DOCSLIB.ORG

The Role of Age-Related DNA Methylation in the Development of Age-Related Diseases

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
The Role of Age-Related DNA Methylation in the Development of Age-Related Diseases The role of age-related DNA methylation in the development of age-related diseases A thesis submitted in part requirement for the degree of Doctor of Philosophy July 2013 Sanne Dorien van Otterdijk Northern Institute for Cancer Research, Faculty of Medical Sciences, Newcastle University Abstract Alterations in DNA methylation can have dramatic effects on gene transcription, and in particular, hypermethylation of promoter associated CpG islands is known to lead to gene inactivation. Altered patterns of DNA methylation play a key role in the development of cancer and may also play important roles in many other diseases. However, the mechanisms which lead to these changes in DNA methylation are unknown. DNA methylation patterns have also been found to change during normal ageing and these changes have similarities to those that occur during the development of cancer. This suggests that for some age-related diseases, most notably cancer, altered patterns of methylation may be an early initiating event and that disease may develop in cells which already possess changes in their DNA methylation landscape. Therefore, this study was designed to examine how methylation levels at a group of genes alters over the life-course and how these relate to methylation changes observed in major age- related diseases (cancer, specifically acute lymphoblastic leukaemia (ALL) and Hereditary Nonpolyposis Colorectal Cancer (HNPCC) patients, and atherosclerosis). DNA was collected from healthy volunteers from different ages and from ALL, HNPCC and atherosclerosis patients. Methylation was quantified using pyrosequencing. The study produced a number of findings: 1) Genes exhibiting variable methylation in PBL samples from healthy volunteers are also highly methylated in leukaemia, suggesting a common underlying mechanism. 2) Increased methylation levels were observed in lymphoid compared to myeloid cells, in healthy individuals, mirroring the patterns seen in leukaemia. 3) A subset of genes exhibiting variable methylation in PBL samples from healthy volunteers and that are highly methylated in leukaemia are aberrantly methylated in HNPCC patients and atherosclerosis patients, suggesting shared risk factors. 4) While methylation levels increase during ageing, a substantial proportion of methylation is already present at birth and may thus alter disease susceptibility throughout life. 5) Blood samples from ALL patients in remission exhibit increased methylation levels (versus controls), not directly related to their leukaemic clone, and the extent of methylation correlates with overall survival. The studies to date are compatible with a hypothesis in which altered methylation of disease-related genes pre-exists in a subset of haematopoietic cells and that these cells may be at a significantly increased risk of progression to age-related diseases. Furthermore, monitoring DNA methylation may be a valuable tool for early diagnosis of these diseases, as well as for monitoring disease progression in patients. i Acknowledgements I would like to thank my supervisors Gordon Strathdee, John Mathers and Ioakim Spyridopoulos for their support, guidance and inputs throughout the project, as well as my group members. Thanks for the numerous members of staff within the University who have provided assistance during this project, under which my assessors, Caroline Relton and Jim Allen, everyone at the flow cytometry facility and the pyrosequencer who helped with technical guidance and the statisticians who were a great help for finding the correct statistical tests. A special thanks to everyone from the old crucible lab for giving me such a warm welcome in Newcastle. It was a privilege to share a lab with all of you! Thanks for those in the SJS who friendly welcomed us in the new lab after the move and for keeping me company during the, sometimes so hard needed, work breaks. Thanks to all of my friends who supported me through the past years by either a nice chat or a couple of pints, both here in Newcastle and overseas. Especially for those involved in Monday dinner and Friday drinks; the Newcastle experience wouldn’t have been the same without the always good start and end of the week with your great company and sometimes some alcohol . So everyone involved in these activities, but also all the friends that I made beside this, I will miss all of you when I leave Newcastle. I will finish my acknowledgements with thanking the most important people, without whose support I would not have come this far: my family and Maurice; spreading your wings is easy, when you have someone there to catch you when you fall. So thanks, for always giving me that safety net, to support me with whichever crazy idea I came up next, and most importantly, for always giving me a home. Maurice, I know the past three years apart wasn’t easy on both of us, but I couldn’t have done it without knowing that you were always there for me. A new chapter of our lives will begin after this, and I’m looking forward to it with you by my side. ii Table of contents CHAPTER 1. BACKGROUND .............................................................................................. 