In Vivo Analysis of the LIN-2/7/10 Complex in Spatial Regulation of LET

In vivo analysis of the LIN-2/7/10 complex in spatial regulation of

LET-23 EGFR signalling in C. elegans

Kimberley D. Gauthier

Department of Anatomy and Cell Biology

Faculty of Medicine

McGill University

Montreal, Quebec, Canada

December 2019

A thesis submitted to McGill University in partial fulfillment of the requirements for the degree

of Doctor of Philosophy

Table of Contents ...... i Abstract ...... vi Résumé ...... viii Acknowledgements ...... x Preface ...... xii Contributions of Authors ...... xiii Nomenclature ...... xiv List of Figures ...... xvi List of Tables ...... xviii List of Abbreviations ...... xix

Chapter 1: Introduction and Literature Review...... 1 1.1 Spatial organization of signalling networks ...... 2 1.1.1 Epithelial cell signalling and regulation ...... 3 1.1.1.1 Establishment and maintenance of epithelial cell polarity ...... 6 1.1.1.2 Polarized trafficking in epithelial cells...... 7 1.2 Epidermal Growth Factor Receptor signalling...... 9 1.2.1 The Ras/MAPK signalling pathway ...... 13 1.2.2 Importance of EGFR in human health ...... 13 1.2.3 Spatial regulation of EGFR signalling ...... 14 1.3 Caenorhabditis elegans vulval cell fate induction as a model for spatial organization of signalling pathways ...... 18 1.3.1 C. elegans as a model organism ...... 18 1.3.2 LET-23, the sole EGFR in C. elegans ...... 21 1.3.3 C. elegans vulval development as a model for spatiotemporal EGFR signalling regulation ...... 21 1.3.4 Applications of VPC induction model for EGFR-related cancers ...... 26 1.4 LIN-2 (CASK), LIN-7 (Lin7), and LIN-10 (APBA) are conserved regulators of subcellular organization ...... 27 1.4.1 The protein domain structure of LIN-2, LIN-7, and LIN-10 ...... 29

1.4.1.1 The PDZ domains of LIN-2, LIN-7, and LIN-10 ...... 30 1.4.1.2 LIN-2 and LIN-7 both have L27 domains ...... 31 1.4.1.3 LIN-2 and CASK are MAGUK proteins...... 32 1.4.1.4 LIN-10 and APBA1 also share CID and PTB domains ...... 32 1.4.2 Localization of LIN-2 CASK, LIN-7 Lin7, and LIN-10 APBA1-3...... 33 1.4.3 Function of LIN-2, LIN-7, and LIN-10...... 36 1.4.3.1 Lin7 maintains polarized epithelial membrane composition ...... 39 1.4.3.1.1 Lin7 and human EGFRs ...... 40 1.4.3.2 CASK regulates synaptic plasticity and basolateral membrane organization ...... 41 1.4.3.2.1 Transcriptional regulation by CASK...... 42 1.4.3.3 LIN-10 and APBA1-3 regulate intracellular trafficking ...... 43 1.4.3.3.1 C. elegans LIN-10 regulates glutamate receptor trafficking in neurons ...... 44 1.4.3.3.2 Mammalian APBA regulates APP trafficking and processing ...... 44 1.4.3.3.3 LIN-10 homologues, hypoxia, and transcriptional regulation ...... 46 1.4.3.3.4 APBA in non-neuronal cells ...... 47 1.4.3.3.5 Regulation of LIN-10 APBA ...... 48 1.5. Spatial regulation by small GTPases ...... 51 1.5.1 Membrane trafficking regulation of C. elegans vulval cell fate induction ...... 52 1.5.2 Arf GTPases and their regulators mediate several steps of cellular organization ...... 55 1.5.2.1 Class I and II Arf GTPases regulate Golgi trafficking ...... 57 1.5.2.2 Class III Arf6 GTPase regulates recycling and the cytoskeleton ...... 57 1.5.2.3 Arf GAPs regulate diverse cellular dynamics ...... 58 1.5.2.3.1 Classification and protein structure of Arf GAPs ...... 59 1.5.2.3.2 Arf GAPs regulate trafficking and actin remodelling ...... 63 1.5.2.3.2.1 Arf GAPs in trafficking and recycling pathways ...... 63 1.5.2.3.2.2 Arf GAPs regulate adhesion complexes and actin remodelling ...... 65 1.6. Rationale and objectives...... 68

Chapter 2: Materials and Methods ...... 70 2.1 Strains and maintenance ...... 71 2.2 Genomic DNA isolation for genotyping ...... 71

2.3 Molecular cloning ...... 71 2.4 Generating endogenously-tagged transgenic strains by CRISPR/Cas9 ...... 72 2.5 Generation of extrachromosomal array lines ...... 73 2.6 LIN-10 subdomain identification and sequence identity ...... 74 2.7 Microscopy and Image Analysis ...... 74 2.7.1 LIN-2/7/10 localization analysis ...... 74 2.7.2 LIN-2/7/10 fluorescence intensity analysis ...... 75 2.7.3 Analyzing LET-23 EGFR polarized distribution ...... 75 2.7.4 Colocalization analysis ...... 75 2.8 Analyzing VPC cell fate induction...... 76 2.9 Correlation analysis for extrachromosomal array expression and VPC induction ...... 77 2.10 RNAi experiments ...... 78 2.11 Co-immunoprecipitation ...... 78 2.12 SDS-PAGE and western blot ...... 79 2.13 Statistical analysis ...... 80

Chapter 3: In vivo analysis of the LIN-2/7/10 complex ...... 86 3.1 Preface ...... 87 3.2 Localization and expression of LIN-2/7/10 in the C. elegans VPCs ...... 87 3.3 Expression of LIN-2, LIN-7, and LET-23 EGFR, but not LIN-10, change throughout VPC induction ...... 94 3.4 LIN-2 and LIN-7 colocalize strongly with each other, and occasionally with LIN-10 at cytoplasmic foci ...... 100 3.5 LET-23 EGFR colocalizes with LIN-7 at the plasma membrane and with LIN-10 at cytoplasmic foci ...... 103 3.6 Colocalization of LIN-2/7/10 and LET-23 EGFR in other tissues ...... 107 3.7 LIN-2 interacts strongly with LIN-7 and minimally with LIN-10 in C. elegans ...... 110 3.8 LIN-10 recruits LIN-2 and LIN-7 to subset of cytosolic punctae ...... 113 3.9 Summary ...... 119

Chapter 4: Complex-independent regulation of LET-23 EGFR signalling by LIN-10 and LIN-7 ...... 120

iii

4.1 Preface ...... 121 4.2 LIN-10 and LIN-7 can promote VPC induction in a complex-independent manner ...... 121 4.3 LIN-10 and LIN-7 overexpression rescue let-23(sy1), but not signalling-defective let- 23(sy97) ...... 125 4.4 LIN-10 independently promotes basolateral LET-23 EGFR localization ...... 128 4.5 LIN-10 C-terminal domains mediate punctate localization ...... 131 4.6 C-terminal PDZ domains mediate complex-independent function of LIN-10, whereas PTB domain required for overall LIN-10 function ...... 135 4.7 LIN-10-positive punctae may represent Golgi mini-stacks or recycling endosomes ...... 137 4.8 ARF-1.2 colocalizes with LIN-10, but is not required for LIN-10 OE rescue of lin-2 ..... 139 4.9 Summary ...... 143

Chapter 5: Preliminary analysis of CNT-1, an Arf6 GAP and novel regulator of VPC induction ...... 144 5.1 Preface ...... 145 5.2 CNT-1, W09D10.1, K02B12.7, and GIT-1 are required for the agef-1(vh4) dead egg phenotype ...... 146 5.3 CNT-2 and CED-12 weakly suppress the Muv phenotype of agef-1; lin-2 mutants ...... 150 5.4 CNT-1 negatively regulates LET-23 EGFR signalling ...... 152 5.5 CNT-1 negatively regulates polarized LET-23 EGFR localization ...... 155 5.6 RAB-35 also suppresses VPC cell fate induction ...... 157 5.7 CNT-1 regulates LET-23 EGFR signalling in an ARF-6-independent manner ...... 157 5.8 CNT-1 likely works downstream or in parallel to ARF-1.2 GTPase ...... 159 5.9 Knocking down cnt-2 suppresses VPC induction in cnt-1; lin-2 ...... 161 5.10 Summary ...... 163

Chapter 6: Discussion ...... 164 6.1. Summary of thesis ...... 165 6.2. Regulation of LIN-7 and LIN-2 ...... 166 6.2.1 Complex-independent function of LIN-7 ...... 168 6.2.2 LIN-7 and VPC cell polarity ...... 171 6.2.3 Complex-dependency of LIN-2 ...... 172

6.3 Novel, independent function of LIN-10 in regulating LET-23 EGFR signalling ...... 173 6.3.1 LIN-10 might interact with LET-23 EGFR phosphotyrosines, as in APBA3 ...... 177 6.3.2 LIN-10 autoregulation might explain its overexpression phenotype ...... 178 6.4 A new perspective on the LIN-2/7/10 complex ...... 179 6.4.1 The combined activity of LIN-2, -7, and -10 optimize fidelity in developmental programming ...... 181 6.4.2 Implications for mammalian CASK, Lin7, and APBA1 ...... 181 6.5 A GAP in our model...... 182 6.5.1 CNT-1 might regulate LET-23 EGFR recycling directly, or restrict LET-23 EGFR mobility through integrin recycling...... 183 6.5.2 CNT-2 promotes LET-23 EGFR-mediated vulva induction ...... 186 6.6 Original contributions to knowledge ...... 187

References ...... 188

Abstract

Spatial organization of signalling network components is essential to ensure appropriate activation of signalling pathways. Polarized sorting of Epidermal Growth Factor Receptor

(EGFR) is a common means of regulating signalling activation, and dysregulation can lead to aberrant signalling and disease. Induction of the vulval cell fate in the hermaphroditic nematode

Caenorhabditis elegans has served as a convenient model to study spatial regulation of EGFR signalling. Basolateral localization of the sole EGFR homologue, LET-23, is necessary for activation of the canonical Ras/ERK signalling cascade in the vulva precursor cells (VPCs).

Signalling activation induces the primary vulval cell fate and is the first step towards vulval development. My primary research objective is to study regulation of polarized LET-23 EGFR localization and signalling in C. elegans.

Basolateral localization of EGFR is mediated through an interaction with an evolutionarily conserved complex composed of LIN-2 (CASK in mammals), LIN-7 (Lin7), and

LIN-10 (APBA1) (the LIN-2/7/10 complex). The complex has been defined biochemically; however, where the complex forms and how it regulates polarized EGFR localization remains unknown. I found that fluorescently-tagged LIN-2 and LIN-7 are cytosolic, occasionally punctate, and colocalized in the VPCs; however, only LIN-7 colocalizes with LET-23 EGFR at basolateral membranes. Both LIN-2 and LIN-7 expression is restricted to induced cell fate lineages. LIN-10, which localizes constitutively to cytoplasmic punctae, recruits LIN-2 and LIN-

7 to a subset of punctae likely representing Golgi ministacks and recycling endosomes.

Unexpectedly, I also found that LIN-10 and LIN-7 overexpression can promote VPC induction in the absence of their complex components, and LIN-10 overexpression can independently recover basolateral EGFR localization in a lin-2 mutant. The C-terminal PDZ domains of LIN-10

vi specifically mediate the effect of overexpression, whereas its PTB domain (but not its LIN-2- interaction domain) is required for its overall function. My results suggest the LIN-2/7/10 complex works in multiple, interconnecting pathways to regulate basolateral LET-23 EGFR trafficking.

Working in opposition to the LIN-2/7/10 complex, our lab previously identified a Golgi- associated pathway that consists of Class I and Class II Arf GTPases, AGEF-1 (an Arf Guanine

Exchange Factor), and the AP-1 clathrin adaptor complex that antagonizes basolateral receptor localization and signalling. I screened for an ARF GTPase Activating Protein (GAP) that regulates LET-23 EGFR signalling and found that CNT-1, a Class III ARF-6 GAP homologous to mammalian ACAP1-4 that mediates recycling, is a novel negative regulator of LET-23 EGFR signalling. Preliminary studies suggest that CNT-1 is working in an ARF-6-independent manner, and that the RAB-35 GTPase, a common regulator of CNT-1, also suppresses LET-23 EGFR activation.

Adaptor and scaffolding proteins play an important role in coordinating cellular organization to maintain cell polarity and overall cellular function. My results offer insight into how the LIN-2/7/10 complex of scaffolding proteins harnesses its components to regulate polarized LET-23 EGFR localization through multiple mechanisms. My studies increase our understanding of the diverse pathways through which scaffolding proteins and small GTPase regulators moderate cellular events by coordinating the spatial organization of signalling proteins in epithelial cells.

vii

Résumé

L’organisation spatiale des composantes du réseau signalétique cellulaire est essentielle à la régulation de l’activation des signaux de transduction. Normalement, le triage polarisé du récepteur du facteur de croissance épidermique (R-EGF) régule l’activation des réseaux signalétiques. Sa dérégulation peut amener à une signalisation aberrante et à des maladies.

L’induction du sort des cellules vulvaire dans le nématode hermaphrodite C. elegans a servi de modèle d’étude pour la régulation spatiale et la signalisation de R-EGF. La localisation basolatérale de l’homologue unique de R-EGF, LET-23, est nécessaire à l’activation de la cascade signalétique canonique Ras/ERK au sein des cellules précurseurs de la vulve (VPCs).

L’activation de cette cascade signalétique initie le sort des cellules vulvaires primaires et c’est la première étape du développement vulvaire. Mon objectif de recherche principal est d’étudier la régulation de la localisation polarisée de LET-23 dans C. elegans, ainsi que les réseaux signalétiques qui en découlent.

La localisation basolatérale de R-EGF est médiée à travers son interaction avec un complexe tertiaire comprenant LIN-2 (CASK chez les mammifères), LIN-7 (Lin-7), and LIN-10

(APBA1), formant le complexe LIN-2/7/10. Le complexe a déjà été décrit biochimiquement, mais on ne sait toujours pas ni où le complexe se forme, ni comment il régule la localisation polarisée des récepteurs. J’ai découvert que les versions fluorescentes de LIN-2 et LIN-7 sont cytoplasmiques et que parfois, elles prennent une forme ponctuée et colocalisent dans les VPCs.

Seul LIN-7 colocalise avec le récepteur LET-23 R-EGF aux membranes basolatérales.

L’expression de LIN-2 et LIN-7 est limitée aux lignées cellulaires induites. LIN-10, élément constitutif de sous-groupe de foci cytoplasmiques comme le Golgi et des endosomes de récupération, y recrute LIN-2 et LIN-7. Etonnamment, j’ai découvert que la surexpression de

viii

LIN-10 et LIN-7 promeut l’induction de la différentiation cellulaire sans le complexe tertiaire.

A-elle seule, la surexpression de LIN-10 peut rétablir la localisation basolatérale dans le mutant lin-2 grâce à son domaine C-terminal PDZ. Pour être fonctionnel, LIN-10 a besoin de son domaine PTB, mais pas de son domaine interagissant avec LIN-2. Mes résultats suggèrent que le complexe LIN-2/7/10 agit sur plusieurs réseaux de signalisations interconnectés, de manière à réguler le trafic de LET-23 R-EGF au niveau basolatéral.

Auparavant, notre laboratoire a identifié une voie de signalisation associée au Golgi, composée de protéines d’activation Arf GTPases (GAP) de classe I et II, d’AGEF-1 (un facteur d’échange de la guanine), et de l’adaptateur de complexe à clathrine AP1, qui antagonise la localisation et la signalisation basolatérale du récepteur. Cette voie s’oppose au complexe LIN-

2/7/10. J’ai effectué un criblage pour la GAP en charge de réguler la signalisation de LET-23 R-

EGF et j’ai découvert que CNT-1, une GAP ARF-6 de classe III homologue à la protéine de mammifère ACAP1-4 importante pour le recyclage, régule négativement la signalisation de

LET-23 R-EGF.

Les voies de trafic intracellulaire sont essentielles pour maintenir la polarité cellulaire et elles dépendent souvent de protéines d’adaptation qui confèrent une spécificité aux cargos. Mes résultats démontrent comment le complexe LIN-2/7/10 unit ces composantes multifonctionnelles et ils révèlent les moyens de régulation nécessaires à la signalisation de LET-23 R-EGF. Mon

étude augmente le niveau de compréhension des diverses voies de signalisations à travers lesquelles des protéines d’adaptation et des régulateurs de petites GTPases modèrent les

évènements cellulaires, en coordonnant l’organisation spatiale des protéines de signalisation dans les cellules épithéliales.

Acknowledgements

It takes a village to write a thesis.

I would like to extend my deepest, sincerest gratitude to the many people who have helped me, encouraged me, believed in me, inspired me, pushed me, challenged me, and comforted me while I pursued this degree. My parents, who have been an endless source of support and love my entire life. You are my guiding stars. My big brother and sister, for dealing with me copying you both in pretty much every aspect. I’m so lucky to have such incredible role models. My dearest friends, who have seen me through every trial and triumph since childhood:

Ann, Charlotte, and Clarence Billiark. The Steczyszyn and Breston families, for your warmth, kindness, and encouragement over the years. My relatives in Montreal, for welcoming me with open arms when I moved here.

My labmate-turned-roommate, Ljiljana, for keeping me hydrated during thesis writing, for listening to my endless rants about my research, for your constructive feedback, for translating my abstract to French, and for your friendship. My PPL-MeDiC-ACB family past and present, especially Erin, Ali, George, Nimara, Nida, and Deanna, for fueling my mind with both detailed scientific discussion and idle gossip. My labmates past (Fiona, Içten, Jung Hwa, Olga,

Jassy) and present (Sarah, Ben, Ali, Aida, Tatsuya), for maintaining a friendly, creative, and productive environment that inspired me every day to do my best.

I would especially like to recognize the incredible administrative staff that support our research, especially Mary Lapenna, Rachel Massicotte, and Joelle Denomy-Hasilo. My department’s Graduate Program Director, Dr. Chantal Autexier, whose mentorship has helped me so much over the years. To Drs. Jean-Claude Labbé and Arthur Forer, thank you for giving me my start in science as an undergrad and for your encouragement. To my mentor, Dr. Alfredo

Ribeiro-da-Silva, thank you for seeing potential in me from day one. To the many professors who have inspired me along the way, especially Drs. Stéphane Laporte, Louise Larose, Simon

Wing, and Lloydie Jerome-Majewska, thank you for your constructive feedback and your mentorship. Finally, my supervisor, Dr. Chris Rocheleau, for always encouraging me and supporting my career development and wild ideas, and even occasionally laughing at my jokes. I have learned so much from your guidance. Thank you for helping me towards my goal: to learn critical thinking and to do good science.

You all have been unwavering in your support and encouragement, and I could not have done this without you.

Jack Mandora, me no choose none.

Preface

This thesis is written in the traditional format in accordance with the guidelines from the

Graduate and Postdoctoral Studies of McGill University. This thesis consists of a review of literature relevant to the research presented, details on materials and methods, three chapters of results, and a discussion of the results and original contributions to knowledge.

Two manuscripts are in preparation, each based on the work presented in Chapters 3 and

4. Chapter 5 details results of a preliminary study. The literature review in Chapter 1 contains written sections (Sections 1.2.2, 1.3.1, 1.3.2, 1.3.3, 1.3.3.1, and 1.3.4), figures (Figures 1.6 and

1.7), and figure legends (Figures 1.6 and 1.7) adapted and acquired from a review article written by Kimberley Gauthier and Christian Rocheleau, referenced below. Figures and text were reproduced and adapted with permission from Springer Nature (License number

4726691118792).

Gauthier K, Rocheleau CE. C. elegans Vulva Induction: An In Vivo Model to

Study Epidermal Growth Factor Receptor Signaling and Trafficking. Methods

Mol Biol. 2017;1652:43-61.

xii

Contributions of Authors

Chapter 3: The let-23(re202[let-23::mKate2::3xFlag]) strain (DV3366) was generated by Tam

Duong from Dr. David Reiner’s lab at the Institute of Biosciences and Technology, Texas A&M

University. This strain has not yet been published and was generously provided to us directly from Dr. Reiner for use in my research.

Chapter 4: Olga Skorobogata made the initial, unpublished observations of ARF-1.2::EGFP expression patterns in the VPCs, corresponding to Figure 4.6, although the ARF-1.2::EGFP extrachromosomal arrays were published. Strains and images used in the figure were acquired and analyzed by Kimberley Gauthier for colocalization.

Chapter 5: Ali Fazlollahi performed genetic crosses to generate several of the new strains used in this chapter, and performed a preliminary analysis of LET-23 EGFR polarized localization in a cnt-1(tm2313) mutant background on an A1 Axio Imager epifluorescence microscope, corresponding to Figure 5.3. Data shown in the figure was from images taken on an LSM780 confocal microscope to achieve more accurate resolution of membrane localization. Imaging and analysis were performed by Kimberley Gauthier.

xiii

Nomenclature

Standard nomenclature conventions for C. elegans genes, alleles, strains, and proteins have been used in this thesis, as have been described in Horvitz et al. and Riddle et al., referenced below.

1. Strains and alleles: Strain names are assigned to unique genotypes and may consist of

multiple alleles. Allele names refer to a specific genomic alteration of a single gene. Strain

and allele names are each named for their laboratory of origin and consist of two letters

followed by an Arabic number. The two letters are a code that designate the lab of origin.

Strains are written in upper case, whereas alleles are italicized and written in lower case.

Alleles are generally written in brackets immediately following the associated gene. E.g.

QR769 is the strain associated with the vh50 allele of the lin-10 gene, written lin-10(vh50)

(where QR and vh are the designations for the Rocheleau lab). Note that all genomic

alterations generated by CRISPR/Cas9, including insertion of fluorophores at gene loci, are

designated by an allele.

2. Genes: Genetic screens were used to identify genes and their products in C. elegans, and

thus many genes are named for phenotypes for which they were screened. For example, lin

genes were named for altered cell fate lineages, let genes were named for lethality associated

with their loss-of-function, and egl genes were named for egg-laying defects. Genes are

italicized and written in lower case and consist of their broader gene classification (three

letters), followed by a hyphen and an Arabic number, indicating the order in which they were

identified (E.g. lin-10 or let-23). Alternatively, some genes are named for their known

orthologues, following the same conventions (e.g. mpk-1 for the MAPK ERK).

xiv

3. Proteins (gene products): Gene products are named for their corresponding gene and are

written non-italicized and capitalized. For example, LET-23 is the protein corresponding to

the let-23 gene loci.

4. Genotypes: C. elegans has five autosomal chromosomes (I, II, III, IV, and V) and one sex

chromosome (X). Genotypes are written by listing genes and alleles in order of the genomic

location, starting sequentially through the autosomal chromosomes, then the sex chromosome

(if relevant). Alleles of different chromosomes are separated by a semi-colon. Alleles on the

same chromosome have a single space between them and are listed in order from left-to-right

based on their position on the chromosome. Transgenes with known genomic loci follow the

same convention. Extrachromosomal arrays are listed last.

5. Transgenes (integrated strains and extrachromosomal arrays): Transgenes are expressed

as single or multiple copy genomic insertions of exogenous DNA at random or specific sites,

or are inherited as large extrachromosomal arrays inherited in a non-Mendelian fashion.

Transgenes are generated from plasmids and often consist of a promoter, gene of interest, and

a 3ʹ regulatory untranslated region. Transgenic lines are designated by the laboratory allele

code, Is (Integrated Strain) or Ex (Extrachromosomal array), and an Arabic number. The

genes and promoters expressed in transgenes are written in brackets following the transgene

name. For example, vhEx37(Plin-31::GFP::LIN-10a + Pttx-3::GFP).

Horvitz HR, Brenner S, Hodgkin J, Herman RK. A uniform genetic nomenclature

for the nematode Caenorhabditis elegans. Mol Gen Genet. 1979;175(2):129-33.

Riddle DL, Blumenthal T, Meyer BJ, Priess JR. Introduction to C. elegans. In: nd,

Riddle DL, Blumenthal T, Meyer BJ, Priess JR, editors. C elegans II. Cold Spring Harbor

(NY)1997.

List of Figures

Figure 1.1 Regulation of epithelial cell polarity ...... 5 Figure 1.2 Polarized trafficking routes in epithelial cells ...... 8 Figure 1.3 Epidermal Growth Factor Receptor (EGFR) signalling pathways ...... 12 Figure 1.4 Intracellular transport routes for internalized EGFR ...... 17 Figure 1.5 Life cycle of Caenorhabditis elegans...... 20 Figure 1.6 LET-23 EGFR activates the canonical Ras/MAPK signalling pathway to specify the primary vulval cell fate ...... 25 Figure 1.7 The LIN-2/7/10 complex maintains basolateral LET-23 EGFR localization ...... 28 Figure 1.8 Known localization patterns of LIN-2, LIN-7, LIN-10, and their orthologues ...... 35 Figure 1.9 Interaction network of Lin7, CASK, and APBA proteins ...... 38 Figure 1.10 Mammalian APBA proteins have autoregulatory interactions in their PTB and PDZ domains ...... 50 Figure 1.11 Modulation of LET-23 EGFR signalling by membrane trafficking and cytoskeleton regulators...... 54 Figure 1.12 Cellular roles of Arfs and their associated GEFs and GAPs ...... 56 Figure 1.13 Arf GAP protein domains and classification ...... 62 Figure 1.14 Arfs and Arf GAPs are involved in endocytosis, recycling, secretion, and actin cytoskeleton organization ...... 67 Figure 3.1 The LIN-2/7/10 complex promotes basolateral localization and signalling in the C. elegans vulva precursor cells to initiate vulval development ...... 93 Figure 3.2 Expression and localization dynamics of LIN-2/7/10 and LET-23...... 97 Figure 3.3 Expression of LIN-2 and LIN-7 is restricted to induced vulval cells ...... 99 Figure 3.4 Subcellular localization of the LIN-2/7/10 complex ...... 102 Figure 3.5 LET-23 EGFR colocalizes with LIN-7 at basolateral membranes and with LIN-10 at foci ...... 106 Figure 3.6 LIN-2 and LIN-7, but not LIN-10 or LET-23 EGFR, colocalize in neurons ...... 109 Figure 3.7 Interactions in vivo of LIN-2, LIN-7, and LIN-10 ...... 112 Figure 3.8 Punctate localization of LIN-2 and LIN-7 are complex-dependent ...... 116 Figure 3.9 LIN-10 punctate localization is complex-independent ...... 118

xvi

Figure 4.1 LIN-10 and LIN-7 promote VPC cell fate induction independently of their complex components ...... 124 Figure 4.2 LIN-10 overexpression promotes basolateral targeting of LET-23::GFP ...... 130 Figure 4.3 C-terminal domains regulate punctate localization and function of LIN-10 ...... 134 Figure 4.4 LIN-10 colocalizes with Golgi and recycling endosome marker VPS-52 ...... 138 Figure 4.5 LIN-10 colocalizes with ARF-1.2 but is not dependent of ARFs for localization .... 141 Figure 5.1 RNAi-mediated knockdown of cnt-1, W09D0.1, K02B12.7, and git-1 suppress the dead egg phenotype of agef-1(vh4) ...... 149 Figure 5.2 Loss of cnt-1 rescues Vul phenotypes with no detectable alteration of LET-23 EGFR localization ...... 154 Figure 5.3 CNT-1 skews polarized LET-23::GFP distribution early in VPC induction ...... 156 Figure 6.1 Model for complex-independent function of LIN-7 ...... 170 Figure 6.2 Model of complex-independent function of LIN-10 ...... 176 Figure 6.3 Model of the role of the LIN-2/7/10 complex in the VPCs ...... 180 Figure 6.4 Hypothetical models to explain CNT-1 regulation of LET-23 EGFR signalling ..... 185

xvii

List of Tables

Table 2.1 Strain list ...... 81 Table 2.2 Guide RNA sequences ...... 84 Table 2.3 Primers for cloning ...... 84 Table 3.1 Analysis of VPC induction in lin-7(vh51), lin-2(vh52), lin-10(vh50), and let-23(re202) ...... 89 Table 3.2 Extrachromosomal LIN-7a::EGFP, GFP::LIN-2a, and GFP::LIN-10a rescue their respective mutant phenotypes ...... 90 Table 4.1 LIN-10 and LIN-7, but not LIN-2, can promote vulval cell fate induction independently of their complex components ...... 123 Table 4.2 LIN-10 and LIN-7 overexpression rescue a PDZ interaction-deficient let-23(sy1) receptor mutant, but not signalling defective let-23(sy97) ...... 127 Table 4.3 Punctate PDZ domains necessary and sufficient to rescue lin-2, but PTB domain required for overall LIN-10 function ...... 136 Table 4.4 ARF-1.2 not required for the rescue of lin-2 by LIN-10 overexpression ...... 142 Table 5.1 List of putative Arf GAPs in C. elegans ...... 147 Table 5.2 RNAi-mediated knock down of ARF GAPs do not suppress vulval cell fate induction in agef-1; lin-2 worms ...... 151 Table 5.3 CNT-1 and RAB-35 suppress VPC cell fate induction ...... 153 Table 5.4 CNT-1 regulates VPC induction in an ARF-6-independent manner ...... 158 Table 5.5 Overexpression of ARF-1.2::EGFP (vhEx7) weakly suppresses VPC induction in one of two cnt-1; lin-2 mutant lines ...... 160 Table 5.6 cnt-2(RNAi) suppresses VPC induction in cnt-1; lin-2 double mutants ...... 162

xviii

List of Abbreviations

ACAP Arf GAP with Coiled-coil (BAR ErbB Erythroblastosis virus-related domain), Ank, and PH domains gene B ADP Adenosine Diphosphate ERK Extracellular signal-Regulated AGAP Arf GAP with GTP-binding Kinase protein-like, Ank, and PH FIH Factor Inhibiting HIF-1α domains GAP GTPase activating protein AGEF Arf GEF GEF Guanine Exchange Factor Ank Ankyrin GFP Green Fluorescent Protein APBA APP Binding Protein Family A GIT GRK-interacting APP Amyloid Precursor Protein GK Guanylate Kinase ARAP Arf GAP with Rho GAP, Ank, GLR-1 Glutamate Receptor 1 and PH domain GPCR G-Protein Coupled Receptor Arf ADP ribosylation factor GRB2 Growth Factor Receptor Bound Arl Arf-Like Protein 2 ASAP Arf GAP with SH3, Ank, and GRK GPCR kinase PH domains GTP Guanine Triphosphate Aβ Amyloid β HIF-1α Hypoxia-Inducible Factor 1- BAR Bin, Amphiphysin, and Rvs alpha BFA Brefeldin A IP Immunoprecipitation CASK Caclium/calmodulin-dependent KSR Kinase Suppressor of Ras Serine protein Kinase LET Lethal Cdc42 Cell Division Control Protein 42 LIN Lineage defective Homologue MAGUK Membrane Associated CED Cell death defective Guanylate Kinase CID CASK-Interacting Domain MALS Mammalian Analogue of LIN-7 CNT Centaurin MAPK Mitogen Activated Protein Crb Crumbs Kinase Dlg1 Discs Large 1 mCh mCherry DNC Dorsal Nerve Chord MEK MAPK/Erk Kinase EGFP Enhanced Green Fluorescent MID Munc18-Interacting Domain Protein Mint Munc18-Interacting Protein EGFR Epidermal Growth Factor mK2 mKate2 Receptor mNG mNeonGreen Egl Egg-Laying Defective Muv Multivulva ELMO Engulfment and Cell Motility PALS Protein Associated with Lin7 ELMOD ELMO Domain-containing protein PATJ Protein Associated with Tight Junctions ER Endoplasmic Reticulum PDZ PSD95/Dlg1/ZO-1

xix

PH Pleckstrin Homology Rho Ras Homologue Family PI(3,4,5)P3 Phosphatidylinositol (3,4,5) Member A triphosphate RNAi RNA interference PSD95 Post-Synaptic Density 95 SH2/SH3 Src Homology Domain 2/3 PTB Phosphotyrosine Binding SMAP Stromal Membrane-Associated Rab Ras-related proteins in Brain Protein Rac Ras-Related C3 Botulinum Veli Vertebrate LIN-7 Toxin Substrate 1 VNC Ventral nerve chord Raf Rapidly Accelerated VPC Vulva precursor cell Fibrosarcoma Vul Vulvaless Ran Ras-related Nuclear protein ZO-1 Zonula Occludens 1 Ras Rat sarcoma

Chapter 1: Introduction and Literature Review

1.1 Spatial organization of signalling networks

Cell biological function relies on the activity of complex signalling cascades that trigger intracellular responses to extracellular stimuli. These signalling networks work to propagate the signal to the nucleus to effect changes in gene expression that determine cell growth, division, migration, and survival. A host of scaffolding proteins, adaptor proteins, trafficking motors, and endocytic regulators are needed to bring these signalling components together to transduce input from membrane receptors to the nucleus. Scaffolding proteins work as large platforms on which signalling can take place by interacting with multiple signalling proteins. Adaptor proteins also enforce proximity of signalling components, but are smaller than scaffolding proteins and typically help to bridge the gap between two enzymes [1]. Membrane trafficking regulators and protein scaffolds ensure the proper spatial distribution of signalling components, especially of membrane-bound receptors whose localization to specific membrane domains is essential for their ability to engage their respective ligands.

The subcellular localization of signalling complexes in a cell is particularly important in the context of polarized cells, such as epithelial cells and neurons. Polarized cells have distinct cell surfaces and compartments that are differentiated by lipid membrane and protein composition, cytoskeleton dynamics, and function. Epithelial cell membranes are divided into apical and basolateral domains that are exposed to unique extracellular environment. Neurons have complex polarization, sometimes along more than one axis, that generally consist of a long axonal projection that send signals to other neurons, and numerous dendritic projections hosting postsynaptic termini that receive signals into the neuronal cell body [2, 3]. Mislocalization of receptors away from the cell surface exposed to the ligand (such as growth factors or neurotransmitters) results in loss of cellular response and can lead to cellular dysfunction and

2 developmental disorders. Alternatively, receptor mislocalization to a ligand-exposed cell surface where the receptor should otherwise be absent results in unintended ectopic signalling activation, leading to aberrant cellular responses that can promote disease [4, 5].

1.1.1 Epithelial cell signalling and regulation

Epithelial cells are arranged into neatly organized sheets maintained by tight cell contacts, and form the lining of organs and tissues. Simple epithelia consist of a single layer of cells connected by their lateral membranes, whereas stratified epithelia consist of stacked layers of epithelial cells. Cell shape provides a secondary axis of classification: squamous cells are relatively flat, cuboidal cells are evenly proportioned, and columnar cells are tall and narrow.

Epithelial cells are characterized by cell junctions that separate apical and basolateral membrane domains, and that keep cells in close proximity to each other and prevent passage of extracellular material between neighbouring cells (Figure 1.1a). Apical membranes face the outer world, such as the outer layer of the epidermis or the lumen-facing layer of internal organs, and often have cilia and microvilli to maximize surface area for absorption and secretion. Basolateral membranes face the inner body of an organism, and are credited with generation and association with a basal lamina that helps anchor cells to the extracellular environment and provides cues for proliferation and differentiation [3].

Tight junctions, composed of occludin and claudin proteins, define the border of apical and basolateral domains by wrapping around the cell, preventing exchange of membrane- associated proteins between the two domains, and serve as the seal of the lumen [6]. The adherens junction, composed of the catenin-cadherin complex, mediate cell-cell adhesion that can trigger actin cytoskeleton rearrangements [7] (Figure 1.1). Cadherin and catenin molecules

3 can also be found at synaptic junctions to stabilize neuronal synapses [8]. Cell junctions across metazoans differ slightly in composition, but serve similar functions. For example, epithelial cells in the nematode Caenorhabditis elegans lack tight junctions, but have a homologous catenin-cadherin complex that also contain an occludin-like and claudin-like protein. C. elegans also have a unique apical junction complex consisting of the highly conserved DLG-1 (Discs

Large) protein and nematode-specific AJM-1 (Apical Junction Marker) [9, 10] (Figure 1.1).

Figure 1.1 Regulation of epithelial cell polarity (a) Epithelial cells are separated into apical and basolateral (basal+lateral) domains by cell junction complexes. Junctions differ in composition but are conserved in function across metazoan species. Adherens junctions (AJs) have related components in Drosophila, vertebrates, and C. elegans. Vertebrates have tight junctions (TJs) absent in the two invertebrate species. Polarity markers further distinguish the apical and basolateral domains. Scrib/Dlg1/Lgl form the basolateral Scribble polarity complex, whereas Crb/PATJ/PALS1 and Par-3/Par-6/aPKC form the apical Crumbs and Par polarity complexes, respectively. This figure was adapted form Yamanaka and Ohno [10] and its reproduction is permitted under the Creative Commons CC-BY License.

1.1.1.1 Establishment and maintenance of epithelial cell polarity

Epithelial cell polarity is essential for cell function and tissue homeostasis. Loss of cell polarity is a necessary step of the epithelial-to-mesenchymal transition (EMT), which enables epithelial cells to lose association with the basement membrane and migrate. Unregulated EMT in tumorigenic cells promotes metastasis, a hallmark of cancer [11, 12].

Apicobasal polarity is both established and maintained by three major polarity complexes: the apical Par3 (Partitioning-defective 3)/Par6/aPKC (Atypical Protein Kinase C) complex, the apical Crb (Crumbs)/PALS1 (Protein Associated with Lin7, or MPP5)/PATJ

(protein associated with tight junctions) complex, and the basolateral Scrib (Scribble)/Dlg1

(Discs Large)/Lgl (Lethal Giant Larvae) complex [13] (Figure 1.1). These proteins all contain protein-interaction domains, such as PDZ domains (described in 1.4.1.1) (Figure 1.1b), and serve as docking sites to link signalling complexes, cytoskeleton and extracellular matrix (ECM)- interacting proteins, and trafficking pathways to coordinate polarized cellular processes.

Proper localization of polarity complexes at the onset of polarity establishment is ensured by intracellular trafficking networks. Microtubule filaments are often stabilized with minus ends pointing apically and plus ends pointing basolaterally, serving as transport routes along which the dynein (minus end-directed) and kinesin (plus end-directed) motor proteins assist in polarized targeting of polarity complex components to cell junctions and membrane domains [14-16].

Additional microtubule filaments are nucleated from the centrosome, with plus-ends extending towards lateral and apical membranes [17]. The actin cytoskeleton provides additional trafficking routes, and is linked to cell polarity maintenance through its regulation by Cdc42 GTPase, an effector of the Par polarity complex. Other small GTPases (especially Rab3, -8, -10, -11, and -

35) play a prominent role in directing and sorting polarized vesicular targeting to establish and maintain epithelial cell polarity [18, 19].

1.1.1.2 Polarized trafficking in epithelial cells

Polarized targeting and trafficking are needed to ensure proper localization of protein cargo in epithelial cells. Transcytosis is needed to allow passage of molecules from one cell surface to the next. Sorting of newly synthesized proteins to the apical and basolateral membranes can happen at the level of the Golgi, basolateral recycling endosomes, apical recycling endosomes, or common recycling endosomes. Cargo internalized from the plasma membrane can also be sorted to either basolateral or apical membranes for recycling (Figure 1.2) [3, 20]. The small GTPases

Rab11 is a major regulator of apical recycling endosomes, and Rab10 plays a prominent role in basolateral recycling and targeting [3, 18, 20]. Cargo sorting signals help determine polarized targeting form the Golgi or endosomal compartments. Basolateral sorting signals include tyrosine-based signals in the cytosolic domain, such as NPXY, which can interact with the AP-1 clathrin adaptor protein complex that preferentially sorts newly synthesized proteins from the

Golgi to the basolateral membrane [21, 22]. Apical sorting relies on more complex and varied signals located anywhere on the cargo protein, including glycosyl-phosphatidylinositol (GPI) anchors, and N- and O-linked glycosylation. Clustering of these modifications into specialized glycosphingolipid and cholesterol-rich subdomains of Golgi and recycling endosome membranes, called lipid rafts, provide specialized cues for apical targeting [3, 20, 23]. Protein interaction motifs, such as PDZ domain-containing adaptor and scaffold proteins, also play an important role in polarized subcellular targeting and tethering of cargo [24, 25].

Figure 1.2 Polarized trafficking routes in epithelial cells Proteins secreted from the Golgi can transit to the basolateral membrane either directly (1) or by passing through basolateral early endosomes (BEE) (2/3). Proteins internalized from the basolateral membrane (3) can also be redirected to common recycling endosomes (CRE) for recycling back to the basolateral membrane, trafficking to apical recycling endosomes (ARE), or targeting for degradation through late endosomes (LE) and lysosomes (lys)/multivesicular bodies (MVBs). Apical proteins are typically sorted from the Golgi to apical recycling endosomes (4a) or apical early endosomes (AEE) (5a) to reach the apical membrane (4b/5b). Proteins internalized from the apical membrane (5b) can pass through apical recycling endosomes (6) to be recycled back to the apical membrane, transcytosed to the basolateral membrane, or degraded through the late endosome/lysosome pathway. This figure was acquired from Stoops and Caplan [20] with permission from the American Society of Nephrology (License number 1008762-1).

1.2 Epidermal Growth Factor Receptor signalling

Epidermal Growth Factor Receptors (EGFRs) represent a family of highly conserved, well- studied transmembrane receptor tyrosine kinases (RTK) that promote cell growth, differentiation, motility, division, and survival pathways. There are four EGFR paralogues in humans: ErbB1

(Her1, the prototypical EGFR), ErbB2 (Her2, Neu), ErbB3 (Her3), and ErbB4 (Her4).

Specificity for pathway activation and subsequent cellular response is achieved by spatiotemporal restriction of EGFR localization, heterotypic dimerization among receptor paralogues, and multiple tyrosine phosphorylation sites that recruit different adaptor and effector proteins. Signalling activation is further regulated by ranging affinities for ligands: for example,

EGF, TGF-α, and amphiregulin have highest specificity for ErbB1 [26-29], whereas neuregulin-

3 and -4 preferentially activate ErbB4 [30, 31].

