Downloaded from genome.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press
Simultaneous Detection of DNA and RNA by Differential Polymerase Chain Reaction (DIFF-PCR)
Paul Imboden, Thomas Burkart, and Kurt Schopfer
Institute of Medical Microbiology, University of Berne, 3010 Berne, Switzerland
A new technique, the differential For the simultaneous detection of a de- cific antisense primer to synthesize a polymerase chain reaction (DIFF- fined double-stranded DNA (dsDNA) seg- cDNA, from which a segment can be am- PCR), allows the simultaneous ampli- ment and its transcription product RNA plified by a DNA polymerase after addi- fication of DNA and homologous RNA in a given sample, a novel technique tion of a sense primer (RNA-PCR). (3'4) in a single assay by the combination called differential PCR (DIFF-PCR) was In DIFF-PCR, the techniques of DNA- of DNA-PCR and RNA-PCR on the established by combining amplification PCR and RNA-PCR were combined for same target. DNA-PCR amplifies a se- of DNA (DNA-PCR) and RNA (RNA- the detection and differentiation of ho- lected segment of dsDNA, whereas PCR). Both DNA-PCR and RNA-PCR are mologous DNA and RNA segments in the RNA-PCR amplifies a complementary well established as separate methods: In same assay. The principle of DIFF-PCR is DNA (cDNA), produced by reverse DNA-PCR, which is used for the sensi- presented in Figure 1. Two sequence-spe- transcription of RNA. In a mixture of tive detection of dsDNA, a specific DNA cific primers were used to produce a target DNA and RNA, DNA is ampli- segment is amplified by a thermostable D-amplicon from dsDNA (Fig. la). Be- fied using a combination of sense polymerase with two oligonucleotide fore starting PCR, reverse transcription and antisense primers under high- primers that are complementary to (RT) of RNA was performed with an an- stringency conditions giving a D-am- known sequences in the target DNA tisense primer, carrying a 5' end non- plicon. RNA is first reverse-tran- (DNA-PCR). (1) Amplified DNA segments complementary to the target sequence. scribed with a primer carrying a can be analyzed by hybridization of This partial identity reverse transcription nontarget 5' end into a tagged cDNA Southern blots using a sequence-specific primer (PIRT primer) produced a tagged at low stringency. Tagged cDNA is probe. (z) In RNA-PCR, RNA is first re- complementary DNA (PIRT-cDNA) that subsequently amplified, providing verse-transcribed with a sequence-spe- was amplified after addition of a sense an R-amplicon smaller in size than the D-amplicon. By quantifying the relative amounts of amplified RNA and homologous DNA, a sensitive a) dsDNA b) sense RNA measure for the transcription rate of h a defined DNA segment is obtained. PIRT Thus, DIFF-PCR may serve as a useful tool for monitoring gene expression (2) 1 RT as well as for studying gene regula- tion and gene function. ---- PIRT-cDNA
PIRT SK38 ~' WO2 SK38
D-amplicon R-amplicon FIGURE 1 Schematic representation of the three reactions involved in DIFF-PCR of a HIV-gag target sequence. (a) Production of a D-amplicon (221 bp) in a DNA-PCR (1) with primers SK38 and WO2. (b) Detection of RNA by RNA-PCR, composed of RT with a PIRT primer (2) and amplification of the tagged cDNA (3) to an R-amplicon (121 bp). Lines represent HIV nucleic acid strands, with arrows indicating 5' to 3' direction. Thick lines represent non-HIV sequence.
