Downloaded from Genbank and Aligned with the Other 56 Sequences Isolated in This Study

Home , Labyrinthula, Labyrinthulomycetes, Oomycete

AN ENVIRONMENTAL SURVEY INVESTIGATING THE ASSOCIATION BETWEEN

LABYRINTHULOMYCETES AND SEA STAR WASTING DISEASE IN PISASTER

OCHRACEUS OF THE NORTHEASTERN PACIFIC OCEAN

Elizabeth Rae Herbert

B.A., The University of British Columbia, 2017

A THESIS SUBMITTED IN PARTIAL FULFILLMENT OF

THE REQUIREMENTS FOR THE DEGREE OF

MASTER OF SCIENCE

THE FACULTY OF GRADUATE AND POSTDOCTORAL STUDIES

(Zoology)

THE UNIVERSITY OF BRITISH COLUMBIA

(Vancouver)

September 2019

AN ENVIRONMENTAL SURVEY INVESTIGATING THE ASSOCIATION BETWEEN LABYRINTHULOMYCETES AND SEA STAR WASTING DISEASE IN PISASTER OCHRACEUS OF THE NORTHEASTERN PACIFIC OCEAN

submitted by Elizabeth Rae Herbert in partial fulfillment of the requirements for the degree of Master of Science in Zoology

Examining Committee:

Brian Leander Supervisor

Patrick Martone Supervisory Committee Member

Martin Adamson Supervisory Committee Member

Laura Parfrey Additional Examiner

Abstract

A wasting disease has devastated sea star populations across the Northeast Pacific coastline. In

2016, three novel Labyrinthulomycetes – saprobic marine protists linked to other wasting diseases – were found living on diseased sea star tissue of Pisaster ochraceus. This raised the question of whether these Labyrinthulomycetes are a causal factor in sea star wasting disease

(SSWD). I hypothesized that Labyrinthulomycetes are a causal factor in SSWD because most

Labyrinthulomycetes isolated from living tissue are parasitic to their hosts. If

Labyrinthulomycetes are a causal factor in the SSWD of P. ochraceus, they could be: H1) parasites – indicated by Labyrinthulomycetes found living specifically on the dermal tissue of P. ochraceus (host-specific); or H2) facultative parasites – indicated by Labyrinthulomycetes isolated from P. ochraceus and nearby decaying organisms (generalists). If Labyrinthulomycetes are not a causal factor in SSWD – simply taking advantage of already decaying organisms (H3) – then their isolation from diseased sea star tissue would be a result from these protists being at the right place at the right time. An environmental survey was conducted of the Labyrinthulomycetes of the Pacific coast of British Columbia to assess this association. I sampled diseased sea star tissue (P. ochraceus) and nearby decaying organisms from the intertidal zones to determine if these Labyrinthulomycetes are host-specific (H1) or generalists (H2 and H3). Identical

Labyrinthulomycetes were isolated from a variety of decaying organisms. More specifically,

Oblongichytrium porteri – one of the first Labyrinthulomycetes isolated from sea star tissue in

2016 – was found to have a wide abundance at all sampling locations on diseased sea star tissue and a variety of nearby decaying organisms. I conclude that the Labyrinthulomycetes associated with diseased P. ochraceus tissue are generalists, thereby rejecting H1. Further inoculation iii

experiments are needed to determine whether Labyrinthulomycetes are facilitative parasites involved in SSWD (H2), or if they are just taking advantage of the readily available decaying matter (H3).

Lay Summary

A wasting disease has devastated starfish populations across the Northeast Pacific coastline. The cause(s) of this disease has been a popular topic for research investigations. In 2016, three novel

Labyrinthulomycetes – fungus-like marine protists linked to other wasting diseases – were found living on diseased starfish tissue. Are these Labyrinthulomycetes a causal factor in sea star wasting disease (SSWD)? An environmental survey of Labyrinthulomycetes was conducted in the Northeast Pacific intertidal zones of British Columbia to assess this association. One of the

Labyrinthulomycetes previously isolated from diseased starfish tissue was found on nearly all substrates in all locations. Results neither supported nor rejected the contributing factor of

Labyrinthulomycetes to SSWD. Linking a single microbial agent to the disease is challenging, and there is likely more than one contributor to the outbreaks of SSWD. Increasing our knowledge of the lifestyles of Labyrinthulomycetes and their diversity in the ocean gives us insight as to how they contribute to ecosystem functioning.

Preface

All work presented in the current thesis is original work conducted at the University of British

Columbia. The project was planned and designed with the help of Dr. Brian Leander and Dr.

Celeste Leander, inspired by the previous project by Rebecca FioRito: “Characterization of three novel Labyrinthulomycetes isolated from ochre sea stars (Pisaster ochraceus).” Field and laboratory work, including the collection of organisms, light microscopy and DNA extractions, were undertaken in collaboration with Finola Fogarty – an undergraduate student I mentored throughout my master’s program. Phylogenetic analysis was undertaken in collaboration with

Dr. Niels Van Steenkiste – a postdoctoral fellow in the Leander Lab. One publication, on which

Finola, Celeste, and Brian are co-authors, is currently being prepared for publication.

Table of Contents

Abstract ...... iii

Lay Summary ...... v

Preface ...... vi

Table of Contents ...... vii

List of Tables ...... x

List of Figures ...... xi

List of Abbreviations ...... xiii

Acknowledgements ...... xiv

Dedication ...... xv

Chapter 1: Introduction ...... 1

1.1 The Labyrinthulomycetes ...... 1

1.1.1 General Overview ...... 1

1.1.2 Characterization and Classification ...... 2

1.1.2.1 History of Classification ...... 2

1.1.2.2 Introduction to the Genera ...... 5

1.1.3 Practical Importance ...... 10

1.1.3.1 Commercial ...... 10

1.1.3.2 Ecology ...... 12

1.1.3.2.1 Parasitic Labyrinthulomycetes ...... 15

1.2 Case Study: Sea Star Wasting Disease in Pisaster ochraceus ...... 17

1.2.1 Species Overview: Pisaster ochraceus ...... 17 vii

1.2.2 Sea Star Wasting Disease ...... 18

1.2.2.1 Labyrinthulomycetes Isolated from Diseased Pisaster ochraceus ...... 21

Chapter 2: Labyrinthulomycetes Suspected in Sea Star Wasting Disease are Generalists ..23

2.1 Synopsis ...... 23

2.2 Methods...... 25

2.2.1 Sample Collection ...... 25

2.2.2 Cultivation of Labyrinthulomycetes ...... 25

2.2.3 Imaging of Isolates ...... 26

2.2.4 DNA Extraction and Amplicon Sequencing ...... 28

2.2.5 Molecular Phylogenetic Analyses...... 29

2.3 Results ...... 31

2.3.1 Oblongichytrium ...... 31

2.3.2 Thraustochytrium kinnei ...... 33

2.3.3 Undescribed Isolate: Aplanochytrium sp...... 33

2.3.4 Molecular Phylogenetic Analysis ...... 35

2.4 Discussion ...... 37

2.4.1 Contributions to the Mystery of Sea Star Wasting Disease ...... 37

2.4.2 Conclusions of the Environmental Survey ...... 37

2.4.2.1 Oblongichytrium ...... 38

2.4.2.2 Thraustochytrium kinnei ...... 39

2.4.2.3 Undescribed Isolate: Aplanochytrium sp...... 39

2.4.3 Future Directions ...... 40

Chapter 3: Conclusions ...... 42 viii

3.1 “The perfect storm”: Sea Star Wasting Disease ...... 42

3.2 The Labyrinthulomycetes in the Intertidal Zone of British Columbia ...... 43

3.3 Future Directions ...... 44

3.3.1 Expand Environmental Survey ...... 44

3.3.2 Experimental Studies ...... 45

3.3.2.1 Inoculation Experiment of Pisaster ochraceus ...... 45

3.3.2.2 Labyrinthulomycetes Response to Climate Stressors ...... 46

3.4 Final Synopsis ...... 47

Bibliography ...... 50

Appendices ...... 61

Appendix A ...... 61

A.1 Initial Cultivation ...... 61

A.2 Oblongichytrium Abundance ...... 62

A.3 Two 18S rDNA Sequences from Thraustochytrium kinnei ...... 62

Appendix B ...... 64

B.1 Isolation Techniques ...... 64

List of Tables

Table 1 Substrate and sampling locations for isolated Labyrinthulomycetes in this study...... 27

Table 2 Primer pairs used in this study...... 29

List of Figures

Figure 1 Schematic drawings summarizing the variations in the life cycles of major lineages of the Labyrinthulomycetes. Modified from: Bennet et al. (2016)...... 4

Figure 2 Phylogenetic scheme summarizing relationships within the major lineages of Labyrinthulomycetes. Adapted from Bennet et al. (2016); Gomaa et al. (2013); and Pan et al. (2017)...... 5

Figure 3 Progression of SSWD. A) Community of healthy Pisaster ochraceus. B) Category 1 of SSWD indicated by lesion(s) on one arm or body. C) Category 2 of SSWD indicated by lesions on 2 arms or 1 arm and body. D) Category 3 of SSWD indicated by lesions on most of the body and/or 1-2 missing arms. E) Category 4 of SSWD indicated by severe tissue death and/or >3 missing arms. Source: Eisenlord et al. (2016)...... 19

Figure 4 DIC micrographs showing different morphological traits of Oblongichytrium isolates. A) Colony of Oblongichytrium porteri on agar media. B) Higher magnification of O. porteri on agar media. Arrows point to ectoplasmic nets. C) Colony of Oblongichytrium minutum on agar media. D) Higher magnification of O. minutum on agar media. Arrows point to ectoplasmic nets. E) Higher magnification of Oblongichytrium cells undergoing vegetative mitosis, indicated by arrowheads. F) Higher magnification of Oblongichytrium cell with large contractile vacuole (V). G) Higher magnification of Oblongichytrium oblong-shaped biflagellate zoospores, indicated by double arrowheads. Scale bars: A = 100 μm; B = 20 μm; C = 100 μm; D = 20 μm; E = 20 μm; F = 20 μm; G = 20 μm...... 32

Figure 5 DIC micrographs showing different morphological traits of Thraustochytrium kinnei isolates. A) Colony of T. kinnei on agar media. B) Higher magnification of T. kinnei on agar media. Arrows point to ectoplasmic nets. C) Higher magnification of T. kinnei cells with large contractile vacuole (V). D) Higher magnification of T. kinnei cells. Double arrowheads pointing to the sporangium. Single arrowhead pointing to the basal rudiment with sub-sporangium apophysis. Scale bars: A = 100 μm; B = 20 μm; C = 20 μm; D = 20 μm...... 34

Figure 6 DIC micrographs showing morphological traits of Aplanochytrium sp. (isolate EH69). A) Colony of Aplanochytrium sp. on agar media. B) Higher magnification of Aplanochytrium sp. on agar media. Arrows point to ectoplasmic nets. Scale bars: A = 100 μm; B = 20 μm...... 35

Figure 7 Bayesian majority-rule consensus tree of the 18S rDNA alignment. Filled circles (above) and hollow circles (below) the branches indicate full Bayesian posterior probabilities (pp) and ML bootstrap values (bs), respectively. All unsupported branches (pp < 0.95, bs < 70) have been collapsed. Scale bar = number of substitutions per site. Direct isolates of this study indicated by colored text (Oblongichytrium in red, Thraustochytrium kinnei in blue, Aplanochytrium sp. (EH69) in green)...... 36

xii

List of Abbreviations

bp – base pair(s)

DIC – differential interference contrast

DHA – docosahexaenoic acid

DNA – deoxyribonucleic acid

EP – extracellular polysaccharides

KMV – modified Vishniac’s medium mg – micrograms

PCR – polymerase chain reaction pp – posterior probability

PUFA – polyunsaturated fatty acids rDNA – ribosomal DNA rRNA – ribosomal RNA sp. – species spp. – species (plural)

SSA – serum seawater agar

SSaDV – sea star-associated densovirus

SSWD – sea star wasting disease

μl – microlitres

μm – micrometers

xiii

Acknowledgements

This thesis could not have been accomplished without the support and guidance of my supervisor, committee, friends and colleagues.

To Dr. Brian Leander, thank you for believing in me and this project. Your excitement for marine invertebrates inspired me during my undergraduate years, and since then you have supported me and my immense passion for marine biology.

To Dr. Celeste Leander, thank you for not only igniting my interest in labys, but for your incredible patience and guidance during every milestone (and crisis) of this journey.

To Dr. Niels Van Steenkiste, I have learned nearly all of my research tools from you. Thank you for taking me on as a co-author and undergraduate research assistant on our project ‘Species diversity in the marine microturbellarian Astrotorhynchus bifidus sensu lato (Platyhelminthes:

Rhabdocoela) from the Northeast Pacific Ocean.’ It was this project that sparked my interest in pursuing my own research thesis.

To Finola Fogarty, thank you for being my incredible first mentee and friend. Your smiling face and quick learning were of the upmost importance for this project.

To the Leander Lab, past and present members, thank you for your support through my years here at UBC. xiv

Dedication

This is dedicated to the people who kept my spirits high and my smile wide through this journey.

… you know who you are.

