DOCSLIB.ORG

Genetic Structure and Diversity of Black Francolin in Uttarakhand, Western Himalaya, India

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Genetic Structure and Diversity of Black Francolin in Uttarakhand, Western Himalaya, India Journal of Wildlife and Biodiversity 4(1): 29-39 (2020) -(http://jwb.araku.ac.ir/) Research Article DOI: 10.22120/jwb.2019.115300.1093 Genetic structure and diversity of Black Francolin in Uttarakhand, Western Himalaya, India populations (2.99%). Overall the populations of 1* 2 Priyanka Negi , Atul Kathait , Tripti black francolin were genetically variable with Negi3, Pramesh Lakhera1 high adaptive potential in Uttarakhand, Western 1* Himalaya. Department of Zoology, Eternal University Baru sahib, India Keywords: Conservation, heterozygosity, 2 School of Life Science, ApeejaySatya University, homozygosity, genetic diversity, microsatellite Gurgaon, India markers, polymorphic sites 3School of Environment and Natural Resources, Doon University, Dehradun, India Introduction *email: [email protected] The increased pressure of habitat fragmentation, Received: 04 October 2019 / Revised: 12 November 2019 / Accepted: 02 November 2019 / Published online: 05 January overhunting and induced anthropogenic activity, 2020. Ministry of Sciences, Research and Technology, Arak put the number of species in threat. The University, Iran. Himalayan geographical region is facing the Abstract same. The protection of species requires a The present study evaluates the genetic diversity thorough understanding of species biology as well as of the level and distribution of genetic of black francolin (Francolinus francolinus diversity (Neel andEllstrand 2003). The latter is asiae) in Uttarakhand on the basis of an important factor for the adaptation and microsatellite loci. For this purpose, we survival of the natural populations in the examined five populations from three changing environment (Lande 1988; Landeand geographical zones of Uttarakhand, Western Shannon 1996). However current conservation Himalaya. Microsatellite markers were practice focused on captive breeding, which polymorphic with the number of alleles per reduces genetic diversity and this can severely locus ranging from 4-21, effective number of affect the capability of a population to cope with alleles per locus from 1.34 to 4.93, the the fluctuations in the environment (Landeand Polymorphic Information Content (PIC) value Shannon 1996, Frankham 2002, 2010). ranged from 0.22 to 0.85. The averaged The Himalayan ecosystem is a kind of sky observed heterozygosity across all loci was island, where the distribution of species restricts to their geographical boundaries. This provides Ho=0.320.12 and averaged expected uniqueness in genetic diversity among the heterozygosity He=0.510.06 respectively. The species. Galliformes are widely distributed in genetic structure showed that there were two the entire Himalayan range. The black francolin genetically distinct clusters. The Lesser is one of the key species of genus francolin with Himalayan and Himalayan foothill population the presence of five of species and six sub forming a single cluster and population of the species (Forcinaet al. 2012). Black francolin Tarai region forming another cluster. The (Francolinus francolinus asiae) widely pairwise FST results showed a sizeable genetic distributed from Kashmir to West Bengal along difference between the population of higher and with the foothills of central Nepal, Bihar, and lower altitudes. The AMOVA showed that thence through Punjab, Uttar Pradesh, Madhya higher levels of variation were observed among Pradesh to the Chilka lake in Odisha (Ali and Ripley 1983, McGowan and Kirwan 2015). individuals within populations (64.36%) and Although the Bird Life International (2016) lower differentiation observed