ISSN No. 2320 – 8694 Peer Reviewed - open access journal Common Creative Licence - NC 4.0

Volume No – 4 Issue No – IV June, 2016 Journal of Experimental Biology and Agricultural Sciences

Journal of Experimental Biology and Agricultural Sciences (JEBAS) is an online platform for the advancement and rapid dissemination of scientific knowledge generated by the highly motivated researchers in the field of biological sciences. JEBAS publishes high-quality original research and critical up-to-date review articles covering all the aspects of biological sciences. Every year, it publishes six issues. The JEBAS is an open access journal. Anyone interested can download full text PDF without any registration. JEBAS has been accepted by EMERGING SOURCES CITATION INDEX (Thomson Reuters – Web of Science database), DOAJ, CABI, INDEX COPERNICUS INTERNATIONAL (Poland), AGRICOLA (USA), CAS (ACS, USA), CABI – Full Text (UK), AGORA (FAO-UN), OARE (UNEP), HINARI (WHO), J gate, EIJASR, DRIJ and Indian Science Abstracts (ISA, NISCAIR) like well reputed indexing database.

[HORIZON PUBLISHER INDIA [HPI] http://www.horizonpublisherindia.in/]

Journal of Experimental Biology and Agricultural Sciences ______

Technical Editors

Dr. M K Meghvansi Dr. A. K. Srivastava Scientist D Principal Scientist (Soil Biotechnology Division Science) Defence Research Laboratory, National Research Center For Tezpur, India Citrus A E mail: [email protected] Nagpur, Maharashtra, India Email: [email protected]

Dr. B L Yadav Head – Botany Dr. Neeraj MLV Govt. College, Bhilwara, Associate Professor and Head India Department of Botany E mail: [email protected] Feroze Gandhi College, RaeBareli, UP, India

Dr. Yashpal S. Malik ICAR-National Fellow Dr.Md.Moin Ansari Indian Veterinary Research Associate Professor-cum-Senior Institute (IVRI) Scientist Izatnagar 243 122, Bareilly, Division of Surgery and Uttar Pradesh, India Radiology E mail: [email protected]; Faculty of Veterinary Sciences [email protected] and Animal Husbandry Shuhama, Srinagar-190006, J&K, India Dr. K L Meena Lecturer – Botany MLV Govt. College, Bhilwara, India E mail: [email protected]

Er. Gautam Kumar Room No – 4302 Computer Center – II IIIT-A E mail: [email protected]

Associate Editors

Dr Biswanath Maity Auguste Emmanuel ISSALI Carver College of Medicine Forestry Engineer Department of Pharmacology Head - Coconut Breeding University of Iowa – Iowa Department at Marc Delorme City, USA Coconut Research Station, Port Email: [email protected] Bouet, Côte d’Ivoire Regional Coordinator -COGENT Email: [email protected] Wu Yao Senior Manager China Development Bank Dr. Omoanghe S. Isikhuemhen ChaoYang District Department of Natural Resources Beijing, China & Environmental Design Email: North Carolina Agricultural & [email protected] Technical State University Greensboro, NC 27411, USA Email: [email protected]

Journal of Experimental Biology and Agricultural Sciences ______

Dr. Vincenzo Tufarelli Dr. Sunil K. Joshi Department of Emergency and Laboratory Head, Cellular Organ Transplantation (DETO) Immunology Section of Veterinary Science Investigator, Frank Reidy and Animal Production Research Center of Bioelectrics University of Bari ‘Aldo Moro’ College of Health Sciences, Old s.p. Casamassima km 3, 70010 Dominion University Valenzano, Italy 4211 Monarch Way, IRP-2, Suite # Email: 300 [email protected] Norfolk, VA 23508 USA Email: [email protected]