Chapter 1: Introduction

The Labyrinthulomycetes have undergone series of classification reconstructions and reevaluations, and the increased availability of molecular data is further unraveling the mystery of relatedness within this group. I will begin with a brief overview of these protists, then summarize their past and present classifications. After the main genera of Labyrinthulomycetes are summarized, I will outline their recent applications for industrial use. Although much of this realm is unexplored, I will encapsulate the ecological contributions of Labyrinthulomycetes and will then evaluate the potential link of Labyrinthulomycetes to the ecologically devastating sea star wasting disease (SSWD).

1.1 The Labyrinthulomycetes

1.1.1 General Overview

The Labyrinthulomycetes are a group of heterotrophic fungus-like protists that are found throughout a wide range of marine and freshwater habitats. Labyrinthulomycetes have three unique characteristics that divide these protists from other fungoid organisms: biflagellate zoospores possessing an anterior flagellum with mastigonemes (lateral hairs) (Perkins 1974); rhizoid-like ectoplasmic nets produced by a unique organelle called the “bothrosome” (Perkins

1972; Porter 1972, 1974); and multilamellate cell walls composed of Golgi body-derived scales

(Perkins 1974; Porter 1974). Labyrinthulomycetes are often referred to as ‘slime nets,’ due their ectoplasmic nets – a network of fine, often anastomosing, cytoplasmic threads – that extend from the bothrosome organelle of the cell body into the environment. This fine structure allows

Labyrinthulomycetes to absorb nutrients, or in some cases, forms the trackways along which the 1

cell bodies travel (Porter 1990). Most Labyrinthulomycetes are heterotrophic saprotrophs

(feeding on decaying organic matter), that absorb nutrients in an osmotrophic or phagotrophic manner (S. Raghukumar & Damare 2011). The breakdown of this organic matter – usually consisting of intractable plant and animal remains – is then accessible to other grazing animals.

The feeding behavior of Labyrinthulomycetes plays an important role in the ‘microbial loop’ by packaging and recycling nutrients in diverse communities of marine organisms (S. Raghukumar

& Damare 2011). The internal classifications of Labyrinthulomycetes have undergone radical revisions over the past century; a summary of the past and present phylogeny is outlined in the next section.

1.1.2 Characterization and Classification

1.1.2.1 History of Classification

Like most protists, the phylogenetic history of the Labyrinthulomycetes has undergone several revisions. Their uncertainty in phylogenetic history has led to the publishing of

Labyrinthulomycetes according to both the zoological (ICZN) and botanical (IBCN/ICNfap) codes of nomenclature. Historically, many Labyrinthulomycetes were described using the botanical code for nomenclature, whilst recent species descriptions of Labyrinthulomycetes have been under the zoological code (Bennett et al. 2016). Their unique and unusual characteristics have previously placed Labyrinthulomycetes in various unrelated groups. Labyrinthulomycetes were initially included in the Oomycota based on morphological characteristics. However, in the mid 1970’s, ultrastructural investigations revealed significant differences between

Labyrinthulomycetes and other oomycote biflagellate ‘zoosporic fungi,’ and the molecular systematics by Patterson (1989) confirmed that Labyrinthulomycetes were part of a supergroup 2

of eukaryotes called “Stramenopiles.” Porter (1990) proposed treating Labyrinthulomycetes as an independent phylum in the Stramenopiles, the Labyrinthulomycota, which is consistent with recent phylogenetic evidence (Bennett et al. 2016). Multigene phylogenetic analyses of the early

2000’s resolved the precise branching order of the main clades of Stramenopiles;

Labyrinthulomycetes, the human pathogen Blastocytis, and the ciliate-like opalinids form one major, early diverging branch of Stramenopiles. The other lineages are composed of

Hyphochytriomycota, Oomycota, and golden-brown photosynthetic Ochrophyta (Bennett et al.

2016).

The classifications within the Labyrinthulomycetes have undergone significant rearrangements with the increasing sophistication of microscopy and molecular technology (Honda et al. 1999;

Leander et al. 2004; Leander & Porter 2001; Olive 1975; Porter 1990; Yokoyama & Honda

2007; Yokoyama et al. 2007). Genera that were previously monophyletic – classified by morphological characteristics – rearranged into genera that are not morphologically alike with the support of molecular data. These new arrangements of genera highlighted the paraphyletic and polyphyletic nature of several genera and revealed that morphological characters are not reliable indicators of phylogenetic relationships (Pan et al. 2017). Additionally, molecular data have placed several protist genera into the Labyrinthulomycetes whose previous taxonomic affinity was unclear (Gomaa et al. 2013; Pan et al. 2017; Tice et al. 2016).

Combinations of molecular and biochemical characteristics has led to a revision of the nomenclature of Labyrinthulomycetes, revealing previously misidentified organisms (Pan et al.

2017), and introducing many new genera such as: Aurantiochytrium, Oblongichytrium, and 3

Stellarchytrium (FioRito et al. 2016; Yokoyama & Honda 2007; Yokoyama et al. 2007). Similar to fungi, the increase of extensive environmental sampling and sequencing of DNA has revealed a vast number of undescribed representatives of Labyrinthulomycetes in a wide range of marine, freshwater, and terrestrial environments (M. D. M. Jones et al. 2011). Environmental DNA surveys have improved knowledge on the diversity, habitats, and distribution of the

Labyrinthulomycetes; however, most environmental lineages have proven insufficient resolution for deeper divisions of this group, as they are mostly undescribed or uncultivatable (Pan et al.

2017). Genus-level classifications are problematic in the Labyrinthulomycetes because the morphological features of different species are difficult to observe and often dependent upon culture conditions (Yokoyama & Honda 2007). Literature is inconsistent with determining the main lineages of the Labyrinthulomycetes; therefore, the most prevalent genera in the literature are listed in Figures 1 and 2, and described briefly in the next section of this thesis.

Figure 1 Schematic drawings summarizing the variations in the life cycles of major lineages of the Labyrinthulomycetes. Modified from: Bennet et al. (2016). 4

Figure 2 Phylogenetic scheme summarizing relationships within the major lineages of Labyrinthulomycetes. Adapted from Bennet et al. (2016); Gomaa et al. (2013); and Pan et al. (2017).

1.1.2.2 Introduction to the Genera

Labyrinthula

The first described species of Labyrinthulomycetes, Labyrinthula vitelli and Labyrinthula macrocystis, were described by Cienkowski (1867), who observed Labyrinthula spp. associated with intertidal algae in the Black Sea. Labyrinthula are unique from other Labyrinthulomycetes because their cells glide within their ectoplasmic net. Summarized in Figure 1, Labyrinthula spp.

begin as bi-flagellate zoospores, and upon landing on a substrate, zoospores will form cysts which develop into spindle-shaped cells, that form colonies embedded within the ectoplasmic network. Ectoplasmic nets are produced by unique organelles, the bothrosomes, scattered in the spindle-shaped cells; each cell develops a separate net and colonies have the ability to fuse the nets together (Perkins 1974; Yokoyama & Honda 2007). Labyrinthula spp. cells can travel in either direction within the integrated ectoplasmic net, similar to a highway-system. However, cells do not exhibit rapid multi-directional movements because their movement is restricted to inside the ectoplasmic net (Perkins 1974). Upon maturity, zoospores develop within the ectoplasmic net, and the cycle begins again (Leander et al. 2004).

Aplanochytrium

Similar to Labyrinthula, Aplanochytrium cells are able to move with their ectoplasmic net.

Unlike the Labyrinthula cells, Aplanochytrium cells are not embedded with the ectoplasmic net, and instead are able to crawl slowly on the ectoplasmic net (Perkins 1974; Yokoyama & Honda

2007). Aplanochytrium do not have biflagellate zoospores, and instead produce non-motile

‘aplano-spores.’ Summarized in Figure 1, once settled upon the substrate, ‘aplano-spores’ develop into cysts which eventually develop into cells and form colonies. Each cell produces an ectoplasmic net from the bothrosomes, and colonies are able to fuse their nets together (Perkins

1974; Yokoyama & Honda 2007). Upon maturity, ‘aplano-spores’ differentiate within the cell

(thallus), and the cycle begins with release of the spores (Leander et al. 2004).

Thraustochytrium

Thraustochytrium was the second discovered genus of Labyrinthulomycetes, described by

Sparrow (1936), who observed Thraustochytrium proliferum associated with benthic algae from

Woods Hole, Massachusetts. Thraustochytrium zoospores move via distally directed undulations of the longer anterior flagellum, while the posterior flagellum may or may not move.

Summarized in Figure 1, Thraustochytrium zoospores ultimately settle onto the substrate and begin to grow in size. The cell (thallus) can either be unicellular or colonial, and is composed of a vegetative and a reproductive component. The reproductive component of the thallus, the sporangium, is an oval shaped cell. The vegetative components consist of a sub-sporangium apophysis (or swelling), which is part of a larger single basal rudiment (Bahnweg & Sparrow

1974). The thallus produces a penetrating tube by a single bothrosome that releases digestive enzymes, and eventually this penetrating tube gives rise to a complex of branched rhizoids, called the “ectoplasmic net” (Goldstein & Belsky 1964; Perkins 1974; Yokoyama & Honda

2007). The sporangium grows in size, more than tripling the size of the initial sporangium cell, until zoospores are differentiated and released through a tear in the sporangial cell wall

(Goldstein & Belsky 1964). After zoospores are released, they are mobile for a range of approximately fifteen minutes to three hours, and the cycle repeats after settling on the substrate.

Schizochytrium, Oblongichytrium, and Aurantiochytrium

Schizochytrium develops tetrads (clusters) of sporangia through vegetative mitosis (referred to as successive binary division in most literature) (Bahnweg & Sparrow 1974). Summarized in Figure

1, after zoospore settlement, the cyst enlarges and becomes a young oil-droplet-filled thallus until the first cleavage furrow forms. Each furrow enlarges independently and divides again to 7

become a 4-cell tetrad, further succeeding divisions occur randomly. Ectoplasmic net formation is independent per segment, and is not initiated until the 4-cell tetrad stage. Zoospore formation is independent of the maturity of adjacent cells, and zoospore liberation is initiated through a tear in the sporangial cell wall (Goldstein & Belsky 1964). The successive binary division of the thallus resulting in the proliferation of an indeterminate mass of zoosporangia is a unique characteristic amongst fungi. However, the origin of spore-forming structures in other fungi is different from the ontogeny of sporangia in Schizochytrium (Goldstein & Belsky 1964).

Yokoyama & Honda (2007) separated Schizochytrium into Schizochytrium sensu stricto,

Aurantiochytrium, and Oblongichytrium based on molecular phylogenetic data, fatty acid and pigment profiles. Schizochytrium species possess only betacarotene as a carotenoid pigment and

20% arachidonic acid. Oblongichytrium species are characterized by their narrow oblong-shaped zoospores, ca. 20% docosapentaenoic acid in their total polyunsaturated fatty acid profile, accumulation of canthaxanthin and β-carotene, and absence of asaxnthin. Colonies are pale yellow, have well-developed ectoplasmic nets, and enlarge by vegetative mitosis of the thallus, similar to Schizochytrium. Aurantiochytrium species possess astaxanthin, phoenicoxanthin, canthaxanthin, and beta-carotene as well as arachidonic acid and docosahexaenoic acid.

Aurantiochytrium colonies are smaller, but sporangia still undergo vegetative mitosis

(Yokoyama & Honda 2007).

Stellarchytrium

Stellarchytrium was recently discovered by FioRito et al. (2016), and their full lifecycle has not been observed. In their initial species description, ectoplasmic nets were observed as extensive 8

and readily visible. Division through vegetative cytokinesis was observed on agar media, similar to Schizochytrium. Swimming ovoid-shaped biflagellate zoospores were observed after being immersed in a few drops of seawater (FioRito et al. 2016).

Ulkenia, Botryochytrium, Parietichytrium, and Sicyoidochytrium

Yokoyama et al. (2007) amended initial descriptions of Ulkenia and revealed three new genera;

Botryochytrium, Parietichytrium, and Sicyoidochytrium based on molecular phylogenetic data, and supported by pigmentation and fatty acid profiles. Ulkenia species possess astaxanthin, phenicoxanthin, echinenon, and beta-carotene; Botryochytrium species possess canthaxanthin, echinoenon, beta-carotene, and n-6 docosapentaenoic acid; Parietichytrium species possess beta- carotene and docosatetraenoic acid; and Sicyoidochytrium species possess canthaxanthin, echinenon, and beta-carotene (Yokoyama et al. 2007). The mobile zoospores of these genera ultimately settle onto the substrate and begin to grow in size. The sporangium grows in size, until the cell wall disappears and a naked sporangial protoplasm remains. This sporangial protoplasm

“pinches and pulls” to form biflagellate zoospores, and the cycle begins again (Yokoyama et al.

2007).

Amphifilia, Amphitrema, Archerella, Diplophrys and Paramphitrema

Amphifilia, Amphitrema, Archerella, Diplophrys and Paramphitrema are planktonic species recently added to the Labyrinthulomycetes with support of molecular data. These

Labyrinthulomycetes were formerly classified in the testate amoebae, with characteristic cells enclosed in ovoid, elongated, fusiform, or rectangular punctate shells (Gomaa et al. 2013).

Amphifilia cell shells consist of Golgi-derived, colorless, ovoid surface scales (Anderson & 9

Cavalier-Smith 2012), while Amphitremida (Amphitrema, Archerella, Diplophrys and

Paramphitrema) cell shells consist of thick, rigid, lightly pigmented shells (Gomaa et al. 2013).