3:23-27©1993 by Cold Spring Harbor Laboratory Press ISSN 1054-9803/93 $5.00 PCR Methods and Applications 23 Downloaded from genome.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press
primer to give an R-amplicon smaller in taining 100 pmoles each of prim- cloned into a plasmid containing a T7 size than the D-amplicon (Fig. lb). The ers SK38 and WO2, 2.5 units of Taq promoter. Plasmid DNA was quantified amplification of dsDNA and of the PIRT- polymerase (Perkin-Elmer Cetus), photometrically and fluorometrically. cDNA occurred at the same time with the and 20 I~g of gelatine was added, Sense HIV RNA and antisense HIV RNA same sense primer but with different an- and PCR cycling was performed for were produced by the T7 RNA poly- tisense primers. Thus, a set of three 30 cycles of I min at 99°C, 2 min at merase from two clones carrying the in- primers determined the formation of 60°C, 3 min at 75°C, with a final 5 sert in opposite orientations. The two amplification products that were min incubation at 75°C. amount of RNA produced was deter- specific for the nucleic acid type and 5. An aliquot was electrophoresed mined by comparing cRNA and template were distinguished by gel electrophore- through 2% NuSieve GTG agarose DNA signal intensities of Northern blots. sis. Quantification of the reaction prod- gel (FMC BioProducts, Rockland, For amplification by DIFF-PCR, cloned ucts by Southern hybridization was ME), blotted to a Hybond N+ ny- HIV DNA and transcribed cRNA were re- achieved with a probe common to both lon membrane (Amersham Inter- acted with the following primers: dsDNA amplicons. This strategy allowed the si- national plc, Buckinghamshire, was amplified with primers SK38 and multaneous analysis of DNA and RNA UK), and hybridized overnight at WO2 (Table 1), resulting in a D-ampli- targets of homologous nucleotide se- 50°C with 5'-end-labeled oligonu- con of 221 bp. A PIRT primer was used quences in the same sample. cleotide SK19 as described.
TABLE 1 Primer Sequences and their Location in HIV-1
Name Location in HIV Matching RT R-PCR D-PCR Sequence SK38 1543-1570 28/28 absent 78°C 78°C 5'-ATAATCCACCTATCCCAGTAGGAGAAAT-3' WO2 c1763-cl 738 26/26 absent * 72°C 5'-ATTTTGGACCAACAAGGTTTCTGTCA-3' SK39 c1657-cl 630 28/28 80°C 80°C 80°C 5'-TTTGGTCCTTGTCTTATGTCCAGAATGC-3 ' PIRT14 c1671-c1658 14/28 42°C 86°C 42°C 5'-cgaattcggatccgCTCTAAAGGGTTCC-3' PIRT11 c1668-c1658 11/28 32°C 84°C 32°C 5'-cgaattcggatccgaagTAAAGGGTTCC-3' PIRT8 c1665-c1658 8/28 26°C 86°C 26°C 5'-cgaattcggatccatcgatcAGGGTTCC-3' (GenBank accession number HIVHXB2). Complementary sequences of HIV RNA are denoted by the letter c. Non-HIV bases are shown in lowercase letters. The number of HIV-matching nucleotides for each primer is shown in the third column. The theoretical melting temperatures (Tm) of the primer/target duplexes under standard conditions (hybridization in high salt buffer) were calculated for primer binding to RNA in RT, for primer binding to the R-amplicon in PCR (R-PCR), and primer binding to the D-amplicon (D-PCR) according to the formula [Tm = 2(A + T) + 4(C + G)], (6) where A, T, C, and G are the number of nucleotides complementary to the target sequence. These calculated temperatures are not identical to the melting temperatures during DIFF-PCR, but they illustrate the different primer/target stabilities in the three reactions of DIFF-PCR. (*) The absence of the WO2 sequence in the R-amplicon. The probe, used for detection of cloned or amplified HIV target sequences, was SK19 (position 1587-1627, sequence 5'-ATCCTGGGAT TAAATAAAATAGTAAGAATG TATAGCCCTAC-3'). Oligonucleotides SK38, SK39, and SK19 have been de- scribed. (7)
24 PCR Methods and Applications Downloaded from genome.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press
in parallel. Amplification of PIRT-cDNA Quantitation of RNA/DNA levels with SK38 and primers PIRT8 or PIRT11, respectively, showed no influence on Whether the amount of D-amplicon and DNA-PCR, and the production of R-am- R-amplicon produced by DIFF-PCR is a plicon was specific for sense RNA (Fig. 2, function of the amount of DNA and RNA lanes 9,8). Preliminary DIFF-PCR experi- in the sample was determined by ampli- ments using these primers with RNA iso- fying DNA/RNA samples obtained from lated from supernatant of HIV-infected kinetics of an in vitro T7 RNA poly- cells also led to RNA-specific production merase reaction. The effect of increasing of R-amplicons, indicating that the sample RNA contents in the DIFF-PCR