung function measurements are well reported (Reinhard et al., 2002) and it is likely that larger differences between disease and control groups, and perhaps even at a baseline as a consequence of IL-8 expression, may be more evident on a different genetic background. Despite no observed differences between IL-8 transgenic and littermate disease groups with respect to cell infiltrates and lung function, one disease parameter was found to be altered. The disease groups of both lines of lung targeted hIL-8 transgenic animals showed an increased prevalence of mucus secreting goblet cells in the airways of the lung when compared to littermate control animals. Goblet cell mucus hypersecretion and goblet cell metaplasia is a common characteristic of allergic airway inflammation in both humans and mice and is associated with airway remodelling. Metaplasia is the process by which goblet cells arise from normal airway epithelial cells, such as Clara cells, and once formed, produce mucins in response to many factors including Th2 type cytokines IL-13 and IL-4 (Kuperman et al., 2005). Mucus hypersecretion is not just a feature of asthma, but is found in association with many other lung diseases such as cystic fibrosis, chronic bronchitis, bronchiectasis and COPD, and excessive mucus plays a major part in the pathology of these diseases by plugging airways and causing recurrent infections. Neutrophils have been implicated in pathways leading to goblet cell hyperplasia (Shao and Nadel, 2005) but aside from their role in neutrophil recruitment, there have been no reports directly implicating CXC chemokines in this process. Data presented in this chapter suggests that there is no difference in the number of goblet cells or mucus secretion in the lungs of transgenic compared to control mice in the absence of disease induction. This argues against a hypothesis 254 where IL-8 is acting directly on the airway epithelium in the absence of other inflammatory stimuli to mediate hyperplasia. The lack of a neutrophil infiltrate in these animals also argues against a neutrophil mediated mechanism and so perhaps one more likely hypothesis is that IL-8 may be affecting the IL-4 and IL-13 mediated pathways of goblet cell production and activation. Mice that overexpress IL-4 or IL- 13 show evidence of increased goblet cell hyperplasia and mucus production (Temann et al., 1997 and Zhu et al., 1999). It would therefore be of great interest to look at levels of IL-4 and IL-13 in the BAL and lung of all disease groups in the ovalbumin experiment described in this study to try to determine whether presence of the hIL-8 protein in the lung has affected endogenous cytokine production in the context of this disease model. If no differences in IL-4 or IL-13 levels are observed then possible novel mechanisms involving IL-8, probably in conjunction with another inflammatory mediator(s) should start to be explored and, as Clara cells themselves can both become goblet cells and are constitutively expressing the IL-8 protein, the possibility that any mechanism could be mediated by IL-8 protein inside the cell should also be borne in mind. As goblet cell hyperplasia and mucus secretion is one measure of airway remodelling, other markers of this process, such as collagen deposition and fibrosis should also be considered. Angiogenesis is one part of the fibrotic process in which CXC chemokines are heavily implicated (Strieter et al., 1995) and in a broader picture of fibrosis, neutralisation of the murine IL-8 homologue, MIP-2, was found to be protective in a mouse model of fibrotic lung disease (Keane et al., 1999). Of interest would be assessment of fibrosis in lung tissue from the ovalbumin disease experiment described in this chapter, but also important would be characterisation of any fibrotic pathologies in lungs of these transgenic animals prior to disease induction. Indeed subtle changes in airway structure may be able to account for the small changes observed in baseline airway compliance and increased bronchial hyperreactivity upon aerosol exposure to OVA of these lines. 255 Overview Transgenesis, CD4+ T cells and lung inflammation have been the main themes of this thesis, but while much has been achieved, much work still remains in characterising the new transgenic lines that have been created, answering questions surrounding observed phenotypes and in creating new models to try to answer key questions about disease pathogenesis and basic T cell biology. One of the main aims at the start of this thesis was to address a possible role for the T cell receptor in determining CD4+ T cell effector phenotype. Evidence from previous studies suggested that preferred structural motifs may expand during the course of Thl or Th2 type immune response and that these motifs may convey TCR/pMHC binding characteristics that inherently skew the process of differentiation and Thl or Th2 T cell development. This thesis described identification of Th 1 and Th2 derived TCR a chains that were successfully expressed transgenically, although levels of Thl TCR a chain expression were much lower than those seen in the Th2 TCR a transgenic lines. Ongoing work is needed to establish the cause of this apparent low transgene expression level in the Thl TCR a chain transgenic mice as this low level of expression and lack of expansion of the transgenic TCR sequence in the context of peptide specificity in in vitro culture is precluding the use of this line to determine inherent T cell phenotype and p chain pairing. It may be necessary to cross this mouse line with mice carrying a disrupted TCR a locus in order to achieve these aims. High levels of expression in the Th2 TCR a chain transgenic lines meant that experiments to determine 1 chain pairing and inherent effector cell phenotype were possible. It was found that transgenic expression of this Th2 TCR a chain, with an elongated CDR3a region, did not bias the naïve TCR [3 chain repertoire of these mice, but that in the context of peptide specificity a [3 chain pair could quickly be established. A dominant a13 TCR in peptide specific T cell lines derived from these animals was also associated with a Th2 type cytokine and transcription factor profile suggesting that expression of the elongated Th2 derived TCR a chain is sufficient to bias TCR p chain selection and pMHC binding such that development of a Th2 phenotype is favoured. 256 In vivo data supported this argument by demonstrating that during a memory response to peptide, T cells bearing the elongated transgenic TCR a chain produced less IFNI. Experiments are currently ongoing to determine whether these cells that make less IFN-y are associated with a dominant TCR 13 chain, and further work to establish an inherent Thl or Th2 bias in vivo could include a disease model such as EAE, to demonstrate increased resistance or susceptibility to disease as a consequence of inherent T cell phenotype. It will also be of interest to look at Th17 and regulatory T cell phenotypes in these animals. The question of inherent phenotype bias will nevertheless be most easily and most conclusively answered in mice expressing a transgenic TCR a and 13 chain that have been subsequently crossed onto a RAG knockout background and thus do not express any endogenous TCR at all. One TCR [3 chain pair identified from in vitro studies has now been expressed transgenically and breeding of these animals with Th2 TCR a chain animals is now currently underway. Basic characterisation of these animals in terms of normal proliferative and cytokine responses to peptide stimulation will be required both in vitro and in vivo, leading to the ultimate test of the original hypothesis using a RAG knockout background and comparing these animals to those with a Thl TCR a and 13 chain pair. At this point, comparisons of TCR binding affinity for pMHC can be achieved using MHC class II tetramers and signalling experiments to determine differential downstream consequences of TCR/pMHC ligation will also be possible. The predicted outcome from these studies would be that the Th2 TCR makes lower affinity interactions with the pMHC ligand and consequently has an altered pattern of phosphorylation and downstream signalling events that lead to a Th2 rather than Thl profile of gene expression. A second hypothesis leading from these studies concerned Thl and Th2 responses in the context of lung inflammation. If transgenic expression of Thl and Th2 derived TCRs can lead to inherent T cell phenotype bias then these transgenic animals could be used to generate Thl and Th2 type models of lung inflammation. As a starting point for this question this thesis has described the generation of an inducible transgene that confers lung specific, but inducible expression of the TCR cognate 257 peptide, PLP 56-70, in the mouse lung. Results obtained to date have shown the inducible mechanism of this approach to be functioning correctly and low levels of transgene expression have been detected using both membrane bound and secreted versions of the construct. Trafficking of T cells to the lung in response to this peptide expression has yet to be demonstrated and should become the immediate focus of work with these lines. In the absence of a complete TCR transgenic animal, experiments to try to prime and induce T cell trafficking in mice transgenic for the lung construct and the Cre protein have been started. Priming with peptide followed by induction of lung expression has been the first approach, but it may be that due to peptide induced tolerance mechanisms priming with whole PLP protein will be required. Whether any priming at all will be required and whether Thl or Th2 biased T cells will successfully traffic to the lung upon transgene induction awaits the existence of complete Thl and Th2 TCR transgenic animals and so at present this second hypothesis remains far from being properly addressed. However, if transgenic T cells do successfully traffic in this model, there is great potential for modelling some of the chronic inflammatory processes in the lung that have so far eluded many others. An alternative approach to lung inflammation and the last section of this thesis described overexpression of the human interleukin 8 cytokine in the bronchial epithelial cells of the mouse lung. High levels of IL-8 protein and concomitant neutrophilia in the lung are found in association with a number of different lung diseases but, despite much evidence that the human protein is biologically active in the mouse, there are as yet no reports in the literature of this protein having been overexpressed in the lung. This thesis has described the generation of two lines of IL- 8 expressing mice and lung specific expression has been demonstrated in both. Despite well known functions of IL-8 as a chemoattractant for leukocytes, especially neutrophils, no significant inflammatory cell infiltrates were observed in these animals in response to the constitutive IL-8 expression, although that the protein was biologically active was suggested by altered neutrophil percentages and distribution in the lung. Levels of IL-8 protein, as well as mechanisms of impaired recruitment such as receptor desensitisation have been suggested to explain these findings and further 258 work is required to establish the reason for the lack of neutrophil trafficking into the lungs of these mice. Lack of neutrophilic infiltrates in these animals could aid the analysis of neutrophil independent IL-8 mediated disease mechanisms in the lung. The finding of increased goblet cell numbers and mucus production in the lungs of transgenic animals compared to littermate controls, in the context of ovalbumin induced lung inflammation, is of particular interest and leads to further questions about potential roles for IL-8 in lung remodelling and fibrosis. Further work to establish whether there are any changes in lung structure as a consequence of IL-8 overexpression, in the absence of lung inflammation, is required as well as experiments to try to determine the mechanism of increased mucus production in the context of disease. To establish a model of lung neutrophilia and the pathologies associated with these infiltrates it may be necessary to generate mice carrying an inducible version of this hIL-8 transgene, but despite the absence of these cells in the lungs of mice described here, this model still holds much potential for dissecting mechanisms of IL-8 mediated pathology in the lung. 259 Bibliography Abadie, V; Badell, E; Douillard, P; Ensergueix, D; Leenen, PJM; Tanguy, M; Fiette, L; Saeland, S; Gicquel, B; and Winter, N; 2005. Neutrophils rapidly migrate via lymphatics after Mycobacterium bovis BCG intradermal vaccination and shuttle live bacilli to the draining lymph nodes. Blood. 106. 1843-1850 Adamson, IY; and Bowden, DH; 1974. The pathogenesis of bleomycin-induced pulmonary fibrosis in mice. Am. J Pathol. 77. 185-197 Agarwal, S; and Rao, A; 1998. Modulation of chromatin structure regulates cytokine gene expression during T cell differentiation. Immunity 9. 765-775 Aggarwal, A; Baker, CS; Evans, TW; and Haslam, PL; 2000. G-CSF and IL-S but not GM-CSF correlate with severity of pulmonary neutrophilia in actue respiratory distress syndrome. Eur. Respir. J. 15. 895-901 Aggarwal, S; Ghilardi, N; Xie, M; Sauvage, FJ; and Gurney, AL; 2003. Interleukin-23 promotes a distinct CD4 T cell activation state characterised by the production of interleukin-17. 1 Biol. Chem. 278. 1910-1914. Aifantis, I; Buer, J; von Boehmer, H; and Azogui, 0; 1997. Essential role of the pre-T cell receptor in allelic exclusion of the T cell receptor p locus. Immunity. 7. 601- 607 Aifantis, I; Pivniouk, VI; Gartner, F; Feinberg, J; Swat, W; Alt, FW; von Boehmer, H; and Geha, RS; 1999. Allelic exclusion of the T cell receptor p locus requires the SH2 domain-containing leukocyte protein (SLP)-76 adaptor protein. J Exp. Med. 190. 1093-1102 Aifantis, I; Gounari, F; Scorrano, L; Borowski, C; and von Boehmer, H; 2001. Constitutive pre-TCR signaling promotes differentiation through Ca2+ mobilization and activation of NF-KB and NFAT. Nature Immunology. 2. 403-409 Aifantis, I; Borowski, C; Gounari, F; Lacorazza, HD; Nikolich-Zugich, J; and von Boehmer, H; 2002. A critical role for the cytoplasmic tail of pTa in T lymphocyte development. Nature Immunology 3. 483-488 Akinbi, HT; Epaud, R; Bhatt, H; and Weaver, TE; 2000. Bacterial killing is enhanced by expression of lysozyme in the lungs of transgenic mice. J. Immunol. 165. 5760-5766 Akira, S; Okazaki, K; and Sakano, H; 1987. Two pairs of recombination signals are sufficient to cause immunoglobulin V-(D)-J joining. Science 238. 1134-1138 260 Alam, SM; Crispe, IN; and Gascoigne, NR; 1995. Allelic exclusion of mouse T cell receptor alpha chains occurs at the time of thymocyte TCR up-regulation. Immunity. 3. 449-458 Alam, SM; Travers, PJ; Wung, JL; Nasholds, W; Redpath, S; Jameson, SC and Gascoigne, NR; 1996. T cell receptor affinity and thymocyte positive selection. Nature. 381. 616-620 Alam, SM; and Gascoigne, NRJ; 1998. Posttranslational regulation of TCR Va allelic exclusion during T cell differentiation. J. Immunol. 160. 3883-3890 Alexander, C; Tarzi, M; Larche, M; and Kay, AB; 2005. The effect of Fel d 1- derived T cell peptides on upper and lower airway outcome measurements in cat- allergic subjects. Allergy. 60. 1269-1274 Allen, S; Read, S; DiPaolo, R; McHugh, RS; Shevach, EM; Gleeson, PA and van Driel, IR; 2005. Promiscuous thymic expression of an autoantigen gene does not result in negative selection of pathogenic T cells. .1 Immunol. 175. 5759-5764 Allen, TC; Fudala, R; Nash, SE; and Kurdowska, A; 2007. Anti-Interleukin 8 autoantibody:Interleukin 8 immune complexes visualised by laser confocal microscopy in injured lung. Arch. Pathol. Lab. Med. 131. 452-456 Allison, JP; Mcintyre, BW; and Bloch, D; 1982. Tumor-specific antigen of murine T-lymphoma defined with monoclonal antibody. J Immunol. 129. 1144-1151 Allison, TJ; Winter, CC; Fournie, J; Bonneville, M; and Garboczi, DN; 2001. Structure of a human yS T-cell antigen receptor. Nature. 411. 820-824 Andersen, P; Andersen AB; Sorensen, AL; and Nagai, S; 1995. Recall of long- lived immunity to mycobacterium tuberculosis infection in mice. J. Immunol. 154. 3359-3372 Anderson, MS; Venanzi, ES; Klein, L; Chen, Z; Berzins, SP; Turley, SJ; von Boehmer, H; Bronson, R; Dierich, A; Benoist, C and Mathis, D; 2002. Projection of an immunological self shadow within the thymus by the Aire protein. Science. 298. 1395-1401 Andres, PG; Howland, KC; Nirula, A; Kane, LP; Barron, L; Dresnek, D; Sadra, A; Imboden, J; Weiss, A and Abbas, AK; 2004. Distinct regions in the CD28 cytoplasmic domain are required for T helper type 2 differentiation. Nature Immunology. 5. 435-442 Annacker, 0; Pimenta-Araujo, R; Burlen-Defranoux, 0; Barbosa, TC; Cumano, A; and Bandeira, A; 2001. CD25+ CD4+ T cells regulate the expansion of peripheral CD4 T cells through the production of IL-10. J. Immunol. 166. 3008-3018 261 Argaet, VP; Schmidt, CW; Burrows, SR; Silins, SL; Kurilla, MG; Doolan, DL; Suhrbier, A; Moss, DJ; Kieff, E; Sculley, TB and Misko, IS; 1994. Dominant selection of an invariant T cell antigen receptor in response to persistent infection by Epstein-Barr virus. I Exp. Med. 180. 2335-2340 Ariga, H; Shimohakamada, Y; Nakada, M; Tokunaga, T; Kikuchi, T; Kariyone, A; Tamura, T and Takatsu, K; 2007. Instruction of naïve CD4+ T cell fate to T-bet expression and T helper 1 development: roles of T cell receptor mediated signals. Immunology (on-line ahead of print). Arnett, KL; Harrison, SC; and Wiley, DC; 2004. Crystal structure of a human CD3-E / 8 dimer in complex with a UCHT1 single-chain antibody fragment. Proc. Natl. Acad Sci. 101. 16268-16273 Arshad, SH; Hamilton, RG; and Adkinson, NF; 1998. Repeated aerosol exposure to small doses of allergen. A model for chronic allergic asthma. Am. I Respir. Crit. Med. 157. 1900-1906 Arstila, TP; Casrouge, A; Baron, V; Even, J; Kanellopoulos, J; and Kourilsky, P; 1999. A direct estimate of the human ct13 T cell receptor diversity. Science. 286. 958- 961 Avni, 0; Lee, D; Macian, F; Szabo, SJ; Glimcher, LH; and Roa, A; 2002. TH cell differentiation is accompanied by dynamic changes in histone acetylation of cytokine genes. Nature Immunology. 3. 643-651 Badou, A; Savignac, M; Moreau, M; Leclerc, C; Foucras, G; Cassar, G; Paulet, P; Lagrange, D; Druet, P; Guery, J-C; and Pelletier, L; 2001. Weak TCR stimulation induces a calcium signal that triggers IL-4 synthesis, stonger TCR stimulation induces MAP kinases that control IFN-y production. Eur. I. Immunol. 31. 2487-2496 Baker, BM; Gagnon, SJ; Biddison, WE; and Wiley, DC; 2000. Conversion of a T cell antagonist into an agonist by repairing a defect in the TCR/peptide/MHC interface: Implications for TCR signaling. Immunity. 13. 475-484 Baker, BM; and Wiley, DC; 2001. al3 T cell receptor ligand-specific oligomerization revisited. Immunity. 14. 681-692 Baldwin, ET; Weber, IT; St Charles, R; Xuan, J; Appella, E; Yamada, M; Matsushima, K; Edwards, BFP; Clore, GM; Gronenborn, AM; and Wlodawer, A; 1991. Crystal structure of interleukin 8: Symbiosis of NMR and crystallography. Proc. Natl. Acad. Sci. 88. 502-506 262 Baldwin, TA; Sandau, MM; Jameson, SC; and Hogquist, KA; 2005. The timing of TCRa expression critically influences T cell development and selection. J Exp. Med. 202. 111-121 Bancroft, AJ; Grencis, RK; Else, KJ and Devaney, E; 1994. The role of CD4 cells in protective immunity to Brugia pahangi. Parasite Immunology. 16. 385-387 Bassing, CH; Alt, FW; Hughes, MM; D'Auteuil, M; Wehrly, TD; Woodman, BB; Gartner, F; White, JM; Davidson, L; and Sleckman, BP; 2000. Recombination signal sequences restrict chromosomal V(D)J recombination beyond the 12/23 rule. Nature. 405. 583-586 Belcher, RW; and Reid, JD; 1975. Sarcoid granulomas in CBA/J mice. Histologic response after inoculation with saroid and nonsarcoid tissue homogenates. Arch. Pathol. 99. 283-285 Belperio, JA; Dy, M; Burdick, MD; Xue, YY; Li, K; Elisa, JA and Keane, MP; 2002. Interaction of IL-13 and C10 in the pathogenesis of bleomycin-induced pulmonary fibrosis. Am. J. Respir. Cell Mol. Biol. 27. 419-427 Belz, GT; Stevenson, PG; and Doherty, PC; 2000. Contemporary analysis of MHC- related immunodominance hierarchies in the CD8+ T cell response to influenza A viruses. I Immunol. 165. 2404-2409 Bennouna, S; Bliss, SK; Curiel, TJ; and Denkers, EY; 2003. Cross-talk in the innate immune system: Neutrophils instruct recruitment and activation of dendritic cells during microbial infection. J. Immunol. 171. 6052-6058 Bergeron, A; Laissy, J-P; Schouman-Claeys, E; Hance, AJ; and Tazi, A; 2001. Computed tomography of pulmonary sarcoid-like granulomas induced by complete Freund's adjuvant in rats. Eur. Respir. 1 18. 357-361 Bettelli, E; Carrier, Y; Gao, W; Korn, T; Strom, TB; Oukka, M; Weiner, HL; and Kuchroo, VK; 2006. Reciprocal developmental pathways for the generation of pathogenic effector TH17 and regulatory T cells. Nature. 441. 