Most members have apertures of the outer shell and ultrastructural traits resembling bothrosomes, but are described in the literature as not “true bothrosomes.” Also, Amphifilia have filamentous ectoplasmic extensions extending from the apertures which resemble ectoplasmic nets, but are described as not “true ectoplasmic nets” (Gomaa et al. 2013; Pan et al. 2017). The decision to list these features as “not true” bothrosomes and ectoplasmic nets is based on the phylogenetic analysis by Gomaa et al. (2013), which suggests that the bothrosome appears lately in the evolution of Labyrinthulomycetes. There are no observed zoospores of Amphifilia,

Amphitrema, Archerella, Diplophrys or Paramphitrema (Pan et al. 2017).

1.1.3 Practical Importance

1.1.3.1 Commercial

Labyrinthulomycetes have an important role in remineralization and as a result, their byproducts have caught attention for commercial use. Thraustochytrids (such as Thraustochytrium,

Schizochytrium, Aurantiochytrium, and Aplanochytrium) have gained special attention due to their robust growth rates, production of carotenoid pigments and valuable omega-3 polyunsaturated fatty acids (PUFAs), including docosahexaenoic acid (DHA) and eicosapentaenoic acid (EPA) (Bowles et al. 1999; Lewis et al. 1999; Pan et al. 2017; Yokoyama

& Honda 2007). Renewable DHA produced by Aplanochytrium and Schizochytrium have been used to feed rotifers and brine shrimp prior to feeding them to finfish larvae, and their growths are being researched as an alternative source of fish oil for use in salmonid aquafeeds (Miller et al. 2007; S. Raghukumar 2008). Additionally, the DHA produced from Schizochytrium has been 10

used in common foods of human consumption such as butter, cheese, yogurt and cereal (Gupta et al. 2016). Other extracellular polysaccharides (EP’s) produced by thraustochytrids (such as

Aplanochytrium, Botryochytrium, Thraustochytrium, and Ulkenia) have a wide variety of properties including the potential antitumor, antiviral, and anticoagulant agents (S. Raghukumar

2008; Singh et al. 2014). For example, squalene production of Aurantiochytrium sp. (strain 18W-

13a) has caught the eye of cosmetic and pharmaceutical companies (Kaya et al. 2011) because squalene is a key precursor for the biosynthesis of cholesterol, bile acids and steroids in plants and animals, and is effective at inhibiting chemically induced colon, lung and skin tumorigenesis. The discovery of the 18W-13a strain is groundbreaking due to its anticipated alternative source for commercial production of squalene, instead of deep-sea sharks (Kaya et al.

2011). Novel secondary metabolites – those not directly involved in normal growth, development or reproduction (i.e. antibiotics or terpenoids) – have been discovered through commensalistic and symbiotic relationships between microbes and marine invertebrates, suggesting a possible campaign to discover new drugs from invertebrate relationships with Labyrinthulomycetes (S.

Raghukumar 2008).

Other commercial attention for thraustochytrids is within the bioremediation and biodiesel fields because of the ability of Thraustochytrium, Schizochytrium, and Aurantiochytrium to break down complex organic material in the substrate to sustain their metabolism. One strain of

Thraustochytrium (T18) has proven effective in purifying water from waste systems, demonstrating the efficiency of commercial production of Labyrinthulomycetes for wastewater recovery (Lowrey et al. 2016). The potential of thraustochytrids for bioremediation was demonstrated by Raikar et al. (2001) by using hydrocarbon degradation experiments, which may 11

contribute to a larger solution for oil-spills in the ocean. In their study, an isolate degraded up to

71% of tarballs (viscous hydrocarbons) and added to sediments in one month, demonstrating their ability to break down the complex hydrocarbon molecules (S. Raghukumar 2008; Raikar et al. 2001). Labyrinthulomycetes, similar to hydrocarbon degrading bacteria, may form the biological basis for the natural oil‐degrading capacity of the ecosystem (Brooijmans et al. 2009).

Thraustochytrium, Schizochytrium and Aurantiochytrium have a high potential for biodiesel production, due to their high fatty acid content for biodiesel (FAB) content, demonstrating their potential contribution to carbon neutral fuel (Gupta et al. 2016). With increased investigations of

Labyrinthulomycetes, we may discover even more applications for these saprobic marine protists.

1.1.3.2 Ecology

Labyrinthulomycetes have important ecological roles including: the bio-erosion of calcium carbonate substrates; as parasites of commercially important marine animals; as contributors to biodiversity regulation in marine ecosystems; and as indicators of environmental change through studies of parasitic relationships with their hosts (Gleason et al. 2017). Most

Labyrinthulomycetes are marine, although some span the realms of freshwater and terrestrial environments. Labyrinthulomycetes feed on organic matter, which is initiated through the exogenous production of cellulase and xylanase degradation enzymes, as well as alkaline and acid phosphatase (Damare 2015; S. Raghukumar & Damare 2011). The production of these extracellular enzymes indicate the ability of Labyrinthulomycetes to dephosphorylate organic molecules, contributing an important role in nutrient cycling (Damare 2015).

Labyrinthulomycetes are primarily found in coastal environments, including estuarine and near- shore marine habitats such as seagrass beds around the world, and are commonly found associated with organic detritus and macroalgae (Kuznetsov 1981; Porter 1990). Labyrinthula are unique for their common association with marine vascular plants. In culture, the cells of

Labyrinthula are able to colonize and decompose a wider variety of vascular plant and algal tissues by penetrating the cell wall of the substrate, and decomposing the cellular contents of the substrate. Labyrinthula are able to feed on other epibiotic microorganisms including bacteria, yeast, hyphal fungi, diatoms, filamentous algae and even other Labyrinthulomycetes. However, the most common substrate to isolate Labyrinthula are from submerged moribund or adrift leaves of marine vascular plants and filamentous marine grasses, or thalloid macroalgae

(Bockelmann et al. 2012; Porter 1990). Closely related species of Labyrinthula, namely

Stellarchytrium, have been found associated with sea stars (FioRito et al. 2016). Terrestrial

Labyrinthula have been isolated from the roots and root hairs of trees in sandy soils of low salinity water, and from inland saline soils, which demonstrates the wide range of salinity tolerance of Labyrinthula (Amon 1978; Aschner 1958).

Thraustochytrium, Schizochytrium, and Ulkenia are considered euryhaline organisms because they have been isolated from environments ranging from weakly brackish waters to briny salt evaporation ponds (E. B. G. Jones & Harrison 1976). However, thraustochytrids are likely stenohaline because most species are found in habitats of more or less constant salinity

(Goldstein & Belsky 1964). Thraustochytrids are also recovered in large numbers from marine sediments (Bongiorni 2012), and thereby contribute significantly to the biomass of estuarine and marine environments. Unlike Labyrinthula, other thraustochytrids are rarely found growing on 13

living algae and vascular plants, likely due to the presence of antimicrobial secondary metabolites of plants (S. Raghukumar 2002). Brown algae, such as Sargassum, produce tannins to inhibit the growth of colonizing epibionts; however, these effects are short lived after which a succession of other organisms such as bacteria, hydroids, bryozoans, and other

Labyrinthulomycetes rapidly follow (Damare 2015). The unique extracellular enzymes and bioactive compounds produced by Labyrinthulomycetes allow them to survive on the nutrients produced by these plants. Tolerance experiments have revealed the ability of Schizochytrium and

Thraustochytrium to withstand other fluctuating environmental conditions including the ability to temporarily suspend animation (anabiosis) by resisting repeated cycles of drying and freezing for several days or even years (Kuznetsov 1981). This ability of anabiosis is likely due to the properties of EP’s produced by Labyrinthulomycetes to retain moisture and prevent desiccation

(Jain et al. 2005).

Other thraustochytrids have been found living within marine sponges (Höhnk & Ulken 1979), in the surface mucus of hermatypic (reef-building) corals (Harel et al. 2008), among the tissue of mollusks (G. M. Jones & O’Dor 1983; Mclean & Porter 1987; Polglase 1980); and are regular components of the gut microbiota of echinoids (Thorsen 1999). Thraustochytrium,

Schizochytrium, and Sicyoidochytrium may even be capable of hosting viruses (Perkins 1976; S.

Raghukumar 2008), which raises the possibility that Labyrinthulomycetes may be virus vectors for other organisms (Bennett et al. 2016). In cases where Labyrinthulomycetes are growing on living tissue, this growth may come at a cost to their host, such as the eelgrass wasting disease of

Zostera marina (Muehlstein et al. 1988).

1.1.3.2.1 Parasitic Labyrinthulomycetes

Labyrinthulomycetes can become parasitic and eventually become pathogens to their hosts causing wasting diseases. For example, this has been observed with Labyrinthulomycetes growing on primary producers. Labyrinthula zosterae has been identified as the causal agent in

Zostera marina wasting disease, which led to huge declines of the eelgrass populations

(Muehlstein et al. 1988). The effects of Labyrinthula-induced wasting diseases are ecologically devastating because eelgrass provides food, foraging areas, shelter and spawning surfaces to young fish and invertebrates (Muehlstein et al. 1988). Experiments infecting different seagrass genera with Labyrinthula sp. revealed that the pathogenicity of Labyrinthula sp. to seagrass is host-genus-specific (Garcias-Bonet et al. 2011). Additionally, pathogenetic behavior of

Labyrinthula has been observed outside of their marine habitats, particularly in turfgrasses associated with elevated salinity in soil or irrigation water. Labyrinthula terrestris is a causal factor in rapid blight, a recently discovered disease of cool-season turfgrasses (Douhan et al.

2009). The host-range of L. terrestris extends to many turf species, and even cereal and grain species such as wheat, rice and barley (Douhan et al. 2009). Species of Labyrinthula, Ulkenia and Schizochytrium-like thalli have also been observed as parasites infecting a number of diatom species; for example, Ulkenia amoeboidean has been observed parasitizing multiple species of diatoms (Gaertner 1979; C. Raghukumar 2006). Diatoms are responsible for 20% of global carbon fixation and considered the dominant marine primary producers; however, indirect effects of Labyrinthulomycetes parasitizing diatom species are relatively understudied, so the ecological impacts have yet to be assessed (Davis et al. 2012).

Many marine invertebrates, particularly those under stress, are parasitized by

Labyrinthulomycetes (FioRito et al. 2016). The marine free-living flatworm Macrostomum lignano is parasitized by Thraustochytrium caudivorum, identified by initial lesions on the flatworm, which can lead to partial or even complete dissolution of the animal (Lukas et al.

2007). Thraustochytrids (such as Schizochytrium, Sicyoidochytrium and Aurantiochytrium) growing in the tissues of nudibranchs, squids, and octopuses have been described as parasitic, but further research is needed to determine the certainty of parasitism in this relationship (G. M.

Jones & O’Dor 1983; Singh et al. 2014). The production of N-acetyl--glucosaminidase by

Thraustochytrium, Aurantiochytrium, Sicyoidochytrium, and Ulkenia indicates their ability to breakdown chitin in marine invertebrates, such as the shells of marine mollusks (Damare 2015).

The Quahog Parasite X (a thraustochytrid referred to as ‘QPX’) causes massive mortalities in the

Quahog hard-shell clam (Mercenaria mercenaria). This marine mollusk is not only important for absorbing pollutants, bacteria and viruses in the water through filter feeding, but is a highly commercially reared shellfish (Garcia-Vedrenne et al. 2013). A second example is in Abalone aquaculture systems in British Columbia, where Aplanochytrium haliotidis (formally

Labyrinthuloides haliotidis) acts as a facilitating parasite in the Abalone mortalities and is transmissible without direct contact between individual Abalone (Bower 1987). These marine mollusk mortalities result in serious environmental and economic losses because Abalone are herbivorous and are an important consumer to maintain algae populations low enough to decrease the chance of algal blooms (Stierhoff et al. 2012). In 2016, Stellarchytrium dubum,

Oblongichytrium porteri, and Aplanochytrium blankum were the first Labyrinthulomycetes isolated from dermal tissues of ochre sea stars (Pisaster ochraceus) exhibiting symptoms of the sea star wasting disease (SSWD) (FioRito et al. 2016). 16

1.2 Case Study: Sea Star Wasting Disease in Pisaster ochraceus

1.2.1 Species Overview: Pisaster ochraceus

Sea stars have earned the label “keystone species” because they exert a greater impact on their community than would be predicted by their relative abundance or biomass (Ferrer et al. 2015).

One species of sea star, Pisaster ochraceus, was the first recognized keystone species in the pioneering work by Paine (1966, 1969); and is particularly dominant across the Northeast Pacific coastline of North America. P. ochraceus sea stars prevent the monopolization of substrate by any single species, and thereby increase ecosystem diversity through consuming and non- consuming interactions (Gosnell & Gaines 2012). For example, when P. ochraceus populations decline, competitive dominant animals such as mussels and whelks will outcompete other invertebrates for space in rocky intertidal habitats. Because P. ochraceus selectively prey upon mussels such as Mytilus spp., space is available for less competitive species, thereby promoting biodiversity (Ferrer et al. 2015). Decreasing P. ochraceus populations in an ecosystem results in an increase of mussel and whelk populations, even though sea stars do not feed on whelks

(Gosnell & Gaines 2012). These studies demonstrate a requirement of keystone species; where removal or loss of such species can result in a dramatic shift in community structure, a decrease in biodiversity, and even a collapse of the community (Ferrer et al. 2015). Disease outbreaks are one of the many factors that can shift the diversity in these balanced ecosystems and these outbreaks are increasing in both frequency and intensity in many marine taxa (Bates et al. 2009).