as- FIGURE 2 Simultaneous detection of HIV R-amplicon formed was a specific ampli- say on the ratio of R-amplicon to D-am- DNA and RNA target sequences by DIFF-PCR. fication product of the PIRT-cDNA. In plicon (R/D ratio) is shown in Figure 3. HIV plasmid DNA (1 fmole per reaction) was contrast, the DIFF-PCR with PIRT14 Using primers PIRT8 and PIRTll, spe- used alone (lanes 1-5) or together with 25 (lanes 2,7) produced R-amplicons from cific amplification products of sense fmoles of its sense cRNA (lanes 6-10) as tem- HIV DNA as well as from a DNA/RNA tar- RNA and dsDNA were observed, and the plate for DIFF-PCR. RT was performed with get mixture without the presence of RT. resulting R/D ratio was fairly propor- primers SK39 (lanes 1,6), PIRT14 (lanes 2,7), This non-RNA-specific formation of an tional to the amount of sense RNA in the PIRT11 (lanes 3,8), PIRT8 (lanes 4,9) or in the R-amplicon was the result of the high sample. This allowed an estimation of absence of a PIRT primer (lanes 5,10). DNA the RNA quantity in relation to the DNA was amplified by PCR after addition of prim- complementarity of the PIRT14 primer ers SK38 and WO2. Amplification products (14 bases complementary to the target), quantity in a mixture of DNA and ho- were separated by gel electrophoresis and an- which enabled annealing to HIV DNA mologous RNA. Specificity for amplifica- alyzed by Southern hybridization. The 221-bp during PCR and, together with primer tion of RNA was not retained in DIFF- D-amplicon, formed by primers SK38 and SK38, its amplification in a DNA-PCR. PCR with primer PIRT14, but the WO2 is indicated (D); the 121-bp R-amplicon, When primer SK39, which is fully ho- addition of sense RNA resulted in an in- formed by primer SK38 and one of the PIRT mologous to the HIV target sequence, creased R/D ratio, reflecting the produc- primers is also indicated (R). The amplifica- was used for RT, an untagged cDNA was tion of a PIRT14-tagged cDNA and its tion product of primers SK38 and SK39 has a synthesized. Its amplification by primers amplification. The nondifferentiating size of 115 bp (lanes 1,6). Positions of size SK38 and SK39 was surpassed by the am- primer SK39, however, showed the same markers from a ~X174/HaeIII digest are indi- R/D ratio with sense RNA and antisense cated at left. plification of dsDNA by the same prim- ers, because RNA-PCR was less efficient RNA independent of the RNA concentra- than DNA-PCR (lanes 1,6). tion.
7-9). Although RT does not distinguish between ssDNA and ssRNA, (6) only RNA target produced a PIRT-cDNA in RT. This was made possible by avoiding denatur- a) PIRT8 b) PIRT1 1 o) PIRT14 d) SKSS ing of dsDNA. No amplifiable cDNA was produced either without RT, without PIRT primer (lanes 5,10), or from an- 1.0 tisense RNA. Amplification of the PIRT- O cDNA (RNA-PCR) by primer SK38 and I the PIRT primer was not affected by the simultaneously running DNA-PCR with primers SK38 and WO2, because primer 0.5 WO2 lies upstream of the PIRT location.
Uncoupling RNA-PCR from DNA-PCR 0.0 For RNA-PCR, three PIRT primers (28- 0 5 20 60 0 5 20 60 0 5 20 60 0 5 20 60 mers) with different degrees of comple- mentarity to the target RNA were tested Duration of T7 RNA Polymerase Reaction (rain) for their specificity in directing RT FIGURE 3 Analysisof enzymaticalHIV cRNA production by T7 RNA polymerase. Samples taken and PIRT-cDNA amplification. They from T7 RNA polymerase reaction kinetics at O, 5, 20, and 60 min containing constant amount of target DNA and increasing amounts of RNA were analyzed by DIFF-PCR. Bars represent the matched the target sequence at their 3' ratio of R/D produced by amplification of DNA and sense cRNA (open bars) or DNA and antisense end with 8 (PIRT8), 11 (PIRT11), and 14 cRNA (solid bars) using RT primers PIRT8 (a), PIRT11 (b), PIRT14 (c), or SK39 (d). Using RT (PIRT14) nucleotides, respectively (Table primers PIRT8 and PIRT11, respectively, the amplification of RNA was nucleic acid type specific 1). In addition, a reaction using primer and sequence specific. Autoradiographs from DIFF-PCR were scanned on a CD60 densitometer SK39 that has complete complementar- (Desaga, Heidelberg, Germany). The R/D ratio was calculated by dividing the peak area of the ity (28 matching bases) and one reaction R-amplicon signal by the peak area of the D-amplicon signal. The means +1 S.E.M. of three in the absence of any primer were run independent DIFF-PCR experiments, each with duplicate amplicon analysis, are shown.