The extracellular domain of EGFRs consists of two leucine-rich ligand binding domains

(L1 and L2) and two cystine-rich subdomains (CR1 and CR2) (Figure 1.3a). Unbound ErbB1,

ErbB3, and ErbB4 exist in an inactive folded state maintained by intramolecular interactions between CR1 and CR2. Ligand binding to L1 and L2 releases the autoinhibitory interaction and exposes the dimerization loop in CR1, allowing for homo- and heterodimerization with other

EGFR paralogues [32]. ErbB2 monomers have no known ligand, remain in the open uninhibited state, and are the preferred dimerization partners of other EGFRs [33-35] (Figure 1.3a).

Ligand binding and dimerization induces structural changes in the intracellular C- terminal domains of EGFRs that bring kinase domains in proximity for trans- autophosphorylation of tyrosine residues in the C-terminus [32]. Phosphotyrosines serve as docking sites for adaptor and effector proteins that recruit downstream signalling components to

9 propagate signalling activation. EGFRs can activate four major intracellular signalling pathways: the Ras/MAPK pathway, PI3K/Akt, PLCγ/PKC, and JAK/STAT [32, 36] (Figure 1.3b).

Figure 1.3 Epidermal Growth Factor Receptor (EGFR) signalling pathways (a) EGFRs consist of two leucine-rich extracellular domains (L1/L2), two cysteine-rich extracellular domains (CR1/CR2), a transmembrane domain, and an intracellular tail containing the kinase activation domain. Three of the four human EGFR paralogues (EGFR/ErbB1, ErbB3, and ErbB4) exist as inactive monomers maintained by interactions between CR1/CR2 domains (i). Ligand binding to the L1/L2 domains induces conformational changes (ii) that enable dimerization and activation of the intracellular tail (iii). ErbB2 is constitutively in an open, active state (iv). (b) Active EGFRs can stimulate the Ras/Raf/MEK/ERK pathway, the PI3K/Akt/mTOR pathway, the JAK/STAT pathway, or the PLC-/PKC pathway to regulate proliferation, survival, differentiation, growth, and migration. Figure 1.3a was adapted from Wieduwilt and Moasser [32] with permission from Cellular Molecular Life Sciences (License number 4726690504502). Figure 1.3b was adapted from Iwakura and Nawa [37] distributed under the terms of the Creative Commons Attribution License, which permits its use, distribution, and reproduction in other forms.

1.2.1 The Ras/MAPK signalling pathway

Activation of the canonical Ras/MAPK pathway is initiated by the SH2 (Src Homology) and

SH3 domain-containing Grb2 adaptor protein binding phosphorylated tyrosine residues on intracellular tail of activated EGFR. Alternatively, Grb2 can interact with the Shc adaptor protein, which can interact with EGFR via its SH2 domain. Phosphorylation of Shc provides a binding site for the SH2 domain of Grb2 [38, 39]. Grb2 is then phosphorylated by EGFR and recruits SOS (Son Of Sevenless), a Ras Guanine Exchange Factor (GEF) that activates the membrane-bound small GTPase Ras. Active Ras initiates the intracellular kinase cascade by recruiting and activating a series of kinases: first, the kinase Raf (MAP kinase kinase kinase) is recruited and activated, which can then phosphorylate and activate MEK (MAPK/Erk Kinase, also known as MAP kinase kinase), which in turn phosphorylates and activates ERK

(Extracellular signal-Regulated Kinase), a member of the MAPK (Mitogen Activated Protein

Kinase) family. Active ERK phosphorylates cytoplasmic targets and transcription factors, and regulates transcription of genes involved in cell proliferation, shape, and growth [40].

1.2.2 Importance of EGFR in human health

The EGFR family was discovered over forty years ago, and was first associated with cancer about a decade later when mutant EGFR was identified in tumours associated with the avian erythroblastosis virus, from which the ErbB name was derived [41-43]. The EGFR family and the downstream targets Ras GTPase and Raf kinase are frequently mutated or amplified in epithelial cancers, such as non-small cell lung cancer, breast cancer, and squamous cell carcinoma [44-47]. EGFR expression in breast cancer is associated with higher proliferation,

13 genomic instability, and risk of relapse [44, 48]. Loss of signalling activation also has a severe impact on health and results in developmental dysregulation and neurodegeneration [49, 50].

1.2.3 Spatial regulation of EGFR signalling

EGFR signalling undergoes strict regulation to coordinate the timing and output of signalling activation. Overexpression of EGFR is associated with many cancers due to spontaneous dimerization and dysregulated signalling activation, pointing to the importance of regulating receptor expression and density on membranes. Downstream Ras/MAPK signalling is further regulated by the KSR (Kinase Suppressor of Ras) scaffold protein, which interacts with Ras, Raf, and MEK to promote proximity for kinase/substrate interactions for signal propagation [51-53].

Receptor activation triggers its internalization through clathrin-mediated endocytosis or clathrin-independent endocytosis [54], which can serve to attenuate signalling activation by targeting the receptor to the late endosome/lysosomal system for degradation. Alternatively, the receptor can be deactivated by phosphatases from the endoplasmic reticulum (ER) and recycled to the cell surface for reactivation [55-57]. Early endosomes also serve as signalling endosomes that maintain clusters of receptors and effectors that enhances activation and signalling propagation (Figure 1.4). The fate of internalized receptor is in part determined by signal strength: ligand abundance tends to favour signal attenuation pathways to prevent overactivation and hyperproliferation. This is likely the result of enhanced recruitment of the E3 ubiquitin ligase

Cbl2, which targets highly phosphorylated receptors of ubiquitination for clathrin-independent endocytosis and degradation [58, 59]. Many oncogenic, constitutively active EGFR mutants have been discovered to evade internalization or degradation, and inhibition of EGFR endocytosis can promote tumorigenesis [60-62]. On the other hand, formation of clathrin-coated pits allows for

14 clustering and enhanced phosphorylation of EGFR, and receptor recycling promotes signalling propagation [63]. Blocking endosome recycling and degradation of EGFR through loss of early endosome-associated Rabaptin-5 sustains EGFR signalling at signalling endosomes [64], and preventing receptor internalization by knocking down clathrin or the AP-2 clathrin adaptor complex dampens activation of downstream signalling pathways [65]. Therefore, receptor internalization is an important means of both attenuating and propagating EGFR signalling.

Polarized targeting of EGFR in epithelial cells is an important means of regulation to maintain normal signalling activation. For example, receptor mislocalization from the basolateral to the apical membrane is associated with polycystic kidney disease pathogenesis due to ectopic signalling activation [66]. Madin-Darby Canine Kidney (MDCK) cells have served as a useful model to further our understanding of polarized EGFR localization. Newly synthesized EGFR is sorted to the basolateral membrane through leucine-mediated sorting signals in its cytoplasmic domain that interact with AP-1 [67-69]. At the onset of MDCK cell junction formation, EGFR is targeted to the basolateral membrane from Rab11-positive recycling endosomes by PKC (protein kinase C)-mediated threonine phosphorylation [68, 70]. Low levels of apical EGFR localization in MDCK cells have also been reported, though it is usually inactive on this membrane [71, 72].

Ectopic receptor activation at the apical membrane causes prolonged signal propagation compared to basolateral activation in MDCK and porcine kidney cells, likely due to evasion of receptor internalization and degradation pathways associated with activation on the basolateral membrane [72, 73].

In some cases, such as in mammalian bladder epithelial cells, EGFR is activated and required on both basolateral and apical membranes for regular signalling activity [74]. Receptor localization on both membrane domains can also serve as a means to modulate signalling activity

15 by relocating activated receptor from one membrane domain to the ligand-deficient membrane domain. For example, in neuron-associated ependymal precursor cells, EGFR is activated on the apical membrane, and translocated to the basolateral membrane by the endocytic adaptor protein

Numb to attenuate signalling [75]. Polarized targeting, endocytosis, degradation, recycling, and translocation all play essential roles in regulating EGFR signalling intensity and activation.

Figure 1.4 Intracellular transport routes for internalized EGFR Through the biosynthetic route, EGFR is typically targeted towards the basolateral membrane through interactions with AP-1 clathrin adaptor complex (1). Upon ligand activation, EGFR is internalized through clathrin-mediated endocytosis (for low to moderate activation) or clathrin- independent endocytosis (for high activation due to an abundance of ligand) (2). Internalized EGFR can continue to activate its downstream signalling cascade on signalling endosomes as it is translocated to a perinuclear compartment (3). From there, EGFR can be degraded through the late endosome/lysosome pathway, a fate that is favoured with an abundance of ligand to prevent overactivation of signalling (4). Alternatively, EGFR can be inactivated by phosphatases from the endoplasmic reticulum (ER) and recycled back to the membrane for resensitization (5).

1.3 Caenorhabditis elegans vulval cell fate induction as a model for spatial organization of signalling pathways

Although EGFR and Ras were both known to have a causative role in tumorigenesis, their relationship to each other and to intracellular signalling networks were only discovered throughout the 1980s and 1990s. Genetic studies in mice, fruit flies (Drosophila melanogaster), and the hermaphroditic nematode Caenorhabditis elegans played a vital role in uncovering the composition, order, and regulation of the EGFR/Ras/MAPK signalling cascade. Specification of the C. elegans vulval cell fate requires polarized EGFR signalling in epithelial cells, and research into this process has made substantial contributions to our understanding of development, and of the multifaceted network of signalling pathway regulation.

1.3.1 C. elegans as a model organism

C. elegans are non-parasitic roundworms that have been an invaluable genetic model organism for research in cell biology and development, particularly in the study of signalling pathway regulation. Their life-cycle takes three days to complete and progresses through four larval stages

(L1 to L4) into the egg-laying adult stage (Figure 1.5). Most C. elegans exist as self-fertilizing hermaphrodites with two X-chromosomes; however, a rare nondisjunction event resulting in a loss of the X-chromosome in developing gametes can spontaneously produce XO males that can mate with their hermaphroditic counterparts. Their quick life-cycle and ability to both self- fertilize and outcross facilitates genetic studies. The translucent cuticle allows for direct, visual inspection of the worms’ cells and organs through a Nomarski differential interference contrast

(DIC) filter in a compound microscope [76-78], and for fluorescent imaging in live worms. C.

18 elegans have a largely invariant cell lineage and developmental program, simplifying phenotypic analysis of gene variants. There is also a considerable amount of conservation of genes and signalling pathways between C. elegans and humans [79-81], indicating that this species can serve as a useful model organism to increase our fundamental understanding of human cell function, development, and disease.

Figure 1.5 Life cycle of Caenorhabditis elegans Newly hatched C. elegans hermaphroditic larvae undergo four larval stages (L1 to L4) before reaching maturity at adulthood. Adult worms can self-fertilize and mate with males to produce eggs. Developmental timing indicated for standard life cycle at 22°C. VPC cell fate induction occurs from the L2 to L3 larval stages. Vulval morphogenesis occurs throughout the L4 stage. This image was acquired from WormAtlas [82] and is freely available for non-profit educational and scientific purposes.

1.3.2 LET-23, the sole EGFR in C. elegans

C. elegans have a single EGFR homologue, LET-23 [83], and shares a conserved C-terminal

PDZ interaction motif with ErbB4 [84]. An atypical but functionally conserved PDZ-binding motif is also found in ErbB2 [84]. LET-23 EGFR can signal through the canonical LET-60

Ras/LIN-45 Raf/MEK-2 MEK/MPK-1 MAPK signalling pathway to initiate cell fate specification for the developing vulva and excretory duct cell [85], and can activate developmental pathways mediated by PLC-3 PLCγ to regulate behavioural quiescence and contractility in the sheath cells surrounding the gonad [86, 87]. Unlike mammalian EGF receptors, which dimerize upon ligand activation, LET-23 EGFR is constitutively dimerized, and the LIN-3 ligand induces allosteric changes that activate the intracellular C-terminal tail of the receptor [88], ultimately leading to stimulation of downstream signalling pathways.

1.3.3 C. elegans vulval development as a model for spatiotemporal EGFR signalling regulation

Development of the worm vulva can serve as a functional read-out of LET-23 EGFR signalling.

Activation of the canonical Ras/MAPK signalling pathway by LET-23 EGFR is the first step towards vulval development, and specifies the vulval cell fate in the vulval precursor cells

(VPCs) (Figure 1.6a). Dysregulation of LET-23 EGFR signalling and VPC cell fate induction can lead to a vulvaless (Vul) or multivulva (Muv) phenotype, relating to underactivation and overactivation of LET-23 EGFR signalling, respectively. The signalling events that lead to vulva development have been well characterized and can serve as a template for genetic epistasis tests to determine where a new gene functions within the pathway. Spatial localization of LET-23

EGFR is an important means of regulating vulval development: basolateral localization of the receptor is required for signalling activation and vulval cell fate induction.

Vulval cell fate specification occurs through L2 and L3 larval stages and begins with six

VPCs organized as a simple squamous epithelium on the ventral side of the worm, each with similar competency to differentiate into vulval cells (Figure 1.6b). Without an inductive signal, however, their default fate is to differentiate into hypodermal cells (named the tertiary cell fate) and fuse with the hypodermal syncytium [89].

The inductive signal comes in the form of an EGF-like ligand, LIN-3, released by the anchor cell located in the developing gonad primordium, just dorsal to the underlying VPCs

(Figure 1.6a). All six VPCs express the associated receptor, LET-23 EGFR, in a polarized fashion, with higher expression levels seen on the apical membrane than the basolateral membrane [90, 91]. Nevertheless, basolateral localization of LET-23 EGFR is necessary to interact with the inductive signal [90].

The VPC in closest proximity to the anchor cell, P6.p, receives the greatest amount of

LET-23 EGFR-mediated MPK-1 MAPK activation, and thereby assumes the primary vulval cell fate [89, 92, 93]. Primary cell fate specification induces activation of transcription for Notch receptor ligands, LAG-2 and DSL-1, which are then expressed on the cell surface and engage the apically-localized Notch receptor LIN-12 in the neighbouring cells P5.p and P7.p. Activation of

LIN-12 Notch signalling in turn prevents primary cell fate specification by downregulating LET-

23 EGFR expression and MPK-1 MAPK activation in P5.p and P7.p, and also activates transcription to specify the secondary cell fate [94-97]. In addition, the secondary cell fate is reinforced by reduced activation of LET-23 EGFR on the cell surface of P5.p and P7.p, which leads to activation of the RAL-1 GTPase downstream of LET-60 Ras rather than LIN-45 Raf

[98] (Figure 1.6a). Therefore, both lateral signalling and graded morphogen signalling are involved in specification of the primary and secondary vulval cell fates. Together, P5.p-P7.p generate the 22 cells of the vulva: eight cells from the primary cell lineage of P6.p and seven cells each from the secondary cell lineages of P5.p and P7.p. Due to their distance from the anchor cell and the quenching of ligand by the induced cell lineages, the remaining VPCs remain uninduced and adopt the tertiary non-vulval cell fate. P4.p and P8.p divide once and then fuse with the hypodermis, while P3.p has an equal chance of dividing or not dividing prior to fusing with the hypodermis [99, 100] (Figure 1.6b). The product of VPC induction can be monitored at the L4 stages, when the cells have finished dividing and begin undergoing complex morphogenic changes to form the vulva. Assessment of VPC cell fate induction can serve as a quantitative readout of LET-23 EGFR activation [101].

Genetic studies on vulva induction in C. elegans played a central role in identifying the components and mapping out the specific order of the canonical EGFR/Ras/MAPK signalling pathway. For example, these studies helped to establish Ras GTPase (LET-60) as acting downstream of EGFR in the signalling pathway [83, 102, 103], and to identify Raf (LIN-45)

[104], Grb2 (SEM-5) [105], and KSR (KSR-1 and KSR-2) as components of the pathway [51,

52]. These genes were found to be highly conserved across species, including humans, mice, rats, and flies [106].

Figure 1.6 LET-23 EGFR activates the canonical Ras/MAPK signalling pathway to specify the primary vulval cell fate (a) The LIN-3 EGF-like ligand, released from the gonadal anchor cell, is necessary to stimulate the canonical LET-23 EGFR/ LET-60 Ras/ LIN-45 Raf/ MPK-1 MAPK signalling pathway in the vulva precursor cells (VPCs) of L3 C. elegans larvae to specify the vulval cell fate. Basolateral localization of LET-23 EGFR, mediated by an interaction with the LIN-2 CASK/ LIN-7 Lin7/ LIN-10 APBA1 complex, is necessary for activation of the pathway. The VPC closest to the anchor cell, P6.p, receives the most ligand and differentiates into the primary vulval cell fate. The two adjacent cells (P5.p and P7.p) receive apically-localized inhibitory Notch signalling from the primary cell that downregulates MPK-1 MAPK. This, in addition to reduced EGF stimulation, promotes LET-60 Ras to signal through an alternate Ral GTPase- mediated pathway and ultimately causes these cells to differentiate into the secondary cell fate. (b) DIC image of five of the six VPCs, with vulval lineages shown below. The three VPCs closest to the anchor cell (P5.p-P7.p) are induced to undergo three rounds of division to produce the 22 cells of the vulva. The remaining uninduced cells divide once and fuse with the hypodermis, with the exception of P3.p, which has an equal chance of fusing with the hypodermis with or without dividing. Scalebar 10 μm. Figure and description adapted from Gauthier and Rocheleau [101] with permission from Springer Nature (License number 4726691118792).

1.3.4 Applications of VPC induction model for EGFR-related cancers

Perturbations in the EGFR/Ras/MAPK pathway have a tremendous impact on human health.

Therefore, understanding the diverse mechanisms by which this pathway is regulated is crucial for the development of novel, effective, and safe treatments and therapies of EGFR-related diseases.

In addition to identifying new regulators, this model system may have further applications for in vivo anti-cancer drug screening. A LET-23 chimeric receptor expressing wildtype human EGFR tyrosine kinase (TK) domain in place of its own TK domain can rescue let-23 mutant phenotypes [107]. Activating mutations in the TK domain seen in human cancers cause a Muv phenotype in C. elegans that can be suppressed by known TK inhibitors gefinitib and erlotinib. Bae et al. developed this humanized C. elegans model to screen for compounds that suppress the Muv phenotype associated with more aggressive mutations in the TK domain that are resistant to TK inhibitors.

The identification of missense mutations can also contribute to our understanding of how the many components of EGFR/Ras/MAPK pathway function and how they can be targeted.

Ras-suppressing missense mutations in ksr genes identified in C. elegans and Drosophila were used as a guide in designing drugs to target human KSR as an alternative method to treating Ras- overexpressing cancers [108].

1.4 LIN-2 (CASK), LIN-7 (Lin7), and LIN-10 (APBA) are conserved regulators of subcellular organization

LIN-2 (CASK in vertebrates and Drosophila), LIN-7 (Lin7A-C, Veli1-3, or MALS1-3), and

LIN-10 (APBA1-3, Mint1-3, or X11α-γ), named for their involvement in the vulval cell fate lineage [109], play an essential role in vulval cell fate specification by forming a complex and maintaining basolateral LET-23 EGFR localization. Loss-of-function mutations in the complex components, or loss of interaction between LET-23 EGFR C-terminal PDZ interaction motif and the PDZ domain of LIN-7 results in exclusive apical localization of LET-23 EGFR, loss of signalling activation in the VPCs, and a Vul phenotype [90, 110-113] (Figure 1.7). In C. elegans, mutations in lin-2, lin-7, or lin-10 specifically regulate LET-23 EGFR signalling during vulva development and do not function in other LET-23 EGFR signalling events. In humans, mutations in CASK, Lin7, or APBA1-3 are associated with learning disabilities, autism spectrum disorders, neurodegenerative diseases, and certain cancers [114-120].

Figure 1.7 The LIN-2/7/10 complex maintains basolateral LET-23 EGFR localization (a) Known interactions and protein domain structure of LET-23 EGFR, LIN-7, LIN-2, and LIN- 10. TM: Transmembrane domain. PIM: PDZ Interaction Motif. L27: LIN-2/7 interaction domain. PDZ: Psd95/Dlg1/ZO-1-like domain. CaMKII: Calcium/Calmodulin Kinase II domain. SH3: Src Homology Domain 3. GK: Guanylate Kinase domain. CID: CASK Interaction Domain. PTB: Phosphotyrosine domain. (b) In the L3 larva of wild type worms, LET-23::GFP (EGFR) is most strongly expressed in the P6.p cell. LET-23::GFP localizes to both the apical and basolateral membranes. (c) Disruption of the LIN-2/7/10 complex in a lin-2(e1309) mutant results in exclusive apical localization of LET-23::GFP and a vulvaless (Vul) phenotype. Scalebar 10 μm. Figure 1.7b-c and accompanying descriptions were adapted from Gauthier and Rocheleau [101] with permission from Springer Nature (License number 4726691118792).

Whether as a complex, independently, or in alternate complexes, LIN-2, -7, and -10, and their homologues, have all been found to regulate the subcellular localization of numerous transmembrane proteins in polarized cells. In C. elegans, the LIN-2/7/10 complex is also known to regulate infection response through a direct interaction between LIN-2 and the insulin receptor

DAF-2; however, whether DAF-2 localization is altered has not been explored [121]. A homologous complex composed of CASK (Calcium/calmodulin-dependent Serine protein

Kinase), Lin7, and APBA1 (APP-binding family A member 1) has also been identified in mammalian neurons where it regulates synaptic localization of neurexin [122-125], the NMDA receptor subunit NR2B [126-128], the glutamate receptor interacting protein GRIP1 and associated signalling molecule PKCε [129], and 5-HT2C G-protein coupled receptor (GPCR)

[130].

LIN-2/7/10 protein interactions are conserved in Drosophila [131], though complex function has not been described in this organism. Individually, orthologous proteins regulate synaptic plasticity, neuronal development, and protein localization in flies [132-136]. In

Zebrafish, LIN-2 homologues regulate cerebellar development [115], and LIN-7 homologues regulate and maintain cellular polarity during neural tube and retinal development [137-139].

1.4.1 The protein domain structure of LIN-2, LIN-7, and LIN-10

LIN-2, LIN-7, and LIN-10 are multidomain proteins that share some common features, but are otherwise structurally distinct. Each contain different subtypes of PDZ (PSD-95/Dlg1/ZO-1) domains, and LIN-2 and LIN-7 both contain L27 domains, named for their discovery in mediating the LIN-2/7 interaction. LIN-7 is a small protein of roughly 23 kDa with only two protein subdomains, whereas LIN-2 and LIN-10 are around 100 kDa each with 6 and 4

29 subdomains, respectively. The LIN-2/7/10 complex has been well-defined biochemically: The C- terminal PDZ interaction motif of LET-23 interacts with the PDZ domain of LIN-7, an interaction that is conserved with mammalian ErbB2 and ErbB4. Interactions between LIN-7 and

LIN-2 are mediated by L27 domains, and the Calcium/calmodulin Kinase II (CaMKII) domain of LIN-2 interacts with the CASK-Interacting Domain (CID) of LIN-10 [84, 90, 112, 124, 140,

141]. (Figure 1.7a).

1.4.1.1 The PDZ domains of LIN-2, LIN-7, and LIN-10

PDZ domains are protein-protein interaction domains that recognize consensus sequences at the

C-terminal tip of their target proteins and are often involved in regulating localization of their partners. First identified in PSD95, Dlg1, and ZO-1, PDZ domains are a common feature of numerous scaffolding and adaptor proteins. PDZ domains vary greatly in amino acid sequence, but share a common structure of six β-barrel strands, two α-helices, and a V-shaped groove formed between the second β-strand and the second α-helix in which the ligand peptide forms an antiparallel β sheet with the β-strand [142-145]. Ligand peptide specificity is in large part determined by an amino acid residue following the second β-strand, and another residue at the start of the second α-helix [142, 146].

These domains are classified into three major subtypes according to their consensus recognition motif: Type I (e.g. LIN-7) PDZ domains recognize S/T–X–Φ (where Φ is a hydrophobic residue), such as the C-terminal -TCL residues of LET-23 EGFR [112, 147]. Type

II PDZ domains (e.g. LIN-2) recognize Φ–X–Φ, such as the -YYV recognition motif in mammalian neurexin (NRXN1) [123, 142, 147]. Type III PDZ domains recognize E/D–X–W–

C/S [147, 148].

LIN-10 and APBA proteins have tandem PDZ domains (PDZ1 and PDZ2) on their C- terminus, and often both domains are required to mediate interactions. Both PDZ domains are structurally distinct from other known PDZ domains and interact with their target motifs through an unconventional mechanism. The second α helix and β sheet of PDZ1 are antiparallel, leaving a smaller than usual peptide-binding groove, causing the peptide to insert itself almost perpendicularly [149]. PDZ2 is 10 to 20 residues shorter than most PDZ domains and consequently accommodates shorter peptide sequences. Therefore, these PDZ domains are not officially classified in any of the three main subtypes [149], although the consensus recognition motifs are most similar to Type III [150]. The PDZ1 domain recognizes X–W/F–L/I, and PDZ2 recognizes X–Φ–V/L/I, although PDZ2 sometimes interacts with hydrophilic or polar residues at the -1 position [150]. There is some flexibility and overlap in peptide recognition among PDZ domains. For example, although CASK and APBA proteins have different types of PDZ domains, both can interact with the C-terminal recognition motif of neurexin [122, 123].

1.4.1.2 LIN-2 and LIN-7 both have L27 domains

L27 domains were first defined for their role in mediating the LIN-2/7 interaction (Figure 1.7a), and have since been identified in several other proteins [112, 124, 151, 152]. Although LIN-2 homologues have two L27 domains, only its second L27 domain (L27C) interacts with the sole

N-terminal L27 of LIN-7 homologues. The first L27 domain (L27N) of LIN-2 is free to simultaneously interact with other partners, such as EPS-8 for LIN-2 [153] or Dlg1 (also known as Sap97) for CASK [154, 155]. There are two distinct subtypes of L27 domains, type A (e.g.

LIN-7) and type B (e.g. both domains of LIN-2), and only heterodimerization between different types can occur [155]. Tandem L27 domains, like those that exist in LIN-2 homologues and

PALS1, independently bind their respective partners, and these heterodimers then associate with each other to form a stable heterotrimer complex [155, 156].

1.4.1.3 LIN-2 and CASK are MAGUK proteins

LIN-2 homologues belong to the MAGUK (membrane-associated guanylate kinase) family of scaffold proteins, characterized by inclusion of a Src-homology-3 (SH3) domain, at least one

PDZ domain, and a catalytically inactive C-terminal guanylate kinase (GK) interaction domain

[157, 158] (Figure 1.7a). Many MAGUK family members also contain L27 domains, such as

Dlg1-3 and PALS1-3 [151, 154]. LIN-2 and CASK also have an N-terminal calcium/calmodulin kinase domain (CamKII) through which it interacts with LIN-10 and APBA1 [112, 124, 140,

141] (Figure 1.7a). The CamKII domain is generally thought to be a catalytically inactive pseudokinase that mediates protein interactions, although noncanonical Mg2+-independent kinase activity has been described for mammalian CASK against neurexin [159]. Calmodulin kinase II enzyme, although structurally similar to the CamKII domain of LIN-2 homologues, cannot interact with mammalian APBA1 on its own [141].

1.4.1.4 LIN-10 and APBA1 also share CID and PTB domains

N-terminal to the tandem PDZ domains, LIN-10 and mammalian APBA1-3 have a phosphotyrosine binding (PTB) domain (Figure 1.7a). PTB domains have high sequence divergence, yet share a common PH-domain fold structure: a β-sandwich of two antiparallel sheets, capped by an α-helix. Between the α-helix cap and the fifth β-sheet is the peptide binding groove, a defining feature of PTB domains [160]. PTB domains generally recognize NPXY consensus motifs, with some involvement for amino acids flanking this motif to enhance

32 specificity [160, 161]. Ligand peptides form a β-turn, enabling phosphotyrosine interaction with arginine residues in the PTB domain [160, 162]. The PTB domains of LIN-10 homologues belong to a class of domains that does not require phosphorylated tyrosine in their target peptide and instead relies on hydrophobic interactions in the peptide groove [162, 163].

Unique to LIN-10 and APBA1 is the CID in the variable N-terminal region, necessary for

LIN-2 and CASK interaction (Figure 1.7a). APBA1 and APBA2 have an additional domain absent from LIN-10 called the Munc18-interacting domain (MID) in their N-terminus that mediates synaptic vesicle fusion. APBA3 does not have CID or MID domains in its N-terminal region [164, 165].

1.4.2 Localization of LIN-2 CASK, LIN-7 Lin7, and LIN-10 APBA1-3

Where LIN-2/7/10 localize at the time of C. elegans vulval cell fate specification (that is, at the one-cell P6.p stage), and where the complex forms with its cargo LET-23 EGFR, is unknown.

Immunostaining for LIN-7 overexpressed under a heat-shock promoter revealed PDZ-dependent apical junction localization at the P6.pxx four-cell stage, after vulva cell fate has been induced

[90]. GFP-tagged LIN-7 also localized to cell junctions in live intestinal cells [90] (Figure 1.8).

LIN-2 localizes to neuromuscular junctions in muscle cells [166], and its localization in vulval cell lineages is unknown. In C. elegans vulval cells, LIN-10 immunostaining revealed punctate localization at the P6.pxx four-cell stage after vulva cell fate induction [167]. LIN-10 localizes to

Golgi ministacks and Golgi-adjacent recycling endosomes in C. elegans neurons and intestinal cells [167-169] (Figure 1.8).

The mammalian CASK/Lin7/APBA1 complex co-immunoprecipitates in synaptic plasma membrane fractions [124], although localization to synaptic membranes for all three complex

33 components has not been shown. Mammalian Lin7 and CASK colocalize at the basolateral membrane and cell junctions in epithelial cells [153, 170, 171]. CASK is also present in both presynaptic and postsynaptic compartments [136, 172], and has once been found in the cytosol where it colocalizes with APBA1 at perinuclear foci in neurons [140]. CASK and APBA proteins have also individually been found in cell nuclei [173-176]. Mammalian APBA proteins preferentially localize to the trans-Golgi network and dendritic Golgi outposts in neurons, and to the Golgi in epithelial cells [140, 177-179] (Figure 1.8).

Figure 1.8 Known localization patterns of LIN-2, LIN-7, LIN-10, and their orthologues (a) In epithelial cells, both mammalian Lin7 (mL7) and C. elegans LIN-7 (cL7) have been identified at cell junctions. mL7 also localizes to the basolateral membrane were it colocalizes with mammalian CASK (mL2), sometimes forming a complex. mL2 can also be found in the nucleus. C. elegans LIN-10 (cL10) has been found to localize to recycling endosomes in intestinal cells. Mammalian APBA proteins (mL10) localize to the Golgi and nucleus. (b) In neurons, mammalian CASK/Lin7/APBA proteins are localized in pre- and post-synaptic junctions. mL2 has been identified in perinuclear compartments and in the nucleus. mL10 localizes to the Golgi and nucleus. cL10 also localizes to Golgi ministacks.

1.4.3 Function of LIN-2, LIN-7, and LIN-10

The precise mechanism by which the LIN-2/7/10 complex regulates basolateral LET-23 EGFR localization remains unclear. Loss of function mutations in any individual complex component, or mutations in let-23 egfr that inhibit binding to LIN-7, result in exclusive apical localization of

LET-23 EGFR and loss of vulval cell fate induction [90, 112, 167, 180-182]. LIN-2 also interacts with EPS-8 (EGFR Pathway Substrate 8) via its L27N domain, likely while maintaining its interaction to LIN-7 [153]. Loss of EPS-8 or mutation of the L27N domain of LIN-2 that interacts with EPS-8 causes accumulation of LET-23 EGFR in intracellular punctae that colocalize with early endosome marker EEA1 [153], suggesting that EPS-8 interacts with LIN-2 to prevent internalization of LET-23 EGFR.

GLR-1, which has a type I PDZ interaction motif on its C-terminal end, is also localized to the basolateral membrane in a LIN-2/7/10-dependent manner when ectopically expressed in the VPCs, and is mislocalized to the apical membrane when the complex is mutated [183]. LIN-2 and LIN-7 are not required for GLR-1 localization in neurons, where it is endogenously expressed [183]. Fusion of the type I PDZ interaction motif to mammalian ErbB1 is also sufficient to localize the receptor to the basolateral membrane and activate vulval cell fate induction; without this motif, ErbB1 is localized to the apical membrane [107]. Therefore, the

LIN-2/7/10 complex play an important role in promoting basolateral membrane traffic; however, it is unclear if the complex is involved in secretion, membrane tethering, or recycling.

In mammalian neurons, the function of the CASK/Lin7/APBA1 complex is better understood. Specificity for cargo is determined by the PDZ domains of Lin7 and CASK.

Furthermore, CASK interacts with protein 4.1, an actin cytoskeleton-interacting protein, which helps anchor CASK to the cortex in the cell periphery and stabilizes cargo localization to the

36 plasma membrane [171, 184]. CASK has been implicated in protein sorting: its association with

Dlg1 targets NMDA receptor NR2B from the somatic ER to dendritic Golgi outposts, bypassing the default route to somatic Golgi, and enabling post-synaptic localization of NR2B [128].

APBA1 provides a direct link to protein trafficking. While maintaining its association to

CASK/Lin7, the PDZ domains of APBA1 interact with the dendritic-specific kinesin KIF17 to regulate NMDA receptor NR2B trafficking to synaptic termini [126, 128]. APBA1 can also simultaneously interact with CASK and Munc18, a SNARE-binding protein associated with exocytosis, to regulate neurexin trafficking [122, 164]. Munc18 likely transits with the

CASK/Lin7/APBA1 complex along secretory vesicles to synaptic membranes, where it exchanges its interaction with APBA1 for syntaxin, a Q-SNARE, to direct membrane fusion and exocytosis [185]. The yeast homologue of APBA1, Mso1p, directly interacts with phosphatidylinositol (4,5)-bisphosphate (PI(4,5)P2)-rich membranes to promote membrane fusion with Munc18 [186]; however, this mechanism is not fully understood, and the implications for conserved CASK/Lin7/APBA1 complex function are unclear.

Beyond the tripartite complex, LIN-2, -7, -10, and their homologues associate with an ever expanding network of proteins to regulate a broad range of cellular processes (Figure 1.9).

Some of these interactions and functions will be described throughout this subsection. The themes explored below are exemplary of the diversity of function and cellular regulation mediated by LIN-2, LIN-7, and LIN-10. Whether these interactions are involved in LIN-2/7/10 complex function in C. elegans remains to be explored.

Figure 1.9 Interaction network of Lin7, CASK, and APBA proteins Most of the known, functional interactions for Lin7, CASK, and APBA family of proteins are represented here, as described in section 1.4.3 and subsections. Most interactions have only been identified for mammalian proteins, and some have only been identified for specific paralogues.

1.4.3.1 Lin7 maintains polarized epithelial membrane composition

The function of LIN-7 in C. elegans has not been characterized beyond its association with LIN-

2 and LIN-10. In mammalian epithelia, Lin7 can interact with CASK, presumably independently of APBA1, to regulate polarized membrane localization of cargo proteins. For example, Lin7 and

CASK stabilize basolateral membrane localization of the Kir2.3 potassium channel in mammalian renal epithelial cells [187]. Lin7 also exists in alternate complexes, often involving other MAGUK proteins, and participates in cell polarity maintenance. Through its L27 domain,

Lin7 interacts with the L27C domain of PALS1, which interacts with PATJ via its L27N domain.

In this way, Lin7 is often associated with the Crumbs polarity complex at the apical cell junction

[154, 188]. Through this association, Lin7 PDZ domains recruit Insulin Receptor Substrate p53

(IRSp53), which serves as a scaffold to regulate actin cytoskeleton dynamics and Par polarity.

Together, Lin7 and IRSp53 regulate tight junction assembly during epithelial cell polarization

[189]. In addition, Lin7 interacts with the L27C domain of the MPP7 MAGUK to stabilize the localization of Dlg1 to cell junctions, a cell polarity regulator that interacts with MPP7 L27N

[135, 190]. Lin7 is also recruited to synaptic and epithelial cell junctions through a PDZ- mediated interaction with β-catenin in an actin-dependent manner [191].

Mechanistically, Lin7 has been implicated in basolateral recycling and transcytosis.

Nerve growth factor receptor (NGFR, P75) fused to the C-terminal PDZ interaction motif derived from C. elegans LET-23 EGFR (P75-LET-23) localizes to the basolateral membrane of cultured MDCK polarized epithelial cells due to the specific interaction between the C-terminal fusion and the PDZ domain of Lin7 [192]. P75 alone, or fused to a mutated PDZ interaction motif, localizes to the apical membrane. Lin7 does not influence the initial delivery of P75-LET-

23 to the basolateral membrane, but rather promotes the transcytosis of internalized P75-LET-23

39 from the apical membrane to the basolateral membrane through microtubule-dependent trafficking routes [192]. Although NGFR P75 is not a regular target of Lin7, basolateral targeting of internalized cargo has also been described for the endogenous Lin7 cargo γ-aminobutiric acid

(GABA) transporter (BGT) [193] and ErbB receptors [84], suggesting a conservation in Lin7 function. However, BGT and ErbB targeting involved recycling of cargo internalized from the basolateral membrane rather than transcytosis.

1.4.3.1.1 Lin7 and human EGFRs

ErbB4 has a conserved type I PDZ interaction motif that can also interact with mammalian Lin7.

ErbB2 has a degenerate version of the PDZ interaction motif that is sufficient to maintain interaction with the PDZ domain of Lin7 [84]. PDZ interaction of Lin7 and ErbB2 specifically promotes recycling of internalized receptor back to the basolateral membrane in cell culture, rather than the initial delivery to the membrane [84]. The involvement of CASK and APBA proteins in mammalian ErbB localization has not been characterized, although a large-scale study of PDZ-containing proteins found both Lin7 and CASK precipitating with ErbB4/Her4

[194]. However, CASK depletion does not disrupt ErbB1 or ErbB2 receptor localization in intestinal epithelia [195].

In addition to the PDZ interaction motif, Lin7A paralogue has also been found to interact with the tyrosine kinase domain of all four ErbB receptors, and therefore has a bivalent interaction with ErbB2 and ErbB4 [84]. This interaction is mediated by the N-terminal tip of

Lin7A which is only partly conserved in Lin7B-C and C. elegans LIN-7. Interaction with the kinase domain promotes the transit of receptor from the ER to the Golgi. Loss of the N-terminal amino acid residues of Lin7A sequestered both ErbB2 and the truncated Lin7A to the ER [84].

This means of regulating cargo trafficking has not been described for Lin7 in any other context, and full-length Lin7 has not been identified at the ER, so it is unclear if this is a conserved function of Lin7.

1.4.3.2 CASK regulates synaptic plasticity and basolateral membrane organization

CASK homologues have been implicated in cellular organization in neurons and epithelial cells, and in transcriptional regulation. In mammalian epithelial cells, CASK maintains basolateral localization of Lin7C isoform and Dlg1 in intestinal epithelia, but not the junctional localization of Lin7C [195].

In C. elegans, LIN-2 interacts with FRM-3 (EPB4.1, protein 4.1), an interaction that is conserved in mammals [171, 184], to regulate UNC-49 (GABA) at neuromuscular junctions

(NMJs) independently of LIN-7 and LIN-10 [166]. Furthermore, studies in Drosophila reveal differential function of CASK in pre- and postsynaptic NMJs. Loss of presynaptic CASK decreases synaptic vesicle cycling, number of synapses, and frequency of spontaneous synaptic events, with no change in overall NMJ size, whereas loss of postsynaptic CASK results in smaller glutamate-gated currents and loss of postsynaptic GluRIIA subtype of glutamate receptors [136].

CASK maintains synaptic junctions by regulating cell adhesion molecules. In addition to neurexin, mammalian CASK also regulates syndecan-2 to promote dendritic spine formation

[196, 197] and SynCAM (Synaptic Cell Adhesion Molecule) to promote synaptic formation and transmission [198] via PDZ domain interactions.

Neuronal CID-containing Caskin1 (CASK-interacting protein 1) competes with APBA1 for binding to CASK in vitro, and forms an alternative complex with CASK and Lin7 to regulate

41 neurexin localization [199]. Caskin1 is only found in a subset of CASK-expressing cells and likely provides some specificity for CASK function [200]. No Caskin1 orthologue has been identified in C. elegans or Drosophila.

Parkin, an E3 ubiquitin ligase associated with a juvenile-onset form of Parkinson’s disease, can interact with the PDZ domain of CASK. The function of this interaction remains unknown, and does not seem to alter protein stability or degradation of CASK [201].

The SH3 and GK domains of several MAGUK proteins, including CASK, Dlg1, PSD95, and p55, have been found to mediate intramolecular and intermolecular interactions. CASK can form homodimers or intramolecular interactions via its SH3 and GK domain, a feature shared with other MAGUK proteins such as Dlg1, PSD95, and MPP7 [202-204]. These interactions have not been detected for C. elegans LIN-2 [204, 205]. Intramolecular interactions regulate

PSD95 and Dlg1 interaction with other proteins, and the ability of PSD95 to form signalling clusters at synaptic junctions [203, 206, 207]. The finding of these intra- and intermolecular interactions pose interesting possibilities for dimerization and supramolecular structure formation among these scaffolding proteins.

1.4.3.2.1 Transcriptional regulation by CASK

In addition to regulating the localization of NR2B, CASK also upregulates its transcription

[208]. The NR2B gene locus is a target of the T-box receptor (Tbr-1) transcription factor, which interacts with the GK domain of CASK and unexpectedly translocates it to the nucleus [173,

208]. CASK GK domain also interacts with and recruits TSPYL2 (or CINAP), a nucleosome assembly protein whose protein levels decreased upon NR2B signalling activation [209].

Together, the Tbr-1/CASK/TSPYL2 complex regulate expression of Tbr-1 target genes, and participate in a negative feedback loop upon NR2B signalling activation [208, 209].