Sea stars are notably regenerative species; meaning, they can regrow tissue or limbs when lost

(Khadra et al. 2015); however, when infected, a disease may consume their tissue faster than sea stars can regenerate.

1.2.2 Sea Star Wasting Disease

One category of disease, referred to as ‘wasting disease’, can rapidly cause death in many species. Wasting disease often targets species that play key community roles in their ecosystem, such as keystone species (Bates et al. 2009). The progression of wasting diseases are similar between echinoderm taxa, including sea stars. Symptoms of these wasting diseases begin with white coloured lesions, followed by turgor pressure loss and total body disintegration, and eventually results in total decay and death (Bates et al. 2009). SSWD is divided into four categories based on symptoms (Figure 3); category 1 is determined by small white lesions on the body or arms of the sea star (Figure 3B), and category 4 results in these stars wasting away into piles of slime and ossicles (Figure 3E) (Hewson et al. 2014). Sea stars have suffered from this wasting disease in past years, first noted back to the 1970’s (Menge 1979). Past outbreaks have been brief, spanning only a few months at most in a localized area along the Pacific coast, making it difficult to find the potential causes. Some outbreaks, occurring in association with unusually warm waters during El Niño periods (i.e. the Channel Islands in 1997), have highlighted the sensitivity of the incidence and progression of SSWD to temperature (Bates et al.

2009). In 2013, another SSWD swept through the Pacific coastline of North America at an unprecedented temporal scale, lasting nearly two years and affecting over 20 species of sea stars

(Menge et al. 2016). The extensive geographic range (from Baja California to Southern Alaska) and the vast number of species infected, support SSWD as the largest known marine wildlife epizootic disease to date (Hewson et al. 2014). Experimental treatments of seawater with UV light suggests a microscopic infectious stage is associated with SSWD, rather than a host-contact spread of the disease (Hewson et al. 2014).

A microbial pathogen, likely influenced by environmental change, is hypothesized for the cause of SSWD. Pathogens typically eliminate weaker, maladapted individuals in the population, affecting the density and behavior of infected organisms (Chandler & Wares 2017). Vibrio bacteria, the infectious sea star-associated densovirus (SSaDV), and an unidentified eukaryote have been isolated from die-offs of other sea star species, but it is difficult to distinguish causal relationships as microbial communities can flourish in a sick or injured animal (Hewson et al.

2014). Vibrio microbes are commonly found in or on marine invertebrates, and have been consistently identified in the remaining diseased sea star tissues in previous SSWD outbreaks.

Additionally, Vibrio spp. was isolated from Crown-of-Thorns Star (Acanthaster planci) following an injection of bacterial growth medium that caused symptoms similar to SSWD

(Hewson et al. 2014). SSaDV has also been a hypothetical candidate for the root cause of

SSWD; however, Vibrio and SSaDV are abundant in environmental samples. Recent conclusions from Hewson et al. (2018) and Harvell et al. (2019) indicate that their data only supports the causative pathogen SSaDV in SSWD for sea star Pycnopodia helianthoides. Hewson et al.

(2018) hypothesized that SSWD in other sea stars may represent a syndrome of heterogeneous etiologies between geographic locations and/or species; leaving many unanswered questions including: are other microbial agents, associated with dying sea stars; what triggers the outbreaks; and how the mass mortalities of sea stars will alter near-shore communities throughout the Northeast Pacific coast.

Environmental change is likely linked to the rates of the increased progression of SSWD in individuals, with increased temperature being the leading hypothesized environmental stressor influencing SSWD (Schiebelhut et al. 2018). Increased seawater temperature during immersion 20

influences the progression and intensity of wasting in P. ochraceus (Bates et al. 2009), consistent with the mortality reports of the Mediterranean sea star Astropecten jonstoni from wasting disease (Staehli et al. 2009). Relatively brief periods of elevated body temperature can also result in large-scale disease outbreaks (Bates et al. 2009), and these elevations in body temperatures can occur more often during periods of decreased upwellings of cold deep water and when warm weather coincides with daylight low tides (Bates et al. 2009). A decrease of 3oC delays the morbidity and mortality of P. ochraceus, further supporting the hypothesis that an increase in temperature increases the risk to SSWD (Kohl et al. 2016).

After the major mortalities of P. ochraceus between 2013-2014, populations of P. ochraceus have experienced record recruitment up to 300 times previous rates. Recovery rate predictions are difficult to determine because P. ochraceus does not reach reproductive maturity until nearly

5 years of age (Schiebelhut et al. 2018). When sampling previously exposed P. ochraceus, an over dominant mutation in an intron of the elongation factor 1-α (EF1A) gene was observed, which may mediate the tolerance and resistance of SSWD in P. ochraceus (Chandler & Wares

2017). Despite their somewhat resilient populations, the sea star wasting disease (SSWD) is still present in P. ochreacus populations today.

1.2.2.1 Labyrinthulomycetes Isolated from Diseased Pisaster ochraceus

Potential contributors to SSWD are Labyrinthulomycetes. In 2016, researchers discovered three novel Labyrinthulomycetes living on the diseased tissue of Pisaster ochraceus sea stars (FioRito et al. 2016). As discussed above, some Labyrinthulomycetes have adapted a pathogenic lifestyle and are associated with severe wasting diseases of both plants and marine animals under stress 21

(FioRito et al. 2016). These Labyrinthulomycetes are also isolated from a variety of substrates, making them generalist species with the ability to invade a host. The findings from 2016 led to the following questions: are these Labyrinthulomycetes a causal factor in SSWD or are they opportunistically taking advantage of the abundance of already decaying organic matter?

Chapter 2: Labyrinthulomycetes Suspected in Sea Star Wasting Disease are

Generalists

2.1 Synopsis

A wasting disease swept through the Northeast Pacific coastline between 2013-2014, devastating populations of over 20 species of sea stars- particularly Pisaster ochreacus. Populations of P. ochraceus are slowly recovering; however, the symptoms and effects of this wasting disease are still evident today. Researchers have been attempting to narrow down the cause(s) of sea star wasting disease (SSWD); more specifically, researchers are trying to discover why this recent outbreak swept through at unprecedented rates. In 2016, three novel Labyrinthulomycetes

(saprobic marine protists which have been linked to marine plant and invertebrate wasting diseases) were isolated from P. ochraceus dermal tissue showing wasting symptoms (FioRito et al. 2016). These researchers hypothesized that Labyrinthulomycetes are a causal factor in SSWD because most Labyrinthulomycetes isolated from living tissue are parasitic to their hosts (FioRito et al. 2016; Perkins 1973; Porter 1990). However FioRito et al. (2016) were unable to establish a direct link between Labyrinthulomycetes and SSWD. My research goals were to find a direct link between Labyrinthulomycetes and the wasting disease of P. ochraceus sea stars, and to contribute to the greater understanding of the diversity of Labyrinthulomycetes in the Northeast

Pacific Ocean. To address my research goals, I conducted an environmental survey to investigate the link of Labyrinthulomycetes and SSWD, and to determine how common and widespread the

Labyrinthulomycetes isolated from FioRito et al. (2016) are in the environment. I hypothesized that Labyrinthulomycetes are a causal factor in SSWD because most species isolated from living

tissue are parasitic to their hosts, and leading hypotheses of SSWD suggest an infectious microbial agent (FioRito et al. 2016; Perkins 1973; Porter 1990). If Labyrinthulomycetes are a causal factor in SSWD of P. ochraceus, they could be: H1) parasites – indicated by

Labyrinthulomycetes are found living specifically on the dermal tissue of P. ochraceus (host- specific); or H2) facultative parasites – indicated by Labyrinthulomycetes isolated from P. ochraceus and nearby decaying organisms (generalists). If Labyrinthulomycetes are not a causal factor in SSWD – simply taking advantage of already decaying organisms (H3) – then their isolation from diseased sea star tissue would be a result from these protists being at the right place at the right time. I sampled diseased sea star tissue and nearby decaying organisms from the intertidal zones of British Columbia and plated them on agar media to observe growth of

Labyrinthulomycetes. Sampling a variety of decaying organisms revealed the range of host specificity of Labyrinthulomycetes associated with sea stars showing symptoms of wasting disease. Most of the isolates were identified as Oblongichytrium spp. – including one of the original Labyrinthulomycetes discovered by FioRito et al. (2016) (Oblongichytrium porteri).

Identical Labyrinthulomycetes (primarily O. porteri and O. minutum) were isolated from all sampling locations from a variety of decaying organisms in different environments, including sea star, plant and other invertebrate tissue. This data suggests that the Labyrinthulomycetes associated with diseased sea star tissue are generalists in the rocky intertidal zone of the

Northeast Pacific Ocean, rejecting H1 and supporting H2 and H3. Further experimental research, such as inoculation experiments of Labyrinthulomycetes to healthy P. ochraceus, are needed to determine the details of their association with SSWD.

2.2 Methods

My research goals were to find a direct link between Labyrinthulomycetes and the wasting disease of P. ochraceus sea stars, and to contribute to the greater understanding of the diversity of Labyrinthulomycetes in the Northeast Pacific Ocean. I hypothesized that Labyrinthulomycetes are either: H1) parasites of P. ochraceus – indicated by Labyrinthulomycetes are found living specifically on the dermal tissue of P. ochraceus; H2) facultative parasites of P. ochraceus – indicated by Labyrinthulomycetes isolated from P. ochraceus and nearby decaying organisms

(generalists); or H3) simply taking advantage of already decaying organisms. To address my research goals and hypotheses, I conducted an environmental survey of decaying organisms in the Northeast Pacific rocky intertidal zones.

2.2.1 Sample Collection

Specimens of Pisaster ochraceus showing symptoms of the wasting syndrome, and other decaying organisms, were collected between January and October of 2018 from the rocky intertidal zones along the Northeast Pacific coastline. Specific locations and a detailed list of the decaying organisms collected are listed in Table 1.

2.2.2 Cultivation of Labyrinthulomycetes

Isolation and culture of potential Labyrinthulomycetes was necessary as the presence of these protists could not be determined by examination of substrate tissue under the light microscope.

All sample tissue was externally rinsed on site with filtered sea water before being excised into 1 cm2 pieces and placed onto nutrient rich agar plates. This method ensured that any potential isolates came from the sample tissue, rather than from the surrounding marine water. I plated 25

each sample on two different agar-based media: Serum Seawater Agar (SSA: 1% agar and 1% horse serum); and 2-keto-3-methylvalerate (KMV). KMV media contained 1 L seawater, 10 g agar, 0.1 g yeast extract, 0.1 g peptone, 1 g gelatin hydrolysate, 1 g glucose and <1 g GeO2. Both media recipes were prepared using filtered, autoclaved seawater. To prevent bacterial growth,

150 mg ampicillin salt and 150 mg streptomycin were added to the media after autoclaving

(FioRito et al. 2016). Once cooled, media was distributed to petri dishes, and the sample tissues were placed and flooded with 100 μl of autoclaved sea water. Colonies of Labyrinthulomycetes grew on the media plates at room temperature (23oC). Growths of Labyrinthulomycetes were transferred to new media plates every 7-10 days to further purify the isolates (FioRito et al.

2016). For additional information of isolation and cultivation methodology, refer to Appendix A and B.

2.2.3 Imaging of Isolates

Live specimens were imaged on a Zeiss Axioplan 2 microscope equipped with a Zeiss-Axiocam

503-color camera. Differential interference contrast (DIC) optics were used to enhance contrast of images. Slides were prepared by placing two drops of autoclaved seawater, then placing a 1 cm2 piece of agar with growing isolates on the slide and a coverslip. Zen software was used for measurements of morphological traits such as zoospores, ectoplasmic nets, and non-motile adult cells.

Table 1 Substrate and sampling locations for isolated Labyrinthulomycetes in this study.

