DOCSLIB.ORG

1 2 3 4 5 the Atypical RNA-Binding Protein TAF15 Regulates Dorsoanterior Neural Development 6 Through Diverse Mechanisms in Xeno

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
1 2 3 4 5 the Atypical RNA-Binding Protein TAF15 Regulates Dorsoanterior Neural Development 6 Through Diverse Mechanisms in Xeno bioRxiv preprint doi: https://doi.org/10.1101/2021.06.14.041913; this version posted June 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 1 2 3 4 5 6 The atypical RNA-binding protein TAF15 regulates dorsoanterior neural development 7 through diverse mechanisms in Xenopus tropicalis 8 9 10 11 12 13 14 15 Caitlin S. DeJong 1*, Darwin S. Dichmann 1#, Cameron R. T. Exner 2, Yuxiao Xu 2, & 16 Richard M. Harland 1‡ 17 18 19 20 21 22 1 Molecular and Cell Biology Department, Genetics, Genomics and Development 23 Division, University of California, Berkeley, CA, USA 24 2 Department of Psychiatry, Weill Institute for Neurosciences, Quantitative Biosciences 25 Institute, University of California San Francisco, San Francisco, CA 26 * Present address: Vaccine and Infectious Disease Division, Fred Hutchinson Cancer 27 Research Center, Seattle, Washington 98109; # Present address: Invitae Corporation, 28 San Francisco, California, USA 29 30 31 32 33 34 35 36 37 ‡To whom correspondence should be addressed. Mail: [email protected] Running Title: TAF15 regulates dorsoanterior neural development in Xenopus tropicalis Page 1 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.14.041913; this version posted June 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 38 ABSTRACT 39 40 The FET family of atypical RNA-binding proteins includes Fused in sarcoma (Fus), 41 Ewing’s sarcoma (EWS), and the TATA-binding protein-associate factor 15 (TAF15). 42 FET proteins are highly conserved, suggesting specialized requirements for each 43 protein. Fus regulates splicing of transcripts required for mesoderm differentiation and 44 cell adhesion in Xenopus, but roles that EWS and TAF15 play remain unknown. Here 45 we analyze the roles of maternally deposited and zygotically transcribed TAF15, which 46 is essential for the proper development of dorsoanterior neural tissues. By measuring 47 changes in exon usage and transcript abundance from TAF15-depleted embryos we 48 found TAF15 may regulate dorsoanterior neural development through fgfr4 and 49 ventx2.1. TAF15 uses distinct mechanisms to downregulate FGFR4 expression: 1) 50 retention of a single intron within fgfr4 when maternal and zygotic TAF15 is depleted, 51 and 2) reduction of total fgfr4 transcript when zygotic TAF15 alone is depleted. The two 52 mechanisms of gene regulation (post-transcriptional vs transcriptional) suggest TAF15- 53 mediated gene regulation is target and cofactor-dependent, depending on the milieu of 54 factors that are present at different times of development. 55 56 57 58 59 60 61 62 63 64 65 66 67 68 69 70 71 72 73 74 75 76 77 78 79 80 81 82 83 84 85 Running Title: TAF15 regulates dorsoanterior neural development in Xenopus tropicalis Page 2 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.14.041913; this version posted June 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 86 INTRODUCTION 87 88 The FET family of atypical RNA-binding proteins includes Fused in sarcoma (Fus), 89 Ewing’s sarcoma (EWS), and the TATA-binding protein-associate factor 15 (TAF15). 