among listed black francolin is stable at global level, but 30 | Journal of Wildlife and Biodiversity 4(1): 29-39 (2020) there were some reports indicate that its Material and Methods population is declining in many parts of its native range (Behbash et al. 2010, Riaz et al. Study Area 2011). The Uttarakhand (28044’ to 31028’N and 77035’ Despite habitat preference, feeding habit and to 81001’ E) encompasses 53,483 Km2 and is population abundance (Negiand and Lakhera situated in the Western Himalayan region of 2016, 2019), there is no significant study on India. It is India ‘s youngest mountain state and genetic diversity of the black francolin in India. according to biogeographical classification by the Wildlife Institute of India, the state comes In Indian Himalayan region, there is a strong into the Biogeographic Zones 2B Western need for conservation programs based on Himalaya and 7B Shiwaliks (Rodgers et al. genetic data. In the present work, our aim is to 2000). Uttarakhand is divided into five distinct carry out the first in-depth genetic study of black topographic regions i) snow cover Trans francolin in the Garhwal Himalayan region to Himalaya, ii) Sub Himalaya, iii) Lesser get useful information and offer logical Himalaya, iv) Bhabar Himalayan foothills and management recommendations for the purpose v) Tarai. The black francolin is distributed from of sustainable use and long-term protection of 100m to 2200m asl. So, to cover all the species within an adaptive conservation representative topographic zones, five sites were framework. In this work, the genetic makeup of selected. Two sites were selected from Lesser the black francolin resident in Western Himalaya (Rudraprayag and Jaunsar), one from Himalaya was characterized using microsatellite Bhabar Himalayan Foothills (Kotdwar) and two (short tandem repeats, STR) DNA markers. from Tarai region (Haridwar and Udham Singh Nagar) (Fig. 1). A total 56 samples were collected from the period of 2013 to 2015. Figure 1. Different sampling sites of black francolin from Uttarakhand, India 31 | Journal of Wildlife and Biodiversity 4(1): 29-39 (2020) DNA extraction and genotyping 64D4, MCW104, MCW 145). The important A combination of the standard phenol- details of the markers are given in Table1. PCR chloroform method was used for the extraction was performed in 25l reaction mixture, of DNA from tissues (Sambrook and Russell containing 50-100ng DNA, 100ng of each 2001) while a modified phenol-chloroform primer, 2.5mM of each dNTPs, 10X Taq assay method (Barbanera et al. 2005) and Qiagen buffer and 3U Taq polymerase. DNA isolation kit were also used for feathers. In The amplification conditions were: 4 min initial view to examine the quality and concentration of denaturation at 94°C, followed by 35 cycles of extracted DNA, 2 μl of each DNA sample was denaturation at 94°C for 40 s, annealing at a loaded into a 0.8% agarose gel containing specific temperature (Table 1) for 50 s and ethidium bromide. The concentration of DNA extension at 72°C for 1 min with a final was visualized under UV transilluminator. A extension at 72°C for 5 min. Subsequently, the total of eight polymorphic cross-amplified PCR products were separated by capillary microsatellite markers was standardized for the electrophoresis on analyzer ABI 3500XL genetic analysis of black francolin (Negi and (Applied Biosystems) and the allelic sizes of the Lakhera, 2018). All individuals were genotyped fragments were estimated based on with eight dinucleotide microsatellite loci fluorescently labeled forward primers (FAM, (MCW81, MCW330, MCW183, MCW11, and HEX) using the GENEMAPPER 3.7 MCW206, (Applied Biosystems, USA) and Peak analyzer 1.0. Table 1. Description of microsatellite loci used in the study Annealing Fluorescent Amplicon Loci 5’-3’ Sequence temperature Label size 