Isolate Substrate Location Oblongichytrium porteri Cancer productus (crab) Bowen Island, BC Hemigrapsus orgenesis (crab)

Oblongichytrium porteri Ulva fenestrata (green algae) Friday Harbour, USA

Oblongichytrium porteri diseased Pisaster ochraceus (sea star) Nanaimo, BC Zostera marina (seagrass) Phyllospadix scouleri (seagrass)

Oblongichytrium porteri diseased Pisaster ochraceus (sea star) Pender Island, BC diseased Evasterias troschelii (sea star) pink and spiny scallop Cancer productus (crab) Hemigrapsus orgenesis (crab)

Oblongichytrium porteri Cancer productus (crab) Port Moody, BC Hemigrapsus orgenesis (crab) Ulva fenestrata (green algae)

Oblongichytrium porteri Cancer productus (crab) Powell River, BC Hemigrapsus orgenesis (crab)

Oblongichytrium porteri Cancer productus (crab) Sooke, BC Hemigrapsus orgenesis (crab) Batillaria atramentaria (snail) Strongylocentrotus purpuratus (sea urchin)

Oblongichytrium porteri Cancer productus (crab) Sunshine Coast, BC Hemigrapsus orgenesis (crab)

Oblongichytrium minutum Cancer productus (crab) Bowen Island, BC Hemigrapsus orgenesis (crab)

Oblongichytrium minutum Cancer productus (crab) Kitsilano, BC Hemigrapsus orgenesis (crab) diseased Pisaster ochraceus (sea star)

Oblongichytrium minutum Katharina tunicata (chiton) Nanaimo, BC

Oblongichytrium minutum Ulva fenestrata (green algae) Port Moody, BC Fucus distichus (brown algae)

Oblongichytrium minutum Ulva fenestrata (green algae) Powell River, BC

Oblongichytrium minutum Batillaria atramentaria (snail) Sooke, BC

Oblongichytrium minutum diseased Pisaster ochraceus (sea star) Sunshine Coast, BC

Oblongichytrium minutum diseased Pisaster ochraceus (sea star) West Vancouver, BC diseased Evasterias troschelii (sea star) Batillaria atramentaria (snail)

Oblongichytrium minutum Cancer productus (crab) Victoria, BC Hemigrapsus orgenesis (crab)

Thraustochytrium kinnei Zostera marina (seagrass) Nanaimo, BC Phyllospadix scouleri (seagrass)

Thraustochytrium kinnei Cancer productus (crab) Porteau Cove, BC Hemigrapsus orgenesis (crab)

Thraustochytrium kinnei Cancer productus (crab) Powell River, BC Hemigrapsus orgenesis (crab)

Thraustochytrium kinnei Cancer productus (crab) West Vancouver, BC Hemigrapsus orgenesis (crab) Fucus distichus (brown algae)

Aplanochytrium sp. Ulva fenestrata (green algae) Powell River, BC (EH 69)

2.2.4 DNA Extraction and Amplicon Sequencing

Genomic DNA was isolated from the cultured Labyrinthulomycetes following the standard protocol provided by the MasterPure complete DNA & RNA purification kit (Epicenter

Biotechnologies). PCR was performed on a Bio-Rad T100TM Thermal Cycler (http://www.bio- rad.com) using IllustraTM PuReTaqTM Ready-to-GoTM PCR beads (GE Healthcare), 22 µl of dH20, 2 µl of genomic DNA and 1 µl of primer mix. Primer mixes were a combination of three overlapping primer sets (Table 2). The PCR cycle consisted of an initial denaturing period (94 28

°C for 4 min); 40 cycles of denaturing (94 °C for 30 sec), annealing temperatures varied for each primer set (Table 2); extension (72 °C for 2 min) and final extension period (72 °C for 10 min).

Amplicons were visualized on 1.5% agarose gels stained with GelRedTM (Biotium) and enzymatically cleaned using IllustraTM ExoProStar S (GE Healthcare). Cleaned amplicons were sequenced using an Illumina MiSeqTM next generation sequencer (http://www.illumina.com) at the Sequencing + Bioinformatics Consortium at the University of British Columbia. For information on trouble shooting in sequencing methodology, refer to Appendix A.

Table 2 Primer pairs used in this study.

Primer Primer sequence (5′ → 3′) Direction Annealing temperature (°C) NS1 GTAGTCATATGCTTGTCTC Forward 46

NS4 CTTCCGTCAATTCCTTTAAG Reverse 46

586F AGCCGCGGTAATTCCAGCT Forward 55

1286R AACTAAGAACGGCCATGCAC Reverse 55

891F GTCAGAGGTGAAATTCTTGG Forward 50

1781R CCTTCCGCAGGTTCACCTAC Reverse 50

2.2.5 Molecular Phylogenetic Analyses

Resulting trace files were assembled into SSU rDNA sequences in Geneious v10.2.3

(http://www.geneious.com) and subjected to a BLAST search on the NCBI website

(https://blast.ncbi.nlm.nih.gov) to verify taxonomic identity. 84 sequences were downloaded from GenBank and aligned with the other 56 sequences isolated in this study. The default settings in Geneious were used to align the sequences, and fine curation was performed using 29

Gblocks v0.91b (Castresana 2000). The final 140-taxon alignment was cut at 862 base pairs, to avoid any bias in sequence length. Jmodeltest 2 (Darriba et al. 2012) selected a general-time reversible (GTR) model of nucleotide substitution that incorporated invariable sites and a gamma-distributed rate variation among sites (GTR + I + G) under the Akaike information criterion (AIC) and AIC with correction (AICc). These partitions and models of evolution were used in the RAxML v8.2.11 maximum likelihood analyses (Stamatakis et al. 2008), and

MrBayes v3.2.6 Bayesian analyses (Ronquist & Huelsenbeck 2003), of the 140-taxon dataset.

RAxML was run in Geneious, performing a best-scoring tree search and non-parametric bootstrapping (1000 pseudoreplicates). Two sequences of the Oomycete species, Haliphthoros milfordensis, were carefully chosen as the outgroup for this analysis; one sequence of H. milfordensis was downloaded from GenBank and the other, (EH 72), was directly isolated from our samples. Bayesian analysis was run in MrBayes on XSEDE in the CIPRES Science Gateway

(http://www.phylo.org), under the GTR + I + G model (nst = 6; rates = invgamma), using default prior settings, and four Monte Carlo Markov chains (MCMC; default temperature = 0.2) in two independent runs for 100,000,000 generations. Trees were sampled every 1000 generations after a burnin value of 25,000 generations (burnin = 0.25). The H. milfordensis sequence from

GenBank (AB284573) was selected as the outgroup for Bayesian analyses. Convergence was determined based on the LogL values and the average distance of split frequencies. 50% majority rule consensus trees were constructed from the 75,000 remaining trees in each analysis. I considered 70% bootstrap and 0.95 posterior probabilities as threshold values for branch support

(Huelsenbeck & Rannala 2004). A consensus phylogenetic tree was constructed from maximum likelihood and Bayesian analyses. The final tree was edited in Adobe Illustrator (Adobe

Illustrator CS6). 30

2.3 Results

2.3.1 Oblongichytrium

Representatives from Oblongichytrium porteri and Oblongichytrium minutum were isolated from nearly the same local and substrates (Table 1). Images and measurements were taken from isolates grown and transferred on either SSA or KMV media for 1 month, showing no preference to media type. After which time isolates were transferred onto a slide for observation. Cells were orbicular shaped with diameters ranging from 2.5 to 8.0 μm, forming dense colonies that ranged from 125 to 250 μm in diameter (Figure 4A-E). Cell colouring was either pale yellow or absent in pigmentation and large contractile vacuoles were observed (Figure 4F), similar to those described by FioRito et al. (2016). Cells had extensive ectoplasmic nets measuring up to 90 μm in length and 1.2 μm in width (Figure 4B, D). Colony growth through budding of cells via vegetative mitosis was observed multiple times and at various stages (Figure 4E). Oblong-shaped biflagellate zoospores were observed in many isolates (Figure 4G).

2.3.2 Thraustochytrium kinnei

Thraustochytrium kinnei isolates were found in different locations on a variety of substrates, with the exception of sea star tissue (Table 1). Images and measurements were taken from isolates grown and transferred on either SSA or KMV media for 1 month, showing no preference to media type. Isolates were then transferred onto a slide for observation. Cells were round, orbicular or spatulate shaped and ranged from 3.0 to 20.0 μm in diameter (Figure 5B, C, D).

Many contractile vacuoles and vegetative sub-sporangium apophysis were observed (Figure 5C,

D). T. kinnei colonies measured up to 160 μm in diameter and were orbicular or irregularly shaped (Figure 5A). Ectoplasmic nets measured up to 90 μm in length and varied in thickness

(Figure 5B). No zoospores were observed within the T. kinnei isolates.

2.3.3 Undescribed Isolate: Aplanochytrium sp.

Aplanochytrium sp. was isolated from green algae from Powell River (Table 1). The cells of isolate Aplanochytrium sp. (EH 69) were elliptical or amoeboid in shape, and were not observed moving. Cells on the interior on the colony were much smaller than the cells of the periphery, ranging from 3.0 to 11.5 μm in diameter respectfully (Figure 6B). The orbicular-shaped colony measured 150 μm in diameter, and ectoplasmic nets measured 40 μm in length (Figure 6A, B). I did not observe any zoospores from this isolate.

2.3.4 Molecular Phylogenetic Analysis

Based on both SSU rDNA sequences and morphological data, most isolates found in this study fall into two previously described clades – Oblongichytrium and Thraustochytrium kinnei – supported by bootstrap values and posterior probabilities higher than 70 and 0.95 respectfully.

Bootstrap values and Posterior probabilities support a division of two Oblongichytrium groups:

Oblongichytrium porteri and Oblongichytrium minutum. The 18S rDNA sequence from

Aplanochytrium sp. (EH 69) clusters within a clade containing serval environmental sequences labeled “Thraustochytrium sp.”, one Aurantiochytrium sp., and one described species:

Aplanochytrium haliotides. Full bootstrap support and posterior probability support the separation of Aplanochytrium sp. (EH 69) from an uncultured Labyrinthulid clone (Figure 7).

2.4 Discussion

2.4.1 Contributions to the Mystery of Sea Star Wasting Disease

One of my research goals was to find a direct link between Labyrinthulomycetes and the wasting disease of Pisaster ochraceus sea stars. By conducting an environmental survey, I addressed if

Labyrinthulomycetes were: parasites of P. ochraceus (H1), facilitative parasites of P. ochraceus

(H2), or taking advantage of the already decaying organisms (H3). By isolating Oblongichytrium spp. from diseased P. ochraceus tissue and other decaying organisms, I rejected H1. Although the isolation of Labyrinthulomycetes from living tissue suspects a parasitic relationship from

FioRito et al. (2016), the results of this study can neither support nor deny the involvements of

Labyrinthulomycetes in SSWD, thus neither confirming nor denying H2 and H3. Ecological diseases are often a result of multiple species interacting, making it difficult to identity the causal agent(s) (FioRito et al. 2016). Further inoculation experiments of Labyrinthulomycetes to healthy P. ochraceus sea stars would contribute to the relationship of Labyrinthulomycetes and

SSWD. In future studies I suggest using both KMV and SSA media when cultivating

Labyrinthulomycetes (particularly Oblongichytrium and Thraustochytrium) to increase the chance of survival and growth.

2.4.2 Conclusions of the Environmental Survey

One of my research goals was to contribute to the greater understanding of the diversity of

Labyrinthulomycetes in the Northeast Pacific Ocean. I determined that the Labyrinthulomycetes found in this study grow on many substrate types spread throughout the southern coast of British

Columbia, and can be isolated from both KMV and SSA media. I notably found

Oblongichytrium porteri – originally isolated from diseased sea star tissue – still living within 37

diseased sea star tissue and other decaying organisms. Thraustochytrium kinnei isolates were less common, but also grew on a variety of substrates. The isolated Labyrinthulomycetes found in this study are not novel, but are very important to understanding the ecological behaviors of these protists. More specifically, these findings highlight the diversity of the

Labyrinthulomycetes, including the unusual isolation of Labyrinthulomycetes from living tissue

(Leander et al. 2004).

2.4.2.1 Oblongichytrium

Members of Oblongichytrium are characterized by the shape of their oblong-zoospores and distinguished by the percentage of docosapentaenoic acid (DHA) in total polyunsaturated fatty acids (PUFA) (FioRito et al. 2016; Yokoyama & Honda 2007). Observations of oblong- zoospores and large, pale yellow colonies formed by continuous vegetative divisions in this study agree with the previous descriptions of Oblongichytrium (Yokoyama & Honda 2007).

Posterior probability (pp) and bootstrap values (bs) support the separation of Oblongichytrium porteri and Oblongichytrium minutum, although there are no distinctive morphological features nor geographical locations supporting the separation (Table 1). The morphological criteria used for the taxonomy of Labyrinthulomycetes does not correspond with the monophyletic groups inferred from recent molecular phylogenetic data (FioRito et al. 2016). Therefore, the morphological traits are only used to support the results from molecular phylogenetic data.

Because it is uncommon for a generalist decomposer, such as Labyrinthulomycetes, to grow on living organisms (Leander et al. 2004), FioRito et al. (2016) suggested that O. porteri could be playing a role in SSWD. Although this species could be a facilitative parasite of Pisaster 38

ochraceus, our success in isolating it from other decaying substrates in many different locations in British Columbia suggests that spreading SSWD may not be its only ecological role (Table 1).

Other Oblongichytrium spp. sequences from GenBank were isolated from Hawaii, Japan, and

Germany, suggesting that members this clade can be found over the globe.

2.4.2.2 Thraustochytrium kinnei

Thraustochytrium kinnei cells grew exceptionally large, and many contractile vacuoles were observed (Figures 5C, D). As mentioned earlier in Chapter 1.1.4.1. Thraustochytrium produce high levels of omega-3 polyunsaturated fatty acids (PUFAS) and the utilization of these oils ranges from cosmetic to biotechnology; however, T. kinnei has yet to be investigated for such purposes. Further investigation of the oils produced by these T. kinnei isolates may reveal their potential importance in these fields. T. kinnei was isolated from various crab carapaces, likely due to their ability to breakdown chitin by the production of N-acetyl--glucosaminidase.

Similar to Oblongichytrium, T. kinnei has a large distribution and were isolated from crabs and algae/seagrass from a range of locations. Additionally, there was no preference of growth between SSA or KMV media. The GenBank sequences of T. kinnei were isolated from different marine environments from Antarctica and Japan (Caamaño et al. 2017; Cavalier-Smith et al.

1994), suggesting this species has a global distribution.

