Alveolar Soft-Part Sarcoma of the Prostate: a Case Report and Review of the Literature

Int J Clin Exp Pathol 2018;11(10):5126-5132 www.ijcep.com /ISSN:1936-2625/IJCEP0080600

Case Report Alveolar soft-part sarcoma of the prostate: a case report and review of the literature

Jian-Rong Wang1, Qiu Rao2, Hui Li1, Yao-Hui Wang1, Yi Sun1, Hai-Peng Si1, Long-Shu Shen1, Chun-Yang Liu1, Yi-Fen Zhang1

1Department of Pathology, Affiliated Hospital of Nanjing University of Traditional Chinese Medicine, Nanjing 210029, Jiangsu Province, China; 2Department of Pathology, Nanjing Jinling Hospital, School of Medicine, Nanjing University, Nanjing 210002, Jiangsu Province, China Received May 30, 2018; Accepted September 7, 2018; Epub October 1, 2018; Published October 15, 2018

Abstract: Alveolar soft-part sarcoma (ASPS) is a rare malignant soft tissue tumor of uncertain cellular origin. We reported the case of a 21-year-old man with ASPS presenting itself as a markedly vascular tumor of the prostate. Immunohistochemistry showed positive nuclear staining for TFE3, positive cytoplasm staining for MyoD1 and neuron-specific enolase, and negative for S100, CK, synaptophysin, chromogranin A, myogenin and PSA. A dual-color, break-apart fluorescence in situ hybridization (FISH) assay identified the presence of a TFE3 gene fusion in the tumor cells. RT-PCR was performed to confirm the ASPSCR1 (ASPL)/TFE3 fusion transcript product in the tumor tissue. The patient suffered bone metastases 8 months after surgery and died of cachexia 14 months later. ASPS of the prostate should be discussed in terms of differential diagnosis from clinicopathological characteristics, im- munophenotypes, and molecular genetic features.

Keywords: Alveolar soft-part sarcoma, prostate, FISH

Introduction and magnetic resonance imaging revealed a large, multilobulated, partially ill-defined, and Alveolar soft-part sarcoma (ASPS) was first heterogeneous mass with a size of 8.4 cm × 7.4 described in 1952 [1]. Primary ASPS of the cm × 6.5 cm in the presacral space with multi- prostate is very rare. Because it has a close ple little cystic changes in the prostate, infiltrat- clinical and histologic resemblance to other ing to the trigon of the bladder. A moderate tumors such as paragangliomas, rhabdomyo- amount of peritoneal effusion was also found. sarcomas and granular cell tumors, there is a The cancer antigen 125 level was 209.15 U/ danger of misdiagnosis and therefore inade- mL. quate or delayed treatment. In order to raise awareness of this disease, we present a case Subsequently, the patient underwent an ultra- and perform a detailed literature review. sound-guided transrectal prostate biopsy followed by a transurethral cystoscope examina- Case report tion. The cystoscope found in the bladder neck a neoplasm 2 cm in diameter which was spheri- A 21-year-old man was admitted to our hospital cal, pedicle, and the surface of which was con- due to frequent micturition, urinary urgency gested and necrotic. Each side wall of the blad- and dysuria. He suffered from abdominal pain der was congested and few other neoplasms for 2 months and had recently had a fever. were observed. A bladder neck biopsy was also Hypertension and diabetes were not present in performed. the patient, and he had no family history of urinary cancer. An enlarged prostate gland, which Many pseudo-alveolar or nesting patterns were was tender and hard, was observed in a digital found by microscopy in the prostate and the rectal examination. Prostate-specific antigen bladder neck. Most of the vascular channels levels were normal. Computed tomography (CT) were enclosed by thin connective tissue septa. Alveolar soft-part sarcoma of the prostate