1 1.1 EPIGENETICS ....................................................................................................... 2 1.1.1 DNA methylation............................................................................................. 4 1.1.2 DNA methyltransferase genes ......................................................................... 5 1.1.3 DNA de-methylation7The role of DNA methylation in cellular processes ........................................................................................................................ 7 1.1.4 The role of DNA methylation in cellular processes ........................................ 8 1.1.5 The role of DNA methylation in controlling gene expression ........................ 9 1.1.6 Histone modification..................................................................................... 10 1.1.7 DNA methylation........................................................................................... 12 1.2 AGEING AND AGE-RELATED DISEASES ............................................................... 13 1.2.1 Cancer ........................................................................................................... 15 1.2.1.1 Haematopoietic malignancies ................................................................ 15 1.2.2 Cardiovascular diseases ............................................................................... 16 1.2.3 Molecular pathways involved in ageing and age-related diseases .............. 17 1.2.3.1 Cell signalling pathways associated with ageing .................................. 17 1.2.3.2 Cell signalling pathways associated with age-related diseases ............. 21 1.2.4 Epigenetics changes associated with ageing and age-related diseases ....... 21 1.2.4.1 Epigenetic changes associated with ageing ........................................... 21 1.2.4.2 Epigenetic changes associated with cancer ........................................... 23 1.2.4.3 Epigenetic changes associated with cardiovascular disease .................. 24 CHAPTER 2. PROJECT HYPOTHESIS ........................................................................... 26 2.1 PROJECT HYPOTHESIS ........................................................................................ 27 2.2 PROJECT AIMS ................................................................................................... 30 CHAPTER 3. METHODS ..................................................................................................... 31 3.1 SAMPLES ........................................................................................................... 32 3.1.1 Sample collection .......................................................................................... 32 3.1.2 DNA extraction ............................................................................................. 35 3.1.3 Cell type specific cell sorting ........................................................................ 35 3.1.3.1 Isolation of mononuclear cells by gradient centrifugation .................... 36 3.1.3.2 Cell-type specific cell isolation ............................................................. 37 3.1.3.2.1 CD19, CD3 and CD14 isolation ....................................................... 38 iii 3.1.3.2.2 CD34 isolation .................................................................................. 38 3.1.3.3 Isolation of granulocytes ....................................................................... 39 3.1.3.4 Validation of cell isolations ................................................................... 40 3.1.3.4.1 Validation of cell isolations by qPCR ............................................... 40 3.1.3.4.1.1 RNA isolation ......................................................................... 40 3.1.3.4.1.2 cDNA extraction ..................................................................... 41 3.1.3.4.1.3 qPCR ....................................................................................... 41 3.1.3.4.2 Validation of cell isolation by flow cytometry .......................... 43 3.2 METHYLATION ANALYSIS .................................................................................. 43 3.2.1 Preparing for methylation analysis .............................................................. 43 3.2.1.1 Sodium bisulphite modification ...........................................................