Assistant Editors

Dr A K Trivedi Rajveer Singh Chauhan Senior Scientist (Plant Division of Phycology Physiology) Department of Botany National Bureau of Plant Genetic University of Lucknow, Lucknow, Resources INDIA Nainital (Uttarakhand) INDIA – E-mail: [email protected] 263 132 E mail: [email protected] Y. Norma-Rashid (Norma Yusoff) Professor Institute of Biological Sciences Rajnish Kumar – Faculty of Science Room No – 4302 (Biomedical University of Malaya, 50603 Informatics Lab) Kuala Lumpur MALAYSIA Computer center – II, IIIT-A, E-mail: [email protected] Allahabad E mail: [email protected] Dr.Peiman Zandi Department of Agronomy I.A.University Dr. Bilal Ahmad Mir Takestan branch,Takestan,Iran Department of Genetics E-mail: [email protected] University of Pretoria South Africa-0002 E mail: [email protected]; Dr. Oadi Najim Ismail Matny [email protected] Assistant Professor – Plant pathology Department of Plant Protection Dr. Amit Kumar Jaiswal College Of Agriculture Science School of Food Science and University Of Baghdad, Iraq Environmental Health E-mail: [email protected], College of Sciences and Health [email protected] Dublin Institute of Technology, Dublin 1, Ireland E mail: [email protected] Dr. Girijesh K. Patel Post Doc Fellow 1660 Springhill Avenue Dr. Gurudayal Ram Mitchell Cancer Institute Assistant Professor University of South Alabama, USA Jacob School of Biotechnology E-mail: [email protected] and Bioengineering (JSBB) Sam Higginbottom Institute of Agriculture, Technology and Dr Anurag Aggarwal Sciences(SHIATS) MD, DA, PDCC (Neuroanesthesia Allahabad, Uttar Pradesh – and Intensive Care), India 211007 E-mail: [email protected]

Welcome Message - Managing Editor (Dr Kamal Kishore Chaudhary, M.Sc, Ph.D) ______

Dear Readers,

It is with much joy and anticipation that we celebrate the launch of Issue IV (Volume 4) of Journal of Experimental Biology and Agricultural Sciences (JEBAS). On behalf of the JEBAS Editorial Team, I would like to extend a very warm welcome to the readership of JEBAS. I take this opportunity to thank our authors, editors and anonymous reviewers, all of whom have volunteered to contribute to the success of the journal. I am also grateful to the staff at Horizon Publisher India [HPI] for making JEBAS a reality.

JEBAS is dedicated to the rapid dissemination of high quality research papers on how advances in Biotechnology, Agricultural sciences along with computational algorithm can help us meet the challenges of the 21st century, and to capitalize on the promises ahead. We welcome contributions that can demonstrate near-term practical usefulness, particularly contributions that take a multidisciplinary / convergent approach because many real world problems are complex in nature. JEBAS provides an ideal forum for exchange of information on all of the above topics and more, in various formats: full length and letter length research papers, survey papers, work-in-progress reports on promising developments, case studies and best practice articles written by industry experts.

Finally, we wish to encourage more contributions from the scientific community and industry practitioners to ensure a continued success of the journal. Authors, reviewers and guest editors are always welcome. We also welcome comments and suggestions that could improve the quality of the journal.

Thank you. We hope you will find JEBAS informative.

Dr. Kamal K Chaudhary Managing Editor - JEBAS June 2016

INDEX ______

Research Articles

The clinical significance of the combination of pathogenic therapy in children with overactive bladder syndrome (OAB) and nocturia doi: http://dx.doi.org/10.18006/2016.4(4).384.388

Molecular identification and integrated management of the Fusarium f. sp. cucumerinu the causal agent of Fusarium wilt disease of Cucumis sativus L. in Iraq doi: http://dx.doi.org/10.18006/2016.4(4).389.397

Response of alfalfa forage to phosphorus, boron and manganese based fertilizing systems doi: http://dx.doi.org/10.18006/2016.4(4).398.405

Effect of the interactions between moisture content, seed storage time and use of pesticides on seed germination, viability and viability indicators of wheat crop doi: http://dx.doi.org/10.18006/2016.4(4).406.413

Influence of organic and mineral fertilizers on the antioxidants and total phenolic compounds level in tomato (Solanum lycopersicum) var. mongal F1 doi: http://dx.doi.org/10.18006/2016.4(4).414.420

Effects of integrated management of bio and chemical fertilizers on yield of maize hybrids (Zea mays L.) doi: http://dx.doi.org/10.18006/2016.4(4).421.426

Effect of benzyladenine and salicylic acid on biochemical traits of two cultivars of carnation doi: http://dx.doi.org/10.18006/2016.4(4).427.434

Histopathological study of toxicity mixture of cashew apple juice (Anacardium occidentale), cow milk and yogurt on the wistar rat doi: http://dx.doi.org/10.18006/2016.4(4).435.439

Effect of magnevist conjugated dendrimer on Bax/Bcl2 gene expression levels in MCF-7 cancer cells doi: http://dx.doi.org/10.18006/2016.4(4).440.447

Review Article

Hyperspectral imaging (hsi): applications in animal and dairy sector doi: http://dx.doi.org/10.18006/2016.4(4).448.461