The patient underwent a radical prostatectomy, a radical bladder cystectomy and a bilateral urinary diversion. A parenchymatous prostatic neoplasm with a sallow gray-red section and delicate texture was found by gross examination. The size of the tumor was about 8 cm × 7 cm × 6 cm. Part of the tumor invaded the bladder neck. Figure 1. Histology of alveolar soft-part sarcoma. A. An area showing an organ-like pattern in the prostate (H&E, 200 ×). B. Tumor cells in the pros- Microscopic examination rev- tate with abundant eosinophilic cytoplasms, which are somewhat granular. Mitotic figures are uncommon (H&E, 400 ×). ealed that the polygonal tumor cells with eosinophilic cytoplasms were delineated by thin fibrovascular separation which separated the tumor cells into an organoid or nest- like pattern. The tumor cells were large and polyhedral with small and rounded nuclei (Figure 1). Immunohistoche- mistry showed positive nuclear staining for TFE3, positive cytoplasm staining for MyoD1 and neuron-specific enolase (Figure 2), negative for S100, epithelial membrane antigen, CK, synaptophysin, chromogranin A, Myogenin, HMB-45, and PSA. Diastase-resistant PAS staining was negative in the tumor cells in this case.

A fluorescence in situ hybridization (FISH) assay identified the presence of a TFE3 gene Figure 2. A. Tumor cells show diffuse nuclear positivity. B. Diffuse cytoplas- fusion in the paraffin-embed- mic staining with NSE. C. Cytoplasmic staining with MYOD1. D. Negative ded tissues. The transcription staining for S100. factor gene (TFE3) of the X chromosome fused with chro- The tumor cells had abundant eosinophilic mosome 17, and the aberrant fusion protein cytoplasms and large vesicular nuclei contain- ASPL-TFE3 was largely distributed in the tumor ing prominent nucleoli. The tumor cells had cells (Figure 3). minor dysplasia with uncommon mitotic figures. Immunohistochemical staining revealed The probes were purchased from Empire that the tumor cells were positive for neuron- Genomics Company, including the ASPL gene specific enolase, weak staining for chromo- labeled with green fluorescence (Rp11-655F9, granin A, but negative for S100, epithelial mem- Rp11-765014) and the TFE3 gene labeled brane antigen, cytokeratin (CK), synaptophysin, with red fluorescence (Rp11-416B14, Rp11- inhibin-A, smooth muscle actin (SMA), desmin, 344N17). A TFE3 FISH assay of the tumor cells P504s, and PSA, which is suggestive of a showed 1 set of fusion signals and 1 set of paraganglioma. green and red split signals observed in approxi-

