Significance of Anti-E2 in the Diagnosis of HCV Infection in Patients on Maintenance Hemodialysis: Anti-E2 Is Frequently Detected Among Anti-HCV Antibody-Negative 1
Dong-Soon Lee,2 Richard P. Lesniewski, Young-ChuI Sung, Won Ki Mm, Su-Gil Park, Keoun-Hoo Lee, and Hyun-Su Kim
lecularly cloned into a vector containing an SV 40 D.-S. Lee, Department of Clinical Pathology. Korea promotor and was expressed in Chinese Hamster Cancer Center Hospital, Seoul, Korea ovary cells. Using this E2 protein, the anti-E2 test was performed by EIA on 100 patients on maintenance R. Lesniewski. Pharmaceutical Products Division of Abbott Laboratories, Chicago, IL hemodialysis, and on 50 patients with chronic hepa- titis C who were anti-HCV-.positive, to evaluate the V-C. Sung. Department of Life Science, Pohang Uni- antigenecity ofthe E2 protein. Ofthe 100 hemodialysis versity of Science and Technology, Pohang, Korea patients, 15 (15.0%) tested anti-HCV-positive using a W.-K. Mm, Department of Clinical Pathology, Asan third generation anti-HCV ELISA kit. Of the 85 patients Medical Center, Ulsan University College of Medicine, who tested negative for anti-.HCV, nine (10.6%) were Seoul. Korea anti-E2-positive and six (66.7%) ofthese anti-E2 positive S.-G. Park, Devision of Nephrology, Department of patients showed HCV RNA viremia by HCV reverse Internal Medicine, Asan Medical Center, Ulsan Univer- transcription-polymerase chain reaction. Fourty-two sity College of Medicine, Seoul, Korea (84.0%) of 50 patients with chronic hepatitis C were K-H. Lee, Hyein Dialysis Clinic, Seoul, Korea anti-E2-positive. As a control group, we tested for H-S. Kim. Research & Development Center, Cheil anti-E2 among 30 blood donors who were anti-HCV- Foods & Chemicals, Youngin, Korea negative, and also among 85 patients with hepato-
(J. Am. Soc. Nephrol. 1996; 7:2409-2413) cellular carcinoma who were anti-HCV-negative, but in both groups, none (0%) was anti-E2-positive. In conclusion, these data suggest that the E2 protein of ABSTRACT HCV should be included in a diagnostic anti-HCV kit A routine screening test used in the diagnosis of for the detection of HCV infection in immunocompro- hepatitis C virus (HCV) infection is the anti-HCV anti- mised patients. body (anti-HCV) test containing core, NS3, NS4, and Key Words: Anti-HCV, E2 protein, diagnosis, HCV RNA, renal NS5 antigens of HCV. When HCV infection occurs failure in immunocompromised hosts, antibody formation against core, NS3, or NS4 antigens may be weak in A ntl-hepatltis C virus antibody (anti-HCV) is a the presence of HCV viremia and cannot be detected surrogate marker of HCV infection, but its pres- by routine anti-HCV tests. This study proposed that in ence does not exactly reflect HCV viremla in patients immunocompromised hosts such as patients with ( 1-3). HCV reverse transcription-polymerase chain chronic renal failure (whose capacity to form anti- reaction (RT-PCR) is performed to prove HCV viremia, but cannot be performed routinely because of the bodies is diminished), antibody formation against the delicate techniques involved and its unreliable results E2 region would be preserved, because the E2/NS1 (4). There may be a serious problem in using anti-HCV region of HCV is strongly immunogenic. The aim of tests in the diagnosis of HCV infection when anti-HCV this study is to evaluate the significance of anti-E2 in is used as a surrogate marker for HCV vlremia in the diagnosis of HCV infection among patients on Immunocompromised patients. Such patients, whose maintenance hemodialysis who are anti-HCV-nega- capacity to form humoral antibodies is reduced, may tive, using a conventional third-generation enzyme not show reactivity against conventional antl-HCV immunoassay (EIA) kit. The E2/NS1 gene of HCV en- antibody tests in spite of the presence of HCV viremla. coding the amino acid sequence 388-664 was mo- Lok et at. also reported that diminution or loss of reactivity to HCV antigens was observed after kidney 1 Received December 20. 1995. Accepted May 3, 1995. and bone marrow transplantation (5). Conventional 2 Correspondence to Dr. D.-S. Lee, Department of Clinical Pathology, Korea third generation anti-HCV antibody-detection kits at Cancer Center Hospital, 215-4, Gongrungdong Nowonku, Seoul, Korea. present contain the antigens of NS3, NS4, NS5, and 104&6673/071 1-2409103.00/0 Journal of the American Society of Nephrology capsid regions of HCV. When HCV Infection occurs In Copyright © 1996 by the American Society of Nephroiogy immunocompromised hosts, antibody formation
Journal of the American Society of Nephrology 2409 Significance of Anti-E2 in the Diagnosis of HCV Infection