CASK has also been found in the nucleus of proliferating keratinocytes in newborn mice to restrict cell division and prevent hyperproliferation. In differentiating keratinocytes of adult mice as well as migrating and proliferating cells involved in wound healing, CASK relocates to the cytoplasm and plasma membrane to release its inhibition of cell proliferation [210].

1.4.3.3 LIN-10 and APBA1-3 regulate intracellular trafficking

Studies in worms and mammals show a role for LIN-10 and APBA in Golgi and endosomal trafficking. APBA proteins can regulate trafficking independently from CASK, Lin7, and

Munc18, and neuronal LIN-10 regulates trafficking independently of LIN-2/7 in C. elegans. A

C-terminal fragment of all three APBA paralogues encompassing a small portion of the PTB domain and both PDZ domains can interact with Golgi-associated Class I and Class II Arf

GTPases [211]. APBA coprecipitates with clathrin and Arf GTPases, and localizes to the Golgi in a Brefeldin A-sensitive manner, a drug that inhibits Arf Guanine Exchange Factors (GEFs)

[211, 212].

The PTB domain of an APBA1 isoform (APBA1 826) and APBA3 can also interact with the Rab6 GTPase, a small GTPase involved in retrograde trafficking and Golgi-associated recycling pathways, and this interaction may be necessary for the transport of amyloid precursor protein (APP) in Rab6-positive vesicles [213-215]. C. elegans LIN-10 PTB domain can also interact with the homologous RAB-6.2 GTPase to regulate the recycling of the AMPA-type glutamate receptor, GLR-1, described below [169].

1.4.3.3.1 C. elegans LIN-10 regulates glutamate receptor trafficking in neurons lin-10 mutants were initially characterized as having no phenotype other than vulval dysregulation [109, 216]. Closer examination revealed mild uncoordinated phenotypes: mutants are less likely to change direction after being touched on the nose, and they make fewer reversals than wildtype worms [183]. These phenotypes are due to dysregulation of glutamate receptor

(GLR-1) trafficking in C. elegans interneurons [183]. LIN-10 promotes the synaptic localization of GLR-1 by regulating its targeting and recycling after clathrin-mediated endocytosis through a

Golgi-associated retrograde recycling pathway, mediated in part by RAB-6.2 GTPase [169, 217].

Both PDZ domains of LIN-10 are also required for its regulation of GLR-1 through an undefined mechanism [168]. LIN-10 punctate localization to Golgi ministacks, which is necessary for its ability to regulate GLR-1, is promoted by N-terminal hydroxylation by the prolyl hydroxylase

EGL-9 [218] and interaction with RAB-6.2 [169], and is inhibited by N-terminal phosphorylation by CDK-5 [219]. LIN-10 has not been found to directly interact with GLR-1, and how LIN-10 is molecularly linked to GLR-1 remains unclear.

1.4.3.3.2 Mammalian APBA regulates APP trafficking and processing

APBA proteins have been extensively studied for their regulation of APP (Amyloid Precursor

Protein) in neurons. APP is a broadly expressed membrane glycoprotein with particularly high expression at synapses, and is best known for its role in Alzheimer’s disease pathogenesis as a precursor of amyloid β (Aβ). Physiologically, APP is associated with promoting general health of cells, and regulates synaptogenesis, cell and neurite growth, and cell survival [220, 221]. After secretion to the plasma membrane, APP is preferentially processed by proteolytical cleavage associated with the non-amyloidogenic pathway. This is mediated by α-secretase and γ-secretase,

44 and produces a soluble extracellular domain and an intracellular domain that can activate transcription in the nucleus. Remaining uncleaved APP is internalized and transits through early endosomes and the trans-Golgi network. Internalized APP is preferentially processed by amyloidogenic β-secretase and γ-secretase, releasing pathogenic Aβ fragments, which are recycled back to the surface where they aggregate and form amyloid plaques, a hallmark of

Alzheimer’s disease pathology [222, 223].

The PTB domains of all three APBA paralogues interact with APP to regulate its internalization, sorting, secretion, and recycling [119, 224-226]. Most studies have used overexpression of APBA proteins and found that APBA generally inhibits Aβ secretion by regulating its trafficking. This is in part mediated by a direct interaction between APBA proteins and γ-secretase subunit presenilin-1 [227-229], allowing for specific processing of APP. On the other hand, loss of APBA proteins is also associated with a decrease in Aβ production and amyloid plaque formation. This occurs independently of γ-secretase, and involves regulation of

β-secretase function [230]. This might be related to the interaction of APBA1 with the copper chaperone for superoxide dismutase 1 (CCS) [231, 232], which in turn interacts with β-secretase

[233]. How APBA proteins both positively and negatively regulate Aβ is unclear, but is likely related to regulation of APBA function. For example, N-terminal phosphorylation of APBA2 by

Src kinase targets internalized APP for degradation, whereas unphosphorylated APBA2 promotes APP recycling and Aβ secretion [234]. Src phosphorylation of APBA1 instead recruits

APP from axons and dendrites into the somatic Golgi [235]. The function of APBA proteins is further regulated by its association with specific interacting partners. For example, CASK has been found in a complex with APBA1 and APP in presynaptic termini, likely to promote synaptic adhesion [236]; however, CASK is not involved in the regulation of β-secretase

45 cleavage by APBA1 [230]. The effector interactions and regulation of APBA proteins that help differentiate their diverse tasks are not fully understood.

1.4.3.3.3 LIN-10 homologues, hypoxia, and transcriptional regulation

The regulation of GLR-1 trafficking by LIN-10 in C. elegans interneurons is sensitive to oxygen levels due to the response of the EGL-9 prolyl hydroxylase to hypoxia. Under low oxygen conditions, EGL-9 is suppressed and unable to hydroxylate LIN-10, which can then be phosphorylated by CDK-5, displaced from synaptic sites, and unable to promote GLR-1 recycling [218].

The undefined N-terminal region of APBA3 interacts with and sequesters the prolyl hydroxylase FIH-1 (Factor Inhibiting HIF-1α) at the Golgi (factor inhibiting HIF-1), assisted in some cells by an interaction between APBA3 PTB domain and NECAB3 (N-terminal EF-hand

Calcium Binding protein 3) to promote hypoxia-mediated signalling pathways in cancer cells and macrophages. These interactions prevent FIH-1 from hydroxylating HIF-1α (Hypoxia-Inducible

Factor 1 α), targeting it for degradation [237-239]. Independently of FIH-1, APBA3 suppresses hypoxia-induced apoptosis in epithelial cells by downregulating the transcriptional expression of

NF-κB p50, an inhibitory isoform that suppresses the anti-apoptotic pathways associated with

NF-κB signalling [240].

Nuclear function has also been reported for APBA1: through its PDZ domains, APBA1 interacts and colocalizes with the FSBP (Fibrinogen Silencer Binding Protein) transcription factor in neuronal nuclei to inhibit GSK3β (Glycogen Synthase Kinase 3 β) gene expression

[174]. GSK3α increases Aβ formation and phosphorylates tau, thereby promoting tauopathy and neurofibrillary tangle formation, a second hallmark of Alzheimer’s disease [241]. Moreover,

APBA1 and APBA3 both differentially interact with the transcriptional coactivators TAZ and

YAP: interaction with APBA1 keeps these coactivators sequestered in the cytoplasm, whereas

APBA3 translocates with intracellular APP and either TAZ or YAP to the nucleus to activate

APP-mediated transcription [150].

1.4.3.3.4 APBA in non-neuronal cells

APBA1-3 are all expressed in neurons and insulin-secreting pancreatic β-cells. Munc18 is also expressed in β-cells, and together with APBA1-2 regulates insulin secretion, suggesting that β- cells use similar machinery for insulin secretion as neurotransmitters [242, 243]. APBA1 and

APBA2 were long thought to be neuron and β-cell-specific; however, preliminary analysis from the Human Proteome Atlas, a large scale project aimed at mapping all human cellular proteins, has found expression of these two genes in other non-neuronal tissues, including liver, ovaries, lung, intestinal, breast, and epidermal tissue [244] (Human Protein Atlas available from http://www.proteinatlas.org). APBA1 was also recently shown to be expressed in homogenates isolated from mouse testis, lung, and paranephros [245]. The function or expression of APBA1 in these tissues has not yet been characterized.

In epithelial cells, the PDZ domains of APBA3 interact with Bcr (Breakpoint Cluster

Region), initially characterized for a chromosomal translocation of its gene loci that causes chronic myelogenous leukemia [246, 247]. Bcr is apically localized, and colocalizes with

APBA3 at perinuclear punctae and intracellular vesicles, though the function of this interaction is unknown [248]. Furthermore, exogenous expression of APBA3 and APP in HeLa cells results in

APBA3-mediated basolateral localization of APP [212], suggesting APBA3 may regulate

47 basolateral targeting of proteins in epithelial cells. The function of APBA proteins in regulating subcellular organization of non-neuronal cells has been otherwise poorly explored.

1.4.3.3.5 Regulation of LIN-10 APBA

The multifaceted regulation of APP processing by APBA can in part be explained by post- translational modifications and intramolecular interactions among APBA paralogues. Between the PTB domain and the PDZ1 domains of APBA proteins exists a flexible linker or Arm domain that, in APBA1 and APBA2, folds back and inserts into the peptide-binding groove of the PTB domain, where an NPXY motif in the linker specifically interacts with the PTB domain [249,

250] (Figure 1.10). This interaction blocks APP binding, and is relieved by phosphorylation of the tyrosine in the NPXY motif of the linker, which causes the linker to swing away from the

PTB domain [249, 250]. A second autoinhibitory interaction exists between the C-terminal tail of

APBA1/2 and its PDZ1 domain, in which the C-terminal residues of APBA1/2 insert into the peptide-binding groove of PDZ1 to block association of other interacting partners [149].

Although homodimerization is possible, intramolecular interactions are favoured.

Phosphorylation of a conserved tyrosine residue in the C-terminal tail inhibits interaction with

PDZ1, and instead favours a PDZ2 interaction, resulting in enhanced binding to PDZ1-target proteins [149]. Both PTB and PDZ autoregulatory “closed” conformations were identified together in a crystal structure of APBA2, and an amino acid interaction was identified between the two domains (Figure 1.10b, d), which may help stabilize closed, autoinhibited states [250].

Although these conformations have not been examined in C. elegans, a yeast two-hybrid screen of interacting proteins revealed interaction between LIN-10 proteins [205].

Regulation of the N-terminal domains also modulates LIN-10 function in C. elegans. A proline residue in LIN-10b isoform (P27), N-terminal to the CID, is required for rescue of mutant lin-10 function in both vulval development and GLR-1 trafficking [168]. Importance of

N-terminal regulation is further demonstrated by the finding that fusing the N-terminal domains of APBA1 to the C-terminal PTB and PDZ domains of APBA2 successfully rescues lin-10 function in regulating GLR-1 trafficking, whereas full-length APBA2 or a chimeric protein generated by fusing the inverse domains fails to rescue lin-10. This suggests that the N-terminus of APBA1 equips the C-terminus of APBA2 with important regulatory domains necessary for regulation of GLR-1 [168]. This likely involves post-translational modification that regulate

APBA function, such as Src phosphorylation, as described above [234, 235].

Figure 1.10 Mammalian APBA proteins have autoregulatory interactions in their PTB and PDZ domains (a) Protein domain structure of APBA1-3 (Mint1-3). ARM domain is the flexible linker between the PTB (Phosphotyrosine Binding Domain) and PDZ1 (first PSD95/Dlg1/ZO-1-like domain). MI: Munc18 Interaction domain. CI: CASK Interaction domain. (b) Structure of the closed, autoinhibited state for PTB: the linker region (red) occupies the peptide binding groove of the PTB domain (blue). Autoinhibited PDZ1 (orange) conformation was also identified in which the C-terminal resides (purple) insert into the peptide binding groove. PDZ2 (green) is not shown. (c) Molecular interactions between the linker region and the PTB domain. (d) An interaction between the PTB domain and PDZ1 in their closed conformations was identified following protein crystallization. This figure was acquired from Xie et al. [250] with permission from Oxford University Press (License number 4726691496597).

1.5. Spatial regulation by small GTPases

The Ras superfamily of small GTPases serve as master regulators of numerous aspects of cellular biology, including membrane trafficking, cytoskeletal rearrangements, and cell signalling.

Intracellular trafficking networks play an essential role in regulating cellular organization and cellular polarity.

The Ras superfamily is divided into five main families: Ras, Rho, Ran, Rab, and Arf

[251]. Ras GTPases are central activators of signalling cascades that promote cellular proliferation and cell growth. In addition to activating MAP kinases, Ras can also signal through the PI3K/AKT pathway. The Rho family consists of Rho, Rac, and Cdc42, and together these small GTPases regulate the actin cytoskeleton. Ran GTPases coordinate entry and export of select cargo across the nuclear membrane. Rab GTPases are major regulators of membrane trafficking and help define specific endocytic vesicles. There are over 60 Rabs identified in humans [252], and 31 in C. elegans [253]. Finally, the Arf GTPase family, comprising Arf, Arl, and Sar GTPases, play an important role in regulating cellular organization by coordinating

Golgi secretion, ER-to-Golgi traffic, and endocytic recycling. Arf GTPases often intersect with the Rab and Rho family of GTPases to regulate trafficking, actin cytoskeleton dynamics, and focal adhesion sites.

GTPases are often described as molecular switches: in their active GTP-bound state, they interact with effector proteins to perform specific functions in cellular processes. Hydrolysis of

GTP to GDP renders the GTPase unable to interact with their effectors and often causes them to dissociate from membranes, thereby disabling their cellular function. GTP hydrolysis by small

GTPases is rate-limiting and inherently inefficient; therefore, a GTPase-Activating Protein

(GAP) is required to catalyze the reaction [254]. GAPs are characterized by a catalytic arginine

51 that forms a hydrogen bond with the γ-phosphate of GTP, mediating a transition state and catalyzing GTP hydrolysis. In order to be activated once more, a Guanine nucleotide Exchange

Factor (GEF) is required to remove the GDP from the small GTPase, leaving the nucleotide binding-site open. Small GTPases have similar affinity for both GDP and GTP; however, because the concentration of soluble GTP is roughly 10-fold higher than GDP in the cytosol,

GTP is most likely to associate with the free nucleotide binding site [255].

1.5.1 Membrane trafficking regulation of C. elegans vulval cell fate induction

Proteins involved in intracellular trafficking have emerged as important regulators of LET-23

EGFR signalling during vulval cell fate induction. For example, our lab has identified the late endosome-associated RAB-7 GTPase and the dynein heavy chain subunit DHC-1 as negative regulators of LET-23 EGFR signalling [256, 257] (Figure 1.11). Mutations in these genes cause

LET-23 EGFR to accumulate at cytosolic punctae. In a lin-2 mutant, this accumulation of LET-

23 EGFR-positive punctae is associated with rescue of signalling and vulval development [256,

257], suggesting that these punctae are likely signalling endosomes.

The AP-1 clathrin adaptor complex subunit UNC-101 has also been characterized as a negative regulator of LET-23 EGFR signalling [258]. AP-1 localizes to the trans-Golgi network where it recruits clathrin to promote secretion and membrane trafficking [259]. Consistent with

AP-1 working alongside Arf GTPases, our lab has also found that Class I and Class II Arf

GTPase, as well as a putative Arf1 GEF AGEF-1 negatively regulate LET-23 EGFR signalling, and that both AGEF-1 and AP-1 subunit UNC-101 antagonize basolateral receptor targeting [91,

258] (Figure 1.11). Hypomorphic mutations in agef-1 impair polarized sorting of LET-23 EGFR by decreasing apical fluorescent intensity of a LET-23::GFP transgene, suggesting AGEF-1 may

52 be involved in apical targeting of the receptor. Furthermore, ectopic expression of ARF-1.2 suppresses vulval cell fate induction in agef-1; lin-2 double mutants [91], suggesting that,

AGEF-1 opposes LET-23 EGFR signalling by promoting activation of the ARF-1.2 GTPase.

The mobility of LET-23 EGFR on membranes is an additional factor in modulating signalling propagation. For example, β integrin homologue PAT-3 restricts LET-23 EGFR activation by recruiting talin to the basolateral membrane, which in turn promotes actin polymerization in the cell cortex (Figure 1.11). This process results in reduced receptor mobility, which likely limits receptor clustering or recycling, and ultimately promotes signalling attenuation [260].

Figure 1.11 Modulation of LET-23 EGFR signalling by membrane trafficking and cytoskeleton regulators Dynein and RAB-7 downregulate LET-23 EGFR signalling, likely by promoting its passage to the late endosome/lysosomal pathway for degradation. Active integrins (PAT-3) recruit talin to polymerize actin in the cell cortex and inhibit the mobility of LET-23 EGFR, likely preventing signalling propagation and recycling of the receptor. Finally, The AGEF-1/Arf/AP-1 pathway works in opposition to the LIN-2/7/10 complex (not shown) to either promote apical targeting or inhibit basolateral targeting of LET-23 EGFR.

1.5.2 Arf GTPases and their regulators mediate several steps of cellular organization

The Arf family of GTPases play a broad role in cellular trafficking and organization, and often intersect with other small GTPases. The Arf family is further divided into Class I, II, and III Arfs

(based on sequence homology); Arf-like (Arl); and Sar1 GTPases [261]. Class I and II Arfs and

Arl GTPases are associated with Golgi secretion and retrograde recycling, Class III Arfs regulate endocytic recycling and the actin cytoskeleton, and Sar1 regulates ER-to-Golgi traffic. Arls are also associated with microtubule regulation, mitochondrial membranes, and lysosomes [262]

(Figure 1.12). Unique among the Ras superfamily is the ability of Arf GTPases to recruit and interact with coat proteins [263]. Furthermore, Arf GTPases lack any intrinsic GTPase activity.

Therefore, in order to transition to the inactive GDP-bound state, Arf GTPases rely exclusively on an Arf GAP [262, 264, 265].

Figure 1.12 Cellular roles of Arfs and their associated GEFs and GAPs Arf GTPases and their regulators play diverse role in cellular maintenance. Of note, Class I/II Arf GTPases regulate secretion from the Golgi, retrograde Golgi-to-ER traffic, and retrograde endosome-to-Golgi traffic. Class III Arf GTPase regulates endocytosis and recycling pathways. ArfGAP1-3 help regulate trafficking from the Golgi with Class I/II Arfs and Arl GTPases. ArfGAP3 also regulates trafficking from endosomes for recycling. ACAP, AGAP, ASAP, SMAP, and ARAP regulate endocytosis at the plasma membrane and regulate endosomes. GIT proteins are also near the plasma membrane. ELMOD proteins regulate trafficking from the endoplasmic reticulum and lipid droplets. This figure was acquired from Sztul et al. [262] and is freely distributable under Creative Commons License.

1.5.2.1 Class I and II Arf GTPases regulate Golgi trafficking

Class I Arfs consist of Arf1, -2, and -3, although Arf2 is not found in humans. In C. elegans, this class is represented by ARF-1.2. Class II Arfs consist of Arf4 and -5, or C. elegans ARF-3. C. elegans also has an ARF-1.1 GTPase that does not have specific homology to other Arfs, and may be a nematode-specific GTPase [91, 261].

GTP-bound Class I and II Arfs recruit the AP-1 clathrin adaptor complex and COPI coatomer complex to Golgi membranes for secretion and Golgi-to-ER retrograde trafficking, respectively [262]. Arf1 can further facilitate vesicular transport by recruiting Cdc42 GTPase to trigger cytoskeleton remodeling near the Golgi [266, 267]. Arf1 and Arf4 are also implicated in endosome-to-Golgi retrograde recycling pathways through their regulation of recycling endosome morphology and trafficking [268]. In this way, Class I/II Arfs directly promote trafficking to and from the Golgi (Figure 1.12).

1.5.2.2 Class III Arf6 GTPase regulates recycling and the cytoskeleton

Arf6 (or ARF-6 in C. elegans) is the sole member of the third class of Arf GTPases and functions mostly at the plasma membrane, where it is involved in endocytosis and recycling

[261] (Figure 1.12). Arf6 can alter lipid membrane composition to promote clathrin-mediated endocytosis by activating the phosphoinositide 5-phosphate (PI(5)P) kinase (PIP5K) to generate

PI(4,5)P2 [269-271]. Internalized cargo can then be sorted and recycled through Arf6-mediated pathways involving numerous effectors, including Rab22 and Rab35 GTPases, the secretion- regulating exocyst complex, and redox-sensitive APE1 endonuclease [272-275].

Arf6 also works in cytoskeleton remodelling and has been implicated in cancer for driving metastasis and invasion. In response to EGFR signalling, Arf6 promotes membrane

57 ruffling at the cell cortex by engaging actin cytoskeleton regulators and activating Rho/Rac

GTPases, which promotes metastasis in cancer cells [276]. The Arf6 GAP ASAP1 works as an effector of Arf6, along with the Arf6 GEF GEP100, to promote breast, renal, and lung cancer tumorigenesis through EGFR signalling, forming the EGFR-GEP100-Arf6-ASAP1 axis [277-

280]. Arf6 further enhances metastatic potential through integrin and cadherin recycling to promote focal adhesion and actin cytoskeleton rearrangements [280-283]. Integrins are transmembrane proteins that directly interact with ECM components, such as laminin in the basement membrane, and can regulate cell signalling pathways and regulate the cytoskeleton through the recruitment of actin filament-binding proteins talin and vinculin [284].

1.5.2.3 Arf GAPs regulate diverse cellular dynamics

Arf GAPs are important regulators of Arf-mediated processes. They mediate vesicle budding from the Golgi, recycling endosome maturation, establishment of focal adhesion sites, and actin polymerization at the cell cortex [262, 285] (Figure 1.12). They play prominent roles in membrane trafficking and cell migration. Most Arf GAPs have several functional domains in addition to their GAP domain that mediate protein-protein interactions and lipid interactions, enabling them to participate in a range of cellular processes [286]. Although many Arf GAPs have higher affinity for certain members of the Arf GTPase family, it is not uncommon for Arf

GAPs to regulate several Arf GTPases in vitro and in vivo, though few are catalytically active against Arl and Sar GTPases [287].

1.5.2.3.1 Classification and protein structure of Arf GAPs

Arf GAPs are classified into ten major subtypes according to their structure and function (Figure

1.13). ArfGAP1 (Gcs1p in yeast), ArfGAP2/3 (Glo3p in yeast), SMAP1/2, AGFG1/2, ADAP1/2, and GIT1/2 each have an N-terminal Arf GAP domain. ASAP1-3 (also known as AMAP or

Centaurin β3-4), ARAP1-3, ACAP1-3, and AGAP1-11 (also known as PIKE, or PI3K-enhancer) are more complex proteins with a centrally located GAP domain flanked by several other functional domains [286].

ArfGAP1 and ArfGAP2/3 were among the first to be studied. In C. elegans, these GAPs are represented by the uncharacterized C. elegans proteins K02B12.7 and F07F6.4, respectively.

ArfGAP1 has tandem C-terminal lipid packing sensor domains, whereas ArfGAP2/3 have coatomer and SNARE binding sites and a Glo3p regulatory region in their C-terminus [262].

SMAP, or W09D10.1 in C. elegans, is an Arf6 GAP characterized by a C-terminal CALM binding domain and a central clathrin box [288, 289]. GIT1 and GIT2 were first identified as

GPCR kinase-interacting proteins that were soon found to have Arf GAP activity for all three classes of Arf GTPases, with strongest activity for Arf6 [290-292]. Both are represented by GIT-

1 in C. elegans and include ankyrin repeats, Spa2 Homology Domain, and a coiled-coil region, flanked by paxillin binding sites (Figure 1.13).

ACAP and AGAP, homologous to C. elegans CNT-1 and CNT-2, respectively, are both

Centaurin-type Arf GAPs, named after the mythological centaur due to their complex multidomain structures [293, 294]. ACAPs are Arf6 GAPs that represent the Centaurin β1-2 family, whereas AGAPs are primarily Arf1 and Arf5 GAPs of the Centaurin γ family [295-297], although AGAP3 has also been found to regulate Arf6 activity [298]. Both protein families contain a GAP domain flanked by a PH (Pleckstrin Homology) lipid-binding domain and

59 ankyrin repeats on the C-terminus, but differ greatly on their N-terminus: ACAP has a coiled- coil BAR (Bin/Amphiphysin/Rvs) domain on its N-terminus that recognizes lipid membrane curvature, whereas AGAP has a GTPase-like domain (GLD) [294] (Figure 1.13). The GLD domain is catalytically active in Drosophila CenG1A, and its GTPase activity is catalyzed by its own GAP domain to regulate larval developmental timing [299]. In contrast, although mammalian AGAP GLD domain can interact with GTP, its GTPase activity is largely impaired.

Instead, the GLD domain mediates protein binding and allosterically regulates GAP activity

[300, 301].

ASAP, AGFG, ADAP, and ARAP do not have known paralogues in C. elegans. ASAP, like ACAP, has a BAR domain, PH domain, and ANK repeats, but is distinguished by an SH3 domain on its C-terminus. ASAP represents a group of Arf6 GAPs, though some also have activity for Class I and Class II Arfs and can promote Arf6 function in a GAP-independent fashion [278, 285]. AGFG is named for the FG (phenylalanine and glycine) repeats on its C- terminus, and ADAP has dual PH domains following its N-terminal GAP domain. ARAP is unique in that it also contains a Rho GAP domain, in addition to a SAM (Sterile Alpha Motif) domain, ankyrin repeats, a Ras association motif, and five PH domains dispersed throughout the relatively large protein [262] (Figure 1.13).

Finally, a non-conventional type of Arf GAP has recently been characterized that lacks any apparent GAP domain: ELMOD1-3 (Engulfment and cell Motility Domain-containing protein 1-3). Although ELMOD proteins do not have a consensus GAP motif, their ELMO domains have a catalytic arginine that has GAP activity for Arls, Arf1, and Arf6 [302-304]. The uncharacterized protein C56G7.3 in C. elegans is homologous to the mammalian ELMOD proteins. Related to ELMOD are PH domain-containing ELMO1-3, the first proteins in which an

ELMO domain was found [305]. Unlike ELMOD, ELMO proteins do not have Arl2 GAP activity [302], although GAP activity for other Arfs or Arls has not been tested. ELMO was first discovered in C. elegans as CED-12, and forms a complex with Dock180 that functions as a

Rac1 GEF. ELMO, Dock180 and Rac1, along with CrkII regulate actin cytoskeleton dynamics to promote engulfment of apoptotic cells [305, 306].

Figure 1.13 Arf GAP protein domains and classification Protein domains of the ten groups of Arf GTPase Activating Proteins (GAPs). A: ArfGAP lipid- packing sensor. Ank: Ankyrin repeats. BAR: Bin/Amphiphysin/Rvs domain. BoCCS: Binder of Coatamer, Cargo, and SNARE. CALM BD: CALM Binding Domain. CB: Clathrin Box.

(E/DLPPKP)8: 8 repeats of this amino acid sequence. FG repeats: Phenylalanine and glycine repeats. GLD: GTPase-Like Domain. GRM: Glo3 Regulatory Motif. PH: Pleckstrin Homology domain. PBS: Paxilin Binding Site. Pro Rich: Proline rich region. RA: Ras association site. SAM: Sterile Alpha Motif. SH3: Src Homology domain. SHD: Spa Homology Domain. This figure is adapted from Sztul et al. [262] and is freely distributable under Creative Commons License.

1.5.2.3.2 Arf GAPs regulate trafficking and actin remodelling

Arf GAPs modulate Arf function in several ways. Like most GAPs, they can inhibit Arf activity by hydrolyzing GTP and inactivating their target GTPase. This is needed to remove Arf GTPases from endomembrane compartments to make way for other small GTPases during endosome recycling, or to terminate Arf-mediated signalling pathways. Arf GAPs are also temporally required for Arf function, such as in membrane trafficking, by promoting Arf cycling. Whereas

GAP activity early in the vesicle budding process would inhibit Arf activity and coat formation,

GTP hydrolysis is required once vesicle budding is complete to release Arfs and the coat complex to allow for vesicular trafficking. Finally, Arf GAPs can also serve as effectors of Arf

GTPases and other small GTPases, independently of their GAP activity [262, 287]. Their multidomain structure and dynamic regulation of Arf GTPases enable Arf GAPs to participate in numerous cellular processes, especially in trafficking pathways and actin remodelling.

1.5.2.3.2.1 Arf GAPs in trafficking and recycling pathways

Arf GAPs serve as both negative and positive regulators of membrane trafficking. GAP activity can inhibit Arf-mediated coat assembly and block vesicle formation; however, Arf GTP hydrolysis is required once the vesicle is formed for regular vesicle transport. For example, the yeast homologues of ArfGAP1 (Gcs1p) and ArfGAP2-3 (Glo3p) have been found to interact with and activate SNARE complexes that mediate vesicle fusion, which in turn recruit Arf1 and the coatomer complex, and Glo3p GAP activity is required after vesicle formation to inactivate

Arf1 [307, 308]. In addition, mammalian ArfGAP3 is implicated in early-to-late endosome trafficking by targeting cargo for retrograde trafficking through the Golgi by recruiting the Arf1 effector GGA and promoting vesicle formation [309]. On the other hand, GIT1 GAP activity

63 inhibits internalization of β2-adrenergic receptor, which restricts its signalling activation due to lack of receptor resensitization through recycling pathways [290].

In postsynaptic neurons, AGAP3 is part of the NMDA receptor complex and inhibits

Arf6 function and Ras/ERK signalling, and is involved in AMPA receptor trafficking [298].

Homologous CenG1A in Drosophila instead blocks neuronal signalling by inhibiting synaptic vesicle recycling and neurotransmitter release in the presynaptic terminal, and inhibiting release of retrograde signal that stimulates neurotransmitter release from the presynaptic terminal [310].

ACAP1 has been found to be part of a clathrin coat complex that regulates integrin and glucose transporters [311]. In mammals and in worms, CNT-1 orthologues serve as Rab35

GTPase effectors to inactivate Arf6 to regulate membrane traffic during phagosome formation and neurite outgrowth [312-316]. In C. elegans, CNT-1 also works as an effector of the basolateral recycling regulator RAB-10, which recruits CNT-1 and the RAB-5 GAP TBC-2 to inactivate ARF-6 and RAB-5, respectively, to promote recycling pathways [317]. CNT-1 has been found to regulate cell signalling in neurons fated to undergo apoptosis, likely independently of its GAP function. CNT-1 is cleaved by cell-death regulator CED-3 (Caspase 3), and the PH domain of its truncated N-terminal fragment outcompetes Akt kinase for binding to PI(3,4,5)P3, thereby suppressing Akt-mediated cell survival pathways [318]. Full-length mammalian ACAP2 can interact with PI(3,4,5)P3, and promotes apoptosis in colorectal cancer cells, though whether

ACAP2 is cleaved similarly to C. elegans CNT-1 or disrupts Akt signalling is unknown [319].

ACAP2 expression is downregulated in esophageal cancers, leukemia, and lymphoma, which may have a tumorigenic effect in these cancers due to loss of pro-apoptotic signalling. On the other hand, ACAP2 is upregulated in certain breast, kidney, lung, and ovarian cancers, though the impact on tumorigenesis is unclear [319]. Moreover, in contrast to the relationship between

C. elegans CNT-1 and Akt, mammalian ACAP1 requires phosphorylation by Akt for its regulation of integrin recycling, which may contribute to metastatic potential of cancer cells

[320].

1.5.2.3.2.2 Arf GAPs regulate adhesion complexes and actin remodelling

Several Arf GAPs regulate cell adhesion and cytoskeleton dynamics by regulating integrin recycling, or by intersecting with Rac/Rho/Cdc42 to regulate actin remodelling, typically through Arf6-mediated processes. For example, ArfGAP1, which catalyzes Arf1 GTPase ativity, can also act as an Arf6 GAP to inhibit Rac1 activation and stabilize formation of cortical actin foci [321].

ACAP1 and ARAP2 regulate integrin recycling through distinct mechanisms. ACAP1 regulates Arf6-positive tubular recycling endosomes, whereas ARAP2 associates with Arf6- positive recycling endosomes that also contain APPL1 [322]. ACAP3 GAP activity is required to regulate neuronal migration in developing murine cerebral cortex, though whether this involves integrin recycling pathways remains to be tested [323]. ASAP is also an important regulator of integrin recycling, though its precise mechanism remains unclear.

Arf6 inhibition by GIT1 causes reduced Rac1 activation, thereby blocking Rac1 inhibition of integrin adhesion complex stability [324, 325]. GIT2 can reduce Rac1 activation through an undefined Arf6-independent pathway [326]. On the other hand, GIT1 promotes focal adhesion turnover by activating Rac through its association with the Rac and Cdc42 GEF PIX, as well as Paxillin and PAK (p21 associated kinase), to enable cell migration and serve as a scaffold to promote Erk signalling [327-329]. This complex is conserved in C. elegans, and regulates migration and pathfinding of the distal tip cell, a stem cell that develops the hermaphroditic

65 gonad [330, 331]. Through these diverse mechanisms, regulation of integrins and focal adhesion complexes implicate Arf GAPs in cell migration, growth, shape, and signalling.

Figure 1.14 Arfs and Arf GAPs are involved in endocytosis, recycling, secretion, and actin cytoskeleton organization Arf GAPs regulate integrin recycling to coordinate adhesion and cell migration. AGAP proteins destabilize integrins in focal adhesion complexes, promoting their internalization. ACAP proteins promote the recycling of integrins. GIT proteins inhibit Rac1 activation to allow for nascent adhesion complex to transition into focal adhesion complexes. This figure was acquired from Vitali et al. [285] and its reproduction in a thesis or dissertation is allowed by the publisher Taylor & Francis.

1.6. Rationale and objectives

My primary research objective is to use C. elegans vulval cell fate induction as a model to analyze regulators of the subcellular organization of the LET-23 EGFR signalling pathway. In particular, I will focus on characterization of the LIN-2/7/10 complex, and I will describe a preliminary analysis in identifying an ARF GAP involved in regulating VPC induction.

Although vulval cell fate has been well characterized, there remains several important questions about its regulation, particularly by the LIN-2/7/10 complex.

Objective 1: Perform an in vivo analysis of LIN-2/7/10 complex to identify its subcellular localization and dynamics in the VPCs.

The evolutionarily conserved LIN-2/7/10 complex is an important regulator of polarized protein localization in C. elegans VPCs and mammalian neurons. However, its subcellular localization, and where it intersects with its cargo, remain unknown. Furthermore, the distinct localization patterns of mammalian Lin7 at membranes and of APBA1 at the Golgi raises important questions about the nature and stability of complex formation. The subcellular localization of the LIN-2/7/10 complex would also offer insight into whether the complex might function in membrane tethering or intracellular sorting pathways.

Objective 2: Perform a functional analysis of the LIN-2/7/10 complex components to better understand how the complex regulates polarized distribution and signalling of LET-23

EGFR.

Mechanistically, the regulation of neurexin and NMDA receptor targeting to synaptic membranes by the mammalian CASK/Lin7/APBA1 complex has been well characterized

68 through interactions of the cargo with CASK and Lin7, and interaction of APBA1 with kinesin motors and SNARE-regulating Munc18. However, this model cannot explain the function of the homologous LIN-2/7/10 complex in epithelial cells. LIN-10 lacks the MID found in APBA1 and thus cannot interact with the homologous UNC-18, whose expression is also restricted to neurons and thus absent from the epithelial VPCs [332]. Furthermore, the expression of the C. elegans homologue of KIF17, osm-3, is also restricted to neurons [333]. Therefore, the relevance of complex formation and the contribution of LIN-10 in the context of VPC cell fate induction is unclear. The LIN-2/7/10 complex must be working through alternate mechanisms that may reveal novel, conserved functions of the complex.

Objective 3: Identify and characterize an ARF GAP that regulates LET-23 EGFR signalling and vulval cell fate induction.

Our lab has identified Class I and Class II ARF-1.2/3 GTPases and the Arf GEF AGEF-1 as negative regulators of LET-23 EGFR signalling and vulval cell fate induction. If the nucleotide state of the ARF GTPases is required for their regulation of LET-23 EGFR, as would be suggested by the involvement of AGEF-1, then there should be an Arf GAP that works in opposition to AGEF-1 to positively regulate LET-23 EGFR. Alternatively, because Arf GAPs are known to work as effectors for small GTPases and their regulators, and because GTP hydrolysis is at times an essential component of Arf function, there might be an Arf GAP that is working as an effector for Class I and II Arf GTPases that would negatively regulate LET-23

EGFR signalling. This would add to our understanding of LET-23 EGFR regulation by membrane trafficking proteins.

Chapter 2: Materials and Methods

2.1 Strains and maintenance

C. elegans strains were maintained following established protocols [334, 335]. Wildtype worms refer to the N2 Bristol strain, obtained from the Caenorhabditis Genetics Center (CGC, Twin cities, MN, USA). Worms were maintained at 20°C for all experiments, and at 20°C or 15°C for general maintenance in 6 mm petri dishes with 6 ml Nematode Growth Media (“NGM plates”)

[335]. Solidified NGM plates were seeded with a thin lawn of Escherichia coli strain HB101.

New strains were generated by genetic crosses or by microinjection (following established techniques [336]), and individual lines of each strain were isolated as progeny of unique crosses. Mutant genotypes were confirmed by phenotypic analysis of unique identifying traits (e.g. vulvaless phenotype for lin-2(e1309)) and/or by PCR of genomic DNA to check for presence of known deletion or point mutations. A complete strain list can be found in Table 2.1, indicating their respective sources.

2.2 Genomic DNA isolation for genotyping

Genomic DNA was isolated by incubating one worm in 5 μl genomic lysis buffer (10 mM Tris pH 8.3, 50 mM KCl, 2.5 mM MgCl2, 0.45% NP-40, 0.45% Tween-20, 0.01% gelatin), or five worms in 10 μl at 65°C for 1 h, then 95°C for 15 min. For subsequent PCR analysis, 2 μl of genomic DNA lysate was used per reaction.

2.3 Molecular cloning

All PCR (including site-directed mutagenesis) reactions were performed using Phusion

Polymerase (New England Biolabs [NEB]), except PCR for some genotyping which was performed using Kodaq Polymerase (ABM). All restriction enzymes were purchased from NEB.

Genomic DNA and amino acid sequences for C. elegans genes were acquired from WormBase, and DNA/amino acid sequences for mammalian genes were acquired from UniProt.

2.4 Generating endogenously-tagged transgenic strains by CRISPR/Cas9

The mNeonGreen::LIN-10 line (lin-10(vh50), “mNG::LIN-10”), mNeonGreen::LIN-7 (lin-

7(vh51), “mNG::LIN-7”), and LIN-2::mKate2 (lin-2(vh52), “LIN-2::mK2”) were generated by

CRISPR/Cas9 cloning following the Self-Excising Cassette (SEC) method [337]. The SEC is part of the repair template and contains a hygromycin-resistance gene and a dominant rol-6 allele for selection. Guide RNA sequences are listed in Table 2.2 and were designed using a prediction software developed by Dr. Feng Zheng at Massachusetts Institute of Technology (crispr.mit.edu; no longer unavailable). All primers used for cloning are listed in Table 2.3. I cloned the 20 bp guide RNA sequence into pDD162 the vector (Addgene), which contains the Cas9 open reading frame driven by a gonad-specific eft-3 promoter and the single guide RNA (combined tracr RNA and crispr RNA) driven by the U6 promoter, making the Cas9+sgRNA vector. Site-directed mutagenesis was used to clone in the guide RNA sequence. Primers were designed as per the protocol guidelines [337] and ordered from Integrated DNA Technology (IDT). Primers were phosphorylated before the PCR reaction using T4 Polynucleotide Kinase (NEB). An aliquot of the amplicon (5 µl) was ligated using T4 Ligase (NEB), digested with DpnI restriction enzyme

(NEB), and transformed into DH5α E. coli.

Homology arms of roughly 500 bp for the 5ʹ region of the lin-10 and lin-7 gene loci were amplified by PCR from wildtype genomic worm DNA, and cloned into pDD286

(mNeonGreen^SEC^3xFlag), provided generously by Dr. David Reiner (Institute of Biosciences and Technology, Texas A&M University), to create homology repair templates using Gibson

72 assembly [338]. Homology arms of roughly 500 bp for the 3ʹ region of the lin-2 gene locus were amplified from wildtype genomic DNA and cloned into the pDD287 vector

(mKate2^SEC^3xMyc), provided generously by D. Reiner, by Gibson assembly. I prepared injection mixes consisting of 50 ng/ul Cas9+sgRNA plasmid, 10 ng/ul homology arm mix [337], and 10 ng/ul pvha-6::gfp::(TBC-2ΔPH) [339], which fluoresces brightly in the intestine, as an extrachromosomal array marker. Following the screening protocol [337], I recovered one positive transformant for lin-2, lin-7, and lin-10 genomic modifications, confirmed by fluorescent signals and by PCR.

2.5 Generation of extrachromosomal array lines

I cloned GFP, including codons for optimal expression in C. elegans and a flexible linker on its

C-terminal end [340], into the pOR146.1 vector generously provided by Dr. Chris Rongo

(Rutgers University) containing a lin-31 promoter and an unc-54 3ʹ untranslated region using

NheI and KpnI restriction enzymes. The longest isoforms (a isoforms) of lin-10 and lin-2 genes amplified from wildtype cDNA were cloned in downstream of GFP using KpnI and SalI restriction enzymes, replacing the lin-10b gene in the parent vector. The lin-7a open reading frame amplified from wildtype cDNA was cloned into a modified p255 vector expressing ARF-

1.2::EGFP under a lin-31 promoter [91] by replacing ARF-1.2 using SalI and AgeI restriction enzymes. I prepared injection mixes consisting of 40 ng/µl of the extrachromosomal array plasmid and 80 ng/µl of a pttx-3::gfp plasmid used as an extrachromosomal array selection marker. F1 progeny expressing GFP in neuronal cell bodies in the head from the selection marker were maintained on a UV stereomicroscope (Leica). To make the vhEx63

73 extrachromosomal array, mCherry was cloned into the vector to replace GFP using NheI and

KpnI cut sites.