Journal of Experimental Biology and Agricultural Sciences, June - 2016; Volume – 4(IV)

Journal of Experimental Biology and Agricultural Sciences

http://www.jebas.org

ISSN No. 2320 – 8694

THE CLINICAL SIGNIFICANCE OF THE COMBINATION OF PATHOGENIC THERAPY IN CHILDREN WITH OVERACTIVE BLADDER SYNDROME (OAB) AND NOCTURIA

1 2,* 3 4 Morozov S L , Guseva N B , Dlin V V and Tonkikh E V

1Scientific assistant, Department of Nephrology, Pirogov Russian National Research Medical, 125412 Taldomskaya str 2, Moscow, Russia 2Professor, Head of Moscow Voiding Dysfunction Centre, Speransky Pediatric Hospital, Pirogov Russian National Research Medical University, The Russian representative ICCS, 123317 Shmitovsky pr. 29, Moscow, Russia 3Professor, Head of the Department of Nephrology, Pirogov Russian National Research Medical University, 125412 Taldomskaya str 2, Moscow, Russia 4Department of Clinical Pharmacology, Burdenko Voronezh Medical Academy, 394005 Studencheskaya street, 10, Moscow, Russia

Received – January 08, 2016; Revision – February 10, 2016; Accepted – April 25, 2016 Available Online – June 25, 2016

DOI: http://dx.doi.org/10.18006/2016.4(4).384.388

KEYWORDS ABSTRACT Children The aim of the present study was to identify the frequency of nocturnal polyuria in children with Desmopressin MELT suffering by OAB. Further, efficacy of the oxybutynine monotherapy either individually or in combination with desmopressin MELT was also accessed in present study. In present study, total 150 Nocturia patients were selected for the clinical trial at Moscow Voiding Disfunction Centre from 2007-2011. Data collected for this study were based on the intensity of urination, calendar of episodes of Overactive bladder incontinence, results of dyuresis, uroflowmethry with determination of volume of residual urine, ultrasound examination (USE) of the kidneys and bladder. Among the examined 150 patients, only 50 respondents found suitable for the study while the rest 100 respondents were excluded from the study due to different reasons. These participants with clinical symptoms of urinary disorders were assessed by qualimetry and evaluated with 32+ 2.5 points and were randomized into two treatment groups, among these group 1 (20 patients) were treated by oxybutyninе and desmopress in MELT bedtime while the group 2 (30 patients) were treated by only basic therapy with oxybutynine. In group 1, the clinical picture is changed and the assessment of quality control has decreased towards the relief of clinical symptoms up to 22 points, on the basis of increasing the volume of the bladder and decrease nocturnal polyuria. This improvement is statistically significant reduction in the level of nocturia and 38 ± 8% in

All the article published by Journal of Experimental * Corresponding author Biology and Agricultural Sciences is licensed under a E-mail: [email protected] (N.B. Guseva) Creative Commons Attribution-NonCommercial 4.0 International License Based on a work at www.jebas.org. Peer review under responsibility of Journal of Experimental Biology and Agricultural Sciences.

Production and Hosting by Horizon Publisher India [HPI] (http://www.horizonpublisherindia.in/ ). All ______rights reserved. Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

385 Morozov et al

comparison with 24 hours in diuresis. The increase in the effective volume of the bladder was 31%. While in case of group 2, although a improvement in the clinical symptoms was reported (27 ± 2.5 points), and this difference was statistically significant as compared to baseline values but it is least performing treatment as compared group 1. Further, in this group, the parameters of nocturnal polyuria also not changed. Thus, it was concluded that in the imperative syndrome and nocturnal polyuria can be affectively treated by integrated application oxybutynine and desmopressin MELT.