2.4.2.3 Undescribed Isolate: Aplanochytrium sp.

The isolate Aplanochytrium sp. (EH69) unfortunately falls in a clade of environmental sequences with ambiguous labels (e.g., “Thraustochytrium sp.”). Within this clade there are unpublished 39

GenBank sequences identified as Aurantiochytrium sp., Thraustochytrium sp., and an uncultured

Labyrinthulid, all isolated from New York, Japan, Chile, and Antarctica. The only sequence with a confirmed identity in this clade is Aplanochytrium haliotides (formally Labyrinthuloides haliotides), which is a known parasite of Abalone (Bower 1987). This group represents a very diverse group of Labyrinthulomycetes, many of which are likely previously misidentified based on morphological similarities since molecular phylogenetic data has grouped them together. The placement of isolate Aplanochytrium sp. (EH69) in a group with named species A. haliotidis, as well as cell morphology, suggest that this isolate is a member of Aplanochytrium. However, I did not observe any zoospores, and such observations are needed to place new isolates into

Aplanochytrium.

2.4.3 Future Directions

The diversity of Labyrinthulomycetes in the Northeast Pacific is poorly understood (FioRito et al. 2016). I was able to contribute to a more comprehensive understanding of the geographical distribution and range of substrates of Labyrinthulomycetes by sequencing 72 isolates from a variety of substrates from sites along the British Columbia coastline. Future studies should monitor changes in the populations of Labyrinthulomycetes by sampling from these same locations over time, or to sample from a larger radius for larger spatial patterns. Transcriptomes of Labyrinthulomycetes would provide us with a more robust understanding of their phylogenetic relationships and could help to explain the variety of roles of Labyrinthulomycetes in the marine ecosystem, specifically those involved in wasting diseases. Marine microbes are paramount in decomposing tissue and recycling nutrients in the ocean (S. Raghukumar &

Damare 2011). Increasing our knowledge of the different lifestyles of Labyrinthulomycetes and their diversity in the ocean gives us more insight as to how these ecosystems operate as a whole.

Chapter 3: Conclusions

3.1 “The perfect storm”: Sea Star Wasting Disease

Environmental change is likely linked to the rates of the increased progression of SSWD in individual sea stars (Schiebelhut et al. 2018). The combination of environmental stressors with a microbial agent, known as “the perfect storm,” is hypothesized as the cause of the recent SSWD outbreak (Hewson et al. 2014; Kohl et al. 2016). Based on a literature review and my own research, I think an increase in environmental temperature combined with at least one microbial agent leads to an increased rate of SSWD progression. Experiments by Bates et al. (2009) and

Kohl et al. (2016) have demonstrated the effects of temperature and the sea star wasting disease in Pisaster ochraceus More specifically, Bates et al. (2009) demonstrated the increased progression and mortality rates of diseased P. ochraceus during brief periods of elevated body temperatures. During my sampling for this environmental survey, my observations of SSWD in

P. ochraceus and environmental temperature aligned closely with Bates et al. (2009). I observed an increase in the presence and the rate of disease spread in P. ochraceus during the warmer summer months of July and August compared to the cooler winter months of November through

March. Although individual differences in thermal stress sensitivity may exist in P. ochraceus, data suggests that increasing sea surface temperatures might have a lasting impact on intertidal populations of this marine invertebrate keystone species in the Northeast Pacific Ocean (Kohl et al. 2016).

3.2 The Labyrinthulomycetes in the Intertidal Zone of British Columbia

The results of this project indicate that Oblongichytrium porteri – one of the

Labyrinthulomycetes first isolated from Pisaster ochraceus tissue showing symptoms of SSWD

– and Oblongichytrium minutum are some of the most abundant Labyrinthulomycetes in the rocky intertidal zone of the Northeast Pacific Ocean. One explanation for the abundance of

Oblongichytrium spp. along the British Columbia coastline assumes the link between growths of

Labyrinthulomycetes, SSWD, and increasing water temperatures. Lab tests by Wahid et al.

(2007) have demonstrated that increasing temperatures between 25 - 31oC lead to an increase in the growth rates of Labyrinthulomycetes and infection rate of bacterial cells. Additionally,

Garcia-Vedrenne et al. (2013) have demonstrated that the growth rate and physiology of parasitic thraustochytrid QPX is temperature dependent. Lab tests of P. ochraceus and field observations of other sea stars have demonstrated that an increase in both water and body temperature increases the progression of SSWD (Bates et al. 2009; Kohl et al. 2016; Staehli et al. 2009). If

Oblongichytrium spp. are facilitative parasites of P. ochraceus, and the warming water temperatures increase the growth rate of Oblongichytrium spp. and effects of SSWD, then there would be a large increase of Oblongichytrium spp. populations released to the surrounding the environment. Because most Labyrinthulomycetes are able to survive on a variety of substrates, it would not be surprising for Oblongichytrium spp. to be found associated with other substrates too.

This project was limited to a specific range of sampling sites in the rocky intertidal zones of

British Columbia. Substrate sampled were limited to the accessibility by walking and wading at low tide. The results demonstrate that O. porteri is still found associated with diseased P. 43

ochraceus tissue, as well as other decaying organisms. These results conclude that O. porteri, as well as Oblongichytrium minutum and Thraustochytrium kinnei are generalists found on a variety of decaying organisms. This conclusion does not rule out the possible contribution of

Labyrinthulomycetes to SSWD.

3.3 Future Directions

For anyone wishing to pick up where my project has left off in respect to SSWD, or for any of those who wish to begin working with the Labyrinthulomycetes, I have a few suggested projects.

However, I suggest referring to Appendix A before continuing with future projects.

3.3.1 Expand Environmental Survey

Labyrinthulomycetes are essential to the ecology of our marine ecosystem – including their involvement in wasting diseases – and yet they are a very understudied group of organisms. The sample locations for this study were centered on the rocky intertidal zones of British Columbia, and results indicated the dominance of Oblongichytrium spp. in these locations. To increase our knowledge of the distribution and involvement of Labyrinthulomycetes in SSWD, I propose the following environmental surveys further south of the Eastern Pacific coastline. Expanding the methods and protocols of this project to other rocky intertidal locations abundant with Pisaster ochraceus would give insight of the patterns of Labyrinthulomycetes living on diseased sea stars.

Studies of similar methods and protocols with other species of diseased sea stars would highlight any similarities and differences in Labyrinthulomycetes associated with SSWD. Examples of such projects would include the Pisaster brevispinus in Washington, Solaster dawsoni in southern California, Pycnopodia helianthoides (if populations regenerate after their devastating 44

loss due to the disease) in southern California or on the Oregon coast, and Evasterias troschelii in Washington. These surveys would provide important information for both the distribution patterns of Labyrinthulomycetes, and also information about the potential link of

Labyrinthulomycetes and SSWD.

3.3.2 Experimental Studies

3.3.2.1 Inoculation Experiment of Pisaster ochraceus

Inoculation experiments are required to establish a direct link between Labyrinthulomycetes and

SSWD. A potential experiment to assess this relationship would be to infect healthy Pisaster ochraceus sea stars with Labyrinthulomycetes isolated from diseased P. ochraceus tissue. In this experiment, Labyrinthulomycetes would be hypothesized as a causal agent in SSWD of P. ochraceus. To test this hypothesis, healthy P. ochraceus stars would have to be collected and kept in two identical environmentally controlled tanks, similar to the conditions of the wild populations’ habitat. Second or third generations would have to be produced before conducting the experimental stage of this project. Once healthy P. ochraceus stars survive in the tanks for one calendar year, experiments would begin to ensure the absence of prior exposure to the disease. The cultivation and isolation protocols would follow those outlined in Chapter 2 of this thesis, with a few modifications. After confirmed identification, Labyrinthulomycetes isolated from diseased P. ochraceus would be kept alive and transferred to new agar media plates every

1-2 weeks for 2 months to ensure purification of cultures. Once purified, molecular and morphological analyses on Labyrinthulomycetes would confirm identifications; and after identifications were confirmed, healthy P. ochraceus stars from tank 2 would be swabbed with cultured Labyrinthulomycetes. Tank 1 would remain untouched and serve as a control to avoid 45

any possibilities of stress due to the tank environment. Analysis would proceed comparing the P. ochraceus stars from tank 1 (control) and tank 2 (infected). Any symptoms of SSWD in the P. ochraceus stars in tank 2, and the absence of symptoms from stars in tank 1, would provide support for the original hypothesis, indicating the causal factor of Labyrinthulomycetes in

SSWD. Finally, the microscopic relationship, via TEM and/or confocal microscopy, of the sea star tissue lesions would need to be performed to support, or deny, the presence of

Labyrinthulomycetes in the diseased tissue.

3.3.2.2 Labyrinthulomycetes Response to Climate Stressors

The leading hypotheses behind SSWD support the combined factors of environmental stressors with a pathogen agent. Since Labyrinthulomycetes are found associated with a variety of substrates including marine invertebrates, it would be informative to measure the response of the

Labyrinthulomycetes isolated from diseased Pisaster ochraceus tissue to environmental stressors, similar to the temperature experiments of thraustochytrid QPX by Garcia-Vedrenne et al. (2013). In this potential experiment, Labyrinthulomycetes would be hypothesized to increase their growth rate in warmer temperatures (30oC) and decrease their growth rate in cooler temperatures (15oC), compared to the control of room temperature (23oC). The cultivation and isolation protocols would follow similarly to Chapter 2 of this thesis. Once isolated,

Labyrinthulomycetes would be transferred to new agar media plates every 1-2 weeks for 2 months for purification of cultures. Once purified, molecular and morphological analyses on the isolates would confirm identifications; and after identification, isolates of each identity would be transferred to three separate agar media plates, labeled 15oC, 23oC, and 30o C. These plates containing the isolates would then be placed in incubation chambers indicated by their labels. 46

These temperatures were chosen to represent variants of cold and warm, with respect to room temperature as the control (23oC). Effects of temperature would be measured by the rate of growth (i.e. the number of colonies) every day for one week. An increase of growth rate in warmer temperatures would indicate that Labyrinthulomycetes are likely increasing in population size due to warmer water temperatures from global climate change. This response could also indicate a connection between SSWD, global climate change, and

Labyrinthulomycetes.

3.4 Final Synopsis

My sampling campaign of Labyrinthulomycetes in British Columbia has contributed to the knowledge of the diversity of Labyrinthulomycetes in the Northeast Pacific Ocean and has provided insight on how common and widespread the Labyrinthulomycetes isolated from

FioRito et al. (2016) are in the environment. These results have led to the following conclusions:

1) Oblongichytrium porteri, originally isolated from diseased Pisaster ochraceus, is still isolated from P. ochraceus symptomatic of SSWD; 2) O. porteri can be isolated from nearly all decaying organic substrate in all rocky intertidal zones of British Columbia; 3) Isolates of O. porteri,

Oblongichytrium minutum and Thraustochytrium kinnei were the most abundant isolates from the rocky intertidal zones of British Columbia; 4) P. ochraceus sea stars are still found exhibiting symptoms of SSWD following patterns of increased symptoms with warmer temperatures, and healthy populations are slowly recovering. These results can neither confirm nor deny a parasitic relationship of Labyrinthulomycetes in SSWD; however, these results compare to similar studies of microbes involved in SSWD. The difficulty in distinguishing Labyrinthulomycetes as a causal factor in SSWD is likely due to the possible involvement of an environmental stressor and of the 47

flourishing microbial communities in sick or injured animals. The success in isolating an abundance of O. porteri and O. minutum in diseased sea stars and nearby decaying organisms as well as other investigations of the cause of SSWD suggest the need for inoculation experiments infecting P. ochraceus with Labyrinthulomycetes. These inoculation experiments, as well as confocal and electron microscopic investigations, would address the hypotheses unanswered from this thesis: are Labyrinthulomycetes facilitative parasites to P. ochraceus or are they taking advantage of these already decaying organisms.

Addressing these questions are ecologically important in order to predict and hopefully reduce the mortality rates of a future SSWD outbreak, especially if environmental stressors are a causal factor in SSWD. A major concern for species showing susceptibility to environmental change is that adaptation rates are outpaced by environmental change. Given the large population size, extensive gene flow, and the high standing stock of genetic variation on which selection can act,

P. ochraceus will likely persist and respond to future perturbations (Bates et al. 2009;

Schiebelhut et al. 2018). However, not all species of sea stars have the resilience seen in P. ochraceus, such as Pycnopodia helianthoides which experienced population declines between

96-100% (Hewson et al. 2014). If a wave of SSWD returns in the same magnitude as the 2013-

2014 outbreak, we may see a devastating domino effect from the loss of these key stone species.

As is clear by the phylogenetic analysis and the literature review in this thesis, the systematics of

Labyrinthulomycetes is poorly resolved because molecular phylogenetic data largely contradicts the previous genus-level morphological characteristics. Increased sampling efforts and cultivation of Labyrinthulomycetes will not only improve the knowledge of the diversity and 48

importance of these protists, but also provide data to improve molecular phylogenic inferences and diagnostic characters at the genus level. Resolving the phylogeny of Labyrinthulomycetes and their ecological relationships with marine organisms could reveal more industrial uses for these protists, as well as the possible causality and commonality of these protists in wasting diseases of marine animals, such as the sea star wasting disease in the Northeast Pacific Ocean.

Bibliography

Amon, J. P. (1978). Thraustochytrids and Labyrinthulids of Terrestrial , Aquatic and Hypersaline

Environments of the Great Salt Lake, USA. Mycologia, 70(6), 1299–1301.

Anderson, O. R., & Cavalier-Smith, T. (2012). Ultrastructure of Diplophrys parva, a new small

freshwater species, and a revised analysis of Labyrinthulea (Heterokonta). Acta

Protozoologica, 51(4), 291–304.