Load more

Recommended publications
  • Detailed Review Paper on Retinoid Pathway Signalling
    1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process.
    [Show full text]
  • Topoisomerase Ii Inhibitors Induce an Illegitimate Genome Rearrangement Common in Infant Leukemia
    TOPOISOMERASE II INHIBITORS INDUCE AN ILLEGITIMATE GENOME REARRANGEMENT COMMON IN INFANT LEUKEMIA by Bhawana Bariar A dissertation submitted to the faculty of The University of North Carolina at Charlotte in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biology Charlotte 2013 Approved by: ______________________________ Dr. Christine Richardson ______________________________ Dr. Mark Clemens ______________________________ Dr. Laura Schrum ______________________________ Dr. Pinku Mukherjee ______________________________ Dr. Anthony Fodor ii ©2013 Bhawana Bariar ALL RIGHTS RESERVED iii ABSTRACT BHAWANA BARIAR. Topoisomerase II inhibitors induce an illegitimate genome rearrangement common in infant leukemia. (Under the direction of DR. CHRISTINE RICHARDSON) Infant acute leukemias account for ~30% of all malignancy seen in childhood across the Western world. They are aggressive and characterized by rapid onset shortly after birth. The majority of these have rearrangements involving the MLL (mixed lineage leukemia) gene. Although MLL fusion to more than 75 genes have been identified, AF9 is one of its most common translocation partners. Since MLL breakpoint sequences associated with infant acute leukemia are similar to those in secondary AML following exposure to the topoisomerase II (topo II) poison etoposide, it has been hypothesized that exposure during pregnancy to biochemically similar compounds may promote infant acute leukemia. Some studies have shown an epidemiological link between bioflavonoid intake
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Creb5 Establishes the Competence for Prg4 Expression in Articular Cartilage
    ARTICLE https://doi.org/10.1038/s42003-021-01857-0 OPEN Creb5 establishes the competence for Prg4 expression in articular cartilage Cheng-Hai Zhang1, Yao Gao1, Unmesh Jadhav2,3, Han-Hwa Hung4, Kristina M. Holton5, Alan J. Grodzinsky4, ✉ Ramesh A. Shivdasani 2,3,6 & Andrew B. Lassar 1 A hallmark of cells comprising the superficial zone of articular cartilage is their expression of lubricin, encoded by the Prg4 gene, that lubricates the joint and protects against the devel- opment of arthritis. Here, we identify Creb5 as a transcription factor that is specifically expressed in superficial zone articular chondrocytes and is required for TGF-β and EGFR signaling to induce Prg4 expression. Notably, forced expression of Creb5 in chondrocytes 1234567890():,; derived from the deep zone of the articular cartilage confers the competence for TGF-β and EGFR signals to induce Prg4 expression. Chromatin-IP and ATAC-Seq analyses have revealed that Creb5 directly binds to two Prg4 promoter-proximal regulatory elements, that display an open chromatin conformation specifically in superficial zone articular chondrocytes; and which work in combination with a more distal regulatory element to drive induction of Prg4 by TGF-β. Our results indicate that Creb5 is a critical regulator of Prg4/lubricin expression in the articular cartilage. 1 Department of Biological Chemistry and Molecular Pharmacology, Blavatnik Institute at Harvard Medical School, Boston, MA, USA. 2 Department of Medical Oncology and Center for Functional Cancer Epigenetics, Dana-Farber Cancer Institute, Boston, MA, USA. 3 Departments of Medicine, Brigham & Women’s Hospital and Harvard Medical School, Boston, MA, USA. 4 Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA, USA.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Supplementary Figure S4
    18DCIS 18IDC Supplementary FigureS4 22DCIS 22IDC C D B A E (0.77) (0.78) 16DCIS 14DCIS 28DCIS 16IDC 28IDC (0.43) (0.49) 0 ADAMTS12 (p.E1469K) 14IDC ERBB2, LASP1,CDK12( CCNE1 ( NUTM2B SDHC,FCGR2B,PBX1,TPR( CD1D, B4GALT3, BCL9, FLG,NUP21OL,TPM3,TDRD10,RIT1,LMNA,PRCC,NTRK1 0 ADAMTS16 (p.E67K) (0.67) (0.89) (0.54) 0 ARHGEF38 (p.P179Hfs*29) 0 ATG9B (p.P823S) (0.68) (1.0) ARID5B, CCDC6 CCNE1, TSHZ3,CEP89 CREB3L2,TRIM24 BRAF, EGFR (7p11); 0 ABRACL (p.R35H) 0 CATSPER1 (p.P152H) 0 ADAMTS18 (p.Y799C) 19q12 0 CCDC88C (p.X1371_splice) (0) 0 ADRA1A (p.P327L) (10q22.3) 0 CCNF (p.D637N) −4 −2 −4 −2 0 AKAP4 (p.G454A) 0 CDYL (p.Y353Lfs*5) −4 −2 Log2 Ratio Log2 Ratio −4 −2 Log2 Ratio Log2 Ratio 0 2 4 0 2 4 0 ARID2 (p.R1068H) 0 COL27A1 (p.G646E) 0 2 4 0 2 4 2 EDRF1 (p.E521K) 0 ARPP21 (p.P791L) ) 0 DDX11 (p.E78K) 2 GPR101, p.A174V 0 ARPP21 (p.P791T) 0 DMGDH (p.W606C) 5 ANP32B, p.G237S 16IDC (Ploidy:2.01) 16DCIS (Ploidy:2.02) 14IDC (Ploidy:2.01) 14DCIS (Ploidy:2.9) -3 -2 -1 -3 -2 -1 -3 -2 -1 -3 -2 -1 -3 -2 -1 -3 -2 -1 Log Ratio Log Ratio Log Ratio Log Ratio 12DCIS 0 ASPM (p.S222T) Log Ratio Log Ratio 0 FMN2 (p.G941A) 20 1 2 3 2 0 1 2 3 2 ERBB3 (p.D297Y) 2 0 1 2 3 20 1 2 3 0 ATRX (p.L1276I) 20 1 2 3 2 0 1 2 3 0 GALNT18 (p.F92L) 2 MAPK4, p.H147Y 0 GALNTL6 (p.E236K) 5 C11orf1, p.Y53C (10q21.2); 0 ATRX (p.R1401W) PIK3CA, p.H1047R 28IDC (Ploidy:2.0) 28DCIS (Ploidy:2.0) 22IDC (Ploidy:3.7) 22DCIS (Ploidy:4.1) 18IDC (Ploidy:3.9) 18DCIS (Ploidy:2.3) 17q12 0 HCFC1 (p.S2025C) 2 LCMT1 (p.S34A) 0 ATXN7L2 (p.X453_splice) SPEN, p.P677Lfs*13 CBFB 1 2 3 4 5 6 7 8 9 10 11
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Hox Gene Colinear Expression in the Avian Medulla Oblongata Is Correlated with Pseudorhombomeric Domains
    Developmental Biology 323 (2008) 230–247 Contents lists available at ScienceDirect Developmental Biology journal homepage: www.elsevier.com/developmentalbiology Genomes & Developmental Control Hox gene colinear expression in the avian medulla oblongata is correlated with pseudorhombomeric domains Faustino Marín ⁎, Pilar Aroca, Luis Puelles Department of Human Anatomy and Psychobiology, School of Medicine, University of Murcia, CIBER de Enfermedades Raras (CIBERER), Instituto Universitario de Envejecimiento, E-30100 Murcia, Spain article info abstract Article history: The medulla oblongata (or caudal hindbrain) is not overtly segmented, since it lacks observable Received for publication 30 April 2008 interrhombomeric boundaries. However, quail–chick fate maps showed that it is formed by 5 pseudorhom- Revised 29 July 2008 bomeres (r7–r11) which were empirically found to be delimited consistently at planes crossing through Accepted 15 August 2008 adjacent somites ( Cambronero and Puelles, 2000). We aimed to reexamine the possible segmentation or Available online 27 August 2008 rostrocaudal regionalisation of this brain region attending to molecular criteria. To this end, we studied the expression of Hox genes from groups 3 to 7 correlative to the differentiating nuclei of the medulla oblongata. Keywords: Hindbrain Our results show that these genes are differentially expressed in the mature medulla oblongata, displaying Rhombomeres instances of typical antero-posterior (3′ to 5′) Hox colinearity. The different sensory and motor columns, as Transcription factor well as the reticular formation, appear rostrocaudally regionalised according to spaced steps in their Hox Pattern formation expression pattern. The anterior limits of the respective expression domains largely fit boundaries defined Chick embryo between the experimental pseudorhombomeres. Therefore the medulla oblongata shows a Hox-related Chick brain rostrocaudal molecular regionalisation comparable to that found among rhombomeres, and numerically Myelencephalon consistent with the pseudorhombomere list.
    [Show full text]
  • Transcription Factor Gene Expression Profiling and Analysis of SOX Gene Family Transcription Factors in Human Limbal Epithelial
    Transcription factor gene expression profiling and analysis of SOX gene family transcription factors in human limbal epithelial progenitor cells Der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg zur Erlangung des Doktorgrades Dr. rer. nat. vorgelegt von Dr. med. Johannes Menzel-Severing aus Bonn Als Dissertation genehmigt von der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg Tag der mündlichen Prüfung: 7. Februar 2018 Vorsitzender des Promotionsorgans: Prof. Dr. Georg Kreimer Gutachter: Prof. Dr. Andreas Feigenspan Prof. Dr. Ursula Schlötzer-Schrehardt 1 INDEX 1. ABSTRACTS Page 1.1. Abstract in English 4 1.2. Zusammenfassung auf Deutsch 7 2. INTRODUCTION 2.1. Anatomy and histology of the cornea and the corneal surface 11 2.2. Homeostasis of corneal epithelium and the limbal stem cell paradigm 13 2.3. The limbal stem cell niche 15 2.4. Cell therapeutic strategies in ocular surface disease 17 2.5. Alternative cell sources for transplantation to the corneal surface 18 2.6. Transcription factors in cell differentiation and reprogramming 21 2.7. Transcription factors in limbal epithelial cells 22 2.8. Research question 25 3. MATERIALS AND METHODS 3.1. Human donor corneas 27 3.2. Laser Capture Microdissection (LCM) 28 3.3. RNA amplification and RT2 profiler PCR arrays 29 3.4. Real-time PCR analysis 33 3.5. Immunohistochemistry 34 3.6. Limbal epithelial cell culture 38 3.7. Transcription-factor knockdown/overexpression in vitro 39 3.8. Proliferation assay 40 3.9. Western blot 40 3.10. Statistical analysis 41 2 4. RESULTS 4.1. Quality control of LCM-isolated and amplified RNA 42 4.2.