0 TA ( C) MCW F GTTGCTGAGAGCCTGGTGCAG FAM 112-135bp 600C 81 RACACCCTGTATGTGGAATTACTTCTC MCW F CTTGACAGTGATGCATTAAATG HEX 221-249bp 500C 206 R ACATCTAGAATTGACTGTTCAC F GATCTCACCAGTATGAGCTGC P6A1 FAM 190-234bp 520C R TCTCACACTGTAACACAGTGC MCW FGTTATATTTAATGTCCACTTGTCAATGATG HEX 96-120 bp 600C 11 R TAAACCACTTCACATGGAGCCT MCW FTGCTGGACCTCATCAGTCTGACAG HEX 256-300bp 550C 330 RCAAACAAAATGTTCTCATAGAGTTCCTGC MCW F GATCCCAGTGTCGAGTATCCGA FAM 296-326bp 550C 183 R CTGAGATTTACTGGAGCCTGCC MCW FCAATTTAACTTTATTCTCCAAATTTGGCT HEX 180-210bp 520C 145 RGAGTAAACACAATGGCAACGGAAA MCW FCTTTTTAGCACAACTCAAGCTGTGAG FAM 210-225bp 550C 104 R CACAGACTTGCACAGCTGTGACC 32 | Journal of Wildlife and Biodiversity 4(1): 29-39 (2020) Data analysis Carlo (MCMCs), with 10 independent runs for Genetic diversity and population differentiation: each K, using the admixture model with Allele frequencies and genetic diversity correlated allele frequencies. The most reliable measures were calculated using GenAlEX 6.5 value of K was chosen according to Evannoet al. (Peakall and Smouse 2012) and FSTAT 2.9.4 2005, implemented in STRUCTURE (Goudet 1995). These measures included the HARVESTER (Earl and VonHoldt 2012). number of alleles (Na), number of private alleles Analysis of Bottleneck: For analysis of the (Ne), expected heterozygosity or Gene Diversity recent detection of bottlenecks in different (HE) and observed heterozygosity (HO). demographic population software GENEPOP 4.1 (Rousset 2008) was used to infer BOTTLENECK 1.202 (Piryet al. 1999) was possible departure from the Hardy-Weinberg used. In the present study, a one-tailed Wilcoxon Equilibrium (HWE) at each locus and evidence signed-rank test of heterozygosity of excess of linkage disequilibrium. Using allelic (Luikartet al. 1998) detected under the Stepwise frequencies, Polymorphic Information Content Mutation Model (SMM), the Infinite Allele (PIC), a measure of marker informativeness was Model (IAM) and the Two-Phase Model (TPM). calculated with CERVUS 3.0 (Kalinowskiet al. 2007). Genetic differences between populations Results were analyzed with pairwise FST (Weir and Genetic Diversity: A total
Load more

Recommended publications
  • Non-Passerines
    A List of Birding References - Non-Passerines Joe Hobbs Version 1.1 A List of Birding References Non-Passerines Compiled by Joe Hobbs Version 1.1 Published March 2021 Copyright © 2021 Joe Hobbs All rights reserved Cover photo courtesy of Bill Byrne. Birding References, Non Passerines version 1.1 - Joe Hobbs Page 1 INTRODUCTION From 2010 to 2019 I compiled 27 lists of birding references each covering a different family group that were kindly hosted by Dutch Birding on their website, www.dutch- birding.nl. Judging by the feedback I received many birders found them to be useful, which encouraged me to maintain them with regular updates. At this point I am certain that anyone who wants one has a copy, and therefore feel the time is right to abandon the previous format and replace them with two files (i.e. one each for Passerines and Non-Passerines) that considerably extends the number of families and with an empha- sis on those papers and notes concerning bird identification, mystery photo solutions, behaviour, species profiles, species status, occurrences, first records, taxonomy, topog- raphy etc. published in birding journals. The list of references begins with the following categories: Moult & Ageing; Taxonomy; Topography, Physiology & Song; Zoogeography & Migration; Great Bird Reserves; Im- portant Bird Areas, thereafter arranged by family following the IOC world list taxonomy order (version 10.1). This note will be updated from time to time. CAUTION, PLEASE TAKE NOTE The list is far from comprehensive and should always be used in conjunction with other published and online reference resources. VERSION Version 1.1.