PCR Methods and Applications 25 Downloaded from genome.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press
To study the association of the origi- TABLE 2 Requirements for Annealing of Antisense Primers Used in DIFF-PCR nal RNA/DNA ratio in the sample with PIRT primer the R/D ratio after amplification, the Reaction Target Primer WO2 RNA and DNA content of samples from Reverse transcription (sense) RNA no yes the T7 RNA-PCR was determined by PCR on cDNA (sense) ccDNA no yes Northern hybridization and compared PCR on dsDNA sense DNA strand yes no with the R/D ratio obtained by DIFF-PCR (Fig. 4). The R/D ratio did depend on the RNA/DNA ratio of the sample, although the overall efficiency for RNA amplifica- to homologous DNA in a sample is pos- has to anneal to its specific target, as tion was 50-fold lower than for DNA am- sible by DIFF-PCR. shown in Table 2, whereas the second plification. This difference remained antisense primer (WO2) must not an- constant upon serial dilution of samples neal. From these requirements the con- DISCUSSION (with a RNA/DNA ratio of 1) down to sev- clusion can be drawn that ccDNA (i.e., eral thousand copies per reaction. This Three variables determine the discrimi- the strand complementary to the PIRT- suggests that the lower amplification of nation of DNA and RNA in DIFF-PCR: re- cDNA) must be different from the sense RNA is the result of low efficiency of the action temperatures, target accessibility, DNA. Because ccDNA is produced from RT and not preferential amplification of and primer/target complementarity. The the cDNA during the first cycle of PCR, the D-amplicon. The reason for this low differentiating key is the PIRT primer. the tag for later discrimination has to be efficiency of RT is mispriming of the While the dsDNA remains in double- introduced into the cDNA during RT. PIRT primers and not inaccessibility of stranded conformation at low stringency This can be performed at low stringency the RNA, as random-primed RT gives (37°C), the PIRT primer anneals to the as long as RNA, but not the dsDNA, is much higher levels of cDNA and more RNA and, by elongation with RT, a tag is accessible to the PIRT primer. This is amplification products. The R/D factor is introduced in the cDNA. Once the tag is achieved by heating the sample to 55°C a characteristic of a given set of primers introduced, the PIRT primer will distin- to reduce RNA secondary structure with- and targets, and its value can be deter- guish under the high-stringency condi- out melting the dsDNA. This denaturing mined empirically. The R/D ratio was de- tions of PCR annealing (55°C) between temperature has to be determined em- termined for the given target/primer native DNA target and the tagged ampli- pirically for a specific target sequence, as combination by assaying samples that fication product from RNA. To achieve the temperatures for melting of RNA sec- contained known amounts of target RNA this discrimination, the PIRT primer ondary structure and denaturation of ds- and DNA. Once this value is determined, must be able to discriminate between DNA depend on the GC content and the the DIFF-PCR is calibrated and simulta- the three reactions involved in DIFF-PCR length of the target sequence. neous quantification of RNA in relation (Fig 1). In each reaction the PIRT primer For the fine tuning of RNA/DNA dis- crimination the only parameter that can be varied is the number of complemen- tary nucleotides in the PIRT primer, as the temperature settings for the three re- 0.B actions are limited. We have found that 8 or 11 nucleotides allow discrimination 0.4 ! of DNA from RNA, whereas 14 comple-