90 This is a family of heterogeneous nuclear ribonuclear particle (hnRNP) proteins that 91 contain domains for transcriptional activation, RNA binding, and DNA binding 92 (Schwartz, Cech, & Parker, 2015). FET family proteins function in both RNA 93 Polymerase II-mediated transcription and pre-mRNA splicing (Schwartz et al., 2015; 94 Tan & Manley, 2009). Among vertebrates, the three FET members are highly conserved 95 from fish to mammals, suggesting an independent and specialized requirement for each 96 protein (Schwartz et al., 2015). FET proteins have been investigated primarily as 97 components of fusion oncogenes; following abnormal chromosomal translocations, FET 98 protein N-terminal low-complexity/activation domains are found fused to various DNA- 99 binding proteins, contributing to the formation of various cancers (e.g. sarcomas and 100 leukemias) as well as neuronal degenerative diseases (Crozat, Åman, Mandahl, & Ron, 101 1993; Delattre et al., 1992; King, Gitler, & Shorter, 2012; Kovar, 2011; Martini et al., 102 2002; Neumann et al., 2011; Panagopoulos et al., 1999; Rabbitts, Forster, Larson, & 103 Nathan, 1993; Sjögren, Meis-Kindblom, Kindblom, Åman, & Stenman, 1999; Tan & 104 Manley, 2009; Vance et al., 2009). It has only been more recently that the functions of 105 these proteins have been examined in their full length, “wild-type”, form (Dichmann & 106 Harland, 2012; Schwartz et al., 2015; Tan & Manley, 2009). Studies of the structural, 107 functional, and biochemical properties of the FET family proteins determined that these 108 proteins have multiple functions, such that FET proteins may have evolved to facilitate 109 the complex coupling of transcription and mRNA processing that occurs in multicellular 110 organisms (Kato et al., 2012; Schwartz et al., 2015; Schwartz, Wang, Podell, & Cech, 111 2013). 112 113 The majority of work that has contributed to our understanding of FET protein biology 114 and disease mechanism has been carried out in cell lines and mouse models (Hicks et 115 al., 2000; Li et al., 2007; Scekic‐Zahirovic et al., 2016; Sharma et al., 2016; Svetoni et 116 al., 2016; Kapeli et al., 2016) with little known of the role of FET proteins in embryonic 117 development. Previous work from our lab examining the role of Fus in Xenopus 118 development found that embryos depleted of Fus exhibit mesoderm differentiation 119 defects and epithelial dissociation (Dichmann & Harland, 2012). The underlying 120 mechanism of these phenotypes was retention of all introns in fibroblast growth factor 8 121 (fgf8), fibroblast growth factor receptor 2 (fgfr2), and cadherin 1 (cdh1) transcripts 122 (Dichmann & Harland, 2012). This study therefore showed that Fus is required for 123 processing of a subset of transcripts in Xenopus development. Given the important role 124 of FUS in Xenopus development, the perplexing potential for functional redundancy of 125 FET family members in mouse (while remaining highly conserved throughout 126 vertebrates), and the lack of basic research on FET protein functions, we examined the 127 role of TAF15 in early Xenopus development; including the role of maternal versus 128 zygotic TAF15. 129 130 To determine the role of TAF15 in early Xenopus development, we used RNA- 131 sequencing (RNAseq) from single embryos depleted of maternal (M) and zygotic (Z) 132 TAF15, using reagents that target all mRNA by inhibiting translation with Morpholino 133 oligonucleotides, or just zygotic function using splice blocking MOs or CRISPR Running Title: TAF15 regulates dorsoanterior neural development in Xenopus tropicalis Page 3 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.14.041913; this version posted June 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 134 mediated mutagenesis. Upon evaluating the transcriptional changes that result from 135 M+Z versus Z-only TAF15 depletion, we find a subset of target genes whose expression 136 is regulated either post-transcriptionally (via intron retention) or by transcript level, 137 depending on whether maternal or zygotic TAF15 is depleted. These results suggest 138 that maternal TAF15 translation is limiting for splicing of a subset of mRNAS. Further, 139 we show that during the time of zygotic genome activation, zygotic TAF15 modulates 