    [Show full text]
  • Captive Breeding and Reintroduction of Black Francolin, Grey Francolin and Chukar Partridge (2015-2020) in District Dir Lower, Khyber Pakhtunkhwa, Pakistan
    CAPTIVE BREEDING AND REINTRODUCTION OF BLACK FRANCOLIN, GREY FRANCOLIN AND CHUKAR PARTRIDGE (2015-2020) IN DISTRICT DIR LOWER, KHYBER PAKHTUNKHWA, PAKISTAN Syed Fazal Baqi Kakakhel Naveed Ul Haq Ejaz Ul Haq European Journal of Biology Vol.5, Issue 2, pp 1-9, 2020 CAPTIVE BREEDING AND REINTRODUCTION OF BLACK FRANCOLIN, GREY FRANCOLIN AND CHUKAR PARTRIDGE (2015-2020) IN DISTRICT DIR LOWER, KHYBER PAKHTUNKHWA, PAKISTAN Syed Fazal Baqi Kakakhel¹*, Naveed Ul Haq², Ejaz Ul Haq³ ¹Conservator Wildlife Northern Circle Khyber Pakhtunkhwa Wildlife Department, Pakistan ²Deputy Conservator Wildlife Dir Wildlife Division Khyber Pakhtunkhwa Wildlife Department, Pakistan ³Sub Divisional Wildlife officer Dir Lower Wildlife Sub Division, Khyber Pakhtunkhwa Wildlife Department Pakistan *Crresponding Author’s E-mail: [email protected] ABSTRACT Purpose: The ex-situ conservation aims to discover new populations or supports the populations that yet survive in the wild. To breed animals in captivity and release them in their natural control habitats is one of the conservation methods. Amongst other species partridges also breed in captivity and can be release in the wild but presently data lacking, need to examine. Chukar partridge, Black francolin and Grey francolin are used for sports hunting in Pakistan. The available record on captive breeding of Chukar partridge, Black francolin and Grey francilin and their release in the wild for the years 2015-2020 was reviewed using a developed questionnaire. Methodology: Review record of Khyber Pakhtunkhwa Wildlife Department Pakistan through a developed questionnaire Findings: It was found that the maximum number of chukar partridge breed was 36, Black francolin (6) and Grey francolin (24). Out of the breeding stock, Chukar partridges (44) and Grey francolin (28) were released in the wild to its natural habitat by hard release technique.
    [Show full text]
  • Population Biology of Black Francolin (Francolinus Francolinus) with Reference to Lal Suhanra National Park, Pakistan*
    Pakistan J. Zool., vol. 45(1), pp. 183-191, 2013. Population Biology of Black Francolin (Francolinus francolinus) with Reference to Lal Suhanra National Park, Pakistan* Waseem Ahmad Khan1 and Afsar Mian2 1Animal Ecology Laboratory, Islamabad Model Postgraduate College, H-8, Islamabad 2Bioresource Research Centre, 34, Bazaar Road, G-6/4, Islamabad, Pakistan Abstract.- Transect data collected on black francolin, known as black partridge in Pakistan and India, (Francolinus francolinus) population from Lal Suhanra National Park (south Punjab, Pakistan) between 1993 and 2004 suggested that the species was present in only 6/23 stands (mainly in irrigated plantation with reed vegetation) with an average density of 8.40±1.39/km²; varying between 3.44±0.88 and 13.28±2.25/km2 in different stands. Densities were lower during winter (November–March, minimum in February) and maximum during summer (May- July), explained on population recruitment cycle, mortality and local movements. Densities were not significantly different between study years, yet these were generally lower during drought years compared to better rainfall years. Sex ratio (male/ female = 1.31) was skewed towards males. There were 0.32±0.09 young/adult female and 0.14±0.03 young/adult birds, while 2/6 stands had no young, representing non-breeding stands. Young were not observed or could not be identified separately during October-February, and the young/adult ratio was the highest in August. Dispersion index (variance/mean) of 0.60±0.09 suggests random-uniform dispersion. Group size averaged at 1.88±0.15 birds/group (range 1-5), majority of individuals appeared as singles (52.39%).