against core, NS3, or NS4 antigens may be weak in the used as a solid-phase antigen In an enzyme immunoassay presence of HCV viremia and cannot be detected by (EIA) designed to detect E2 antibodies. routine antl-HCV tests. We suppose that in immuno- compromised patients, antibody formation against E2 Anti-HCV Antibody Immunoblot Test region would be preserved because the E2/NS1 region of HCV Is strongly Immunogenic. In this study, we DBL HCV blot 3.0 (third generation anti-HCV immunoblot; Genelabs Diagnostics Ltd. Singapore) containing five anti- evaluated the reactivity of E2 antigen In immunocom- gens (core, NS3- 1 , NS3-2, NS4, and NS5) was performed for promised hosts. As immunocompromised patients, we confirmation in patients who showed negative results for chose patients with chronic renal failure who were on anti-HCV, but positive results for antl-E2. maintenance hemodlalysis. A number of clinical fea- tures of uremia suggest abnormalities in immune function; these include a high rate of infection and an HCV RT-PCR and Southern Blot Hybridization increased incidence of cancers. Up to 60% of patients HCV RNA extraction was carried out using the method of with chronic renal failure suffer from severe infection, Okamoto et at. (8). HCV RNA was reverse-transcribed by and up to 40% of deaths are thought to be the result of M-MLV reverse transcriptase (Glbco BRL Life Technologies infectIon (6). In the area of humoral antibody, a de- Inc., Grand Island, NY) with antisense primer 300A (Table 1). crease in immunogiobulin levels is seen In uremic One third of the reverse-transcrIption product was subjected humans (7). to PCR using AmpliTaq polymerase (Perkmn Elmer Cetus, We compared the results of anti-E2 and conven- Norwalk, CT) with sense primer 805 and antisense primer tional third-generation anti-HCV antibody and Inves- 300A (Table 1). To prevent carryover, we put the negative controls in every third sample, and If there were any positive tigated the clinical importance of anti-E2 in diagnosis bands in negative controls, we discarded those results. PCR of HCV infection among patients on maintenance was carried out for 40 cycles In a Thermal Cycler 480 (Perkin hemodialysis. Elmer), and the conditions of PCR were 40 cycles of 94#{176}Cfor 1 mm, 58#{176}Cfor 1 min, and 72#{176}Cfor 1 mm. Of the 50 tL of MATERIALS AND METHODS PCR product, 6 pL was used for electrophoresis and the Materials remaining 44 pL of PCR product was blotted to a nylon membrane. Labeling of Probe 2 was done using the kination Sera from 1 00 patients with chronic renal failure who were method with gamma ATP and the blotted membranes were on maintenance hemodlalysis were frozen at -80#{176}Cuntil hybridized with probe 2 and autoradiographed. analysis. For the evaluation of E2 protein antigenicity, 50 serum samples from patients with chronic hepatitis C who were anti-HCV-positive (as a positive control group), 30 AmpIicor HCV PCR serum samples from healthy blood donors who were anti- HCV-negative and had high alanine aminotransferase levels To confirm the result of HCV RT-PCR objectively, we re- (as a negative control group), and 85 patients with hepato- tested HCV RT-PCR using an Amplicor HCV PCR kit (Roche cellular carcinoma who were anti-HCV-negative and consid- Diagnostic Systems. Branchburg, NJ) according to the in- ered to be immunocompetent were analyzed. structions of the kit. In brief, HCV RNA extraction was done using lysis buffer (5.7 M guanidium thiocyanate, 49.5 mM Anti-HCV Antibody Test Tnis HC1 [pH 7.51, 100 mM beta mercaptoethanol, 1 .25 g of poly(rA) per mL) and the RNA was then precipitated with We tested all of the samples for antl-HCV with a third- isopropanol by the method of Young et al. (9). Reverse generation anti-HCV kit (Abbott Laboratories, North Chi- transcription and amplification was carried out for 40 cycles cago, IL). We repeated the anti-HCV test with the same kit a (two cycles at 95#{176}Cfor 15 s and 60#{176}Cfor 20 5; 38 cycles at second time. 90#{176}Cfor 15 5 and 60#{176}Cfor 20 s) in a Geneamp PCR system 9600 thermal cycler (Perkin Elmer), using the Recombinant Anti-E2 Antibody Test enzyme Thermus thermophilus DNA (rTth) polymerase in- The HCV E2/NS 1 genes encoding amino acid sequence cluded In the Amplicor HCV PCR kit. Primers used in
388-664 were amplified by PCR and molecularly cloned In a combined RT-PCR are shown in Table 1 . The PCR product vector containing SV 40 promotor, and expressed In Chinese was confirmed by the DNA-EIA method as suggested In the Hamster ovary cells. The expressed E2 gene product was Amplicor HCV kit.