2.6 LIN-10 subdomain identification and sequence identity

Subdomains for LIN-10a were mapped according to the domains previously identified for the b isoform [168]. Subdomains were cloned into the plin-31::gfp expression vector described above by replacing the full-length lin-10a open reading frame. Amino acid sequence identity between

LIN-10a domains and mammalian APBA1 was calculated according to sequence identities identified by BLAST (NCBI, NIH) and Clustal Omega (EMBL-EBI). Total number of similar amino acids were divided by the total number of amino acids in the respective LIN-10 protein domain to calculate the sequence identity.

2.7 Microscopy and Image Analysis

Epifluorescent (black-and-white) images were acquired on a Zeiss Axio A1 Imager. Confocal

(colourized) images were acquired using an LSM780 laser-scanning confocal microscope

(Zeiss). Worms were mounted on a 2% agarose pad on a glass slide and immersed in 10 mM levamisole. Colocalization analysis was performed using Zen image analysis software (Zeiss).

Images were otherwise analyzed using FIJI (ImageJ).

2.7.1 LIN-2/7/10 localization analysis

Punctate or membrane localization of LIN-2, -7, -10, and LET-23 were determined by visual inspection and confirmed by comparing fluorescence intensity of the region of interest to the background cytosolic fluorescent intensity. Peaks in fluorescence spanning the puncta or

74 membrane region of at least twice as bright as the background fluorescence were categorized as punctate or membrane-associated.

2.7.2 LIN-2/7/10 fluorescence intensity analysis

Cytosolic fluorescence intensity was measured by sampling three 1 µm2 cytosolic regions (using

FIJI) in primary cell lineages free of any apparent punctae to achieve consistent measurements.

At least 10 images were analyzed per vulval development stage (as identified in Figure 3.2a).

Three 1 um2 regions of background fluorescence were also randomly sampled from regions of the image with no worm present. The difference between the average cytosolic fluorescence intensity and the average background fluorescence was used as a measurement of fluorescent intensity for each image.

2.7.3 Analyzing LET-23 EGFR polarized distribution

Polarized membrane distribution of LET-23 EGFR was analyzed by drawing a 20 pixel-wide line across P6.p cells for each worm and measuring the averaged peak fluorescent intensity on the basolateral and apical membrane using FIJI. For worms at the 2-cell stage, one line was drawn across each P6.px cell. To limit bias, lines were drawn across DIC images over the centre of the nucleus, and transposed to the fluorescent image.

2.7.4 Colocalization analysis

Mander’s correlation coefficients for ARF-1.2::EGFP and mCherry::LIN-10 were measured using Zen 2012 software (Zeiss) and quantified by tracing the cells of interest, yielding a software-generated scatterplot of green and red fluorescent intensity values per pixel. Crosshairs

75 along the X and Y axis divide the graph into four quadrants and are used to omit background fluorescence, such that only pixels in the upper right-hand quadrant are calculated for colocalization. The crosshairs were adjusted to omit most of the cytoplasmic signal in order to capture colocalization at punctae. Mander’s correlation coefficients for endogenously-tagged

LIN-2, LIN-7, LIN-10, and LET-23 EGFR generated by CRISPR/Cas9 cloning were measured using Zen 2012 and quantified by tracing the cells of interest and adjusting the crosshairs in order to omit background fluorescence and include cytosolic signal. The same settings were used for all images analyzed. Overlap of punctae was determined by identifying punctae using methods described in 2.7.1 and checking for overlap in peak fluorescence intensity. Average number of overlapping punctae per worm was used for analysis.

2.8 Analyzing VPC cell fate induction

VPC induction scoring was performed as described previously [101]. Early to mid L4 worms were mounted on a Zeiss Axio A1 imager in 10 mM levamisole and their developing vulvae were visualized using a 100X objective. Each worm is given a VPC induction score by analyzing the descendants of two-cell Pn.px VPC. Each induced Pn.px lineage is given a score of 0.5, and uninduced lineages are given a score of 0, such that each worm was given a VPC induction score between 0 and 6. Average VPC induction scores of less than 3 were considered Vul, and worms with an induction score of greater than 3 were considered Muv. Proportion of Vul and Muv worms for each genotype were calculated for %Vul and %Muv phenotypes, respectively.

For vulval induction of worms expressing extrachromosomal arrays, worms expressing

GFP in any VPC lineage were scored and compared to siblings on the same plate lacking any extrachromosomal array expression (including the neuronal extrachromosomal marker, pttx-

3::gfp). Exceptionally, worms expressing vhEx63 (mCh::LIN-10a) were scored by comparing worms expressing neuronal pttx-3::gfp to sisters without neuronal GFP expression because mCherry expression in the vulval cell lineages was not visible on the Zeiss Axio A1 imager.

2.9 Correlation analysis for extrachromosomal array expression and VPC induction

In addition to scoring VPC cell fate induction, I kept track of which specific Pn.px lineages expressed the extrachromosomal arrays (determined by visible GFP fluorescence on a Zeiss Axio

A1 imager at 100X) in developing vulvas of early to mid-L4 larvae. For each worm, I counted the number of GFP-expressing Pn.px lineages that were induced into vulval cell fates (either the primary or secondary cell fates), or that were uninduced (did not continue dividing).

To assess the correlation between extrachromosomal array expression and VPC cell fate induction, Pn.px lineages of all worms per genotype were categorized into four groups: those that expressed GFP and that were induced to assume a vulval cell fate (A), those with no visible GFP that were induced (B), those with GFP expression that were not induced (C), and those with no visible GFP that were not induced (D). Using these groups, the Phi (Φ) Correlation Coefficient between GFP expression and VPC induction was calculated for each worm using the formula below, and the average correlation coefficient for each genotype was used for analysis.

퐴퐷 − 퐵퐶 Φ = √(퐴 + 퐵)(퐶 + 퐷)(퐴 + 퐶)(퐵 + 퐷)

2.10 RNAi experiments

RNAi was performed by feeding as previously described [341]. All RNAi experiments were performed at 20°C. RNAi clones for rab-5 (I-4J01), cnt-1 (II-8K03), git-1 (X-5I19), K02B12.7

(I-4O03), W09D10.1 (III-5P13), and F07F6.4 (II-4K20) were obtained from Dr. Julie Ahringer’s

RNAi library provided by Dr. Richard Roy (McGill University). I generated ced-12, c56g7.3, and cnt-2 RNA interference (RNAi) feeding vectors by cloning 500 bp to 1 kb regions from wildtype genomic DNA that covers all isoforms of each gene. I cloned these fragments into the

L4440 feeding RNAi vector (Addgene) using BglII and XhoI restriction enzymes (NEB).

For analysis of dead egg phenotype, L4 agef-1(vh4) mutant larvae were transferred to

RNAi plates, and transferred again individually to three new RNAi plates 18 hours later after reaching adulthood. After 24 h, parent worms were removed and the number of hatched larvae and unhatched eggs were counted. Hatched larvae and unhatched eggs were counted again after an additional 24 h (48 h total). The percentage of dead eggs was calculated by dividing the number of unhatched larvae at the 48 h mark by the total number of progeny laid (unhatched and hatched) at the 24 h mark. For VPC induction, synchronized L1 agef-1(vh4); lin-2(e1309) larvae were put on four RNAi plates (roughly 50 worms per plate) and L4s were scored after 2 days.

2.11 Co-immunoprecipitation

Six NGM plates saturated with healthy worms kept at 20°C were washed off using sterile M9 buffer and collected in a 15 ml conical tube for each genotype. Harvested worms were washed three times by pelleting the worms at 2000 RPM for 2 min, removing the supernatant without disrupting the worm pellet (usually to about 500 µl) and adding fresh M9. Two additional washes were performed using chilled (4°C) worm protein lysis buffer (50 mM Hepes pH 7.6, 1

TM mM EDTA, 1 mM MgCl2, 100 mM KCl, 10% glycerol, 0.05% NP-40, cOmplete EDTA-free

Protease Inhibitor Cocktail tablet [Sigma], NaF, Na3VO4, PMSF). After removing the supernatant on the second wash, tubes were topped up with fresh lysis buffer to a final volume of

2 ml. To generate whole worm lysates, worms were freeze/thawed fives times in liquid nitrogen, then sonicated three times, chilling on ice 1 min between each round, using the following parameters: 30% amplitude, 3 s on, 5 s off, 5 times for a total sonication time of 15 seconds, until the sample was homogenized. Sonicated samples were centrifuged at 12,000 xg for 30 min (4°C) to clarify the lysates. Supernatant was collected as the soluble fraction of the worm lysate and used immediately for downstream applications.

SureBeadsTM Protein G Magnetic Beads (BioRad) were washed with 100 μl worm protein lysis buffer two times by incubating beads at room temperature with buffer for 2 min rotating on a nutator, then pelleting beads using a magnetic rack (BioRad). Beads were incubated with monoclonal M2 mouse anti-Flag antibody (Sigma) or monoclonal rabbit anti-Myc antibody

(Sigma) in lysis buffer for 1 h at room temperature while rotating on a nutator. After washing the beads to remove excess antibody, antibody-bound beads were incubated with 800 µg whole worm lysate overnight at 4°C while rotating. Protein concentration was measured using BSA standard assay with Bradford reagent (BioRad). Beads were washed three times and pelleted the next day using a magnetic rack, supernatant was removed, and 30 µl 1X SDS sample buffer was added. Co-immunoprecipitation assay was performed four times for each condition.

2.12 SDS-PAGE and western blot

SDS-PAGE was performed using TGX Stain-Free FastCast mini gels (BioRad). After electrophoresis, gels were exposed for 45 s to view protein bands. Protein content on gels were

79 then transferred onto PVDF membranes. Membranes were blocked for 1 h with 5% skim milk in

0.1% TBS-T and probed with 1:2000 primary antibody for bait and prey proteins (mouse anti-

Flag for LIN-10 or LIN-7, rabbit anti-Myc for LIN-2) diluted in blocking solution and incubated overnight at 4°C while rotating. The next day, membranes were washed with 0.1% TBS-T and incubated with 1:10,000 secondary antibody (rabbit anti-mouse or goat anti-rabbit [Sigma]) diluted in blocking solution for 1 h at room temperature. Membranes were exposed using ECL-

Clarity (BioRad) and imaged using a ChemiDoc imager (BioRad). For bait and prey of a similar size (LIN-10 and LIN-2), the membrane was stripped using a mild stripping buffer [342], blocked for 1 h, and re-probed. In these cases, prey protein was probed first, then bait protein was probed after stripping.

2.13 Statistical analysis

All statistical analyses were performed using GraphPad Prism 8.0. Two-tailed Student’s t-test or

One-Way ANOVA with Dunnett’s test for multiple comparisons were used to compare average means. Fisher’s exact test was used to compare dead egg phenotype (hatched vs unhatched), vulvaless phenotypes (Vul vs not-Vul), multivulva phenotypes (Muv vs not-Muv), and localization analyses (e.g. punctate vs not punctate).

Table 2.1 Strain list Strain Genotype Source name QR180 agef-1(vh4) I [91] QR512 agef-1(vh4) I; lin-2(e1309) X [91] QR917 arf-1.2(ok796) III; lin-2(e1309) X; vhEx37[plin-31::gfp::lin- This study 10a + pttx-3::gfp] QR733 arf-1.2(ok796) III; vhEx37[plin-31::gfp::lin-10a + pttx-3::gfp] This study

QR918 arf-6(tm1447) IV; lin-2(e1309) X [91] Strain remade using QR906 QR880 cnt-1(tm2313) II; arf-6(tm1447) IV; lin-2(e1309) X line 1 This study QR883 cnt-1(tm2313) II; arf-6(tm1447) IV; lin-2(e1309) X line 2 This study QR884 cnt-1(tm2313) II; arf-6(tm1447) IV; lin-2(e1309) X line 3 This study QR892 cnt-1(tm2313) II; lin-2(e1309) X line 1 This study QR848 cnt-1(tm2313) II; lin-2(e1309) X line 2 This study QR849 cnt-1(tm2313) II; lin-2(e1309) X line 3 This study QR888 cnt-1(tm2313) II; lin-2(e1309) X; vhEx7[plin-31::arf-1.2::egfp This study + pttx-3::gfp] line 1 QR889 cnt-1(tm2313) II; lin-2(e1309) X; vhEx7[plin-31::arf-1.2::egfp This study + pttx-3::gfp] line 2 QR820 cnt-1(tm2313) II; zhIs038[plet-23::let-23::gfp + unc-119(+)] This study IV QR882 cnt-1(tm2313) II; zhIs038[plet-23::let-23::gfp + unc-119(+)] This study IV; lin-2(e1309) X CU7630 cnt-1(tm2313) II Dr. Ding Xue [318] JT307 egl-9(sa307) V CGC QR750 egl-9(sa307) V; vhEx37[plin-31::gfp::lin-10a + pttx-3::gfp] This study

QR887 let-23(re202) lin-7(vh51) II This study DV3366 let-23(re202[let-23::mKate2::3xFlag]) II Dr. David Reiner QR930 let-23(sy1) lin-7(vh51) II This study PS80 let-23(sy1) unc-4(e120) II CGC QR751 let-23(sy1) unc-4(e120) II; vhEx37[plin-31::gfp::lin-10a + This study pttx-3::gfp] QR748 let-23(sy1) unc-4(e120) II; vhEx60[plin-31::lin-7a::egfp + This study pttx-3::gfp] PS295 let-23(sy97) unc-4(e120)/mnC1 dpy-10(e128) unc-52(e444) II CGC

QR735 let-23(sy97) unc-4(e120) II; vhEx37[plin-31::gfp::lin-10a + This study pttx-3::gfp] QR749 let-23(sy97) unc-4(e120) II; vhEx60[plin-31::lin-7a::egfp + This study pttx-3::gfp] CB1439 lin-10(e1439) I CGC QR931 lin-10(e1439) I; cnt-1(tm2313) II line 1 This study QR932 lin-10(e1439) I; cnt-1(tm2313) II line 2 This study QR933 lin-10(e1439) I; cnt-1(tm2313) II line 3 This study QR878 lin-10(e1439) I; lin-2(vh52) X This study QR929 lin-10(e1439) I; lin-7(vh51) II This study QR747 lin-10(e1439) I; vhEx37[plin-31::gfp::lin-10a + pttx-3::gfp] This study QR730 lin-10(e1439) I; vhEx52[plin-31::gfp::lin-10a(N-term) + pttx- This study 3::gfp] line 1 QR720 lin-10(e1439) I; vhEx55[plin-31::gfp::lin-10a(PTB+PDZ) + This study pttx-3::gfp] QR752 lin-10(e1439) I; vhEx60[plin-31::lin-7a::egfp + pttx-3::gfp] This study QR739 lin-10(e1439) I; vhEx63[plin-31::mCherry::lin-10a + pttx- This study 3::gfp] QR841 lin-10(e1439) I; vhEx66[plin-31::gfp::lin-10a(PDZ1+2) + This study pttx-3::gfp] QR890 lin-10(e1439) I; vhEx72[plin-31::gfp::lin-10a(PTB long)] This study QR891 lin-10(e1439) I; vhEx74[plin-31::gfp::lin-10a(PTB short)] This study CB1439 lin-10(e1439) I This study QR886 lin-10(vh50) I; let-23(re202) II This study QR826 lin-10(vh50) I; lin-2(e1309) X line 1 This study QR876 lin-10(vh50) I; lin-2(vh52) X This study QR845 lin-10(vh50) I; qbcSi01[pvps-52::vps-52::mCherry] II This study

QR769 lin-10(vh50[mNeonGreen::3xFlag::LIN-10]) I This study QR723 lin-2(e1309) X; vhEx37[plin-31::gfp::lin-10a + ttx-3::gfp] This study QR722 lin-2(e1309) X; vhEx52[plin-31::gfp::lin-10a(N-term) + pttx- This study 3::gfp] line 1 QR743 lin-2(e1309) X; vhEx55[plin-31::gfp::lin-10a(PTB+PDZ) + This study pttx-3::gfp] QR724 lin-2(e1309) X; vhEx58[plin-31::gfp::lin-2a + pttx-3::gfp] This study QR842 lin-2(e1309) X; vhEx66[plin-31::gfp::lin-10a(PDZ1+2) + pttx- This study 3::gfp] CB1309 lin-2(e1309) X CGC QR736 lin-2(e1309) X; vhEx60[plin-31::lin-7a::egfp + pttx-3::gfp] This study

QR737 lin-2(e1309) X; vhEx63[plin-31::mCherry::lin-10a + pttx- This study 3::gfp] QR893 lin-2(e1309) X; vhEx74[plin-31::gfp::lin-10(PTB short)] This study QR830 lin-2(vh52[lin-2::mKate2::3xMyc]) X This study CB1413 lin-7(e1413) II CGC QR874 lin-7(e1413) II; lin-2(vh52) X This study QR734 lin-7(e1413) II; vhEx37[plin-31::gfp::lin-10a + pttx-3::gfp] This study QR740 lin-7(e1413) II; vhEx58[plin-31::gfp::lin-2a + pttx-3::gfp] This study QR725 lin-7(e1413) II; vhEx60[plin-31::lin-7a::egfp + pttx-3::gfp] This study QR877 lin-7(vh51) II; lin-2(e1309) X This study QR935 lin-7(vh51) II; lin-2(e1309) X; vhEx63[plin31::mCherry::lin- This study 10a + pttx-3::gfp] QR846 lin-7(vh51) II; lin-2(vh52) X This study QR934 lin-7(vh51) II; vhEx63[plin-31::mCherry::lin-10a + pttx- This study 3::gfp] QR829 lin-7(vh51[mNeonGreen::3xFlag::LIN-7]) II This study QR928 rab-35(b1013) III; lin-2(e1309) X This study QR600 vhEx37[plin-31::gfp::lin-10a + pttx-3::gfp] line 1 This study QR726 vhEx5[rol-6(su1006) + plin-31::arf-1.2::egfp); vhEx63[plin- This study 31::mCherry::lin-10a + pttx-3::gfp] QR704 vhEx52[plin-31::gfp::lin-10a(N-term) + pttx-3::gfp] line 1 This study QR707 vhEx55[plin-31::gfp::lin-10a(PTB+PDZ) + pttx-3::gfp] line 1 This study QR710 vhEx58[plin-31::gfp::lin-2a + pttx-3::gfp] line 1 This study QR712 vhEx60[plin-31::lin-7a::egfp + pttx-3::gfp] line 1 This study QR715 vhEx63[plin-31::mCherry::lin-10a + pttx-3::gfp] line 1 This study QR788 vhEx66[plin-31::gfp::lin-10a(PDZ1+PDZ2) + pttx-3::gfp] This study line 1 QR794 vhEx72[plin-31::gfp::lin-10a(PTB long) + pttx-3::gfp] line 1 This study QR796 vhEx74[plin-31::gfp::lin-10a(PTB short) + pttx-3::gfp] line 1 This study zhIs035[plet-23::let-23::gfp + unc-119(+)] I [91] QR480 zhIs035[plet-23::let-23::gfp + unc-119(+)] I; lin-2(e1309) X [91] QR732 zhIs035[plet-23::let-23::gfp + unc-119(+)] I; lin-2(e1309) X; This study vhEx63[plin-31::mCherry::lin-10a + pttx-3::gfp] QR727 zhIs035[plet-23::let-23::gfp + unc-119(+)] I; vhEx63[plin- This study 31::mCherry::lin-10a + pttx-3::gfp]

zhIs038[plet-23::let-23::gfp + unc-119(+)] IV [91, 343] QR476 zhIs038[plet-23::let-23::gfp + unc-119(+)] IV; lin-2(e1309) X [91]

Table 2.2 Guide RNA sequences Gene target Genomic guide RNA sequence (as DNA) PAM N-terminal insertion in lin-10 ACCATGAACAATTCTGTTGC N-terminal insertion in lin-7 TTCCAGATGGATAACCCGGA C-terminal insertion in lin-2 GATCAGTAGACCCAAGTGAC

Table 2.3 Primers for cloning Gene Forward primer (5ʹ to 3ʹ) Reverse primer (5ʹ to 3ʹ) lin-10 from CTATAAGGTACCTCATCTGAA GTGACTGAGCTCTCAAATGTA cDNA GCAGTAG TTGTGGTTG lin-2 from cDNA TATATAGGTACCAGGGAGCTT GAGCTCTCAGTAGACCCAAGT GACCCGGAC GACTGGAAG lin-7 from cDNA CATATAGTCGACATGGATAAC CATATAACCGGTTCTTCGTGG CCGGATGGTC ATTTGTCG GFP GAGTCAGCTAGCATGAGTAAA GCATGTGGTACCTTGAATTGG GGAGAAGAAC TTCCTTTAAAG mCherry CATATAGCTAGCATGGTGAGC CTATATGGTACCTTGAATTGGT AAGGGCGAG TCCTTTAAAGACTTGTACAGCT CGTCCATG lin-10 N-term CTATAAGGTACCTCATCTGAA ATAACTGAGCTCTCAAACTCC GCAGTAG CTCGATTAGAAC lin-10 CTATAAGGTACCTCATCTGAA GTAATAGAGCTCTCAATGATG N+PTBshort GCAGTAG GATCGTCAATCC lin-10 CTATAAGGTACCTCATCTGAA GTAACTGAGCTCTCACTTTGGT N+PTBlong GCAGTAG ACAACAACTTC lin-10 PTB+PDZ TCTCCTGGTACCAACAGCAAA GTGACTGAGCTCTCAAATGTA GAAACAATG TTGTGGTTG lin-10 PDZ1+2 TCTCCTGGTACCCTTGAAATGT GTGACTGAGCTCTCAAATGTA TTGCAAAG TTGTGGTTG 5ʹ homology arm ACGTTGTAAAACGACGGCCAG CATGTTGTCCTCCTCTCCCTTG for 5ʹ insertion in TCGCCGGCAGTGAACCTAGAA GAGACCATCTTGCAACAGAAT lin-10 CCTAGG TGTTCATAGTC 3ʹ homology arm CGTGATTACAAGGATGACGAT TCACACAGGAAACAGCTATGA for 5ʹ insertion in GACAAGAGAATGTCATCTGAA CCATGTTATGAAGAGGAGAAG lin-10 GCAGTAG ACAGG 5ʹ homology arm ACGTTGTAAAACGACGGCCAG CATGTTGTCCTCCTCTCCCTTG for 5ʹ insertion in TCGCCGGCAGTTTTCAACAAA GAGACCATCTGCAAGATTTGG lin-7 TTCG TTGG 3ʹ homology arm CGTGATTACAAGGATGACGAT TCACACAGGAAACAGCTATGA for 5ʹ insertion in GACAAGAGAATGGATAACCCG CCATGTTATCAAATTGCCGATT lin-7 GATG TGC

5ʹ homology arm ACGTTGTAAAACGACGGCCAG CATCGATGCTCCTGAGGCTCC for 3ʹ insertion in TCGCCGGCACCAACATTGTAG CGATGCTCCGTAGACCCAAGT lin-2 GGGTTCATC GACTGGAAG 3ʹ homology arm GAGCAGAAGTTGATCAGCGAG GGAAACAGCTATGACCATGTT for 3ʹ insertion in GAAGACTTGTGATCTCACACT ATCGATTTCCAAACAGTTACT lin-2 TTACTAATAC CTCTTCTGTC ced-12 RNAi CTCTCAAGATCTTGACGATAC CTATTACTCGAGCTCATCCAC clone AACTCGTGATTG ATTGGAATC cnt-2 RNAi clone CAACTAAGATCTATACGTGTG CTATAACTCGAGCCAAATAAG CCTGTACAG CAGCTGAGC C56G7.3 RNAi CAACTAAGATCTATCGAGCTA GTATAACTCGAGATTCGGTTC clone AAAGGCGCAG AGTAGTGGCAAG

Chapter 3: In vivo analysis of the LIN-2/7/10 complex

3.1 Preface

Through genetic and biochemical studies, LIN-2, LIN-7, and LIN-10 have been found to form a complex and regulate LET-23 EGFR signalling specifically in the VPCs by maintaining basolateral receptor localization. However, little is known about the expression and localization of the complex components in vivo, or how the complex regulates LET-23 EGFR localization. In this chapter, I describe an in vivo analysis of the LIN-2/7/10 complex. These studies were initiated using extrachromosomal arrays for tissue-specific analysis. To study their endogenous expression patterns, test for colocalization, and perform co-immunoprecipitation analyses, I generated endogenously-tagged gene products using CRISPR/Cas9. These studies reveal new expression, localization, and regulation of the LIN-2/7/10 complex in the VPC lineages that inform us on likely models for function.

3.2 Localization and expression of LIN-2/7/10 in the C. elegans VPCs

To identify where the LIN-2/7/10 complex forms in vivo, I used CRISPR/Cas9 to tag the endogenous 5ʹ end of the lin-7 and lin-10 gene loci with an mNeonGreen (mNG) fluorophore and a 3xFlag tag, generating the lin-7(vh51) (“mNG::LIN-7”) and lin-10(vh50) (“mNG::LIN-

10”) alleles, respectively. I also inserted an mKate2 (mK2) fluorophore and a 3xMyc tag to the 3ʹ end of the lin-2 gene loci, generating the lin-2(vh52) (“mK2::LIN-2”) allele (Figure 3.1a). The gene products are predicted to generate wildtype, functional proteins based on the absence of vulval development defects in their respective lines (Table 3.1). For tissue-specific expression, I generated extrachromosomal array transgenes under a VPC-specific promoter (lin-31) of the

LIN-7a isoform tagged C-terminally with EGFP (vhEx60, “LIN-7a::EGFP”), LIN-2a tagged N- terminally with GFP (vhEx58, “GFP::LIN-2a”), and LIN-10a tagged N-terminally with GFP

(vhEx37, “GFP::LIN-10a”) (Figure 3.1e). These transgenes rescued the vulvaless phenotypes of their respective mutants, confirming functionality (Table 3.2).

Table 3.1 Analysis of VPC induction in lin-7(vh51), lin-2(vh52), lin-10(vh50), and let- 23(re202) Avg # of VPCs Genotype %Vul %Muv induced n N2 (wildtype) 0% 0% 3.00 36 lin-7(vh51[mNG::3xFlag::LIN-7]) II 0% 0% 3.00 47 lin-2(vh52[LIN-2::mK2::3xMyc]) X 0% 0% 3.00 47 lin-10(vh50[mNG::3xFlag::LIN-10]) I 0% 0% 3.00 45 let-23(re202[LET-23::mK2::3xFlag]) II 5% 7% 3.02 42 One-way ANOVA for VPC induction with Dunnett’s test for multiple comparisons. Fisher’s exact test for Vul and Muv phenotypes. All conditions compared to N2 (wildtype).

Table 3.2 Extrachromosomal LIN-7a::EGFP, GFP::LIN-2a, and GFP::LIN-10a rescue their respective mutant phenotypes Avg # of VPCs Genotype %Vul %Muv induced n 1 lin-7(e1413) 82% 0% 1.15 17 2 lin-7(e1413); vhEx60(plin-31::lin-7a::egfp) 27%** 7% 2.83**** 15

3 lin-2(e1309) 96% 0% 0.39 23 4 lin-2(e1309); vhEx58(plin-31::gfp::lin-2a) 8%**** 8% 2.92**** 13

5 lin-10(e1439) 91% 0% 0.87 22 6 lin-10(e1439); vhEx37(plin-31::gfp::lin-10a) 8%**** 6% 2.94**** 36 Two-tailed Student’s t-test. Fisher’s exact test for Vul and Muv phenotypes compared to the shaded row. **P<0.01, ****P<0.0001. Row 2 was compared with row 1. Row 4 was compared with row 3. Row 6 was compared with row 5.

In the VPCs, endogenously-tagged mNG::LIN-7 is predominately cytosolic (Figure 3.1b,

3.2b and d). LIN-7 can also frequently be found along portions of basolateral membrane domains in both L3 and L4 worms, in addition to cytoplasmic foci, a pattern not previously identified among its orthologues (Figure 3.2b and d). C-terminally-tagged extrachromosomal LIN-

7a::EGFP, on the other hand, is cytosolic with no punctate or membrane localization (Figure

3.1f). The C-terminal PDZ domain has previously been found to be required for lateral membrane localization of LIN-7 in the VPCs and of mammalian Lin7 in epithelia [90, 170]; therefore, placement of the fluorophore at the C-terminus might disrupt recruitment to membranes without compromising overall function. Alternatively, overexpression of LIN-7 from the extrachromosomal array may overwhelm any detectable signal at the plasma membrane or cytosolic foci.

LIN-2::mK2 was also found to have a strong cytosolic signal and to localize to cytoplasmic foci in almost all L3 and L4 larval worms (Figure 3.8e-f), and did not have a distinct membrane localization pattern (Figure 3.1c, 3.2e). N-terminally tagged GFP::LIN-2a also localized to punctae, although less frequently: only 30% of VPCs imaged had punctate LIN-2 localization (Figure 3.1g, 3.8h). Finally, LIN-10 localizes to punctae in all worms across a variety of tissues, with a relatively low cytosolic signal (Figure 3.1d and h, and Figure 3.2g), consistent with localization to Golgi ministacks and recycling endosomes previously identified in neuronal and intestinal cells [168, 169, 183].

Figure 3.1 The LIN-2/7/10 complex promotes basolateral localization and signalling in the C. elegans vulva precursor cells to initiate vulval development (a) Schematic of endogenously-tagged lin-7, lin-2, and lin-10 alleles generated by CRISPR/Cas9: vh51, vh52, and vh50, respectively. mNG: mNeonGreen. (b) Expression pattern of endogenously-tagged mNG::LIN-7 throughout an L3 C. elegans larva (side view). Scalebar: 10 μm. (c) Expression pattern of endogenously-tagged LIN-2::mK2 in an L3 larva. Scale as in (b). (d) Expression pattern of endogenously-tagged mNG::LIN-10 in an L3 larva. Scale as in (b). (e) Schematic of extrachromosomal array transgenes vhEx60 (plin-31::lin-7a::egfp), vhEx58 (plin-31::gfp::lin-2a), and vhEx37 (plin-31::gfp::lin-10a). (f) LIN-7a::EGFP is exclusively cytosolic and nuclear in all VPCs imaged. P5.p cell shown in image. Scalebar, 5 μm. (g) GFP::LIN-2a localizes diffusely to the cytosol and nucleus in all VPCs imaged. In 30% of VPCs, such as the P6.p cell shown here, LIN-2a also localizes to faint cytosolic foci. Scale as in (f). (h) GFP::LIN-10a localizes to cytoplasmic punctae and is expressed diffusely in the cytosol of all VPCs imaged. P4.p cell shown in image. Scale as in (f). A: Apical. BL: Basolateral. G: Developing gonad. DNC: Dorsal nerve chord. VNC: Ventral nerve chord. AF: Autofluorescence. Ne: Neuronal cell body. n: Nucleus.

3.3 Expression of LIN-2, LIN-7, and LET-23 EGFR, but not LIN-10, change throughout VPC induction

Cytosolic fluorescent intensities associated with LIN-2::mK2 and mNG::LIN-7 increase gradually from the one-cell P6.p stage and peak after all cell divisions have taken place near the

L3/L4 molt, then drop in L4 larvae (Figure 3.2a-c, e-f). Furthermore, their expression is restricted to the induced vulval cell fate lineages: in the tertiary cell fates of P3.p, P4.p, and P8.p, and in the uninduced cells of a lin-2, lin-7, or lin-10 mutant, fluorescent intensity of LIN-2::mK2 and mNG::LIN-7 drops after one cell division (Figure 3.3a-d). In addition to changes in fluorescent intensity, LIN-7 experiences changes in localization. The proportion of worms with distinct membrane localization of LIN-7 increase from 20% of one-cell P6.p to 90% of four-cell

P6.pxx, then drops back to 20% in the developing vulva of mid-L4 larvae (Figure 3.2d). The majority of worms imaged have some faint, LIN-7-positive punctae throughout most of vulval development, but the proportion of worms with punctate LIN-7 localization decreases to 20% in mid-L4 vulva. This suggests that while LIN-7 and LIN-2 experience comparable expression changes throughout vulval development, LIN-7 localization is more dynamic than LIN-2.

Unlike its complex components, LIN-10 localization and cytosolic fluorescence intensity does not detectably change throughout vulval development. LIN-10 is expressed evenly in all

VPCs and their descendants, including the non-vulval cell lineages of P3.p, P4.p, and P8.p

(Figures 3.2g-h, and 3.3e-f).

LET-23 EGFR is localized in a polarized fashion in the VPCs, with stronger fluorescent intensity detected on the apical membrane than the basolateral membrane [91]. To look for changes in LET-23 EGFR localization, I compared the peak fluorescent intensities of an integrated LET-23::GFP transgene (zhIs035 [91]) along the basolateral and apical membranes of

P6.p, P6.px, and P6.pxx cells. The subsequent cell division generating P6.pxxx is a transverse division along the left/right plane and occurs with the formation of the apical lumen of the vulva

[89] (Figure 3.2a), and as a result the apical membranes of P6.p lineages face the lumen rather than the ventral side [344], obscuring them from imaging and analysis. I found that the basolateral/apical fluorescent intensity ratio of LET-23::GFP doubles from P6.p to P6.pxx, coinciding with a drop in fluorescent intensity on the apical membrane (Figure 3.2i-j).

Figure 3.2 Expression and localization dynamics of LIN-2/7/10 and LET-23 (a) Schematic of the stages of vulval development, from induction (late L2/early L3) to mid- morphogenesis (mid L4), used for analysis of fluorescent intensity. An, Anterior. Po, Posterior. L, Left. R, Right. (b) mNG::LIN-7 expression and localization in P6.p, P6.pxx, L3/L4 molt, and mid L4 worms. Arrowhead: punctate localization of LIN-7. Arrow: membrane localization of LIN-7. Asterisk: nucleus of anchor cell. (c) mNG::LIN-7 cytosolic fluorescent intensity expression analysis from P6.p to mid-L4. (d) Analysis of mNG::LIN-7 localization patterns fro P6.p to mid-L4. (e) LIN-2::mK2 expression and localization in P6.p, P6.pxx, L3/L4 molt, and mid L4 worms. Arrowhead: punctate localization of LIN-2. (f) LIN-2::mK2 cytosolic fluorescent intensity analysis from mP6.p to mid-L4. (g) mNG::LIN-10 expression and localization in P6.p, P6.pxx, L3/L4 molt, and mid L4 worms. (h) mNG::LIN-10 cytosolic fluorescent intensity analysis from P6.p to mid-L4. (i) LET-23::GFP (zhIs035) expression and localization in P6.p, P6.px, and P6.pxx worms. (j) Peak basolateral, apical, and basolateral/apical ratio fluorescent intensity analysis of LET-23::GFP. Scalebars: 5 μm. BL: Basolateral. A: Apical.

Figure 3.3 Expression of LIN-2 and LIN-7 is restricted to induced vulval cells (a-b) mNG::LIN-7 expression in VPC lineages of wildtype (a) and lin-2 mutant (b) L4 larvae. (c- d) LIN-2::mK2 expression in VPC lineages of wildtype (c) and lin-2 mutant (d) L4 larvae. (e-f) mNG::LIN-10 expression in VPC lineages of wildtype (e) and lin-2 mutant (f) L4 larvae. Scalebars: 5 μm. Arrowhead: nuclei of uninduced cells. Arrow: segment of ventral nerve chord in same focal plane as VPCs. V: Vulval lumen.

3.4 LIN-2 and LIN-7 colocalize strongly with each other, and occasionally with LIN-10 at cytoplasmic foci

To identify where the LIN-2/7/10 complex forms in vivo, I crossed both lin-7(vh51) and lin-

10(vh50) with lin-2(vh52). I found that interacting partners LIN-7 and LIN-2 colocalize strongly in the cytosol of the VPCs and at cytoplasmic foci (Figure 3.4a), although LIN-2 is frequently localized to punctae without LIN-7. Mander’s correlation coefficients reveal moderately strong colocalization between LIN-2 and LIN-7 (Figure 3.4c-d).

There is some overlap between LIN-2 and its other interacting partner LIN-10 at cytoplasmic punctae; however, they are frequently localized to separate compartments (Figure

3.4b). Mander’s colocalization coefficients reveal relatively weak colocalization between LIN-10 and LIN-2 (Figure 3.4c-d).

To test for overlap between LIN-7 and LIN-10, I crossed lin-7(vh51) with an extrachromosomal mCherry-tagged LIN-10a transgenic line (vhEx63) (mCh::LIN-10), and found that roughly 60% of LIN-7-positive punctae overlapped with LIN-10-positive punctae. The overlap between LIN-7 and LIN-10 is LIN-2-dependent due to a decreased localization of LIN-7 to punctae in a lin-2(e1309) mutant (Figure 3.4e-g), described further below (Figure 3.8). The small number of LIN-7-positive punctae present in a lin-2 mutant overlap with mCh::LIN-10 at a similar frequency as a wildtype background, suggesting a small amount of LIN-7-positive punctae localizes to similar subcellular compartments as LIN-10, even without LIN-2 (Figure

3.4e-g).

100

101

Figure 3.4 Subcellular localization of the LIN-2/7/10 complex (a) LIN-7 and LIN-2 colocalize in the cytosol and at punctae in L3 (i) and L4 (ii) worms. (b) LIN-10 and LIN-2 colocalize at some punctae in L3 (i) and L4 (ii) worms. (c-d) Weighted Mander’s colocalization coefficients for L3 (c) and L4 (d) larval stages. (e-f) Overlap of mNG::LIN-7-positive punctae in a wildtype (e) and lin-2 mutant (f) background. (g) Quantification of the percentage (on Y-axis) of VPCs imaged with punctate mNG::LIN-7 localization (1, green), and the percentage of LIN-7-positive punctae that overlaps with mCh::LIN-10a (2, magenta) from (e-f). Scalebars: 5 μm. Arrowhead: colocalizing punctae. Arrow: non-colocalizing punctae. V: Vulval lumen. G: L3 gonad. Ut: L4 uterus. Error bars: SD.

102

3.5 LET-23 EGFR colocalizes with LIN-7 at the plasma membrane and with

LIN-10 at cytoplasmic foci

To identify where the LIN-2/7/10 complex might interact with its designated cargo, I crossed lin-

7(vh51) and lin-10(vh50) with a strain expressing endogenously-tagged LET-

23::mKate2::3xFlag (“LET-23::mK2”; cloned by CRISPR/Cas9) generously provided by D.

Reiner (let-23(re202)). LET-23::mK2 localizes to the basolateral and apical membrane domains of VPCs (Figure 3.5a-b), as has been described for endogenous LET-23 EGFR and other LET-23

EGFR reporters [91, 167, 343]. The fluorophore is placed just upstream of the PDZ interaction motif on the C-terminal end to preserve the interaction with LIN-7, similar to other functional

LET-23::GFP transgenes [343]. However, basolateral receptor localization is at times undetectable at the one-cell P6.p stage, and the presence of mild and infrequent vulval abnormalities suggests the modifications made to the endogenous let-23 gene locus cause a minor disruption to its regular function (Table 3.1).

I found that LET-23 EGFR and LIN-7 overlap at the plasma membrane (Figure 3.5a) in the VPCs (L3) and differentiated vulval cells (L4). This is consistent with LIN-7 interacting with the receptor at the cell periphery. This interaction might happen in the absence of LIN-2 because

LIN-2 does not colocalize with LIN-7 at the cell periphery (Figure 3.4a). Mander’s correlation coefficients show that LIN-7 colocalizes fairly weakly with LET-23 EGFR; however, the receptor colocalizes with LIN-7 relatively strongly (Figure 3.5c-d).

There is minimal colocalization between LET-23::mK2 and mNG::LIN-10 (Fig 3.5b-d), which is consistent with the infrequent expression of LIN-10 near the cell periphery. Our lab has previously found that a LET-23::GFP transgene (zhIs035) typically localizes to a few small cytoplasmic foci in most P6.p and P6.px cells [257]. LET-23::mK2 fluorescent intensity is very

103 low in the VPCs, which likely explains why so few cytosolic punctae can be observed with this line. Therefore, to determine if LIN-10 might colocalize with LET-23 EGFR intracellularly, I crossed the LET-23::GFP integrated transgene with extrachromosomal mCh::LIN-10a and found some overlap between cytosolic LET-23 EGFR-positive foci with LIN-10 (Fig 3.5e). This overlap decreases in a lin-2 mutant, but is not eliminated entirely (Fig 3.5f-g).

104

105

Figure 3.5 LET-23 EGFR colocalizes with LIN-7 at basolateral membranes and with LIN- 10 at foci (a) Endogenously-tagged LIN-7 and LET-23 (re202) overlap at basolateral membranes in L3 (i) and L4 (ii) worms. (b) Endogenously-tagged LIN-10 and LET-23 infrequently overlap in L3 (i) and L4 (ii) worms. (c-d) Weighted Mander’s colocalization coefficients for L3 (c) and L4 (d) larval stages. (e-f) Overlap of faint LET-23::GFP punctae with mCherry::LIN-10a-positive punctae in wildtype (e) and a lin-2 mutant (f). (g) Quantification of LET-23::GFP-positive punctae that overlap with mCh::LIN-10a-positive punctae, as shown in (e-f). N = 10 P6.p cells for WT, 11 for lin-2(e1309). **p<0.01 Two-tailed Student’s t-test. Scalebars: 5 μm. Arrowhead: colocalizing punctae. Arrow: non-colocalizing punctae. V: Vulval lumen. G: L3 gonad. Ut: L4 uterus. A: Apical. BL: Basolateral. Error bars: SD.