235-238 Biedermann, T; Zimmermann, S; Himmelrich, H; Gumy, A; Egeter, 0; Sakrauski, AK; Seegmuller, I; Voigt, H; Launois, P; Levine, AD; Wagner, H; Heeg, K; Louis, JA; and Rocken, M; 2001. IL-4 instructs TH1 responses and resistance to Leishmania major in susceptible BALB/c mice. Nature Immunology. 2. 1054-1060 Birk, OS; Douek, DC; Elias, D; Takacs, K; Dewchand, H; Gur, SL; Walker, MD; van der Zee, R; Cohen, IR; and Altmann, DM; 1996. The role of Hsp60 in autoimmune diabetes: Analysis in a transgenic model. Proc. Natl. Acad. Sci. 93. 1032- 1037 263 Blanchard, D; van Els, C; Borst, J; Carrel, S; Boylston, A; de Vries, JE; and Spits, H; 1987. The role of the T cell receptor, CD8, and LFA-1 in different stages of the cytolytic reaction mediated by alloreactive T lymphocyte clones. J Immunol. 138. 2417-2421 Blander, JM; Sant'Angelo, DB; Bottomly, K; and Janeway, CA; 2000. Alteration at a single amino acid residue in the T cell receptor a chain complementarity determining region 2 changes the differentiation of naive CD4 T cells in response to antigen from T helper cell type 1 (Thl) to Th2. I Exp. Med. 191. 2065-2074 Blease, K; Schuh, JM; Jakubzick, C; Lukacs, NW; Kunkel, SL; Joshi, BH; Puri, RK; Kaplan, MH; and Hogaboam, CM; 2002. Stat6-deficient mice develop airway hyperresponsiveness and peribroncial fibrosis during chronic fungal asthma. Am. J. Path. 160. 481-490 Boniface, JJ; Reich, Z; Lyons, DS; and Davis, MM; 1999. Thermodynamics of T cell receptor binding to peptide-MHC: Evidence for a general mechanism of molecular scanning. Proc. Natl. Acad. Sci. 96. 11446-11451 Bonniaud, P; Kolb, M; Galt, T; Roberston, J; Robbins, C; Stampfli, M; Lavery, C; Margetts, PJ; Roberts, AB; and Gauldie, J; 2004. Smad3 null mice develop airspace enlargement and are resistant to TGF-(3-mediated pulmonary fibrosis. J. Immunol. 173. 2099-2108 Borg, NA; Ely, LK; Beddoe, T; Macdonald, WA; Reid, HH; Clements, CS; Purcell, AW; Kjer-Nielsen, L; Miles, JJ; Burrows, SR; McCluskey, J; and Rossjohn, J; 2005. The CDR3 regions of an immunodominant T cell receptor dictate the "energetic landscape" of peptide-MHC recognition. Nature Immunology. 6. 171- 180 Borgulya, P; Kishi, H; Uematsu, Y; and von Boehmer, H; 1992. Exclusion and inclusion of alpha and beta T cell receptor alleles. Cell. 69. 529-537 Born, W; Yague, J; Palmer, E; Kappler, J; and Marrack, P; 1985. Rearrangement of T cell receptor (3-chain genes during T-cell development. Proc. Natl. Acad. Sci. 82. 2925-2929 Borowski, C; Li, X; Aifantis, I; Gounari, F; and von Boehmer, H; 2004. Pre- TCRa and TCRa are not interchangeable partners of TCR13 during T lymphocyte development. J. Exp. Med. 199. 607-615 Bosma, GC; Custer, RP; and Bosma, MJ; 1983. A severe combined immunodeficiency mutation in the mouse. Nature. 301. 527-530 264 Bousso, P; Bhakta, NR; Lewis, RS; and Robey, E; 2002. Dynamics of thymocyte- stromal cell interactions visualized by two-photon microscopy. Science. 296. 1876- 1880 Boutin, Y; Leitenberg, D; Tao, X; and Bottomly, K; 1997. Distinct biochemical signals characterize agonist and altered peptide ligand-induced differentiation of naïve CD4+ T cells into Thl and Th2 subsets. J Immunol. 159. 5802-5809 Boyd, R; Kozieradzki, I; Chidgey, A; Mittrucker, H; Bouchard, D; Timms, E; Kishihara, K; Ong, CJ; Chui, D; Marth, JD; Mak, TW; and Penninger, JM; 1998. Receptor-specific allelic exclusion of TCRVa-chains during development. J. Immunol. 161. 1718-1727 Boyton, RJ; Zaccai, N; Jones, EY; and Altmann, D; 2002. CD4 T Cells Selected by Antigen Under Th2 Polarizing Conditions Favor an Elongated TCRa Chain Complementarity-Determining Region 3. J. Immunol. 168. 1018-1027 Bozic, CR; Gerard, NP; von Uexkull-Guldenand, C; Kolakowski, LF; Conklyn, MJ; Breslow, R; Showell, HJ; and Gerard, C; 1994. The murine interleukin 8 type B receptor homologue and its ligands. J Biol. Chem. 269. 29355-29358 Brandle, D; Muller, C; Rulicke, T; Hengartner, H; and Pircher, H; 1992. Engagement of the T cell receptor during positive selection in the thymus down- regulates RAG-1 expression. Proc. Nati. Acad. Sci. 89. 9529-9533 Brenner, MB; McLean, J; Dialynas, DP; Stominger, JL; Smith, JA; Owen, FL; Seidman, JG; Ip, S; Rosen, F; and Krangel, MS; 1986. Identification of a putative second T cell receptor. Nature. 322. 145-149 Brinster, RL; Chen, HY; Trumbauer, ME; Yagle, MK; and Palmiter, RD; 1985. Factors affecting the efficiency of introducing foreign DNA into mice by microinjecting eggs. Proc. Natl. Acad. Sci. 82. 4438-4442 Brocke, S; Gijbels, K; Allegretta, M; Ferber, I; Piercy, C; Blankenstein, T; Martin, R; Utz, U; Karin, N; Mitchell, D; Veromaa, T; Waisman, A; Gaur, A; Conlon, P; Ling, N; Fairchild, PJ; Wraith, DC; O'Garra, A; Fathman, CG; and Steinman, L; 1996. Treatment of experimental encephalomyelitis with a peptide analogue of myelin basic protein. Nature. 379. 343-346 Bruijnzeel, PL; Kuijper, PH; Rihs, S; Betz, S; Warringa, RA; and Koenderman, L; 1993. Eosinophil migration in atopic dermatitis. 1: increased migratory responses to N-formyl-methionyl-leucyl-phenylalanine, neutrophil-activating factor, platelet- activating factor, and platelet factor 4. J Invest. Dermatol. 100. 137-142 265 Buer, J; Aifantis, I; DiSanto, JP; Fehling, HJ; and von Boehmer, H; 1997. Role of different T cell receptors in the development of Pre-T cells. J. Exp. Med. 185. 1541- 1547 Bullens, DMA; Truyen, E; Coteur, L; Dilissen, E; Hellings, PW; Dupont, LJ; and Ceuppens, JL; 2006. IL-17 mRNA in sputum of asthmatic patients: linking T cell driven inflammation and granulocytic influx. Respiratory Research. 7. 135-143 Bunnell, SC; Hong, DI; Kardon, JR; Yamazaki, T; McGlade, CJ; Barr, VA; and Samelson, LE; 2002. T cell receptor ligation induces the formation of dynamically regulated signaling assemblies. I Cell Biol. 158. 1263-1275 Burrows, SD; Doyle, ML; Murphy, KP; Franklin, SG; White, JR; Brooks, I; McNulty, DE; Scott, MO; Knutson, JR; and Porter, D; 1994. Determination of the monomer-dimer equilibrium of interleukin-8 reveals it is a monomer at physiological concentrations. Biochemistry. 33. 12741-12745 Burrows, SR; Mins, SL; Moss, DJ; Khanna, R; Misko, IS; and Argaet, VP; 1995. T cell receptor repertoire for a viral epitope in humans is diversified by tolerance to a background major histocompatibility complex antigen. I Exp. Med. 182. 1703-1715 Busch, DH; and Pamer, EG; 1999. T cell affinity maturation by selective expansion during infection. I Exp. Med. 189. 701-709 Bush, A; Cole, P; Hariri, M; Mackay, I; Phillips, G; O'Callaghan, C; Wilson, R; and Warner, JO; 1998. Primary ciliary dyskinesia: diagnosis and standards of care. Eur. Respir. 1 12. 982-988 Cabaniols, JP; Fazilleau, N; Casrouge, A; Kourilsky, P; and Kanellopoulos, JM; 2001. Most oc/I3 T cell receptor diversity is due to terminal deoxynucleotidyl transferase. I Exp. Med. 194. 1385-1390 Call, ME; Pyrdol, J; Wiedmann, M; and Wucherpfennig, KW; 2002. The organizing principle in the formation of the T cell receptor-CD3 complex. Cell. 111. 967-979 Campanelli, D; Detmers, PA; Nathan, CF; and Gabay, JE; 1990. Azurocidin and a homologous serine protease from Neutrophils. J Clin. Invest. 85. 904-915 Campbell, JJ; Qin, S; Unutmaz, D; Soler, D; Murphy, KE; Hodge, MR; Wu, L; and Butcher, EC; 2001. Unique subpopulations of CD56+ NK and NK-T peripheral blood lymphocytes identified by chemokine receptor expression repertoire. I Immunol. 166. 6477-6482 266 Candeias, S; Katz, J; Benoist, C; Mathis, D; and Haskins, K; 1991. Islet-specific T-cell clones from nonobese diabetic mice express heterogeneous T-cell receptors. Proc. Natl. Acad. Sci. USA. 88. 6167-6170 Candon, S; McHugh, RS; Foucras, G; Natarajan, K; Shevach, EM; and Margulies, DH; 2004. Spontaneous organ-specific Th2 mediated autoimmunity in TCR transgenic mice. J. Immunol. 172. 2917-2924 Carre, PC; Mortenson, RL; King, TE; Noble, PW; Sable, CL; and Riches, DWH; 1991. Increased expressioin of the interleukin-8 gene by alveolar macrophages in idiopathic pulmonary fibrosis. J. Clin. Invest. 88. 1802-1810 Carson, RT; Vignali, KM; Woodland, DL; and Vignali, DAA; 1997. T cell receptor recognition of MHC class II bound peptide flanking residues enhances immunogenicity and results in altered TCR V region usage. Immunity. 7. 387-399 Casanova, E; Lemberger, T; Fehsenfeld, S; Mantamadiotis, T; and Schutz, G; 2003. a complementation in the Cre recombinase enzyme. Genesis 37. 25-29 Casrouge, A; Beaudoing, E; Dalle, S; Pannetier, C; Kanellopoulos, J; and Kourilsky, P; 2000. Size estimate of the cc(3 TCR repertoire of naive mouse splenocytes. J. Immunol. 164. 5782-5787 Chan, AC; Irving, BA; Fraser, JD; and Weiss, A; 1991. The chain is associated with a tyrosine kinase and upon T cell antigen receptor stimulation associates with ZAP-70, a 70-kDa tyrosine phosphoprotein. Proc. Natl. Acad. Sci. 88. 9166-9170 Chan, AC; Dalton, M; Johnson, R; Kong, G; Wang, T; Thoma, R; and Kurosaki, T; 1995. Activation of ZAP-70 kinase activity by phosphorylation of tyrosine 493 is required for lymphocyte antigen receptor function. EMBO J. 14. 2499-2508 Chan, MM; Chmura, K; and Chan, ED; 2006. Increased NaCl-induced interleukin- 8 production by human bronchial epithelial cells is enhanced by the AF508/W1282X mutation of the cystic fibrosis transmembrane conductance regulator gene. Cytokine. 33. 309-316 Chen, M; Pittet, MJ; Gorelik, L; Flavell, RA; Weissleder, R; von Boehmer, H; and Khazale, K; 2005. Regulatory T cells suppress tumor-specific CD8 T cell cytotoxicity through TGF-13 signals in vivo. Proc. Natl. Acad. Sci. 102. 419-424 Chen, Q; Rabach, L; Noble, P; Zheng, T; Lee, CG; Homer, RJ; and Elias, JA; 2005. IL-11 receptor a in the pathogenesis of IL-13 induced inflammation and remodeling. J. Immunol. 174. 2305-2313 Cheng, D; Han, W; Chen, SM; Sherrill, TP; Chont, M; Park, G; Sheller, JR; Polosukhin, VV; Christman, JW; Yull, FE; and Blackwell, TS; 2007. Airway 267 epithelium controls lung inflammation and injury through the NF-KB pathway. I Immunol. 178. 6504-6513 Cherniack, RM; 1956. The physical properties of the lung in chronic obstructive pulmonary emphysema. J. Clin. Invest. 35. 394-404 Chertov, 0; Michiel, DF; Xu, L; Wang, JM; Tani, K; Murphy, WJ; Longo, DL; Taub, DD; and Oppenheim, JJ; 1996. Identification of defensin-1, defensin-2, and CAP37/Azurocidin as T cell chemoattractant proteins released from interleukin-8 stimulated neutrophils. J. Biol. Chem.. 6. 2935-2940 Chien, YH; Gascoigne, NR; Kavaler, J; Lee, NE; and Davis, MM; 1984. Somatic recombination in a murine T cell receptor gene. Nature 309. 322-326 Chikuma, S; Abbas, AK; and Bluestone, JA; 2005. B7-independent inhibition of T cells by CTLA-4. J. Immunol. 175. 177-181 Chlewicki, LK; Holler, PD; Monti, BC; Clutter, MR; and Kranz, DM; 2005. High-affinity, peptide-specific T cell receptors can be generated by mutations in CDR1, CDR2 or CDR3. J. MoL Biol. 346. 223-239 Choudhuri, K; Wiseman, D; Brown, MH; Gould, K; and van der Merwe, PA; 2005. T cell receptor triggering is critically dependent on the dimensions of its peptide-MHC ligand. Nature 436. 578-582 Chow, Y; O'Brodovich, H; Plumb, J; Wen, Y; Sohn, K; Lu, Z; Zhang, F; Lukacs, GL; Tanswell, AK; Hui, C; Buchwald, M; and Hu, J; 1997. Development of an epithelium-specific expression cassette with human DNA regulatory elements for transgene expression in lung airways. Proc. Natl. Acad. Sci. USA. 94. 14695-14700 Ciofani, M; Schmitt, TM; Ciofani, A; Michie, AM; Cuburu, N; Aublin, A; Maryanski, JL; and Zuniga-Pflucker, JC; 2004. Obligatory role for cooperative signaling by pre-TCR and notch during thymocyte differentiation. J. Immunol. 172. 5230-5239 Colbert, RA; Rowland-Jones, SL; McMichael, AJ; and Frelinger, JA; 1993. Allele specific B pocket transplant in class I major histocompatibility complex protein changes requirement for anchor residue at P2 of peptide. Proc. Natl. Acad. Sci. 90. 6879-6883 Cole, AM; Liao, HI; Stuchlik, 0; Tilan, J; Pohl, J; and Ganz, T; 2002. Cationic polypeptides are required for antibacterial activity of human airway fluid. J. Immunol. 169. 6985-6991 268 Cole, AM; Thapa, DR; Gabayan, V; Liao, H; Liu, L; and Ganz, T; 2005. Decreased clearance of Pseudomonas aeruginosa from airways of mice deficient in lysozyme M. J Leuk Biol. 78. 1081-1085 Colf, LA; Bankovich, AJ; Hanick, NA; Bowerman, NA; Jones, LL; Kranz, DM; and Garcia, KC; 2007. How a single T cell receptor recognizes both self and foreign MHC. Cell.129. 135-146 Constant, S; Pfeiffer, C; Woodard, A; Pasqualini, T; and Bottomly, K; 1995. Extent of T cell receptor ligation can determine the functional differentiation of naïve CD4+ T cells. J. Exp. Med. 182. 1591-1596 Constant, SL; Lee, KS; and Bottomly, K; 2000. Site of antigen delivery can influence T cell priming: pulmonary evironment promotes preferential Th2 type differentiation. Eur. J. Immunot 30. 840-847 Cooper, CJ; Orr, MT; McMahan, CJ; and Fink, PJ; 2003. T cell receptor revision does not solely target recent thymic emigrants. J. ImmunoL 171. 226-233 Corthay, A; Nandakumar, KS; and Holmdahl, R; 2001. Evaluation of the percentage of peripheral T cells with two different T cell receptor a-chains and of their potentital role in autoimmunity. Journal of autoimmunity 16. 423-429 Cranston, A; Dong, C; Howcroft, J and Clark AJ; 2001. Chromosomal sequences flanking an efficiently expressed transgene dramatically enhance its expression. Gene 269. 217-225 Creery, WD; Diaz-Mitoma, F; Filion, L and Kumar, A; 1996. Differential modulation of B7-1 and B7-2 isoform expression on human monocytes by cytokines which influence the development of T helper cell phenotype. Eur. J Immunol. 26. 1273-1277 Cua, DJ; Sherlock, J; Chen, Y; Murphy, CA; Joyce, B; Seymour, B; Lucian, L; To, W; Kwan, S; Churakova, T; Zurawski, S; Wiekowski, M; Lira, SA; Gorman, D; Kastelein, RA; and Sedgwick, JD; 2003. Interleukin-23 rather than interleukin-12 is the critical cytokine for autoimmune inflammation of the brain. Nature 421. 744- 478 Dahl, ME; Dabbagh, K; Liggitt, D; Kim, S; and Lewis, DB; 2004. Viral-induced T helper type 1 responses enhance allergic disease by effects on lung dendritic cells. Nature Immunlogy. 5. 337-343 Daniels, MA; Teixeiro, E; Gill, J; Hausmann, B; Roubaty, D; Holmberg, K; Werlen, G; Hollander, GA; Gascoigne, NRJ; and Palmer, E; 2006. Thymic selection threshold defined by compartmentalization of Ras/MAPK signalling. Nature 444. 724-729 269 Das, MP; Nicholson, LB; Greer, JM; and Kuchroo, VK; 1997. Autopathogenic T helper cell type 1 (Thl) and protective Th2 clones differ in their recognition of the autoantigenic peptide of myelin proteolipid protein. J. Exp. Med 186. 867-876 Davis, MM; and Chien YH in Fundamental Immunology (ed. Paul, W.E) 341-366 (Lippincott-Raven, Philadelphia, 1999) de Jong, EC; Vieira, PL; Kalinski, P; Schuitemaker, JHN; Tanaka, Y; Wierenga, EA; Yazdanbakhsh, M; and Kapsenberg, ML; 2002. Microbial compounds selectively induce Thl cell-promoting or Th2 cell-promoting dendritic cells in vitro with diverse Th cell polarizing signals. J. Immunol. 168. 1704-1709 Delon, J; Gregoire, C; Malissen, B; Darche, S; Lemaitre, F; Kourilsky, P; Abastado, JP; and Trautmann, A; 1998. CD8 expression allows T cell signaling by monomeric peptide-MHC complexes. Immunity. 9. 467-473 Derbinski, J; Schulte, A; Kyewski, B; and Klein, L; 2001. Promiscuous gene expression in medullary thymic epithelial cells mirrors the peripheral self. Nature Immunology. 2. 1032-1039 Derbinski, J; Gabler, J; Brors, B; Tierling, S; Jonnakuty, S; Hergenhahn, M; Peltonen, L; Walter, J; and Kyewski, B; 2005. Promiscuous gene expression in thymic epithelial cells is regulated at multiple levels. J. Exp. Med. 202. 33-45 Detmers, PA; Lo, SK; Olsen-Egbert, E; Walz, A; Baggiolini, M; and Cohn, ZA; 1990. Neutrophil-activating protein 1/interleukin 8 stimulates the binding activity of the leukocyte adhesion receptor CD11b/CD18 on human neutrophils. J. Exp. Med. 171. 1155-1162 Dickins, RA; McJunkin, K; Hernando, E; Premsrirut, PK; Krizhanovsky, V; Burgess, DJ; Kim, SY; Cordon-Cardo, C; Zender, L; Hannon, GJ; and Lowe, SW; 2007. Tissue-specific and reversible RNA interference in transgenic mice. Nature genetics 39. 914-921 DiMolfetto, L; Neal, H; Wu, A; Reilly, C; and Lo, D; 1998. The density of the class II MHC T cell receptor ligand influences IFN-y / IL-4 ratios in immune responses in vivo. Cellular Immunology. 183. 70-79 Ding, Y; Smith, KJ; Garboczi, DN; Utz, U; Biddison, WE; and Wiley, DC; 1998. Two human T cell receptors bind in a similar diagonal mode to the HLA-A2/Tax peptide complex using different TCR amino acids. Immunity. 8. 403-411 Donnelly, SC; Strieter, RM; Kunkel, SL; Walz, A; Robertson, CR; Carter, DC; Grant, IS; Pollok, AJ; and Haslett, C; 1993. Interleukin-8 and development of adult respiratory distress syndrome in at-risk patient groups. Lancet 341. 643-647 270 Douek, DC; Corley, KTT; Zal, T; Mellor, A; Dyson, PJ; and Altmann, DM; 1996. Negative selection by endogenous antigen and superantigen occurs at multiple thymic sites. Int. Immunol. 8. 1413-1420 Dubin, RF; Robinson, SK; and Widdicombe, JH; 2004. Secretion of lactoferrin and lysozyme by cultures of human airway epithelium. Am. J Physiol. Lung Cell Mol. Physiol. 286. L750-L755 Duez, C; Tsicopoulos, A; Janin, A; Tillie-Leblond, I; Thyphronitis,G; Marquillies, P; Hamid, Q; Wallaert, B; Tonnel, AB; and Pestel, J; 1996. An in vivo model of allergic inflammation: pulmonary human cell infiltrate in allergen- challenged allergic Hu-SCID mice. Eur. J. Immunol. 26. 1088-1093 Dupuy, AJ; Clark, K; Carlson, CM; Fritz, S; Davidson, AE; Markley, KM; Finley, K; Fletcher, CF; Ekker, SC; Hackett, PB; Horn, S; and Largaespada, DA; 2002. Mammalian germ-line transgenesis by transposition. Proc. Natl. Acad. Sci. 99. 4495-4499 Edwards, RJ; Taylor, GW; Ferguson, M; Murray, S; Rendell, N; Wrigley, A; Bai, Z; Boyle, J; Finney, SJ; Jones, A; Russell, HH; Turner, C; Cohen, J; Faulkner, L; and Sriskandan, S; 2005. Specific C-terminal cleavage and inactivation of lnterleukin-8 by invasive disease isolates of Streptococcus pyogenes. J. Infect. Dis. 192. 783-790 Elder, ME; Lin, D; Clever, J; Chan, AC; Hope, TJ; Weiss, A; and Parslow, TG; 1994. Human severe combined immunodeficiency due to a defect in ZAP-70, a T cell tyrosine kinase. Science 264. 1596-1599 Elizur, A; Adair-Kirk, TL; Kelley, DG; Griffin, GL; deMello, DE; and Senior, RM; 2007. Clara cells impact the pulmonary innate immune response to LPS. Am. J Physiol. Lung Cell Mol. Physiol. 293. L383-L392 Elliott, JI; and Altmann, DM; 1995. Dual T cell receptor alpha chain T cells in autoimmunity. J. Exp. Med. 182. 953-959 Elliott, JI; and Altmann, DM; 1996. Non-obese diabetic mice hemizygous at the T cell receptor alpha locus are susceptible to diabetes and sialitis. Eur. J. Immunol. 26. 953-956 Ellmerich, S; Mycko, M; Takacs, K; Waldner, H; Wahid, FN; Boyton, RJ; King, KHM; Smith, PA; Amor, S; Herlihy, AH; Hewitt, RE; Jutton, M; Price, DA; Hafler, DA; Kuchroo, VK; and Altmann, DM; 2005. High incidence of spontaneous disease in an HLA-DR15 and TCR transgenic multiple sclerosis model. I Immunol. 174. 1938-1946 271 Ely, LK; Beddoe, T; Clements, CS; Matthews, JM; Purcell, AW; Kjer-Nielsen, L; McCluskey, J; and Rossjohn, J; 2006. Disparate thermodynamics governing T cell receptor-MHC-I interactions implicate extrinsic factors in guiding MHC restriction. Proc. Natl. Acad. Sci. 103. 6641-6646 Emi, M; Keicho, N; Tokunaga, K; Katsumata, H; Souma, S; Nakata, K; Taguchi, Y; Ohishi, N; Azuma, A; and Kudoh, S; 1999. Association of diffuse panbronchiolitis with microsatellite polymorphism of the human interleukin 8 (IL-8) gene. J Hum. Genetics 44. 169-172 Erger, RA; and Casale, TB; 1998. Interleukin-8 plays a significant role in IgE- mediated lung inflammation. Eur. Respir. J 11. 299-305 Ethuin, F; Gerard, B; Benna, JE; Boutten, A; Gougereot-Pocidalo, M; Jacob, L; and Chollet-Martin, S; 2004. Human neutrophils produce interferon gamma upon stimulation by interleukin-12. Laboratory Investigation. 84. 1363-1371 Fahy, JV; Fleming HE; Wong, HH; Liu, JT; Su, JQ; Reimann, J; Fick, RB; and Boushey, HA; 1997. The effect of an anti-IgE monoclonal antibody on the early and late phase responses to allergen inhalation in asthmatic subjects. Am.J Respir. Crit. Care Med. 155. 1828-1834 Falk, K; Rotzschke, 0; Stevanovic, S; Jung, G; and Rammensee, H; 1991. Allele specific motifs revealed by sequencing of self-peptides eluted from MHC molecules. Nature 351. 290-296 Fang, TC; Yashiro-Ohtani, Y; Del Bianco, C; Knoblock, DM; Blacklow, SC; and Pear, WS; 2007. Notch directly regulates Gata3 expression during T helper 2 cell differentiation. Immunity 27. 100-110 Fasso, M; Anandasabapathy, N; Crawford, F; Kappler, J; Fathman, CG; and Ridgeway, WM; 2000. T cell receptor (TCR)-mediated repertoire selection and loss of TCR vp diversity during the initiation of a CD4+ T cell response in vivo. J. Exp. Med. 192. 1719-1730 Faurschou, M; and Borregaard, N; 2003. Neutrophil granules and secretory vesicles in inflammation. Microbes and Infection 5. 1317-1327 Fehling, HJ; Krotkova, A; Saint-Ruf, C; and von Boehmer, H; 1995. Crucial role of the pre-T cell receptor alpha gene in development of alpha beta but not gamma delta T cells. Nature. 