5127 Int J Clin Exp Pathol 2018;11(10):5126-5132 Alveolar soft-part sarcoma of the prostate

Discussion

In 1952, Christopherson reported 12 cases of malignant soft tumor with an acinar-like or organ-like pattern separated by fibrous blood vessels, called alveolar soft tissue sarcoma [1]. ASPS was reported as a rare, slow-growing, indo- lent soft tissue sarcoma with Figure 3. The fusion pattern observed by FISH is an unbalanced X; 17 trans- early metastasis and relapse. location with the gain of a normal X chromosome (red and green fusion fluorescence). A TFE3 fluorescence in situ hybridization assay showed 1 set of Generally, ASPS accounts for fusion signals and 1 set of green and red split signals, indicating evidence approximately 0.5-1% of all of a TFE3 gene rearrangement. soft tissue sarcomas and affects mainly adolescents mately 20% of the tumorous nuclei, indicating and young adults [2], with female predilection. the presence of a TFE3 gene rearrangement. It largely affects the deep soft tissue. A few cases may occur in the female genital tract, To detect ASPSCR1/TFE3 fusion, a reverse- breasts, shoulder blades, the tympanic cavity, transcription polymerase chain reaction (RT- nasal cavity [3-6] and other parts. This case PCR) was performed. Total RNA was extra- was a rare site of ASPS, occurring in the pros- cted from the paraffin-embedded tumor tis- tate and involving the bladder. Few such cases sues. The primer sequences used are as fol- have been reported in the English literature. lows: ASPL-E7-F3: TCCAAGCCAAAGAAGTCCAA; TFE3-E6-R2: GCCACGCCTTGACTACTGTAC. DNA With a slow, insidious growth, ASPS is often dis- sequencing of PCR products was performed covered by accident. The tumor’s size can using a Qiagen 3000 BioRobot (Qiagen, sometimes be up to 6~10 cm in diameter. ASPS German). Written, informed consent was obtai- relapses easily (the local recurrence rate can ned from the patient. A sequence analysis be up to 20%) [7]. As a rule, ASPS is richly vas- showed that there was an unbalanced translo- cular. Widely hematogenous route transfer cation of Chromosome 17 and the X chromo- occurs mainly in areas such as the lungs, some (Figure 4), and that the ASPL-TFE3 fusion bones, brain, and skin [2]. With a propensity for product was 146bp long (Structurally, exon 7 of early metastatic spread, ASPS occurring out- the ASPL gene is fused with the TFE3 gene at side of the head and neck frequently presents exon 6). The patient was therefore finally diag- itself as a large mass. nosed as having ASPS. Gross examination shows that ASPS is gener- Two months after the surgery, followed by ally nodular. The tumor may have a false cap- informed consent, the patient started a soft sule and poor border, ranging in size from 1 to tissue sarcoma chemotherapy protocol of epi- 24 cm. ASPS tends to be gray brown in color rubicin 50 mg iv with ifosfamide 1000 mg iv and have a soft, flesh texture. Larger lesions (day 1) and cisplatin 40 mg iv (day 2). The are often accompanied by bleeding necrosis patient received 4 cycles of chemotherapy for 4 and cystic degeneration. Microscopically, dif- months. ferent parts of the tumor morphology are slight- ly different. Through low-power observation, Unfortunately, 2 months later, 8 months after the most characteristic histological appear- surgery, an abdominal CT scan showed that ance of ASPS is an organoid or nesting pattern. there were soft tissue shadows in the prostate Cell nests tend to be uniform but may vary in surgery areas, with multiple soft tissue nodules size and shape. Tumor cells in the center of in the abdominal omentum and mesentery. nests lack adhesion, and necrosis may form a There was left ischial bone destruction, which false alveolar structure. In some cases, espe- indicated a strong possibility of metastases. cially in infants and children, the tumor cells The patient died of obvious cachexia 22 months may appear to have a more diffuse growing pat- after the surgery. tern instead of an obvious nest-like structure.

5128 Int J Clin Exp Pathol 2018;11(10):5126-5132 Alveolar soft-part sarcoma of the prostate

Figure 4. RT-PCR and gene sequencing findings: identification of the ASPSCR1 (ASPL)/TFE3 fusion transcript product in the tumor tissue.

The tumor cells are large and polygonal or Although strong TFE3 immunoreactivity is round with small differences in size and shape, always essentially presented in ASPS, a few containing one or two vesicular nuclei with cases may be negative. Martignoni et al. [11] prominent nucleoli. Nuclear atypia may exist found two cases (from a total of 24 cases) of but are uncommon. Mitotic figures are not eas- ASPS without TFE3 expression, but the ASPL- ily seen. TFE3 gene fusion was detected by FISH. Therefore, for atypical cases, FISH detection of ASPS tumor cells have abundant eosinophilic TFE3 gene rearrangement is now the preferred granular cytoplasms, which are partially trans- method [12, 13]. parent or vacuolar. The cells frequently contain rhomboid or rod-shaped intracytoplasmic inclu- Recent genetic studies reveal that ASPS exhib- sions which may be faint in HE staining but can its a conserved aberration in the form of be better observed with PAS staining after dia- an unbalanced translocation der(17)t(X;17) stase digestion. The number of inclusions in (p11;q25) [14]. This translocation fuses the different cases is quite different. In some N-terminal region of the ASPL gene at 17q25 to cases, these inclusions are visible within most the C-terminal region of transcription factor tumor cells, but in others they may also be rare TFE3, which is located at Xp11 [15]. or even absent. Currently, the RT-PCR assay is considered the TFE3 staining is extremely helpful in confirming most powerful tool available for identifying the diagnosis of ASPS. The TFE3 immunoglobu- ASPS. Two variants of ASPSCR1/TFE3 gene lin heavy chain gene is located at the sub-mu- fusion have been observed in the expression of E3 enhanced sequence, the translocation of two distinct fusion transcripts, ASPL-TFE3 type which can lead to abnormal expression of TFE3 1 and type 2 [15-17]. The presence of two X protein. chromosomes in females enhances the chanc- es of translocation on this chromosome, there- ASPS is usually negative for cytokeratins, epi- by explaining the female predilection [18]. thelial membrane antigen, synaptophysin, chromogranin and HMB-45.NSE, with S100 and Differential diagnosis desmin being occasionally positive. A reliable diagnosis of ASPS can be performed The origin of ASPS still remains obscure. Curr- according to the clinical features, histological ently, more evidence supports a myogenic ori- appearances, and genetics. It should be differ- gin. Ultrastructure observation shows that in entiated from the following diseases using dif- ASPS, fine granular and crystal rods of diagnos- ferential diagnosis. tic significance can be seen in the cytoplasm, and the crystals’ structure is similar to actin [8]. Paraganglioma Immunohistochemical studies have shown that actin, desmin, and other related markers have It most typically occurs in the elderly, with no different degrees of expression in ASPS [9]. gender predilection. Most paragangliomas are Molecular biological studies suggest that mus- single and sporadic, though a few cases with cle regulatory proteins, such as a-actin mRNA, family history often present themselves as mul- can be expressed in ASPS [10]. tiple nodules. It often occurs in the head and