O mentary nucleotides lead to incomplete 0.3 discrimination. In addition, introduc- tion of a sequence tag during RT can also I dramatically reduce false positives in 0.2 RT_PCR.(1°) For quantitative evaluation of DIFF- 0.1 PCR results, the amplification of the R-amplicon and the D-amplicon have to 0.0 d ! I I I be equal and the PCR must be in its ex- 0 5 10 15 20 25 ponential phase. Similar to competitive RNA/DNA-ratio PCR with an internal standard, preferen- FIGURE 4 Formation of R- and D-amplicons by DIFF-PCR with PIRT11 is proportional to the tial amplification of one of the two tar- RNA/DNA ratio of the sample. RNA and DNA amounts in samples from a T7 RNA polymerase gets should be avoided. The equivalence reaction kinetics were determined by Northern hybridization and were analyzed further by of replication efficiencies is only testable DIFF-PCR using primer PIRT11. The R/D ratios of DIFF-PCR analysis were proportional to the through experiments with known initial correspondent RNA/DNA ratios of Northern hybridization analysis. Means +-1 S.E.M. of four target numbers. (11) Unbalanced amplifi- Northern hybridizations from three independent DIFF-PCR experiments are shown. For North- cation would lead to a nonlinear rela- ern hybridization, 10 i~l of T7 RNA polymerase reaction aliquots were subjected to denaturing formaldehyde--agarose gel electrophoresis, (8'9) blotted, and analyzed by hybridization with SK19. tionship between the ratio of PCR prod- RNA/DNA ratios were obtained by dividing the peak area of the runoff transcript signal by the ucts and the ratio of PCR targets. (12) As peak area of the plasmid/PvulI digest after densitometric scanning of the autoradiographs. The shown in Figure 4, the R/D ratio is lin- same samples were diluted 1000-fold and analyzed by DIFF-PCR. early dependent on the DNA/RNA ratio
26 PCR Methods and Applications Downloaded from genome.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press
of the sample in DIFF-PCR. Similar re- Scharf, R. Higuchi, G.T. Horn, K.B. Mullis, 1990. A new method for extracting DNA sults have been obtained for competitive and H.A. Erlich. 1988. Primer-directed en- or RNA for polymerase chain reaction. J. DNA-PCR (s) and RNA-PCR. °z) In the zymatic amplification of DNA with a ther- Virol. Methods 27: 203-210. latter cycles, PCR can reach a plateau as a mostable DNA polymerase. Science 239: 16. Ganguli, P.K., R. Brasseur, and L. Gyenes. 1973. Simultaneous extraction of RNA result of decreased enzyme activity, de- 487-491. 3. Kawasaki, E.S. 1990. Amplification of and DNA from rat liver with cupric sul- pletion of reagents, and recombination RNA. In PCR protocols, a guide to methods fate. Prep. Biochem. 3: 313-321. of reaction products. °4) In latter cycles and applications (ed. M.A. Innis, D.H. Gel- 17. Krieg P., E. Amtmann, and G. Sauer. 1983. of DIFF-PCR, the high concentrations of fand, J.J. Sninsky, and T.J. White), pp. 21- The simultaneous extraction of high-mo- R- and D-amplicons could theoretically 27. Academic Press, San Diego, CA. lecular-weight DNA and of RNA from lead to "cross recombination" of the two 4. Jansen, R.W., G. Siegl, and S. Lemon. solid tumors. Anal. Biochem. 134: 288- amplicons as a result of partial sequence 1990. Molecular epidemiology of human 294. identity as described for competitive hepatitis A virus defined by an antigen- 18. Chan, V.T., K.A. Fleming, andJ.O. McGee. PCR. (1~) As long as the ratio of control capture polymerase chain reaction 1983. Simultaneous extraction from clin- yield to target yield equals the ratio of method. Proc. Natl. Acad. Sci. 87-2867- ical biopsies of high-molecular weight DNA and RNA: Comparative characteriza- control input to target input, the ampli- 2871. 5. Telenti, A., P. Imboden, and D. German. tion by biotinylated and 32p-labeled fication reaction is exponential. Our ex- 1992. Competitive polymerase chain re- probes on Southern and Northern blots. perimental findings suggest that during action using an internal standard: Appli- Anal. Biochem. 168" 16-24. DIFF-PCR, amplification is exponential cation to the quantitation of viral DNA. J. 19. Karlinsey, J., G. Stamatoyannopoulos, for both targets (Fig. 4). Virol. Methods 39: 259-268. and T. F~nver. 1989. Simultaneous purifi- For application of this method to 6. Sambrook, J., E.F. Fritsch, and T. Maniatis. cation of DNA and RNA from small num- "true" samples, the method of sample 1989. Molecular cloning: A laboratory man- bers of eukaryotic cells. Anal. Biochem. preparation should allow simultaneous ual, 2nd ed. Cold Spring Harbor Labora- 180: 303-306. isolation of DNA and RNA without tory Press, Cold Spring Harbor, New York. 20. Kollmann, R.T., X. Zhuang, A. Rubinstein, changing their relative amounts. The use 7. Ou, C.Y., S. Kwok, S.W. Mitchell, D.H. and H. Goldstein. 