375. 795-798 Ferber, IA; Brocke, S; Taylor-Edwards, C; Ridgway, W; Dinisco, C; Steinman, L; Dalton, D; and Fathman, CG; 1996. Mice with a disrupted IFNI gene are susceptible to the induction of experimental autoimmune encephalomyelitis (EAE). J. Immunol. 156. 5-7 272 Fernandez-Miguel, G; Alarcon, B; Iglesias, A; Bluethmann, H; Alvarez-Mon, M; Sanz, E; and de la Hera, A; 1999. Multivalent structure of an al3T cell receptor. Proc. Natl. Acad. Sci. 96. 1547-1552 Finnish German APECED consortium. 1997. An autoimmune disease, APECED, caused by mutations in a novel gene featuring two PHD-type zinc-finger domains. Nature Genetics 17. 399-403 Finotto, S; Neurath, MF; Glickman, JN; Qin, S; Lehr, HA; Green, FHY; Ackerman, K; Haley, K; Galle, PR; Szabo, SJ; Drazen, JM; De Sanctis, GT; and Glimcher, LH; 2002. Development of spontaneous airway changes consistent with human asthma in mice lacking T-bet. Science 295. 336-338 Fontenot, JD; Rasmussen, JP; Williams, LM; Dooley, JL; Farr, AG; and Rudensky, AY; 2005. Regulatory T cell lineage specification by the forkhead transcription factor Foxp3. Immunity 22. 329-341 Foster, PS; Hogan, SP; Ramsay, AJ; Matthaei, KI and Young, IG; 1996. Interleukin 5 deficiency abolishes eosinophilia, airways hyperrreactivity, and lung damgage in a mouse asthma model. J. Exp.Med. 183. 195-201 Fowell, DJ; Magram, J; Turck, CW; Killeen, N; and Locksley, RM; 1997. Impaired Th2 subset development in the absence of CD4. Immunity. 6. 559-569 Freeman, GJ; Borriello, F; Hodes, RJ; Reiser, H; Gribben, JG; Hg, JW; Kim, J; Goldberg, JM; Hathcock, K; and Laszlo, G; 1993. Murine B7-2, an alternative CTLA4 counter-receptor that costimulates T cell proliferation and interleukin 2 production. J. Exp. Med. 178. 2185-2192 Freeman, GJ; Boussiotis, VA; Anumanthan, A; Bernstein, GM; Ke, XY; Rennert, PD; Gray, GS; Gribben, JG; and Nadler, LM; 1995. B7-1 and B7-2 do not deliver identical costimulatory signals, since B7-2 but not B7-1 preferentially costimulates the initial production of IL-4. Immunity 2. 523-532 Fujimura, M; Myou, S; Nomura, M; Mizuguchi, M; Matsuda, T; Harada, A; Mukaida, N; Matsushima, K; and Nonomura, A; 1999. Interleukin-8 inhalation directly provokes bronchoconstriction in guinea pigs. Allergy 54. 386-391 Fujiwara, M; Hirose, K; Kagami, S; Takatori, H; Wakashin, H; Tamachi, T; Watanabe, N; Saito, Y; Iwamoto, I; and Nakajima, H; 2007. T-bet inhibits both TH2 cell-mediated eosinophil recruitment and TH 17 cell-mediated neutrophil recruitment into the airways. J. Allergy Clin. Immunol. 119. 662-670 Gallegos, AM; and Bevan, MJ; 2004. Central tolerance to tissue-specific antigens mediated by direct and indirect antigen presentation. J Exp. Med. 200. 1039-1049 273 Ganzalo, JA; Jia, GQ; Aguirre, V; Friend, D; Coyle, AJ; Jenkins, NA; Lin, GS; Katz, H; Lichtman, A; Copeland, N; Kopf, M; and Gutierrez-Ramos, JC; 1996. Mouse Eotaxin expression parallels eosinophil accumulation during lung allergic inflammation but it is not restricted to a Th2 type response. Immunity. 4. 1-14 Garcia, KC; Degano, M; Stanfield, RL; Brunmark, A; Jackson, MR; Peterson, PA, Teyton, L; and Wilson, IA; 1996. An alphabeta T cell receptor structure at 2.5 A and its orientation in the TCR-MHC complex. Science 274. 209-219 Garcia, KC; Degano, M; Pease, LR; Huang, M; Peterson, P; Teyton, L; and Wilson, IA; 1998. Structural basis of plasticity in T cell receptor recognition of a self peptide-MHC antigen. Science 279. 1166-1172 Geiser, T; Dewald, B; Ehrengruber, MU; Clark-Lewis, I; and Baggiolini, M; 1993. The interleukin-8 related chemotactic cytokines GROa, GROG, and GROy activate human neutrophil and basophil leukocytes. J. Biol Chem. 268. 15419-15424 Geisler, C; 1992. Failure to synthesize the CD3-y chain: consequences for T cell antigen receptor assembly, processing and expression. I Immunot 148. 2437-2445 Gibson, PG; Simpson, JL; and Saltos, N; 2001. Heterogeneity of airway inflammation in persistent asthma. Chest 119. 1329-1336 Gil, D; Schamel, W; Montoya, M; Sanchez-Madrid, F; and Alarcon, B; 2002. Recruitment of Nck by CDR reveals a ligand-induced conformational change essential for T cell receptor signaling and synapse formation. Cell 109. 901-912 Gil, D; Schrum, AG; Alarcon, B; and Palmer, E; 2005. T cell receptor engagement by peptide-MHC ligands induces a conformational change in the CD3 complex of thymocytes. J. Exp. Med. 201. 517-522 Gilfillan, S; Bachmann, M; Trembleau, S; Adorini, L; Kalinke, U; Zinkernagel, R; Benoist, C and Mathis, D; 1995. Efficient immune responses in mice lacking N- region diversity. Eur. J. Immunol. 25. 3115-3122 Giraldo, P; and Montoliu, L; 2001. Size matters: use of YACs, BACs and PACs in transgenic animals. Transgenic Research. 10. 83-103 Glasser, SW; Burhans, MS; Eszterhas, SK; Bruno, MD; and Korfhagen, TR; 2000. Human SP-C gene sequences that confer lung epithelium-specific expression in transgenic mice. Am. J. Physiol. Lung Cell Mol. Physiol. 278. L933-L945 Golding, A; Chandler, S; Ballestar, E; Wolffe, A; and Schlissel, MS; 1999. Nucleosome structure completely inhibits in vitro cleavage by the V(D)J recombinase. EMBO J. 18. 3712-3723 274 Good, RA; Quie, PG; Windhorst, DB; Page, AR; Rodey, GE; White, J; Wolfson, JJ; and Holmes, BH; 1968. Fatal (chronic) granulomatous disease of childhood: a hereditary defect of leukocyte function. Sem. Hematol. 5. 215-254 Gordon, JW; Scangos, GA; Plotkin, DJ; Barbosa, JA and Ruddle, FH; 1980. Genetic transformation of mouse embryos by microinjection of purified DNA. Proc. Natl. Acad Sc!. 77. 7380-7384 Gorham, JD; Guler, ML; Steen, RG; Mackey, AJ; Daly, MJ; Frederick, K; Dietrich, WF; and Murphy, KM; 1996. Genetic mapping of a murine locus controlling development of T helper 1/T helper 2 type responses. Proc. Natl. Acad. Sci. 93. 12467-12472 • Govindaraju, V; Michoud, M; Al-Chalabi, M; Ferraro, P; Powell, WS; and Martin, JG; 2006. Interleukin-8: novel roles in human airway smooth muscle cell contraction and migration. Am. J. Physiol. Cell Physiol. 291. C957-C965 Graf, B; Bushnell, T; and Miller, J; 2007. LFA-1 mediated T cell costimulation through increased localization of TCR./class II complexes to the central supramolecular activation cluster and exclusion of CD45 from the immunological synapse. J. Immunol. 179. 1616-1624 Groettrup, M; Ungewiss, K; Azogui, 0; Palacios, R; Owen, MJ; Hayday, AC; and von Boehmer, H; 1993. A novel disulphide-linked heterodimer on pre-T cells consists of the T cell receptor beta chain and a 33 kd glycoprotein. Cell 75. 283-294 Grun, JL; and Maurer, PH; 1989. Different T helper cell subsets elicited in mice utilizing two different adjuvant vehicles: the role of endogenous interleukin 1 in proliferative responses. Cell Immunol. 121. 134-145 Grunewald, J; Wahlstrom, J; Berlin, M; Wigzell, H; Eklund, A; and Olerup, 0; 2002. Lung restricted T cell receptor AV2S3 + CD4 + T cell expansions in sarcoidosis patients with a shared HLA-DR(3 chain conformation. Thorax 57. 348-352 Guillen, C; McInnes, IB; Vaughan, DM; Kommajosyula, S; Van Berkel, PHC; Leung, BP; Aguila, A; and Brock, JH; 2002. Enhanced Thl repsonse to Staphylococcus aureus infection in human lactoferrin-transgenic mice. J Immunol. 168. 3950-3957 Hagen, G; Wolf, M; Katyal, S; Singh, G; Beato, M; and Suske, G; 1990. Tissue- specific expression, hormonal regulation and 5'-flanking gene region of the rat Clara cell 10 kDa protein: comparison to rabbit uteroglobin. Nuc. Acids. Res. 18. 2939-2946 275 Hahn, M; Nicholson, MJ; Pyrdol, J; and Wucherpfennig, KW; 2005. Unconventional topology of self peptide-major histocompatibility complex binding by a human autoimmune T cell receptor. Nature Immunlogy. 6. 490-496 Hajizadeh, R; Sato, H; Carlisle, J; Nadaf, MT; Evans, W; Shepherd, BE; Miller, RF; Kalams, SA; and Drake W; 2007. Mycobacterium tuberculosis Antigen 85A induces Th1-1 immune responses in systemic sarcoidosis. J. Clin. Immunol. 27. 445- 454 Hall, G; Houghton, CG; Rahbek, JU; Lamb, JR; and Jarman, ER; 2003. Suppression of allergen reactive Th2 mediated responses and pulmonary eosinophilia by intranasal administration of an immunodominant peptide is linked to IL-10 production. Vaccine. 21. 549-561 Hamelmann, E; Schwarze, J; Takeda, K; Oshiba, A; Larsen, GL; Irvin, CG; and Gelfand, EW; 1997. Noninvasive Measurement of Airway Responsiveness in Allergic Mice Using Barometric Plethysmography. Am. J. Respir. Crit. Care Med. 156. 766-775 Han, X; Fan, Y; Wang, S; Yang, J; Bilenki, L; Qiu, H; Jiao, L; and Yang, X; 2004. Dendritic cells from Chlamydia-infected mice show altered Toll-like receptor expression and play a crucial role in inhibition of allergic responses to ovalbumin. Eur. J. Immunol. 34. 981-989 Hansen, G; Berry, G; DeKruyff, RH; and Umetsu, DT; 1999. Allergen-specific Thl cells fail to counterbalance Th2 cell-induced airway hyperreactivity but cause severe airway inflammation. J. Clin.Invest. 103. 175-183 Harrington, CJ; Paez, A; Hunkapiller, T; Mannikko, V; Brabb, T; Ahearn, M; Beeson, C; and Goverman, J; 1998. Differential tolerance is induced in T cells recognizing distinct epitopes of myelin basic protein. Immunity 8. 571-580 Haskins, K; Kubo, R; White, J; Pigeon, M; Kappler, J; and Marrack, P; 1983. The major histocompatibility complex-restrcited antigen receptor on T cells. 1. Isolation with a monoclonal antibody. J. Exp. Med. 157. 1149-1169 Haslam, PL; Turton, CW; Heard, B; Lukoszek, A; Collins, JV; Salsbury, AJ; and Turner-Warwick, M; 1980. Bronchoalveolar lavage in pulmonary fibrosis: comparison of cells obtained with lung biopsy and clinical features. Thorax 35. 9-18 He, X; Janeway, CA; Levine, M; Robinson, E; Preston-Hurlburt, P; Viret, C; and Bottomly, K; 2002. Dual receptor T cells extend the immune repertoire for foreign antigens. Nature Immunology 3. 127-134 Hebert, CA; Luscinskas, FW; Kiely, J; Luis, E; Darbonne, WC; Bennett, GL; Liu, CC; Obin, MS; Gimbrone, MA; and Baker, JB; 1990. Endothelial and 276 leukocyte forms of IL-8: Conversion by thrombin and interactions with neutrophils. J.Immunol. 145. 3033-3040 Hedrick, SM; Cohen, DI; Nielsen, EA; and Davis, MM; 1984. Isolation of cDNA clones encoding T cell-specific membrane-associated proteins. Nature 308. 149-153 Hibbert, L; Pflanz, S; de waal Malefyt, R; and Kastelein, R; 2003. IL-27 and IFN- a signal via Statl and Stat3 and induce T-Bet and IL-12R(32 in naïve T cells. J Interferon and Cyt. Res. 23. 513-522 Hirsch, E; Katanaev, VL; Garlanda, C; Azzolino, 0; Pirola, L; Silengo, L; Sozzani, S; Mantovani, A; Altruda, F; and Wymann, MP; 2000. Central role for G protein-coupled phosphoinositide 3-kinase y in inflammation. Science 287. 1049-1053 Ho, IC; Hodge, MR; Rooney, JW; and Glimcher, LH; 1996. The proto-oncogene c-maf is responsible for tissue-specific expression of interleukin-4. Cell 85. 973-983 Ho, L; Urban, BC; Thickett, DR; Davies, RJO; and McMichael, AJ; 2005. Deficiency of a subset of T cells with immunoregulatory properties in sarcoidosis. Lancet 365. 1062-1072 Hoffman, ES; Passoni, L; Crompton, T; Leu, TMJ; Schatz, DG; Koff, A; Owen, MJ; and Hayday, AC; 1996. Productive T-cell receptor (3 chain gene rearrangement: coincident regulation of cell cycle and clonality during development in vivo. Genes and Development 10. 948-962 Hogan, SP; Matthaei, KI; Young, JM; Koskinen, A; Young, IG; and Foster, PS; 1998. A novel T cell regulated mechanism modulating allergen-induced airways hyperreactivity in BALB/c mice independently of IL-4 and IL-5. J Immunol. 161. 1501-1509 Holler, PD; Holman, PO; Shusta, EV; O'Herrin, S; Wittrup, KD; and Kranz, DM; 2000. In vitro evolution of a T cell receptor with high affinity for peptide/MHC. Proc. Natl. Acad. Sci. 97. 5387-5392 Holmes, WE; Lee, J; Kuang, WJ; Rice, GC; and Wood, WI; 1991. Structure and functional expression of a human interleukin-8 receptor. Science 253. 1278-1280 Hori, S; Nomura, T; and Sakaguchi, S; 2003. Control of regulatory T cell development by the transcription factor Foxp3. Science 299. 1057-1061 Hosken, NA; Shibuya, K; Heath, AW; Murphy, KM; and O'Garra A; 1995. The effect of antigen dose on CD4+ T helper cell phenotype development in a T cell receptor al3 transgenic model. I Exp. Med. 182. 1579-1584 277 Howland, KC; Ausubel, LJ; London, CA; and Abbas, AK; 2000. The roles of CD28 and CD40 ligand in T cell activation and tolerance. J. Immunol. 164. 4465-4470 Hozumi, N; and Tonegawa, S; 1976. Evidence for somatic rearrangement of immunoglobulin genes coding for variable and constant regions. Proc. Natl. Acad. Sci. 73. 3628-3632 Huang, T; MacAry, PA; Eynott, P; Moussavi, A; Daniel, KC; Askenase, PW; Kemeny, DM; and Chung KF; 2001. Allergen-specific Thl cells counteract efferent Th2 cell-dependent bronchial hyperresponsiveness and eosinophilic inflammation partly via IFN-y. J. Immunol. 166. 207-217 Huang, C-Y; Golub, R; Wu, GE; and Kanagawa, 0; 2002. Superantigen-induced TCR a locus secondary rearrangement: Role in tolerance induction. I Immunol. 168. 3259-3265 Huang, C-Y; and Kanagawa, 0; 2004. Impact of early expression of TCR a chain on thymocyte development. Eur. J. Immunol. 34. 1532-1541 Huang, C-Y; Sleckman, BP; and Kanagawa, 0; 2005. Revision of T cell receptor a chain genes is required for normal T lymphocyte development. Proc. Natl. Acad. Sci.102. 14356-14361 Huber, AR; Kunkel, SL; Todd, RF; and Weiss, SJ; 1991. Regulation of transendothelial neutrophil migration by endogenous interleukin-8. Science 254. 99- 102 Hunninghake, GM; Soto-Quiros, ME; Avila, L; Su, J; Murphy, A; Demeo, DL; Ly, NP; Liang, C; Sylvia, JS; Klanderman, BJ; Lange, C; Raby, BA; Silverman, EK; and Celedon, JC; 2007. Polymorphisms in IL13, total IgE, eosinophilia, and asthma exacerbations in childhood. J. Allergy Clin. Immunol. 120. 84-90 Huseby, ES; White, J; Crawford, F; Vass, T; Becker, D; Pinilla, C; Marrack, P; and Kappler, JW; 2005. How the T cell repertoire becomes peptide and MHC specific. Cell 122. 247-260 Huseby, ES; Crawford, F; White, J; Marrack, P and Kappler, JW; 2006. Interface-disrupting amino acids establish specificity between T cell receptors and complexes of major histocompatibility complex and peptide. Nature Immunology 7. 1191-1199 Imanishi, T; Hara, H; Suzuki, S; Susuki, N; Akira, S; and Saito, T; 2007. TLR2 directly triggers Thl effector functions. J.Immunol. 178. 6715-6719 Irvine, DJ; Purbhoo, MA; Krogsgaard, M; and Davis, MM; 2002. Direct observation of ligand recognition by T cells. Nature 419. 845-849 278 Irving, BA; and Weiss, A; 1991. The cytoplasmic domain of the T cell receptor zeta chain is sufficient to couple to receptor-associated signal transduction pathways. Cell. 64. 891-901 Ivanov, II; McKenzie, BS; Zhou, L; Tadokoro, CE; Lepelley, A; Lafaille, JJ; Cua, DJ; and Littman, DR; 2006. The orphan nuclear receptor RORyt directs the differentiation program of proinflammatory IL-17+ T helper cells. Cell 126. 1121-1133 Iwasaki, A; and Kelsall, BL; 1999. Freshly isolated Peyer's patch, but not spleen, dendritic cells produce interleukin 10 and induce the differentiation of T helper type 2 cells. J. Exp. Med. 190. 229-239 Jain, J; McCaffrey, PG; Valge-Archer, VE; and Rao, A; 1992. Nuclear factor of activated T cells contains Fos and Jun. Nature 356. 801-804 Jin, FY; Nathan, C; Radzioch, D; and Ding, A; 1997. Secretory leukocyte protease inhibitor: a macrophage product induced by and antagonistic to bacterial lipopolysaccharide. Cell. 88. 417-426 Johnston, SL; Papi, A; Monick, MM; and Hunninghake, GW; 1997. Rhinoviruses induce interleukin-8 mRNA and protein production in human monocytes. J Infect. Dis. 175. 323-329 Jordan, MS; Boesteanu, A; Reed, AJ; Petrone, AL; Holenbeck, AE; Lerman, MA; Naji, A; and Caton, AJ; 2001. Thymic selection of CD4+ CD25+ regulatory T cells induced by an agonist self-peptide. Nature Immunology 2. 301-306 Jorgensen, JL; Esser, U; Fazekas de St. Groth, B; Reay, PA; and Davis, MM; 1992. Mapping T-cell receptor-peptide contacts by variant peptide immunization of single-chain transgenic. Nature. 355. 224-230 June, CH; Fletcher, MC; Ledbetter, JA; and Samelson, LS; 1990. Increases in tyrosine phosphorylation are detectable before phospholipase C activation after T cell receptor stimulation. I Immunol. 144. 1591-1599 Kalergis, AM; Boucheron, N; Doucey, M-A; Palmieri, E; Goyarts, EC; Vegh, Z; Luescher, IF; and Nathenson, SG; 2001. Efficient T cell activation requires an optimal dwell-time of interactioin between the TCR and the pMHC complex. Nature Immunology 2. 229-234 Kang, H-R; Cho, SJ; Lee, CG; Homer, RJ; and Elias, JA; 2007. Transforming growth factor (TGF)-13 stimulates pulmonary fibrosis and inflammation via a Bax- dependent, Bid-activated pathway that involves Matrix Metalloproteinase-12. J. Biol. Chem. 282. 7723-7732 279 Kappler, J; Kubo, R; Haskins, K; Hannum, C; Marrack, P; Pigeon, M; McIntyre, B; Allison, J; and Trowbridge, I; 1983. The major histocompatibility complex-restricted antigen receptor on T cells in mouse and man: Identification of constant and variable peptides. Cell 35. 295-302 Kappler, JW; Roehm, N; and Marrack, P; 1987. T cell tolerance by clonal elimination in the thymus. Cell 49. 273-280 Kauffman, SL; 1980. Cell proliferation in the mammalian lung. Int. Rev. Exp. Pathol. 22. 131-191 Kaviratne, M; Hesse, M; Leusink, M; Cheever, AW; Davies, SJ; McKerrow, JH; Wakefield, LM; Letterio, JJ; and Wynn, TA; 2004. IL-13 activates a mechanism of tissue fibrosis that is completely TGF-P independent. J. Immunol. 173. 4020-4029 Kawabe, T; Naka, T; Yoshida, K; Tanaka, T; Fujiwara, H; Suematsu, S; Yoshida, N; Kishimoto, T; and Kikutani, H; 1994. The immune responses in CD40- deficient mice: impaired immunoglobulin class switching and germinal center formation. Immunity 1. 167-178 Keane, MP; Belperio, JA; Moore, TA; Moore, BB; Arenberg, DA; Smith, RE; Burdick, MD; Kunkel, SL; and Strieter, RM; 1999. Neutralization of CXC chemokine, macrophage inflammatory protein-2, attenuates bleomycin-induced pulmonary fibrosis. J. Immunol. 162. 5511-5518 Kersh, GJ; Kersh, EN; Fremont, DH; and Allen, PM; 1998. High and low potency ligands with similar affinities for the TCR: The importance of kinetics in TCR signaling. Immunity 9. 817-826 Kiani, A; Viola, JPB; Lichtman, AH; and Rao, A; 1997. Down-regulation of IL-4 gen transcription and control of Th2 cell differentiation by a mechanism involving NFAT1. Immunity 7. 849-860 Kiani, A; Garcia-Cozar, FJ; Habermann, I; Laforsch, S; Aebischer, T; Ehninger, G; and Anjana, R; 2001. Regulation of interferon-y gene expression by nuclear factor of activated T cells. Blood 98. 1480-1488 Kim, DO; Kim, B-S; Lee, SJ; Park, I-S; and Nam, YK; 2004. Comparative analysis of inherited patterns of the transgene in transgenic mud loach Misgurnus mizolepis lines carrying the CAT reporter gene. Fisheries Science 70 201-210 Kimata, H; Yoshida, A; Ishioka, C; Lindley, I; and Mikawa, H; 1992. Interleukin- 8 (IL-8) selectively inhibits immunoglobulin E production induced by IL-4 in human B cells. J. Exp Med. 176. 1227-1231 280 Kishi, H; Borgulya, P; Scott, B; Karjalainen, K; Traunecker, A; Kaufman, J; and von Boehmer, H; 1991. Surface expression of the 13 T cell receptor (TCR) chain in the absence of other TCR or CD3 proteins on immature T cells. EMBO 1 10. 93-100 Kisielow, P; Bluthmann, H; Staerz, UD; Steinmetz, M; and von Boehmer, H; 1988. Tolerance in T-cell-receptor transgenic mice involves deletion of nonmature CD4+8+ thymocytes. Nature. 333. 742-746 Kjer-Nielsen, L; Holmberg, K; Perera, JD; and McCluskey, J; 1992. Impaired expression of chimaeric major histocompatibility complex transgenes associated with plasmid sequences. Transgenic Research. 1. 182-187 Kjer-Nielsen, L; Clements, CS; Purcell, AW; Brooks, AG; Whisstock, JC; Burrows, SR; McCluskey J; and Rossjohn, J; 2003. A structural basis for the selection of dominant af3 T cell receptors in antivral immunity. Immunity 18. 53-64 Kjer-Nielsen, L; Dunstone, MA; Kostenko, L; Ely, LK; Beddoe, T; Mifsud, NA; Purcell, AW; Brooks, AG; McCluskey, J; and Rossjohn, J; 2004. Crystal structure of the human T cell receptor CD3Ey heterodimer complexed to the therapeutic mAb OKT3. Proc. Natl. Acad. Sci. 101. 7675-7680 Klein, L; Klugmann, M; Nave, K-A; Tuohy, VK; and Kyewski, B; 2000. Shaping of the autoreactive T-cell repertoire by a splice variant of self protein expressed in thymic epithelial cells. Nature Medicine 6. 56-61 Knall, C; Young, S; Nick, JA; Buhl, AM; Worthen, GS; and Johnson, GL; 1996. Interleukin-8 regulation of the Ras/Raf/Mitogen-activated protein kinase pathway in human neutrophils. 1 Biol. Chem. 271. 2832-2838 Ko, Y-C; Mukaida, N; Ishiyama, S; Tokue, A; Kawai, T; Matsushima, K; and Kasahara, T; 1993. Elevated interleukin-8 levels in the urine of patients with urinary tract infections. Infection and Immunity 61. 1307-1314 Koch, M; Witzenrath, M; Reuter, C; Herma, M; Schutte, H; Suttorp, N; Collins, H; and Kaufmann, SHE; 2006. Role of local pulmonary IFN-y expression in murine allergic airway inflammation. Am. J Respir. Cell. MoL Biol. 35. 211-219 Koga, T; 1993. Neutrophilia and high level of interleukin-8 in the bronchoalveolar lavage fluid of diffuse panbronchiolitis. Kurume Med. 1 40. 