5129 Int J Clin Exp Pathol 2018;11(10):5126-5132 Alveolar soft-part sarcoma of the prostate neck, mediastinal and retroperitoneal, which real lumen of glands - the acini lumen edge of are chemoreceptor sites. metastatic adenocarcinoma is neat. CEA, EMA, and CK stain positive, with the absence of a Histologically, the tumor cells are separated by D-PAS stain in cytoplasmic crystalline particles. thin-wall sinus blood vessels forming an organ- The Xp11.2 translocation associated with RCC like pattern. Tumor cell nests are smaller and harbors a balanced t(X;17)(p11.2;q25) translo- uniform; the surrounding cells are flat susten- cation in most cases, which can contrasted to tacular cells. The tumor cells are smaller with that of ASPS [20, 21]. eosinophilic cytoplasms and smaller particles in contrast to ASPS. Immunohistochemistry The treatment of choice for ASPS is generally shows a layer of sustentacular cells showing surgical excision with sufficient margins sup- S-100 positivity which embrace the nest-like plemented by adjuvant chemotherapy and tumor cells showing NSE, Syn and CgA positivi- radiotherapy. However, the effectiveness of ty, while desmin, MyoD1, and MSA stain nega- adjuvant chemotherapy and radiotherapy is tive. Electron microscopy shows that the tumor inconclusive. Local recurrence and metastasis cells have neuroendocrine granules. of the tumor tends to be resistant to radiation and chemotherapy. Therefore, patients need Alveolar rhabdomyosarcoma long-term, postoperative, regular follow-ups. Recently, new molecular target therapies under Tumor cells show a nest-like or alveolar pattern, study [22, 23] may change the natural course of with fibrovascular stroma between the alveoli. the disease as well as possible approaches to There is a lack of an antral vascular network. primary disease in the near future. The tumor is composed of round, ovular, small polygonal primitive mesenchymal cells and the ASPS can demonstrate early hematogenous scattered eosinophilic cytoplasms of immature metastases. Hence, early detection of the pri- rhabdomyoblasts. The tumor cells strongly mary tumor and extensive tumor resection is express desmin, myogenin, MyoD1, and MSA. the key point to the treatment. The prognostic parameters of ASPS include age at the time of Granular cell tumor (GCT) diagnosis, tumor size, AJCC stage and the presence of metastases at the time of diagnosis [4, GCT is more common in the elderly, generally 24]. Cases with recurrence, metastasis and located in the head and neck, limbs, trunk of incomplete removal have a poor prognosis. the skin and subcutaneous tissue, and mea- There is a significant correlation between tumor sures less than 3 cm in size. The microscopic size and the presence of metastases [24]. In picture of GCT shows that the tumor cells are Koichi’s study, 12 of 15 patients (80%) with arranged in flakes, clusters or nests, with the tumors measuring > 5 cm in diameter demon- lack of a stroma sinus. Tumor cells have small strated metastatic disease (AJCC stage IV) (P = and round nuclei located in their centers. The 0.001). In this report, the 21-year-old male with cytoplasms are abundant, eosinophilic and tumor size larger than 7 cm was found with granular. Prominent nuclear immunoreactivity bone metastases 8 months after the complete for TFE3 can also be seen in some granular cell tumor excision. tumors [19]. However, the immunohistochemical staining of S-100 and NSE is positive, but Conclusion this is thought to come from Schwann cells. SMA, desmin and keratins stain negative. In conclusion, we report a case of ASPS arising from the prostate, which is an extremely rare Metastatic adenocarcinoma containing rich location. TFE3 immunoreactivity, the immuno- blood vessels histochemical panel, FISH and RT-PCR for the ASPL-TFE3 fusion transcript characteristic of ASPS, having an alveolar structure with abun- the t(X;17) are very useful for the differential dant cytoplasms, epithelioid, is often misdiag- diagnosis of ASPS. nosed as liver, kidney and adrenal metastasis adenocarcinoma. However, the intermediate Disclosure of conflict of interest cells in the nests of ASPS are looser and the acini lumen margins are irregular, unlike the None.