    [Show full text]
  • Gear for a Big Year
    APPENDIX 1 GEAR FOR A BIG YEAR 40-liter REI Vagabond Tour 40 Two passports Travel Pack Wallet Tumi luggage tag Two notebooks Leica 10x42 Ultravid HD-Plus Two Sharpie pens binoculars Oakley sunglasses Leica 65 mm Televid spotting scope with tripod Fossil watch Leica V-Lux camera Asics GEL-Enduro 7 trail running shoes GoPro Hero3 video camera with selfie stick Four Mountain Hardwear Wicked Lite short-sleeved T-shirts 11” MacBook Air laptop Columbia Sportswear rain shell iPhone 6 (and iPhone 4) with an international phone plan Marmot down jacket iPod nano and headphones Two pairs of ExOfficio field pants SureFire Fury LED flashlight Three pairs of ExOfficio Give- with rechargeable batteries N-Go boxer underwear Green laser pointer Two long-sleeved ExOfficio BugsAway insect-repelling Yalumi LED headlamp shirts with sun protection Sea to Summit silk sleeping bag Two pairs of SmartWool socks liner Two pairs of cotton Balega socks Set of adapter plugs for the world Birding Without Borders_F.indd 264 7/14/17 10:49 AM Gear for a Big Year • 265 Wildy Adventure anti-leech Antimalarial pills socks First-aid kit Two bandanas Assorted toiletries (comb, Plain black baseball cap lip balm, eye drops, toenail clippers, tweezers, toothbrush, REI Campware spoon toothpaste, floss, aspirin, Israeli water-purification tablets Imodium, sunscreen) Birding Without Borders_F.indd 265 7/14/17 10:49 AM APPENDIX 2 BIG YEAR SNAPSHOT New Unique per per % % Country Days Total New Unique Day Day New Unique Antarctica / Falklands 8 54 54 30 7 4 100% 56% Argentina 12 435
    [Show full text]
  • Habitat Preference of the Sole Wild Population of Francolinus Bicalcaratus Ayesha in the Palearctic: Implications for Conservation and Management
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by I-Revues Revue d’Ecologie (Terre et Vie), Vol. 71 (3), 2016 : 288-297 HABITAT PREFERENCE OF THE SOLE WILD POPULATION OF FRANCOLINUS BICALCARATUS AYESHA IN THE PALEARCTIC: IMPLICATIONS FOR CONSERVATION AND MANAGEMENT 1* 2 1 3 Saâd HANANE , Nabil ALAHYANE , Najib MAGRI , Mohamed-Aziz EL AGBANI 3 & Abdeljebbar QNINBA 1 Forest Research Center, High Commission for Water, Forests and Desertification Control, Avenue Omar Ibn El Khattab, BP 763, 10050, Rabat-Agdal, Morocco. 2 Faculté des Sciences de Rabat, 4 Avenue Ibn Battouta, BP 1014 RP, 10090, Agdal-Rabat, Morocco. 3 Université Mohammed V-Agdal, Institut Scientifique de Rabat, Avenue Ibn Battouta, BP 703, 10090, Agdal-Rabat, Morocco. * Corresponding author. E-mail : [email protected] ; phone: +212 660 125799 ; Fax: +212 537 671151 RÉSUMÉ.— Préférence d’habitat de la seule population sauvage de Francolinus bicalcaratus ayesha dans le Paléarctique : implications pour sa conservation et sa gestion.— Le Francolin à double éperon (Francolinus bicalcaratum ayesha) est un oiseau en danger critique d’extinction et endémique du Maroc, où il habite les forêts de chêne-liège. Ses populations ont été réduites principalement en raison de la chasse et de la destruction des habitats. La caractérisation de l’habitat utilisé par ces oiseaux indigènes peut optimiser les programmes futurs de réintroduction. La méthode de détection auditive a été utilisée sur des transects pour localiser les mâles chanteurs. Nous avons analysé les facteurs qui déterminent la présence du Francolin à double éperon dans le Nord-Ouest du Maroc en considérant 13 variables explicatives.