1992. Design of poly- merase chain reaction primers for the se- of glass powder has been described for Mack, J.H.J. Sninsky, J.W. Krebs, P. Pe- orino, D. Warfield, and G. Schochetman. lective amplification of HIV-1 RNA in the simple and efficient extraction of either 1988. DNA amplification for direct detec- presence of HIV-1 DNA. AIDS 6: 547-552. RNA or DNA for PCR. ~ls~ Methods for si- tion of HIV-1 in DNA of peripheral blood multaneous extraction of RNA and DNA mononuclear cells. Science 239: 295-297. have been described, (~6-19) but the rela- 8. Scharf, S.J. 1990. Cloning with PCR. In Received April 20, 1993; accepted in tive recoveries of RNA and DNA have not PCR protocols, a guide to methods and ap- revised form June 11, 1993. been investigated. This remains a prob- plications (ed. M.A. Innis, D.H. Gelfand, lem to be solved for quantitation of RNA/ J.J. Sninsky, and T.J. White), pp. 84-91. DNA levels by amplification methods. Academic Press, San Diego, CA. In contrast to other attempts to dis- 9. Ausubel, F.M., R. Brent, R.E. Kingston, criminate between HIV DNA and D.D. Moore, J.G. Seidman, J.A. Smith, and K. Struhl. 1987. Current protocols in molec- RNA, (2°) DIFF-PCR does not depend on ular biology. Greene Publishing/Wiley In- the presence of a poly(A) tail in the terscience, New York. mRNA but allows the sensitive, specific 10. Shuldiner, A., K. Tanner, C.A. Moore, and detection of any dsDNA segment to- J. Roth. 1991. RNA template-specific PCR: gether with the corresponding transcrip- An improved method that dramatically tion product RNA (e.g., mRNA). Tran- reduces false positives in RT-PCR. Bio- scription rate is a direct parameter for Techniques 11: 760-763. measuring gene expression, and DIFF- 11. Nedelman, J., P. Heagerty, and C. PCR is an attempt to quantitate this pa- Lawrence. 1992. Quantitative PCR with rameter by measuring R/D values. We internal controls. Comput. Applic. Biosci. 8: 65-70. have shown that this method is working 12. Lubin, M.B., J.D. Elashoff, S. Wang, J. Rot- in an artificial system using quantified ter, and H. Toyoda. 1991. Precise gene amounts of DNA and RNA. Once adapted dosage determination by polymerase to true samples, this novel technique chain reaction: Theory, methodology, may find applications for the analysis of and statistical approach. Mol. Cell. Probes. gene expression on the transcription 5: 307-317. level and thus may serve as a tool for the 13. Wang, A.M., M.V. Doyle, and D.F. Mark. study of gene activity. 1989. Quantitation of mRNA by the poly- merase chain reaction. Proc. Natl. Acad. Sci. 86: 9717-9721. REFERENCES 14. Mullis, K.B. 1991. The polymerase chain reaction in an anemic mode: How to 1. Mullis, K.B. and F.A. Faloona. 1987. Spe- avoid cold oligodeoxyribonuclear fusion. cific synthesis of DNA in vitro via a poly- PCR Methods Applic. 1" 1-4. merase-catalyzed chain reaction. Methods 15. Yamada O., T. Matsumoto, M. Nakash- Enzymol. 155: 335-350. ima, S. Hagari, T. Kamahora, H. Ueyama, 2. Saiki, R.K., D.H. Gelfand, S. Stoffel, S.J. Y. Kishi, H. Uemura, and T. Kurimura.
PCR Methods and Applications 27 Downloaded from genome.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press
Simultaneous detection of DNA and RNA by differential polymerase chain reaction (DIFF-PCR).
P Imboden, T Burkart and K Schopfer
Genome Res. 1993 3: 23-27
References This article cites 16 articles, 4 of which can be accessed free at: http://genome.cshlp.org/content/3/1/23.full.html#ref-list-1
License
Email Alerting Receive free email alerts when new articles cite this article - sign up in the box at the Service top right corner of the article or click here.
To subscribe to Genome Research go to: https://genome.cshlp.org/subscriptions
Copyright © Cold Spring Harbor Laboratory Press