5130 Int J Clin Exp Pathol 2018;11(10):5126-5132 Alveolar soft-part sarcoma of the prostate

Address correspondence to: Dr. Yi-Fen Zhang, apart FISH assay in a renal tumor consultation Department of Pathology, Affiliated Hospital of service. Am J Surg Pathol 2013; 37: 1150- Nanjing University of Traditional Chinese Medicine, 1163. Nanjing 210029, Jiangsu Province, China. E-mail: [13] Rao Q, Williamson SR, Zhang S, Eble JN, Gri- [email protected] gnon DJ, Wang M, Zhou XJ, Huang W, Tan PH, Maclennan GT, Cheng L. TFE3 break-apart References FISH has a higher sensitivity for Xp11.2 translocation-associated renal cell carcinoma com- [1] Christopherson WM, Foote FW Jr, Stewart FW. pared with TFE3 or cathepsin K immunohisto- Alveolar soft-part sarcomas; structurally char- chemical staining alone: expanding the acteristic tumors of uncertain histogenesis. morphologic spectrum. Am J Surg Pathol 2013; Cancer 1952; 5: 100-111. 37: 804-815. [2] Weiss SW GJ. Enzinger and Weiss’s soft tissue [14] Mitton B, Federman N. Alveolar soft part sarco- tumors. 5th edition. Philadelphia, PA; 2008. mas: molecular pathogenesis and implications pp. 1182-91. for novel targeted therapies. Sarcoma 2012; [3] Zhou M, Zhao G, Zhao F, Jing-Yin LI. Alveolar 2012: 428789. soft part sarcoma:a clinicopathological analy- [15] Ladanyi M, Lui MY, Antonescu CR, Krause- sis of 21 cases. Chinese Journal of Clinical and Boehm A, Meindl A, Argani P, Healey JH, Ueda Experimental Pathology 2010; 26: 63-66. T, Yoshikawa H, Meloni-Ehrig A, Sorensen PH, [4] Ordonez NG, Ladanyi M. Alveolar soft part sar- Mertens F, Mandahl N, van den Berghe H, Sci- coma. Fletcher CDM, Bridge JA, Hogendoorn P, ot R, Dal Cin P, Bridge J. The der(17)t(X;17) Mertens F, editors. WHO classification of tu- (p11;q25) of human alveolar soft part sarco- mours of soft tissue and bone. 4th edition. ma fuses the TFE3 transcription factor gene to Lyon, France: IARC; 2013. pp. 218-20. ASPL, a novel gene at 17q25. Oncogene 2001; [5] Zhang LL, Tang Q, Wang Z, Zhang XS. Alveolar 20: 48-57. soft part sarcoma of the uterine corpus with [16] Rosai J. Rosai And Ackerman’s Surgical Pathol- pelvic lymph node metastasis: case report and ogy. 10th edition. Mosby/Elsevier; 2011. pp. literature review. Int J Clin Exp Pathol 2012; 5: 2182-2183. 715-719. [17] Daigeler A, Kuhnen C, Hauser J, Goertz O, [6] Yavuz A, Goya C, Bora A, Beyazal M. Primary Tilkorn D, Steinstraesser L, Steinau HU, alveolar soft part sarcoma of the scapula. Lehnhardt M. Alveolar soft part sarcoma: clini- Case Rep Oncol 2013; 6: 356-361. copathological findings in a series of 11 cases. [7] Azizi AA, Haberler C, Czech T, Gupper A, Prayer World J Surg Oncol 2008; 6: 71. D, Breitschopf H, Acker T, Slavc I. Vascular-en- [18] Folpe AL, Deyrup AT. Alveolar soft-part sarco- dothelial-growth-factor (VEGF) expression and ma: a review and update. J Clin Pathol 2006; possible