139-146 Kohno, K; Kataoka, J; Ohtsuki, T; Suemoto, Y; Okamoto, I; Usui, M; Ikeda, M; and Kurimoto, M; 1997. IFN-y-inducing factor (IGIF) is a costimulatory factor on the activation of Thl but not Th2 cells and exerts its effect independently of IL-12. J. Immunol. 158. 1541-1550 281 Kolanus, W; Romeo, C; and Seed, B; 1993. T cell activation by clustered tyrosine kinases. Cell 74. 171-183 Komori, S; Katsumata, M; Greene, MI; and Yui, K; 1993. Frequent deletion of the transgene in T cell receptor beta chain transgenic mice. Int. ImmunoL 5. 161-167 Komori, T; Okada, A; Stewart, V; and Alt, FW; 1993. Lack of N regions in antigen receptor variable region genes of TdT-deficient lymphocytes. Science 261. 1171-1175 Konstan, MW; Hilliard, KA; Norvell, TM; and Berger, M; 1994. Bronchoalveolar lavage findings in cystic fibrosis patients with stable, clinically mild lung disease suggest ongoing infection and inflammation. Am. J Respir. Crit. Care Med. 150. 448- 454 Kopf, M; Le Gros, G; Bachmann, M; Lamers, MC; Bluethmann, H; and Kohler, G; 1993. Disruption of the murine IL-4 gene blocks Th2 cytokine responses. Nature 362. 245-248 Kouskoff, V; Signorelli, K; Benoist, C; and Mathis, D; 1995. Cassette vectors directing expression of T cell receptor genes in transgenic mice. Journal of Immunological Methods. 180. 273-280 Krogsgaard, M; Prado, N; Adams, EJ; He, X-I; Chow, D-C; Wilson, DB; Garcia, KC; and Davis, MM; 2003. Evidence that structural rearrangements and / or flexibility during TCR binding can contribute to T cell activation. Mol. Cell 12. 1367- 1378 Krug, N; Madden, J; Redington, AE; Lackie, P; Djukanovic, R; Schauer, U; Holgate, ST; Frew, AJ; and Howarth, PH; 1996. T-cell cytokine profile evaluated at the single cell level in BAL and blood in allergic asthma. Am. J Respir. Cell MoL Biol. 14. 319-326 Kruit, A; Grutters, JC; Ruven, HJT; van Moorsel, CHM; Weiskirchen, R; Mengsteab, S; and van den Bosch, JMM; 2006. Transforming growth factor-f3 gene polymorphisms in sarcoidosis patients with and without fibrosis. Chest 129. 1584- 1591 Kucharzik, T; Hudson, JT; Lugering, A; Abbas, JA; Bettini, M; Lake, JG; Evans, ME; Ziegler, TR; Merlin, D; Madara, JL; and Williams, IR; 2005. Acute induction of human IL-8 production by intestinal epithelium triggers neutrophil infiltration without mucosal injury. Gut 54. 1565-1572 Kung, TT; Jones, H; Adams, GK; Umland, SP; Kreutner, W; Egan, RW; Chapman, RW; and Watnick, AS; 1994. Characterization of a murine model of allergic pulmonary inflammation. Int. Arch. Allergy ImmunoL 105. 83-90 282 Kuperman, DA; Huang, X; Nguyenvu, L; Holscher, C; Brombacher, F; and Erle, DJ; 2005. IL-4 receptor signaling in clara cells is required for allergen induced mucus production. J Immunol. 175. 3746-3752 Kurashima, K; Mukaida, N; Fujimura, M; Schroder, J-M; Matsuda, T; and Matsushima, K; 1996. Increase of chemokine levels in sputum precedes exacerbation of acute asthma attacks. J Leukoc. Biol. 59. 313-316 Kurdowska, A; Noble, JM; Steinberg, KP; Ruzinski, JT; Hudson, LD; and Martin, TR; 2001. Anti-interleukin 8 autoantibody:interleukin 8 complexes in the acute respiratory distress syndrome. Am. J. Respir. Crit. Care. Med. 163. 463-468 Kurup, VP; Mauze, S; Choi, H; Seymour, BWP; and Coffman, RL; 1992. A murine model of allergic bronchopulmonary aspergillosis with elevated eosinophils and IgE. J. Immunol. 148. 3783-3788 Kurup, VP; Seymour, BW; Choi, H; and Coffman, RL; 1994. Particulate Aspergillus fumigatus antigens elicit a Th2 response in BALB/c mice. J. Allergy Clin. Immunol. 93. 1013-1020 Kwan, J; and Killeen, N; 2004. CCR7 directs the migration of thymocytes into the thymic medulla. J. Immunol. 172. 3999-4007 Lakso, M; Sauer, B; Mosinger, B; Lee, EJ; Manning, RW; Yu, SH; Mulder, KL; and Westphal, H. 1992. Targeted oncogene activation by site-specific recombination in transgenic mice. Proc. Natl. Acad. Sci. USA. 89. 6232-6236 Langrish, CL; Chen, Y; Blumenschein, WM; Mattson, J; Basham, B; Sedgwick, JD; McClanahan, T; Kastelein, RA; and Cua, DJ; 2005. IL-23 drives a pathogenic T cell population that induces autoimmune inflammation. J Exp. Med. 201. 233-240 Lansford, R; Manis, JP; Sonoda, E; Rajewsky, K; and Alt, FW; 1998. Ig heavy chain class switching in rag-deficient mice. Int. Immunol. 10. 325-332 Lanzavecchia, A; Lezzi G; and Viola, A; 1999. From TCR engagement to T cell activation: a kinetic view of T cell behavior. Cell 96. 1-4 Larsen, CG; Anderson, AO; Appella, E; Oppenheim, JJ; and Matsushima, K; 1989. The neutrophil-activating protein (NAP-1) is also chemotactic for T lymphocytes. Science 243. 1464-1466 Lebman, DA; and Coffman, RL; 1988. Interleukin 4 causes isotype switching to IgE in T cell-stimulated clonal B cell cultures..1 Exp. Med. 168. 853-862 Lee, JJ; McGarry, MP; Farmer, SC; Kenzler, KL; Larson, KA; Carrigan, PE; Brenneise, IE; Horton, MA; Haczku, A; Gelfand, EW; Leikauf, GD; and Lee, 283 NA; 1997. Interleukin-5 expression in the lung epithelium of transgenic mice leads to pulmonary changes pathognomonic of asthma. J Exp. Med. 185. 2143-2156 Lee, YL; Fu, CL; Ye, YL; and Chiang, BL; 1999. Administration of interleukin-12 prevents mite Der p 1 allergen-IgE antibody production and airway eosinophil infiltration in an animal model of airway inflammation. Scand. J Immunol. 49. 229- 236 Lee, HJ; Takemoto, N; Kurata, H; Kamogawa, Y; Miyatake, S; O'Garra, A; and Arai, N; 2000. GATA-3 induces T helper cell type 2 (Th2) cytokine expression and chromatin remodeling in committed Thl cells. J. Exp. Med. 192. 105-115 Lee, CG; Homer, RJ; Zhu, Z; Lanone, S; Wang, X; Koteliansky, V; Shipley, JM; Gotwals, P; Noble, P; Chen, Q; Senior, RM; and Elisa, JA; 2001. Interleukin-13 induces tissue fibrosis by selectively stimulating and activating transforming growth factor p. J. Exp. Med. 194. 809-821 Lee, DU; Agarwal, S; and Rao, A; 2002. Th2 lineage commitment and efficient IL-4 production involves extended demethylation of the IL-4 gene. Immunity 16. 649-660 Lee, CG; Cho, SJ; Kang, MJ; Chapoval, SP; Lee, PJ; Noble, PW; Yehualaeshet, T; Lu, B; Flavell, RA; Milbrandt, J; Homer, RJ; and Elias, JA; 2004. Early growth response gene-1 mediated apoptosis is essential for transforming growth factor P.-induced pulmonary fibrosis. J Exp. Med. 200. 377-389 Lezzi, G; Scotet, E; Scheidegger, D; and Antonio, L; 1999. The interplay between the duration of TCR and cytokine signalling determines T cell polarization. Eur. J. ImmunoL 29. 4092-4101 Li, Y; Huang, Y; Lue, J; Quandt, JA; Martin, R; and Mariuzza, RA; 2005. Structure of a human antoimmune TCR bound to a myelin basic protein self-peptide and a multiple sclerosis-associated MHC class II molecule. EMBO J 24. 2968-2979 Lin, J; and Weiss, A; 2003. The tyrosine phosphatase CD148 is excluded from the immunologic synapse and down-regulates prolonged T cell signaling. J. Cell Biol. 162. 673-682 Lira, SA; 1996. Genetic approaches to study chemokine function. J. Leuk. Biol. 59. 45-52 Listman, JA; Rimm, IJ; Wang, Y; Geller, M; Tang, JC; Ho, S; Finn, PW; and Perkins, DL; 1996. Plasticity of the T cell receptor repertoire in TCR p-chain transgenic mice. Cellular Immunology 167. 44-55 Liston, A; Lesage, S; Gray, DHD; O'Reilly, LA; Strasser, A; Fahrer, AM; Boyd, RL; Wilson, J; Baxter, AG; Gallo, EM; Crabtree, GR; Peng, K; Wilson, SR; and 284 Goodnow, CC; 2004. Generalised resistance to thymic deletion in the NOD mouse: a Polygenic trait characterized by defective induction of Bim. Immunity 21. 817-830 Lobito, AA; Yang, B; Lopes, MF; Miagkov, A; Adams, RN; Palardy, GR; Johnson, MM; McFarland, HI; Recher, M; Drachman, DB; and Lenardok, MJ; 2002. T cell receptor transgenic mice recognizing the immunodominant epitope of the Torpedo californica acetylcholine receptor. Eur. J. Immunol. 32. 2055-2067 Loetscher, P; Seitz, M; Clark-Lewis, I; Baggiolini, M; and Moser, B; 1996. Activation of NK cells by CC chemokines: chemotaxis, Ca2+ mobilization, and enzyme release. J. Immunol. 156. 322-327 Lois, C; Hong, EJ; Pease, S; Brown, EJ; and Baltimore, D; 2002. Germline transmission and tissue-specific expression of transgenes delivered by lentiviral vectors. Science 295. 868-872 Loonstra, A; Vooijs, M; Beverloo, HB; Allak, BA; van Drunen, E; Kanaar, R; Berns, A; and Jonkers, J; 2001. Growth inhibition and DNA damage induced by Cre recombinase in mammalian cells. Proc. Natl. Acad. Sci. 98. 9209-9214 Lund, T; O'Reilly, L; Hutchings, P; Kanagawa, 0; Simpson, E; Gravely, R; Chandler, P; Dyson, J; Picard, JK; Edwards, A; Kioussis, D; and Cooke, A; 1990. Prevention of insulin-dependent diabetes mellitus in non-obese diabetic mice by transgenes encoding modified I-A I3-chain or normal I-E a chain. Nature. 345. 727- 729 Lund, RJ; Loytomaki, M; Naumanen, T; Dixon, C; Chen, Z; Ahlfors, H; Tuomela, S; Tahvanainen, J; Scheinin, J; Henttinen, T; Rasool, 0; and Lahesmaa, R; 2007. Genome-wide identification of novel genes involved in early Thl and Th2 differentiation. J. Immunol. 178. 3648-3660 Lyons, DS; Lieberman, SA; Hampl, J; Boniface, JJ; Chien, Y; Berg, LJ; and Davis, MM; 1996. A TCR binds to antagonist ligands with lower affinities and faster dissociation rates than to agonists. Immunity 5. 53-61 Ma, B; Liu, W; Homer, RJ; Lee, PJ; Coyle, AJ; Lora, JM; Lee, CG; and Elias, JA; 2006. Role of CCR5 in the pathogenesis of IL-13 induced inflammation and remodeling. J. Immunol. 176. 4968-4978 Macatonia, SE; Hosken, NA; Litton, M; Vieira, P; Hsieh, C-S; Culpepper, JA; Wysocka, M; Trinchieri, G; Murphy, KM; and O'Garra, A; 1995. Dendritic cells produce IL-12 and direct the development of Thl cells from naïve CD4+ T cells. .1 Immunol. 154. 5071-5079 285 Madrenas, J; Wange, RL; Wang, JL; Isakov, N; Samelson, LE; and Germain, RN; 1995. Zeta phosphorylation without ZAP-70 activation induced by TCR antagonists or partial agonists. Science 267. 515-518 Magram, J; Connaughton, SE; Warrier, RR; Carvajal, DM; Wu, C; Ferrante, J; Stewart, C; Sarmiento, U; Faherty, DA; and Gately, MK; 1996. IL-12-defieicent mice are defective in IFN-y production and type 1 cytokine responses. Immunity 4. 471-481 Mahler, DA; Huang, S; Tabrizi M; and Bell, GM; 2004. Efficacy and safety of a monoclonal antibody recognizing interleukin-8 in COPD. Chest 126. 926-934 Malherbe, L; Filippi, C; Julia, V; Foucras, G; Moro, M; Appel, H; Wucherpfennig, K; Guery, J-C; and Glaichenhaus, N; 2000. Selective activation and expansion of high affinity CD4+ T cells in resistant mice upon infection with Leishmania major. Immunity 13. 771-782 Manning, TC; Parke, EA; Teyton, L; and Kranz, DM; 1999. Effects of complementarity determining region mutations on the affinity of an a/f3 T cell receptor: measuring the energy associated with CD4/CD8 repertoire skewing. J Exp. Med. 189. 461-470 Marcoval, J; Benitez, MA; Alcaide, F; and Mana, J; 2005. Absence of ribosomal RNA of Mycobacterium tuberculosis complex in sarcoidosis. Arch. Dermatol. 141. 57-59 Marolleau, JP; Fondell, JD; Malissen, M; Trucy, J; Barbier, E; Marcu, KB; Cazenave, PA; and Primi, D; 1988. The joining of germ-line V alpha to J alpha genes replaces the preexisting V alpha-J alpha complexes in a T cell receptor alpha, beta positive T cell line. Cell 55. 291-300 Martich, GD; Danner, RL; Ceska, M; and Suffredini, AF; 1991. Detectioni of interleukin 8 and tumor necrosis factor in normal humans after intravenous endotoxin: the effect of anti-inflammatory agents. I Exp. Med. 173. 1021-1024 Matsui, K; Boniface, JJ; Steffner, P; Reay, PA; and Davis, MM; 1994. Kinetics of T-cell receptor binding to peptide/I-Ek complexes: Correlation of the dissociation rate with T-cell responsiveness. Proc. Natl. Acad. Sci. 91. 12862-12866 Matsui, H; Wagner, VE; Hill, DB; Schwab, UE; Rogers, TD; Button, B; Taylor, RM; Superfine, R; Rubinstein, M; Iglewski, BH; and Boucher, RC; 2006. A physical linkage between cystic fibrosis airway surface dehydration and Pseudomonas aeruginosa biofilms. Proc. Natl. Acad. Sci. 103. 18131-18136 Matsushima, K; Morishita, K; Yoshimura, T; Lavu, S; Kobayashi, Y; Lew, W; Appella, E; Kung, HF; Leonard, EJ; and Oppenheim, JJ. 1988. Molecular cloning 286 of a human monocyte-derived neutrophil chemotactic factor (MDNCF) and the induction of MDNCF mRNA by interleukin 1 and tumor necrosis factor. J. Exp. Med. 167. 1883-1893 Mayerova, D; and Hogquist, KA; 2004. Central tolerance to self-antigen expressed by cortical epithelial cells. J. Immunol. 172. 851-856 Mazza, C; Auphan-Anezin, N; Gregoire, C; Guimezanes, A; Kellengerger, C; Roussel, A; Kearney, A; van der Merwe, PA; Schmitt-Verhulst, A; and Malissen, B; 2007. How much can a T-cell antigen receptor adapt to structurally distinct antigenic peptides. EMBO J 26. 1972-1983 McBlane, JF; van Gent, DC; Ramsden, DA; Romeo, C; Cuomo, CA; Gellert, M; and Oettinger, MA; 1995. Cleavage at a V(D)J recombination signal requires only RAG1 and RAG2 proteins and occurs in two steps. Cell 83. 387-395 McGargill, MA: Derbinski, JM; and Hogquist, KA; 2000. Receptor editing in developing T cells. Nature Immunology 1. 336-341 McHeyzer-Williams, LJ; Panus, JF; Mikszta, JA; and McHeyzer-Williams, MG; 1999. Evolution of antigen-specific T cell receptors in vivo: preimmune and antigen- driven selection of preferred complimentarity-determining region 3 (CDR3) motifs. J Exp.Med. 189. 1823-1837 McHugh, RS; Shevach, EM; Marguiles DH and Natarajan, K; 2001. A T cell receptor transgenic model of severe, spontaneous organ-specific autoimmunity. Eur. J. Immunol. 31. 2094-2103 McMahan, CJ; and Fink, PJ; 1998. RAG Reexpression and DNA recombination at T cell receptor loci in peripheral CD4+ T cells. Immunity 9. 637-647 McMillan, SJ; and Lloyd, CM; 2004. Prolonged allergen challenge in mice leads to persistent airway remodelling. Clin. Exp. Allergy 34. 497-507 Mee, PJ; Turner, M; Basson, AM; Costello, PS; Zamoyska, R; and Tybulewicz, VLJ; 1999. Greatly reduced efficiency of both positive and negative selection of thymocytes in CD45 tyrosine phosphatase-deficient mice. Eur. J. Immunol. 29. 2923- 2933 Mehlhop, PD; van de Run, M; Goldberg, AB; Brewer, JP; Kurup, VP; Martin, TR; and Oettgen, HC; 1997. Allergen-induced bronchial hyperreactivity and eosinophilic inflammation occur in the absence of IgE in a mouse model of asthma. Proc. Natl. Acad. Sci. 94. 1344-1349 Mendel, I; Natarajan, K; Ben-Nun, A; and Shevach, EM; 2004. A novel protective model against experimental allergic encephalomyelitis in mice expressing a transgenic 287 TCR-specific for myelin oligodendrocyte glycoprotein. Journal of Neuroimmunology. 149. 10-23 Metzger, D; Clifford, J; Chiba, H; and Chambon, P; 1995. Conditional site- specific recombination in mammalian cells using a ligand-dependent chimeric Cre recombinase. Proc. Natl. Acad. Sci. 92. 6991-6995 Middleton, J; Neil, S; Wintle, J; Clark-Lewis, I; Moore, H; Lam, C; Auer, M; Hub, E; and Rot, A; 1997. Transcytosis and surface presentation of IL-8 by venular endothelial cells. Cell 91. 385-395 Minguet, S; Swamy, M; Alarcon, B; Luescher, IF; and Schamel, WWA; 2007. Full activation of the T cell receptor requires both clustering and conformational changes at CD3. Immunity. 26. 43-54 Mio, T; Romberger, DJ; Thompson, AB; Robbins, RA; Heires, A; and Rennard, SI; 1997. Cigarette smoke induces interleukin-8 release from human bronchial epithelial cells. Am. J Respir. Crit. Care Med. 155. 1770-1776 Mitchell, DN; Rees, RJ; and Goswami, KK; 1976. Transmissible agents from human sarcoid and Crohn's disease tissues. Lancet 2. 761-765 Moller, DR; Forman, JD; Liu, MC; Noble, PW; Greenlee, BM; Vyas, P; Holden, DA; Forrester, JM; Lazarus, A; Wysocka, M; Trinchieri, G; and Karp, C; 1996. Enhanced expression of IL-12 associated with Thl cytokine profiles in active pulmonary sarcoidosis. J. Immunol. 156. 4952-4960 Moller, DR; 2003. Pulmonary fibrosis of sarcoidosis. New approaches, old ideas. Am. J. Respir. Cell Mot Biol. 29. S37-S41 Mombaerts, P; Iacomini, J; Johnson, RS; Herrup, K; Tonegawa, S; and Papaioannou, VE; 1992a. RAG-1 deficient mice have no mature B and T lymphocytes. Cell 68. 869-877 Mombaerts, P; Clarke, AR; Rudnicki, MA; Iacomini, J; Itohara, S; Lafaille, JJ; Wang, L; Ichikawa, Y; Jaenisch, R; and Hooper ML; 1992b. Mutations in T-cell antigen receptor genes alpha and beta block thymocyte development at different stages. Nature. 360. 225-231 Monks, CRF; Freiberg, BA; Kupfer, H; Sciaky, N; and Kupfer, A; 1998. Three- dimensional segregation of supramolecular activation clusters in T cells. Nature 395. 82-86 Montalbano, A; Ogwaro, KM; Tang, A; Matthews, AG; Larijani, M; Oettinger, MA; and Feeney, AJ; 2003. V(D)J recombination frequencies can be profoundly affected by changes in the spacer sequences. J. Immunol. 171. 5296-5304 288 Monticelli, S; and Rao, A; 2002. NFAT1 and NFAT2 are positive regulators of IL-4 gene transcription. Eur. .1 Immunol. 32. 2971-2978 Morohashi, H; Miyawaki, T; Nomura, H; Kuno, K; Murakami, S; Matsushima, K; and Mukaida, N; 1995. Expression of both types of human interleukin-8 receptors on mature neutrophils, monocytes, and natural killer cells. I Leukoc. Biol. 57. 180- 187 Mosmann, TR; and Coffman, RL; 1989. Thl and Th2 cells: Different patterns of lymphokine secretion lead to different functional properties. Ann. Rev. Immunol. 7. 145-173 Muhlebach, MS; Stewart, PW; Leigh, MW; and Noah, TL; 1999. Quantitation of inflammatory responses to bacteria in young cystic fibrosis and control patients. Am. J. Respir. Crit. Care Med. 160. 186-191 Muhlebach, MS; Reed, W; Noah, TL; 2004. Quantitative cytokine gene expression in CF airway. Pediatric Pulmonology 37. 393-399 Mul, FPJ; Zuurbier, AEM; Janssen, H; Calafat, J; van Wetering, S; Hiemstra, PS; Roos, D; and Hordijk, PL; 2000. Sequential migration of neutrophils across monolayers of endothelial and epithelial cells. I Leukoc. Biol. 68. 529-537 Muramatsu, M; Sankaranand, VS; Anant, S; Sugai, M; Kinoshita, K; Davidson, NO; and Honjo, T; 1999. Specific expression of activation-induced cytidine deaminase (AID), a novel member of the RNA-editing deaminase family in germinal center B cells. I Biol. Chem. 274. 18470-18476 Murayama, T; Ohara, Y; Obuchi, M; Khabar, K; Higashi, H; Mukaida, N; and Matsushima, K; 1997. Human cytomegalovirus induces interleukin-8 production by a human monocytic cell lines, THP-1, through acting concurrently on AP-1 and NF-xB binding sites of the Interleukin-8 gene. J. Virology 71. 5692-5695 Murphy, KM; Heimberger, AB; and Loh, DY; 1990. Induction by antigen of intrathymic apoptosis of CD4+ CD8+ TCRlo thymocytes in vivo. Science 250. 1720- 1723 Murphy, PM; and Tiffany, HL; 1991. Cloning of complementary DNA encoding a functional human interleukin-8 receptor. Science 253. 1280-1283 Murray, JS; Pfeiffer, C; Madri, J; and Bottomly, K; 1992. Major histocompatibility complex (MHC) control of CD4 T cell subset activation. II. A single peptide induces either humoral or cell-mediated responses in mice of distinct MHC genotype. Eur. .1 Immunol. 22. 559-565 289 Mustelin, T; Coggeshall, MK; and Altman A; 1989. Rapid activation of the T-cell tyrosine protein kinase pp56" by the CD45 phosphotyrosine phosphatase. Proc. Natl. Acad. Sci. 86. 6302-6306 Nakagawa, H; Hatakeyama, S; Ikesue, A; and Miyai, H; 1991. Generation of interleukin-8 by plasmin from AVLPR interleukin-8, the human fibroblast derived neutrophil chemotactic factor. FEBS 282. 412-414 Navab, R; Wang, Y; Chow, Y; Wang, A; Jankov, RP; Takamoto, N; Tsai, SY; Tsai, M; Transwell, AK; and Hu, J; 2002. Regulation of Human Clara Cell 10 kD protein expression by chicken Ovalbumin upstream promoter transcription factors (COUP-Tfs) Am. J. Respir. Cell Mot Biol. 27. 273-285 Nicholson, LB; Greer, JM; Sobel, RA; Lees, MB; and Kuchroo, VK; 1995. An altered peptide ligand mediates immune deviation and prevents autoimmune encephalomyelitis. Immunity 3. 397-405 Niederberger, N; Holmberg, K; Alam, SM; Sakati, W; Naramura, M; Gu, H; and Gascoigne, NRJ; 2003. Allelic exclusion of the TCR a-chain is an active process requiring TCR mediated signaling and c-Cbl. J. Immunol. 170. 4557-4563 Nishiwaki, T; Yoneyama, H; Eishi, Y; Matsuo, N; Tatsumi, K; Kimura, H; Kuriyama, T; and Matsushima, K; 2004. Indigenous pulmonary propionibacterium acnes primes the host in the development of sarcoid-like pulmonary granulomatosis in mice. Am. J. Path. 165. 631-639 Nocker, RE; Schoonbrood, DF; van de Graaf, EA; Hack, CE; Lutter, R; Jansen, HM; and Out, TA; 1996. Interleukin-8 in airway inflammation in patients with asthma and chronic obstructive pulmonary disease. Int. Arch. Allergy Immunol. 109. 183-191 Norman, PS; Ohman, JL; Long, AA; Creticos, PS; Gefter, MA; Shaked, Z; Wood, RA; Eggleston, PA; Hafner, KB; Rao, P; Lichtenstein, LM; Jones, NH; and Nicodemus, CF; 1996. Treatment of cat allergy with T-cell reactive peptides. Am. J. Respir. Crit. Care Med. 154. 1623-1628 O'Shea, H; Yousaf, N; Altmann, D; Fehervari, Z; Tonks, P; Hetherington, C; Harach, S; Bland, C; Cooke A; and Lund, T; 2006. Effect of X- and Y- Box Deletions on the Development of Diabetes in H-2Ea-Chain Transgenic Nonobese Diabetic Mice. Scandinavian Journal of Immunology. 63. 