106

3.6 Colocalization of LIN-2/7/10 and LET-23 EGFR in other tissues

Endogenously-tagged LIN-2, LIN-7, LIN-10, and LET-23 EGFR allow for analysis of their localization and expression patterns in other tissues. I found that all four proteins are expressed in neurons and sensory tissue in the anterior half of the worm. The intestine is prone to a high degree of autofluorescence, and is excluded from this initial analysis. Whereas LET-23 EGFR and LIN-7 overlap minimally in the head (Figure 3.6a), LIN-2 and LIN-7 colocalize strongly in the neural ring, and the ventral and dorsal nerve chords (Figure 3.6b). LIN-10 overlaps minimally with LIN-2 in the neural ring and nerve chords (Figure 3.6c), and shares very little overlap with LET-23 EGFR in other neural tissues in the head of the worm (Figure 3.6d). LET-

23 EGFR is known to regulate excretory duct cell development in a LIN-2/7/10-independent manner; accordingly, the complex components are absent from duct cell (Figure 3.6a, d). Further analysis is needed to identify the precise cell types in which LIN-2, -7, and -10 are expressed.

107

108

Figure 3.6 LIN-2 and LIN-7, but not LIN-10 or LET-23 EGFR, colocalize in neurons (a-d) Three dimensional Z-stack maximum intensity projections of anterior half of larval worms. (a) LIN-7 and LET-23 EGFR are both expressed in several tissues in the head of C. elegans but do not colocalize in overlap. (b) LIN-7 and LIN-2 colocalize strongly in neuronal tissues. (c) LIN-2 and LIN-10 overlap minimally in nerve ring. (d) LIN-10 and LET-23 EGFR have distinct localization and expression patterns in the head. Scalebars: 20 μm. NR: Neural Ring. NC: Nerve Chords. DC: Duct Cell. Int: Intestine. AF: Autofluorescence.

109

3.7 LIN-2 interacts strongly with LIN-7 and minimally with LIN-10 in C. elegans

The specific interactions between LIN-2 and LIN-7, and between LIN-2 and LIN-10 have been tested by yeast two-hybrid assay, and complex formation has been confirmed by co- immunoprecipitation of the C. elegans proteins expressed exogenously in Drosophila S2 cells

[112]. These interactions have been shown to be evolutionarily conserved, and the complex has been shown to form in mammalian neurons by co-immunoprecipitation and in vitro pull-down assays [124, 130, 140, 141, 345]. It has not yet been shown that the complex forms in vivo in C. elegans, and the disparity in localization patterns observed in Figures 3.4 and 3.6 call into question the extent of these interactions in vivo in C. elegans.

I performed a co-immunoprecipitation assay to test if the proteins interact in vivo (Figure

3.7). On a western blot, I found that mNG::3xFlag::LIN-10 yielded two bands. The larger band at roughly 180 kDa is expected to include the three known isoforms of LIN-10 (a, b, and c), and is about 45 kDa larger than anticipated of the fusion of LIN-10 with a fluorophore. A similar size shift has been previously reported when lin-10 was first cloned, and could be due to extensive post-translational modifications [167]. A second smaller band was also observed for LIN-10 as expected from published work, and may represent an uncharacterized splice variant or proteolytic cleavage [167]. Blotting for mNG::3xFlag::LIN-7 yielded the expected single band at around 65 kDa, and LIN-2::mK::3xMyc yielded the expected two bands at 140 kDa and 100 kDa representing the full-length a isoform and shorter b isoform, respectively (Figure 3.7).

The full-length LIN-2a isoform immunoprecipitated with both LIN-7 and LIN-10. On the other hand, the truncated LIN-2b isoform lacking the N-terminal CamKII domain only precipitated with LIN-7, consistent with this domain being required for interaction with LIN-10.

110

Furthermore, while LIN-7 and LIN-2 immunoprecipitated strongly together, LIN-2 immunoprecipitated weakly with LIN-10, and no LIN-10 was recovered when purifying LIN-2 from lysates (Figure 3.7). These results and the colocalization analysis suggest LIN-2 and LIN-7 interact stably in several tissues, whereas LIN-2 and LIN-10 interact minimally.

111

Figure 3.7 Interactions in vivo of LIN-2, LIN-7, and LIN-10 Co-immunoprecipitation assays using whole worm lysate from worms expressing: (i) LIN- 2::mK2, (ii) mNG::LIN-10, (iii), both LIN-2::mK and mNG::LIN-10, (iv) mNG::LIN-7, and (v) both LIN-2::mK and mNG::LIN-7.

112

3.8 LIN-10 recruits LIN-2 and LIN-7 to subset of cytosolic punctae

To further characterize the localization dynamics of LIN-2, LIN-7, and LIN-10, I tested their interdependency for localization. Given the strong colocalization between LIN-2 and LIN-7, and their dependency for localization in some mammalian epithelial cells [170, 195], I reasoned that they may rely on each other for localization in the VPCs as well. Because of the loss of LIN-7 and LIN-2 expression in uninduced cells (Figure 3.3), I limited my analysis to P6.p cells in L3 worms (before cell fate determination), and to L4 worms with partial or full vulval development

(in which LIN-7 and LIN-2 are expressed). I found that LIN-7 punctate localization is both LIN-

2 and LIN-10-dependent. mNG::LIN-7, which localizes to punctae in 65% of L3 worms (P6.p) and 50% of all L4 worms (pooled for both early- and mid-L4), was localized to punctae in only

15% of P6.p cells and 10% of L4 worms with partial or full vulval development in lin-2(e1309) null mutants (Fig 3.8a-c). In lin-10(e1439) mutants, punctate localization of LIN-7 was similarly decreased to 15% of P6.p cells and 15% of L4 worms with partial or full vulval development

(Fig 3.8a-c). Plasma membrane localization, on the other hand, is not significantly decreased in a lin-2 mutant in P6.p cells, but was slightly decreased in L4 worms (Fig 3.8b-c). Membrane localization of LIN-7 was found to be LIN-10-dependent in P6.p cells, where its association with the basolateral membrane decreased from 20% in wildtype to 0% in lin-10(e1439) mutants, but not in L4 worms (Fig 3.8b-c).

I found that LIN-2 localization to cytoplasmic foci is in turn partly LIN-10-dependent, and LIN-7-independent. The predominately punctate LIN-2::mK2 becomes exclusively cytoplasmic in 80% worms at the L3 stage in a lin-10(e1439) null mutant (Figure 3.8d-e). The dependency was less pronounced, but still evident at the L4 stage (Figure 3.8f). Consistently, the extrachromosomal GFP::LIN-2a transgene, which localizes to faint punctae in approximately

113

30% of VPCs imaged, was almost completely mislocalized into the cytosol in a lin-10(e1439) mutant (Figure 3.8g-h). Punctate localization of LIN-2 was unaltered in a lin-7(e1413) mutant in the VPCs (Figure 3.8d-f).

114

115

Figure 3.8 Punctate localization of LIN-2 and LIN-7 are complex-dependent (a-c) Analysis of endogenously-tagged mNG::LIN-7 localization in P6.p (a,b) and L4 vulval lineages (c) in the indicated genotypes. Arrowhead: punctate localization of LIN-7 in P6.p. Arrow in (a.i): nucleus of neuron in VNC. Arrow in (a.ii): punctate localization of LIN-7 in anchor cell. (d-f) Analysis of endogenously-tagged LIN-2::mK2 localization in P6.p (d,e) and L4 vulval lineages (f) in the indicated genotypes. Arrowhead: punctate localization of LIN-2 in P6.p. Arrow: fluorescent expression in VNC in same focal plane as VPCs. (g-h) Analysis of extrachromosomal GFP::LIN-2a localization in wildtype (g.i) and a lin-10 mutant (g.i), quantified in (h). Arrowheads: GFP::LIN-2a-positive punctae. n: nucleus. n: Nucleus. Scalebars: 5 μm. Fisher’s Exact Test. *p<0.05. **p<0.01. ***p<0.001. ****p<0.0001.

116

On the other hand, I found that both endogenously-tagged mNG::LIN-10 and extrachromosomal GFP::LIN-10a punctate localization was not altered with loss-of-function mutations in lin-2 and lin-7 (Figure 3.9a-b), suggesting that LIN-10 maintains its localization pattern independently of its complex.

Finally, I found that both LIN-10 and LIN-7 localization was LET-23 EGFR- independent. The sy1 allele of the let-23 egfr gene contains an early stop codon that truncates the last 8 amino acids, resulting in the loss of LET-23 EGFR protein interaction to the PDZ domain of LIN-7 [112, 180, 181]. Although the mutant is otherwise signalling-competent, it is localized exclusively to the apical membrane in the VPCs and cannot induce the vulval cell fate [112].

LIN-7 was not also mislocalized to apical membranes in a let-23(sy1) mutant; instead, LIN-7 remained associated to basolateral membranes in 20% of P6.p cells analyzed, and retained its punctate localization in 70% of cells (Fig 3.8b). Extrachromosomal GFP::LIN-10a localization is also unaltered in a let-23(sy1) mutant (Figure 3.9b). This suggests that LIN-7 and LIN-10 are appropriately localized to their respective subcellular domains independently of an association with LET-23 EGFR.

117

Figure 3.9 LIN-10 punctate localization is complex-independent (a) Endogenously-tagged mNG::LIN-10a localizes to cytoplasmic punctae in VPCs independent of its interacting partner LIN-2. Scalebar 5 μm: (b) Extrachromosomal GFP::LIN-10a localizes to punctae in the VPCs of wildtype (i) and lin-2 (ii), lin-7 (iii), and let-23(sy1) (iv) mutants. n: nucleus. Scalebar: 10 μm.

118

3.9 Summary

In an in vivo analysis of the LIN-2/7/10 complex, I have identified novel localization patterns and expression dynamics for the complex components. Cytoplasmic proteins LIN-2 and LIN-7 localize to a few faint cytoplasmic foci in the VPCs, colocalize strongly in the VPCs and in neurons, and co-immunoprecipitate in worm lysates. As vulval cell fate is established and the cells go through three rounds of division, LIN-2 and LIN-7 expression increases and peaks around the L3/L4 molt, then drops around the mid-L4 stage. LIN-7 also localizes occasionally to the basolateral membrane, a localization pattern not seen for the other complex components.

Curiously, LIN-10 exhibited very different dynamics: its expression remains stable throughout vulval development, and its punctate localization is independent of its complex components, of

LET-23 EGFR, or of developmental stage. LIN-10 also recruits LIN-2 and LIN-7 to cytoplasmic foci, which is the likely site of complex formation.

119

Chapter 4: Complex-independent regulation of LET-23 EGFR

signalling by LIN-10 and LIN-7

120

4.1 Preface

In the previous chapter, I found that LIN-10 is regulated differently from its complex components: it has a minimal association with LIN-2 in vivo, and has distinct expression and localization dynamics throughout vulval development. However, LIN-10 is indispensable for vulval cell fate induction [183, 346], suggesting its role in regulating vulval development and

LET-23 EGFR signalling may go beyond its interaction with LIN-2.

The in vivo analysis of the LIN-2/7/10 complex described in the previous chapter was initiated using tissue-specific expression of extrachromosomal arrays, which are expressed mosaically and inherited in a non-Mendelian fashion. Genes expressed as extrachromosomal arrays are inherently overexpressed due to the presence of the endogenous gene. While testing for a change of extrachromosomal GFP::LIN-10 localization in a lin-2 or lin-7 mutant, I noticed an unusually high proportion of egg-laying worms that is unexpected for these vulvaless mutants.

I later observed a similar effect with extrachromosomal LIN-7::EGFP expression. Upon further investigation, I found that LIN-10 and LIN-7 overexpression can compensate for loss of complex components and rescue VPC cell fate induction. In this chapter, I will describe a novel, complex- independent function for LIN-10 and LIN-7, and I will detail a structure-function analysis of

LIN-10 to further understand its requirement in regulating vulval development.

4.2 LIN-10 and LIN-7 can promote VPC induction in a complex-independent manner

Loss of either lin-2, lin-7, or lin-10 alone has previously been shown to inhibit vulval cell fate induction due to the mislocalization of LET-23 EGFR and loss of downstream MPK-1 ERK activation. Using GFP-tagged transgenes mosaically expressed as extrachromosomal arrays, I

121 tested for any compensatory effects among complex components. I found that overexpression of

LIN-10a (vhEx37 and vhEx63) strongly rescued VPC induction in lin-2(e1309) and lin-7(e1413) null mutants (Figure 4.1a-c; Table 4.1). Overexpression of LIN-7a (vhEx60) was also able to partially rescue vulval development in lin-2 and lin-10(e1439) mutants, whereas overexpression of LIN-2a (vhEx58) failed to rescue lin-7 or lin-10 (Table 4.1).

Virtually every Pn.px lineage that expressed the GFP::LIN-10 transgene was induced in lin-2 and lin-7 mutants, suggesting a strong association between LIN-10 overexpression and cell fate induction, and suggesting that LIN-10 is working cell autonomously (Figure 4.1d). This is supported by relatively strong Phi correlation coefficients of 0.65 and 0.69 in lin-2 and lin-7 mutants, respectively (Figure 4.1e). Correlation was more moderate for LIN-7 overexpression, with coefficients of 0.52 and 0.47 in lin-2 and lin-10 mutants, and roughly 80% of LIN-7- overexpressing Pn.px lineages were induced (Figure 4.1d-e). On the other hand, LIN-2 overexpression had minimal correlation with VPC cell fate induction (Figure 4.1d-e), further indicating that induction is specific to LIN-10 and LIN-7 expression, and not an artefact of GFP or transgene expression.

122

Table 4.1 LIN-10 and LIN-7, but not LIN-2, can promote vulval cell fate induction independently of their complex components

Avg. # of VPCs Genotype %Vul %Muv induced n 1 GFP::LIN-10a (in N2) 0% 0% 3.00 17 2 lin-2(e1309) † 96% 0% 0.39 23 3 lin-2(e1309); LIN-7a::EGFP 70%* 0% 1.88**** 30 4 lin-2(e1309); GFP::LIN-10a 16%**** 8% 2.85**** 37 5 lin-2(e1309); mCh::LIN-10a ‡ 78% 0% 1.30** 27

6 lin-7(e1413) 78% 2% 1.15 51 7 lin-7(e1413); GFP::LIN-2a 79% 0% 1.42 33 8 lin-7(e1413); GFP::LIN-10a 23%**** 13% 2.80**** 30

9 lin-10(e1439) 91% 0% 0.80 22 10 lin-10(e1439); GFP::LIN-2a 86% 0% 0.90 21 11 lin-10(e1439); LIN-7a::EGFP 59%* 3% 2.03*** 29 *p<0.05; **p<0.01; ***p<0.001; ****p<0.0001. Fisher’s exact test (%Muv and %Vul); One- way ANOVA with multiple comparisons (Avg. # of VPCs induced). Rows 3-5 were compared with row 2; Rows 7 and 8 were compared with row 6; Rows 10 and 11 were compared with row 9. †Data taken from Chapter 3 Table 3.2 row 3. ‡VPC induction scored in worms with Pttx- 3::GFP expression because mCherry signal undetectable in VPCs under epifluorescence.

123

Figure 4.1 LIN-10 and LIN-7 promote VPC cell fate induction independently of their complex components (a) lin-2(e1309) mutants have no vulva development. Scalebar: 10 μm. (b-c) Overexpression of LIN-10a (vhEx37) rescues vulval cell fate induction in lin-2 mutants. Scale as in (a). (d) Average percentage of cells (Pn.px lineages) expressing the indicated extrachromosomal arrays that are induced into vulval cell fate lineages. Error bars are standard deviation. Legend as in (e). Sample sizes for corresponding genotypes in Tables 4.1 and 4.2. (e) Phi correlation of extrachromosomal array expression and vulval cell fate induction for the indicated transgenes and mutant backgrounds. Sample sizes for corresponding genotypes in Tables 4.1 and 4.2.

124

4.3 LIN-10 and LIN-7 overexpression rescue let-23(sy1), but not signalling- defective let-23(sy97)

LIN-7 interacts with LET-23 via its C-terminal PDZ domain. LIN-10 has two PDZ domains that have previously been found to recognize distinct consensus sequences [150]. Nevertheless, there is some overlap in interacting networks between different PDZ domains, and the PDZ interaction motif of LET-23 EGFR (-TCL) matches the consensus sequence for the first PDZ domain of mammalian LIN-10 homologue APBA1 [150]. To check if LIN-10 overexpression might independently promote signalling by interacting with LET-23 EGFR via its own PDZ domains, I tested for rescue of the sy1 allele of let-23 that has an early stop codon resulting in a truncation of its C-terminal PDZ interaction motif [112, 180]. This allele is otherwise functional for let-23 signalling events and only causes abnormalities in vulval development [180], where interaction with LIN-7 is necessary for receptor localization and function. LIN-10 overexpression strongly rescues a let-23(sy1) mutant (Table 4.2), suggesting that LIN-10 does not require an interaction between the receptor and LIN-7 to promote vulval development, nor is it likely that the PDZ domains of LIN-10 interact with the PDZ interaction motif of LET-23 EGFR. LIN-10 expression was once again strongly correlated to cell fate induction (Figure 4.1d-e). Unexpectedly, LIN-7 overexpression also partially rescued the let-23(sy1) allele (Table 4.2; Figure 4.1d-e), suggesting that LIN-7 can also promote vulval induction independently of its interaction with the LET-23

EGFR PDZ interaction motif.

To test if LIN-10 and LIN-7 overexpression might be activating signalling downstream of the receptor, I tested for rescue of a signalling-defective let-23(sy97) mutant that is unable to activate the downstream LET-60 Ras/MPK-1 MAPK pathway. This allele has other phenotypes associated with loss of LET-60 Ras activation, such as a rod-like lethal phenotype in L1 worms

125

[180]. Although LIN-10 overexpression moderately correlates with VPC induction in let-

23(sy97) (Figure 4.1d-e), both LIN-10 and LIN-7 overexpression fail to rescue the let-23(sy97) allele (Table 4.2), suggesting that both proteins require a functioning receptor and do not promote VPC induction by activating the signalling cascade downstream of LET-23 EGFR.

126

Table 4.2 LIN-10 and LIN-7 overexpression rescue a PDZ interaction-deficient let-23(sy1) receptor mutant, but not signalling defective let-23(sy97)

Avg. # of VPCs Genotype % Muv % Vul induced n 1 let-23(sy1) 0% 92% 0.49 48 2 let-23(sy1); GFP::LIN-10 10% 30%**** 2.72**** 30 3 let-23(sy1); LIN-7::EGFP 0% 74%* 1.94**** 27

4 let-23(sy97) 0% 95% 0.48 43 5 let-23(sy97); GFP::LIN-10 0% 96% 0.72 25 6 let-23(sy97); LIN-7::EGFP 0% 100% 0.52 22 *p<0.05; ****p<0.0001; Fisher’s exact test (%Muv and %Vul); One-way ANOVA with multiple comparisons (Avg # VPCs induced). Rows 2 and 3 were compared with row 1; Rows 5 and 6 were compared with row 4.

127

4.4 LIN-10 independently promotes basolateral LET-23 EGFR localization

LIN-7 rescuing vulval induction independently of LIN-2 and LIN-10 suggests it likely does not require LIN-2 or LIN-10 to interact with LET-23 EGFR and upregulate its signalling. This is supported by the unique, LIN-2-independent localization of LIN-7 to basolateral membranes described in Chapter 3. LIN-7 overexpression rescuing let-23(sy1) might be explained by conservation of a bivalent interaction with the receptor [84]. However, the association between

LIN-10 and LET-23 EGFR has previously been shown to be indirect via LIN-2 and LIN-7 [112]; therefore, it is particularly surprising to find that its overexpression can promote vulval cell fate induction independently of LIN-2 and LIN-7. This suggests that LIN-10 has an additional, unidentified complex-independent function in promoting LET-23 EGFR signalling activation.

To better understand how LIN-10 overexpression can independently promote signalling, I next tested the effect of extrachromosomal mCh::LIN-10a expression (vhEx63) on LET-23::GFP

(zhIs035) localization. I found that overexpression of LIN-10 was able to restore some basolateral receptor localization in a lin-2 mutant (Figure 4.2a-c). Our lab has previously reported similarly modest restoration of basolateral LET-23 EGFR localization in a lin-2 mutant by loss of negative regulators, such as ARF Guanine Exchange Factor AGEF-1 or AP-1 clathrin adaptor subunit UNC-101 [91]. In a wildtype background, LIN-10 overexpression also increased the basal/apical ratio of LET-23::GFP localization (Figure 4.2d-f). An increase in basolateral fluorescent intensity can be detected in one-cell P6.p, but not in two-cell P6.px (Figure 4.2g-h).

This suggests that LIN-10 independently regulates LET-23 EGFR signalling by promoting basolateral receptor localization.

128

129

Figure 4.2 LIN-10 overexpression promotes basolateral targeting of LET-23::GFP (a) LET-23::GFP (zhIs035) is localized on apical membranes of lin-2(e1309) mutant P6.p (i) and P6.px (ii) cells. (b) Overexpression of LIN-10a (vhEx63) restores basolateral LET-23::GFP in a lin-2 mutant. (c) Quantification of VPCs with basolateral LET-23::GFP localization in (a) and (b). *p<0.05 Fisher’s exact test. (d) Polarized LET-23::GFP localization in wildtype P6.p (i) and P6.px (ii) cells. Peak fluorescence intensity of basolateral and apical membranes were measured along the dashed line. (e) LET-23::GFP localization in VPCs expression extrachromosomal mCh::LIN-10. (f) Quantification of basolateral/apical peak fluorescent intensity of images represented in (d-e). *p<0.05, ***p<0.001 Two-tailed Student’s t-test. (g-h) Comparing relative fluorescent intensity of basolateral and apical membranes in P6.p (g) and P6.px (h) with or without LIN-10 overexpression for set of images represented in (d-e). Legend and sample sizes as in (f). Intensities normalized to fluorescent intensity of wildtype worms (no mCh::LIN-10 expressed) for basolateral and apical membranes. Error bars are SD. BL = Basolateral. A = Apical. WT = Wildtype. Scalebar: 5 μm. Images are all at same scale.

130

4.5 LIN-10 C-terminal domains mediate punctate localization

To better understand the function of LIN-10, I performed a structure-function analysis to identify the protein domains that regulate its localization and function (Figure 4.3a-b). The N-terminal half of LIN-10 is largely unstructured and contains the CASK (LIN-2) Interacting Domain

(CID), shared only with mammalian APBA1. It is also highly variable and shares low sequence homology with APBA1 and 2, who in turn share low sequence homology in their N-terminal domains with each other (Figure 4.3a and [168]). Despite divergent sequences, the function of the CID is conserved, as C. elegans LIN-10 can interact with mammalian CASK [141]. On the other hand, the C-terminal half, containing the phosphotyrosine-binding domain (PTB) and tandem PDZ domains, has a much higher sequence identity among LIN-10 and APBA1-3 isoforms (Figure 4.3a and [168]).

In C. elegans neurons, LIN-10 localization to punctae was previously found to require its

N-terminal half (similar to the N-term construct in Figure 4.3b). In the VPCs, on the other hand,

I found that the N-term construct was cytosolic and displaced from intracellular punctae, even when extended into the PTB domain (N+PTBshort) (Figure 4.3c), which has previously been found to be important for function of the LIN-10b isoform in vulval development [168].

Extending the N-terminal half beyond the PTB domain into the flexible linker region between the PTB and the first PDZ domain (N+PTBlong) recovered some punctate localization, even in a lin-10(e1439) mutant (Figure 4.3d). This suggests that the linker region between the PTB and

PDZ domains contributes to LIN-10 punctate localization. This linker region has been found to have an autoinhibitory interaction with the PTB domain in mammalian APBA [249, 250].

The C-terminal PTB and PDZ domains showed robust localization to punctae, indicating that the PDZ domains are important for this localization (Figure 4.5e(i)). This is further

131 demonstrated by a small truncation containing only the PDZ domains which also showed strong localization to punctae (Figure 4.3e(ii)). This PDZ domain fragment overlaps with the

N+PTBlong construct by 17 amino acids covering a small segment of the linker and PDZ1 domain (Figure 4.3b), suggesting there may be a regulatory region in this segment that in part determines punctate localization with the PDZ domains. Mammalian APBA1-2 have been shown to have autoinhibitory interactions in their PDZ1 domain [149, 250], and C. elegans LIN-10 has been found to self-interact in a yeast two-hybrid screen [205]. To verify that the localization pattern of the PDZ domains was not due to oligomerization with endogenous full-length LIN-10,

I looked at its localization in a lin-10(e1439) mutant, and still found that the PDZ domains were punctate (Figure 4.3h). Therefore, my results show that the C-terminal PDZ domains, and likely a portion of the linker region, mediate punctate localization of LIN-10.

132

133

Figure 4.3 C-terminal domains regulate punctate localization and function of LIN-10 (a) Protein domains of human APBA1-3 and C. elegans LIN-10. Percent identities compare amino acid sequences of CASK Interaction Domain (CID), Phosphotyrosine Binding Domain (PTB), and PDZ1/2 domains of LIN-10a to those of APBA1. (b) Truncations of LIN-10a generated to compare localization and function. Red region of N+PTBlong and PDZ indicates 17 amino acids overlapping between these two truncations. (c-e) Localization of N-term (c.i), N+PTBshort (c.ii), N+PTBlong (d), PTB+PDZ (e.i), and PDZ domains (e.ii) from truncated LIN-10 fragments as shown in (b). N in (d) = 29 cells imaged (from 19 worms). Arrowhead: VPC with diffuse cytosolic localization. Arrows: VPCs with punctate localization. (e) C-terminal domains are sufficient for punctate localization of LIN-10. (f-g) Expression of the N+PTBshort construct rescues lin-10(e1439) (f), but not lin-2(e1309) (g). A pseudovulva, and a partially induced vulva can be seen in (f). (h-i) Expression of the PDZ domains fails to rescue a lin- 10(e1439) mutant (h) but does rescue a lin-2(e1309) mutant (i). Arrowheads in (g) and (h) are nuclei of uninduced primary (two in the centre) and secondary (on left and right edge of image) Pn.px cells. n: Nucleus. V: Vulval lumen. Scalebar: 10 μm. Images are all at same scale.

134

4.6 C-terminal PDZ domains mediate complex-independent function of LIN-

10, whereas PTB domain required for overall LIN-10 function

To further characterize the complex-independent function of LIN-10, I tested which domains of

LIN-10 were necessary for the rescue of lin-2 and for lin-10. I found that the C-terminal PDZ domains that mediated punctate localization of LIN-10 were necessary and sufficient to rescue

VPC induction in a lin-2 mutant (Table 4.3; Figure 4.3i). However, expression of these domains alone was not sufficient to rescue lin-10 (Figure 4.3h). On the other hand, truncation of the PDZ domains in the N+PTBshort fragment failed to rescue a lin-2 mutant, whereas this fragment did rescue lin-10 (Table 4.3; Figure 4.3f-g). I found that presence of the PTB domain, whether present on the N-terminal cytosolic half (N+PTBshort or N+PTBlong) or added to the C-terminal punctate domains (PTB+PDZ), was specifically required for rescue of a lin-10 mutant. This suggests that the PTB and PDZ domains are differentially required for LIN-10 function: general

LIN-10 function is mediated by the PTB domain, regardless of the subcellular localization, whereas the LIN-2-independent function of LIN-10 is restricted to the punctate compartments and is mediated by the C-terminal PDZ domains (Table 4.3).

135

Table 4.3 Punctate PDZ domains necessary and sufficient to rescue lin-2, but PTB domain required for overall LIN-10 function

Avg # of Genotype %Vul %Muv VPCs induced n 1 lin-10(e1439) 90% 0% 0.86 49 2 lin-10(e1439); GFP::LIN-10(N-term) 91% 3% 1.27 35 3 lin-10(e1439); GFP::LIN-10(N+PTB short) 52%**** 11%* 2.39**** 27 4 lin-10(e1439); GFP::LIN-10(N+PTB long) 4%*** 4% 3.00**** † 24 5 lin-10(e1439); GFP::LIN-10(PTB+PDZ) 77% 3% 1.85**** 30 6 lin-10(e1439); GFP::LIN-10(PDZ) 95% 0% 0.73 22

7 lin-2(e1309) 88% 0% 0.64 60 8 lin-2(e1309); GFP::LIN-10(N-term) 81% 0% 1.08 31 9 lin-2(e1309); GFP::LIN-10(N+PTB short) 100% 0% 0.62 26 10 lin-2(e1309); GFP::LIN-10(PTB+PDZ) 74% 0% 1.73**** 31 11 lin-2(e1309); GFP::LIN-10(PDZ) 54%*** 4% 2.25**** 24 *p<0.05; ***p<0.001; ****p<0.0001; Fisher’s exact test (%Muv and %Vul); One-way ANOVA with multiple comparisons (Avg # VPC induced). Rows 2 to 6 were compared with row 1. Rows 8 to 11 were compared to row 7. †p<0.01 Student’s two-tailed t-test comparing row 4 to row 3.

136

4.7 LIN-10-positive punctae may represent Golgi mini-stacks or recycling endosomes

The punctate localization pattern I observed for fluorescently-tagged LIN-10 in vivo is similar to what was found in VPC descendants by immunostaining [167], and is consistent with Golgi or recycling endosome localization as seen for LIN-10 in C. elegans neurons and intestinal cells

[167-169], and for APBA proteins in mammalian neurons [140, 177]. I found that endogenously- tagged mNG::LIN-10 (lin-10(vh51)) frequently colocalize with VPS-52, a shared subunit of the trans-Golgi-associated GARP complex and recycling endosome-associated EARP complex

[347-350]. LIN-10-positive punctae regularly overlap with VPS-52 in the VPCs of L3 larvae and the differentiating vulval cells of L4 larvae (Figure 4.5). LIN-10 and VPS-52 also colocalize in the surrounding tissue, such as the developing L3 gonad (including the anchor cell) and the uterine epithelia of L4 larvae (Figure 4.5). This is consistent with LIN-10 localizing to Golgi and recycling endosomes in C. elegans epithelial cells.

137

Figure 4.4 LIN-10 colocalizes with Golgi and recycling endosome marker VPS-52 (a-c) Endogenously-tagged mNG::LIN-10 (lin-10(vh51)) colocalizes with Golgi and recycling endosome marker VPS-52 (qbcSi01) in VPCs (a-b) and differentiating vulval cells (c). Asterisk (*): anchor cell. G: developing gonad in L3 worms. Ut: Uterus. V: Vulval lumen. Arrow: colocalizing punctae in VPCs (a-b) and vulva (c). Arrowhead: Colocalizing punctae in gonad (a- b) and uterus (c). Scalebar: 5 μm. Images are all at same scale.

138

4.8 ARF-1.2 colocalizes with LIN-10, but is not required for LIN-10 OE rescue of lin-2

The finding that the C-terminal PDZ domains of LIN-10 mediate its complex-independent function suggests that LIN-10 has additional binding partners with which it promotes basolateral

LET-23 EGFR targeting and signalling. The PDZ domains of the mammalian APBA proteins mediate an interaction with Class I and Class II Arf GTPases in neurons. APBA proteins were also found to localize to the Golgi in a Brefeldin A-sensitive manner, a compound that disrupts the Arf guanine exchange factors (GEF) BIG1/2 [351-353], and are associated with clathrin- coated secretory vesicles [211, 212]. Our lab has previously reported that the C. elegans Class I and Class II Arf GTPases (ARF-1.2 and ARF-3, respectively), work in opposition to the LIN-

2/7/10 complex with the Arf GEF AGEF-1 (homologous to BIG1/2) and the AP-1 clathrin adaptor complex to negatively regulate LET-23 EGFR signalling and basolateral localization

[91]. LIN-10 overexpression phenocopies suppression of the AGEF-1/ARF/AP-1 pathway with respect to rescue of VPC induction and increasing basolateral LET-23 EGFR localization.

Therefore, the complex-independent function of LIN-10 might involve an interaction with ARF

GTPases that might inhibit the AP-1-mediated pathway.

I found that LIN-10 frequently colocalizes with, or is adjacent to, ARF-1.2 cytoplasmic foci at Pn.p and Pn.px stages (Figure 4.6a-b). Unlike in mammals, LIN-10 does not require active ARF GTPases for its localization, as punctate localization is not disrupted in arf-1.2 loss- of-function mutants, arf-1.2; arf-3(RNAi)-treated mutants, or agef-1(vh4) hypomorphic mutants

(Figure 4.6c). If ARF-1.2 had a dual role in regulating LET-23 EGFR trafficking by either antagonizing basolateral targeting when associated with AP-1, or promoting basolateral targeting when associated with LIN-10, I would expect loss of arf-1.2 to suppress the rescue of lin-2 by

139

LIN-10 overexpression. Loss of arf-1.2 only partly rescues lin-2, and the level of rescue is significantly less than when LIN-10 is overexpressed (Table 4.4 and [91]). However, I found no change in vulval induction in arf-1.2; lin-2; GFP::LIN-10 compared to lin-2; GFP::LIN-10

(Table 4.4). Therefore, LIN-10 is not likely working as an ARF-1.2 effector to promote trafficking. It remains possible that LIN-10 overexpression may instead function through inhibition of ARFs.

140

Figure 4.5 LIN-10 colocalizes with ARF-1.2 but is not dependent of ARFs for localization (a) LIN-10 (vhEx63) frequently localizes with (arrowheads) or near (arrows) ARF-1.2 GTPase (vhEx7). Scalebar: 5 μm. (b) Average Mander’s correlation coefficients reveal moderate colocalization between ARF-1.2 and LIN-10 in C. elegans VPCs. (c) LIN-10 localization to cytosolic punctae (i) is not altered in a hypomorphic agef-1(vh4) mutant (ii), a loss-of-function arf-1.2(ok796) mutant (iii), and an arf-1.2 mutant treated with arf-3(RNAi). Scalebar: 10 μm.

141

Table 4.4 ARF-1.2 not required for the rescue of lin-2 by LIN-10 overexpression

Avg # of Genotype %Vul %Muv VPCs induced n 1 lin-2(e1309) † 96% 0% 0.39 23 2 lin-2(e1309); GFP::LIN-10a ‡ 16% 8% 2.85 37 3 arf-1.2(ok796); lin-2(e1309) 85% 5% 1.88**** 20 4 arf-1.2(ok796); lin-2(e1309); GFP::LIN-10a 24% 12% 2.94 17 ****p<0.0001. Fisher’s exact test (%Muv and %Vul); One-way ANOVA with multiple comparisons (Avg # VPCs induced). Rows 3 and 4 were compared with row 2. †Data taken from Table 3.2 row 3. ‡Data taken from Table 4.1 row 3.

142

4.9 Summary

In this chapter, I have described a novel, complex-independent function for LIN-10 in promoting

LET-23 EGFR signalling and vulval cell fate induction. Similar to suppression of the AGEF-

1/ARF/AP-1 pathway, overexpression of LIN-10 rescues vulval development in a lin-2, lin-7, and PDZ interaction-deficient let-23(sy1) mutant. LIN-10 works directly on the receptor by promoting its basolateral targeting, even in absence of its complex components. The PTB domain – with or without the LIN-2-interaction domain – is required for the rescue of lin-10 mutants, and the complex-independent function of LIN-10 is mediated by its C-terminal PDZ domains that are largely responsible for the punctate localization of LIN-10. Finally, LIN-10 colocalizes with ARF-1.2 in the VPCs, but does not require ARF-1.2 for localization or for signalling activation. Whether LIN-10 and ARF GTPases interact genetically and molecularly in

C. elegans requires further investigation.

143

Chapter 5: Preliminary analysis of CNT-1, an Arf6 GAP and novel

regulator of VPC induction

144

5.1 Preface

In screens for suppressors of the lin-2 Vul phenotype, our lab has identified components of secretory trafficking as negative regulators of LET-23 EGFR signaling, such as Class I and Class

II ARF GTPases (ARF-1.2 and ARF-3, respectively), and AGEF-1, an ARF guanine exchange factor homologous to mammalian BIG1/2 [91]. ARF GTPases lack intrinsic GTPase activity, and therefore rely on a GTPase activating protein (GAP) to catalyze GTP hydrolysis and to switch from their active GTP-bound state to their inactive GDP-bound state. Furthermore, many Arf

GAPs are equipped with functional domains in addition to their GAP domain, such as membrane binding domains and protein-interaction domains, that make them useful effector proteins for other small GTPases. Mammalian ASAP, which has no homologue in C. elegans, is a known effector of EGFR signalling. Otherwise, Arf GAP regulation of EGFR signalling or trafficking has been poorly studied. I tested if any of the 7 putative Arf GAP genes in C. elegans (CNT-1,

CNT-2, W09D10.1, K02B12.7, GIT-1, F07F6.4, and C56G7.3) or CED-12 (ELMO) might regulate LET-23 EGFR signalling and vulval development. I first screened for Arf GAPs that function in opposition to AGEF-1, then tested for an effect on vulval cell fate induction in sensitized genetic backgrounds. In this chapter, I will detail preliminary findings of the ARF-6

GAP CNT-1 working as a novel negative regulator of LET-23 EGFR signalling in C. elegans vulval cell fate induction.

145

5.2 CNT-1, W09D10.1, K02B12.7, and GIT-1 are required for the agef-1(vh4) dead egg phenotype

C. elegans has 7 putative Arf GAP genes: K02B12.7 (ArfGAP1), F07F6.4 (ArfGAP2/3), CNT-1

(ACAP), CNT-2 (AGAP), W09D10.1 (SMAP1/2), GIT-1 (GIT1/2), and C56G7.3 (ELMOD)

(Table 5.1). The ELMO domain of ELMOD proteins have a nonconventional Arf GAP activity for Arl2 and some Arf GTPases. Although the ELMO family, which contains a domain of similar structure and sequence, was found to not have GAP activity for Arf2, it has not been tested for other Arfs. Therefore, I included the ELMO homologue CED-12 for analysis.

146

Table 5.1 List of putative Arf GAPs in C. elegans C. elegans ArfGAP Mammalian Homologue Protein domains CNT-1 ACAP BAR, PH, Arf GAP, Ank W09D10.1 SMAP1/2 Arf GAP K02B12.7 ArfGAP1 Arf GAP GIT-1 GIT1 Arf GAP, Ank, GIT CNT-2 AGAP GTPase, PH, Arf GAP, Ank F07F6.4 ArfGAP2/3 Arf GAP C56G7.3 ELMOD3 ELMO CED-12* ELMO1/2 ELMO, PH *CED-12/ELMO proteins have not been shown to have GAP activity

147

Towards identifying a candidate Arf GAP that might work in opposition to the AGEF-

1/ARF/AP-1 pathway, I screened for an Arf GAP whose loss would suppress phenotypes associated with an agef-1(vh4) hypomorphic allele. In addition to a mild dumpy and uncoordinated phenotype, enlarged lysosomes in their coelomocytes, and impaired protein secretion from body wall muscle and intestine, just over half of the eggs laid by an adult agef-

1(vh4) worm fail to hatch due to uncharacterized defects in embryogenesis [91]. I conducted a screen to test for Arf GAPs that, when knocked down by RNA interference (RNAi), would suppress the readily quantifiable dead egg phenotype of agef-1(vh4) worms (Figure 5.1a).

Roughly 57% of eggs laid by adult agef-1(vh4) mutants exposed to an empty RNAi vector failed to hatch after 24 to 48 hours (Figure 5.1b). Regularly, embryogenesis takes approximately 12 hours to complete prior to hatching [354]. Knocking down rab-5 by RNAi, a small GTPase necessary for endocytosis and associated with early endosomes used here as a positive control, produces a strong dead egg phenotype, and further increased the agef-1(vh4) dead egg phenotype to 94%. I found that knocking down cnt-1 by RNAi strongly reduced the dead egg phenotype to

8%. Knocking down w09d10.1, k02b12.7, and git-1 by RNAi also significantly reduced the dead egg phenotype to 18%, 33%, and 37%, respectively. On the other hand, targeting f07f6.4, ced-12, cnt-2, and c56g7.3 by RNAi did not significantly alter the dead egg phenotype of agef-1(vh4)

(Figure 5.1b).

148

Figure 5.1 RNAi-mediated knockdown of cnt-1, W09D0.1, K02B12.7, and git-1 suppress the dead egg phenotype of agef-1(vh4) (a) Schematic of the RNAi screen for modulation of the dead egg phenotype in agef-1(vh4) mutant worms, described in Chapter 2 section 2.10. (b) RNAi of candidate Arf GAP genes in agef-1(vh4); lin-2 testing for change in dead egg phenotype. Data is pooled from two RNAi experiments for each ARF GAP gene. ***p<0.001, ****p<0.0001. Fisher’s exact test for comparison of dead vs hatched eggs. EV: empty vector.

149

5.3 CNT-2 and CED-12 weakly suppress the Muv phenotype of agef-1; lin-2 mutants

The finding that half of the Arf GAPs tested could significantly suppress the dead egg phenotype of agef-1(vh4) worms validates our rationale that knock down of a GAP can suppress phenotypes associated with mutant agef-1. Genetically, this suggests that they are working in opposition to

AGEF-1 in the same pathway. I applied the same rationale to test if any of the Arf GAPs worked in opposition to AGEF-1 in regulating vulval cell fate induction. The agef-1(vh4) mutation strongly rescues VPC induction and the Vul phenotype associated with a lin-2 mutant [91].

However, cell fate patterning is not fully recovered, resulting in some Vul and Muv worms.

Knocking down the candidate Arf GAPs by RNAi failed to suppress vulval induction in agef-

1(vh4); lin-2 double mutants, although ced-12(RNAi) and cnt-2(RNAi) modestly suppressed the

Muv phenotype from 39.5% to 13.9% and 15.2%, respectively (Table 5.2). cnt-1(RNAi) increased the Muv phenotype by 56.5%, though this was not found to be statistically significant.

This suggests that CNT-2 and CED-12 may be working in opposition to AGEF-1 in regulating

VPC induction.