Aschner, M. (1958). Isolation of Labyrinthula macrocystis from soil. Bulletin of the Research

Council of Israel, 6D, 174–179.

Bahnweg, G., & Sparrow, F. K. (1974). Four New Species of Thraustochytrium from Antarctic

Regions, with Notes on the Distribution of Zoosporic Fungi in the Antarctic Marine

Ecosystems. American Journal of Botany, 61(7), 754–766.

Bates, A. E., Hilton, B. J., & Harley, C. D. G. (2009). Effects of temperature, season and locality

on wasting disease in the keystone predatory sea star Pisaster ochraceus. Diseases of

Aquatic Organisms, 86(3), 245–251.

Bennett, R. M., Honda, D., Beakes, G. W., & Thines, M. (2016). Handbook of the Protists.

Handbook of the Protists, 1-36.

Bockelmann, A. C., Beining, K., & Reusch, T. B. H. (2012). Widespread occurrence of

endophytic Labyrinthula spp. in northern European eelgrass Zostera marina beds. Marine

Ecology Progress Series, 445, 109–116.

Bongiorni, L. (2012). Thraustochytrids, a Neglected Component of Organic Matter

Decomposition and Food Webs in Marine Sediments. In S. Raghukumar (Ed.), Biology of

Marine Fungi, Progress in molecular and subcellular biology (Vol. 53, pp. 1–13). 50

Bower, S. M. (1987). Labyrinthuloides haliotidis n.sp. (Protozoa: Labyrinthomorpha), a

pathogenic parasite of small juvenile abalone in a British Columbia mariculture facility.

Canadian Journal of Zoology, 65, 1996–2007.

Bowles, R. D., Hunt, A. E., Bremer, G. B., Duchars, M. G., & Eaton, R. A. (1999). Long-chain n

- 3 polyunsaturated fatty acid production by members of the marine protistan group the

thraustochytrids: screening of isolates and optimisation of docosahexaenoic acid production.

Progress in Industrial Microbiology, 35(C), 193–202.

Brooijmans, R. J. W., Pastink, M. I., & Siezen, R. J. (2009). Hydrocarbon-degrading bacteria:

the oil-spill clean-up crew. Microbial Biotechnology, 2(6), 587–594.

Caamaño, E., Loperena, L., Hinzpeter, I., Pradel, P., Gordillo, F., Corsini, G., Tello, M., Lavín,

P., González, A. R. (2017). Isolation and molecular characterization of Thraustochytrium

strain isolated from Antarctic Peninsula and its biotechnological potential in the production

of fatty acids. Brazilian Journal of Microbiology, 48(4), 671–679.

Castresana, J. (2000). Selection of conserved blocks from multiple alignments for their use in

phylogenetic analysis. Mol Biol Evol, 17(4), 540–552.

Cavalier-Smith, T., Allsopp, M. T. E. P., & Chao, E. (1994). Thraustochytrids are Chromists, not

Fungi: 18s rRNA Signatures of Heterokonta. Philosophical Transactions: Biological

Sciences, 346(1318), 387–397.

Chandler, V. K., & Wares, J. P. (2017). RNA expression and disease tolerance are associated

with a “keystone mutation” in the ochre sea star Pisaster ochraceus. PeerJ, 5, e3696.

Cienkowski, L. (1867). Ueber den Bau und die Entwickelung der Labyrinthuleen. Archiv Für

Mikroskopishce Anatomie, 3, 274–310.

Damare, V. S. (2015). Diversity of thraustochytrid protists isolated from brown alga, Sargassum 51

cinereum using 18S rDNA sequencing and their morphological response to heavy metals.

Journal of the Marine Biological Association of the United Kingdom, 95(2), 265–276.

Darriba, D., Taboada, G. L., Doallo, R., & Posada, D. (2012). jModelTest 2: more models, new

heuristics and parallel computing. Nature Methods, 9(8), 772.

Davis, A. K., Hildebrand, M., Traller, J. C., Abbriano, R., & Smith, S. R. (2012). The place of

diatoms in the biofuels industry. Biofuels, 3(2), 221–240.

Douhan, G. W., Olsen, M. W., Herrell, A., Winder, C., Wong, F., & Entwistle, K. (2009).

Genetic diversity of Labyrinthula terrestris, a newly emergent plant pathogen, and the

discovery of new Labyrinthulid organisms. Mycological Research, 113(10), 1192–1199.

Eisenlord, M., Groner, M., Yoshioka, R., Elliott, J., Maynard, J., Fradkin, S., Turner, M., Pyne,

K., Rivlin, N., Hooidonk, R., Harvell, C. D. (2016). Ochre star mortality during the 2014

wasting disease epizootic: Role of population size structure and temperature. Philosophical

Transactions of the Royal Society B: Biological Sciences, 371.

Ferrer, R. P., Lunsford, E. T., Candido, C. M., Strawn, M. L., & Pierce, K. M. (2015). Saxitoxin

and the ochre sea star: Molecule of keystone significance and a classic keystone species.

Integrative and Comparative Biology, 55(3), 533–542.

FioRito, R., Leander, C., & Leander, B. (2016). Characterization of three novel species of

Labyrinthulomycota isolated from ochre sea stars (Pisaster ochraceus). Marine Biology,

163(8), 1–10.

Gaertner, A. (1979). Some fungal parasites found in the diatom populations of the Rosfjord area

(South Norway) during March 1979. Veröffentlichungen Des Instituts Für Meeresforschung

in Bremerhaven, 18, 92–33.

Garcia-Vedrenne, A. E., Groner, M., Page-Karjian, A., Siegmund, G. F., Singhal, S., Sziklay, J., 52

& Roberts, S. (2013). Development of Genomic Resources for a thraustochytrid Pathogen

and Investigation of Temperature Influences on Gene Expression. PLoS ONE, 8(9), 1–10.

Garcias-Bonet, N., Sherman, T. D., Duarte, C. M., & Marbà, N. (2011). Distribution and

Pathogenicity of the Protist Labyrinthula sp. in western Mediterranean Seagrass Meadows.

Estuaries and Coasts, 34(6), 1161–1168.

Gleason, F. H., Gadd, G. M., Pitt, J. I., & Larkum, A. W. D. (2017). The roles of endolithic fungi

in bioerosion and disease in marine ecosystems. I. General concepts. Mycology, 8(3), 205–

215.

Goldstein, S., & Belsky, M. (1964). Axenic Culture Studies of a New Marine Phycomycete

Possessing an Unusual Type of Asexual Reproduction, 51(1), 72–78.

Gomaa, F., Mitchell, E. A. D., & Lara, E. (2013). Amphitremida (Poche, 1913) Is a New Major,

Ubiquitous Labyrinthulomycete Clade. PLoS ONE, 8(1).

Gosnell, J. S., & Gaines, S. D. (2012). Keystone intimidators in the intertidal: Non-consumptive

effects of a keystone sea star regulate feeding and growth in whelks. Marine Ecology

Progress Series, 450, 107–114.

Gupta, A., Singh, D., Byreddy, A. R., Thyagarajan, T., Sonkar, S. P., Mathur, A. S., Tuli, D. S.,

Barrow, C. J., Puri, M. (2016). Exploring omega-3 fatty acids, enzymes and biodiesel

producing thraustochytrids from Australian and Indian marine biodiversity. Biotechnology

Journal, 11(3), 345–355.

Harel, M., Ben-Dov, E., Rasoulouniriana, D., Siboni, N., Kramarsky-Winter, E., Loya, Y.,

Barak, Z., Wiesman, Z., Kushmaro, A. (2008). A new thraustochytrid, strain Fng1, isolated

from the surface mucus of the hermatypic coral Fungia granulosa. FEMS Microbiology

Ecology, 64, 378–387. 53

Harvell, C. D., Montecino-Latorre, D., Caldwell, J. M., Burt, J. M., Bosley, K., Keller, A.,

Heron, S. F., Salomon, A. K., Lee, L., Pontier, O., Pattengill-Semmens, C., Gaydos, J. K.

(2019). Disease epidemic and a marine heat wave are associated with the continental-scale

collapse of a pivotal predator (Pycnopodia helianthoides). Science Advances, 5(1), 1–9.

Hewson, I., Bistolas, K. S. I., Quijano Cardé, E. M., Button, J. B., Foster, P. J., Flanzenbaum, J.

M., Kocian, J., Lewis, C. K. (2018). Investigating the complex association between viral

ecology, environment, and northeast Pacific Sea Star Wasting. Frontiers in Marine Science,

5(77).

Hewson, I., Button, J. B., Gudenkauf, B. M., Miner, B., Newton, A. L., Gaydos, J. K., Wynne, J.,

Groves, C. L., Hendler, G., Murray, M., Fradkin, S., Breitbart, M., Fahsbender, E., Lafferty,

K. D., Kilpatrick, A. M., Miner, C. M., Raimondi, P., Lahner, L., Friedman, C. S., Daniels,

S., Haulena, M., Marliave, J., Burge, C. A., Eisenlord, M. E., Harvell, C. D. (2014).

Densovirus associated with sea-star wasting disease and mass mortality. Proceedings of the

National Academy of Sciences of the United States of America, 111(48), 17278–17283.

Höhnk, W., & Ulken, A. (1979). Pilze aus marinen schwämmen. Veröffentlichungen Des

Instituts Für Meeresforschung in Bremerhaven, 17, 199–204.

Honda, D., Yokochi, T., Nakahara, T., Raghukumar, S., Nakagiri, A., Schaumann, K., &

Higashihara, T. (1999). Molecular Phylogeny of Labyrinthulids and Thraustochytrids Based

on the Sequencing of 18s Ribosomal RNA Gene. J. Eukanot. Mirrobiol., 46(6), 637–647.

Huelsenbeck, J. P., & Rannala, B. (2004). Frequentist properties of Bayesian posterior

probabilities of phylogenetic trees under simple and complex substitution models. Syst Biol,

53(6), 904–913.

Jain, R., Raghukumar, S., Tharanathan, R., & Bhosle, N. B. (2005). Extracellular polysaccharide 54

production by thraustochytrid protists. Marine Biotechnology, 7(3), 184–192.

Jones, E. B. G., & Harrison, J. L. (1976). Physiology of marine phycomycetes. In Recent

advances in aquatic mycology (pp. 261–278). London: Elek Science.

Jones, G. M., & O’Dor, R. K. (1983). Ultrastructural Observations on a Thraustochytrid Fungus

Parasitic in the Gills of Squid (Illex illecebrosus LeSueur). The Journal of Parasitology, 69,

903-911.

Jones, M. D. M., Forn, I., Gadelha, C., Egan, M. J., Bass, D., Massana, R., & Richards, T. A.

(2011). Discovery of novel intermediate forms redefines the fungal tree of life. Nature, 474,

200–203.

Kaya, K., Nakazawa, A., Matsuura, H., Honda, D., Inouye, I., & Watanabe, M. M. (2011).

Thraustochytrid Aurantiochytrium sp. 18W-13a Accummulates High Amounts of Squalene.

Bioscience, Biotechnology, and Biochemistry, 75(11), 2246–2248.

Khadra, Y. Ben, Ferrario, C., Di Benedetto, C., Said, K., Bonasoro, F., Candia Carnevali, M. D.,

& Sugni, M. (2015). Wound repair during arm regeneration in the red starfish Echinaster

sepositus. Wound Repair and Regeneration, 23(4), 611–622.

Kohl, W. T., McClure, T. I., & Miner, B. G. (2016). Decreased temperature facilitates short-term

sea star wasting disease survival in the keystone intertidal sea star Pisaster ochraceus. PLoS

ONE, 11(4), 1–10.

Kuznetsov, E. A. (1981). Anabiosis in lower aquatic fungi. Mikologiya i Fitopatologiya, 15,

526–531.

Leander, C. A., Porter, D., & Leander, B. S. (2004). Comparative morphology and molecular

phylogeny of aplanochytrids (Labyrinthulomycota). European Journal of Protistology,

40(4), 317–328. 55

Leander, C. A., & Porter, D. S. (2001). The Labyrinthulomycota Is Comprised of Three Distinct

Lineages. Mycologia, 93(3), 459–464.

Lewis, T. E., Nichols, P. D., & McMeekin, T. A. (1999). The Biotechnological Potential of

Thraustochytrids. Marine Biotechnology, 1, 580–587.

Lowrey, J., Armenta, R. E., & Brooks, M. S. (2016). Recycling of lipid-extracted hydrolysate as

nitrogen supplementation for production of thraustochytrid biomass. Journal of Industrial

Microbiology and Biotechnology, 43(8), 1105–1115.

Lukas, S., Dagmar, K., Dita, V., Gunde, R., & Ursula, P. (2007). Thraustochytrids as novel

parasitic protists ofmarine free-living flatworms: Thraustochytrium caudivorum sp. nov.

parasitizes Macrostomum lignano. Marine Biology, 152(5), 1095–1104.

Mclean, I. N., & Porter, D. (1987). Lesions produced by a thraustochytrid in Tritonia diomedea

(Mollusca: Gastropoda: Nudibranchia). Journal of Invertebrate Pathology, 49(2), 223–225.

Menge, B. A. (1979). Coexistence Between the Seastars Asterias vulgaris and A. forbesi in a

Heterogeneous Environment: A Non-Equilibrium Explanation. OecoIogi, 41, 245–272.

Menge, B. A., Cerny-Chipman, E. B., Johnson, A., Sullivan, J., Gravem, S., & Chan, F. (2016).