TABLE 1 . Primers used in reverse transcription-polymerase chain reaction (RT-PCR) Southern blot hybridization, and AmplicorTM hepatitis C virus PCR
Primer Test Polarity Position Sequence 5’ to 3’
80S RT-PCP Sense 60-83 GTC1TCACGCAGAAAGCGTCTACG 300A RT-PCR Antisense 278-301 CACTCACAAGCACCCTATCAGGCA PROBE 1 HybridIzation probe 121-175 TCCCGGGAGAGCCATAGTGGTCTGC GGAACCGGTGAGTACACCGGAA1T KY8O Amplicor Sense 56-79 GCAGAAAGCGTCTAGCCATGGCGT KY78 Amplicor Antisense 276-299 CTCGCAAGCACAATATCAGGCAGT KY88 Hybridization probe 251-275 G1TGGGTCGCGAAAGGCC1TGTGGT
2410 Volume 7 - Number 1 1 ‘ 1996 Lee et al
Follow-Up of Nine Anti-E2 Reactives cases showed weak reactivity against the NS3 and NS4 antigens After 1 yr, we followed-up those five cases that were only of HCV. The remaining three subjects anti-E2-positlve but HCV RT-PCR- and immunoblot-nega- were stifi HCV RT-PCR-negatlve, as before. tive. We performed antl-HCV tests, HCV RT-PCR, and immu- noblot assays on the samples obtained for the follow-up (1 yr DISCUSSION later) study. The external glycoprotein of the envelope is usually a major antigen of enveloped viruses, frequently serv- RESULTS ing a number of important functions such as receptor Anti-E2 Antibody binding, membrane fusion, and hemagglutination 10). is also the first antigen Of the 100 hemodialysis patients, 15 (15.0%) were ( The envelope protein anti-HCV-positive when tested with a third-generation exposed to host cells, and formation of antibodies to anti-HCV antibody kit (Table 2). Of the 85 patients the envelope region of a virus begins as early as 2 h who were anti-HCV-negatlve, nine (10.6%) were anti- after viral infection ( 10). Envelope proteins of HCV are E2-positive. Forty-two (84.0%) of 50 patients with composed of El and E2 protein, and E2 protein is chronic hepatitis C were anti-E2-positive, but none of more strongly immunogenic than E 1 . The E 1 and E2 the 30 blood donors with high alanine aminotransfer- regions of HCV induce humoral immune responses in ase levels and 85 patients with hepatocellular card- the host, whereas the capsid of HCV Induces both noma who were anti-HCV-negative showed a positive cytotoxic T cell responses and a strong humoral re- reaction against the E2 protein. sponse. For these reasons, the E2 region ofHCV Is the target of HCV vaccine research. Anti-HCV Immunoblot Test There are a few reports about the usefulness of anti-E2 in HCV infection. Yokosuka et a!. reported Of the nine patients who showed negative results for that levels of anti-E2 gradually decreased and finally anti-HCV but positive results for anti-E2, the sera of disappeared after treatment with interferon ( 1 1), and two patients showed positive reactions to the immu- they suggested anti-E2 as a marker for viral replica- noblot test. One was positive for core, NS-3, and NS-4, tion ( 12). Kawai et at. and Nakamoto et at. also re- and the other for NS-3 (Table 3). ported that detection of E2 protein of HCV In liver HCV RT-PCR and Southern Blot Hybridization tissue correlated with active