150

Table 5.2 RNAi-mediated knock down of ARF GAPs do not suppress vulval cell fate induction in agef-1; lin-2 worms

Avg. # of VPCs Genotype %Vul %Muv Induced n agef-1; lin-2; EV(RNAi) 22.2% 39.5% 3.04 81 agef-1; lin-2; cnt-1(RNAi) 21.7% 56.5% 3.30 23 agef-1; lin-2; W09D10.1(RNAi) 33.3% 28.6% 2.76 21 agef-1; lin-2; K02B12.7(RNAi) 16.7% 44.4% 3.00 26 agef-1; lin-2; git-1(RNAi) 29.6% 22.2% 2.98 27 agef-1; lin-2; F07F6.4(RNAi) 21.1% 31.6% 3.18 19 agef-1; lin-2; C56G7.3(RNAi) 22.6% 22.6% 2.82 31 agef-1; lin-2; ced-12(RNAi) 30.6% 13.9% ** 2.72 36 agef-1; lin-2; cnt-2(RNAi) 21.2% 15.2% * 2.91 33 *p<0.05, **p<0.01. One-way ANOVA for VPC induction with Dunnett’s test for multiple comparisons to the empty vector (EV)-treated worms. Fisher’s exact test for Vul and Muv phenotypes compared to EV-treated worms.

151

5.4 CNT-1 negatively regulates LET-23 EGFR signalling

Arf GAPs can also work as effectors of small GTPases, and their GAP activity may be required for regular Arf function to release coat proteins and enable endosome trafficking. If an Arf GAP is working as an effector of ARF-1.2/3 GTPase, then reduction of Arf GAP expression should phenocopy loss of arf-1.2/3 or agef-1 and rescue vulval induction in a lin-2 mutant. VPCs are slightly refractory to RNAi, which can account for the weak effects seen in Table 5.2; therefore,

I used genetic mutants to test for an effect on vulval development in lin-2 mutants. I started by screening a cnt-1 allele due to its strong effect on the agef-1(vh4) dead egg phenotype. The tm2313 allele of cnt-1 is a 344-base pair deletion that introduces a stop codon near the start of the

GAP domain, presumably truncating the GAP domain and ankyrin repeats (Figure 5.2a).

Phenotypically, this allele is a putative null [314, 317, 318], though whether the N-terminal domains are still expressed and functional is unknown.

I found that cnt-1(tm2313) partially rescued vulval induction in a lin-2 mutant (Table

5.3). I made three independent lines of cnt-1; lin-2 double mutants to ensure that this effect was not due to a background mutation in cnt-1 generated as a by-product of mutagenesis, and found partial rescue in all three lines (Table 5.3). Vulval cell fate induction is also partially restored in lin-10; cnt-1 double mutants (Table 5.3). Although partial inductions were common (Figure

5.2b), morphogenesis of the induced lineages were otherwise normal. Loss of cnt-1 expression does not cause any perturbations in vulval induction or morphogenesis on its own (Table 5.3).

Together, this suggests that CNT-1 is a negative regulator of vulval cell fate induction.

152

Table 5.3 CNT-1 and RAB-35 suppress VPC cell fate induction Avg. # of Genotype %Vul %Muv VPCs induced n 1 cnt-1(tm2313) 0% 0% 3.00 35 2 rab-35(b1013) 0% 0% 3.00 21 3 lin-2(e1309) 100% 0% 0.34 25 4 cnt-1(tm2313); lin-2(e1309) (line 1) 70%** 0% 1.67*** 23 5 cnt-1(tm2313); lin-2(e1309) (line 2) 88% 0% 1.31* 24 6 cnt-1(tm2313); lin-2(e1309) (line 3) 68%** 8% 1.54** 25 7 rab-35(b1013); lin-2 (line 1) 80%* 3% 1.45** 30

8 lin-10(e1439) 97% 0% 0.57 34 9 lin-10(e1439); cnt-1(tm2313) (line 1) 82% 0% 1.29* 28 10 lin-10(e1439); cnt-1(tm2313) (line 2) 76%* 10% 1.64*** 29 11 lin-10(e1439); cnt-1(tm2313) (line 3) 72%** 0% 1.72*** 29 *p<0.05, **p<0.01, ***p<0.001. One-way ANOVA for VPC induction with Dunnett’s test for multiple comparisons. Fisher’s exact test for Vul and Muv phenotypes. Rows 4-7 were compared to row 3. Rows 9-11 were compared to row 7.

153

Figure 5.2 Loss of cnt-1 rescues Vul phenotypes with no detectable alteration of LET-23 EGFR localization (a) CNT-1, an Arf GAP, has a BAR domain, a PH domain, a GAP domain, and ankyrin repeats. The tm2313 deletion allele is a putative null. (b) Loss-of-function mutations in the ARF-6 GAP cnt-1 partially restore vu in lin-10 mutants. Scalebar: 10 μm. V: Vulva resulting from partial VPC induction. Arrowheads: induced P6.px cell lineages. Arrows: uninduced VPC lineages. (c) Exclusive apical localization of a LET-23 EGFR transgene (zhIs038) in lin-2. Scalebar: 5 μm. (d) Basolateral LET-23::GFP was not detected in cnt-1; lin-2 double mutants. Scale as in (c). n: Nuclei of VPCs. BL: Basolateral. A: Apical.

154

5.5 CNT-1 negatively regulates polarized LET-23 EGFR localization

CNT-1, and its mammalian homologue ACAP, play an important role in regulating intracellular trafficking and endocytic recycling. This conserved function might come into play in its regulation of LET-23 EGFR signalling. To test this, we looked at the subcellular localization of

LET-23 EGFR in a cnt-1 mutant. Loss of other negative regulators, like agef-1, increase the basolateral/apical ratio of LET-23 EGFR. Similarly, we found that loss of cnt-1 slightly increased the basolateral/apical fluorescence intensity of a LET-23::GFP transgene (zhIs038) from 80.7% to 100.1% at the one-cell P6.p stage in early L3 worms (Figure 5.3a-c). This effect was lost at the two-cell P6.px stage, suggesting CNT-1 likely only affects LET-23 EGFR signalling at the early stages of cell fate induction (Figure 5.3a-c). However, unlike loss of agef-1 or AP-1 clathrin adaptor subunit unc-101 which restore basolateral LET-23 EGFR localization in a lin-2 mutant, I did not detect any appreciable restoration of basolateral receptor localization in a cnt-1; lin-2 double mutant (Figure 5.2c-d).

Beyond the AGEF-1/ARF/AP-1 pathway, our lab has found other genes involved in membrane trafficking that negatively regulate LET-23 EGFR signalling, such as RAB-7 (a small

GTPase associated with late endosomes and lysosomes) and DHC-1 (the heavy chain of the microtubule-associated motor dynein). Rather than restoring basolateral LET-23 EGFR, loss of rab-7 and dhc-1 rescue vulval induction in a lin-2 mutant by causing an accumulation of LET-23

EGFR-positive punctae in the VPCs, which likely promotes receptor signalling from endosomes.

Conversely, I did not detect an accumulation of LET-23 EGFR-positive punctae in cnt-1 mutant worms compared to wildtype worms. However, the number of LET-23 EGFR-positive punctae increased marginally from the 1-cell Pn.p to 2-cell Pn.px stage in cnt-1 mutants whereas no increase was found in wildtype worms (Figure 5.3d).

155

Figure 5.3 CNT-1 skews polarized LET-23::GFP distribution early in VPC induction (a-b) LET-23::GFP (zhIs038) expression and localization in P6.p and P6.px cells of WT (a) and cnt-1 mutants (b). A 20 pixel-wide line was drawn across the nuclei of each VPC to measure peak fluorescent intensity of each membrane, as shown in (a.i). Scalebar: 5 μm. (c) Quantification images in (a) and (b) reveal that the peak basal/apical fluorescence intensity in cnt-1 mutants is increased compared to WT in P6.p cells, but not in P6.px cells. Legend as in (d). *p<0.05 Student’s two-tailed t-test. (d) Loss of cnt-1 does not change the number of LET- 23::GFP-positive punctae compared to WT. There is a slight increase in punctae from P6.p to P6.px cells in cnt-1 mutants but not in WT worms. Sample size as in (c). *p<0.05 Student’s two- tailed t-test. BL: Basolateral. A: Apical.

156

5.6 RAB-35 also suppresses VPC cell fate induction

To further understand the mechanism through which CNT-1 regulates LET-23 EGFR signalling,

I tested for involvement of a known regulator of CNT-1, RAB-35. CNT-1 and mammalian

ACAP2 work as effectors of the small GTPase Rab35 to regulate membrane trafficking in C. elegans phagosome formation and in endocytic recycling in mammals [313, 314]. I found that a rab-35(b1013) mutant rescues vulval development in a lin-2 mutant to a similar extent as loss of cnt-1 (Table 5.3 row 6).

5.7 CNT-1 regulates LET-23 EGFR signalling in an ARF-6-independent manner

CNT-1 (and its mammalian ACAP isoforms) is a GAP for the Class III Arf GTPase, ARF-6

(mammalian Arf6). In C. elegans intestinal cells, RAB-10 recruits CNT-1 to inactivate ARF-6 and enable recycling of early endosomes, and loss of cnt-1 can be compensated for by loss of arf-6 [317]. If ARF-6 overactivation was the primary mechanism of regulation by cnt-1, then loss of arf-6 should suppress vulval cell fate induction in a cnt-1; lin-2 double mutant. Instead, I found that loss of arf-6 does not suppress the cnt-1 rescue of lin-2 (Table 5.4), although it does slightly increase the Vul phenotype in one of three lines from by 23%. Loss of arf-6 itself also does not rescue VPC cell fate induction in a lin-2 mutant (Table 5.4 and [91]). This suggests that cnt-1 likely does not rescue lin-2 by increasing activation of ARF-6.

157

Table 5.4 CNT-1 regulates VPC induction in an ARF-6-independent manner Avg VPC Genotype % Vul % Muv induction n 1 lin-2(e1309) 100% 0% 0.34 25 2 arf-6(tm1447); lin-2(e1309) (line 1) 96% 0% 0.31 27 3 arf-6(tm1447); lin-2(e1309) (line 2) 100% 0% 0.25 20 4 arf-6(tm1447); lin-2(e1309) (line 3) 93% 0% 0.46 27

5 cnt-1(tm2313); lin-2(e1309) (line 3)† 68% 8% 1.54 25 6 cnt-1; arf-6; lin-2 (line 1) 75% 6% 1.63 32 7 cnt-1; arf-6; lin-2 (line 2) 91%* 0% 1.02 32 8 cnt-1; arf-6; lin-2 (line 3) 76% 0% 1.45 37 *p<0.05. One-way ANOVA for VPC induction with Dunnett’s test for multiple comparisons. Fisher’s exact test for Vul and Muv phenotypes. †Data taken from Table 5.3 row 5. Rows 2-4 were compared to row 1. Rows 6-7 were compared to row 5.

158

5.8 CNT-1 likely works downstream or in parallel to ARF-1.2 GTPase

Hypomorphic agef-1(vh4) fully rescues the lin-2 Vul phenotype, and ectopic expression of ARF-

1.2::EGFP (vhEx7) suppresses this effect [91]. This is consistent with AGEF-1 working upstream of ARF-1.2 activation to suppress LET-23 EGFR signalling. To determine if CNT-1 might negatively regulate VPC cell fate induction by working with the AGEF-1/ARF/AP-1 pathway, I tested if CNT-1 works upstream of ARF-1.2 activation. If so, I would expect ectopic ARF-

1.2::EGFP expression to suppress VPC induction in a cnt-1; lin-2 double mutant. I found that ectopic ARF-1.2 expression mildly suppresses VPC cell fate induction in one cnt-1; lin-2 line, and had no effect in a second line (Table 5.5). In contrast, ectopic expression of ARF-1.2 strongly suppresses VPC induction in agef-1; lin-2 double mutants from 3.0 to 1.69, and increased the frequency of Vul phenotypes from 20% to 90% [91]. My results are better explained by CNT-1 working in parallel or downstream to ARF-1.2. Further study is needed to determine if a relationship exists between CNT-1 and AGEF-1/ARF/AP-1.

159

Table 5.5 Overexpression of ARF-1.2::EGFP (vhEx7) weakly suppresses VPC induction in one of two cnt-1; lin-2 mutant lines Avg # VPC Genotype %Vul %Muv induced n 1 cnt-1; lin-2 (no transgene, line 1) 48% 0% 2.15 27 2 cnt-1; lin-2; vhEx7 (line 1) 88%** 0% 1.44* 24 3 cnt-1; lin-2 (no transgene, line 2) 47% 0% 2.16 19 4 cnt-1; lin-2; vhEx7 (line 2) 61% 0% 2.00 23 *p<0.05, **p<0.01. Two-tailed Student’s t-test. Fisher’s exact test for Vul and Muv phenotypes compared to the shaded row. Row 2 was compared with row 1. Row 4 was compared with row 3.

160

5.9 Knocking down cnt-2 suppresses VPC induction in cnt-1; lin-2

Arf GAPs are frequently involved in similar cellular processes and target common GTPases for regulation. Given that cnt-1 only partially rescues lin-2 VPC induction, it’s possible that it is working redundantly with another Arf GAP or competing for a similar target. To test for any genetic redundancy between Arf GAPs in regulating VPC induction, I performed an RNAi screen to knock down candidate Arf GAPs in a cnt-1; lin-2 double mutant. I focussed on the Arf

GAPs that I found work similarly to CNT-1 in suppressing the agef-1 dead egg phenotype: GIT-

1, W09D10.1, and K02B12.7. I also included CNT-2, homologous to mammalian AGAP and

Drosophila CenG1A, because it shares common domains with CNT-1: both proteins have a PH domain, an Arf GAP domain, and Ankyrin repeats on their C-terminal ends. However, CNT-1 has a Bar domain on its N-terminus, whereas CNT-2 has a small GTPase-like domain. Like

CNT-1, mammalian homologues of GIT-1 and W09D10.1 have highest GAP activity for Class

III Arf6 GTPase, whereas CNT-2 and K02B12.7 homologues favour Classes I and II. I found that knocking down git-1, w09d10.1, and k02b12.7 partly decreased VPC induction in cnt-1; lin-

2, but only knocking down cnt-2 by RNAi significantly suppressed VPC induction. This suggests that CNT-2 promotes LET-23 EGFR signalling (Table 5.6), consistent with the moderate suppression of the agef-1; lin-2 Muv phenotype (Table 5.2).

161

Table 5.6 cnt-2(RNAi) suppresses VPC induction in cnt-1; lin-2 double mutants Avg VPC Genotype % Vul % Muv induction n cnt-1; lin-2; EV(RNAi) 91% 0% 1.08 68 cnt-1; lin-2; git-1(RNAi) 92% 1% 0.76 74 cnt-1; lin-2; k02b12.7(RNAi) 99% 0% 0.71 70 cnt-1; lin-2; w09d10.1(RNAi) 95% 0% 0.72 74 cnt-1; lin-2; cnt-2(RNAi) 97% 0% 0.50** 71 **p<0.01. One-way ANOVA for VPC induction with Dunnett’s test for multiple comparisons to EV-treated worms. Fisher’s exact test for Vul and Muv phenotypes compared to EV-treated worms.

162

5.10 Summary

In this chapter, I have described a role for the ARF-6 GAP CNT-1 in regulating vulval cell fate induction. CNT-1 serves as a novel negative regulator of LET-23 EGFR signalling, and disrupts polarized localization of the receptor. RAB-35, a known interactor of CNT-1, also suppresses vulval cell fate induction, suggesting RAB-35 and CNT-1 may be working together to inhibit vulval development. Whereas RAB-35 recruits CNT-1 to inactivate ARF-6 to regulate endosome recycling, my data indicate that CNT-1 functions independently of ARF-6 to antagonize LET-23

EGFR-mediated vulva induction. Genetic epistasis suggests that CNT-1 likely works in parallel or downstream of ARF-1.2. Furthermore, I identify CNT-2 as a potential positive regulator of

LET-23 EGFR signalling. Further study is needed to better characterize the relationship between

CNT-1, RAB-35, CNT-2, and Arf GTPases in regulating LET-23 EGFR signalling in C. elegans

VPCs.

163

Chapter 6: Discussion

164

6.1. Summary of thesis

In this thesis, I have presented an in vivo analysis of the LIN-2/7/10 complex, a complex- independent function for LIN-10 in regulating LET-23 EGFR signalling, and a novel role for the

ARF-6 GAP CNT-1 in regulating LET-23 EGFR localization and VPC induction in C. elegans.

I found that LIN-2 and LIN-7 localize to cytoplasmic foci in a LIN-10-dependent manner, and that LIN-7 colocalizes with LET-23 EGFR at the cell periphery. Throughout vulval cell fate patterning, LIN-2 and LIN-7, but not LIN-10, undergo dynamic expression changes: they both peak in expression in vulval cells at the L3/L4 molt and are restricted to induced vulval cell fate lineages. Additionally, while the in vivo LIN-2/7 interaction is strong and likely occurs in other tissues, the LIN-2/10 interaction is relatively weak in C. elegans.

Moreover, I found that the PTB and PDZ domains are differentially required for LIN-10 function. The PTB domain is required for rescue of a lin-10 mutant, irrespective of its localization to cytoplasmic foci. The PDZ domains are involved in a novel pathway that largely mediates LIN-10 punctate localization and that bypasses the requirement for LIN-2 and LIN-7 to promote LET-23 EGFR signalling

Finally, I have characterized a novel function of CNT-1, an ARF-6 GAP, in negatively regulating LET-23 EGFR signalling. My results suggest CNT-1 works in an ARF-6-independent manner and modulates polarized LET-23 EGFR localization downstream or in parallel to ARF-

1.2 GTPase, possibly with the RAB-35 GTPase.

165

6.2. Regulation of LIN-7 and LIN-2

My results reveal varying localization patterns for LIN-2, LIN-7, and LIN-10 throughout vulval development. LIN-7 undergoes particularly dynamic changes in localization as the VPCs divide.

LIN-7 localization in four-cell P6.pxx cells was originally identified at apical cell junctions [90].

Mammalian Lin7 has similarly been reported to localize to apical tight junctions where it interacts with the Crumbs complex [135, 191]. I found that LIN-7 localizes to segments of varying length along the basolateral membrane of VPCs and daughter cells. The patchy and faint distribution of LIN-7 along the membrane might explain why this localization pattern was lost in previously acquired immunostained images. This discontinuous and variable localization pattern may indicate that it is transiently localized to the membrane.

Intracellular punctate localization has not been reported for mammalian Lin7, but would be consistent with its involvement in targeting internalized PDZ domain-containing proteins to the basolateral membrane. Mammalian CASK is generally localized to basolateral membranes, but in some cases, has been found in the cytosol [153, 170, 171]. In C. elegans VPCs, I did not find LIN-2 to be concentrated on membranes, and only some LIN-2 and LIN-7 punctae overlapped with LIN-10 punctae. Both LIN-2 and LIN-7 are mostly, but not fully dependent on

LIN-10 for punctate localization. LIN-2 has been shown to simultaneously bind EPS-8 and LIN-

7 to promote basolateral recycling of internalized LET-23 EGFR [153]. Mammalian Lin7 has been implicated in basolateral recycling of internalized cargo [84, 193]. Therefore, it is likely that the subset of LIN-2/7 punctae that do not overlap with LIN-10 and do not require LIN-10 for localization represent early endosomes. Consistent with this idea, mammalian APBA1-3 have been found to be excluded from EEA1-positive early endosomes [227, 355]. Characterizing the

166

LIN-2 and LIN-7 punctae by testing for colocalization with endomembrane markers would further reveal the nature and function of their punctate localization.

My results indicate that LIN-2 and LIN-7 expression undergo dynamic changes throughout vulval development, whereas LIN-10 expression is relatively stable. I expect that these changes are due to transcriptional regulation rather than protein stability because LIN-2 and LIN-7 were still expressed in uninduced cells when expressed under a non-endogenous promoter (plin-31) in vhEx58 and vhEx60, respectively. A transcriptional reporter showing activation from lin-2 and lin-7 gene promoters would provide a more quantitative readout of their transcriptional regulation. Fluorescent intensity analysis in the existing extrachromosomal array lines would be unreliable due to the mosaic inheritance and varied expression patterns; integrating these lines for more stable expression would provide a more accurate analysis for protein expression to compare with transcriptional regulation. The loss in expression in uninduced cells occurs at the two-cell Pn.px stage, around the time when uninduced cell lineages fuse with the hypodermal syncytium. Whether loss of LIN-2 and LIN-7 expression in these lineages is due to their diffusion across the hypodermis, a tissue where their detectable expression is low, or due to the genetic factors relating to vulval cell fate induction, remain to be further studied.

MPK-1 ERK activation begins as early as mid L2 larvae [93], although the first cell division doesn’t occur until early/mid-L3. Receptor expression also increases from L2 to L3 larvae [90, 153]. A downstream target of MPK-1 ERK signalling, the Notch ligand LAG-2, is transcriptionally active into the P6.pxx stage and L4 early vulval cells [356], consistent with a need for continued signalling activation. LIN-2 and LIN-7 expression levels peak at the completion of the vulva cell divisions. This correlates with an observed drop in LET-23 EGFR

167 levels on the apical membrane. Therefore, LIN-2 and LIN-7 might be upregulated to promote basolateral LET-23 EGFR recycling and inhibit apical targeting to sustain signalling after cell fate induction.

6.2.1 Complex-independent function of LIN-7

My results show that LIN-7 overexpression can compensate for loss of its complex components to independently promote LET-23 EGFR signalling. Given that LIN-7 interacts with LET-23

EGFR directly, and is unique among its complex components in localization to the basolateral membrane, LIN-7 likely associates with membrane-bound receptor independently of its complex.

In the absence of LIN-2 or LIN-10, LIN-7 expression is substantially decreased due to loss of vulval cell fate induction. Therefore, an important consideration is that by ectopically expressing LIN-7 in Vul mutants under a non-endogenous promoter, I am allowing for expression of LIN-7 in cell lineages in which it otherwise would be nearly absent. The majority of LIN-7::EGFP-positive cells were induced into primary or secondary cell fate lineages. It is possible that simple restoration of LIN-7 expression, rather than specifically overexpression, is sufficient for vulval cell fate induction because LIN-7 is now available to carry out its regular cellular functions in lin-2 or lin-10 mutants. Alternatively, overexpression of LIN-7 may indeed be necessary to compensate for loss of LIN-2 and LIN-10-mediated processes by enhancing basolateral recycling for the small amount of receptor that makes it to the basolateral membrane independently of the complex (Figure 6.1a). The relationship between VPC cell fate induction and LIN-7 expression levels requires further examination.

Still, this cannot explain why LIN-7 overexpression rescues a receptor mutant lacking a

PDZ interaction motif (let-23(sy1)). Mammalian Lin7A was found to have a second point of

168 interaction with the kinase domain of all four human EGFR paralogues through a region N- terminal to its L27 domain that helps transit the receptor from the ER to the Golgi [84]. Lin7B and C isoforms, in addition to C. elegans LIN-7, only retain a portion of this N-terminal sequence (Figure 6.1b and [84]). The study showing loss of interaction between let-23(sy1) and

LIN-7 used only the PDZ domain of LIN-7 with a C-terminal fragment of LET-23 that excluded the kinase domain [112]; therefore, a second point of interaction may have been missed. In this case, LIN-7 overexpression could rescue let-23(sy1) by retaining its interaction with the kinase domain to upregulate secretion of the receptor (Figure 6.1a).

169

Figure 6.1 Model for complex-independent function of LIN-7 (a) LIN-7 might promote LET-23 EGFR signalling independently of its complex by through a bivalent interaction with the receptor, or through conservation of interaction with cell polarity regulators such as PALS1 or MPP7/Dlg1 through its L27 domain. (b) The N-terminal residues that mediate interaction between mammalian Lin7A and the kinase domain of EGFRs is only partially conserved in Lin7B-C, Drosophila LIN-7 orthologue, and C. elegans LIN-7. Figure 6.1b was adapted from Shelly et al. [84] with permission Development Cell (License # 4726900201682).

170

6.2.2 LIN-7 and VPC cell polarity

General regulation of epithelial cell polarity could provide an alternative explanation for the effect of LIN-7 overexpression. Mammalian Lin7 is involved in maintenance of epithelial cell polarity by ensuring polarized targeting of internalized cargo and by associating with the Crumbs polarity complex and cadherin-catenin complex at cell junctions [188, 189, 191]. During eye development in zebrafish; neural tube development in zebrafish, frogs (Xenopus), and chickens; and intestinal lumen development, LIN-7 homologues undergo changes in expression and localization patterns that are associated with dynamic regulation of cell polarity across the developing epithelia [137, 139, 191]. The precise function of these changes is not fully understood; however, the changes I observed in LIN-7 localization may involve similar cell polarity pathways.

Although the apical junctions are intact in the VPCs of lin-7 mutants based on normal localization of AJM-1 [90], the position of other cell polarity markers or other polarized membrane proteins has not been explored. Zebrafish homologue LIN7C is required for cell polarity maintenance during neural tube development, but not establishment of polarity nor development of cadherin-catenin cell junctions [139]. Ectopic expression of LIN7C is sufficient to alter spindle positioning and orientation of cell divisions during zebrafish neural tube development, thereby disrupting the symmetry of the developing tissue and often resulting in development of two separate neural tubes [139]. Furthermore, overexpression of mammalian

Lin7 induces overactivation of MEK/ERK and AKT, hyperproliferation, and invasion in human breast adenocarcinoma cell line, and Lin7 is overexpressed in invasive microcapillary carcinomas of the breast, a cancer type characterized by major polarity dysregulation [114].

171

Given the importance of LIN-7 orthologues in cell polarity, LIN-7 overexpression in the

VPCs could have more global impacts on epithelial cell polarity that could indirectly shift the balance between apical and basolateral cargo sorting, which may be sufficient to relocalize LET-

23 EGFR to the basolateral membrane even in absence of a PDZ-mediated interaction. The finding that the actin cytoskeleton-regulating protein ERM-1 (Ezrin-Radixin-Moesin) localizes to basolateral membranes in proliferating VPCs, then relocates to apical membranes in differentiated vulval cells [343] provides further rationale to study polarity regulating of the

VPCs during induction. A role for LIN-7 would likely involve interactions with polarity regulators, such as the Crumbs complex or MPP7 (Figure 6.1b). Crumbs complex components

PALS1 and PATJ have been poorly studied in C. elegans, though homologues do exist. Whether the PALS/Lin7 or the MPP7/LIN-7 interactions are conserved in C. elegans has not been validated.

6.2.3 Complex-dependency of LIN-2

LIN-2 is the only member of the complex that has been found to have an alternate binding partner (EPS-8 [153]); nevertheless, it was the only component not found to have a complex- independent function. This could point to the importance of LIN-2 in bridging LIN-7-mediated and LIN-10-mediated pathways and therefore only promotes LET-23 EGFR localization in the context of both LIN-7 and LIN-10. Of note, LIN-2 overexpression did not cause a dominant negative phenotype as might occur with overexpressing a scaffold that bridges an interaction between two proteins. Alternatively, LIN-2 may require an interaction specifically with LIN-7 for its function, as suggested by the strong association between LIN-2 and LIN-7 in vivo and their similar expression profiles. LIN-2 overexpression might need to be matched by an

172 increased pool of LIN-7 available for binding; therefore, co-overexpression of LIN-7 and LIN-2 might restore the balance between these two proteins and result in complete rescue of mutant Vul phenotypes. Furthermore, the characterization of heterotrimer complex formation with tandem

L27 domain-containing proteins [155], and the finding that LIN-2/LIN-7/EPS-8 co- immunoprecipitate in a complex [153], suggests an association with LIN-7 might be needed to stabilize EPS-8 function.

6.3 Novel, independent function of LIN-10 in regulating LET-23 EGFR signalling

The role of LIN-10 in regulating polarized signalling and trafficking of LET-23 EGFR in C. elegans epithelia was thought to require an interaction with LIN-2 to form the LIN-2/7/10 complex, in addition to a functional PTB domain [112, 167, 168]. However, my results show that

LIN-10 can function independently of an interaction with LIN-2. Expression of the PTB domain, whether on the LIN-2-interacting N-terminus or the PDZ-domain-containing C-terminus, is essential for rescue of lin-10 mutants, suggesting the PTB domain mediates overall LIN-10 function, whereas the PDZ domains are involved in a complex-independent pathway. Therefore,

LIN-10 seems to have three functional domains, and requires at least two for its function: the

LIN-2-interacting CID, the PTB domain, and the complex-independent PDZ domains. LIN-10 localization to the Golgi or recycling endosomes does not appear to be important for its overall function, but is associated specifically with its complex-independent function. A yeast LIN-10 homologue can interact directly with membranes through its PTB domain [186]; however, PTB domains are not required for LIN-10 endomembrane localization, indicating that LIN-10 is

173 recruited to cytosolic punctae by PDZ-interacting proteins that are likely also involved in its complex-independent regulation of LET-23 EGFR trafficking (Figure 6.2a).

LIN-10 PTB and PDZ domains likely work with uncharacterized effectors to mediate basolateral sorting. For example, mammalian APBA2 PDZ domains mediate an interaction with

Class I/II Arf GTPases to regulate secretion from the trans-Golgi network [211]. In C. elegans,

LIN-10 and ARF-1.2 colocalize in the VPCs, and overexpression of LIN-10 phenocopies downregulation of the AGEF-1/ARF/AP-1 pathway. Therefore, one possible explanation for the complex-independent pathway is that LIN-10 interacts with ARF GTPases to ultimately suppress the AGEF-1/ARF/AP-1 pathway, possibly by inhibiting recruitment of AP-1. Overexpression of

LIN-10 in a lin-2 mutant would then relieve the suppression caused by AGEF-1/ARF/AP-1, allowing for some minor but sufficient restoration of basolateral LET-23 EGFR localization for cell fate induction. It remains to be determined whether LIN-10 interacts with ARF GTPases, and whether this interaction mediates its complex-independent function.

In many contexts, the PTB and PDZ domains are the primary functional units of LIN-10 and APBA proteins, and host a wide network of protein interactions (see Figure 1.9). As described in the Introduction, mammalian APBA proteins couple PTB-mediated interaction with

APP to PDZ-mediated interactions with APP regulators, including transcriptional activators, secretases, and Arf GTPases [150, 211, 228]. Therefore, both the PTB and PDZ domains are needed for regulation of APP trafficking and processing. Through a mechanism that is not fully understood, overexpression of the C-terminal PDZ domains of APBA2 was found to be sufficient to inhibit APP maturation and Aβ formation, despite loss of direct interaction with its cargo. This was similar to the effect of blocking ER and Golgi export through treatment with

BFA, suggesting that the PDZ domains may promote an undefined Golgi secretory pathway

174

[357]. This may also help to explain the requirement of LIN-10 PDZ domains in GLR-1 endosome-to-Golgi retrograde trafficking by mediating Golgi secretion [168]. The finding that

LIN-10 overexpression can regulate LET-23 EGFR localization despite loss of direct association to the receptor suggests LIN-10 may be working in a similar fashion in the VPCs. Further characterizing the role of LIN-10 PDZ domains in VPC cell fate induction could inform us on conserved mechanisms for the APBA protein family, and could reveal a novel mechanism for

Golgi export.

175

Figure 6.2 Model of complex-independent function of LIN-10 (a) In addition to the known association of LIN-10 with LIN-2/7, its PTB domain likely interacts with an effector to regulate intracellular trafficking, or might interact with phosphorylated LET- 23 EGFR. The PDZ domains might interact with additional effectors to regulate LET-23 EGFR trafficking, or might be involved in autoregulatory intra- or intermolecular interactions. (b) Sequence alignments reveal that the Y1016 residue (arrow) of human ErbB1 that interacts with mammalian APBA3 is conserved in C. elegans LET-23 EGFR. Sequences from UniProt and WormBase, alignment generated with Clustal Omega. (c) Sequence alignments of the C-terminal residues of mammalian APBA (X11α-γ) proteins and C. elegans LIN-10 (arrows) reveal that the autoregulatory tyrosine residue that interacts with PDZ1 and PDZ2 is conserved in C. elegans. Figure 6.2c was adapted from Long et al. [149] with permission from Springer Nature (License number 4726900384837).

176

6.3.1 LIN-10 might interact with LET-23 EGFR phosphotyrosines, as in APBA3

The mammalian CASK/Lin7/APBA1 complex has been shown to have multivalent interactions with cargo. For example, neurexin interacts with the PDZ domains of both CASK and APBA1

[122-124]. The sequence of the Type I PDZ-interaction motif of LET-23 EGFR, -TCL, matches the consensus motif for PDZ2 of LIN-10 [150]. However, LIN-10 overexpression also rescues the PDZ interaction-deficient let-23(sy1) receptor mutant, suggesting LIN-10 does interact with the receptor in a PDZ-mediated manner. Alternatively, NPXY motifs are associated with basolateral targeting, and PTB domains of homologous APBA proteins preferentially bind unphosphorylated NPXY motifs [162, 163]; however, LET-23 EGFR does not have a matching motif in its C-terminal primary structure. This suggests that LIN-10 is unlikely to bypass LIN-2 and LIN-7 by interacting with LET-23 EGFR directly, supporting previous findings that LIN-10 and LET-23 EGFR do not interact in yeast two-hybrid interaction assays [112, 205].

On the other hand, mammalian APBA3 has been found to interact with a phosphorylated tyrosine residue of ErbB1 that is not in an NPXY motif (Y1016) in a large-scale protein microarray interaction assay [358], though the biological relevance of this interaction has not been explored. Whether the phosphorylation of the homologous residue of LET-23 EGFR

(Y1242) (Figure 6.2b) is important for VPC cell fate induction, and whether phosphorylated receptor might interact directly with the PTB domain of LIN-10 (Figure 6.2a), is unknown. This might relate to the involvement of the LIN-10 PTB domain in regulating VPC cell fate induction, but would not account for the PDZ-mediated complex-independent function of LIN-10.

177

6.3.2 LIN-10 autoregulation might explain its overexpression phenotype

Endogenous LIN-10 expression is unchanged in uninduced cell lineages and in lin-2/7 mutants.

Therefore, unlike LIN-7, the complex-independent function of LIN-10 specifically requires overexpression to compensate for loss of lin-2 or lin-7. Overexpression of proteins can result in neomorphic phenotypes, although this is a rare occurrence [359, 360]. Still, LIN-10 has been found to self-interact in a yeast two-hybrid screen [205], and mammalian APBA proteins are known to have intramolecular interactions. Therefore, overexpression of LIN-10 may cause some dimerization, which in turn might increase LIN-10 activity.

As described in the introduction, the C-terminal tip of APBA1/2 interacts with the PDZ1 domain [149, 250], and sequences associated with these intramolecular interactions are conserved in C. elegans LIN-10 (Figure 6.2c). Overexpression could cause dimerization or oligomerization of LIN-10, which might help amplify secretory functions of LIN-10 by relieving the autoinhibitory intramolecular interaction between the PTB domain and the linker region

(Figure 6.2a). If this hypothetical model is true, then extrachromosomal GFP::LIN-10 (vhEx37) and mNG::LIN-10 (vh50) should co-immunoprecipitate. Presuming that disruption of intermolecular interactions do not disrupt intramolecular interactions, then overexpression of

LIN-10 deficient in these intermolecular interactions should fail to activate itself, or endogenous

LIN-10, to rescue a lin-2 mutant. Such interactions might explain why expression of the LIN-10

PDZ domains can rescue the lin-2 Vul phenotype, but not that of a lin-10 mutant. If these interactions are found to exist, they might be characteristic of endogenous LIN-10 function or of neomorphic effects due to overexpression. In either case, this would demonstrate a novel role for autoregulation of LIN-10 in VPC induction.

178

6.4 A new perspective on the LIN-2/7/10 complex

The localization of LIN-2, -7, and -10 provide novel insight into complex formation and function. LIN-10-mediated recruitment of LIN-2 and LIN-7 to cytosolic punctae, and LIN-2- dependent overlap between LIN-10 and LET-23 EGFR, suggests that the complex most likely assembles at the Golgi or recycling endosomes to direct receptor targeting, rather than promoting retention of the receptor on the plasma membrane. Fluorescence resonance energy transfer

(FRET), split-GFP, or proximity ligation assays could further identify the precise localization of interaction in vivo.

An updated model of the LIN-2/7/10 complex can be put together to incorporate my results with what is known about mammalian CASK, Lin7, and APBA function (Figure 6.3).

LIN-10 likely mediates a constitutive Golgi secretion, which may nonspecifically target LET-23

EGFR to the basolateral membrane. At the onset of signaling activation, LET-23 EGFR expression is upregulated [90], and LIN-2/7 are upregulated soon after. I expect that they help to amplify the signal by keeping LET-23 EGFR active in two ways: first, by interacting with LIN-

10 to increase the amount of receptor that gets shuttled through LIN-10-mediated pathways; and second, for LIN-2, LIN-7, and EPS-8 to promote recycling or tethering of LET-23 EGFR [153].

Some recycling may also involve LIN-10-mediated pathways for targeting to the basolateral membrane. Therefore, the complex is predicted to work as a team and individually at numerous stages in LET-23 EGFR trafficking.

179

Figure 6.3 Model of the role of the LIN-2/7/10 complex in the VPCs My results are consistent with a model in which LIN-10 promotes basolateral targeting from Golgi or recycling endosomes. Some LET-23 EGFR is sorted to the basolateral membrane by LIN-10 alone. Association of LIN-2/7 with LIN-10 increases the basolateral targeting for LET- 23 EGFR. This might happen at the level of secretion from Golgi ministacks, or from recycling endosomes to direct inactivated receptor back to the membrane for resensitization. LIN-2/7 likely also work in recycling of the receptor without LIN-10. Finally, LIN-7 remains at the membrane to associate with LET-23 EGFR without its complex components. Question marks indicate predicted unidentified interacting proteins.

180

6.4.1 The combined activity of LIN-2, -7, and -10 optimize fidelity in developmental programming

The finding that LIN-2, -7, and -10 are involved in multiple overlapping pathways to promote

LET-23 EGFR signalling raises important questions of the relevance of having the complex form in the first place. I expect that the LIN-2/7/10 complex helps maximize specificity in cell fate induction to ensure normal cell fate patterning.

The vulva in C. elegans is composed of only 22 cells, and relies on half of its stock of precursor cells for development. Induction of P5.p, P6.p, and P7.p is required for normal morphogenesis and function; therefore, there is very little room for error in VPC induction. Vul worms are viable and can self-fertilize to make progeny; however, eggs building up inside Vul worms will eventually cause premature death of the mother, resulting in a substantially decreased brood size compared to wildtype worms. Therefore, Vul worms are outcompeted by wildtype worms, providing a means for selection of a strict developmental program.

Although LIN-10 and LIN-7 overexpression can bypass the requirement of their complex components for induction, they do not bypass the requirement of the complex for patterning, as demonstrated by the development of Vul and Muv worms in lin-2 mutants overexpressing

GFP::LIN-10. Therefore, complex formation between LIN-2, -7, and -10 help to regulate a highly specific signalling cascade that is balanced by positive and negative regulators and competing signalling pathways to maintain an invariant vulval cell lineage.

6.4.2 Implications for mammalian CASK, Lin7, and APBA1

Mutations in mammalian CASK, Lin7, and APBA proteins are associated with neurodegenerative disorders, learning disabilities, cognitive dysfunction, and cancer. Exploring

181 their function in regulating subcellular organization and tissue development is crucial to understanding their role in disease progression.

Compensatory mechanisms among the CASK/Lin7/APBA1 complex components have not been tested; however, my results suggest these proteins might integrate their wide network of complex-independent pathways with their complex-mediated regulation of synaptic proteins.

Moreover, recent reports of non-neuronal expression of APBA1 suggest that the

CASK/Lin7/APBA1 complex may indeed form in mammalian epithelial cells to regulate basolateral membrane proteins. Involvement of APBA proteins in CASK and Lin7-mediate epithelial pathways has not been examined; however, the finding that LIN-10 can promote LIN-

2/7 pathways independently of an interaction provides further rationale to test for a requirement of APBA proteins in epithelial trafficking networks.

6.5 A GAP in our model

In a screen for an Arf GAP that regulates LET-23 EGFR signalling, I found that the ARF-6 GAP

CNT-1 antagonizes LET-23 EGFR signalling. My results suggest CNT-1 may be working in an

ARF-6-independent pathway. arf-6 mutants do not rescue lin-2 mutants [91], nor is arf-6 required for cnt-1 to suppress lin-2. Therefore, it is unlikely that CNT-1 is working as a GAP or as an effector of ARF-6 to antagonize LET-23 EGFR signalling. Whether CNT-1 is working with the AGEF-1/ARF/AP-1 pathway requires further testing. This project is still preliminary, and many avenues remain to be explored.

Loss of rab-35 phenocopies loss of cnt-1 in its degree of VPC induction rescue in a lin-2 mutant. Given that CNT-1 has been found to be an effector of RAB-35 in C. elegans and in mammals, it is likely that they are working together to regulate VPC induction. If so, then it

182 would be expected that a cnt-1; rab-35 double would not cause further suppression of the lin-2

Vul phenotype than either single mutant. CNT-1 is recruited by RAB-35 to inactivate ARF-6 in worms and in mammals, which makes the finding that CNT-1 works in an ARF-6-independent manner particularly unexpected. Although several Arf GAPs have catalytic activity for a variety of Arfs, ACAP has not thus far been shown to be involved in regulating an Arf other than Arf6

[295, 361]. It is possible that the negative regulation of ARF-6 by CNT-1 is balanced by the requirement of CNT-1 for GTP hydrolysis to promote ARF-6-mediated trafficking [362], and so loss of arf-6 would not compensate for loss of cnt-1. If so, then ectopic expression of dominant negative and constitutively active ARF-6 in the VPCs might reveal a function for ARF-6 in vulva induction. Alternatively, CNT-1 could function as a GAP and effector for either ARF-1.2 or ARF-3, as might be suggested by the limited suppression by overexpression of ARF-1.2. If

GAP activity of CNT-1 is truly not required, then ectopic expression of a catalytically inactive

CNT-1 protein should reverse VPC induction rescue in cnt-1; lin-2 double mutants. If instead a catalytically inactive mutant fails to reverse the effect, it would indicate that CNT-1 regulation of

VPC induction requires its GAP activity. In this case, further study would be needed to test which ARF is being targeted by CNT-1 to regulate VPC induction.