17-25 Oestreich, KJ; Cobb, RM; Pierce, S; Chen, J; Ferrier, P; and Oltz, EM; 2006. Regulation of TCR(3 gene assembly by a promoter/enhancer holocomplex. Immunity 24. 381-391 290 Ohshima, Y; Yang, L-P; Uchiyama, T; Tanaka, Y; Baum, P; Sergerie, M; Hermann, P and Delespesse, G; 1998. OX40 costimulation enhances interleukin-4 (IL-4) expression at priming and promotes the differentiation of naive human CD4+ T cells into high IL-4 producing effectors. Blood 92. 3338-3345 Oka, M; Norose, K; Matsushima, K; Nishigori, C; and Herlyn, M; 2006. Overexpression of IL-8 in the cornea induces ulcer formation in the SCID mouse. Br. J Ophthalmol 90. 612-615 Ono, M; Yaguchi, H; Ohkura, N; Kitabayashi, I; Nagamura, Y; Nomura, T; Miyachi, Y; Tsukada, T; and Sakaguchi, S; 2007. Foxp3 controls regulatory T-cell function by interacting with AML1/Runxl. Nature 446. 685-689 Oosterwijk, MF; Juwana, H; Arens, R; Tesselaar, K; van Oers, MHJ; Eldering, E; and van Lier, RAW; 2007. CD27-CD70 interactions sensitise naive CD4+ T cells for IL-12 induced Thl cell development. Int. Immunot 19. 713-718 Pack, RJ; Al-Ugaily, LH; and Morris G; 1981. The cells of the tracheobronchial epithelium of the mouse: a quantitative light and electron microscope study. Journal of Anatomy. 132. 71-84. Padovan, E; Casorati, G; Dellabona, P; Meyer, S; Brockhaus, M; and Lanzavecchia, A; 1993. Expressioni of two T cell receptor alpha chains: dual receptor T cells. Science 262. 422-424 Padovan, E; Giachino, C; Cella, M; Valitutti, S; Acuto, 0; and Lanzavecchia, A; 1995. Normal T lymphocytes can express two different T cell receptor beta chains: implications for the mechanism of allelic exclusion. J Exp. Med. 181. 1587-1591 Padrines, M; Wolf, M; Walz, A; and Baggiolini, M; 1994. Interleukin-8 processing by neutrophil elastase, cathepsin G and proteinase-3. FEBS Letters. 352. 231-235 Pai, S; Truitt, M; and Ho, I-C; 2004. GATA-3 deficiency abrogates the development and maintenance of T helper type 2 cells. Proc. Natl. Acad. Sci. 101. 1993-1998 Palmiter, RD; Brinster, RL; Hammer, RE; Trumbauer, ME; Rosenfeld, MG; Brinberg, NC; and Evans, RM; 1982. Dramatic growth of mice that develop from eggs microinjected with metallothionein-growth hormone fusion genes. Nature 300. 611-615 Pannetier, C; Cochet, M; Darche, S; Casrouge, A; Zoller, M; and Kourilsky, P; 1993. The sizes of the CDR3 hypervariable regions of the murine T-cell receptor l chains vary as a function of the recombined germ-line segments. Proc. Natl. Acad. Sci. USA. 90. 4319-4323. 291 Park, H; Li, Z; Yang, ZO; Chang, SH; Nurieva, R; Wang, Y-H; Wang, Y; Hood, L; Zhu, Z; Tian, Q; and Dong, C; 2005. A distinct lineage of CD4 T cells regulates tissue inflammation by producing interleukin 17. Nature Immunology 6. 1133-1141 Park, JH; Chang, HS; Park, C-S; Jang, A-S; Park, BL; Rhim, TY; Uh, S-T; Kim, YH; Chung, IY; and Shin, HD; 2007. Association analysis of CD40 polymorphisms with asthma and the level of serum total IgE. Am. I Respir. Crit. Care Med. 175. 775- 782 Patton, SE; Gilmore, LB; Jetten, AM; Nettesheim, P; and Hook, GE; 1986. Biosynthesis and release of proteins by isolated pulmonary Clara cells. Exp. Lung Res. 11. 277-294 Paust, S; Lu, L; McCarty, N; and Cantor, H; 2004. Engagement of B7 on effector T cells by regulatory T cells prevents autoimmune disease. Proc. Natl. Acad. Sci. 101. 10398-10403 Peng, SL; Gerth, AJ; Ranger, AM; and Glimcher, LH; 2001. NFATcl and NFATc2 together control both T and B cell activation and differentiation. Immunity. 14. 13-20 Perez, A; Issler, AC; Cotton, CU; Kelley, TJ; Verkman, AS; and Davis, PB; 2007. CFTR inhibition mimics the cystic fibrosis inflammatory profile. Am. J. Physiol. Lung Cell Mol. Physiol. 292. L383-L395 Pfeiffer, C; Stein, J; Southwood, S; Ketelaar, H; Sette, A; and Bottomly, K; 1995. Altered peptide ligands can control CD4 T lymphocyte differentiation in vivo. J. Exp. Med. 181. 1569-1574 Pignatti, P; Moscato, G; Casarini, S; Delmastro, M; Poppa, M; Brunetti, G; Pisati, P; and Balbi, B; 2005. Downmodulation of CXCL8/IL-8 receptors on neutrophils after recruitment in the airways. I Allergy Clin. Immunol. 115. 88-94 Porter, CM; and Clipstone, NA; 2002. Sustained NFAT signaling promotes a Thl - like pattern of gene expression in primary murine CD4+ T cells. I Immunol. 168. 4936-4945 Punnonen, J; Aversa, G; Cocks, BG; McKenzie, ANJ; Menon, S; Zurawski, G; de waal Malefyt, R; and de Vries, JE; 1993. Interleukin 13 induces interleukin 4 independent IgG4 and IgE synthesis and CD23 expressiono by human B cells. Proc. Natl. Acad. Sci. 90. 3730-3734 Rajarathnam, K; Sykes, BD; Kay, CM; Dewald, B; Geiser, T; Baggiolini, M; and Clark-Lewis, I; 1994. Neutrophil activation by monomeric interleukin-8. Science 264. 90-92 292 Randolph, DA; Carruthers, CJL; Szabo, SJ; Murphy, KM; and Chaplin, DD; 1999. Modulation of airway inflammation by passive transfer of allergen-specific Thl and Th2 cells in a mouse model of asthma. J Immunol. 162. 2375-2383 Ranger, AM; Oukka, M; Rengarajan, J; and Glimcher, LH; 1998a. Inhibitory function of two NFAT family members in lymphoid homeostasis and Th2 development. Immunity 9. 627-635 Ranger, AM; Hodge, MR; Gravallesse, EM; Oukka, M; Davidson, L; Alt, FW; de la Brousse, FC; Hoey, T; Grusby, M; and Glimcher, LH; 1998b. Delayed lymphoid repopulation with defects in IL-4 driven responses produced by inactivation of NF-ATc. Immunity 8. 125-134 Rankin, JA; Picarella, DE; Geba, GP; Temann, UA; Prasad, B; DiCosmo, B; Tarallo, A; Stripp, B; Whitsett, J; and Flavell, RA; 1996. Phenotypic and physiologic characterisation of transgenic mice expressing interleukin 4 in the lung; Lymphocytic and eosinophilic inflammation without airway hyperreactivity. Proc. Natl. Acad. Sci. USA. 93. 7821-7825. Rathmell, JC; Lindsten, T; Zong, W; Cinalli, RM; and Thompson, CB; 2002. Deficiency in Bak and Bax perturbs thymic selection and lymphoid homeostasis. Nature Immunology 3. 932-939 Raulet, DH; Garman, RD; Saito, H; and Tonegawa, S; 1985. Developmental regulation of T-cell receptor gene expression. Nature 314. 103-107 Redecke, V; Hacker, H; Datta, SK; Fermin, A; Pitha, PM; Broide, DH; and Raz, E; 2004. Activation of Toll-like receptor 2 induces a Thl immune response and promotes experimental asthma. J. Immunol. 172. 2739-2743 Reich, Z; Boniface, JJ; Lyons, DS; Borochov, N; Wachtel, EJ; Davis, MM; 1997. Ligand-specific oligomerization of T-cell receptor molecules. Nature 387. 617-620 Reinhard, C; Eder, G; Fuchs, H; Ziesenis, A; Heyder, J; and Schulz, H; 2002. Inbred strain variation in lung function. Mammalian Genome 13. 429-437 Reinherz, EL; Tan, K; Tang, L; Kern, P; Liu, J; Xiong, Y; Hussey, RE; Smolyar, A; Hare, B; Zhang, R; Joachimlak, A; Chang, H; Wagner, G; and Wang, J; 1999. The crystal structure of a T cell receptor in complex with peptide and MHC class II. Science 286. 1913-1921 Reiser, H; Freeman, GJ; Razi-Wolf, Z; Gimmi, CD; Benacerraf, B; and Nadler, LM; 1992. Murine B7 antigen provides an efficient costimulatory signal for activation of murine T lymphocytes via the T-cell receptor/CD3 complex. Proc. Natl. Acad. Sci. 89. 271-275 293 Reiser, J; Gergoire, C; Darnault, C; Mosser, T; Guimezanes, A; Schmitt- Verhulst, A; Fontecilla-Camps, JC; Mazza, G; Malissen, B; and Housset, D; 2002. A T cell receptor CDR3 (3 loop undergoes conformational changes of unprecedented magnitude upon binding to a peptide/MHC class I complex. Immunity 16. 345-354 Reiser, J; Darnault, C; Gregoire, C; Mosser, T; Mazza, G; Kearney, A; van der Mervwe, PA; Fontecilla-Camps, JC; Housset, D; and Malissen, B; 2003. CDR3 loop flexibility contributes to the degeneracy of TCR recognition. Nature Immunology 4. 241-247 Remick, DG; Green, LB; Newcomb, DE; Garg, SJ; Bolgos, GL; and Call, DR; 2001. CXC chemokine redundancy ensures local neutrophil recruitment during acute inflammation. Am. J. Path. 159. 1149-1157 Richman-Eisenstat, JBY; Jorens, PG; Hebert, CA; Ueki, I; and Nadel, JA; 1993. Interleukin-8: an important chemoattractant in sputum of patients with chronic inflammatory airway diseases. Am. J Physiol. 264. L413-L418 Risueno, RM; van Santen, HM; and Alarcon, B; 2006. A conformational change senses the strength of T cell receptor-ligand interaction during thymic selection. Proc. Natl. Acad. Sci. 103. 9625-9630 Ritchie, WA; Neil, C; King, T; Bruce, C; and Whitelaw, A; 2007. Transgenic embryos and mice produced from low titre lentiviral vectors. Transgenic Res. (online ahead of print) Robertson, G; Garrick, D; Wu, W; Kearns, M; Martin, D; and Whitelaw, E; 1995. Position-dependent variegation of globin transgene expression in mice. Proc. Natl. Acad. ScL 92. 5371-5375 Robinson, DS; Hamid, Q; Ying, S; Tsicopoulos, A; Barkans, J; Bentley, AM; Corrigan, C; Durham, DR; and Kay, AB; 1992. Predominant Th2 like bronchoalveolar T-lymphocyte population in atopic asthma. N Eng. J Med. 326. 298- 304 Rogers, DF; 1994. Airway goblet cells: responsive and adaptable front-line defenders. EurRespir. J 7. 1690-1706 Rojas, M; Woods, CR; Mora, AL; Xu, J; Brigham, KL; 2005. Endotoxin-induced lung injury in mice: structural, functional and biochemical responses. Am. J Physiol. Lung Cell MoL Physiol. 288. L333-L341 Rot, A; 1991. Chemotactic potency of recombinant human neutrophil attractant / activation protein-1 (Interleukin-8) for polymorphonuclear leukocytes of different species. Cytokine. 3. 21-27 294 Roth, DB; Nakajima, PB; Menetski, JP; Bosma, MJ; and Gellert, M; 1992. V(D)J recombination in mouse thymocytes: Double-strand breaks near T cell receptor 8 rearrangement signals. Cell 69. 41-53 Ruiz, M; Giudicelli, V; Ginestoux, C; Stoehr, P; Robinson, J; Bodmer, J; Marsh, SGE; Bontrop, R; Lemaitre, M; Lefranc, G; Chaume, D; and Lefranc, M; 2000. IMGT, the international ImMunoGeneTics database. Nuc. Acids Res. 28. 219-221 Saint-Ruf, C; Ungewiss, K; Groettrup, M; Bruno, L; Fehling, HJ; and von Boehmer, J; 1994. Analysis and expression of a cloned pre-T cell receptor gene. 266. 1208-1212 Sakaguchi, S; Sakaguchi, N; Asano, M; Itoh, M; and Toda, M; 1995. Immunologic self tolerance maintained by activated T cells expressing IL-2 receptor a chains (CD25). J. Immunol. 155. 1151-1164 Salmon, P; Boyer, 0; Lores, P; Jami, J; and Klatzmann, D; 1996. Characterization of an intronless CD4 minigene expressed in mature CD4 and CD8 T cells, but not expressed in immature thymocytes..1 Immunol. 156. 1873-1879 Samanta, AK; Oppenheim, JJ; and Matsushima, K; 1990. Interleukin 8 (Monocyte derived neutrophil chemotactic factor) dynamically regulates its own receptor expression on human neutrophils. J. Biol. Chem. 265. 183-189 Samelson, LE; Harford, JB; and Klausner, RD; 1985. Identification of the components of the murine T cell antigen receptor complex. Cell 43. 223-231 Sant'Angelo, DB; Cresswell, P; Janeway, CD; and Denzin, LK; 2001. Maintenance of TCR clonality in T cells expressing genes for two TCR heterodimers. Proc. Natl. Acad. Sci. 98. 6824-6829 Sarukhan, A; Garcia, C; Lanoue, A; and von Boehmer, H; 1998. Allelic inclusion of T cell receptor a genes poses an autoimmune hazard due to low level expression of autospecific receptors. Immunity 8. 563-570 Scapini, P; Carletto, A; Nardelli, B; Calzetti, F; Roschke, V; Mergio, F; Tamassia, N; Pieropan, S; Biasi, 0; Sbarbati, A; Sozzani, S; Bambara, L; and Cassatella, MA; 2005. Proinflammatory mediators elicit secretion of the intracellular B lymphocyte stimulator pool (BLys) that is stored in activated neutrophils: implications for inflammatory diseases. Blood 105. 830-837 Schamel, WWA; Arechaga, I; Risueno, RM; van Santen, HM; Cabezas, P; Risco, C; Valpuesta, JM; and Alarcon, B; 2005. Coexistence of multivalent and monovalent TCRs explains high sensitivity and wide range of response. J. Exp. Med. 202. 493-503 295 Schilham, MW; Fung-Leung, WP; Rahemtulla, A; Kuendig, T; Zhang, L; Potter, J; Miller, RG; Hengartner, H; and Mak, TW; 1993. Alloreactive cytotoxic T cells can develop and function in mice lacking both CD4 and CD8. Eur. J. Immunol. 23. 1299-1304 Schmekel, B; Karlsson, SE; Linden, M; Sundstrom, C; Tegner, H; and Venge, P; 1990. Myeloperoxidase in human lung lavage. I. A marker of local neutrophil activity. Inflammation. 14. 447-454 Schmidt-Supprian, M; Tian, J; Grant, EP; Pasparakis, M; Maehr, R; Ovaa, H; Ploegh, HL; Coyle, AJ; and Rajewsky, K; 2004. Differential dependence of CD4+CD25+ regulatory and natural killer-like T cells on signals leading to NF-KB activation. Proc. Natl. Acad. Sci. 101. 4566-4571 Schmielau, J; and Finn, OJ; 2001. Activated granulocytes and granulocyte-derived hydrogen peroxide are the underlying mechanism of suppression of T-cell function in advanced cancer patients. Cancer Research. 61. 4756-4760 Schmitt, E; Hoehn, P, Huels, C; Goedert, S; Palm, N; Rude, E; and Germann, T; 1994. T helper type 1 development of naïve CD4+ T cells requires the coordinate action of interleukin-12 and interferon-gamma and is inhibited by transforming growth factor-beta. Eur. J. Immunol. 24. 793-798 Schroder, J; Mrowietz. U; Morita, E; and Christophers, E; 1987. Purification and partial biochemical characterization of a human monocyte-derived, Neutrophil- activating peptide that lacks interleukin 1 activity. I Immunol. 139. 3474-3483 Secrist, JP; Burns, LA; Karnitz, L; Koretzky, GA; and Abraham, RT; 1993. Stimulatory effects of the protein tyrosine phosphatase inhibitor, pervanadate, on T- cell activation events. J. Biol.Chem. 268. 5886-5893 Segal, DM; Taurog, JD; and Metzger, H; 1977. Dimeric immunoglobulin E serves as a unit signal for mast cell degranulation. Proc. Natl. Acad. Sci. 74. 2993-2997 Seidman, JG; Nau, MM; Norman, B; Kwan, S-P; Scharff, M; and Leder, P; 1980. Immunoglobulin V/J recombination is accompanied by deletion of joining site and variable region segments. Proc. Natl. Acad. Sci. 77. 6022-6026 Serfling, E; Barthelmas, R; Pfeuffer, I; Schenk, B; Zarius, S; Swoboda, R; Mercurio, F; and Karin, M; 1989. Ubiquitous and lymphocyte-specific factors are involved in the induction of the mouse interleukin 2 gene in T lymphocytes. EMBO J. 8. 465-473 296 Shao, MXG; and Nadel, JA; 2005. Neutrophil elastase induces MUC5AC mucin production in human airway epithelial cells via a cascade involving protein kinase C, reactive oxygen species, and TNF-a-converting enzyme. J Immunol. 175. 4009-4016 Shaw, JP; Utz, PJ; Durand, DB; Toole, JJ; Emmel, EA; and Crabtree, GR; 1988. Identification of a putative regulator of early T cell activation genes. Science 241. 202- 205 Shijubo, N; Itoh, Y; Shigehara, K; Yamaguchi, T; Itoh, K; Shibuya, Y; Takahashi, R; Ohchi, T; Ohmichi, M; Hiraga, Y; and Abe, S; 2000. Association of Clara cell 10-kDa protein, spontaneous regression and sarcoidosis. Eur. Respir. J 16. 414-419 Shimoda, K; van Deursen, J; Sangster, MY; Sarawar, SR; Carson, RT; Tripp, RA; Chu, C; Quelle, FW; Nosaka, T; Vignali, DA; Doherty, PC; Grosveld, G; Paul, WE; and Ihle, JN; 1996. Lack of IL-4 induced Th2 response and IgE class switching in mice with disrupted Stat6 gene. Nature 380. 630-633 Shinkai, Y; Rathbun, G; Lam, KP; Oltz, EM; Stewart, V; Mendelsohn, M; Charron, J; Datta, M; Young, F; and Stall, AM; 1992. RAG-2 deficient mice lack mature lymphocytes owing to ability to initate V(D)J rearrangement. Cell 68. 855-867 Shinkai, Y; Koyasu, S; Nakayama, K; Murphy, KM; Loh, DY; Reinherz, EL; and Alt, FW; 1993. Restoration of T cell development in RAG-2 deficient mice by functional TCR transgenes. Science 259. 822-825 Sigurs, N; Gustafsson, PM; Bjarnason, R; Lundberg, F; Schmidt, S; Sigurbergsson, F; and Kjellman, B; 2005. Severe respiratory syncytial virus bronchiolitis in infancy and asthma and allergy at age 13. Am. J. Respir. Crit. Care Med. 171. 137-141 Sime, PJ; Xing, Z; Graham, FL; Csaky, KG; and Gauldie, J; 1997. Adenovector- mediated gene transfer of active transforming growth factor pi induces prolonged severe fibrosis in rat lung. J. Clin. Invest. 100. 768-776 Simonet, WS; Hughes, TM; Nguyen, HQ; Trebasky, LD; Danllenko, DM; and Medlock, ES; 1994. Long-term impaired neutrophil migration in mice overexpressing interleukin-8. J. Clin. Invest. 94. 1310-1319 Singer, M; and Sansonetti, PJ; 2004. IL-8 is a key chemokine regulating neutrophil recruitment in a new mouse model of Shigella-induced colitis. J. Immunol. 173. 4197- 4206 Sisson, TH; Hansen, JM; Shah, M; Hanson, KE; Du, M; Ling, T; Simon, RH; and Christensen, PJ; 2006. Expression of the reverse tetracycline transactivator gene causes emphysema-like changes in mice. Am. J Respir. Cell MoL Biol. 34. 552-560 297 Sloan-Lancaster, J; Shaw, AS; Rothbard, JB; and Allen, PM; 1994. Partial T cell signalling: altered phospho-zeta and lack of zap70 recruitment in APL-induced T cell anergy. Cell 79. 913-922 Sloane, AJ; Linder, RA; Prasad, SS; Sebastian, LT; Pedersen, SK; Robinson, M; Bye, PT; Nielson, DW; and Harry, JL; 2005. Proteomic analysis of sputum from adults and children with cystic fibrosis and from control subjects. Am. J Respir. Crit. Care. Med. 172. 1416-1426 Song, Z; Marzilli, L; Greenlee, BM; Chen, ES; Silver, RF; Askin, FB; Teirstein, AS; Zhang, Y; Cotter, RJ; and Moller, DR; 2005. Mycobacterial catalase- peroxidase is a tissue antigen and target of the adaptive immune response in systemic sarcoidosis. J. Exp. Med. 201. 755-767 Sospedra, M; Ferrer-Francesch, X; Dominguez, 0; Juan, M; Foz-Sala, M; and Pujoll-Borrell, R; 1998. Transcription of a broad range of self-antigens in human thymus suggests a role for central mechanisms in tolerance toward peripheral antigens. J. Immunol. 161. 5918-5929 Speir, JA; Stevens, J; Joly, E; Butcher, GW; and Wilson, IA; 2001. Two different, highly exposed, bulged structures for an unusually long peptide bound to rat MHC class I RT1-A. Immunity 14. 81-92 Spiotto, MT; Reth, MA; and Schreiber, H; 2003. Genetic changes occurring in established tumors rapidly stimulate new antibody responses. Proc. Natl. Acad. Sci. 100. 5425-5430 Sporri, R; and e Sousa, CR; 2002. Self peptide/MHC class I complexes have a negligible effect on the response of some CD8+ T cells to foreign antigen. Eur. J. Immunol. 32. 3161-3170 Stern, LJ; and Wiley, DC; 1994. Antigenic peptide binding by class I and class II histocompatibility proteins. Structure 2. 245-251 Stoll, S; Delon, J; Brotz, TM; and Germain, RN; 2002. Dynamic imaging of T cell- dendritic cell interactions in lymph nodes. Science 296. 1873-1876 Straus, DB; and Weiss, A; 1992. Genetic evidence for the involvement of the lck tyrosine kinase in signal transduction through the T cell antigen receptor. Cell 70. 585- 593 Stricter, RM; Polverini, PJ; Kunkel, SL; Arenberg, DA; Burdick, MD; Kasper, J; Dzuiba, J; Van Damme, J; Walz, A; Marriott, D; Chan, S-Y; Roczniak, S; and Shanafelt, AB; 1995. The functional role of the ELR motif in CXC chemokine- mediated angiogenesis. J. Biol. Chem. 270. 27348-27357 298 Stripp, BR; Sawaya, PL; Luse, DS; Wikenheiser, KA; Wert, SE; Huffman, JA; Lattier, DL; Singh, G; Katyal, SL; and Whitsett, JA; 1992. cis- Acting Elements That Confer Lung Epithelial Cell Expression of the CCio Gene. I Biol. Chem. 267. 14703-14712 Sugiyama, S; Kohyama, M; Oda, M; Azuma, T; Wither, JE; and Hozumi, N; 2004. Molecular basis of antigen recognition by insulin specific T cell receptor. Immunol. Letters 91. 133-139 Suri-Payer, E; and Cantor, H; 2001. Differential cytokine requirements for regulation of autoimmune gastritis and colitis by CD4+ CD25+ T cells. I Autoimmunity 16. 115-123 Sussman, JJ; Bonifacino, JS; Lippincott-Schwartz, J; Weissman, AM; Saito, T; Klausner, RD; and Ashwell, JD; 1988. Failure to synthesize the T cell CD3-zeta chain: structure and function of a partial T cell receptor complex. Cell 52. 85-95 Suzuki, I; Hizawa, N; Yamaguchi, E; and Kawakami, Y; 2000. Association between a C+33T polymorphism in the IL-4 promoter region and total serum IgE levels. Clin. Exp. Allergy 30. 1746-1749 Sykulev, Y; Brunmark, A; Jackson, M; Cohen, RJ; Peterson, PA; and Eisen, HN; 1994. Kinetics and affinity of reactions between an antigen-specific T cell receptor and peptide-MHC complexes. Immunity 1. 15-22 Sykulev, Y; Joo„M; Vturina, I; Tsomides, TJ; and Eisen, HN; 1996. Evidence that a single peptide-MHC complex on a target cell can elicit a cytolytic T cell response. Immunity 4. 565-571 Szabo, SJ; Kim, ST; Costa, GL; Zhang, X; Fathman, CG; and Glimcher, LH; 2000. A novel transcription factor, T-bet, directs Thl lineage commitment. Cell 100. 655-669 Szymczak, AL; Workman, CJ; Gil, D; Dilioglou, S; Vignali, KM; Palmer, E; and Vignali, DAA; 2005. The CD3E proline-rich sequence, and its interaction with Nck, is not required for T cell development and function. J. Immunol. 175. 270-275 Taboit-Dameron, F; Malassagne, B; Viglietta, C; Puissant, C; Leroux-Coyau, M; Chereau, C; Attal, J; Weill, B; and Houdebine, L-M; 1999. Association of the 5'HS4 sequence of the chicken P-globin locus control region with human EF la gene promoter induces ubiquitous and high expression of human CD55 and CD59 cDNAs in transgenic rabbits. Transgenic Research 8. 223-235 299 Takacs, K; Douek, DC; and Altmann, DM; 1995. Exacerbated autoimmunity associated with a T helper-1 cytokine profile shift in H-2E transgenic mice. Eur. J. Immunol. 25. 