    [Show full text]
  • Bird-O-Soar Black Francolin Expanding Its Range Into Thar Desert
    #44 Bird-o-soar 21 April 2020 Black Francolin expanding its range into Thar Desert Black Francolin male in the Vallabhgarden area of Bikaner region. © Jitendra Solanki. Black Francolin Francolinus francolinus patches in Sri Ganganagar District. The (Linnaeus, 1766), a resident species in its species occurs here, maybe, due to alteration range, is well distributed from southern of habitat as irrigation has been in practice Afghanistan through Indus Valley of Pakistan, since 1960 in this area (Singh et al. 2009). Kachchh in Gujarat, along the Himalaya Roberts (1991) reported that the species had to Assam, to Bangladesh, to Odisha and declined rapidly during early 90s in Pakistan central India (Rasmussen & Anderton 2012). in most of its distribution range and is entirely Though the species is assessed as Least absent from the main desert tracks of Thar or Concern as per IUCN Red List, its population Cholistan. is declining in many parts of its distribution range (Birdlife International 2018). Grimmet Though Black Francolin has been frequently et al. (1998) and Kazmierczak & Perlo (2000) reported from Tal Chhapar Blackbuck report that the species is almost absent from Sanctuary, which is largely a flat tract of the Indian part of Thar Desert except small grassland present in Churu District, it is Zoo’s Print Vol. 35 | No. 4 21 #44 Bird-o-soar 21 April 2020 report of the species from the core area of Thar Desert. We had earlier sighted this species in Jhunjhnu and Churu districts of Rajasthan and Suratgarh Tehsil of Sri Ganganagar District. The avian diversity of Thar Desert is changing considerably due to Indira Gandhi Canal and several species appear to be invading the core region of Thar Desert because of these ecological changes (Patil et al.
    [Show full text]
  • Florida Field Naturalist
    FLORIDA FIELD NATURALIST QUARTERLYPUBLICATION OF THE FLORIDAORNITHOLOGICAL SOCIETY THE BLACK FRANCOLIN IN THE EVERGLADES AGRICULTURAL AREA WILLIAMG. GENUNG~AND REGINALDH. LEWIS':~ The Black Francolin (Francolinus francolinus asiae) was intro- duced into the United States during the 1960's under the U.S. Department of Interior Foreign Game Introduction Program. One successful introduction has been reported at Gum Cove in south- western Louisiana (Sims 1963, 1965, Sims et al. 1967, Palermo 1968). Stevenson (1976) reported without details a release near Avon Park, Highlands Co., Florida. Among documented releases in Florida were 35 pairs liberated on the University of Florida's Agri- cultural Research and Education Center (AREC), Belle Glade, Palm Beach County, Florida. In this paper we report on this success- ful introduction. The male Black Francolin is approximately twice the size and slightly more elongate than the Bobwhite (Colinus virginanus). Its black head, neck, and breast, rich chestnut collar, large, white sub- triangular cheek spot, light-brown, black-streaked upper-parts, and its barred retrices, primaries and tail are diagnostic field characters. The bill is blackish to light-brown, and the legs are reddish to dull orange (Fig. I). Spurs are often prominent. The brownish to buffy-hued female has dark triangular mark- ings on breast and flanks. The chestnut collar present in the male is reduced to a pale neck patch in the female, and the bill is a lighter brown. Feathers of the thigh are buffy, and the tibiae are lighter than in the male. Bump and Bump (1964) provided a more technical description. lDeceased April, 1982. Qeceased April, 1976.