6.5.1 CNT-1 might regulate LET-23 EGFR recycling directly, or restrict LET-23 EGFR mobility through integrin recycling

Although regulation of polarized LET-23 EGFR localization suggests CNT-1 regulates the receptor, it remains to be tested genetically that CNT-1 is not antagonizing VPC induction downstream of receptor activation. If CNT-1 is indeed regulating the receptor, this likely involves directing intracellular recycling pathways of LET-23 EGFR (Figure 6.4a).

183

Neither CNT-1 nor ACAP proteins have been shown to regulate recycling of EGFRs.

Mammalian Rab35 has been found to target endocytosed ErbB1 for lysosomal degradation, and

ACAP2 was presumed to be involved due to regulation of integrin recycling with Rab35 and colocalization of integrin with ErbB1 [272]; however, ACAP2 regulation of ErbB1 was not specifically shown. ACAP1 has been found to regulate integrin recycling without altering ErbB1 levels [311, 322]; therefore, it could be that while ACAP2 mediates integrin recycling, a different effector works with Rab35 to regulate ErbB1 trafficking. If CNT-1 and RAB-35 regulate LET-23 EGFR trafficking, it would support the hypothesis that ACAP2 regulates EGFR trafficking in a Rab35-mediated pathway.

Regulation of integrin recycling could provide an alternative explanation for the role of

CNT-1 in LET-23 EGFR signalling (Figure 6.4b). ACAPs are regulators of integrin recycling and are often found in integrin adhesion complexes [285]. Integrin subunit PAT-3 has recently been identified as a negative regulator of LET-23 EGFR activation by recruiting talin to stabilize the actin cortex and restrict receptor mobility [260]. Testing for altered recruitment of talin or disruption of PAT-3 localization in cnt-1 mutants would indicate if CNT-1 regulates integrin recycling in the VPCs. Furthermore, determining if a functionally inactive integrin mutant suppresses VPC induction in cnt-1; lin-2 mutants would support the hypothesis that CNT-1 regulates VPC induction by regulating integrins to restrict LET-23 EGFR mobility.

184

Figure 6.4 Hypothetical models to explain CNT-1 regulation of LET-23 EGFR signalling (a) CNT-1 might be directly involved in trafficking of LET-23 EGFR either by inhibiting its internalization or by inhibiting its recycling back to the basolateral membrane. (b) Alternatively, CNT-1 might regulate integrin recycling. Integrins are known to negatively regulate signalling by recruiting talin to nucleate actin polymerization in the cell cortex, ultimately inhibiting LET- 23 EGFR membrane mobility [260].

185

6.5.2 CNT-2 promotes LET-23 EGFR-mediated vulva induction

RNAi-mediated knockdown of cnt-2 suppressed VPC induction in cnt-1; lin-2 double mutants, and modestly but significantly suppressed the Muv phenotype of agef-1; lin-2 double mutants.

CNT-2 has been characterized as a putative ARF-1.2 GAP during regulation of neuroblast cell divisions [363], suggesting that CNT-2 could promote LET-23 EGFR signalling by working in opposition to AGEF-1 to regulate ARF-1.2. Genetic mutants of cnt-2 would validate the finding that cnt-2 suppresses agef-1 during vulval development, and could reveal a more robust phenotype than that seen by RNAi.

The nature of the relationship between CNT-1 and CNT-2 is not quite clear. Although

CNT-1 and CNT-2 have similar domains, they have not previously been reported to work together or in opposition to each other. It’s possible that CNT-1- and CNT-2-mediated pathways converge on a common GTPase target (e.g. either ARF-1.2 or ARF-6), and loss of cnt-1 increases the pool of available GTPase for regulation by CNT-2, resulting in upregulation of

CNT-2-mediated pathways. The precise relationship between CNT-2, CNT-1, and the AGEF-

1/ARF/AP-1 pathway requires further study to identify if and how these pathways might intersect to regulate VPC cell fate induction.

186

6.6 Original contributions to knowledge

1. In vivo analysis of the LIN-2/7/10 complex

In Chapter 3, I presented the first characterization of localization and expression of LIN-2, -7, and -10 in the VPCs at the time of cell fate induction, of their colocalization with each other, their dependency on each other for localization, and their colocalization with LET-23 EGFR.

This is the first identification of any LIN-7 homologue at cytoplasmic foci. This is also the first demonstration that LIN-2/7/10 proteins interact in vivo in C. elegans by co-immunoprecipitation, and that LIN-2 and LIN-7 colocalize in neuronal tissues.

2. New function for LIN-10 and LIN-7 in regulating LET-23 EGFR signalling

This is the first identification of a complex-independent role for LIN-7 and LIN-10 in promoting

LET-23 EGFR signalling. The finding that LIN-7 can rescue a let-23(sy1) allele is the first demonstration that LIN-7 regulates LET-23 EGFR signalling in a PDZ-independent manner. A role for the PDZ domains of LIN-10 in regulating LET-23 EGFR signalling had not been shown before. Finally, this is the first demonstration that LIN-10 does not require its LIN-2-interacting domain for its function in the VPCs.

3. CNT-1, CNT-2, and RAB-35 are novel regulators of VPC cell fate induction

This is the first identification of CNT-1, CNT-2, and RAB-35 in regulating VPC cell fate induction and LET-23 EGFR signalling. Mammalian homologue ACAP (CNT-1) is not a known regulator of EGFR signalling.

187

References

188

1. Buday L, Tompa P. Functional classification of scaffold proteins and related molecules. FEBS J. 2010;277(21):4348-55.

2. Arimura N, Kaibuchi K. Neuronal polarity: from extracellular signals to intracellular mechanisms. Nat Rev Neurosci. 2007;8(3):194-205.

3. Rodriguez-Boulan E, Macara IG. Organization and execution of the epithelial polarity programme. Nat Rev Mol Cell Biol. 2014;15(4):225-42.

4. Hung MC, Link W. Protein localization in disease and therapy. J Cell Sci. 2011;124(Pt 20):3381-92.

5. Wilson PD. Apico-basal polarity in polycystic kidney disease epithelia. Biochim Biophys Acta. 2011;1812(10):1239-48.

6. Itoh M, Bissell MJ. The organization of tight junctions in epithelia: implications for mammary gland biology and breast tumorigenesis. J Mammary Gland Biol Neoplasia. 2003;8(4):449-62.

7. Hartsock A, Nelson WJ. Adherens and tight junctions: structure, function and connections to the actin cytoskeleton. Biochim Biophys Acta. 2008;1778(3):660-9.

8. Seong E, Yuan L, Arikkath J. Cadherins and catenins in dendrite and synapse morphogenesis. Cell Adh Migr. 2015;9(3):202-13.

9. Cox EA, Hardin J. Sticky worms: adhesion complexes in C. elegans. J Cell Sci. 2004;117(Pt 10):1885-97.

10. Yamanaka T, Ohno S. Role of Lgl/Dlg/Scribble in the regulation of epithelial junction, polarity and growth. Front Biosci. 2008;13:6693-707.

11. Hanahan D, Weinberg RA. Hallmarks of cancer: the next generation. Cell. 2011;144(5):646-74.

12. Kalluri R, Weinberg RA. The basics of epithelial-mesenchymal transition. J Clin Invest. 2009;119(6):1420-8.

13. Assemat E, Bazellieres E, Pallesi-Pocachard E, Le Bivic A, Massey-Harroche D. Polarity complex proteins. Biochim Biophys Acta. 2008;1778(3):614-30.

14. Redenbach DM, Boekelheide K. Microtubules are oriented with their minus-ends directed apically before tight junction formation in rat Sertoli cells. Eur J Cell Biol. 1994;65(2):246-57. 189

15. Gilbert T, Le Bivic A, Quaroni A, Rodriguez-Boulan E. Microtubular organization and its involvement in the biogenetic pathways of plasma membrane proteins in Caco-2 intestinal epithelial cells. J Cell Biol. 1991;113(2):275-88.

16. Bacallao R, Antony C, Dotti C, Karsenti E, Stelzer EH, Simons K. The subcellular organization of Madin-Darby canine kidney cells during the formation of a polarized epithelium. J Cell Biol. 1989;109(6 Pt 1):2817-32.

17. Jaulin F, Xue X, Rodriguez-Boulan E, Kreitzer G. Polarization-dependent selective transport to the apical membrane by KIF5B in MDCK cells. Dev Cell. 2007;13(4):511-22.

18. Parker SS, Cox C, Wilson JM. Rabs set the stage for polarity. Small GTPases. 2018;9(1- 2):116-29.

19. Apodaca G, Gallo LI, Bryant DM. Role of membrane traffic in the generation of epithelial cell asymmetry. Nat Cell Biol. 2012;14(12):1235-43.

20. Stoops EH, Caplan MJ. Trafficking to the apical and basolateral membranes in polarized epithelial cells. J Am Soc Nephrol. 2014;25(7):1375-86.

21. Gravotta D, Deora A, Perret E, Oyanadel C, Soza A, Schreiner R, et al. AP1B sorts basolateral proteins in recycling and biosynthetic routes of MDCK cells. Proc Natl Acad Sci U S A. 2007;104(5):1564-9.

22. Folsch H. Role of the epithelial cell-specific clathrin adaptor complex AP-1B in cell polarity. Cell Logist. 2015;5(2):e1074331.

23. Ikenouchi J. Roles of membrane lipids in the organization of epithelial cells: Old and new problems. Tissue Barriers. 2018;6(2):1-8.

24. Brone B, Eggermont J. PDZ proteins retain and regulate membrane transporters in polarized epithelial cell membranes. Am J Physiol Cell Physiol. 2005;288(1):C20-9.

25. Good MC, Zalatan JG, Lim WA. Scaffold proteins: hubs for controlling the flow of cellular information. Science. 2011;332(6030):680-6.

26. Cohen S. Isolation and Biological Effects of an Epidermal Growth-Stimulating Protein. Natl Cancer Inst Monogr. 1964;13:13-37.

27. Derynck R, Roberts AB, Winkler ME, Chen EY, Goeddel DV. Human transforming growth factor-alpha: precursor structure and expression in E. coli. Cell. 1984;38(1):287-97.

190

28. Marquardt H, Hunkapiller MW, Hood LE, Todaro GJ. Rat transforming growth factor type 1: structure and relation to epidermal growth factor. Science. 1984;223(4640):1079-82.

29. Shoyab M, Plowman GD, McDonald VL, Bradley JG, Todaro GJ. Structure and function of human amphiregulin: a member of the epidermal growth factor family. Science. 1989;243(4894 Pt 1):1074-6.

30. Zhang D, Sliwkowski MX, Mark M, Frantz G, Akita R, Sun Y, et al. Neuregulin-3 (NRG3): a novel neural tissue-enriched protein that binds and activates ErbB4. Proc Natl Acad Sci U S A. 1997;94(18):9562-7.

31. Harari D, Tzahar E, Romano J, Shelly M, Pierce JH, Andrews GC, et al. Neuregulin-4: a novel growth factor that acts through the ErbB-4 receptor tyrosine kinase. Oncogene. 1999;18(17):2681-9.

32. Wieduwilt MJ, Moasser MM. The epidermal growth factor receptor family: biology driving targeted therapeutics. Cell Mol Life Sci. 2008;65(10):1566-84.

33. Graus-Porta D, Beerli RR, Daly JM, Hynes NE. ErbB-2, the preferred heterodimerization partner of all ErbB receptors, is a mediator of lateral signaling. EMBO J. 1997;16(7):1647-55.

34. Pinkas-Kramarski R, Soussan L, Waterman H, Levkowitz G, Alroy I, Klapper L, et al. Diversification of Neu differentiation factor and epidermal growth factor signaling by combinatorial receptor interactions. EMBO J. 1996;15(10):2452-67.

35. Carraway KL, 3rd, Cantley LC. A neu acquaintance for erbB3 and erbB4: a role for receptor heterodimerization in growth signaling. Cell. 1994;78(1):5-8.

36. Roskoski R, Jr. The ErbB/HER family of protein-tyrosine kinases and cancer. Pharmacol Res. 2014;79:34-74.

37. Iwakura Y, Nawa H. ErbB1-4-dependent EGF/neuregulin signals and their cross talk in the central nervous system: pathological implications in schizophrenia and Parkinson's disease. Front Cell Neurosci. 2013;7:4.

38. Batzer AG, Rotin D, Urena JM, Skolnik EY, Schlessinger J. Hierarchy of binding sites for Grb2 and Shc on the epidermal growth factor receptor. Mol Cell Biol. 1994;14(8):5192-201.

39. Blinov ML, Faeder JR, Goldstein B, Hlavacek WS. A network model of early events in epidermal growth factor receptor signaling that accounts for combinatorial complexity. Biosystems. 2006;83(2-3):136-51.

191

40. Roberts PJ, Der CJ. Targeting the Raf-MEK-ERK mitogen-activated protein kinase cascade for the treatment of cancer. Oncogene. 2007;26(22):3291-310.

41. Carpenter G, Lembach KJ, Morrison MM, Cohen S. Characterization of the binding of 125-I-labeled epidermal growth factor to human fibroblasts. J Biol Chem. 1975;250(11):4297- 304.

42. Ullrich A, Coussens L, Hayflick JS, Dull TJ, Gray A, Tam AW, et al. Human epidermal growth factor receptor cDNA sequence and aberrant expression of the amplified gene in A431 epidermoid carcinoma cells. Nature. 1984;309(5967):418-25.

43. Frykberg L, Palmieri S, Beug H, Graf T, Hayman MJ, Vennstrom B. Transforming capacities of avian erythroblastosis virus mutants deleted in the erbA or erbB oncogenes. Cell. 1983;32(1):227-38.

44. Rimawi MF, Shetty PB, Weiss HL, Schiff R, Osborne CK, Chamness GC, et al. Epidermal growth factor receptor expression in breast cancer association with biologic phenotype and clinical outcomes. Cancer. 2010;116(5):1234-42.

45. Herbst RS, Heymach JV, Lippman SM. Lung cancer. N Engl J Med. 2008;359(13):1367- 80.

46. Shigematsu H, Gazdar AF. Somatic mutations of epidermal growth factor receptor signaling pathway in lung cancers. Int J Cancer. 2006;118(2):257-62.

47. Yarden Y, Sliwkowski MX. Untangling the ErbB signalling network. Nat Rev Mol Cell Biol. 2001;2(2):127-37.

48. Wang Z. ErbB Receptors and Cancer. Methods Mol Biol. 2017;1652:3-35.

49. Wagner B, Natarajan A, Grunaug S, Kroismayr R, Wagner EF, Sibilia M. Neuronal survival depends on EGFR signaling in cortical but not midbrain astrocytes. EMBO J. 2006;25(4):752-62.

50. Siddiqui S, Fang M, Ni B, Lu D, Martin B, Maudsley S. Central role of the EGF receptor in neurometabolic aging. Int J Endocrinol. 2012;2012:739428.

51. Sundaram M, Han M. The C. elegans ksr-1 gene encodes a novel Raf-related kinase involved in Ras-mediated signal transduction. Cell. 1995;83(6):889-901.

52. Ohmachi M, Rocheleau CE, Church D, Lambie E, Schedl T, Sundaram MV. C. elegans ksr-1 and ksr-2 have both unique and redundant functions and are required for MPK-1 ERK phosphorylation. Curr Biol. 2002;12(5):427-33.

192

53. Therrien M, Chang HC, Solomon NM, Karim FD, Wassarman DA, Rubin GM. KSR, a novel protein kinase required for RAS signal transduction. Cell. 1995;83(6):879-88.

54. Sorkin A, Goh LK. Endocytosis and intracellular trafficking of ErbBs. Exp Cell Res. 2009;315(4):683-96.

55. Jongsma ML, Berlin I, Wijdeven RH, Janssen L, Janssen GM, Garstka MA, et al. An ER- Associated Pathway Defines Endosomal Architecture for Controlled Cargo Transport. Cell. 2016;166(1):152-66.

56. Eden ER, White IJ, Tsapara A, Futter CE. Membrane contacts between endosomes and ER provide sites for PTP1B-epidermal growth factor receptor interaction. Nat Cell Biol. 2010;12(3):267-72.

57. Caldieri G, Malabarba MG, Di Fiore PP, Sigismund S. EGFR Trafficking in Physiology and Cancer. Prog Mol Subcell Biol. 2018;57:235-72.

58. Sigismund S, Algisi V, Nappo G, Conte A, Pascolutti R, Cuomo A, et al. Threshold- controlled ubiquitination of the EGFR directs receptor fate. EMBO J. 2013;32(15):2140-57.

59. Bakker J, Spits M, Neefjes J, Berlin I. The EGFR odyssey - from activation to destruction in space and time. J Cell Sci. 2017;130(24):4087-96.

60. Thalappilly S, Soubeyran P, Iovanna JL, Dusetti NJ. VAV2 regulates epidermal growth factor receptor endocytosis and degradation. Oncogene. 2010;29(17):2528-39.

61. Chung BM, Tom E, Zutshi N, Bielecki TA, Band V, Band H. Nexus of signaling and endocytosis in oncogenesis driven by non-small cell lung cancer-associated epidermal growth factor receptor mutants. World J Clin Oncol. 2014;5(5):806-23.

62. Shtiegman K, Kochupurakkal BS, Zwang Y, Pines G, Starr A, Vexler A, et al. Defective ubiquitinylation of EGFR mutants of lung cancer confers prolonged signaling. Oncogene. 2007;26(49):6968-78.

63. Ibach J, Radon Y, Gelleri M, Sonntag MH, Brunsveld L, Bastiaens PI, et al. Single Particle Tracking Reveals that EGFR Signaling Activity Is Amplified in Clathrin-Coated Pits. PLoS One. 2015;10(11):e0143162.

64. Wang Y, Roche O, Yan MS, Finak G, Evans AJ, Metcalf JL, et al. Regulation of endocytosis via the oxygen-sensing pathway. Nat Med. 2009;15(3):319-24.

193

65. Sigismund S, Argenzio E, Tosoni D, Cavallaro E, Polo S, Di Fiore PP. Clathrin-mediated internalization is essential for sustained EGFR signaling but dispensable for degradation. Dev Cell. 2008;15(2):209-19.

66. Du J, Wilson PD. Abnormal polarization of EGF receptors and autocrine stimulation of cyst epithelial growth in human ADPKD. Am J Physiol. 1995;269(2 Pt 1):C487-95.

67. Hobert ME, Kil SJ, Medof ME, Carlin CR. The cytoplasmic juxtamembrane domain of the epidermal growth factor receptor contains a novel autonomous basolateral sorting determinant. J Biol Chem. 1997;272(52):32901-9.

68. Ryan S, Verghese S, Cianciola NL, Cotton CU, Carlin CR. Autosomal recessive polycystic kidney disease epithelial cell model reveals multiple basolateral epidermal growth factor receptor sorting pathways. Mol Biol Cell. 2010;21(15):2732-45.

69. He C, Hobert M, Friend L, Carlin C. The epidermal growth factor receptor juxtamembrane domain has multiple basolateral plasma membrane localization determinants, including a dominant signal with a polyproline core. J Biol Chem. 2002;277(41):38284-93.

70. Cotton CU, Hobert ME, Ryan S, Carlin CR. Basolateral EGF receptor sorting regulated by functionally distinct mechanisms in renal epithelial cells. Traffic. 2013;14(3):337-54.

71. Hobert ME, Friend LA, Carlin CR. Regulation of EGF signaling by cell polarity in MDCK kidney epithelial cells. J Cell Physiol. 1999;181(2):330-41.

72. Singh B, Bogatcheva G, Washington MK, Coffey RJ. Transformation of polarized epithelial cells by apical mistrafficking of epiregulin. Proc Natl Acad Sci U S A. 2013;110(22):8960-5.

73. Kuwada SK, Lund KA, Li XF, Cliften P, Amsler K, Opresko LK, et al. Differential signaling and regulation of apical vs. basolateral EGFR in polarized epithelial cells. Am J Physiol. 1998;275(6):C1419-28.

74. Balestreire EM, Apodaca G. Apical epidermal growth factor receptor signaling: regulation of stretch-dependent exocytosis in bladder umbrella cells. Mol Biol Cell. 2007;18(4):1312-23.

75. Abdi K, Neves G, Pyun J, Kiziltug E, Ahrens A, Kuo CT. EGFR Signaling Termination via Numb Trafficking in Ependymal Progenitors Controls Postnatal Neurogenic Niche Differentiation. Cell Rep. 2019;28(8):2012-22 e4.

76. Sulston JE. Post-embryonic development in the ventral cord of Caenorhabditis elegans. Philos Trans R Soc Lond B Biol Sci. 1976;275(938):287-97.

194

77. Corsi AK, Wightman B, Chalfie M. A Transparent window into biology: A primer on Caenorhabditis elegans. In: Community TCeR, editor. WormBook: WormBook.

78. Sulston JE, Horvitz HR. Post-embryonic cell lineages of the nematode, Caenorhabditis elegans. Dev Biol. 1977;56(1):110-56.

79. Shaye DD, Greenwald I. OrthoList: a compendium of C. elegans genes with human orthologs. PLoS One. 2011;6(5):e20085.

80. Kaletta T, Hengartner MO. Finding function in novel targets: C. elegans as a model organism. Nat Rev Drug Discov. 2006;5(5):387-98.

81. Culetto E, Sattelle DB. A role for Caenorhabditis elegans in understanding the function and interactions of human disease genes. Hum Mol Genet. 2000;9(6):869-77.

82. Altun ZF, Hall DH. Introduction 2009 [updated April 24, 2012.

83. Aroian RV, Koga M, Mendel JE, Ohshima Y, Sternberg PW. The let-23 gene necessary for Caenorhabditis elegans vulval induction encodes a tyrosine kinase of the EGF receptor subfamily. Nature. 1990;348(6303):693-9.

84. Shelly M, Mosesson Y, Citri A, Lavi S, Zwang Y, Melamed-Book N, et al. Polar expression of ErbB-2/HER2 in epithelia. Bimodal regulation by Lin-7. Dev Cell. 2003;5(3):475- 86.

85. Sundaram MV. Canonical RTK-Ras-ERK signaling and related alternative pathways. WormBook. 2013:1-38.

86. Yin X, Gower NJ, Baylis HA, Strange K. Inositol 1,4,5-trisphosphate signaling regulates rhythmic contractile activity of myoepithelial sheath cells in Caenorhabditis elegans. Mol Biol Cell. 2004;15(8):3938-49.

87. Van Buskirk C, Sternberg PW. Epidermal growth factor signaling induces behavioral quiescence in Caenorhabditis elegans. Nat Neurosci. 2007;10(10):1300-7.

88. Freed DM, Alvarado D, Lemmon MA. Ligand regulation of a constitutively dimeric EGF receptor. Nat Commun. 2015;6:7380.

89. Sternberg PW, Horvitz HR. Pattern formation during vulval development in C. elegans. Cell. 1986;44(5):761-72.

90. Simske JS, Kaech SM, Harp SA, Kim SK. LET-23 receptor localization by the cell junction protein LIN-7 during C. elegans vulval induction. Cell. 1996;85(2):195-204. 195

91. Skorobogata O, Escobar-Restrepo JM, Rocheleau CE. An AGEF-1/Arf GTPase/AP-1 ensemble antagonizes LET-23 EGFR basolateral localization and signaling during C. elegans vulva induction. PLoS Genet. 2014;10(10):e1004728.

92. Sternberg PW, Horvitz HR. The combined action of two intercellular signaling pathways specifies three cell fates during vulval induction in C. elegans. Cell. 1989;58(4):679-93.

93. de la Cova C, Townley R, Regot S, Greenwald I. A Real-Time Biosensor for ERK Activity Reveals Signaling Dynamics during C. elegans Cell Fate Specification. Dev Cell. 2017;42(5):542-53 e4.

94. Greenwald I. lin-12, a nematode homeotic gene, is homologous to a set of mammalian proteins that includes epidermal growth factor. Cell. 1985;43(3 Pt 2):583-90.

95. Greenwald IS, Sternberg PW, Horvitz HR. The lin-12 locus specifies cell fates in Caenorhabditis elegans. Cell. 1983;34(2):435-44.

96. Chen N, Greenwald I. The lateral signal for LIN-12/Notch in C. elegans vulval development comprises redundant secreted and transmembrane DSL proteins. Dev Cell. 2004;6(2):183-92.

97. Shaye DD, Greenwald I. LIN-12/Notch trafficking and regulation of DSL ligand activity during vulval induction in Caenorhabditis elegans. Development. 2005;132(22):5081-92.

98. Zand TP, Reiner DJ, Der CJ. Ras effector switching promotes divergent cell fates in C. elegans vulval patterning. Dev Cell. 2011;20(1):84-96.

99. Sternberg PW, Horvitz HR. Signal transduction during C. elegans vulval induction. Trends Genet. 1991;7(11-12):366-71.

100. Sternberg PW. Vulval development. WormBook. 2005:1-28.

101. Gauthier K, Rocheleau CE. C. elegans Vulva Induction: An In Vivo Model to Study Epidermal Growth Factor Receptor Signaling and Trafficking. Methods Mol Biol. 2017;1652:43- 61.

102. Han M, Aroian RV, Sternberg PW. The let-60 locus controls the switch between vulval and nonvulval cell fates in Caenorhabditis elegans. Genetics. 1990;126(4):899-913.

103. Han M, Sternberg PW. let-60, a gene that specifies cell fates during C. elegans vulval induction, encodes a ras protein. Cell. 1990;63(5):921-31.

196

104. Han M, Golden A, Han Y, Sternberg PW. C. elegans lin-45 raf gene participates in let-60 ras-stimulated vulval differentiation. Nature. 1993;363(6425):133-40.

105. Clark SG, Stern MJ, Horvitz HR. C. elegans cell-signalling gene sem-5 encodes a protein with SH2 and SH3 domains. Nature. 1992;356(6367):340-4.

106. Chang C, Sternberg PW. C. elegans vulval development as a model system to study the cancer biology of EGFR signaling. Cancer Metastasis Rev. 1999;18(2):203-13.

107. Bae YK, Sung JY, Kim YN, Kim S, Hong KM, Kim HT, et al. An in vivo C. elegans model system for screening EGFR-inhibiting anti-cancer drugs. PLoS One. 2012;7(9):e42441.

108. Dhawan NS, Scopton AP, Dar AC. Small molecule stabilization of the KSR inactive state antagonizes oncogenic Ras signalling. Nature. 2016;537(7618):112-6.

109. Ferguson EL, Horvitz HR. Identification and characterization of 22 genes that affect the vulval cell lineages of the nematode Caenorhabditis elegans. Genetics. 1985;110(1):17-72.

110. Kim SK. Polarized signaling: basolateral receptor localization in epithelial cells by PDZ- containing proteins. Curr Opin Cell Biol. 1997;9(6):853-9.

111. Kornfeld K. Vulval development in Caenorhabditis elegans. Trends Genet. 1997;13(2):55-61.

112. Kaech SM, Whitfield CW, Kim SK. The LIN-2/LIN-7/LIN-10 complex mediates basolateral membrane localization of the C. elegans EGF receptor LET-23 in vulval epithelial cells. Cell. 1998;94(6):761-71.

113. Horvitz HR, Sulston JE. Isolation and genetic characterization of cell-lineage mutants of the nematode Caenorhabditis elegans. Genetics. 1980;96(2):435-54.

114. Gruel N, Fuhrmann L, Lodillinsky C, Benhamo V, Mariani O, Cedenot A, et al. LIN7A is a major determinant of cell-polarity defects in breast carcinomas. Breast Cancer Res. 2016;18(1):23.

115. Cristofoli F, Devriendt K, Davis EE, Van Esch H, Vermeesch JR. Novel CASK mutations in cases with syndromic microcephaly. Hum Mutat. 2018;39(7):993-1001.

116. LaConte LE, Chavan V, Mukherjee K. Identification and glycerol-induced correction of misfolding mutations in the X-linked mental retardation gene CASK. PLoS One. 2014;9(2):e88276.

197

117. Wei JL, Fu ZX, Fang M, Zhou QY, Zhao QN, Guo JB, et al. High expression of CASK correlates with progression and poor prognosis of colorectal cancer. Tumour Biol. 2014;35(9):9185-94.

118. Hara T, Murakami Y, Seiki M, Sakamoto T. Mint3 in bone marrow-derived cells promotes lung metastasis in breast cancer model mice. Biochem Biophys Res Commun. 2017;490(3):688-92.

119. Miller CC, McLoughlin DM, Lau KF, Tennant ME, Rogelj B. The X11 proteins, Abeta production and Alzheimer's disease. Trends Neurosci. 2006;29(5):280-5.

120. Zucker B, Kama JA, Kuhn A, Thu D, Orlando LR, Dunah AW, et al. Decreased Lin7b expression in layer 5 pyramidal neurons may contribute to impaired corticostriatal connectivity in huntington disease. J Neuropathol Exp Neurol. 2010;69(9):880-95.

121. Sem X, Kreisberg JF, Kawli T, Tan MW, Rhen M, Tan P. Modulation of Caenorhabditis elegans infection sensitivity by the LIN-7 cell junction protein. Cell Microbiol. 2012;14(10):1584-99.

122. Biederer T, Sudhof TC. Mints as adaptors. Direct binding to neurexins and recruitment of munc18. J Biol Chem. 2000;275(51):39803-6.

123. Hata Y, Butz S, Sudhof TC. CASK: a novel dlg/PSD95 homolog with an N-terminal calmodulin-dependent protein kinase domain identified by interaction with neurexins. J Neurosci. 1996;16(8):2488-94.

124. Butz S, Okamoto M, Sudhof TC. A tripartite protein complex with the potential to couple synaptic vesicle exocytosis to cell adhesion in brain. Cell. 1998;94(6):773-82.

125. Fairless R, Masius H, Rohlmann A, Heupel K, Ahmad M, Reissner C, et al. Polarized targeting of neurexins to synapses is regulated by their C-terminal sequences. J Neurosci. 2008;28(48):12969-81.

126. Setou M, Nakagawa T, Seog DH, Hirokawa N. Kinesin superfamily motor protein KIF17 and mLin-10 in NMDA receptor-containing vesicle transport. Science. 2000;288(5472):1796- 802.

127. Jo K, Derin R, Li M, Bredt DS. Characterization of MALS/Velis-1, -2, and -3: a family of mammalian LIN-7 homologs enriched at brain synapses in association with the postsynaptic density-95/NMDA receptor postsynaptic complex. J Neurosci. 1999;19(11):4189-99.

198

128. Jeyifous O, Waites CL, Specht CG, Fujisawa S, Schubert M, Lin EI, et al. SAP97 and CASK mediate sorting of NMDA receptors through a previously unknown secretory pathway. Nat Neurosci. 2009;12(8):1011-9.

129. Hong CJ, Hsueh YP. CASK associates with glutamate receptor interacting protein and signaling molecules. Biochem Biophys Res Commun. 2006;351(3):771-6.

130. Becamel C, Alonso G, Galeotti N, Demey E, Jouin P, Ullmer C, et al. Synaptic multiprotein complexes associated with 5-HT(2C) receptors: a proteomic approach. EMBO J. 2002;21(10):2332-42.

131. Mukherjee K, Slawson JB, Christmann BL, Griffith LC. Neuron-specific protein interactions of Drosophila CASK-beta are revealed by mass spectrometry. Front Mol Neurosci. 2014;7:58.

132. Hase M, Yagi Y, Taru H, Tomita S, Sumioka A, Hori K, et al. Expression and characterization of the Drosophila X11-like/Mint protein during neural development. J Neurochem. 2002;81(6):1223-32.

133. Gross GG, Lone GM, Leung LK, Hartenstein V, Guo M. X11/Mint genes control polarized localization of axonal membrane proteins in vivo. J Neurosci. 2013;33(19):8575-86.

134. Bachmann A, Timmer M, Sierralta J, Pietrini G, Gundelfinger ED, Knust E, et al. Cell type-specific recruitment of Drosophila Lin-7 to distinct MAGUK-based protein complexes defines novel roles for Sdt and Dlg-S97. J Cell Sci. 2004;117(Pt 10):1899-909.

135. Bohl J, Brimer N, Lyons C, Vande Pol SB. The stardust family protein MPP7 forms a tripartite complex with LIN7 and DLG1 that regulates the stability and localization of DLG1 to cell junctions. J Biol Chem. 2007;282(13):9392-400.

136. Chen K, Featherstone DE. Pre and postsynaptic roles for Drosophila CASK. Mol Cell Neurosci. 2011;48(2):171-82.

137. Luz M, Knust E. Fluorescently tagged Lin7c is a dynamic marker for polarity maturation in the zebrafish retinal epithelium. Biol Open. 2013;2(9):867-71.

138. Wei X, Luo Y, Hyde DR. Molecular cloning of three zebrafish lin7 genes and their expression patterns in the retina. Exp Eye Res. 2006;82(1):122-31.

139. Yang X, Zou J, Hyde DR, Davidson LA, Wei X. Stepwise maturation of apicobasal polarity of the neuroepithelium is essential for vertebrate neurulation. J Neurosci. 2009;29(37):11426-40.

199

140. Borg JP, Lopez-Figueroa MO, de Taddeo-Borg M, Kroon DE, Turner RS, Watson SJ, et al. Molecular analysis of the X11-mLin-2/CASK complex in brain. J Neurosci. 1999;19(4):1307- 16.

141. Borg JP, Straight SW, Kaech SM, de Taddeo-Borg M, Kroon DE, Karnak D, et al. Identification of an Evolutionarily Conserved Heterotrimeric Protein Complex Involved in Protein Targeting. Journal of Biological Chemistry. 1998;273(48):31633-6.

142. Daniels DL, Cohen AR, Anderson JM, Brunger AT. Crystal structure of the hCASK PDZ domain reveals the structural basis of class II PDZ domain target recognition. Nat Struct Biol. 1998;5(4):317-25.

143. Doyle DA, Lee A, Lewis J, Kim E, Sheng M, MacKinnon R. Crystal structures of a complexed and peptide-free membrane protein-binding domain: molecular basis of peptide recognition by PDZ. Cell. 1996;85(7):1067-76.

144. Morais Cabral JH, Petosa C, Sutcliffe MJ, Raza S, Byron O, Poy F, et al. Crystal structure of a PDZ domain. Nature. 1996;382(6592):649-52.

145. Sheng M, Sala C. PDZ domains and the organization of supramolecular complexes. Annu Rev Neurosci. 2001;24:1-29.

146. Bezprozvanny I, Maximov A. Classification of PDZ domains. FEBS Lett. 2001;509(3):457-62.

147. Songyang Z, Fanning AS, Fu C, Xu J, Marfatia SM, Chishti AH, et al. Recognition of unique carboxyl-terminal motifs by distinct PDZ domains. Science. 1997;275(5296):73-7.

148. Maximov A, Sudhof TC, Bezprozvanny I. Association of neuronal calcium channels with modular adaptor proteins. J Biol Chem. 1999;274(35):24453-6.

149. Long JF, Feng W, Wang R, Chan LN, Ip FC, Xia J, et al. Autoinhibition of X11/Mint scaffold proteins revealed by the closed conformation of the PDZ tandem. Nat Struct Mol Biol. 2005;12(8):722-8.

150. Swistowski A, Zhang Q, Orcholski ME, Crippen D, Vitelli C, Kurakin A, et al. Novel mediators of amyloid precursor protein signaling. J Neurosci. 2009;29(50):15703-12.

151. Doerks T, Bork P, Kamberov E, Makarova O, Muecke S, Margolis B. L27, a novel heterodimerization domain in receptor targeting proteins Lin-2 and Lin-7. Trends Biochem Sci. 2000;25(7):317-8.

200

152. Lee S, Fan S, Makarova O, Straight S, Margolis B. A novel and conserved protein- protein interaction domain of mammalian Lin-2/CASK binds and recruits SAP97 to the lateral surface of epithelia. Mol Cell Biol. 2002;22(6):1778-91.

153. Stetak A, Hoier EF, Croce A, Cassata G, Di Fiore PP, Hajnal A. Cell fate-specific regulation of EGF receptor trafficking during Caenorhabditis elegans vulval development. EMBO J. 2006;25(11):2347-57.

154. Lee S, Fan S, Makarova O, Straight S, Margolis B. A Novel and Conserved Protein- Protein Interaction Domain of Mammalian Lin-2/CASK Binds and Recruits SAP97 to the Lateral Surface of Epithelia. Molecular and Cellular Biology. 2002;22(6):1778-91.

155. Zhang J, Yang X, Wang Z, Zhou H, Xie X, Shen Y, et al. Structure of an L27 domain heterotrimer from cell polarity complex Patj/Pals1/Mals2 reveals mutually independent L27 domain assembly mode. J Biol Chem. 2012;287(14):11132-40.

156. Yang X, Xie X, Chen L, Zhou H, Wang Z, Zhao W, et al. Structural basis for tandem L27 domain-mediated polymerization. FASEB J. 2010;24(12):4806-15.

157. Johnston CA, Whitney DS, Volkman BF, Doe CQ, Prehoda KE. Conversion of the enzyme guanylate kinase into a mitotic-spindle orienting protein by a single mutation that inhibits GMP-induced closing. Proc Natl Acad Sci U S A. 2011;108(44):E973-8.

158. Zhu J, Shang Y, Xia C, Wang W, Wen W, Zhang M. Guanylate kinase domains of the MAGUK family scaffold proteins as specific phospho-protein-binding modules. EMBO J. 2011;30(24):4986-97.

159. Kannan N, Taylor SS. Rethinking pseudokinases. Cell. 2008;133(2):204-5.

160. Yan KS, Kuti M, Zhou MM. PTB or not PTB -- that is the question. FEBS Lett. 2002;513(1):67-70.

161. Smith MJ, Hardy WR, Murphy JM, Jones N, Pawson T. Screening for PTB domain binding partners and ligand specificity using proteome-derived NPXY peptide arrays. Mol Cell Biol. 2006;26(22):8461-74.

162. Sain N, Tiwari G, Mohanty D. Understanding the molecular basis of substrate binding specificity of PTB domains. Sci Rep. 2016;6:31418.

163. Zhang Z, Lee CH, Mandiyan V, Borg JP, Margolis B, Schlessinger J, et al. Sequence- specific recognition of the internalization motif of the Alzheimer's amyloid precursor protein by the X11 PTB domain. EMBO J. 1997;16(20):6141-50.

201

164. Okamoto M, Sudhof TC. Mints, Munc18-interacting proteins in synaptic vesicle exocytosis. J Biol Chem. 1997;272(50):31459-64.

165. Okamoto M, Sudhof TC. Mint 3: a ubiquitous mint isoform that does not bind to munc18-1 or -2. Eur J Cell Biol. 1998;77(3):161-5.

166. Tong XJ, Hu Z, Liu Y, Anderson D, Kaplan JM. A network of autism linked genes stabilizes two pools of synaptic GABA(A) receptors. Elife. 2015;4:e09648.

167. Whitfield CW, Benard C, Barnes T, Hekimi S, Kim SK. Basolateral localization of the Caenorhabditis elegans epidermal growth factor receptor in epithelial cells by the PDZ protein LIN-10. Mol Biol Cell. 1999;10(6):2087-100.

168. Glodowski DR, Wright T, Martinowich K, Chang HC, Beach D, Rongo C. Distinct LIN- 10 domains are required for its neuronal function, its epithelial function, and its synaptic localization. Mol Biol Cell. 2005;16(3):1417-26.

169. Zhang D, Isack NR, Glodowski DR, Liu J, Chen CC, Xu XZ, et al. RAB-6.2 and the retromer regulate glutamate receptor recycling through a retrograde pathway. J Cell Biol. 2012;196(1):85-101.

170. Straight SW, Karnak D, Borg JP, Kamberov E, Dare H, Margolis B, et al. mLin-7 is localized to the basolateral surface of renal epithelia via its NH(2) terminus. Am J Physiol Renal Physiol. 2000;278(3):F464-75.

171. Cohen AR, Woods DF, Marfatia SM, Walther Z, Chishti AH, Anderson JM. Human CASK/LIN-2 binds syndecan-2 and protein 4.1 and localizes to the basolateral membrane of epithelial cells. J Cell Biol. 1998;142(1):129-38.

172. Hsueh YP. The role of the MAGUK protein CASK in neural development and synaptic function. Curr Med Chem. 2006;13(16):1915-27.

173. Hsueh YP, Wang TF, Yang FC, Sheng M. Nuclear translocation and transcription regulation by the membrane-associated guanylate kinase CASK/LIN-2. Nature. 2000;404(6775):298-302.

174. Lau KF, Perkinton MS, Rodriguez L, McLoughlin DM, Miller CC. An X11alpha/FSBP complex represses transcription of the GSK3beta gene promoter. Neuroreport. 2010;21(11):761- 6.

175. Hirose Y, Johnson ZI, Schoepflin ZR, Markova DZ, Chiba K, Toyama Y, et al. FIH-1- Mint3 axis does not control HIF-1 transcriptional activity in nucleus pulposus cells. J Biol Chem. 2014;289(30):20594-605.

202

176. Sumioka A, Saito Y, Sakuma M, Araki Y, Yamamoto T, Suzuki T. The X11L/X11beta/MINT2 and X11L2/X11gamma/MINT3 scaffold proteins shuttle between the nucleus and cytoplasm. Exp Cell Res. 2008;314(5):1155-62.

177. Stricker NL, Huganir RL. The PDZ domains of mLin-10 regulate its trans-Golgi network targeting and the surface expression of AMPA receptors. Neuropharmacology. 2003;45(6):837- 48.

178. Jones KA, Eng AG, Raval P, Srivastava DP, Penzes P. Scaffold protein X11alpha interacts with kalirin-7 in dendrites and recruits it to Golgi outposts. J Biol Chem. 2014;289(51):35517-29.

179. Caster AH, Kahn RA. Recruitment of the Mint3 adaptor is necessary for export of the amyloid precursor protein (APP) from the Golgi complex. J Biol Chem. 2013;288(40):28567-80.

180. Aroian RV, Lesa GM, Sternberg PW. Mutations in the Caenorhabditis elegans let-23 EGFR-like gene define elements important for cell-type specificity and function. EMBO J. 1994;13(2):360-6.