    [Show full text]
  • Reduced H3k27me3 Leads to Abnormal Hox Gene Expression In
    Yu et al. Epigenetics & Chromatin (2019) 12:76 https://doi.org/10.1186/s13072-019-0318-1 Epigenetics & Chromatin RESEARCH Open Access Reduced H3K27me3 leads to abnormal Hox gene expression in neural tube defects Juan Yu1†, Lei Wang2†, Pei Pei2†, Xue Li4, Jianxin Wu3, Zhiyong Qiu2, Juan Zhang1, Ruifang Ao1, Shan Wang2*, Ting Zhang2* and Jun Xie1* Abstract Background: Neural tube defects (NTDs) are severe, common birth defects that result from failure of normal neural tube closure during early embryogenesis. Accumulating strong evidence indicates that genetic factors contribute to NTDs etiology, among them, HOX genes play a key role in neural tube closure. Although abnormal HOX gene expres- sion can lead to NTDs, the underlying pathological mechanisms have not fully been understood. Method: We detected that H3K27me3 and expression of the Hox genes in a retinoic acid (RA) induced mouse NTDs model on E8.5, E9.5 and E10.5 using RNA-sequencing and chromatin immunoprecipitation sequencing assays. Furthermore, we quantifed 10 Hox genes using NanoString nCounter in brain tissue of fetuses with 39 NTDs patients including anencephaly, spina bifda, hydrocephaly and encephalocele. Results: Here, our results showed diferential expression in 26 genes with a > 20-fold change in the level of expres- sion, including 10 upregulated Hox genes. RT-qPCR revealed that these 10 Hox genes were all upregulated in RA- induced mouse NTDs as well as RA-treated embryonic stem cells (ESCs). Using ChIP-seq assays, we demonstrate that a decrease in H3K27me3 level upregulates the expression of Hox cluster A–D in RA-induced mouse NTDs model on E10.5.
    [Show full text]
  • Role of HOX Genes in Stem Cell Differentiation and Cancer
    Thomas Jefferson University Jefferson Digital Commons Kimmel Cancer Center Papers, Presentations, and Grand Rounds Kimmel Cancer Center 7-22-2018 Role of HOX Genes in Stem Cell Differentiation and Cancer. Seema Bhatlekar Helen F. Graham Cancer Center and Research Institute; University of Delaware Jeremy Z Fields CATX Inc. Bruce M. Boman Thomas Jefferson University; Helen F. Graham Cancer Center and Research Institute; University of Delaware; CATX Inc. Follow this and additional works at: https://jdc.jefferson.edu/kimmelgrandrounds Part of the Oncology Commons Let us know how access to this document benefits ouy Recommended Citation Bhatlekar, Seema; Fields, Jeremy Z; and Boman, Bruce M., "Role of HOX Genes in Stem Cell Differentiation and Cancer." (2018). Kimmel Cancer Center Papers, Presentations, and Grand Rounds. Paper 62. https://jdc.jefferson.edu/kimmelgrandrounds/62 This Article is brought to you for free and open access by the Jefferson Digital Commons. The Jefferson Digital Commons is a service of Thomas Jefferson University's Center for Teaching and Learning (CTL). The Commons is a showcase for Jefferson books and journals, peer-reviewed scholarly publications, unique historical collections from the University archives, and teaching tools. The Jefferson Digital Commons allows researchers and interested readers anywhere in the world to learn about and keep up to date with Jefferson scholarship. This article has been accepted for inclusion in Kimmel Cancer Center Papers, Presentations, and Grand Rounds by an authorized administrator of the Jefferson Digital Commons. For more information, please contact: [email protected]. Hindawi Stem Cells International Volume 2018, Article ID 3569493, 15 pages https://doi.org/10.1155/2018/3569493 Review Article Role of HOX Genes in Stem Cell Differentiation and Cancer 1,2 3 1,2,3,4 Seema Bhatlekar , Jeremy Z.
    [Show full text]