3134-3141 Takagi, H; Hiroi, T; Yang, L; Tada, Y; Yuki, Y; Takamura, K; Ishimitsu, R; Kawauchi, H; Kiyono, H; and Takaiwa, F; 2005. A rice based edible vaccine expressing multiple T cell epitopes induces oral tolerance for inhibition of Th2- mediated IgE responses. Proc. Natl. Acad Sci. 102. 17525-17530 Takhar, P; Corrigan, CJ; Smurthwaite, L; O'Connor, BJ; Durham, SR; Lee, TH; and Gould, HJ; 2007. Class switch recombination to IgE in the bronchial mucosa of atopic and nonatopic patients with asthma. J. Allergy Clin. Immunol. 119. 213-218 Takizawa, H; Ohtoshi, T; Kawasaki, S; Kohyama, T; Desaki, M; Kasama, T; Kobayashi, K; Nakahara, K; Yamamoto, K; Matsushima, K; and Kudoh, S; 1999. Diesel exhaust particles induce NF-KB activation in human bronchial epithelial cells in vitro: Importance in cytokine transcription. J. Immunol. 162. 4705-4711 Tao, X; Grant, C; Constant, S; and Bottomly, K; 1997. Induction of IL-4 producing CD4÷ T cells by antigenic peptides altered for TCR binding. J. Immunol. 158. 4237- 4244 Taubert, R; Schwendermann, J; and Kyewski, B; 2007. Highly variable expression of tissue restricted self-antigens in human thymus: Implications for self tolerance and autoimmunity. Eur. J. Immunol. 37. 838-848 Temann, UA; Prasad, B; Gallup, MW; Basbaum, C; Ho, SB; Flavell, RA; and Rankin, JA; 1997. A novel role for murine IL-4 in vivo: induction of MUC5AC gene expression and mucin hypersecretion. Am. J. Respir. Cell Mol. Biol. 16. 471-478 Temann, UA; Geba, GP; Rankin, JA; and Flavell, RA; 1998. Expression of interleukin 9 in the lungs of transgenic mice causes airway inflammation, mast cell hyperplasia, and bronchial hyperresponsiveness. J. Exp. Med. 188. 1307-1320 Thierfelder, WE; van Deursen, JM; Yamamoto, K; Tripp, RA; Sarawar, SR; Carson, RT; Sangster, MY; Vignali, DA; Doherty, PC; Grosveld, GC and Ihle, JN; 1996. Requirement for Stat4 in interleukin-12 mediated responses of natural killer and T cells. Nature 382. 171-174 Thompson, AB; Bohling, T; Payvandi, F; and Rennard, SI; 1990. Lower respiratory tract lactoferrin and lysozyme arise primarily in the airways and are elevated in association with chronic bronchitis. .1 Lab Clin. Med. 115. 148-158 Thompson, C; Cloutier, A; Bosse, Y; Thivierge, M; Le Gouill, C; Larivee, P; McDonald, PP; Stankova, J; and Rola-Pleszczynski, M; 2006. CysLT1 receptor 300 engagement inducese activator protein-1 and NF-KB dependent IL-8 expression. Am. J. Respir. Cell Mol. Biol. 35. 697-704 Tonics, NK; Charbonneau, H; Diltz, CD; Fisher, EH; and Walsh, KA; 1988. Demonstration that the leukocyte common antigen CD45 is a protein tyrosine phosphatase. Biochemistry 27. 8695-8701 Trautmann, A; and Randriamampita, C; 2003. Initiation of TCR signalling revisited. Trends in Immunology. 24. 425-428 Trautmann, L; Rimbert, M; Echasserieau, K; Saulquin, X; Neveu, B; Dechanet, J; Cerundolo, V; and Bonneville, M; 2005. Selection of T cell clones expressing high-affinity public TCRs within human cytomegalovirus-specific CD8 T cell responses. J. Immunol. 175. 6123-6132 Trembleau, S; Germann, T; Gately, MK; and Adorini, L; 1995. The role of IL-12 in the induction of organ-specific autoimmune diseases. Immunology Today 16. 383- 386 Tripathi, R; Jackson, A; and Krangel, MS; 2002. A change in the structure of 1/13 chromatin associated with TCR p allelic exclusion. J. Immunol. 168. 2316-2324 Trop, S; Rhodes, M; Wiest, DL; Hugo, P; and Zuniga-Pflucker, JC; 2000. Competitive displacement of pTa by TCR a during TCR assembly prevents surface coexpression of Pre-TCR and a13 TCR. J. Immunol. 165. 5566-5572 Troughton, PR; Platt, R; Bird, H; el-Manzalawi, E; Bassiouni, M; and Wright, V; 1996. Synovial fluid interleukin-8 and neutrophil function in rheumatoid arthritis and seronegative polyarthritis. Br. J. Rheumatol. 35. 1244-1251 Tsai, WC; Strieter, RM; Wilkowski, JM; Bucknell, KA; Burdick, MD; Lira, SA; and Standiford, TJ; 1998. Lung-specific Transgenic expression of KC enhances resistance to Klebsiella pneumoniae in mice. J Immunol. 161. 2435-2440 Tsai, WC; Strieter, RM; Mehrad, B; Newstead, MW; Zeng, X; and Standford, TJ; 2000. CXC chemokine receptor CXCR2 is essential for protective innate host response in murine Pseudomonas aeruginosa pneumonia. Infection and Immunity 68. 4289-4296 Turner, SJ; Cose, SC; and Carbone, FR; 1996. TCR a chain usage can determine antigen-selected TCR p chain repertoire diversity. J. Immunol. 157. 4979-4985 Tynan, FE; Burrows, SR; Buckle, AM; Clements, CS; Borg, NA; Miles, JJ; Beddoe, T; Whisstock, JC; Wilce, MC; Silins, SL; Burrows, JM; Kjer-Nielsen, L; Kostenko, L; Purcell, AW; McCluskey, J; and Rossjohn, J; 2005. T cell receptor 301 recognition of a "super-bulged" major histocompatibility complex class I-bound peptide. Nature Immunology 11. 1114-1122 Uematsu, Y; Ryser, S; Dembic, Z; Borgulya, P; Krimpenfort, P; Berns, A; von Boehmer, H; and Steinmetz, M; 1988. In transgenic mice the introduced functional T cell receptor beta gene prevents expression of endogenous beta genes. Cell 52. 831- 841 Underhill, DM; Ozinsky, A; Smith, KD; and Aderem A; 1999. Toll-like receptor -2 mediates mycobacteria-induced proinflammatory signalling in macrophages. Proc. Natl. Acad. Sci. 96. 14459-14463 Usui, T; Preiss, JC; Kanno, Y; Yao, ZJ; Bream, JH; O'Shea, JJ; and Strober, W; 2006. T-bet regulates Thl responses through essential effects on GATA-3 function rather than on IFNG gene acetylation and transcription. J Exp. Med. 203. 755-766 Vaitaitis, GM; Poulin, M; Sanderson, RJ; Haskins, K; and Wagner, DH; 2003. CD40 induced expression of recombination activating gene (RAG) 1 and RAG2: A mechanism for the generation of autoaggressive T cells in the periphery. J. Immunol. 170. 3455-3459 van der Merwe, PA; Davis, SJ; Shaw, AS; and Dustin, ML; 2000. Cytoskeletal polarization and redistribution of cell-surface molecules during T cell antigen recognition. Sem. Immunol. 12. 5-21 van Gent, DC; Ramsden, DA; and Gellert, M; 1996. The RAG1 and RAG2 proteins establish the 12/23 rule in V(D)J recombination. Cell 85. 107-113 van Gisbergen, K; Sanchez-Hernandez, M; Geijtenbeek, T; and van Kooyk, Y; 2005. Neutrophils mediate immune modulation of dendritic cells through glycosylation-dependent interactions between Mac-1 and DC-SIGN. J. Exp. Med. 201. 1281-1292 Vowles, C; Chan, VSF; and Bodmer, HC; 2000. Subtle Effects on Myelin Basic Protein-Specific T Cell Responses Can Lead to a Major Reduction in Disease Susceptibility in Experimental Allergic Encephalomyelitis. J Immunol. 165. 75-82 Walker, DG; Link, J; Lue, L-F; Dalsing-Hemandez, JE; and Boyes, BE; 2006. Gene expression changes by amyloid (3 peptide-stimulated human postmortem brain microglia identify activation of multiple inflammatory processes. J. Leukoc. Biol. 79. 596-610 Wallace, WAH; Ramage, EA; Lamb, D; and Howie, SEM; 1995. A type2 (Th2- like) pattern of immune response predominates in the pulmonary interstitium of patients with cryptogenic fibrosing alveolitis (CFA). Clin. Exp. Immunol. 101. 436- 441 302 Walz, A; Peveri, P; Aschauer, H; and Baggiolini, M; 1987. Purification and amino acid sequencing of NAF, a novel neutrophil-activating factor produced by monocytes. Biochem. Biophys. Res. Commun. 149. 755-761 Wang, J; Wakeham, J; Harkness, R; and Xing, Z; 1999. Macrophages are a significant source of type 1 cytokines during mycobacterial infection. J. Clin. Invest. 103. 1023-1029 Wang, Z; Zheng, T; Zhu, Z; Homer, RJ; Riese, RJ; Chapman, HA; Shapiro, SD; and Elias, JA; 2000. Interferon y induction of pulmonary emphysema in the adult murine lung. J. Exp. Med. 192. 1587-1599 Weaver, CT; Pingel, JT; Nelson, JO; and Thomas, ML; 1991. CD8 T cell clones deficient in the expression of the CD45 protein tyrosine phosphatase have impaired responses to T cell receptor stimuli. Mol. Cell. Biol. 11. 4415-4422 Wedderburn, LR; O'Hehir, RE; Hewitt, CR; and Lamb, JR; 1993. In vivo clonal dominance and limited T cell receptor usage in human CD4+ T cell recognition of house dust mite allergens. Proc. Natl. Acad Sci. 90. 8214-8218 Whitehurst, CE; Schlissel, MS; and Chen, J; 2000. Deletion of germline promoter PD[31 from the TCR13 locus causes hypermethylation that impairs D[31 recombination by multiple mechanisms. Immunity. 13. 703-714 Wiekowski, MT; Leach, MW; Evans, EW; Sullivan, L; Chen, S-C; Vassileva, G; Bazan, JF; Gorman, DM; Kastelein, RA; Narula, S; and Lira, SA; 2001a. Ubiquitous transgenic expression of the IL-23 subunit p19 induces multiorgan inflammation, runting, infertility, and premature death. J. Immunol. 166. 7563-7570 Wiekowski, MT; Chen, S-C; Zalamea, P; Wilburn, BP; Kinsley, DJ; Sharif, WW; Jensen, KK; Hedrick, JA; Manfra, D; and Lira, SA; 2001b. Disruption of neutrophil migration in a conditional transgenic model: Evidence for CXCR2 densensitization in vivo. J. Immunol. 167. 7102-7110 Wilcox, BE; Gao, GF; Wyer, JR; Ladbury, JE; Bell, JI; Jakobsen, BK; and van der Merwe, PA; 1999. TCR binding to peptide-MHC stabilizes a flexible recognition interface. Immunity 10. 357-365 Williams, LM; and Rudensky, AY; 2007. Maintenance of the Foxp3-dependent develeopmental program in mature regulatory T cells requires continued expression of Foxp3. Nature Immunology. 8. 277-284 Wilson, A; Held, W; and MacDonald, HR; 1994. Two waves of recombinase gene expression in developing thymocytes. J. Exp. Med. 179. 1355-1360 303 Wu, LC; Tuot, DS; Lyons, DS; Garcia, KC; and Davis, MM; 2002. Two-step binding mechanism for T-cell receptor recognition of peptide-MHC. Nature 418. 552- 556 Wu, Y; Borde, M; Heissmeyer, V; Feuerer, M; Lapan, AD; Stroud, JC; Bates, DL; Guo, L; Han, A; Ziegler, SF; Mathis, D; Benoist, C; Chen, L; and Rao, A; 2006. FOXP3 controls regulatory T cell function through cooperation with NFAT. Cell 126. 375-387 Wynn, TA; Eltoum, I; Cheever, AW; Lewis, FA; Gause, WC; and Sher, A; 1993. Analysis of cytokine mRNA expression during primary granuloma formation induced by eggs of Schistosoma mansoni. J. Immunol. 151. 1430-1440 Wynn, TA; Cheever, AW; Jankovic, D; Poindexter, RW; Caspar, P, Lewis, FA; and Sher, A; 1995. An IL-12 based vaccination method for preventing fibrosis induced by schistosome infection. Nature 376. 594-596 Xu, L; Xie, K; Mukaida, N; Matsushima, K; and Fidler, I; 1999. Hypoxia-induced elevation in interleukin-8 expression by human ovarian carcinoma cells. Cancer Research. 59. 5822-5829 Xiong, D; Yajima, T; Lim, B; Stenbit, A; Dublin, A; Dalton, ND; Summers- Torres, D; Molkentin, JD; Duplain, H; Wessely, R; Chen, J; and Knowlton, KU; 2007. Inducible cardiac-restricted expression of enteroviral protease 2A is sufficient to induce dilated cardiomyopathy. Circulation. 115. 94-102 Yamamoto, C; Yoneda, T; Yoshikawa, M; Fu, A; Tokuyama, T; Tsukaguchi, K; and Narita, N; 1997. Airway inflammation in COPD assessed by sputum levels of interleukin-8. Chest 112. 505-510 Yang, Y; Ochando, J; Yopp, A; Bromberg, JS; and Ding, Y; 2005. IL-6 plays a unique role in initiating c-Maf expression during early stage of CD4 T cell activation. J. Immunol. 174. 2720-2729 Yiamouyiannis, CA; Schramm, CM; Puddington, L; Stengel, P; Baradaran- Hosseini, E; Wolyniec, WW; Whiteley, HE; and Thrall, RS; 1999. Shifts in lung lymphocyte profiles correlate with the sequential development of acute allergic and chronic tolerant stages in a murine asthma model. Am. J. Path. 154. 1911-1921 Yokosuka, T; Takase, K; Suzuki, M; Nakagawa, Y; Taki, S; Takahashi, H; Fujisawa, T; Arase, H; and Saito, T; 2002. Predominant role of T cell receptor (TCR) a chain in forming preimmune TCR repertoire revealed by clonal TCR reconstitution system. J. Exp. Med. 195. 991-1001 Yoshida, H; Nishina, H; Takimoto, H; Marengere, LEM; Wakeham, AC; Bouchard, D; Kong, Y-Y; Ohteki, T; Shahinian, A; Bachmann, M; Ohashi, PS; 304 and Penninger, JM; 1998. The transcription factor NF-ATcl regulates lymphocyte proliferation and Th2 cytokine production. Immunity. 8. 115-124 Yoshikawa, T; Dent, G; Ward, J; Angel:), G; Nong, G; Nomura, N; Hirata, K; and Djukanovic, R; 2007. Impaired neutrophil chemotaxis in chronic obstructive pulmonary disease. Am. J Respir. Crit. Care Med. 175. 473-479 Yoshimura, T; Matsushima, K; Tanaka, S; Robinson, EA; Appella, E; Oppenheim, JJ; and Leonard, EJ; 1987. Purification of a human monocyte-derived neutrophil chemotactic factor that has a peptide sequence similarity to other host defence cytokines. Proc. Natl. Acad. Sci. 84. 9233-9237 Zal, T; Weiss, S; Mellor, A; and Stockinger, B; 1996. Expression of a second receptor rescues self-specific T cells from thymic deletion and allows activation of autoreactive effector function. Proc. Natl. Acad. Sci. 93. 9102-9107 Zerrahn, J; Held, W; and Raulet, DH; 1997. The MHC reactivity of the T cell reperoire prior to positive and negative selection. Cell 88. 627-636 Zhang, W; Sloan-Lancaster, J; Kitchen, J; Trible, RP; and Samelson, LE; 1998. LAT: The ZAP-70 tyrosine kinase substrate that links T cell receptor to cellular activation. Cell 92. 83-92 Zhang, W, Irvin, BJ; Trible, RP; Abraham, RT; and Samelson, LE; 1999. Functional analysis of LAT in TCR—mediated signalling pathways using a LAT deficient Jurkat cell line. Int. ImmunoL 11. 943-950 Zheng, W; and Flavell, RA; 1997. The transcription factor GATA-3 is necessary and sufficient for Th2 cytokine gene expression in CD4 T cells. Cell 89. 587-596 Zheng, T; Zhu, Z; Wang, Z; Homer, RJ; Ma, B; Riese, RJ; Chapman, HA; Shapiro, SD; and Elias, JA; 2000. Inducible targeting of IL-13 to the adult lung causes matrix metalloproteinase- and cathepsin- dependent emphysema. J Clin. Invest. 106. 1081-1093 Zhong, W; and Reinherz, EL; 2004. In vivo selection of a TCR V13 repertoire directed against an immunodominant influenza virus CTL epitope. Int. Immunol. 16. 1549-1559 Zhu, Z; Homer, RJ; Wang, Z; Chen, Q; Geba, GP, Wang, J; Zhang, Y; and Elias, JA; 1999. Pulmonary expression of interleukin-13 causes inflammation, mucus hypersecretion , subepithelial fibrosis, physiologic abnormalities, and eotaxin producton. J. Clin. Invest. 103. 779-788 305 Zhu, Z; Ma, B; Homer, RJ; Zheng, T; and Elisas, JA; 2001. Use of the tetracycline-controlled transcriptional silencer (tTS) to eliminate transgene leak in inducible overexpression transgenic mice. J. Biol. Chem. 278. 25222-25229 Zhu, Z; Zheng, T; Lee, CG; Homer, RJ; and Elias, JA; 2002. Tetracycline- controlled transcriptional regulation systems: advances and application in transgenic animal modelling. Cell & Dev. Biol. 13. 121-128 Zhu, J; Nathan, C; Jin, W; Sim, D; Ashcroft, GS; Wahl, SM; Lacomis, L; Erdjument-Bromage, H; Tempst, P; Wright, CD; and Ding, A; 2002. Conversion of proepithelin to epithelins: roles of SLPI and elastase in host defense and wound repair. Cell. 111. 867-878 Zissel, G; Homolka, J; Schlaak, J; Schlaak, M; and Muller-Quernheim , J; 1996. Anti-inflammatory cytokine release by alveolar macrophages in pulmonary sarcoidosis. Am. J. Respir. Crit. Care Med. 154. 713-719 Zlotnik, A; and Yoshie, 0; 2000. Chemokines: A new classification system and their role in immunity. Immunity 12. 121-127 306 Appendices Appendix 1. Stock solutions and Buffers TE ■ 10 mM Tris (pH 8.0) (Sigma-T1503) ■ 1 mM EDTA (pH 8.0) (Sigma-E4884) TAE ■ 40 mM Tris-acetate ■ 1 mM EDTA (pH 8.0) Tissue digestion buffer for genomic DNA extraction ■ 100 mM Tris (pH 8.0) ■ 5 mM EDTA ■ 200 mM NaC1 (Sigma-S7653) ■ 0.2 % w/v SDS (Calbiochem-428015) Competent cell preparation solution A ■ 10 mM MgC12 (Sigma-M2670) ■ 0.2 mM MES (Sigma-M5287) ■ 0.05 mM CaC12 (Sigma-C7902) Competent cell preparation solution B ■ 15 % glycerol (BDH-101186M) ■ 50 mM CaC12 ■ 10 mM MgC12 ■ 2 mM MES Southern blot depurination solution ■ 11 mM HC1 (BDH-101254M) 307 Southern blot denaturing buffer ■ 1.5 M NaC1 ■ 0.5 M NaOH (BDH-102524X) Southern blot neutralisation buffer ■ 1.5 M NaC1 ■ 0.5 M Tris (pH 7.5) 1 x SSC ■ 0.015 M Tri-sodium citrate (Sigma-S4641) ■ 0.15 M NaC1 Maleic acid wash buffer ■ 0.1 M Maleic acid (Sigma-M0375) ■ 0.15 M NaC1 adjust to pH 7.5 with concentrated NaOH ■ 0.3 % v/v Tween 20 (Sigma-P7949) DIG detection buffer ■ 0.1 M Tris ■ 0.1 M NaC1 adjust to pH 9.5 Immunohistochemistry block solution Solution should be made up with PBS ■ 1 % BSA (Sigma-A9647) ■ 0.2 % TritonX100 (Sigma-X100) ■ 0.1 % NaN3 (BDH-10369) ■ 10 % Normal mouse serum (Sigma-M5905) ■ 10 % goat serum (Sigma-G9023) or 10 % donkey serum (Sigma-D9663) depending on species origin of secondary antibody 308 ELISA block solution Solution should be made up with PBS ■ 1% BSA ■ 5% sucrose (Sigma-S7903) ■ 0.05% NaN3 ELISA wash buffer ■ 0.05% Tween 20 in PBS Turks stain ■ 0.01% crystal violet ■ 1% acetic acid (BDH-10001) 309 Appendix 2. Antibodies and recombinant proteins Antibody Product details Concentration used ELISA capture antibodies Anti human IL-8 R&Dsystems-MAB208 0.5 µg/m1 Anti-mouse IFN-y R&Dsystems-MAB785 4 vg/m1 Anti-mouse IL-4 R&Dsystems-MAB404 2 vg/m1 Anti-mouse IL-5 R&Dsystems-MAB405 1 µg/m1 ELISA detection antibodies Biotinylated anti human IL-8 R&Dsystems-BAF208 20 ng/ml Biotinylated anti-mouse IFN-y R&Dsystems-BAF485 400 ng/ml Biotinylated anti-mouse IL-4 R&Dsystems-BAF404 100 ng/ml Biotinylated anti-mouse IL-5 R&Dsystems-BAM705 50 ng/m1 Immunohistochemistry primary antibodies Rabbit anti-Cre Covance-PRB-106C 1/2500 Goat anti-mouse CC10 SantaCruz-SC9773 1/1000 Rabbit anti-human IL-8 Serotec-AHP781 1/500 Rabbit anti-human myeloperoxidase DakoCytomation-A0398 1/500 Rabbit anti Hen Lysozyme Abcam-ab391-100 1/200— 1/1000 Immunohistochemistry secondary antibodies Biotinylated goat anti-rabbit Jackson-111-066-047 1/500 Biotinylated donkey anti-goat Jackson-705-065-003 1/500 Recombinant protein Product details Human IL-8 eBioscience-14-8089 Mouse IFN-y R&Dsystems-485-MI Mouse IL-4 R&Dsystems-404-ML Mouse IL-5 R&Dsystems-405-ML-005 310 Appendix 3. Restriction enzymes and buffers Optimal Temperature Enzyme Product details Cleavage site (A) (5'-3') buffer (°C) BamHI Promega-R6021 G A GATCC E 37.0 BssHII Promega-R6831 G A CGCGC H 50.0 EcoR1 Promega-R6011 G A AATTC H 37.0 EcoRV Promega-R6351 GAT A ATC D 37.0 HindIII Promega-R6041 A A AGCTT E 37.0 KpnI Promega-R6341 GGTAC A C J 37.0 Nan Promega-R6861 GG A CGCC G 37.0 NcoI Promega-R6513 C A CATGG D 37.0 NotI Promega-R6431 GC A GGCCGC D 37.0 Sad Promega-R6061 GAGCT A C J 37.0 SacII Promega-R6221 CCGC A GG C 37.0 Sall Roche-348-783 G A TCGAC suRE/cut H 37.0 SfiI Promega-R6391 GGCCNNNN A NGGCC B 50.0 XbaI Promega-R6 181 T A CTAGA D 37.0 XhoI Promega-R6161 C A TCGAG D 37.0 XmaI Promega-R6491 C A CCGGG B 37.0 Buffer (1x) pH Tris (mM) MgC12 (mM) NaC1 (mM) KC1 (mM) DTT (mM) B 7.5 6 6 50 1 C 7.9 10 10 50 1 D 7.9 6 6 150 1 E 7.5 6 6 100 1 G 8.2 50 5 H 7.5 90 10 50 J 7.5 10 7 50 1 suRE/cut H 7.6 100 10 150 311 Appendix 4. PCR primers for analysis of TCR a and 13 gene usage Primer Sequence (5' - 3') TCR a V region primers NW36 (F) GTCCTGACCTCGCATGCTHCMMBWMYYTCYYSTGGTAY NW37 (F) GTCCTGACCTCGCATGCTTCDWYTRYHTCYTYTGGTAY NW38 (F) GTCCTGACCTCGCATGCRYSASRRYYGTSCWGTGGTTY TCR a C region primers NJ108 (R) GGCCCCATTGCTCTTGGAATC NJ109 (R) CGGCACATTGATTTGGGAGTC NJ110 (R) TCTCGAATTCAGGCAGAGGGTGCTGTCC TCR f3 V region primers NK121 (F) GTCCTGACCTCGCATGCCAYMAYDMYRTKKAYTGGTAY NK122 (F) GTCCTGACCTCGCATGCCAYCMADMWRTKTWYTGGTAY NK123 (F) GTCCTGACCTCGCATGCMCYWMSRTMRMYTGGTAY TCR p C region primers MQ284 (R) AGCACACGAGGGTAGCCTT MS175 (R) GACAGAACTTTGAATTCCTCTGCTTTTGATGG M13 (sequencing primer) (F) CTGGCCGTCGTTTTAC B=CorGorT R=AorG D=AorGorT S=CorG H=AorCorT W=AorT K=GorT Y=CorT M=AorC (F)= forward primer (R) = reverse primer 312 Appendix 5. TCR CDR3I3 spectratyping primers primer Sequence (5' - 3') TCR V ri (TRBV) primer V(3 1 TRBV 5 (F) CTGAATGCCCAGACAGCTCCAAGC vp 2 TRBV I (F) TCACTGATACGGAGCTGAGGC Vi3 3.1 TRBV26 (F) CCTTGCAGCCTAGAAATTCAGT VI3 4 TRBV 2 (F) GCCTCAAGTCGCTTCCAACCTC Vi3 5.1 TRBV 12-2 (F) CATTATGATAAAATGGAGAGAGAT V(3 5.2 TRBV 12-1 (F) AAGGTGGAGAGAGACAAAGGATTC V13 5.3 TRBV 12-3 (F) AGAAAGGAAACCTGCCTGGTT Vi3 6 TRBV 19 (F) CTCTCACTGTGACATCTGCCC VP 7 TRBV 29 (F) TACAGGGTCTCACGGAAGAAGC VI3 8.1 TRBV 13-3 (F) CATTACTCATATGTCGCTGAC V(3 8.2 TRBV 13-2 (F) CATTATTCATATGGTGCTGGC V(3 8.3 TRBV 13-1 (F) TGCTGGCAACCTTCGAATAGGA V(3 9 TRBV 17 (F) TCTCTCTACATTGGCTCTGCAGGC V13 10 TRBV 4 (F) ATCAAGTCTGTAGAGCCGGAGGA V(3 11 TRBV 16 (F) GCACTCAACTCTGAAGATCCAGAGC V(3 12 TRBV 15 (F) GATGGTGGGGCTTTCAAGGATC V(3 13 TRBV 14 (F) AGGCCTAAAGGAACTAACTCCCAC vp 14 TRBV 31 (F) ACGACCAATTCATCCTAAGCAC VI3 15 TRBV 20 (F) CCCATCAGTCATCCCAACTTATCC V13 16 TRBV 3 (F) CACTCTGAAAATCCAACCCAC V13 17 TRBV 24 (F) AGTGTTCCTCGAACTCACAG VI3 18 TRBV 30 (F) CAGCCGGCCAAACCTAACATTCTC V13 19 TRBV 21 (F) CTGCTAAGAAACCATGTACCA Vi3 20 TRBV 23 (F) TCTGCAGCCTGGGAATCAGAA Constant 3 region primer C(3 - FAM labelled (R) 6FAM-CTTGGGTGGAGTCACATTTCTC 6FAM = 6-carboxyflurorescein-amino-hexy fluorescent dye (F) = forward primer (R) = reverse primer 313 Appendix 6. Thl and Th2 TCR a chain primers Annealing Product Primer Sequence (5' — 3') temp [MgC12] size Thl a construct ThlIntronF (F) CAGGAAGAATGATGAAGACATC 538 / 384 55 °C 1.5 mM ThlHindIIIR (R) CAAATGAAAGCTTAGACCCAG bp TRAV 10 (F) GTCCCGGGTCCCAGGCAGGAAGAATGATG 52 °C 2.5 mM 403 by Th1 LP1/2IntronR (R) CATTTGAACGAATGTCTATCAC HindIIITh I F (F) CTGGGTCTAAGCTTTCATTTG 52 °C 3.0 mM 148 bp TRAVJ58 (R) GCCGCGGCCGCGAAGCCACATGCCCATCAGTTGGTG