181. Aroian RV, Sternberg PW. Multiple functions of let-23, a Caenorhabditis elegans receptor tyrosine kinase gene required for vulval induction. Genetics. 1991;128(2):251-67.

182. Hoskins R, Hajnal AF, Harp SA, Kim SK. The C. elegans vulval induction gene lin-2 encodes a member of the MAGUK family of cell junction proteins. Development. 1996;122(1):97-111.

183. Rongo C, Whitfield CW, Rodal A, Kim SK, Kaplan JM. LIN-10 is a shared component of the polarized protein localization pathways in neurons and epithelia. Cell. 1998;94(6):751-9.

184. Biederer T, Sudhof TC. CASK and protein 4.1 support F-actin nucleation on neurexins. J Biol Chem. 2001;276(51):47869-76.

185. Schutz D, Zilly F, Lang T, Jahn R, Bruns D. A dual function for Munc-18 in exocytosis of PC12 cells. Eur J Neurosci. 2005;21(9):2419-32.

186. Weber-Boyvat M, Zhao H, Aro N, Yuan Q, Chernov K, Peranen J, et al. A conserved regulatory mode in exocytic membrane fusion revealed by Mso1p membrane interactions. Mol Biol Cell. 2013;24(3):331-41.

187. Alewine C, Kim BY, Hegde V, Welling PA. Lin-7 targets the Kir 2.3 channel on the basolateral membrane via a L27 domain interaction with CASK. Am J Physiol Cell Physiol. 2007;293(6):C1733-41.

203

188. Straight SW, Pieczynski JN, Whiteman EL, Liu CJ, Margolis B. Mammalian lin-7 stabilizes polarity protein complexes. J Biol Chem. 2006;281(49):37738-47.

189. Massari S, Perego C, Padovano V, D'Amico A, Raimondi A, Francolini M, et al. LIN7 mediates the recruitment of IRSp53 to tight junctions. Traffic. 2009;10(2):246-57.

190. Stucke VM, Timmerman E, Vandekerckhove J, Gevaert K, Hall A. The MAGUK protein MPP7 binds to the polarity protein hDlg1 and facilitates epithelial tight junction formation. Mol Biol Cell. 2007;18(5):1744-55.

191. Perego C, Vanoni C, Massari S, Longhi R, Pietrini G. Mammalian LIN-7 PDZ proteins associate with beta-catenin at the cell-cell junctions of epithelia and neurons. EMBO J. 2000;19(15):3978-89.

192. Straight SW, Chen L, Karnak D, Margolis B. Interaction with mLin-7 alters the targeting of endocytosed transmembrane proteins in mammalian epithelial cells. Mol Biol Cell. 2001;12(5):1329-40.

193. Perego C, Vanoni C, Villa A, Longhi R, Kaech SM, Frohli E, et al. PDZ-mediated interactions retain the epithelial GABA transporter on the basolateral surface of polarized epithelial cells. EMBO J. 1999;18(9):2384-93.

194. Belotti E, Polanowska J, Daulat AM, Audebert S, Thome V, Lissitzky JC, et al. The human PDZome: a gateway to PSD95-Disc large-zonula occludens (PDZ)-mediated functions. Mol Cell Proteomics. 2013;12(9):2587-603.

195. Lozovatsky L, Abayasekara N, Piawah S, Walther Z. CASK deletion in intestinal epithelia causes mislocalization of LIN7C and the DLG1/Scrib polarity complex without affecting cell polarity. Mol Biol Cell. 2009;20(21):4489-99.

196. Hsueh YP, Yang FC, Kharazia V, Naisbitt S, Cohen AR, Weinberg RJ, et al. Direct interaction of CASK/LIN-2 and syndecan heparan sulfate proteoglycan and their overlapping distribution in neuronal synapses. J Cell Biol. 1998;142(1):139-51.

197. Ethell IM, Yamaguchi Y. Cell surface heparan sulfate proteoglycan syndecan-2 induces the maturation of dendritic spines in rat hippocampal neurons. J Cell Biol. 1999;144(3):575-86.

198. Biederer T, Sara Y, Mozhayeva M, Atasoy D, Liu X, Kavalali ET, et al. SynCAM, a synaptic adhesion molecule that drives synapse assembly. Science. 2002;297(5586):1525-31.

199. Tabuchi K, Biederer T, Butz S, Sudhof TC. CASK participates in alternative tripartite complexes in which Mint 1 competes for binding with caskin 1, a novel CASK-binding protein. J Neurosci. 2002;22(11):4264-73.

204

200. Anjum R, Ayoubian H, Schmitz F. Differential synaptic distribution of the scaffold proteins Cask and Caskin1 in the bovine retina. Mol Cell Neurosci. 2014;62:19-29.

201. Fallon L, Moreau F, Croft BG, Labib N, Gu WJ, Fon EA. Parkin and CASK/LIN-2 associate via a PDZ-mediated interaction and are co-localized in lipid rafts and postsynaptic densities in brain. J Biol Chem. 2002;277(1):486-91.

202. Nix SL, Chishti AH, Anderson JM, Walther Z. hCASK and hDlg associate in epithelia, and their src homology 3 and guanylate kinase domains participate in both intramolecular and intermolecular interactions. J Biol Chem. 2000;275(52):41192-200.

203. Shin H, Hsueh YP, Yang FC, Kim E, Sheng M. An intramolecular interaction between Src homology 3 domain and guanylate kinase-like domain required for channel clustering by postsynaptic density-95/SAP90. J Neurosci. 2000;20(10):3580-7.

204. McGee AW, Bredt DS. Identification of an intramolecular interaction between the SH3 and guanylate kinase domains of PSD-95. J Biol Chem. 1999;274(25):17431-6.

205. Walhout AJ, Sordella R, Lu X, Hartley JL, Temple GF, Brasch MA, et al. Protein interaction mapping in C. elegans using proteins involved in vulval development. Science. 2000;287(5450):116-22.

206. Rademacher N, Kuropka B, Kunde SA, Wahl MC, Freund C, Shoichet SA. Intramolecular domain dynamics regulate synaptic MAGUK protein interactions. Elife. 2019;8.

207. Wu H, Reissner C, Kuhlendahl S, Coblentz B, Reuver S, Kindler S, et al. Intramolecular interactions regulate SAP97 binding to GKAP. EMBO J. 2000;19(21):5740-51.

208. Wang TF, Ding CN, Wang GS, Luo SC, Lin YL, Ruan Y, et al. Identification of Tbr- 1/CASK complex target genes in neurons. J Neurochem. 2004;91(6):1483-92.

209. Wang GS, Hong CJ, Yen TY, Huang HY, Ou Y, Huang TN, et al. Transcriptional modification by a CASK-interacting nucleosome assembly protein. Neuron. 2004;42(1):113-28.

210. Ojeh N, Pekovic V, Jahoda C, Maatta A. The MAGUK-family protein CASK is targeted to nuclei of the basal epidermis and controls keratinocyte proliferation. J Cell Sci. 2008;121(Pt 16):2705-17.

211. Hill K, Li Y, Bennett M, McKay M, Zhu X, Shern J, et al. Munc18 interacting proteins: ADP-ribosylation factor-dependent coat proteins that regulate the traffic of beta-Alzheimer's precursor protein. J Biol Chem. 2003;278(38):36032-40.

205

212. Shrivastava-Ranjan P, Faundez V, Fang G, Rees H, Lah JJ, Levey AI, et al. Mint3/X11gamma is an ADP-ribosylation factor-dependent adaptor that regulates the traffic of the Alzheimer's Precursor protein from the trans-Golgi network. Mol Biol Cell. 2008;19(1):51- 64.

213. Teber I, Nagano F, Kremerskothen J, Bilbilis K, Goud B, Barnekow A. Rab6 interacts with the mint3 adaptor protein. Biol Chem. 2005;386(7):671-7.

214. Thyrock A, Stehling M, Waschbusch D, Barnekow A. Characterizing the interaction between the Rab6 GTPase and Mint3 via flow cytometry based FRET analysis. Biochem Biophys Res Commun. 2010;396(3):679-83.

215. Thyrock A, Ossendorf E, Stehling M, Kail M, Kurtz T, Pohlentz G, et al. A new Mint1 isoform, but not the conventional Mint1, interacts with the small GTPase Rab6. PLoS One. 2013;8(5):e64149.

216. Kim SK, Horvitz HR. The Caenorhabditis elegans gene lin-10 is broadly expressed while required specifically for the determination of vulval cell fates. Genes Dev. 1990;4(3):357-71.

217. Glodowski DR, Chen CC, Schaefer H, Grant BD, Rongo C. RAB-10 regulates glutamate receptor recycling in a cholesterol-dependent endocytosis pathway. Mol Biol Cell. 2007;18(11):4387-96.

218. Park EC, Ghose P, Shao Z, Ye Q, Kang L, Xu XZ, et al. Hypoxia regulates glutamate receptor trafficking through an HIF-independent mechanism. EMBO J. 2012;31(6):1379-93.

219. Juo P, Harbaugh T, Garriga G, Kaplan JM. CDK-5 regulates the abundance of GLR-1 glutamate receptors in the ventral cord of Caenorhabditis elegans. Mol Biol Cell. 2007;18(10):3883-93.

220. Tyan SH, Shih AY, Walsh JJ, Maruyama H, Sarsoza F, Ku L, et al. Amyloid precursor protein (APP) regulates synaptic structure and function. Mol Cell Neurosci. 2012;51(1-2):43-52.

221. Zheng H, Koo EH. The amyloid precursor protein: beyond amyloid. Mol Neurodegener. 2006;1:5.

222. O'Brien RJ, Wong PC. Amyloid precursor protein processing and Alzheimer's disease. Annu Rev Neurosci. 2011;34:185-204.

223. Manucat-Tan NB, Saadipour K, Wang YJ, Bobrovskaya L, Zhou XF. Cellular Trafficking of Amyloid Precursor Protein in Amyloidogenesis Physiological and Pathological Significance. Mol Neurobiol. 2019;56(2):812-30.

206

224. Mueller HT, Borg JP, Margolis B, Turner RS. Modulation of amyloid precursor protein metabolism by X11alpha /Mint-1. A deletion analysis of protein-protein interaction domains. J Biol Chem. 2000;275(50):39302-6.

225. Sullivan SE, Dillon GM, Sullivan JM, Ho A. Mint proteins are required for synaptic activity-dependent amyloid precursor protein (APP) trafficking and amyloid beta generation. J Biol Chem. 2014;289(22):15374-83.

226. Lau KF, McLoughlin DM, Standen CL, Irving NG, Miller CC. Fe65 and X11beta colocalize with and compete for binding to the amyloid precursor protein. Neuroreport. 2000;11(16):3607-10.

227. Biederer T, Cao X, Sudhof TC, Liu X. Regulation of APP-dependent transcription complexes by Mint/X11s: differential functions of Mint isoforms. J Neurosci. 2002;22(17):7340- 51.

228. Lau KF, McLoughlin DM, Standen C, Miller CC. X11 alpha and x11 beta interact with presenilin-1 via their PDZ domains. Mol Cell Neurosci. 2000;16(5):557-65.

229. King GD, Cherian K, Turner RS. X11alpha impairs gamma- but not beta-cleavage of amyloid precursor protein. J Neurochem. 2004;88(4):971-82.

230. Ho A, Liu X, Sudhof TC. Deletion of Mint proteins decreases amyloid production in transgenic mouse models of Alzheimer's disease. J Neurosci. 2008;28(53):14392-400.

231. McLoughlin DM, Standen CL, Lau KF, Ackerley S, Bartnikas TP, Gitlin JD, et al. The neuronal adaptor protein X11alpha interacts with the copper chaperone for SOD1 and regulates SOD1 activity. J Biol Chem. 2001;276(12):9303-7.

232. Duquesne AE, Ruijter M, Brouwer J, Drijfhout JW, Nabuurs SB, Spronk CA, et al. Solution structure of the second PDZ domain of the neuronal adaptor X11alpha and its interaction with the C-terminal peptide of the human copper chaperone for superoxide dismutase. J Biomol NMR. 2005;32(3):209-18.

233. Angeletti B, Waldron KJ, Freeman KB, Bawagan H, Hussain I, Miller CC, et al. BACE1 cytoplasmic domain interacts with the copper chaperone for superoxide dismutase-1 and binds copper. J Biol Chem. 2005;280(18):17930-7.

234. Chaufty J, Sullivan SE, Ho A. Intracellular amyloid precursor protein sorting and amyloid-beta secretion are regulated by Src-mediated phosphorylation of Mint2. J Neurosci. 2012;32(28):9613-25.

207

235. Dunning CJ, Black HL, Andrews KL, Davenport EC, Conboy M, Chawla S, et al. Multisite tyrosine phosphorylation of the N-terminus of Mint1/X11alpha by Src kinase regulates the trafficking of amyloid precursor protein. J Neurochem. 2016;137(4):518-27.

236. Wang Z, Wang B, Yang L, Guo Q, Aithmitti N, Songyang Z, et al. Presynaptic and postsynaptic interaction of the amyloid precursor protein promotes peripheral and central synaptogenesis. J Neurosci. 2009;29(35):10788-801.

237. Nakaoka HJ, Hara T, Yoshino S, Kanamori A, Matsui Y, Shimamura T, et al. NECAB3 Promotes Activation of Hypoxia-inducible factor-1 during Normoxia and Enhances Tumourigenicity of Cancer Cells. Sci Rep. 2016;6:22784.

238. Uematsu T, Fujita T, Nakaoka HJ, Hara T, Kobayashi N, Murakami Y, et al. Mint3/Apba3 depletion ameliorates severe murine influenza pneumonia and macrophage cytokine production in response to the influenza virus. Sci Rep. 2016;6:37815.

239. Sakamoto T, Seiki M. Mint3 enhances the activity of hypoxia-inducible factor-1 (HIF-1) in macrophages by suppressing the activity of factor inhibiting HIF-1. J Biol Chem. 2009;284(44):30350-9.

240. Nasu K, Kawakami T, Shinohara A, Sakamoto T, Nangaku M. Munc18-1-interacting protein 3 mitigates renal fibrosis through protection of tubular epithelial cells from apoptosis. Nephrol Dial Transplant. 2019.

241. Hooper C, Killick R, Lovestone S. The GSK3 hypothesis of Alzheimer's disease. J Neurochem. 2008;104(6):1433-9.

242. Zhang W, Lilja L, Bark C, Berggren PO, Meister B. Mint1, a Munc-18-interacting protein, is expressed in insulin-secreting beta-cells. Biochem Biophys Res Commun. 2004;320(3):717-21.

243. Waselle L, Gerona RR, Vitale N, Martin TF, Bader MF, Regazzi R. Role of phosphoinositide signaling in the control of insulin exocytosis. Mol Endocrinol. 2005;19(12):3097-106.

244. Thul PJ, Akesson L, Wiking M, Mahdessian D, Geladaki A, Ait Blal H, et al. A subcellular map of the human proteome. Science. 2017;356(6340).

245. Motodate R, Saito Y, Hata S, Suzuki T. Expression and localization of X11 family proteins in neurons. Brain Res. 2016;1646:227-34.

208

246. Fainstein E, Marcelle C, Rosner A, Canaani E, Gale RP, Dreazen O, et al. A new fused transcript in Philadelphia chromosome positive acute lymphocytic leukaemia. Nature. 1987;330(6146):386-8.

247. Faderl S, Talpaz M, Estrov Z, O'Brien S, Kurzrock R, Kantarjian HM. The biology of chronic myeloid leukemia. N Engl J Med. 1999;341(3):164-72.

248. Malmberg EK, Andersson CX, Gentzsch M, Chen JH, Mengos A, Cui L, et al. Bcr (breakpoint cluster region) protein binds to PDZ-domains of scaffold protein PDZK1 and vesicle coat protein Mint3. J Cell Sci. 2004;117(Pt 23):5535-41.

249. Matos MF, Xu Y, Dulubova I, Otwinowski Z, Richardson JM, Tomchick DR, et al. Autoinhibition of Mint1 adaptor protein regulates amyloid precursor protein binding and processing. Proc Natl Acad Sci U S A. 2012;109(10):3802-7.

250. Xie X, Yan X, Wang Z, Zhou H, Diao W, Zhou W, et al. Open-closed motion of Mint2 regulates APP metabolism. J Mol Cell Biol. 2013;5(1):48-56.

251. Wennerberg K, Rossman KL, Der CJ. The Ras superfamily at a glance. J Cell Sci. 2005;118(Pt 5):843-6.

252. Li G, Marlin MC. Rab family of GTPases. Methods Mol Biol. 2015;1298:1-15.

253. Gallegos ME, Balakrishnan S, Chandramouli P, Arora S, Azameera A, Babushekar A, et al. The C. elegans rab family: identification, classification and toolkit construction. PLoS One. 2012;7(11):e49387.

254. Cherfils J, Zeghouf M. Regulation of small GTPases by GEFs, GAPs, and GDIs. Physiol Rev. 2013;93(1):269-309.

255. Bos JL, Rehmann H, Wittinghofer A. GEFs and GAPs: critical elements in the control of small G proteins. Cell. 2007;129(5):865-77.

256. Skorobogata O, Rocheleau CE. RAB-7 antagonizes LET-23 EGFR signaling during vulva development in Caenorhabditis elegans. PLoS One. 2012;7(4):e36489.

257. Skorobogata O, Meng J, Gauthier K, Rocheleau CE. Dynein-mediated trafficking negatively regulates LET-23 EGFR signaling. Mol Biol Cell. 2016.

258. Lee J, Jongeward GD, Sternberg PW. unc-101, a gene required for many aspects of Caenorhabditis elegans development and behavior, encodes a clathrin-associated protein. Genes & Development. 1994;8(1):60-73.

209

259. Bonifacino JS. Adaptor proteins involved in polarized sorting. J Cell Biol. 2014;204(1):7- 17.

260. Walser M, Umbricht CA, Frohli E, Nanni P, Hajnal A. beta-Integrin de-phosphorylation by the Density-Enhanced Phosphatase DEP-1 attenuates EGFR signaling in C. elegans. PLoS Genet. 2017;13(1):e1006592.

261. Kahn RA, Cherfils J, Elias M, Lovering RC, Munro S, Schurmann A. Nomenclature for the human Arf family of GTP-binding proteins: ARF, ARL, and SAR proteins. J Cell Biol. 2006;172(5):645-50.

262. Sztul E, Chen PW, Casanova JE, Cherfils J, Dacks JB, Lambright DG, et al. ARF GTPases and their GEFs and GAPs: concepts and challenges. Mol Biol Cell. 2019;30(11):1249- 71.

263. Pucadyil TJ, Schmid SL. Conserved functions of membrane active GTPases in coated vesicle formation. Science. 2009;325(5945):1217-20.

264. Kahn RA, Gilman AG. The protein cofactor necessary for ADP-ribosylation of Gs by cholera toxin is itself a GTP binding protein. J Biol Chem. 1986;261(17):7906-11.

265. Randazzo PA, Kahn RA. GTP hydrolysis by ADP-ribosylation factor is dependent on both an ADP-ribosylation factor GTPase-activating protein and acid phospholipids. J Biol Chem. 1994;269(14):10758-63.

266. Fucini RV, Navarrete A, Vadakkan C, Lacomis L, Erdjument-Bromage H, Tempst P, et al. Activated ADP-ribosylation factor assembles distinct pools of actin on golgi membranes. J Biol Chem. 2000;275(25):18824-9.

267. Chen JL, Lacomis L, Erdjument-Bromage H, Tempst P, Stamnes M. Cytosol-derived proteins are sufficient for Arp2/3 recruitment and ARF/coatomer-dependent actin polymerization on Golgi membranes. FEBS Lett. 2004;566(1-3):281-6.

268. Nakai W, Kondo Y, Saitoh A, Naito T, Nakayama K, Shin HW. ARF1 and ARF4 regulate recycling endosomal morphology and retrograde transport from endosomes to the Golgi apparatus. Mol Biol Cell. 2013;24(16):2570-81.

269. Wenk MR, De Camilli P. Protein-lipid interactions and phosphoinositide metabolism in membrane traffic: insights from vesicle recycling in nerve terminals. Proc Natl Acad Sci U S A. 2004;101(22):8262-9.

210

270. Krauss M, Kinuta M, Wenk MR, De Camilli P, Takei K, Haucke V. ARF6 stimulates clathrin/AP-2 recruitment to synaptic membranes by activating phosphatidylinositol phosphate kinase type Igamma. J Cell Biol. 2003;162(1):113-24.

271. Honda A, Nogami M, Yokozeki T, Yamazaki M, Nakamura H, Watanabe H, et al. Phosphatidylinositol 4-phosphate 5-kinase alpha is a downstream effector of the small G protein ARF6 in membrane ruffle formation. Cell. 1999;99(5):521-32.

272. Allaire PD, Seyed Sadr M, Chaineau M, Seyed Sadr E, Konefal S, Fotouhi M, et al. Interplay between Rab35 and Arf6 controls cargo recycling to coordinate cell adhesion and migration. J Cell Sci. 2013;126(Pt 3):722-31.

273. Prigent M, Dubois T, Raposo G, Derrien V, Tenza D, Rosse C, et al. ARF6 controls post- endocytic recycling through its downstream exocyst complex effector. J Cell Biol. 2003;163(5):1111-21.

274. Qi S, Su L, Li J, Zhang C, Ma Z, Liu G, et al. Arf6-driven endocytic recycling of CD147 determines HCC malignant phenotypes. J Exp Clin Cancer Res. 2019;38(1):471.

275. Lu H, Bhat AA, Peng D, Chen Z, Zhu S, Hong J, et al. APE1 Upregulates MMP-14 via Redox-Sensitive ARF6-Mediated Recycling to Promote Cell Invasion of Esophageal Adenocarcinoma. Cancer Res. 2019;79(17):4426-38.

276. Marchesin V, Montagnac G, Chavrier P. ARF6 promotes the formation of Rac1 and WAVE-dependent ventral F-actin rosettes in breast cancer cells in response to epidermal growth factor. PLoS One. 2015;10(3):e0121747.

277. Oka S, Uramoto H, Shimokawa H, Yamada S, Tanaka F. Epidermal growth factor receptor-GEP100-Arf6 axis affects the prognosis of lung adenocarcinoma. Oncology. 2014;86(5- 6):263-70.

278. Hashimoto S, Hashimoto A, Yamada A, Kojima C, Yamamoto H, Tsutsumi T, et al. A novel mode of action of an ArfGAP, AMAP2/PAG3/Papa lpha, in Arf6 function. J Biol Chem. 2004;279(36):37677-84.

279. Hashimoto S, Onodera Y, Hashimoto A, Tanaka M, Hamaguchi M, Yamada A, et al. Requirement for Arf6 in breast cancer invasive activities. Proc Natl Acad Sci U S A. 2004;101(17):6647-52.

280. Morishige M, Hashimoto S, Ogawa E, Toda Y, Kotani H, Hirose M, et al. GEP100 links epidermal growth factor receptor signalling to Arf6 activation to induce breast cancer invasion. Nat Cell Biol. 2008;10(1):85-92.

211

281. Powelka AM, Sun J, Li J, Gao M, Shaw LM, Sonnenberg A, et al. Stimulation-dependent recycling of integrin beta1 regulated by ARF6 and Rab11. Traffic. 2004;5(1):20-36.

282. Onodera Y, Nam JM, Hashimoto A, Norman JC, Shirato H, Hashimoto S, et al. Rab5c promotes AMAP1-PRKD2 complex formation to enhance beta1 integrin recycling in EGF- induced cancer invasion. J Cell Biol. 2012;197(7):983-96.

283. Grossmann AH, Zhao H, Jenkins N, Zhu W, Richards JR, Yoo JH, et al. The small GTPase ARF6 regulates protein trafficking to control cellular function during development and in disease. Small GTPases. 2019;10(1):1-12.

284. Harburger DS, Calderwood DA. Integrin signalling at a glance. J Cell Sci. 2009;122(Pt 2):159-63.

285. Vitali T, Girald-Berlingeri S, Randazzo PA, Chen PW. Arf GAPs: A family of proteins with disparate functions that converge on a common structure, the integrin adhesion complex. Small GTPases. 2019;10(4):280-8.

286. Kahn RA, Bruford E, Inoue H, Logsdon JM, Jr., Nie Z, Premont RT, et al. Consensus nomenclature for the human ArfGAP domain-containing proteins. J Cell Biol. 2008;182(6):1039-44.

287. East MP, Kahn RA. Models for the functions of Arf GAPs. Semin Cell Dev Biol. 2011;22(1):3-9.

288. Natsume W, Tanabe K, Kon S, Yoshida N, Watanabe T, Torii T, et al. SMAP2, a novel ARF GTPase-activating protein, interacts with clathrin and clathrin assembly protein and functions on the AP-1-positive early endosome/trans-Golgi network. Mol Biol Cell. 2006;17(6):2592-603.

289. Tanabe K, Kon S, Ichijo N, Funaki T, Natsume W, Watanabe T, et al. A SMAP gene family encoding ARF GTPase-activating proteins and its implication in membrane trafficking. Methods Enzymol. 2008;438:155-70.

290. Premont RT, Claing A, Vitale N, Freeman JL, Pitcher JA, Patton WA, et al. beta2- Adrenergic receptor regulation by GIT1, a G protein-coupled receptor kinase-associated ADP ribosylation factor GTPase-activating protein. Proc Natl Acad Sci U S A. 1998;95(24):14082-7.

291. Premont RT, Claing A, Vitale N, Perry SJ, Lefkowitz RJ. The GIT family of ADP- ribosylation factor GTPase-activating proteins. Functional diversity of GIT2 through alternative splicing. J Biol Chem. 2000;275(29):22373-80.

212

292. Vitale N, Patton WA, Moss J, Vaughan M, Lefkowitz RJ, Premont RT. GIT proteins, A novel family of phosphatidylinositol 3,4, 5-trisphosphate-stimulated GTPase-activating proteins for ARF6. J Biol Chem. 2000;275(18):13901-6.

293. Dowler S, Currie RA, Campbell DG, Deak M, Kular G, Downes CP, et al. Identification of pleckstrin-homology-domain-containing proteins with novel phosphoinositide-binding specificities. Biochem J. 2000;351(Pt 1):19-31.

294. Jackson TR, Kearns BG, Theibert AB. Cytohesins and centaurins: mediators of PI 3- kinase-regulated Arf signaling. Trends Biochem Sci. 2000;25(10):489-95.

295. Jackson TR, Brown FD, Nie Z, Miura K, Foroni L, Sun J, et al. ACAPs are arf6 GTPase- activating proteins that function in the cell periphery. J Cell Biol. 2000;151(3):627-38.

296. Nie Z, Stanley KT, Stauffer S, Jacques KM, Hirsch DS, Takei J, et al. AGAP1, an endosome-associated, phosphoinositide-dependent ADP-ribosylation factor GTPase-activating protein that affects actin cytoskeleton. J Biol Chem. 2002;277(50):48965-75.

297. Nie Z, Fei J, Premont RT, Randazzo PA. The Arf GAPs AGAP1 and AGAP2 distinguish between the adaptor protein complexes AP-1 and AP-3. J Cell Sci. 2005;118(Pt 15):3555-66.

298. Oku Y, Huganir RL. AGAP3 and Arf6 regulate trafficking of AMPA receptors and synaptic plasticity. J Neurosci. 2013;33(31):12586-98.

299. Gundner AL, Hahn I, Sendscheid O, Aberle H, Hoch M. The PIKE homolog Centaurin gamma regulates developmental timing in Drosophila. PLoS One. 2014;9(5):e97332.

300. Luo R, Akpan IO, Hayashi R, Sramko M, Barr V, Shiba Y, et al. GTP-binding protein- like domain of AGAP1 is protein binding site that allosterically regulates ArfGAP protein catalytic activity. J Biol Chem. 2012;287(21):17176-85.

301. Astanina K, Jacob R. KIF5C, a kinesin motor involved in apical trafficking of MDCK cells. Cell Mol Life Sci. 2010;67(8):1331-42.

302. Bowzard JB, Cheng D, Peng J, Kahn RA. ELMOD2 is an Arl2 GTPase-activating protein that also acts on Arfs. J Biol Chem. 2007;282(24):17568-80.

303. East MP, Bowzard JB, Dacks JB, Kahn RA. ELMO domains, evolutionary and functional characterization of a novel GTPase-activating protein (GAP) domain for Arf protein family GTPases. J Biol Chem. 2012;287(47):39538-53.

213

304. Ivanova AA, East MP, Yi SL, Kahn RA. Characterization of recombinant ELMOD (cell engulfment and motility domain) proteins as GTPase-activating proteins (GAPs) for ARF family GTPases. J Biol Chem. 2014;289(16):11111-21.

305. Gumienny TL, Brugnera E, Tosello-Trampont AC, Kinchen JM, Haney LB, Nishiwaki K, et al. CED-12/ELMO, a novel member of the CrkII/Dock180/Rac pathway, is required for phagocytosis and cell migration. Cell. 2001;107(1):27-41.

306. Brugnera E, Haney L, Grimsley C, Lu M, Walk SF, Tosello-Trampont AC, et al. Unconventional Rac-GEF activity is mediated through the Dock180-ELMO complex. Nat Cell Biol. 2002;4(8):574-82.

307. Rein U, Andag U, Duden R, Schmitt HD, Spang A. ARF-GAP-mediated interaction between the ER-Golgi v-SNAREs and the COPI coat. J Cell Biol. 2002;157(3):395-404.

308. Schindler C, Spang A. Interaction of SNAREs with ArfGAPs precedes recruitment of Sec18p/NSF. Mol Biol Cell. 2007;18(8):2852-63.

309. Shiba Y, Kametaka S, Waguri S, Presley JF, Randazzo PA. ArfGAP3 regulates the transport of cation-independent mannose 6-phosphate receptor in the post-Golgi compartment. Curr Biol. 2013;23(19):1945-51.

310. Homma M, Nagashima S, Fukuda T, Yanagi S, Miyakawa H, Suzuki E, et al. Downregulation of Centaurin gamma1A increases synaptic transmission at Drosophila larval neuromuscular junctions. Eur J Neurosci. 2014;40(8):3158-70.

311. Li J, Peters PJ, Bai M, Dai J, Bos E, Kirchhausen T, et al. An ACAP1-containing clathrin coat complex for endocytic recycling. J Cell Biol. 2007;178(3):453-64.

312. Egami Y, Fujii M, Kawai K, Ishikawa Y, Fukuda M, Araki N. Activation-Inactivation Cycling of Rab35 and ARF6 Is Required for Phagocytosis of Zymosan in RAW264 Macrophages. J Immunol Res. 2015;2015:429439.

313. Egami Y, Fukuda M, Araki N. Rab35 regulates phagosome formation through recruitment of ACAP2 in macrophages during FcgammaR-mediated phagocytosis. J Cell Sci. 2011;124(Pt 21):3557-67.

314. Kutscher LM, Keil W, Shaham S. RAB-35 and ARF-6 GTPases Mediate Engulfment and Clearance Following Linker Cell-Type Death. Dev Cell. 2018;47(2):222-38 e6.

315. Kobayashi H, Fukuda M. Rab35 establishes the EHD1-association site by coordinating two distinct effectors during neurite outgrowth. J Cell Sci. 2013;126(Pt 11):2424-35.

214

316. Kanno E, Ishibashi K, Kobayashi H, Matsui T, Ohbayashi N, Fukuda M. Comprehensive screening for novel rab-binding proteins by GST pull-down assay using 60 different mammalian Rabs. Traffic. 2010;11(4):491-507.

317. Shi A, Liu O, Koenig S, Banerjee R, Chen CC, Eimer S, et al. RAB-10-GTPase-mediated regulation of endosomal phosphatidylinositol-4,5-bisphosphate. Proc Natl Acad Sci U S A. 2012;109(35):E2306-15.

318. Nakagawa A, Sullivan KD, Xue D. Caspase-activated phosphoinositide binding by CNT- 1 promotes apoptosis by inhibiting the AKT pathway. Nat Struct Mol Biol. 2014;21(12):1082- 90.

319. Sullivan KD, Nakagawa A, Xue D, Espinosa JM. Human ACAP2 is a homolog of C. elegans CNT-1 that promotes apoptosis in cancer cells. Cell Cycle. 2015;14(12):1771-8.

320. Li J, Ballif BA, Powelka AM, Dai J, Gygi SP, Hsu VW. Phosphorylation of ACAP1 by Akt regulates the stimulation-dependent recycling of integrin beta1 to control cell migration. Dev Cell. 2005;9(5):663-73.

321. Siu KY, Yu MK, Wu X, Zong M, Roth MG, Chan HC, et al. The non-catalytic carboxyl- terminal domain of ARFGAP1 regulates actin cytoskeleton reorganization by antagonizing the activation of Rac1. PLoS One. 2011;6(4):e18458.

322. Chen PW, Luo R, Jian X, Randazzo PA. The Arf6 GTPase-activating proteins ARAP2 and ACAP1 define distinct endosomal compartments that regulate integrin alpha5beta1 traffic. J Biol Chem. 2014;289(44):30237-48.

323. Miura Y, Kanaho Y. ACAP3, the GTPase-activating protein specific to the small GTPase Arf6, regulates neuronal migration in the developing cerebral cortex. Biochem Biophys Res Commun. 2017;493(2):1089-94.

324. Nishiya N, Kiosses WB, Han J, Ginsberg MH. An alpha4 integrin-paxillin-Arf-GAP complex restricts Rac activation to the leading edge of migrating cells. Nat Cell Biol. 2005;7(4):343-52.

325. Zhou W, Li X, Premont RT. Expanding functions of GIT Arf GTPase-activating proteins, PIX Rho guanine nucleotide exchange factors and GIT-PIX complexes. J Cell Sci. 2016;129(10):1963-74.

326. Frank SR, Adelstein MR, Hansen SH. GIT2 represses Crk- and Rac1-regulated cell spreading and Cdc42-mediated focal adhesion turnover. EMBO J. 2006;25(9):1848-59.

215

327. Premont RT, Perry SJ, Schmalzigaug R, Roseman JT, Xing Y, Claing A. The GIT/PIX complex: an oligomeric assembly of GIT family ARF GTPase-activating proteins and PIX family Rac1/Cdc42 guanine nucleotide exchange factors. Cell Signal. 2004;16(9):1001-11.

328. Nayal A, Webb DJ, Brown CM, Schaefer EM, Vicente-Manzanares M, Horwitz AR. Paxillin phosphorylation at Ser273 localizes a GIT1-PIX-PAK complex and regulates adhesion and protrusion dynamics. J Cell Biol. 2006;173(4):587-9.

329. Hoefen RJ, Berk BC. The multifunctional GIT family of proteins. J Cell Sci. 2006;119(Pt 8):1469-75.

330. Lucanic M, Cheng HJ. A RAC/CDC-42-independent GIT/PIX/PAK signaling pathway mediates cell migration in C. elegans. PLoS Genet. 2008;4(11):e1000269.

331. Peters EC, Gossett AJ, Goldstein B, Der CJ, Reiner DJ. Redundant canonical and noncanonical Caenorhabditis elegans p21-activated kinase signaling governs distal tip cell migrations. G3 (Bethesda). 2013;3(2):181-95.

332. Gengyo-Ando K, Kamiya Y, Yamakawa A, Kodaira K, Nishiwaki K, Miwa J, et al. The C. elegans unc-18 gene encodes a protein expressed in motor neurons. Neuron. 1993;11(4):703- 11.

333. Tabish M, Siddiqui ZK, Nishikawa K, Siddiqui SS. Exclusive expression of C. elegans osm-3 kinesin gene in chemosensory neurons open to the external environment. J Mol Biol. 1995;247(3):377-89.

334. Brenner S. The genetics of Caenorhabditis elegans. Genetics. 1974;77(1):71-94.

335. Stiernagle T. Maintenance of C. elegans. WormBook. 2006:1-11.

336. Berkowitz LA, Knight AL, Caldwell GA, Caldwell KA. Generation of stable transgenic C. elegans using microinjection. J Vis Exp. 2008(18).

337. Dickinson DJ, Pani AM, Heppert JK, Higgins CD, Goldstein B. Streamlined Genome Engineering with a Self-Excising Drug Selection Cassette. Genetics. 2015;200(4):1035-49.

338. Gibson DG, Young L, Chuang RY, Venter JC, Hutchison CA, 3rd, Smith HO. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat Methods. 2009;6(5):343-5.

339. Law F, Seo JH, Wang Z, DeLeon JL, Bolis Y, Brown A, et al. The VPS34 PI3K negatively regulates RAB-5 during endosome maturation. J Cell Sci. 2017;130(12):2007-17.

216

340. Chotard L, Mishra AK, Sylvain MA, Tuck S, Lambright DG, Rocheleau CE. TBC-2 regulates RAB-5/RAB-7-mediated endosomal trafficking in Caenorhabditis elegans. Mol Biol Cell. 2010;21(13):2285-96.

341. Kamath RS, Martinez-Campos M, Zipperlen P, Fraser AG, Ahringer J. Effectiveness of specific RNA-mediated interference through ingested double-stranded RNA in Caenorhabditis elegans. Genome Biol. 2001;2(1):RESEARCH0002.

342. Harlow E, Lane D. Stripping immunoblots for reprobing or storage. CSH Protoc. 2006;2006(1).

343. Haag A, Gutierrez P, Buhler A, Walser M, Yang Q, Langouet M, et al. An in vivo EGF receptor localization screen in C. elegans Identifies the Ezrin homolog ERM-1 as a temporal regulator of signaling. PLoS Genet. 2014;10(5):e1004341.

344. Sharma-Kishore R, White JG, Southgate E, Podbilewicz B. Formation of the vulva in Caenorhabditis elegans: a paradigm for organogenesis. Development. 1999;126(4):691-9.

345. Leonoudakis D, Conti LR, Radeke CM, McGuire LM, Vandenberg CA. A multiprotein trafficking complex composed of SAP97, CASK, Veli, and Mint1 is associated with inward rectifier Kir2 potassium channels. J Biol Chem. 2004;279(18):19051-63.

346. Kim SJ, Horvitz HR. The Caenorhabditis elegans gene lin-10 is broadly expressed while required specifically for the determination of vulval cell fates. Genes & Development.4:357-71.

347. Luo L, Hannemann M, Koenig S, Hegermann J, Ailion M, Cho MK, et al. The Caenorhabditis elegans GARP complex contains the conserved Vps51 subunit and is required to maintain lysosomal morphology. Mol Biol Cell. 2011;22(14):2564-78.

348. Conibear E, Stevens TH. Vps52p, Vps53p, and Vps54p form a novel multisubunit complex required for protein sorting at the yeast late Golgi. Mol Biol Cell. 2000;11(1):305-23.

349. Liewen H, Meinhold-Heerlein I, Oliveira V, Schwarzenbacher R, Luo G, Wadle A, et al. Characterization of the human GARP (Golgi associated retrograde protein) complex. Exp Cell Res. 2005;306(1):24-34.

350. Schindler C, Chen Y, Pu J, Guo X, Bonifacino JS. EARP is a multisubunit tethering complex involved in endocytic recycling. Nat Cell Biol. 2015;17(5):639-50.

351. Donaldson JG, Cassel D, Kahn RA, Klausner RD. ADP-ribosylation factor, a small GTP- binding protein, is required for binding of the coatomer protein beta-COP to Golgi membranes. Proc Natl Acad Sci U S A. 1992;89(14):6408-12.

217

352. Donaldson JG, Finazzi D, Klausner RD. Brefeldin A inhibits Golgi membrane-catalysed exchange of guanine nucleotide onto ARF protein. Nature. 1992;360(6402):350-2.

353. Togawa A, Morinaga N, Ogasawara M, Moss J, Vaughan M. Purification and cloning of a brefeldin A-inhibited guanine nucleotide-exchange protein for ADP-ribosylation factors. J Biol Chem. 1999;274(18):12308-15.

354. Sulston JE, Schierenberg E, White JG, Thomson JN. The embryonic cell lineage of the nematode Caenorhabditis elegans. Dev Biol. 1983;100(1):64-119.

355. Okamoto M, Nakajima Y, Matsuyama T, Sugita M. Amyloid precursor protein associates independently and collaboratively with PTB and PDZ domains of mint on vesicles and at cell membrane. Neuroscience. 2001;104(3):653-65.

356. Underwood RS, Deng Y, Greenwald I. Integration of EGFR and LIN-12/Notch Signaling by LIN-1/Elk1, the Cdk8 Kinase Module, and SUR-2/Med23 in Vulval Precursor Cell Fate Patterning in Caenorhabditis elegans. Genetics. 2017;207(4):1473-88.

357. Saito Y, Akiyama M, Araki Y, Sumioka A, Shiono M, Taru H, et al. Intracellular trafficking of the amyloid beta-protein precursor (APP) regulated by novel function of X11-like. PLoS One. 2011;6(7):e22108.

358. Jones RB, Gordus A, Krall JA, MacBeath G. A quantitative protein interaction network for the ErbB receptors using protein microarrays. Nature. 2006;439(7073):168-74.

359. Sopko R, Huang D, Preston N, Chua G, Papp B, Kafadar K, et al. Mapping pathways and phenotypes by systematic gene overexpression. Mol Cell. 2006;21(3):319-30.

360. Prelich G. Gene overexpression: uses, mechanisms, and interpretation. Genetics. 2012;190(3):841-54.

361. Fang Z, Miao Y, Ding X, Deng H, Liu S, Wang F, et al. Proteomic identification and functional characterization of a novel ARF6 GTPase-activating protein, ACAP4. Mol Cell Proteomics. 2006;5(8):1437-49.

362. Klein S, Franco M, Chardin P, Luton F. Role of the Arf6 GDP/GTP cycle and Arf6 GTPase-activating proteins in actin remodeling and intracellular transport. J Biol Chem. 2006;281(18):12352-61.

363. Singhvi A, Teuliere J, Talavera K, Cordes S, Ou G, Vale RD, et al. The Arf GAP CNT-2 regulates the apoptotic fate in C. elegans asymmetric neuroblast divisions. Curr Biol. 2011;21(11):948-54.

218