HCV infection (13, 14). In addition, Zaaijer et at. recommended the E2 protein of Of the nine anti-E2 reactives who were anti-HCV- HCV as a new antigen for the detection of HCV anti- negative, four (44.4%) were HCV RT-PCR-posltive. The bodies. Among 39 blood donor samples with negative results of the RT-PCR and the Immunoblot test are HCV-RNA and indeterminate results of recombinant summarized in Table 3. immuno blot assay-2 (RIBA-2), he found five (13%) samples showing additional reactivity against NS5 Results of Follow-Up of Nine Anti-E2 Reactives and/or E2 ( 15). Matsuura et at. reported that the E2 Four subjects that were anti-E2- and HCV RT-PCR- protein, expressed in Insect cells, reacted with 90% of positive were stifi HCV RT-PCR-positive after 1 yr serum samples from patients with chronic hepatitis C, (Table 1). One subject (HD 67), who was anti-E2-, using an Immunopredipitation method (16). Immunoblot-, and HCV RT-PCR-positive, but anti- In this study, using an anti-E2 test, we were able to HCV-negative, actually proved to be seroconverted detect HCV Infection, which we could not detect with a after 1 yr, when tested using the third generation conventional third-generation anti-HCV kit. The sero- anti-HCV kit (Table 3). This subject has shown persis- converted subject (HD67) suggests the possibility of tent and high reactivity of anti-E2. Another two pa- early detectability of HCV Infection with an anti-E2 tients (HD26, HD3), who were HCV RT-PCR-negative 1 test because anti-E2 appeared 6 months earlier than yr before, turned out to be HCV RT-PCR-positive. the did appearance of the anti-HCV antibody with the Reaction to immunoblot in two subjects (HD3, HD66) conventional kit. The reactions to immunoblot testing were changed from negative to Indeterminate. Both In two subjects (HD3, HD66) were changed from neg-
TABLE 2. Results of anti-hepatitis C virus antigen (anti-HCV) and anti-E2 testing among four groups: patients on maintenance hemodialysis, blood donors, patients with hepatocellular carcinoma (HCC), and patients with chronic hepatitis
Anti-HCV-Negative Anti-HCV-Positive
Anti-E2 Results Hemodialysis Blood Donors HCC Hemodialysis HCC Chronic Hepatitis
(N = 85) (N = 50) (N = 85) (N = 15) (N = 7) (N = 50)
Anti-E2-Reactive 9 0 0 13 6 42 (10.6%) (0%) (0%) (86.7%) (85.7%) 84.0%) Anti-E2-Nonreactive 76 50 85 2 1 8
Journal of the American Society of Nephrology 2411 Significance of Anti-E2 in the Diagnosis of HCV Infection
TABLE 3. Results of hepatitis C virus (HCV) reverse transcription-polymerase chain reaction and immunoblot tests in nine patients who were anti-HCV-negative and anti-E2-positive
Octo ber 1994 October 1995 Patient Anti HCVa lmmunoblotb HCV Anti HCVc Immunoblot HCV Number Anti E2 Antibody Anti-HCV RT-PCR Antibody Anti-HCV RT-PCR
HD3 + - - - - lD’ +
HD67 + - + + + + +
HD34 + ------
HD23 + - - + - - +
HD26 + - - - - - +
HD88 + ------
HD89 + ------
HD55 + - + + - + +
HD66 + - - + - lDd + a Third-generation anti-HCV enzyme immunoassay kit. b Third-generation immunoblot test.