140 the expression of nascent target genes, acting at the transcriptional (rather than post- 141 transcriptional) level. Interestingly, we find that in at least one case that we examined 142 closely, maternal and zygotic TAF15 have a shared target gene (fgfr4), but that each act 143 to regulate the target gene expression through post-transcriptional vs. transcriptional 144 mechanisms, respectively. Here, we describe our findings as an example in Xenopus 145 where the gene product TAF15: 1) uses distinct molecular mechanisms to regulate the 146 expression of the same gene target (fgfr4) depending on the time of development in 147 which TAF15 is expressed (maternal versus zygotic) and 2) ensures proper 148 dorsoanterior neural development through two distinct molecular pathways (fgfr4 and 149 ventx2.1). 150 151 152 153 154 155 156 157 158 159 160 161 162 163 164 165 166 167 168 169 170 171 172 173 174 175 176 177 178 179 180 181 Running Title: TAF15 regulates dorsoanterior neural development in Xenopus tropicalis Page 4 bioRxiv preprint doi: https://doi.org/10.1101/2021.06.14.041913; this version posted June 14, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. 182 METHODS 183 184 Ethics statement 185 This study was carried out in strict accordance with the recommendations in the Guide 186 for the Care and Use of Laboratory Animals of the National Institutes of Health. The 187 protocol was approved by the Animal Care and Use Committee at the University of 188 California, Berkeley. 189 190 General Xenopus Embryo Culture 191 Xenopus tropicalis embryos were obtained through natural matings. For next day 192 (daytime) matings, males were housed individually, and females were housed together, 193 in four liter Rubbermaid® containers filled with two liters of water collected from the X. 194 tropicalis housing racks. The night before the natural mating, males were boosted with 195 100 units (U) of human chorionic gonadotropin (HCG: Chorulon®, Merck, NADA 196 NO.140-927, Code No. 133754) and females were primed with 10U HCG. The morning 197 of mating, females were boosted with 200U HCG and paired with males.
Load more

Recommended publications
  • Detailed Review Paper on Retinoid Pathway Signalling
    1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process.
    [Show full text]
  • Topoisomerase Ii Inhibitors Induce an Illegitimate Genome Rearrangement Common in Infant Leukemia
    TOPOISOMERASE II INHIBITORS INDUCE AN ILLEGITIMATE GENOME REARRANGEMENT COMMON IN INFANT LEUKEMIA by Bhawana Bariar A dissertation submitted to the faculty of The University of North Carolina at Charlotte in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biology Charlotte 2013 Approved by: ______________________________ Dr. Christine Richardson ______________________________ Dr. Mark Clemens ______________________________ Dr. Laura Schrum ______________________________ Dr. Pinku Mukherjee ______________________________ Dr. Anthony Fodor ii ©2013 Bhawana Bariar ALL RIGHTS RESERVED iii ABSTRACT BHAWANA BARIAR. Topoisomerase II inhibitors induce an illegitimate genome rearrangement common in infant leukemia. (Under the direction of DR. CHRISTINE RICHARDSON) Infant acute leukemias account for ~30% of all malignancy seen in childhood across the Western world. They are aggressive and characterized by rapid onset shortly after birth. The majority of these have rearrangements involving the MLL (mixed lineage leukemia) gene. Although MLL fusion to more than 75 genes have been identified, AF9 is one of its most common translocation partners. Since MLL breakpoint sequences associated with infant acute leukemia are similar to those in secondary AML following exposure to the topoisomerase II (topo II) poison etoposide, it has been hypothesized that exposure during pregnancy to biochemically similar compounds may promote infant acute leukemia. Some studies have shown an epidemiological link between bioflavonoid intake