    [Show full text]
  • Mitochondrial D-Loop Based Genetic Characterization of Two Francolin Species from a Part of Himalayan Foothills
    Asian Journal of Conservation Biology, July 2020. Vol. 9 No. 1, pp. 107-112 AJCB: FP0127 ISSN 2278-7666 ©TCRP Foundation 2020 Mitochondrial D-loop based genetic characterization of two Francolin species from a part of Himalayan foothills Anand Kumar* and Dinesh Kumar Sharma Department of Zoology, HNB Garhwal University, SRT Campus, Badshahithaul, New Tehri, Uttarakhand, India (Received: February 14, 2020; Revised: April 10, 2020 ; Accepted: May 15 , 2020) ABSTRACT Genus Francolinus under the family Phasianideae of order Galliformes are important group of birds and among the largest genera in the class Aves, distributed throughout the world and occupying different habitats. This group has several IUCN red listed species undergoing population fragmentation, decline and habitat loss. So far only two species of genus Francolinus viz., Asian Black francolin (Francolinus francolinus asiae) and the North Indian Grey francolin (Francolinus pondicerianus interpositus) have been reported from Uttarakhand. Here we have characterized genetic-make up of these francolins using mitochondrial DNA marker i.e. D-loop or Control region. The genetic polymorphism pattern of the mitochondrial control region in Black and grey francolin, is described for the North Western Himalayan population in order to get some base line data about genetic diversity, possible population structure and demographic dynamics. Key words: Galliformes, Uttarakhand, mitochondrial DNA, control region, genetic diversity INTRODUCTION Grey francolin F. pondicerianus, Swamp francolin F.
    [Show full text]
  • Tropical Birding Israel Tour
    Tropical Birding Trip Report Israel March, 2018 Tropical Birding Israel Tour March 10– 22, 2018 TOUR LEADER: Trevor Ellery Report and photos Trevor Ellery, all photos are from the tour. Green Bee-eater. One of the iconic birds of southern Israel. This was Tropical Birding’s inaugural Israel tour but guide Trevor Ellery had previously lived, birded and guided there between 1998 and 2001, so it was something of a trip down memory lane for the guide! While Israel frequently makes the international news due to ongoing tensions within the country, such problems are generally concentrated around specific flashpoints and much of the rest of the country is calm, peaceful, clean and modern. www.tropicalbirding.com +1-409-515-9110 [email protected] Tropical Birding Trip Report Israel March, 2018 Our tour started on the afternoon of the 10th where, after picking up the group at Ben Gurion airport near Tel Aviv, we headed north along the coastal strip, collecting our local guide (excellent Israeli birder Chen Rozen) and arrived at Kibbutz Nasholim on the shores of the Mediterranean with plenty of time for some local birding in the nearby fishponds. Spur-winged Lapwing – an abundant, aggressive but nevertheless handsome species wherever we went in Israel. Hoopoe, a common resident, summer migrant and winter visitor. We saw this species on numerous days during the tour but probably most interesting were quite a few birds seen clearly in active migration, crossing the desolate deserts of the south. www.tropicalbirding.com +1-409-515-9110 [email protected] Tropical Birding Trip Report Israel March, 2018 We soon managed to rack up a good list of the commoner species of these habitats.
    [Show full text]
  • Israel Tour Report 2018
    ISRAEL 14–24 April 2018 1 BirdQuest Tour Report: Israel 2018 www.birdquest-tours.com Harlequin Duck (drake), Laxá. Sinai Rosefinch, male, Mizpe Ramon. Cover: Corn Crake, Ofira Park, Eilat (Mike Watson). 2 BirdQuest Tour Report: Israel 2018 www.birdquest-tours.com Returning to Israel for the first time in almost seek in one of the last acacia-filled wadis in 30 years was an exciting prospect. It was the Arava Valley, rose pink male Sinai Rose- once my favourite destination and was one of finches drinking at a spring on the Dead Sea the first places I birded outside the UK back escarpment, smart Desert Finches around in the 1980s. The bird-show is as good as it our vehicle at Sde Boker and Syrian Serins ever was and in some ways even better with song-flighting over us on Mount Hermon. more information available and new sites Numerous other notable encounters included discovered or created