C Third-generation anti-HCV enzyme immunoassay kit. d Indeterminate reactive with NS3 and NS4. ative to indeterminate. This finding is also in accor- should be included in a diagnostic anti-HCV kit to dance with previous studies by Zaaijer et at. that detect HCV infection in Immunocompromised pa- showed that E2 antibody measurements were helpful tients. In assessing donor samples that were Indeterminate when tested by the immunoblot HCV antibody kits REFERENCES ( 14). Regarding the remaining three subjects, who 1 . [Editorials:] Hepatitis C virus-Epidemiology and sero- tested HCV RT-PCR-negative in both tests, It Is not logical diagnosis. J Clin Microbiol 1993;39:321-322. probable that their test results false positives because 2. McGulnness P, Alex BG, Lien A, Wiley B, Parson C, none of the control groups (blood donors, patients McCaughan GW: Detection of serum hepatitis C virus with HCC) were antl-E2-reactive. The detection of RNA in HCV antibody-seropositive volunteer blood do- nors. Hepatology 1993; 18:485-490. anti-HCV antibody with the serological EIA method 3. Roemo R, Thiers V. Driss F, Bertheilot P, Nalpas B, does not necessarily mean HCV viremia in patients. Brechot C:Hepatitis C virus RNA In serum of blood We occasionally see patients with antl-HCV positivity donors with or without elevated transaminase levels. Transfusion 1993;33:629-633. but with absence of HCV viremla. People do not con- 4. Zaaijer HL, Cuypers HT, Reesink HW, Winkel IN, sider those cases to be false positives. In the same Gerken G, Lelie PN: Reliability of polymerase chain way, this rule can be applied to the subjects with reaction for detection of hepatitis C virus. Lancet 1993; 341:722-724. antl-E2. The more important fact to be emphasized 5. Lok ASF, Chien D, Choo QL, et at.: Antibody response to here is that there was no anti-E2-positlve patient who core, envelope and nonstructural hepatitic C virus anti- was also anti-HCV-negative In any of the control gens: Comparison of immunocompetent and Immuno- groups, all members of which were considered to be suppressed patients. Hepatology 1993; 18:497-502. 6. Plum FP. Chronic renal failure. In: Wyngaarden JB, Immunocompetent hosts. The follow-up data of sub- Smith LH, Bennett JC, Eds. Cecil Textbook of Medicine, jects who tested positive for anti-E2 allow us to ex- 19th ed. Philadelphia: WB Saunders; 1992:533-541. plain one possibility for HCV RT-PCR negativity. It Is 7. Raymond GS. Physiologic environmental influences on the immune system. In: Stites DP, Strobo JD, Wells JV, possible that the viral titer of HCV in those three Eds. Basic and Clinical Immunology, 7th ed. Singapore: subjects might be under the limit of detection (< i0 Prentice-Hall International Inc. , Appleton & Lange; coples/mL) of the PCR assay, and therefore could not 1991:187-199. be detected by current PCR methods. In the near 8. Okamoto H, Okada 5, Suguyama Y, et at.: 5’ terminal sequence of of the hepatitis C virus genome. Jpn J Exp future, those subjects may be seroconverted or show Med 1990;60:167-177. the appearance of HCV viremla. Suggested candidates 9. Young KKY, Resnick RM, Myers TW: Detection of hepa- for clinical application of antl-E2 are as follows: fol- titis C virus by a combined reverse transcription- polymerase chain reaction assay. J Clin Microbiol 1993; low-up marker for interferon treatment, evaluation of 3 1:882-886. HCV RIBA indeterminate serum, predictive factors for 10. Cann AJ. Particles. In: Principles of Molecular Virology. active HCV replication, and diagnosis ofHCV infection San Diego, CA: Academic Press, Harcourt Brace; 1993: 21-44. in immunocompromised patients. 1 1 . Yokosuka 0, Omata M, Ito Y, Ohto M: Expression of HCV In conclusion, It is believed that immunocompro- E2/NS1 protein as a fusion protein with maltose binding mised patients showed a diminution or loss of reac- protein: Detection of anti-E2/NS1 antibody In chronic liver disease. Gut 1993;34:S64-S65. tivity to certain hepatitis C viral antigens, but reactiv- 12. Yokosuka 0, Ito Y, Ohto M, Omata M: High detection Ity to native E2 is less affected In these patients. Our rate ofhepatitis C virus E2 antibody in patients with type data strongly suggest that the E2 protein of HCV C hepatitis. Gastroenterol Jpn 1993;28:S52-S54.
2412 Volume 7 ‘ Number 1 1 ‘ 1996 Lee et al
13. Kawai H, Kaneko S, Adachi H, et at.: Simultaneous 15. Zaaljer HL, VallarI DS, Cunningham M, et at.: E2 and detections of hepatitis C virus genome and HCV proteins NS5: New antigens for detection of hepatitis C virus in parraffln embedded tissue sections. In: Abstract Book antibodies. J Med Virol 1994;44:395-397. of the International Symposium on Viral Hepatitis and 16. Matsuura Y, Suzuki R, Watanabe Y, et aL: Character- Liver disease-The 8th Annual Congress. Tokyo, May ization of El and E2 glycoproteins of hepatitis C virus 10-14, 1993. 1993:176. expressed in mammalian and insect cells. In: Abstract 14. Nakamoto Y, Kaneco S, Honda M, et aL: Detection of Book of International Symposium on Viral Hepatitis and putative E2 protein of hepatitis C virus in human liver. Liver disease-The 8th Annual Congress. Tokyo. May J Med Virol 1994;42:374-379. 10-14, 1993. 1993:174.
Journal of the American Society of Nephrology 2413