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • Creb5 Establishes the Competence for Prg4 Expression in Articular Cartilage
    ARTICLE https://doi.org/10.1038/s42003-021-01857-0 OPEN Creb5 establishes the competence for Prg4 expression in articular cartilage Cheng-Hai Zhang1, Yao Gao1, Unmesh Jadhav2,3, Han-Hwa Hung4, Kristina M. Holton5, Alan J. Grodzinsky4, ✉ Ramesh A. Shivdasani 2,3,6 & Andrew B. Lassar 1 A hallmark of cells comprising the superficial zone of articular cartilage is their expression of lubricin, encoded by the Prg4 gene, that lubricates the joint and protects against the devel- opment of arthritis. Here, we identify Creb5 as a transcription factor that is specifically expressed in superficial zone articular chondrocytes and is required for TGF-β and EGFR signaling to induce Prg4 expression. Notably, forced expression of Creb5 in chondrocytes 1234567890():,; derived from the deep zone of the articular cartilage confers the competence for TGF-β and EGFR signals to induce Prg4 expression. Chromatin-IP and ATAC-Seq analyses have revealed that Creb5 directly binds to two Prg4 promoter-proximal regulatory elements, that display an open chromatin conformation specifically in superficial zone articular chondrocytes; and which work in combination with a more distal regulatory element to drive induction of Prg4 by TGF-β. Our results indicate that Creb5 is a critical regulator of Prg4/lubricin expression in the articular cartilage. 1 Department of Biological Chemistry and Molecular Pharmacology, Blavatnik Institute at Harvard Medical School, Boston, MA, USA. 2 Department of Medical Oncology and Center for Functional Cancer Epigenetics, Dana-Farber Cancer Institute, Boston, MA, USA. 3 Departments of Medicine, Brigham & Women’s Hospital and Harvard Medical School, Boston, MA, USA. 4 Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA, USA.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Supplementary Figure S4
    18DCIS 18IDC Supplementary FigureS4 22DCIS 22IDC C D B A E (0.77) (0.78) 16DCIS 14DCIS 28DCIS 16IDC 28IDC (0.43) (0.49) 0 ADAMTS12 (p.E1469K) 14IDC ERBB2, LASP1,CDK12( CCNE1 ( NUTM2B SDHC,FCGR2B,PBX1,TPR( CD1D, B4GALT3, BCL9, FLG,NUP21OL,TPM3,TDRD10,RIT1,LMNA,PRCC,NTRK1 0 ADAMTS16 (p.E67K) (0.67) (0.89) (0.54) 0 ARHGEF38 (p.P179Hfs*29) 0 ATG9B (p.P823S) (0.68) (1.0) ARID5B, CCDC6 CCNE1, TSHZ3,CEP89 CREB3L2,TRIM24 BRAF, EGFR (7p11); 0 ABRACL (p.R35H) 0 CATSPER1 (p.P152H) 0 ADAMTS18 (p.Y799C) 19q12 0 CCDC88C (p.X1371_splice) (0) 0 ADRA1A (p.P327L) (10q22.3) 0 CCNF (p.D637N) −4 −2 −4 −2 0 AKAP4 (p.G454A) 0 CDYL (p.Y353Lfs*5) −4 −2 Log2 Ratio Log2 Ratio −4 −2 Log2 Ratio Log2 Ratio 0 2 4 0 2 4 0 ARID2 (p.R1068H) 0 COL27A1 (p.G646E) 0 2 4 0 2 4 2 EDRF1 (p.E521K) 0 ARPP21 (p.P791L) ) 0 DDX11 (p.E78K) 2 GPR101, p.A174V 0 ARPP21 (p.P791T) 0 DMGDH (p.W606C) 5 ANP32B, p.G237S 16IDC (Ploidy:2.01) 16DCIS (Ploidy:2.02) 14IDC (Ploidy:2.01) 14DCIS (Ploidy:2.9) -3 -2 -1 -3 -2 -1 -3 -2 -1 -3 -2 -1 -3 -2 -1 -3 -2 -1 Log Ratio Log Ratio Log Ratio Log Ratio 12DCIS 0 ASPM (p.S222T) Log Ratio Log Ratio 0 FMN2 (p.G941A) 20 1 2 3 2 0 1 2 3 2 ERBB3 (p.D297Y) 2 0 1 2 3 20 1 2 3 0 ATRX (p.L1276I) 20 1 2 3 2 0 1 2 3 0 GALNT18 (p.F92L) 2 MAPK4, p.H147Y 0 GALNTL6 (p.E236K) 5 C11orf1, p.Y53C (10q21.2); 0 ATRX (p.R1401W) PIK3CA, p.H1047R 28IDC (Ploidy:2.0) 28DCIS (Ploidy:2.0) 22IDC (Ploidy:3.7) 22DCIS (Ploidy:4.1) 18IDC (Ploidy:3.9) 18DCIS (Ploidy:2.3) 17q12 0 HCFC1 (p.S2025C) 2 LCMT1 (p.S34A) 0 ATXN7L2 (p.X453_splice) SPEN, p.P677Lfs*13 CBFB 1 2 3 4 5 6 7 8 9 10 11
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • Hox Gene Colinear Expression in the Avian Medulla Oblongata Is Correlated with Pseudorhombomeric Domains