in this period. We had Marbled Teals seen by golf cart at Lake Ag- a great time on a short itinerary, which visit- amon in the Hula Valley, lots of Chukar and ed the north, including Ma’agan Mikael, Bet Sand Partridges, Pygmy Cormorants common She’an Valley, Hula, Mount Hermon and the at Ma’agan Mikael, the endangered Egyptian Golan Heights before heading south via the Vulture, Levant Sparrowhawks on migration, Dead Sea to Eilat and then completing a cir- great views of both Little and Spotted Crakes, cle back to Tel Aviv via the Negev Desert. We at least 28 White-eyed Gulls from Eilat’s fa- recorded 230 species, including many region- mous north beach,
    [Show full text]
  • Assessment of the Status of Black Francolin Francolinus Francolinus in Armenia
    DOI: 10.2436/20.8100.01.20 Revista Catalana d’Ornitologia 36:56-61, 2020 Assessment of the status of Black Francolin Francolinus francolinus in Armenia Karen Aghababyan1* & Daniel Klem Jr.2 The Black Francolin Francolinus francolinus is listed in the Red Book of Animals of Armenia (2010) as Data Deficient and so a re-assessment of its conservation status is required. A study of this species in the period 2003–2019 reports its occurrence in south-eastern Armenia at 375–600 m a.s.l., in riparian scrub, woodland and orchards with thickets, in an area of occu- pancy estimated at 12.2 km2. In the period 2003–2009 its population trend was stable and in 2019 its population was estimated at 16–25 breeding pairs. No serious threats are evident, although some poaching occurs and stray dogs and cats are suspected to reduce its breeding success. Nevertheless, we recommend changing the status of this species in Armenia to Endan- gered (Criteria D). The following conservation measures are suggested: (1) officially designate the species’ range as an Emerald Site, (2) develop a monitoring and management plan, (3) encourage more targeted birdwatching of the species, which in turn will have positive effects on the local economy, (4) increase the penalty for poaching, (5) promote public awareness of this species, and (6) study the influence of burning thickets and other threats to the growth and sustainability of its population. Key words: Black Francolin, Francolinus francolinus, distribution, population, conservation, Armenia. 1BirdLinks Armenia NGO (former TSE NGO), 87b Dimitrov, apt 14, 0020 Yerevan, Armenia 2Acopian Center for Ornithology, Muhlenberg College, Allentown, PA 18104-5586 USA *Corresponding author: [email protected] Received: 01.02.20; Accepted: 15.06.20 / Edited by S.
    [Show full text]
  • Habitat Preference of Black Francolin (Francolinus Francolinus) in Lal Suhanra National Park, Pakistan*
    Pakistan J. Zool., vol. 44(6), pp. 1593-1601, 2012. Habitat Preference of Black Francolin (Francolinus francolinus) in Lal Suhanra National Park, Pakistan* Waseem Ahmad Khan** and Afsar Mian Bioresource Research Centre, 34 – Bazar Road, G–6/4, Islamabad, Pakistan Abstract.- Study was conducted on habitat preferred by the black francolin in Lal Suhanra National Park. A minimum of seventy plant species were identified for the stands preferring black francolin in their habitat, which included 12 trees, 11shrubs, 3 under shrubs, 21 herbs and 23 grasses. For roosting species exploited moderate sized plants like, Ziziphus sp (32.15%), Accacia sp (31.30%), Tamrix sp (23.18%), were more frequently exploited for roosting. Nesting was associated with minimum of 16 pant of which Saccharum sp., Tamrix sp., Typha angustata., Phragmite karka, Panicum sp., Lasiurus sp., Aristida sp., Cenchrus sp. were more preferred The francolin were distributed in significantly higher densities (t = 2.25, df = 18, p = 0.03) in the irrigated forest plantations (12.39±1.11 birds per km²) as compared to the tropical thorn forests (4.26±0.22 birds per km²). The tree cover has an almost linear increase with the increase in density of the black francolin (adjusted regression value = 0.970, y = - 8.27 + 2.64x), shrub cover (adjusted regression value = 0.964, y = - 9.94 + 3.90x), herb cover (adjusted regression value = 0.951, y = - 3.94 + 4.90x), and grass cover (adjusted regression value = 0.974, y = - 6.61 + 6.18x) has a curvilinear, while undershrubs (adjusted regression value = 0.810, y = 1.245 + 9.33x) has an almost linear regression with the population densities of the black francolin.
    [Show full text]