Thl CDR3 motif (F) TGCAGCAAGCAGGGAAGGCACTGGGTCTAAGC 56 °C 1.5 mM 250 by NJ108 (R) GGCCCCATTGCTCTTGGAATC TRAVIO See above 55 °C 1.5 mM 661 by TRAVJ58 See above Th2 a construct Th2lntronF (F) CTGCCTAGCCATGTTCCTAGTG 527 / 391 55°C 1.5 mM Th2HindIIIR (R) CTGCCCAAACACAAGCTTGC bp TRAV17 (F) GTCCCGGGCTTCTCACTGCCTAGCCATG 52 °C 2.5 mM 348 by Th2LP1/2IntronR (R) GGCTCTGGCCAGGATACTGC Th2HindIIIF (F) GCAAGCTTGTGTTTGGGCAG 52 °C 2.5 mM 119 bp TRAJ50 (R) GCCGCGGCCGCTTAAAGGACCCTAGTAGTAGCAAGG Th2 CDR3 motif (F) GCTGTGAGCTGGGATAACTATGCCCAGGGATTAAC 56 °C 1.5 mM 250 by NJ108 (R) GGCCCCATTGCTCTTGGAATC TRAV17 See above 55 °C 1.5 mM 622 by TRAVJ58 See above (F) = forward primer (R) = reverse primer 314 Appendix 7. MIPLP and SIPLP trans2ene primers and oli2onucleotides Annealing Product size Primer Sequence (5' — 3') temp [MgCl2] Sec./Memb. PLP constructs HELA (F) CTGCTCTGGGGAAAGTCTTT 53 °C 1.5 mM 214 bp PLPB (R) GTTCCATAGATGACATACTG HELA (F) CTGCTCTGGGGAAAGTCTTT 53 °C 1.5 mM 611 bp TM/CYTOB (R) TATTCTGCACTGCAAAGATC SfilBamHlBodF (F) GGCCATTGCGGCCGGATCCTGAGAACTTCA 68 °C 1.5 mM 1755 / 1888 by BodXho I Sfi1R (R) GGCCGCAATGGCCCTCGAGGGATCTCCATA CC102000F (F) GCCTCTGGTTCTCCAGGGTT 53 °C 1.5 mM 3239 / 3372 by BetaglobinB (R) TGATAGGCAGCCTGCACCTG 3rdexonF (F) CTGGGCAACGTGCTGGTTAT 55 °C 1.5 mM 625 / 758 by BetaglobinB See above CC101500F (F) ATAAAAGCACTGGAGAAGTA 53 °C 1.5 mM 629 bp CC10210OR (R) CAGAGGTCGTGGAACTGTAG StopfloxedF (F) CATCAGCCCACATCTACAGAC 2.5/1.5 60 °C 1736/1647 bp StopfloxedR (R) CAATGGCCAGTACTAGTGAAC mM SIPLPStopfloxedR (R) CCTGAAGTTCTCAGGATCCG Oligonucleotide Sequence (5' — 3') PLP 56-70 top (T) CGCCAAAAACTACCAGGACTATGAGTATCTCATTAATGTGATTCATGCTTTCC AGTATGTCATCTATGGAACCCGC PLP 56-70 bottom (B) GGGTTCCATAGATGACATACTGGAAAGCATGAATCACATTAATGAGATA CTCATA GTCCTGGTAGTTTTTGG Kpnl linker top (T) GGAGAGGTACCAACTTGAACGCTATGGGCATCCAATGCATCCATGGAGCT Kpnl linker bottom (B) CCATGGATGCATTGGATGCCCATAGCGTTCAAGTTGGTACCTCTCCGC (F) = forward primer (R) = reverse primer (T) = top strand (B) = bottom strand 315 Appendix 8. PCR primers Annealing Primer Sequence (5' — 3') temp [MgCl2] Product size Th2 13 construct VP3 1 F (F) GACTCGAGCCTAGACAAAGACCATCTTGAAC 55 °C 2.0 mM 850 by J(32-3R (R) CTCCGCGGTCACAGCCTCTTGGTACAGGAC 20TCRI3F1 (F) CATCTTGAACTATGCTGTACTCTC 55 °C 1.5 mM 755 by 20TCROR1 (R) CCAACTTACCGAGAACAGTCAG hIL-8 construct IL-8F (F) AGGAATTCTGTAAACATGACTTCCAAGC 55 °C 1.5 mM 319 by IL-8R (R) GCGAATTCTTATGAGTTCTCAGCCCTCTTC CC101500F (F) ATAAAAGCACTGGAGAAGTA 53 °C 1.5 mM 629 by CC10210OR (R) CAGAGGTCGTGGAACTGTAG Bm70 MerCreMer Cre 1 (F) CGCAGAACCTGAAGATGTTCGCGA 60 °C 2.0 mM 500 by Cre 2 (R) GGATCATCAGCTACACCAGAGACG HPRTF (F) TCGTGATTAGCGATGATGAACC 60 °C 1.5 mM 650 by HPRTR (R) CTGGCAACATCAACAGGACTCC (F) = forward primer (R) = reverse primer Real- time PCR 18s Applied Biosystems — Hs-99999901_sl Human IL-8 Applied Biosystems — Hs-00174103_ml Mouse Tbet Applied Biosystems— Mm00450960_m1 Mouse Gata3 Applied Biosystems — Mm00484683_ml 316 Appendix 9. Wright-Giemsa stain — cell morphology A = Macrophage B = Lymphocyte C = Eosinophil D = Neutrophil 317 Appendix 10. Thl TCR a chain construct - plasmid map Cla 118941 Sal 119941 Not I, Sac 112841 BamH112441 318 Appendix 11. Th2 TCR a chain construct - plasmid map BamHI 0 Sal 11990 Cla 1 18956 /mai 2180 pEMBL18 of I, Sac II 2802 Th2 V17/J50 JA2 Sal 1 1510 Th2 pTA cassette BamH1 4947 19902 bp Bam1-11 1445 constant region BamH 112456 319 Appendix 12. Th2 TCR 13 chain construct - plasmid map Kpn 1 20670 BamHI 860 coR1 2190 Kpn 117740 PTZ 18 BamHI 17740 EcoRI 17590 _____X ho 14470 Th2 pTB cassette Th2 VB31/JB2-3 20670 bp --Sac II 5320 J62.6 amHI 6490 coRl 6690 constant region \coRI 7590 BamHI 1259 320 Appendix 13. MIPLP construct — plasmid map ssH111 hoI53 Hind III 74 amH 18D EcoR 1340 EcoR 1744 CC10 promoter MIPLP 8793 bp ind III 2465 LoxP EcoR 12477 amH 12495 S BssH II 601 of 1 2514 Sac 115971 EcoR 1 2595 Not 1595 • Rabbit beta globin Sfi 15958 ind III 2605 Xho 15945 Floxed STOP amH 1 2612 TM region ind III 2686 HEL PLP (56-70) LoxP HEL EcoR 15410 Xho 13557 Sac II 500 Nar 14926 amH 13995 fi 1 4083 EcoR I 4729 amH 14089 321 Appendix 14. SIPLP construct - plasmid map ssH 111 ho 153 indlIl 74 amH 180 EcoR 1 340 -=--"1-Flind III 2465 EcoR 1 2477 BamH 1 2495 Not 1 2514 BssH II 5877 EcoR 1 2595 Sac II 5838 ind 111 2605 Not 1 5826 amH 1 2612 Sfi 1 5825 Hind III 2686 Xho 1 581 EcoR 1 5277 Sac II 5002 Nar 1 492 amH 1 3995 fi 1 4083 amH 1 4089 322 Appendix 15. Inverted stop sequence SIPLP construct — plasmid map BssH111 Xhol 49 ind11170 EcoRl 332 EcoR1 739 CC10 promoter SIPLP (LSL rev) 8733 bp ind1112461 pnl 2471 Notl 2485 SacI12479 LoxP BamH1 2574 BssH 115948 Sacll 5906 Rabbit beta globin Floxed STOP Notl 5894 Xbal 5887 Xhol 3012 Xhol 5875 HEL PLP (56-70) Lox P EcoR15340/ HEL Sacll 5065-j 'nal 3883 BamHI 3957 Nan 4989 ind1113964 EcoRl 479 otl 4055 EcoR1 3974 Xbal 4062 hol 4125 pnl 4144 amH14074 amHI 4152 coR1 4092 Hind111 4104 323 Appendix 16. Lung targeted hIL-8 construct — plasmid map BssH11 1 Kpnl 42 hol 53 indlIl 74 HindlIl 2465 NNN.- ,--N,Es coRV 2473 ---EcoR1 2477 amHi 2495 BasH11405 Not1 4002 \----EcoR1 3135 Xbal 3995 indlIl 3352 Xhol 398 coR1 3448 324 Appendix 17. Thl TCR a complete V-J insert nucleotide sequence 1 TCCCAGGCAG GAAGAATGAT GAAGACATCC CTTCACACTG TATTCCTATT 51 CTTGTGGCTG TGGATGGACT GTGAGTTGGA AGATTTGGGT CAAGAGAAAA 101 AAATGGTGGA TGTTAGACAT CTATGGGCAA TCTATTTTAT ACAGTTCCTT 151 CTAGTTGTGG ACAAAGAGAT TTAGCAGAGT ACTGCCTGAC TGCTCCTCTC 201 CTTTCTGTTT TTCTTTCTGT GTAGGGGAAA GCCATGGAGA GAAGGTCGAG 251 CAACACCAGT CTACACTGAG TGTTCGAGAG GGAGACAGCG CTGTCATCAA 301 CTGCACTTAC ACAGATACTG CCTCATCATA CTTCCCTTGG TACAAGCAAG 351 AAGCTGGAAA GAGTCTCCAC TTTGTGATAG ACATTCGTTC AAATGTGGAC 401 AGAAAACAGA GCCAAAGACT TACAGTTTTA TTGGATAAGA AAGCCAAACG 451 ATTCTCCCTG CACATCACAG CCACACAGCC TGAAGATTCA GCCATCTACT 501 TCTGTGCAGC AAGCAGGGAA GGCACTGGGT CTAAGCTTTC ATTTGGGAAG 551 GGGGCAAAGC TCACAGTGAG TCCAGGTAAG TGTGAGGCTA TCTAACCATC 601 TTTCTAAATG CGATTTGAGA ATTTTTTTTT CTTTCACACC AACTGATGGG 651 CATGTGGCTT C Black = intronic sequence. Blue = coding sequence Red = mutated base pair (G—>T) 325 Appendix 18. Thl TCR a rearranged V-J insert nucleotide/protein sequence 1 - ATG AAG ACA TCC CTT CAC ACT GTA TTC CTA TTC TTG TGG CTG GAA 1-M K T S L H T VF L F LW L E 46 - AGC CAT GGA GAG AAG GTC GAG CAA CAC CAG TCT ACA CTG AGT GTT 16-S HGE KVEQHQST L S V 91 - CGA GAG GGA GAC AGC GCT GTC ATC AAC TGC ACT TAC ACA GAT ACT 31-R E G D S A V I N C T YT D T 136 - GCC TCA TCA TAC TTC CCT TGG TAC AAG CAA GAA GCT GGA AAG AGT 46-A S S YFPWYKQE AGK S 181 - CTC CAC TTT GTG ATA GAC ATT CGT TCA AAT GTG GAC AGA AAA CAG 61-L H F V ID I R S N V D R K Q 226 - AGC CAA AGA CTT ACA GTT TTA TTG GAT AAG AAA GCC AAA CGA TTC 76-S Q R LT V L L D K K A K R F 271 - TCC CTG CAC ATC ACA GCC ACA CAG CCT GAA GAT TCA GCC ATC TAC 91-S L H IT A T Q P E D S A I Y 316 - TTC TGT GCA GCA AGC AGG GAA GGC ACT GGG TCT AAG CTT TCA TTT 106-F CAA SR E G T G S K L S F 361 - GGG AAG GGG GCA AAG CTC ACA GTGAGT CCA 121-G K GA K LT VSP Light blue = Leader sequence of TRAV10 Dark blue = TRAV10 Red = CDR3a region Green = TRAJ58 326 Appendix 19. Th2 TCR a complete V-J insert nucleotide sequence 1 CTTCTCACTG CCTAGCCATG TTCCTAGTGA CCATTCTGCT GCTCAGCGCG 51 TTCTTCTCAC TGAGTAAGTA TTATTTCAGT CCTTGCTTGC TTTTGTTTCC 1 01 ACAGACAGAA CATGTTCCTA GTCAGAATCT ACACAAGGGA CATAGTATCA 151 TTACAGGTAG GTCTATTCTG GTCTCACTGC TGCTACGTTG GTATTACAGG 201 AGGAAACAGT GCCCAGTCCG TGGACCAGCC TGATGCTCAC GTCACGCTCT 251 ATGAAGGAGC CTCCCTGGAG CTCAGATGCA GTTATTCATA CAGTGCAGCA 301 CCTTACCTCT TCTGGTACGT GCAGTATCCT GGCCAGAGCC TCCAGTTTCT 351 CCTCAAATAC ATCACAGGAG ACGCCGTTGT TAAAGGCACC AAGGGCTTTG 401 AGGCCGAGTT TAGGAAGAGT AACTCCTCTT TCAACCTGAA GAAATCCCCA 451 GCCCATTGGA GCGACTCAGC CAAGTACTTC TGTGCACTGG AGGGTATAGC 501 ATCCTCCTCC TTCAGCAAGC TTGTGTTTGG GCAGGGGACA TCCTTATCAG 551 TCGTTCCAAG TAAGTTTGCA GGCTGCCTGT GGGGCAATGG TTCTCAACCT 601 TGCTACTACT AGGGTCCTTT AA Black = intronic sequence. Blue = coding sequence Red = mutated base pair (G—T) 327 Appendix 20. Th2 TCR a rearranged V-J insert nucleotide/protein sequence 1 - ATG TTC CTA GTG ACC ATT CTG CTG CTC AGC GCG TTC TTC TCA CTG 1-M F L V T I L LL S AF FS L 46 - AGA GGA AAC AGT GCC CAG TCC GTG GAC CAG CCT GAT GCT CAC GTC 16-R G N S A QS V D Q P D A II V 91 - ACG CTC TAT GAA GGA GCC TCC CTG GAG CTC AGA TGC AGT TAT TCA 31-T LYE G A SL E L R CS YS 136 - TAC AGT GCA GCA CCT TAC CTC TTC TGG TAC GTG CAG TAT CCT GGC 46-YS A A P Y L F W Y V Q Y P G 181 - CAG AGC CTC CAG TTT CTC CTC AAA TAC ATC ACA GGA GAC GCC GTT 61-Q SLQFLL KYI T G D A V 226 - GTT AAA GGC ACC AAG GGC TTT GAG GCC GAG TTT AGG AAG AGT AAC 76-V K G T K G F E AEFR K S N 271 - TCC TCT TTC AAC CTG AAG AAA TCC CCA GCC CAT TGG AGC GAC TCA 91-SS F N L K K SPA H W S D S 316 - GCC AAG TAC TTC TGT GCA CTG GAG GUT ATA GCA TCC TCC TCC TTC 106-A K YFCAL E GI A SS SF 361 - AGC AAG CTT GTG TTT GGG CAG GGG ACA TCC TTA TCA GTC GTT CCA 121-S K L V F G Q G T SL S V V P Light blue = Leader sequence of TRAV17 Dark blue = TRAV17 Red = CDR3a region Green = TRAJ50 328 Appendix 21. Th2 TCR 13 complete V-J insert nucleotide sequence CCTAGACAAA GACCATCTTG AACTATGCTG TACTCTCTCC TTGCCTTTCT 51 CCTGGGCATG TTCTTGGGTG GGTGCATTCC CCTGTTGAAA ACCTACTTTC 101 AAATTGTTGC TTCCATCTCT CCACCTGTTA AAGGTGTAGA TTCTTTGGTA 151 CTGGCTTGCC TCTCTTGACC ACAGTCCTCC AATTACTGAG ATATGGGCAT 201 TTCACACTCT TTCAGTATTG ACTCTCAGTT TTGTATCTTT TAGAAAGGAT 251 TTGTCTCCCC TTGCCCTGTA ACATTTTTCA TCCCTGGCTC TTCTAGTATA 301 CTCCCTGAGA CTGATTACAT GTAACCCCTT CAGAGGGAAG GCAAGCAAGC 351 TGGTGTGTGT GTATGTGTAG AGGTGTGTGT TTCTACTCTA AATGACTCTA 401 TTTCTTTACA GGTGTTAGTG CTCAGACTAT CCATCAATGG CCAGTTGCCG 451 AGATCAAGGC TGTGGGCAGC CCACTGTCTC TGGGGTGTAC CATAAAGGGG 501 AAATCAAGCC CTAACCTCTA CTGGTACTGG CAGGCCACAG GAGGCACCCT 551 CCAGCAACTC TTCTACTCTA TTACTGTTGG CCAGGTAGAG TCGGTGGTGC 601 AACTGAACCT CTCAGCTTCC AGGCCGAAGG ACGACCAATT CATCCTAAGC 651 ACGGAGAAGC TGCTTCTCAG CCACTCTGGC TTCTACCTCT GTGCCTGGAG 701 TCTGGGGGGA GGTGCAGAAA CGCTGTATTT TGGCTCAGGA ACCAGACTGA 751 CTGTTCTCGG TAAGTTGGGA GCTAGTAATG AAGGGGAGGG AGCATTTCCC 801 AGGCTAAGGA TAGCCAGAGC CAGTTTTTGT CCTGTACCAA GAGGCTGTGA Black = intronic sequence Blue = coding sequence 329 Appendix 22. Th2 TCR 13 rearranged V-J insert nucleotide/protein sequence 1 - ATG CTG TAC TCT CTC CTT GCC TTT CTC CTG GGC ATG TTC TTG GGT 1-ML YS LL A FLLG M F L G 46 - GTT AGT GCT CAG ACT ATC CAT CAA TGG CCA GTT GCC GAG ATC AAG 16-VS A Q T I H Q W P V A E I K 91- GCT GTG GGC AGC CCA CTG TCT CTG GGG TGT ACC ATA AAG GGG AAA 31-AVG S P L S L GCTIK GK 136- TCA AGC CCT AAC CTC TAC TGG TAC TGG CAG GCC ACA GGA GGC ACC 46-S SP N L Y W Y W Q A T G G T 181- CTC CAG CAA CTC TTC TAC TCT ATT ACT GTT GGC CAG GTA GAG TCG 61-LQQLFYSI T VGQVES 226- GTG GTG CAA CTG AAC CTC TCA GCT TCC AGG CCG AAG GAC GAC CAA 76-VV Q L N L S A SR P K D D Q 271- TTC ATC CTA AGC ACG GAG AAG CTG CTT CTC AGC CAC TCT GGC TTC 91-F IL S T E K L L L S HS G F 316- TAC CTC TGT GCC TGG AGT CTG GGG GGA GGT GCA GAA ACG CTG TAT 106-YLCAWSLGGGA E L Y 361- ITT GGC TCA GGA ACC AGA CTG ACT GTT CTC 121-FGS GTR L T V L Light blue = Leader sequence of TRBV31 Dark blue = TRBV31 Red = CDR313 region Green = TRBJ2-3 330 Appendix 23. MIPLP construct — complete nucleotide sequence 1 GCGCGCAATT AACCCTCACT AAAGGGAACA AAAGCTGGGT ACCGGGCCCC 51 CCCTCGAGGT CGACGGTATC GATAAGCTTA TCGATTTCGA ACCCTGTAGC 101 AGGGCCTCTG TGCAGCAGAG GGTGCACACT ACAGGTTGTG CACACGCGTG 151 TGCGTGCATG CATGCAAGGG TGCACATGCA CAGGGTGGAG GTCAGAGGTC 201 AACGTCAGGT GTCTTCGTCT GTCACCCACA GTCTTGTTTT TCAGACAGGA 251 CTTCTCACTG AATCTGAATC CTGCCCATTT GATGGGCTCA TCAGTCAGTT 301 TCCAGGTTTC CCTGGTCCCC ACCTCCCCAG GGCTGGAATT CAAGGCATAT 351 CTAGCTTTTT TGCATGAATG TTTGAGAGCC AAATTCAGTT CCTCATACTT 401 GCCCAATAGG CATAGTATAT CCACTGAGCC ATGTCCCCAA CTCATTATGT 451 TCACCTCATT CATTCATTCA TCCATCCATC CATCCATCCA TCCATTCATT 501 CATTCAGGTT TGGTTTGGTT TGGTTTTAGT GTTTTGGGTT TTTTTTCAAG 551 ACAGGGTTTC TCTGTGTAGC CCTGGCTGCC CTGAAACTAA CTTTCTTACT 601 TACTTTCTTT CTTTCTTCCT TCCTTCCTTT CTTTCTTTAA GTTGGTTTGG 651 GTTTTTTGGG GGGGGGAGGG TTTGGGTTTT TTTGTTTGTT TGTATTTTAT 701 TCAAGGAAAG GCTCCTCTGG GTTGCCCTGG CTGCCCTGGA AGGAATTCTA 751 TAGCCAGGCT GACCATGAAC TCAGAAATCT ACCTGCCTCT CCCTCTGCCT 801 CCCAAGTGCT AGGATTAAAG GTGTGTGACA CACACACAAC TGGCTCTACA 851 TTTGACACTC ACAGTATTCT GCACACAGCC ACAGGGCTGT ATCGCTAAGA 901 GGCCATGTCA CAGGTCCAGG AAGGCTTCAC TGTTTAATAA CTGGTTTGGA 951 ATTTGGAAGT GGGAAAGTAT GTAGAGACAA TCTCACTCTA GGACTCAAAG 1001 ACAGAGATAA AATGCTCTTT AGAAACCTAT TCTGTGGGGG AACAGAATCA 1051 GAACTCTATG TCAGCCTCTG TGCTAGCTGG GGTCAGGCCA GAGACACAGA 331 1101 AATGAGCTAA GCCTACAGTG AGAACTGATA CGCAGGACAG TTGAGAACAA 1151 TGGGAAAGTG CATCTGAAGG GCCCAAGGCC ACTAGGAAAA AGGCAACCCA 1201 AAATGCCCAC AACTTTAAAT CCCCTTCCTG ATGTGTCATT AGATGCAAAC 1251 GGCCCTGGGG AGGATGTGAC GTTAAACAAG GCAGTGTTCT GTACAGGGGC 1301 AGATCCTGCA GTTACTGGAA GCTGAAGGCT CCAGGCTGAC CACACTAGGT 1351 AGGAAGTTCA TGAAATGAGC TCTCGAAGCG CCTCTTCAGG TCTTCCCCGA 1401 TGTCCAGCCC CACCAGCACC GTAGCAGGTA CTGGGCATCT ATTGATTGGG 1451 TGGGTAGGTG AACATTTGAG ACAACCTGGA AGTTTAAATG GGATTTGTGG 1501 AAATAGAGAG GGTGTTGGTT CCAGCCAAGC CAGGTTCCAT GCTAAGACAT 1551 AAAAGCACTG GAGAAGTAAA AGAGTTAACG CTGAACATGG CCGTGGGAAG 1601 CGAGGAGACC AAGGTAAAGC CTGGGAATGG CTAACACTTG AGAACTGTCA 1651 ACATCATGAA AGGATAAGAA AGAATGGCCA AGGAAAGAAA ACAGGAAAGA 1701 GCTGAGTGTG GGAGAGGCCT GGAGAGAATG GGGCAAGAAG TGGGAGGCTA 1751 AAGGGTAAGG GCAAGGGAGG GTCAAGTCAG ATGAGGACTG AAGGTGCTTT 1801 CAACTGGTAG GACTTGAGGG CTGCTCTGGG TAGGAGCCAG CCCGGTCTGG 1851 GCCCTGGGTC TCTCATGTGT TCTATGGAGA AGTCTTTATA TTTGTTCATG 1901 TGTATTGTAT GTGGGCTCTA ACCTGGCCAA CAATGCCCAA GAATCAAGTG 1951 ATTTTTGTGG CTTGAAGTCT AGCCACCTTC CTTGGAGGGA GGCAATAGAA 2001 GGAGCCTAGT GACATCTCGG ACGGAGTCTG GGGTCTTTGT CCTTCCCCTT 2051 GATCCCTGAA GGGTCTCCAG CCTCTGGTTC TCCAGGGTTG GCAAGTCTAC 2101 AATTGCTTCC CGGAACCTGG AGTGCTCAGT GCTTGACTTT AAAGAGGACA 2151 CAGGTGCCTA CAGTTCCACG ACCTCTGGGT TCCCCGACGC CCCCCCCCCC 2201 GCACTGCCCA TTGCCCAAAC ACCCCACAAG TGGCCTATTG TGTGAGCTCA 332 2251 GTTTCAATGG GAAAAGAAAC TGGGTTTATG AAAAGAGATT ATTTGCTTAT 2301 TGCATGGAGA TGACTAAGTA AATAGTGCAA TTTCTTGAGT GGAGCACAAT 2351 CCCTGCCCCT ACCTCTTGTG GGCTGCCAGG AACATATAAA AAGCCACACG 2401 CATACCCACA CATACCCACA CATACCCTCA CATTACAACA TCAGCCCACA 2451 TCTACAGACA GCCCAAGCTT GATATCGAAT TCCTGCAGCC CGGGGGATCC 2501 ACTAGTTCTA GAGCGGCCGC ACGTCTAAGA AACCATTATT ATCATGACAT 2551 TAACCTATAA AAATAGGCGT ATCACGAGGC CCTTTCGTCT TCAAGAATTC 2601 CATCAAGCTT AGGATCCGGA ACCCTTAATA TAACTTCGTA TAATGTATGC loxP 2651 f site TATACGAAGT TAT TAGGTCC CTCGACCTGC AGCCCAAGCT TACTTACCAT J 2701 GTCAGATCCA GACATGATAA GATACATTGA TGAGTTTGGA CAAACCACAA 2751 CTAGAATGCA GTGAAAAAAA TGCTTTATTT GTGAAATTTG TGATGCTATT 2801 GCTTTATTTG TAACCATTAT AAGCTGCAAT AAACAAGTTA ACAACAACAA 2851 TTGCATTCAT TTTATGTTTC AGGTTCAGGG GGAGGTGTGG GAGGTTTTTT 2901 AAAGCAAGTA AAACCTCTAC AAATGTGGTA TGGCTGATTA TGATCTCTAG 2951 TCAAGGCACT ATACATCAAA TATTCCTTAT TAACCCCTTT ACAAATTAAA 3001 AAGCTAAAGG TACACAATTT TTGAGCATAG TTATTAATAG CAGACACTCT 3051 ATGCCTGTGT GGAGTAAGAA AAAACAGTAT GTTATGATTA TAACTGTTAT 3101 GCCTACTTAT AAAGGTTACA GAATATTTTT CCATAATTTT CTTGTATAGC 3151 AGTGCAGCTT TTTCCTTTGT GGTGTAAATA GCAAAGCAAG CAAGAGTTCT 3201 ATTACTAAAC ACAGCATGAC TCAAAAAACT TAGCAATTCT GAAGGAAAGT 3251 CCTTGGGGTC TTCTACCTTT CTCTTCTTTT TTGGAGGAGT AGAATGTTGA 3301 GAGTCAGCAG TAGCCTCATC ATCACTAGAT GGCATTTCTT CTGAGCAAAA 3351 CAGGTTTTCC TCATTAAAGG CATTCCACCA CTGCTCCCAT TCATCAGTTC 333 3401 CATAGGTTGG AATCTAAAAT ACACAAACAA TTAGAATCAG TAGTTTAACA 3451 CATTATACAC TTAAAAATTT TATATTTACC TTAGAGCTTT AAATCTCTGT 3501 AGGTAGTTTG TCCAATTATG TCACACCACA GAAGTAAGGT TCCTTCACAA 3551 AGATCCCTCG AGAAAAAAAA TATAAAAGAG ATGGAGGAAC GGGAAAAAGT 3601 TAGTTGTGGT GATAGGTGGC AAGTGGTATT CCGTAAGAAC AACAAGAAAA 3651 GCATTTCATA TTATGGCTGA ACTGAGCGAA CAAGTGCAAA ATTTAAGCAT 3701 CAACGACAAC AACGAGAATG GTTATGTTCC TCCTCACTTA AGAGGAAAAC 3751 CAAGAAGTGC CAGAAATAAC AGTAGCAACT ACAATAACAA CAACGGCGGC 3801 TACAACGGTG GCCGTGGCGG TGGCAGCTTC TTTAGCAACA ACCGTCGTGG 3851 TGGTTACGGC AACGGTGGTT TCTTCGGTGG AAACAACGGT GGCAGCAGAT 3901 CTAACGGCCG TTCTGGTGGT AGATGGATCG ATGGCAAACA TGTCCCAGCT 3951 CCAAGAAACG AAAAGGCCGA GATCGCCATA TTTGGTGTCC CCGAGGATCC 4001 GGAACCCTTA ATIATAACTTC GTATAATGTA TGCTATACGA AGTTATTAGG loxP 4051 site TCCCTCGAAG AGGTTCACTA GTACTGGCCA TTGCGGCCGG ATCCTGAGAA 4101 CTTCAGGGTG AGTTTGGGGA CCCTTGATTG TTCTTTCTTT TTCGCTATTG 4151 TAAAATTCAT GTTATATGGA GGGGGCAAAG TTTTCAGGGT GTTGTTTAGA 4201 ATGGGAAGAT GTCCCTTGTA TCACCATGGA CCCCCATGAT AATTTTGTTT 4251 CTTTCACTTT CTACTCTGTT GACAACCATT GTCTCCTCTT ATTTTCTTTT 4301 CATTTTCTGT AACTTTTTCG TTAAACTTTA GCTTGCATTT GTAACGAATT 4351 TTTAAATTCA CTTTTGTTTA TTTGTCAGAT TGTAAGTACT TTCTCTAATC 4401 ACTTTTTTTT CAAGGCAATC AGGGTATATT ATATTGTACT TCAGCACAGT 4451 TTTAGAGAAC AATTGTTATA ATTAAATGAT AAGGTAGAAT ATTTCTGCAT 4501 ATAAATTCTG GCTGGCGTGG AAATATTCTT ATTGGTAGAA ACAACTACAC 334 4551 CCTGGTCATC ATCCTGCCTT TCTCTTTATG GTTACAATGA TATACACTGT 4601 TTGAGATGAG GATAAAATAC TCTGAGTCCA AACCGGGCCC CTCTGCTAAC 4651 CATGTTCATG CCTTCTTCTC TTTCCTACAG CTCCTGGGCA ACGTGCTGGT 4701 TGTTGTGCTG TCTCATCATT TTGGCAAAGA ATTCTGGCAA CATGAGGTCT 4751 TTGCTAATCT TGGTGCTTTG CTTCCTGCCC CTGGCTGCTC TGGGGAAAGT 4801 CTTTGGACGA TGTGAGCTGG CAGCGGCTAT GAAGCGTCAC GGACTTGATA 4851 ACTATCGGGG ATACAGCCTG GGAAACTGGG TGTGTGCCGC AAAATTCGAG 4901 AGTAACTTCA ACACCCAGGC TACAGGCGCC AAAAACTACC ACIGACTATGA PLP(: 4951 -70) GTATCTCATT AATGTGATTC ATGCTTTCCA GTATGTC ATC TATGGAACCC 5001 GCGGAAACCG TAACACCGAT GGGAGTACCG ACTACGGAAT CCTACAGATC 5051 AACAGCCGCT GGTGGTGCAA CGATGGCAGG ACCCCAGGCT CCAGGAACCT 5101 GTGCAACATC CCGTGCTCAG CCCTGCTGAG CTCAGACATA ACAGCGAGCG 5151 TGAACTGCGC GAAGAAGATC GTCAGCGATG GAAACGGCAT GAACGCGTGG 5201 GTCGCCTGGC GCAACCGCTG CAAGGGCACC GACGTCCAGG CGTGGATCAG 5251 AGGCTGCCGG CTGGGCTCGT CCAGCTCAGG GATCTATCAG ATTCTGGCGA 5301 TCTACTCAAC TGTCGCCAGT TCACTGGTGC TTTTGGTCTC CCTGGGGGCA 5351 ATCAGTTTCT GGATGTGTTC TAATGGATCT TTGCAGTGCA GAATATGCAT 5401 CTGAGATTAG AATTCACTCC TCAGGTGCAG GCTGCCTATC AGAAGGTGGT 5451 GGCTGGTGTG GCCAATGCCC TGGCTCACAA ATACCACTGA GATCGATCTT 5501 TTTCCCTCTG CCAAAAATTA TGGGGACATC ATGAAGCCCC TTGAGCATCT 5551 GACTTCTGGC TAATAAAGGA AATTTATTTT CATTGCAATA GTGTGTTGGA 5601 ATTTTTTGTG TCTCTCACTC GGAAGGACAT ATGGGAGGGC AAATCATTTA 5651 AAACATCAGA ATGAGTATTT GGTTTAGAGT TTGGCAACAT ATGCCCATAT 335 5701 GCTGGCTGCC ATGAACAAAG GTTGGCTATA AAGAGGTCAT CAGTATATGA 5751 AACAGCCCCC TGCTGTCCAT TCCTTATTCC ATAGAAAAGC CTTGACTTGA 5801 GGTTAGATTT TTTTTATATT TTGTTTTGTG TTATTTTTTT CTTTAACATC 5851 CCTAAAATTT TCCTTACATG TTTTACTAGC CAGATTTTTC CTCCTCTCCT 5901 GACTACTCCC AGTCATAGCT GTCCCTCTTC TCTTATGGAG ATCCCTCGAG 5951 GGCCATTGCG GCCGCCACCG CGGTGGAGCT CCAGCTTTTG TTCCCTTTAG 6001 TGAGGGTTAA TTGCGCGC Black = pBluescript II vector sequence Brown = CC10 promoter Blue = Floxed STOP sequence Green = Rabbit beta globin intronic and PolyA sequence Red = HEL/PLP (56-70) coding region 336 Appendix 24. Transmembrane HEL/PLP(56-70) nucleotide/protein sequence 1- ATG AGG TCT TTG CTA ATC TTG GTG CTT TGC TTC CTG CCC CTG GCT 1-MR S L L I LV LCF L P L A 46- GCT CTG GGG AAA GTC TTT GGA CGA TGT GAG TTG GCA GCG GCT ATG 16-ALGK V F G R CE LAAA M 91- AAG CGT CAC GGA CTT GAT AAC TAT CGG GGA TAC AGC CTG GGA AAC 31-K R H G L D N Y R G YS L G N 136-TGG GTG TGT GCC GCA AAA TTC GAG AGT AAC TTC AAC ACC CAG GCT 46-WV CA AK FE S N F N T QA 181-ACA GGC GCC AAA AAC TAC CAG GAC TAT GAG TAT CTC ATT AAT GTG 61-T G AKNYQDYE YLINV 226-ATT CAT GCT TTC CAG TAT GTC ATC TAT GGA ACC CGC GGA AAC CGT 76-IHA F Q YV I Y G T R G N R 271-AAC ACC GAT GGG AGT ACC GAC TAC GGA ATC CTA CAG ATC AAC AGC 91-N TDGS T D Y G I L Q I N S 316-CGC TGG TGG TGC AAC GAT GGC AGG ACC CCA GGC TCC AGG AAC CTG 106-R WWCND GRIP GSRNL 361-TGC AAC ATC CCG TGC TCA GCC CTG CTG AGC TCA GAC ATA ACA GCG 121-C N I P C S A L L S SDI TA 406-AGC GTG AAC TGC GCG AAG AAG ATC GTC AGC GAT GGA AAC GGC ATG 136-S V N C A K K IV SD G N GM 451-AAC GCG TGG GTC GCC TGG CGC AAC CGC TGC AAG GGC ACC GAC GTC 151-N A W VA W RNRN C K G T D V 496-CAG GCG TGG ATC AGA GGC TGC CGG CTG GGC TCG TCC AGC TCA GGG 166-Q A W I R G C R L G S SS SG 541-ATC TAT CAG ATT CTG GCG ATC TAC TCA ACT GTC GCC AGT TCA CTG 181-IYQILA I Y S T VAS S L 586-GTG CTT TTG GTC TCC CTG GGG GCA ATC AGT TTC TGG ATG TGT TCT 196-V L L V S L G A I S F W M C S 337 631-AAT GGA TCT TTG CAG TGC AGA ATA TGC ATC 211-N G S L Q C R I CI Black = HEL Red = PLP (56-70) Green = joining sequence Blue = Transmembrane anchor region 338 Appendix 25. SIPLP construct - complete nucleotide sequence 1 GCGCGCAATT AACCCTCACT AAAGGGAACA AAAGCTGGGT ACCGGGCCCC 51 CCCTCGAGGT CGACGGTATC GATAAGCTTA TCGATTTCGA ACCCTGTAGC 101 AGGGCCTCTG TGCAGCAGAG GGTGCACACT ACAGGTTGTG CACACGCGTG 151 TGCGTGCATG CATGCAAGGG TGCACATGCA CAGGGTGGAG GTCAGAGGTC 201 AACGTCAGGT GTCTTCGTCT GTCACCCACA GTCTTGTTTT TCAGACAGGA 251 CTTCTCACTG AATCTGAATC CTGCCCATTT GATGGGCTCA TCAGTCAGTT 301 TCCAGGTTTC CCTGGTCCCC ACCTCCCCAG GGCTGGAATT CAAGGCATAT 351 CTAGCTTTTT TGCATGAATG TTTGAGAGCC AAATTCAGTT CCTCATACTT 401 GCCCAATAGG CATAGTATAT CCACTGAGCC ATGTCCCCAA CTCATTATGT 451 TCACCTCATT CATTCATTCA TCCATCCATC CATCCATCCA TCCATTCATT 501 CATTCAGGTT TGGTTTGGTT TGGTTTTAGT GTTTTGGGTT TTTTTTCAAG 551 ACAGGGTTTC TCTGTGTAGC CCTGGCTGCC CTGAAACTAA CTTTCTTACT 601 TACTTTCTTT CTTTCTTCCT TCCTTCCTTT CTTTCTTTAA GTTGGTTTGG 651 GTTTTTTGGG GGGGGGAGGG TTTGGGTTTT TTTGTTTGTT TGTATTTTAT 701 TCAAGGAAAG GCTCCTCTGG GTTGCCCTGG CTGCCCTGGA AGGAATTCTA 751 TAGCCAGGCT GACCATGAAC TCAGAAATCT ACCTGCCTCT CCCTCTGCCT 801 CCCAAGTGCT AGGATTAAAG GTGTGTGACA CACACACAAC TGGCTCTACA 