    Developmental Biology 323 (2008) 230–247 Contents lists available at ScienceDirect Developmental Biology journal homepage: www.elsevier.com/developmentalbiology Genomes & Developmental Control Hox gene colinear expression in the avian medulla oblongata is correlated with pseudorhombomeric domains Faustino Marín ⁎, Pilar Aroca, Luis Puelles Department of Human Anatomy and Psychobiology, School of Medicine, University of Murcia, CIBER de Enfermedades Raras (CIBERER), Instituto Universitario de Envejecimiento, E-30100 Murcia, Spain article info abstract Article history: The medulla oblongata (or caudal hindbrain) is not overtly segmented, since it lacks observable Received for publication 30 April 2008 interrhombomeric boundaries. However, quail–chick fate maps showed that it is formed by 5 pseudorhom- Revised 29 July 2008 bomeres (r7–r11) which were empirically found to be delimited consistently at planes crossing through Accepted 15 August 2008 adjacent somites ( Cambronero and Puelles, 2000). We aimed to reexamine the possible segmentation or Available online 27 August 2008 rostrocaudal regionalisation of this brain region attending to molecular criteria. To this end, we studied the expression of Hox genes from groups 3 to 7 correlative to the differentiating nuclei of the medulla oblongata. Keywords: Hindbrain Our results show that these genes are differentially expressed in the mature medulla oblongata, displaying Rhombomeres instances of typical antero-posterior (3′ to 5′) Hox colinearity. The different sensory and motor columns, as Transcription factor well as the reticular formation, appear rostrocaudally regionalised according to spaced steps in their Hox Pattern formation expression pattern. The anterior limits of the respective expression domains largely fit boundaries defined Chick embryo between the experimental pseudorhombomeres. Therefore the medulla oblongata shows a Hox-related Chick brain rostrocaudal molecular regionalisation comparable to that found among rhombomeres, and numerically Myelencephalon consistent with the pseudorhombomere list.
    [Show full text]
  • Transcription Factor Gene Expression Profiling and Analysis of SOX Gene Family Transcription Factors in Human Limbal Epithelial
    Transcription factor gene expression profiling and analysis of SOX gene family transcription factors in human limbal epithelial progenitor cells Der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg zur Erlangung des Doktorgrades Dr. rer. nat. vorgelegt von Dr. med. Johannes Menzel-Severing aus Bonn Als Dissertation genehmigt von der Naturwissenschaftlichen Fakultät der Friedrich-Alexander-Universität Erlangen-Nürnberg Tag der mündlichen Prüfung: 7. Februar 2018 Vorsitzender des Promotionsorgans: Prof. Dr. Georg Kreimer Gutachter: Prof. Dr. Andreas Feigenspan Prof. Dr. Ursula Schlötzer-Schrehardt 1 INDEX 1. ABSTRACTS Page 1.1. Abstract in English 4 1.2. Zusammenfassung auf Deutsch 7 2. INTRODUCTION 2.1. Anatomy and histology of the cornea and the corneal surface 11 2.2. Homeostasis of corneal epithelium and the limbal stem cell paradigm 13 2.3. The limbal stem cell niche 15 2.4. Cell therapeutic strategies in ocular surface disease 17 2.5. Alternative cell sources for transplantation to the corneal surface 18 2.6. Transcription factors in cell differentiation and reprogramming 21 2.7. Transcription factors in limbal epithelial cells 22 2.8. Research question 25 3. MATERIALS AND METHODS 3.1. Human donor corneas 27 3.2. Laser Capture Microdissection (LCM) 28 3.3. RNA amplification and RT2 profiler PCR arrays 29 3.4. Real-time PCR analysis 33 3.5. Immunohistochemistry 34 3.6. Limbal epithelial cell culture 38 3.7. Transcription-factor knockdown/overexpression in vitro 39 3.8. Proliferation assay 40 3.9. Western blot 40 3.10. Statistical analysis 41 2 4. RESULTS 4.1. Quality control of LCM-isolated and amplified RNA 42 4.2.