response to angiogenesis inhibitor 59: 1127-1132. bevacizumab in metastatic alveolar soft part [19] Tsuji K, Ishikawa Y, Imamura T. Technique for sarcoma. Lancet Oncol 2006; 7: 521-523. differentiating alveolar soft part sarcoma from [8] Van RS, Van CF, Peterse JL, Kroon BB. Alveolar other tumors in paraffin-embedded tissue: soft part sarcoma. a report of 15 cases. Eur J comparison of immunohistochemistry for TFE3 Cancer 2002; 38: 1324-1328. and CD147 and of reverse transcription poly- [9] Lieberman PH, Brennan MF, Kimmel M, Er- merase chain reaction for ASPSCR1-TFE3 fu- landson RA, Garin-Chesa P, Flehinger BY. Alve- sion transcript. Hum Pathol 2011; 43: 356- olar soft-part sarcoma. A clinico-pathologic 363. study of half a century. Cancer 1989; 63: 1-13. [20] Argani P, Antonescu CR, Illei PB, Lui MY, Tim- [10] Nakano H, Tateishi A, Imamura T, Miki H, Ohno mons CF, Newbury R, Reuter VE, Garvin AJ, T, Moue T, Sekiguchi M, Unno K, Abe S, Matsu- Perez-Atayde AR, Fletcher JA, Beckwith JB, shita T, Katoh Y, Itoh T. RT-PCR suggests hu- Bridge JA, Ladanyi M. Primary renal neoplasms man skeletal muscle origin of alveolar soft- with the ASPL-TFE3 gene fusion of alveolar soft part sarcoma. Oncology 2000; 58: 319-323. part sarcoma: a distinctive tumor entity previ- [11] Martignoni G, Gobbo S, Camparo P, Brunelli M, ously included among renal cell carcinomas of Munari E, Segala D, Pea M, Bonetti F, Illei PB, children and adolescents. Am J Pathol 2001; Netto GJ, Ladanyi M, Chilosi M, Argani P. Dif- 159: 179-192. ferential expression of cathepsin K in neo- [21] Hodge JC, Pearce KE, Wang X, Wiktor AE, plasms harboring TFE3 gene fusions. Mod Oliveira AM, Greipp PT. Molecular cytogenetic Pathol 2011; 24: 1313-1319. analysis for TFE3 rearrangement in Xp11.2 re- [12] Green WM, Yonescu R, Morsberger L, Morris K, nal cell carcinoma and alveolar soft part sar- Netto GJ, Epstein JI, Illei PB, Allaf M, Ladanyi M, coma: validation and clinical experience with Griffin CA, Argani P. Utilization of a TFE3 break- 75 cases. Mod Pathol 2014; 27: 113-127.

5131 Int J Clin Exp Pathol 2018;11(10):5126-5132 Alveolar soft-part sarcoma of the prostate

[22] Covell DG, Wallqvist A, Kenney S, Vistica DT. [24] Ogura K, Beppu Y, Chuman H, Yoshida A, Ya- Bioinformatic analysis of patient-derived ASPS mamoto N, Sumi M, Kawano H, Kawai A. Alveo- gene expressions and ASPL-TFE3 fusion tran- lar soft part sarcoma: a single-center 26-pa- script levels identify potential therapeutic tar- tient case series and review of the literature. gets. PLoS One 2012; 7: e48023. Sarcoma 2012; 2012: 907179. [23] Kummar S, Allen D, Monks A, Polley EC, Hose CD, Ivy SP, Turkbey IB, Lawrence S, Kinders RJ, Choyke P, Simon R, Steinberg SM, Doroshow JH, Helman L. Cediranib for metastatic alveolar soft part sarcoma. J Clin Oncol 2013; 31: 2296-2302.

5132 Int J Clin Exp Pathol 2018;11(10):5126-5132