Sea Star Wasting Disease in the Keystone Predator Pisaster ochraceus in Oregon: Insights

into Differential Population Impacts, Recovery, Predation Rate, and Temperature Effects

from Long-Term Research. PloS One, 11(5), e0153994.

Miller, M. R., Nichols, P. D., & Carter, C. G. (2007). Replacement of fish oil with

thraustochytrid Schizochytrium sp. L oil in Atlantic salmon parr (Salmo salar L) diets.

Comparative Biochemistry and Physiology - A Molecular and Integrative Physiology,

148(2), 382–392.

Muehlstein, L. K., Porter, D., & Short, F. T. (1988). Changes in the content and fatty acid 56

composition of lipid in an isolated population of the capelin Mallotus villosus during sexual

maturation and spawning. Marine Biology, 99, 465–472.

Olive, L. S. (1975). The Mycetozoans. New York: Academic Press.

Paine, R. T. (1966). Food Web Complexity and Species Diversity. The American Naturalist,

100(910), 65–75.

Paine, R. T. (1969). A Note on Trophic Complexity and Community Stability. The American

Naturalist, 103(929), 91–93.

Pan, J., del Campo, J., & Keeling, P. J. (2017). Reference Tree and Environmental Sequence

Diversity of Labyrinthulomycetes. Journal of Eukaryotic Microbiology, 64(1), 88–96.

Patterson, D. J. (1989). Chromophytes from a protistan perspective. In J. P. Green, B. S. C.

Leadbeater, & W. L. Diver (Eds.), The chromophyte algae, problems and perspectives (pp.

357–379). Oxford: Clarendon Press.

Perkins, F. O. (1972). The Ultrastructure of Holdfasts, “Rhizoids”, and “Slime Tracks” in

Thraustochytriaceous Fungi and Labyrinthula spp.* **. Arch. Mikrobiol., 84, 95–118.

Perkins, F. O. (1973). Observations of thraustochytriaceous (Phycomycetes) and labyrinthulid

(Rhizopodea) ectoplasmic nets on natural and artificial substrates—an electron microscope

study. Canadian Journal of Botany, 51(2), 485–491.

Perkins, F. O. (1974). Reassignment of Labyrinthula minuta to the Genus Labyrinthuloides.

Mycologia, 66(4), 697–702.

Perkins, F. O. (1976). Fine structure of lower marine and estuarine fungi. In Recent advances in

aquatic mycology (pp. 513–542). London: Elek Press.

Polglase, J. L. (1980). A preliminary report on the thraustochytrid(s) and Labyrinthulid(s)

associated with a pathological condition in the lesser octopus Eledone cirrhosa. Botanica 57

Marina, 23, 699–706.

Porter, D. (1972). Cell Division in the Marine Slime Mold, Labyrinthula sp., and the Role of the

Bothrosome in Extracellular Membrane Production, 74, 427–448.

Porter, D. (1974). Phylogenetic considerations of the Thraustochytriaceae and Labyrinthulaceae.

Veröff Inst Meeresforsch Bremerhav, 5, 19–44.

Porter, D. (1990). Phylum Labyrinthulomycota. In Handbook of Protoctista (pp. 388–398).

Boston: Jones and Bartlett.

Raghukumar, C. (2006). Algal-fungal interactions in the marine ecosystem, symbiosis to

parasitism. In Recent advances on applied aspects of Indian marine algae with reference to

global scenario (pp. 366–385). Bhavnagar: Central Salt and Marine Chemica.

Raghukumar, S. (2002). Ecology of the marine protists, the labyrinthulomycetes

(thraustochytrids and labyrinthulids). European Journal of Protistology, 38(2), 127–145.

Raghukumar, S. (2008). Thraustochytrid marine protists: Production of PUFAs and other

emerging technologies. Marine Biotechnology, 10(6), 631-640.

Raghukumar, S., & Damare, V. S. (2011). Increasing evidence for the important role of

Labyrinthulomycetes in marine ecosystems. Botanica Marina, 54(1), 3–11.

Raikar, M. T., Raghukumar, S., Vani, V., David, J. J., & Chandramohan, D. (2001).

Thraustochytrid protists degrade hydrocarbons. Indian Journal of Marine Sciences, 30(3),

139–145.

Ronquist, F., & Huelsenbeck, J. P. (2003). MrBayes 3: Bayesian phylogenetic inference under

mixed models. Bioinformatics, 19(12), 1572–1574.

Schiebelhut, L. M., Puritz, J. B., & Dawson, M. N. (2018). Decimation by sea star wasting

disease and rapid genetic change in a keystone species, Pisaster ochraceus. Proceedings of 58

the National Academy of Sciences, 115(27), 7069–7074.

Singh, P., Liu, Y., Li, L., & Wang, G. (2014). Ecological dynamics and biotechnological

implications of thraustochytrids from marine habitats. Applied Microbiology and

Biotechnology, 98(13), 5789–5805.

Sparrow, F. K. (1936). Biological Observations on the Marine Fungi of Woods Hole Waters. The

Biological Bulletin, 70(2), 236–263.

Staehli, A., Schaerer, R., Hoelzle, K., & Ribi, G. (2009). Temperature induced disease in the

starfish Astropecten jonstoni. Marine Biodiversity Records (Vol. 2).

Stamatakis, A., Hoover, P., & Rougemont, J. (2008). A Rapid Bootstrap Algorithm for the

RAxML Web-Servers. Syst Biol, 75(5), 758–771.

Stierhoff, K. L., Neuman, M., & Butler, J. L. (2012). On the road to extinction? Population

declines of the endangered white abalone, Haliotis sorenseni. Biological Concervation, 152,

46–52.

Thorsen, M. S. (1999). Abundance and biomass of the gut-living microorganisms (bacteria,

protozoa and fungi) in the irregular sea urchin Echinocardium cordatum (Spatangoida:

Echinodermata). Marine Biology, 133(2), 353–360.

Tice, A. K., Silberman, J. D., Walthall, A. C., Le, K. N. D., Spiegel, F. W., & Brown, M. W.

(2016). Sorodiplophrys stercorea: Another Novel Lineage of Sorocarpic Multicellularity.

The Journal of Eukaryotic Microbiology, 63(5), 623–628.

Wahid, M. I., Yoshikawa, T., & Sakata, T. (2007). Bacteriolytic activity and growth of marine

isolates of labyrinthulids on dead bacterial cells. Fisheries Science, 73(6), 1286–1294.

Yokoyama, R., & Honda, D. (2007). Taxonomic rearrangement of the genus Schizochytrium

sensu lato based on morphology, chemotaxonomic characteristics, and 18S rRNA gene 59

phylogeny (Thraustochytriaceae, Labyrinthulomycetes): Emendation for Schizochytrium

and erection of Aurantiochytrium and Oblongichytrium gen. nov . Mycoscience, 48(4),

199–211.

Yokoyama, R., Salleh, B., & Honda, D. (2007). Taxonomic rearrangement of the genus Ulkenia

sensu lato based on morphology, chemotaxonomical characteristics, and 18S rRNA gene

phylogeny (Thraustochytriaceae, Labyrinthulomycetes): Emendation for Ulkenia and

erection of Botryochytrium, Parietichytrium, and Sicyoidochytrium gen. nov. Mycoscience,

48(6), 329–341.

Appendices

Appendix A

Appendix A outlines the troubleshooting involved in this project. Information in Appendix A is crucial for individuals who are new to culturing and sequencing Labyrinthulomycetes.

A.1 Initial Cultivation

Cultivation of Labyrinthulomycetes is an art that requires a great deal of experimentation and practice because of the variation and ambiguity of morphological traits, which are dependent on media type, especially when observing under a light microscope. The key to proficiency in the cultivation of Labyrinthulomycetes is to first master the identification of colony growth under a dissecting microscope. During the cultivation stage of my environmental survey, I had no discernable results for the first few months of sampling different substrates. I was attempting to grow isolates on media that Labyrinthulomycetes successfully grew in previous studies (FioRito et al. 2016), so any failure to isolate Labyrinthulomycetes was likely a lack in my own skillset at the time. Three to four months of trial and error resulted in my ability to cultivate and identify

Labyrinthulomycetes from other groups of eukaryotes growing in the media under a dissecting microscope. After more practice and continued observations using DIC light microscopy, and before confirmation with molecular phylogenetic analyses, I was able to determine whether the identity of isolates was Thraustochytrium or Oblongichytrium based on morphological traits.

A.2 Oblongichytrium Abundance

Nearly all of the Labyrinthulomycetes isolated in this study were members of Oblongichytrium; in fact, Oblongichytrium was found living in every sampling location on nearly every substrate sampled (Table 1). During the initial isolation stages, the replication of Oblongichytrium identities led us to re-evaluate our methodology for sampling and isolation. Cultures of

Labyrinthulomycetes were re-isolated using a new DNA isolation kit, then amplified and sequenced with re-ordered primers. The genetic data, supported by the morphological traits visible by light microscopy, determined the identities of the new isolates were Oblongichytrium.

With continued sampling and isolation, I successfully isolated other Labyrinthulomycetes, demonstrating that the protocol resulted in successful isolation of different species and the repeated isolation of Oblongichytrium was reflected by the abundance this species in the sampled environments.

A.3 Two 18S rDNA Sequences from Thraustochytrium kinnei

When assembling SSU rDNA sequences, double peaks began at the 862-base pair (bp) mark from the Thraustochytrium kinnei contigs received by the Sequencing + Bioinformatics

Consortium at the University of British Columbia. This observation indicated a mixed culture with two different copies of the 18S rRNA gene in a single colony of T. kinnei. To determine if this was a mixed culture, DNA was re-extracted from the same culture disk using a new DNA isolation kit, then amplified and sequenced with re-ordered primers. The new assembled contigs also had double peaks beginning at 862 bp. Careful analyzation of the T. kinnei contigs determined that there was a single bp frame shift in the reading frame at the 862 bp location that was initiating the double peaks. This observation is likely due to a single insertion or deletion in 62

the 18S rRNA gene of individuals within each T. kinnei colony, and each copy of this 18S rRNA gene is amplified together in the PCR reaction. This pattern has been observed in other

Thraustochytrium and Aurantiochytrium isolates in GenBank.

These two copies of the 18S rRNA gene in the T. kinnei isolates could be separated by eye in

Geneious software. Alternatively, isolates could be cloned to separate the individuals with either copy of this 18S rDNA sequences, but we determined that cloning was unnecessarily expensive and time consuming for this minor issue. Luckily, the full sequences of the isolates were not necessary for the results of this study. To resolve this issue of double peaks, the contigs were aligned and cut before the double peaks began, creating ~862 bp barcodes to identify

Labyrinthulomycetes. These T. kinnei barcode sequences were successfully aligned with the other full 18S rDNA sequences isolated in this study and from GenBank. To avoid any bias in sequence length, the final alignment (including other SSU rDNA sequences isolated from this study and downloaded from GenBank) was cut at 862 bp.

Appendix B

Appendix B includes isolation techniques for culturing Labyrinthulomycetes. This section does not include all isolation methods, but rather a snapshot of the most popular in the literature.

B.1 Isolation Techniques

Most thraustochytrids (such as Thraustochytrium, Schizochytrium, and Aurantiochytrium) can be isolated by plating tissue sections on a variety of media recipes including: seawater agar; peptone-yeast-glucose seawater agar (PYGSA, approximately 50% seawater); modified

Vishniac’s medium (KMV); or vegetable juice seawater agar; all amended with penicillin and streptomycin to prevent bacterial growth (Porter 1990). Additionally, baiting samples with pollen, especially from pines, is a method commonly used for isolating thraustochytrids and other chytrids (Porter 1990). Regardless of the media recipe, small pieces (no greater than 1 cm2) of substrate tissue are rinsed with sterile seawater, plated on the media, and incubated at room temperature until colonies are visible on the periphery of the tissue sample (approximately 3 days). Colonies, orbit/ovoid in shape, usually begin accumulating on the bottom surface of the tissue that is in direct contact with the agar.

Labyrinthula can be isolated with similar media recipes as other thraustochytrids, but the most popular isolation methods for Labyrinthula is with 1% serum seawater agar (SSA) and plain seawater agar. Alternative recipes include: half-to-quarter-strength concentration of vegetable juice seawater agar and PYGSA. Small pieces of tissue are rinsed, plated, and incubated in room temperature, similar to the thraustochytrids described above. After colonies of Labyrinthula are found growing, usually on the bottom surface of the tissue that is in direct contact with the agar, 64

an agar block containing a swarm of Labyrinthula can then be sub-cultured or co-cultivated with marine yeast or bacteria to promote further growth (Porter 1990). Colonies are more elongated, resembling faint ‘trackways’ extending from the tissue sample, rather than the typical orbit- shaped colonies of most thraustochytrids.

It is important to note the media recipe before comparing or classifying morphological traits of

Labyrinthulomycetes because growth characteristics varies between media recipes for individual species. For example, Schizochytrium aggregatum has the following differences when grown in different media: in nutrient agar, immature thalli have a strong tendency to fragment, colonies flatten as drying proceeds, and the ectoplasmic nets penetrate extensively; while in pollen seawater, thalli rarely fragment and ectoplasmic net growth is less extensive (Goldstein & Belsky

1964). Another example, Stellarchytrium cells grown on agar media grow extensive filamentous strands of ectoplasmic nets, compared to the formation of dense clumps when grown in liquid media (FioRito et al. 2016).