    [Show full text]
  • TAF15 Is Important for Cellular Proliferation and Regulates the Expression of a Subset of Cell Cycle Genes Through Mirnas
    Oncogene (2013) 32, 4646–4655 & 2013 Macmillan Publishers Limited All rights reserved 0950-9232/13 www.nature.com/onc ORIGINAL ARTICLE TAF15 is important for cellular proliferation and regulates the expression of a subset of cell cycle genes through miRNAs M Ballarino1, L Jobert1,4, D Dembe´le´ 1, P de la Grange2, D Auboeuf3 and L Tora1 TAF15 (formerly TAFII68) is a member of the FET (FUS, EWS, TAF15) family of RNA- and DNA-binding proteins whose genes are frequently translocated in sarcomas. By performing global gene expression profiling, we found that TAF15 knockdown affects the expression of a large subset of genes, of which a significant percentage is involved in cell cycle and cell death. In agreement, TAF15 depletion had a growth-inhibitory effect and resulted in increased apoptosis. Among the TAF15-regulated genes, targets of microRNAs (miRNAs) generated from the onco-miR-17 locus were overrepresented, with CDKN1A/p21 being the top miRNAs- targeted gene. Interestingly, the levels of onco-miR-17 locus coded miRNAs (miR-17-5p and miR-20a) were decreased upon TAF15 depletion and shown to affect the post-transcriptional regulation of TAF15-dependent genes, such as CDKN1A/p21. Thus, our results demonstrate that TAF15 is required to regulate gene expression of cell cycle regulatory genes post-transcriptionally through a pathway involving miRNAs. The findings that high TAF15 levels are needed for rapid cellular proliferation and that endogenous TAF15 levels decrease during differentiation strongly suggest that TAF15 is a key regulator of maintaining a highly proliferative rate of cellular homeostasis. Oncogene (2013) 32, 4646–4655; doi:10.1038/onc.2012.490; published online 5 November 2012 Keywords: FUS/EWS/TAF15 (FET) proteins; miRNAs; transcription; proliferation; neuronal differentiation; neuroblastoma INTRODUCTION possible role of TAF15 in additional steps of RNA metabolism.
    [Show full text]
  • Reduced H3k27me3 Leads to Abnormal Hox Gene Expression In
    Yu et al. Epigenetics & Chromatin (2019) 12:76 https://doi.org/10.1186/s13072-019-0318-1 Epigenetics & Chromatin RESEARCH Open Access Reduced H3K27me3 leads to abnormal Hox gene expression in neural tube defects Juan Yu1†, Lei Wang2†, Pei Pei2†, Xue Li4, Jianxin Wu3, Zhiyong Qiu2, Juan Zhang1, Ruifang Ao1, Shan Wang2*, Ting Zhang2* and Jun Xie1* Abstract Background: Neural tube defects (NTDs) are severe, common birth defects that result from failure of normal neural tube closure during early embryogenesis. Accumulating strong evidence indicates that genetic factors contribute to NTDs etiology, among them, HOX genes play a key role in neural tube closure. Although abnormal HOX gene expres- sion can lead to NTDs, the underlying pathological mechanisms have not fully been understood. Method: We detected that H3K27me3 and expression of the Hox genes in a retinoic acid (RA) induced mouse NTDs model on E8.5, E9.5 and E10.5 using RNA-sequencing and chromatin immunoprecipitation sequencing assays. Furthermore, we quantifed 10 Hox genes using NanoString nCounter in brain tissue of fetuses with 39 NTDs patients including anencephaly, spina bifda, hydrocephaly and encephalocele. Results: Here, our results showed diferential expression in 26 genes with a > 20-fold change in the level of expres- sion, including 10 upregulated Hox genes. RT-qPCR revealed that these 10 Hox genes were all upregulated in RA- induced mouse NTDs as well as RA-treated embryonic stem cells (ESCs). Using ChIP-seq assays, we demonstrate that a decrease in H3K27me3 level upregulates the expression of Hox cluster A–D in RA-induced mouse NTDs model on E10.5.
    [Show full text]