851 TTTGACACTC ACAGTATTCT GCACACAGCC ACAGGGCTGT ATCGCTAAGA 901 GGCCATGTCA CAGGTCCAGG AAGGCTTCAC TGTTTAATAA CTGGTTTGGA 951 ATTTGGAAGT GGGAAAGTAT GTAGAGACAA TCTCACTCTA GGACTCAAAG 1001 ACAGAGATAA AATGCTCTTT AGAAACCTAT TCTGTGGGGG AACAGAATCA 1051 GAACTCTATG TCAGCCTCTG TGCTAGCTGG GGTCAGGCCA GAGACACAGA 339 1101 AATGAGCTAA GCCTACAGTG AGAACTGATA CGCAGGACAG TTGAGAACAA 1151 TGGGAAAGTG CATCTGAAGG GCCCAAGGCC ACTAGGAAAA AGGCAACCCA 1201 AAATGCCCAC AACTTTAAAT CCCCTTCCTG ATGTGTCATT AGATGCAAAC 1251 GGCCCTGGGG AGGATGTGAC GTTAAACAAG GCAGTGTTCT GTACAGGGGC 1301 AGATCCTGCA GTTACTGGAA GCTGAAGGCT CCAGGCTGAC CACACTAGGT 1351 AGGAAGTTCA TGAAATGAGC TCTCGAAGCG CCTCTTCAGG TCTTCCCCGA 1401 TGTCCAGCCC CACCAGCACC GTAGCAGGTA CTGGGCATCT ATTGATTGGG 1451 TGGGTAGGTG AACATTTGAG ACAACCTGGA AGTTTAAATG GGATTTGTGG 1501 AAATAGAGAG GGTGTTGGTT CCAGCCAAGC CAGGTTCCAT GCTAAGACAT 1551 AAAAGCACTG GAGAAGTAAA AGAGTTAACG CTGAACATGG CCGTGGGAAG 1601 CGAGGAGACC AAGGTAAAGC CTGGGAATGG CTAACACTTG AGAACTGTCA 1651 ACATCATGAA AGGATAAGAA AGAATGGCCA AGGAAAGAAA ACAGGAAAGA 1701 GCTGAGTGTG GGAGAGGCCT GGAGAGAATG GGGCAAGAAG TGGGAGGCTA 1751 AAGGGTAAGG GCAAGGGAGG GTCAAGTCAG ATGAGGACTG AAGGTGCTTT 1801 CAACTGGTAG GACTTGAGGG CTGCTCTGGG TAGGAGCCAG CCCGGTCTGG 1851 GCCCTGGGTC TCTCATGTGT TCTATGGAGA AGTCTTTATA TTTGTTCATG 1901 TGTATTGTAT GTGGGCTCTA ACCTGGCCAA CAATGCCCAA GAATCAAGTG 1951 ATTTTTGTGG CTTGAAGTCT AGCCACCTTC CTTGGAGGGA GGCAATAGAA 2001 GGAGCCTAGT GACATCTCGG ACGGAGTCTG GGGTCTTTGT CCTTCCCCTT 2051 GATCCCTGAA GGGTCTCCAG CCTCTGGTTC TCCAGGGTTG GCAAGTCTAC 2101 AATTGCTTCC CGGAACCTGG AGTGCTCAGT GCTTGACTTT AAAGAGGACA 2151 CAGGTGCCTA CAGTTCCACG ACCTCTGGGT TCCCCGACGC CCCCCCCCCC 2201 GCACTGCCCA TTGCCCAAAC ACCCCACAAG TGGCCTATTG TGTGAGCTCA 340 2251 GTTTCAATGG GAAAAGAAAC TGGGTTTATG AAAAGAGATT ATTTGCTTAT 2301 TGCATGGAGA TGACTAAGTA AATAGTGCAA TTTCTTGAGT GGAGCACAAT 2351 CCCTGCCCCT ACCTCTTGTG GGCTGCCAGG AACATATAAA AAGCCACACG 2401 CATACCCACA CATACCCACA CATACCCTCA CATTACAACA TCAGCCCACA 2451 TCTACAGACA GCCCAAGCTT GATATCGAAT TCCTGCAGCC CGGGGGATCC 2501 ACTAGTTCTA GAGCGGCCGC ACGTCTAAGA AACCATTATT ATCATGACAT 2551 TAACCTATAA AAATAGGCGT ATCACGAGGC CCTTTCGTCT TCAAGAATTC 2601 CATCAAGCTT AGGATCCGGA ACCCTTAAT A TAACTTCGTA TAATGTATGC /651 loxP TATACGAAGT TATTAGGTCC CTCGACCTGC AGCCCAAGCT TACTTACCAT site 2701 GTCAGATCCA GACATGATAA GATACATTGA TGAGTTTGGA CAAACCACAA 2751 CTAGAATGCA GTGAAAAAAA TGCTTTATTT GTGAAATTTG TGATGCTATT 2801 GCTTTATTTG TAACCATTAT AAGCTGCAAT AAACAAGTTA ACAACAACAA 2851 TTGCATTCAT TTTATGTTTC AGGTTCAGGG GGAGGTGTGG GAGGTTTTTT 2901 AAAGCAAGTA AAACCTCTAC AAATGTGGTA TGGCTGATTA TGATCTCTAG 2951 TCAAGGCACT ATACATCAAA TATTCCTTAT TAACCCCTTT ACAAATTAAA 3001 AAGCTAAAGG TACACAATTT TTGAGCATAG TTATTAATAG CAGACACTCT 3051 ATGCCTGTGT GGAGTAAGAA AAAACAGTAT GTTATGATTA TAACTGTTAT 3101 GCCTACTTAT AAAGGTTACA GAATATTTTT CCATAATTTT CTTGTATAGC 3151 AGTGCAGCTT TTTCCTTTGT GGTGTAAATA GCAAAGCAAG CAAGAGTTCT 3201 ATTACTAAAC ACAGCATGAC TCAAAAAACT TAGCAATTCT GAAGGAAAGT 3251 CCTTGGGGTC TTCTACCTTT CTCTTCTTTT TTGGAGGAGT AGAATGTTGA 3301 GAGTCAGCAG TAGCCTCATC ATCACTAGAT GGCATTTCTT CTGAGCAAAA 3351 CAGGTTTTCC TCATTAAAGG CATTCCACCA CTGCTCCCAT TCATCAGTTC 341 3401 CATAGGTTGG AATCTAAAAT ACACAAACAA TTAGAATCAG TAGTTTAACA 3451 CATTATACAC TTAAAAATTT TATATTTACC TTAGAGCTTT AAATCTCTGT 3501 AGGTAGTTTG TCCAATTATG TCACACCACA GAAGTAAGGT TCCTTCACAA 3551 AGATCCCTCG AGAAAAAAAA TATAAAAGAG ATGGAGGAAC GGGAAAAAGT 3601 TAGTTGTGGT GATAGGTGGC AAGTGGTATT CCGTAAGAAC AACAAGAAAA 3651 GCATTTCATA TTATGGCTGA ACTGAGCGAA CAAGTGCAAA ATTTAAGCAT 3701 CAACGACAAC AACGAGAATG GTTATGTTCC TCCTCACTTA AGAGGAAAAC 3751 CAAGAAGTGC CAGAAATAAC AGTAGCAACT ACAATAACAA CAACGGCGGC 3801 TACAACGGTG GCCGTGGCGG TGGCAGCTTC TTTAGCAACA ACCGTCGTGG 3851 TGGTTACGGC AACGGTGGTT TCTTCGGTGG AAACAACGGT GGCAGCAGAT 3901 CTAACGGCCG TTCTGGTGGT AGATGGATCG ATGGCAAACA TGTCCCAGCT 3951 CCAAGAAACG AAAAGGCCGA GATCGCCATA TTTGGTGTCC CCGAGGATCC 4001 GGAACCCTTA ATATAACTTC GTATAATGTA TGCTATACGA AGTTATTAGG} loxP 4051 site TCCCTCGAAG AGGTTCACTA GTACTGGCCA TTGCGGCCGG ATCCTGAGAA 4101 CTTCAGGGTG AGTTTGGGGA CCCTTGATTG TTCTTTCTTT TTCGCTATTG 4151 TAAAATTCAT GTTATATGGA GGGGGCAAAG TTTTCAGGGT GTTGTTTAGA 4201 ATGGGAAGAT GTCCCTTGTA TCACCATGGA CCCCCATGAT AATTTTGTTT 4251 CTTTCACTTT CTACTCTGTT GACAACCATT GTCTCCTCTT ATTTTCTTTT 4301 CATTTTCTGT AACTTTTTCG TTAAACTTTA GCTTGCATTT GTAACGAATT 4351 TTTAAATTCA CTTTTGTTTA TTTGTCAGAT TGTAAGTACT TTCTCTAATC 4401 ACTTTTTTTT CAAGGCAATC AGGGTATATT ATATTGTACT TCAGCACAGT 4451 TTTAGAGAAC AATTGTTATA ATTAAATGAT AAGGTAGAAT ATTTCTGCAT 4501 ATAAATTCTG GCTGGCGTGG AAATATTCTT ATTGGTAGAA ACAACTACAC 342 4551 CCTGGTCATC ATCCTGCCTT TCTCTTTATG GTTACAATGA TATACACTGT 4601 TTGAGATGAG GATAAAATAC TCTGAGTCCA AACCGGGCCC CTCTGCTAAC 4651 CATGTTCATG CCTTCTTCTC TTTCCTACAG CTCCTGGGCA ACGTGCTGGT 4701 TGTTGTGCTG TCTCATCATT TTGGCAAAGA ATTCTGGCAA CATGAGGTCT 4751 TTGCTAATCT TGGTGCTTTG CTTCCTGCCC CTGGCTGCTC TGGGGAAAGT 4801 CTTTGGACGA TGTGAGCTGG CAGCGGCTAT GAAGCGTCAC GGACTTGATA 4851 ACTATCGGGG ATACAGCCTG GGAAACTGGG TGTGTGCCGC AAAATTCGAG 4901 AGTAACTTC A ACACCCAGGC TACAGGCGCC AAAAACTACC AG ACTATGA 4951 PLP(5 GTATCTCATT AATGTGATTC ATGCTTTCCA GTATGTC ATC TATGGAACCC 701 5001 GCGGAAACCG TAACACCGAT GGGAGTACCG ACTACGGAAT CCTACAGATC 5051 AACAGCCGCT GGTGGTGCAA CGATGGCAGG ACCCCAGGCT CCAGGAACCT 5101 GTGCAACATC CCGTGCTCAG CCCTGCTGAG CTCAGACATA ACAGCGAGCG 5151 TGAACTGCGC GAAGAAGATC GTCAGCGATG GAAACGGCAT GAACGCGTGG 5201 GTCGCCTGGC GCAACCGCTG CAAGGGCACC GACGTCCAGG CGTGGATCAG 5251 AGGCTGCCGG CTGTGAGGAG CTGCCGGAAT TCTCTATCAG ATTCACTCCT 5301 CAGGTGCAGG CTGCCTATCA GAAGGTGGTG GCTGGTGTGG CCAATGCCCT 5351 GGCTCACAAA TACCACTGAG ATCGATCTTT TTCCCTCTGC CAAAAATTAT 5401 GGGGACATCA TGAAGCCCCT TGAGCATCTG ACTTCTGGCT AATAAAGGAA 5451 ATTTATTTTC ATTGCAATAG TGTGTTGGAA TTTTTTGTGT CTCTCACTCG 5501 GAAGGACATA TGGGAGGGCA AATCATTTAA AACATCAGAA TGAGTATTTG 5551 GTTTAGAGTT TGGCAACATA TGCCCATATG CTGGCTGCCA TGAACAAAGG 5601 TTGGCTATAA AGAGGTCATC AGTATATGAA ACAGCCCCCT GCTGTCCATT 5651 CCTTATTCCA TAGAAAAGCC TTGACTTGAG GTTAGATTTT TTTTATATTT 343 5701 TGTTTTGTGT TATTTTTTTC TTTAACATCC CCTAAAATTTT CCTTACATGT 5751 TTTACTAGCC AGATTTTTCC TCCTCTCCTG ACTACTCCCA GTCATAGCTG 5801 TCCCTCTTCT CTTATGGAGA TCCCTCGAGG GCCATTGCGG CCGCCACCGC 5851 GGTGGAGCTC CAGCTrITGT TCCCTTTAGT GAGGGTTAAT TGCGCGC Black = pBluescript II vector sequence Brown = CC10 promoter Blue = Floxed STOP sequence Green = Rabbit beta globin intronic and PolyA sequence Red = HEL/PLP (56-70) coding region 344 Appendix 26. Secreted HEL/PLP(56-70) nucleotide/protein sequence 1- ATG AGG TCT TTG CTA ATC TTG GTG CTT TGC TTC CTG CCC CTG GCT 1-MR S L L I LV LCF L P L A 46- GCT CTG GGG AAA GTC TTT GGA CGA TGT GAG TTG GCA GCG GCT ATG 16-A L G K V F G R CE L A A A M 91- AAG CGT CAC GGA CTT GAT AAC TAT CGG GGA TAC AGC CTG GGA AAC 31-K RHGLDNYR G YS L G N 136-TGG GTG TGT GCC GCA AAA TTC GAG AGT AAC TTC AAC ACC CAG GCT 46-WV CA AK FE S N F N T QA 181-ACA GGC GCC AAA AAC TAC CAG GAC TAT GAG TAT CTC ATT AAT GTG 61-T G A K N YQDYE YLINV 226-ATT CAT GCT TTC CAG TAT GTC ATC TAT GGA ACC CGC GGA AAC CGT 76-IHA F Q YV I Y G T R G N R 271-AAC ACC GAT GGG AGT ACC GAC TAC GGA ATC CTA CAG ATC AAC AGC 91-N T D G S T D Y G I L Q I N S 316-CGC TGG TGG TGC AAC GAT GGC AGG ACC CCA GGC TCC AGG AAC CTG 106-R WWCND G R T P G SRNL 361-TGC AAC ATC CCG TGC TCA GCC CTG CTG AGC TCA GAC ATA ACA GCG 121-C N I P C S A L L S SDI TA 406-AGC GTG AAC TGC GCG AAG AAG ATC GTC AGC GAT GGA AAC GGC ATG 136-S V N C A K K IV SD GNGM 451-AAC GCG TGG GTC GCC TGG CGC AAC CGC TGC AAG GGC ACC GAC GTC 151-N A W YAW W RNRN C K G TD V 496-CAG GCG TGG ATC AGA GGC TGC CGG CTG 166-Q A W I R G C R L Black = HEL Red = PLP (56-70) Green = joining sequence 345 Appendix 27. Inverted stop sequence SIPLP construct - complete nucleotide sequence 1 GCGCGCAATT AACCCTCACT AAAGGGAACA AAAGCTGGCG GGCCCCCCCT 51 CGAGGTCGAC GGTATCGATA AGCTTATCGA TTTCGAACCC TGTAGCAGGG 101 CCTCTGTGCA GCAGAGGGTG CACACTACAG GTTGTGCACA CGCGTGTGCG 151 TGCATGCATG CAAGGGTGCA CATGCACAGG GTGGAGGTCA GAGGTCAACG 201 TCAGGTGTCT TCGTCTGTCA CCCACAGTCT TGTTTTTCAG ACAGGACTTC 251 TCACTGAATC TGAATCCTGC CCATTTGATG GGCTCATCAG TCAGTTTCCA 301 GGTTTCCCTG GTCCCCACCT CCCCAGGGCT GGAATTCAAG GCATATCTAG 351 CTTTTTTGCA TGAATGTTTG AGAGCCAAAT TCAGTTCCTC ATACTTGCCC 401 AATAGGCATA GTATATCCAC TGAGCCATGT CCCCAACTCA TTATGTTCAC 451 CTCATTCATT CATTCATCCA TCCATCCATC CATCCATCCA TTCATTCATT 501 CAGGTTTGGT TTGGTTTGGT TTTAGTGTTT TGGGTTTTTT TTCAAGACAG 551 GGTTTCTCTG TGTAGCCCTG GCTGCCCTGA AACTAACTTT CTTACTTACT 601 TTCTTTCTTT CTTCCTTCCT TCCTTTCTTT CTTTAAGTTG GTTTGGGTTT 651 TTTGGGGGGG GGAGGGTTTG GGTTTTTTTG TTTGTTTGTA TTTTATTCAA 701 GGAAAGGCTC CTCTGGGTTG CCCTGGCTGC CCTGGAAGGA ATTCTATAGC 751 CAGGCTGACC ATGAACTCAG AAATCTACCT GCCTCTCCCT CTGCCTCCCA 801 AGTGCTAGGA TTAAAGGTGT GTGACACACA CACAACTGGC TCTACATTTG 851 ACACTCACAG TATTCTGCAC ACAGCCACAG GGCTGTATCG CTAAGAGGCC 901 ATGTCACAGG TCCAGGAAGG CTTCACTGTT TAATAACTGG TTTGGAATTT 951 GGAAGTGGGA AAGTATGTAG AGACAATCTC ACTCTAGGAC TCAAAGACAG 1001 AGATAAAATG CTCTTTAGAA ACCTATTCTG TGGGGGAACA GAATCAGAAC 346 1051 TCTATGTCAG CCTCTGTGCT AGCTGGGGTC AGGCCAGAGA CACAGAAATG 1101 AGCTAAGCCT ACAGTGAGAA CTGATACGCA GGACAGTTGA GAACAATGGG 1151 AAAGTGCATC TGAAGGGCCC AAGGCCACTA GGAAAAAGGC AACCCAAAAT 1201 GCCCACAACT TTAAATCCCC TTCCTGATGT GTCATTAGAT GCAAACGGCC 1251 CTGGGGAGGA TGTGACGTTA AACAAGGCAG TGTTCTGTAC AGGGGCAGAT 1301 CCTGCAGTTA CTGGAAGCTG AAGGCTCCAG GCTGACCACA CTAGGTAGGA 1351 AGTTCATGAA ATGAGCTCTC GAAGCGCCTC TTCAGGTCTT CCCCGATGTC 1401 CAGCCCCACC AGCACCGTAG CAGGTACTGG GCATCTATTG ATTGGGTGGG 1451 TAGGTGAACA TTTGAGACAA CCTGGAAGTT TAAATGGGAT TTGTGGAAAT 1501 AGAGAGGGTG TTGGTTCCAG CCAAGCCAGG TTCCATGCTA AGACATAAAA 1551 GCACTGGAGA AGTAAAAGAG TTAACGCTGA ACATGGCCGT GGGAAGCGAG 1601 GAGACCAAGG TAAAGCCTGG GAATGGCTAA CACTTGAGAA CTGTCAACAT 1651 CATGAAAGGA TAAGAAAGAA TGGCCAAGGA AAGAAAACAG GAAAGAGCTG 1701 AGTGTGGGAG AGGCCTGGAG AGAATGGGGC AAGAAGTGGG AGGCTAAAGG 1751 GTAAGGGCAA GGGAGGGTCA AGTCAGATGA GGACTGAAGG TGCTTTCAAC 1801 TGGTAGGACT TGAGGGCTGC TCTGGGTAGG AGCCAGCCCG GTCTGGGCCC 1851 TGGGTCTCTC ATGTGTTCTA TGGAGAAGTC TTTATATTTG TTCATGTGTA 1901 TTGTATGTGG GCTCTAACCT GGCCAACAAT GCCCAAGAAT CAAGTGATTT 1951 TTGTGGCTTG AAGTCTAGCC ACCTTCCTTG GAGGGAGGCA ATAGAAGGAG 2001 CCTAGTGACA TCTCGGACGG AGTCTGGGGT CTTTGTCCTT CCCCTTGATC 2051 CCTGAAGGGT CTCCAGCCTC TGGTTCTCCA GGGTTGGCAA GTCTACAATT 2101 GCTTCCCGGA ACCTGGAGTG CTCAGTGCTT GACTTTAAAG AGGACACAGG 2151 TGCCTACAGT TCCACGACCT CTGGGTTCCC CGACGCCCCC CCCCCCGCAC 347 2201 TGCCCATTGC CCAAACACCC CACAAGTGGC CTATTGTGTG AGCTCAGTTT 2251 CAATGGGAAA AGAAACTGGG TTTATGAAAA GAGATTATTT GCTTATTGCA 2301 TGGAGATGAC TAAGTAAATA GTGCAATTTC TTGAGTGGAG CACAATCCCT 2351 GCCCCTACCT CTTGTGGGCT GCCAGGAACA TATAAAAAGC CACACGCATA 2401 CCCACACATA CCCACACATA CCCTCACATT ACAACATCAG CCCACATCTA 2451 CAGACAGCCC AAGCTTGGTA CCTCTCCGCG GTGGCGGCCG CAATGGCCAG 2501 TACTAGTGAA CCTCTTCGAG GGACCTAATA ACTTCGTATA GCATACATTA loxP fTACGAAGTTA51 TATTAAGGGT TCCGGATCCT CGGGGACACC AAATATGGCG} site 2601 ATCTCGGCCT TTTCGTTTCT TGGAGCTGGG ACATGTTTGC CATCGATCCA 2651 TCTACCACCA GAACGGCCGT TAGATCTGCT GCCACCGTTG TTTCCACCGA 2701 AGAAACCACC GTTGCCGTAA CCACCACGAC GGTTGTTGCT AAAGAAGCTG 2751 CCACCGCCAC GGCCACCGTT GTAGCCGCCG TTGTTGTTAT TGTAGTTGCT 2801 ACTGTTATTT CTGGCACTTC TTGGTTTTCC TCTTAAGTGA GGAGGAACAT 2851 AACCATTCTC GTTGTTGTCG TTGATGCTTA AATTTTGCAC TTGTTCGCTC 2901 AGTTCAGCCA TAATATGAAA TGCTTTTCTT GTTGTTCTTA CGGAATACCA 2951 CTTGCCACCT ATCACCACAA CTAACTTTTT CCCGTTCCTC CATCTCTTTT 3001 ATATTTTTTT TCTCGAGGGA TCTTTGTGAA GGAACCTTAC TTCTGTGGTG 3051 TGACATAATT GGACAAACTA CCTACAGAGA TTTAAAGCTC TAAGGTAAAT 3101 ATAAAATTTT TAAGTGTATA ATGTGTTAAA CTACTGATTC TAATTGTTTG 3151 TGTATTTTAG ATTCCAACCT ATGGAACTGA TGAATGGGAG CAGTGGTGGA 3201 ATGCCTTTAA TGAGGAAAAC CTGTTTTGCT CAGAAGAAAT GCCATCTAGT 3251 GATGATGAGG CTACTGCTGA CTCTCAACAT TCTACTCCTC CAAAAAAGAA 3301 GAGAAAGGTA GAAGACCCCA AGGACTTTCC TTCAGAATTG CTAAGTTTTT 348 3351 TGAGTCATGC TGTGTTTAGT AATAGAACTC TTGCTTGCTT TGCTATTTAC 3401 ACCACAAAGG AAAAAGCTGC ACTGCTATAC AAGAAAATTA TGGAAAAATA 3451 TTCTGTAACC TTTATAAGTA GGCATAACAG TTATAATCAT AACATACTGT 3501 TTTTTCTTAC TCCACACAGG CATAGAGTGT CTGCTATTAA TAACTATGCT 3551 CAAAAATTGT GTACCTTTAG CTTTTTAATT TGTAAAGGGG TTAATAAGGA 3601 ATATTTGATG TATAGTGCCT TGACTAGAGA TCATAATCAG CCATACCACA 3651 TTTGTAGAGG TTTTACTTGC TTTAAAAAAC CTCCCACACC TCCCCCTGAA 3701 CCTGAAACAT AAAATGAATG CAATTGTTGT TGTTAACTTG TTTATTGCAG 3751 CTTATAATGG TTACAAATAA AGCAATAGCA TCACAAATTT CACAAATAAA 3801 GCATTTTTTT CACTGCATTC TAGTTGTGGT TTGTCCAAAC TCATCAATGT 3851 ATCTTATCAT GTCTGGATCT GACATGGTAA GTAAGCTTGG GCTGCAGGTC 3901 GAGGGACCTA ATAACTTCGT ATAGCATACA TTATACGAAG TTATATTAAG} loxP 3951 site GGTTCCGGAT CCTAAGCTTG ATGGAATTCT TGAAGACGAA AGGGCCTCGT 4001 GATACGCCTA TTTTTATAGG TTAATGTCAT GATAATAATG GTTTCTTAGA 4051 CGTGCGGCCG CTCTAGAACT AGTGGATCCC CCGGGCTGCA GGAATTCGAT 4101 ATCAAGCTTA TCGATACCGT CGACCTCGAG GGGGGGCCCG GTACCGAGCT 4151 CGGATCCTGA GAACTTCAGG GTGAGTTTGG GGACCCTTGA TTGTTCTTTC 4201 TTTTTCGCTA TTGTAAAATT CATGTTATAT GGAGGGGGCA AAGTTTTCAG 4251 GGTGTTGTTT AGAATGGGAA GATGTCCCTT GTATCACCAT GGACCCTCAT 4301 GATAATTTTG TTTCTTTCAC TTTCTACTCT GTTGACAACC ATTGTCTCCT 4351 CTTATTTTCT TTTCATTTTC TGTAACTTTT TCGTTAAACT TTAGCTTGCA 4401 TTTGTAACGA ATTTTTAAAT TCACTTTTGT TTATTTGTCA GATTGTAAGT 4451 ACTTTCTCTA ATCACTTTTT TTTCAAGGCA ATCAGGGTAT ATTATATTGT 349 4501 ACTTCAGCAC AGTTTTAGAG AACAATTGTT ATAATTAAAT GATAAGGTAG 4551 AATATTTCTC CATATAAATT CTGGCTGGCG TGGAAATATT CTTATTGGTA 4601 GAAACAACTA CACCCTGGTC ATCATCCTGC CTTTCTCTTT ATGGTTACAA 4651 TGATATACAC TGTTTGAGAT GAGGATAAAA TACTCTGAGT CCAAACCGGG 4701 CCCCTCTGCT AACCATGTTC ATGCCTTCTT CTCTTTCCTA CAGCTCCTGG 4751 GCAACGTGCT GGTTGTTGTG CTGTCTCATC ATTTTGGCAA AGAATTCTGG 4801 CAACATGAGG TCTTTGCTAA TCTTGGTGCT TTGCTTCCTG CCCCTGGCTG 4851 CTCTGGGGAA AGTCTTTGGA CGATGTGAGT TGGCAGCGGC TATGAAGCGT 4901 CACGGACTTG ATAACTATCG GGGATACAGC CTGGGAAACT GGGTGTGTGC 4951 CGCAAAATTC GAGAGTAACT TCAACACCCA GGCTACAGGC GCCAAAAACT 5001 ACCAGIGACTA TGAGTATCTC ATTAATGTGA TTCATGCTTT CCAGTATGTC11 PLP(56- 5051 701 ATCTATGGAA CCCGCGGAAA CCGTAACACC GATGGGAGTA CCGACTACGG 5101 AATCCTACAG ATCAACAGCC GCTGGTGGTG CAACGATGGC AGGACCCCAG 5151 GCTCCAGGAA CCTGTGCAAC ATCCCGTGCT CAGCCCTGCT GAGCTCAGAC 5201 ATAACAGCGA GCGTGAACTG CGCGAAGAAG ATCGTCAGCG ATGGAAACGG 5251 CATGAACGCG TGGGTCGCCT GGCGCAACCG CTGCAAGGGC ACCGACGTCC 5301 AGGCGTGGAT CAGAGGCTGC CGGCTGTGAG GAGCTGCCGG AATTCACTCC 5351 TCAGGTGCAG GCTGCCTATC AGAAGGTGGT GGCTGGTGTG GCCAATGCCC 5401 TGGCTCACAA ATACCACTGA GATCGATCTT TTTCCCTCTG CCAAAAATTA 5451 TGGGGACATC ATGAAGCCCC TTGAGCATCT GACTTCTGGC TAATAAAGGA 5501 AATTTATTTT CATTGCAATA GTGTGTTGGA ATTTTTTGTG TCTCTCACTC 5551 GGAAGGACAT ATGGGAGGGC AAATCATTTA AAACATCAGA ATGAGTATTT 5601 GGTTTAGAGT TTGGCAACAT ATGCCCATAT GCTGGCTGCC ATGAACAAAG 350 5651 GTTGGCTATA AAGAGGTCAT CAGTATATGA AACAGCCCCC TGCTGTCCAT 5701 TCCTTATTCC ATAGAAAAGC CTTGACTTGA GGTTAGATTT TTTTTATATT 5751 TTGTTTTGTG TTATTTTTTT CTTTAACATC CCTAAAATTT TCCTTACATG 5801 TTTTACTAGC CAGATTTTTC CTCCTCTCCT GACTACTCCC AGTCATAGCT 5851 GTCCCTCTTC TCTTATGGAG ATCCCTCGAG CATGCATCTA GAGCGGCCGC 5901 CACCGCGGTG GAGCTCCAGC TTTTGTTCCC TTTAGTGAGG GTTAATTGCG 5951 CGC Black = pBluescript II vector sequence Brown = CC10 promoter Blue = Floxed STOP sequence Green = Rabbit beta globin intronic and PolyA sequence Red = HEL/PLP (56-70) coding region 351 Appendix 28. Lung targeted h1L-8 construct - complete nucleotide sequence 1 GCGCGCAATT AACCCTCACT AAAGGGAACA AAAGCTGGG ACCGGGCCCC 51 CCCTCGAGGT CGACGGTATC GATAAGCTTA TCGATTTCGA ACCCTGTAGC 101 AGGGCCTCTG TGCAGCAGAG GGTGCACACT ACAGGTTGTG CACACGCGTG 151 TGCGTGCATG CATGCAAGGG TGCACATGCA CAGGGTGGAG GTCAGAGGTC 201 AACGTCAGGT GTCTTCGTCT GTCACCCACA GTCTTGTTTT TCAGACAGGA 251 CTTCTCACTG AATCTGAATC CTGCCCATTT GATGGGCTCA TCAGTCAGTT 301 TCCAGGTTTC CCTGGTCCCC ACCTCCCCAG GGCTGGAATT CAAGGCATAT 351 CTAGCTTTTT TGCATGAATG TTTGAGAGCC AAATTCAGTT CCTCATACTT 401 GCCCAATAGG CATAGTATAT CCACTGAGCC ATGTCCCCAA CTCATTATGT 451 TCACCTCATT CATTCATTCA TCCATCCATC CATCCATCCA TCCATTCATT 501 CATTCAGGTT TGGTTTGGTT TGGTTTTAGT GTTTTGGGTT TTTTTTCAAG 551 ACAGGGTTTC TCTGTGTAGC CCTGGCTGCC CTGAAACTAA CTTTCTTACT 601 TACTTTCTTT CTTTCTTCCT TCCTTCCTTT CTTTCTTTAA GTTGGTTTGG 651 GTTTTTTGGG GGGGGGAGGG TTTGGGTTTT TTTGTTTGTT TGTATTTTAT 701 TCAAGGAAAG GCTCCTCTGG GTTGCCCTGG CTGCCCTGGA AGGAATTCTA 751 TAGCCAGGCT GACCATGAAC TCAGAAATCT ACCTGCCTCT CCCTCTGCCT 801 CCCAAGTGCT AGGATTAAAG GTGTGTGACA CACACACAAC TGGCTCTACA 851 TTTGACACTC ACAGTATTCT GCACACAGCC ACAGGGCTGT ATCGCTAAGA 901 GGCCATGTCA CAGGTCCAGG AAGGCTTCAC TGTTTAATAA CTGGTTTGGA 951 ATTTGGAAGT GGGAAAGTAT GTAGAGACAA TCTCACTCTA GGACTCAAAG 1001 ACAGAGATAA AATGCTCTTT AGAAACCTAT TCTGTGGGGG AACAGAATCA 352 1051 GAACTCTATG TCAGCCTCTG TGCTAGCTGG GGTCAGGCCA GAGACACAGA 1101 AATGAGCTAA GCCTACAGTG AGAACTGATA CGCAGGACAG TTGAGAACAA 1151 TGGGAAAGTG CATCTGAAGG GCCCAAGGCC ACTAGGAAAA AGGCAACCCA 1201 AAATGCCCAC AACTTTAAAT CCCCTTCCTG ATGTGTCATT AGATGCAAAC 1251 GGCCCTGGGG AGGATGTGAC GTTAAACAAG GCAGTGTTCT GTACAGGGGC 1301 AGATCCTGCA GTTACTGGAA GCTGAAGGCT CCAGGCTGAC CACACTAGGT 1351 AGGAAGTTCA TGAAATGAGC TCTCGAAGCG CCTCTTCAGG TCTTCCCCGA 1401 TGTCCAGCCC CACCAGCACC GTAGCAGGTA CTGGGCATCT ATTGATTGGG 1451 TGGGTAGGTG AACATTTGAG ACAACCTGGA AGTTTAAATG GGATTTGTGG 1501 AAATAGAGAG GGTGTTGGTT CCAGCCAAGC CAGGTTCCAT GCTAAGACAT 1 551 AAAAGCACTG GAGAAGTAAA AGAGTTAACG CTGAACATGG CCGTGGGAAG 1601 CGAGGAGACC AAGGTAAAGC CTGGGAATGG CTAACACTTG AGAACTGTCA 1651 ACATCATGAA AGGATAAGAA AGAATGGCCA AGGAAAGAAA ACAGGAAAGA 1701 GCTGAGTGTG GGAGAGGCCT GGAGAGAATG GGGCAAGAAG TGGGAGGCTA 1751 AAGGGTAAGG GCAAGGGAGG GTCAAGTCAG ATGAGGACTG AAGGTGCTTT 1801 CAACTGGTAG GACTTGAGGG CTGCTCTGGG TAGGAGCCAG CCCGGTCTGG 1851 GCCCTGGGTC TCTCATGTGT TCTATGGAGA AGTCTTTATA TTTGTTCATG 1901 TGTATTGTAT GTGGGCTCTA ACCTGGCCAA CAATGCCCAA GAATCAAGTG 1951 ATTTTTGTGG CTTGAAGTCT AGCCACCTTC CTTGGAGGGA GGCAATAGAA 2001 GGAGCCTAGT GACATCTCGG ACGGAGTCTG GGGTCTTTGT CCTTCCCCTT 2051 GATCCCTGAA GGGTCTCCAG CCTCTGGTTC TCCAGGGTTG GCAAGTCTAC 2101 AATTGCTTCC CGGAACCTGG AGTGCTCAGT GCTTGACTTT AAAGAGGACA 2151 CAGGTGCCTA CAGTTCCACG ACCTCTGGGT TCCCCGACGC CCCCCCCCCC 353 2201 GCACTGCCCA TTGCCCAAAC ACCCCACAAG TGGCCTATTG TGTGAGCTCA 2251 GTTTCAATGG GAAAAGAAAC TGGGTTTATG AAAAGAGATT ATTTGCTTAT 2301 TGCATGGAGA TGACTAAGTA AATAGTGCAA TTTCTTGAGT GGAGCACAAT 2351 CCCTGCCCCT ACCTCTTGTG GGCTGCCAGG AACATATAAA AAGCCACACG 2401 CATACCCACA CATACCCACA CATACCCTCA CATTACAACA TCAGCCCACA 2451 TCTACAGACA GCCCAAGCTT GATATCGAAT TCCTGCAGCC CGGGGGATCC 2501 TGAGAACTTC AGGGTGAGTT TGGGGACCCT TGATTGTTCT TTCTTTTTCG 2551 CTATTGTAAA ATTCATGTTA TATGGAGGGG GCAAAGTTTT CAGGGTGTTG 2601 TTTAGAATGG GAAGATGTCC CTTGTATCAC CATGGACCCC CATGATAATT 2651 TTGTTTCTTT CACTTTCTAC TCTGTTGACA ACCATTGTCT CCTCTTATTT 2701 TCTTTTCATT TTCTGTAACT TTTTCGTTAA ACTTTAGCTT GCATTTGTAA 2751 CGAATTTTTA AATTCACTTT TGTTTATTTG TCAGATTGTA AGTACTTTCT 2801 CTAATCACTT TTTTTTCAAG GCAATCAGGG TATATTATAT TGTACTTCAG 2851 CACAGTTTTA GAGAACAATT GTTATAATTA AATGATAAGG TAGAATATTT 2901 CTGCATATAA ATTCTGGCTG GCGTGGAAAT ATTCTTATTG GTAGAAACAA 2951 CTACACCCTG GTCATCATCC TGCCTTTCTC TTTATGGTTA CAATGATATA 3001 CACTGTTTGA GATGAGGATA AAATACTCTG AGTCCAAACC GGGCCCCTCT 3051 GCTAACCATG TTCATGCCTT CTTCTCTTTC CTACAGCTCC TGGGCAACGT 3101 GCTGGTTGTT GTGCTGTCTC ATCATTTTGG CAAAGAATTC TGTAAACATG 3151 ACTTCCAAGC TGGCCGTGGC TCTCTTGGCA GCCTTCCTGA TTTCTGCAGC 3201 TCTGTGTGAA GGTGCAGTTT TGCCAAGGAG TGCTAAAGAA CTTAGATGTC 3251 AGTGCATAAA GACATACTCC AAACCTTTCC ACCCCAAATT TATCAAAGAA 3301 CTGAGAGTGA TTGAGAGTGG ACCACACTGC GCCAACACAG AAATTATTGT 354 3351 AAAGCTTTCT GATGGAAGAG AGCTCTGTCT GGACCCCAAG GAAAACTGGG 3401 TGCAGAGGGT TGTGGAGAAG TTTTTGAAGA GGGCTGAGAA CTCATAAGAA 3451 TTCACTCCTC AGGTGCAGGC TGCCTATCAG AAGGTGGTGG CTGGTGTGGC 3501 CAATGCCCTG GCTCACAAAT ACCACTGAGA TCGATCTTTT TCCCTCTGCC 3551 AAAAATTATG GGGACATCAT GAAGCCCCTT GAGCATCTGA CTTCTGGCTA 3601 ATAAAGGAAA TTTATTTTCA TTGCAATAGT GTGTTGGAAT TTTTTGTGTC 3651 TCTCACTCGG AAGGACATAT GGGAGGGCAA ATCATTTAAA ACATCAGAAT 3701 GAGTATTTGG TTTAGAGTTT GGCAACATAT GCCCATATGC TGGCTGCCAT 3751 GAACAAAGGT TGGCTATAAA GAGGTCATCA GTATATGAAA CAGCCCCCTG 3801 CTGTCCATTC CTTATTCCAT AGAAAAGCCT TGACTTGAGG TTAGATTTTT 3851 TTTATATTTT GTTTTGTGTT ATTTTTTTCT TTAACATCCC TAAAATTTTC 3901 CTTACATGTT TTACTAGCCA GATTTTTCCT CCTCTCCTGA CTACTCCCAG 3951 TCATAGCTGT CCCTCTTCTC TTATGGAGAT CCCTCGAGCA TGCATCTAGA 4001 GCGGCCGCCA CCGCGGTGGA GCTCCAGCTT TTGTTCCCTT TAGTGAGGGT 4051 TAATTGCGCG C Black = pBluescript II vector sequence Brown = CC10 promoter Green = Rabbit beta globin intronic and PolyA sequence Blue = Human IL-8 355 Appendix 29. hIL-8 nucleotide/protein sequence 1- ATG ACT TCC AAG CTG GCC GTG GCT CTC TTG GCA GCC TTC CTG ATT 1-MT S K L A V A L L A A F L I 46- TCT GCA GCT CTG TGT GAA GGT GCA GTT TTG CCA AGG AGT GCT AAA 16-SA AL CEGA V L P R SA K 91- GAA CTT AGA TGT CAG TGC ATA AAG ACA TAC TCC AAA CCT TTC CAC 31EL R CQCIK T Y S K P F H 136- CCC AAA TTT ATC AAA GAA CTG AGA GTG ATT GAG AGT GGA CCA CAC 46-P K F I K E L R VIES GP H 181- TGC GCC AAC ACA GAA ATT ATT GTA AAG CTT TCT GAT GGA AGA GAG 61-CAN T E II V K L S D G R E 226- CTC TGT CTG GAC CCC AAG GAA AAC TGG GTG CAG AGG GTT GTG GAG 76-LCLDPK E NWVQR VV E 271- AAG TTT TTG AAG AGG GCT GAG AAC TCA 91-K F L K R A E N S Red = mutated base pair (T—>C) 356 Appendix 30. Inflammatory cell scoring system Score Bronchi Blood vessels 0. Bronchi or blood vessel is not surrounded by any inflammatory cells 1. Bronchi or blood vessels is surrounded by the occasional inflammatory cell 2. Inflammation completely surrounds and is 1-4 cells in diameter from the edge of the bronchi or vessel 3. Inflammation completely surrounds and is 5 or more cells in diameter from the edge of the bronchi or vessel 357