1 Introduction monotherapy and combined treatment of oxybutynine and desmopressin MELT. Overactive bladder (OAB) is a common disease in children over 5 years of age . Abrams et al. (2003) diagnosed OAB in 2 Materials and methods 17% of the Northern Europe children aged between 5-12 years aged. Still etiology and pathogenesis of OAB have not been For this study total 16578 patients with the OAB syndrome completely studied; nevertheless it was found that OAB may were examined at the Moscow Voiding Disfunction Centre be a consequence of both neurogenic and non-neurogenic from 2007-2011. Among the total examined patient, almost lesions (Bauer, 2002; Vishnevsky, 2005). With respect to forty percent (6458 patient) showed the symptoms of nocturnal multifactorial pathogenetic mechanism (morphofunctional polyuria (nocturia), among these maximum had two and more immaturity, suppression of the vegetative nervous system, episodes of enuresis per night. From this high frequency, total deficit of regional bloodsupply), the OAB syndrome in 150 respondents with OAB and nocturnal polyuria were children is a polyetiological disease. The symptoms of OAB selected for the three months study, this selection was are urgent urination, imperative urinary incontinence and primarily based on the combination of OAB and nocturnal nocturia (Vishnevsky et al., 2001; Dreiper & Smit, 2007). polyuria and secondarily on the availability for the study. Nocturia is symptomized by controlled (leading to wakening) Respondents those who are not reside in Moscow are excluded or uncontrolled (during sleep) urination two and more times from the study. The protocol of the study included the during night (Vishnevsky et al., 2007). The key factors of this intensity of urination, calendar of episodes of incontinence, pathological symptom which considerably reduces quality of results of dyuresis, uroflowmethry with determination of life of the patient are nocturnal polyuria and insufficiency of volume of residual urine, ultrasound examination (USE) of the the reservoir function of the bladder. Nocturnal polyuria in kidneys and bladder. Among the examined 150 patients, 88 combination with a small volume of the bladder creates a (58%) children had only imperative syndrome while 60 (40%) stable "conflict situation". The essence of the conflict is a children had both the imperative syndrome and night polyuria. disorder of equilibrium between intensity of production of Further, among the suffering respondents (60), 10 girls in urine and the ability of the bladder to accumulate urine at night particular, needed treatment for lower urinary tract infections hours. In these cases, diuresis at night exceeds the functional were excluded from the study while the rest 50 study capacity of the bladder that in principle changes the habitual participants with clinical symptoms of urinary disorders were course of the process of urine excretion at the level of the assessed by qualimetry and evaluated with 32+ 2.5 points. lower portion of the urinary tract provokes frequent urinations Patients were randomized into two treatment groups. Patients at night (Glazener & Evans, 2000). in Group 1, consisted 20 children were treated by oxybutyninе and desmopress in MELT bed time while Group 2 consisted of Taking into consideration immaturity of vegetative regulation 30 patients who received only basic therapy with oxybutynine. of the function of the lower urinary tract in children due to Monitoring carried out up to 3 months of treatment. non-uniform development of organs and structures in the process of growth, multiple night-time, and bladder emptying Prescribed doses of oxybutynin (Driptan 5 mg) used in this is of the uncontrolled character. Recently this phenomenon was study are varies with the age group and it was prescribed ½ unambiguously qualified by using the term "enuresis". tablet 2 times in a day for children up to 7 years, while for the However, disorders at the "receptor/detrusor" level should be children of 8-11 years age group, same dose increased up to 3 regarded in terms of the OAB pathogenesis. The ability of the times in a day. Further, for the children of the age group 12-14 detrusor to respond adequately to nerve impulse is possible years, one tablet 2 times in a day was prescribed and the same only under the condition of normal energy provision dose increased up to three times in a day for the children above (bioenergetics) of the smooth muscle structures (Nijman, 15 years. The design of the study corresponded to the level of 2004). Information regarding the treatment of patient suffering conclusiveness 2(B), that is, the randomized, controlled study, from OAB and nocturnal polyuria combindly are in scarcity; in which the statistical analysis is made on the basis of the data therefore present study was carried to investigate the frequency of a small number of patients (not more than 50), has been of nocturnal polyuria with OAB in children and to highlight conducted (Raes et al., 2006). the focus group study results of treatment with the oxybutynine

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

The clinical significance of the combination of pathogenic therapy in children with overactive bladder syndrome (OAB) and nocturia 386

Under 7 years 8-11 years

12-14 years

15 years and older

Figure 1 Distribution of patients with night polyuria by age groups.

The statistical processing of the results of this thorough In group 1, the clinical picture is changing through increased investigation was conducted by using the methods of urination in one portion and reducing the volume of nocturnal descriptive statistics and calculation of confidence intervals. diuresis. Evaluation method of quality control was reduced The nominal level of significance was at = 0.05. The check of from 32 to 22 + 2.5 points. This was a statistically significant statistical hypotheses was performed by using the methods of improvement in a decrease in volume of nocturnal diuresis to non-parametric statistics by hypothesis of uniformity of 38 ± 8% compared with the total volume of urine output during mathematical expectations for independent samples (groups) the day. Further, treatment increasing the effective bladder was checked by the Kramer-Welch's test (Sureshkumar et al., capacity was 31%. 2003). In group 2, evaluation of clinical symptoms of urinary 3 Results and Discussion disorders has improved to 27 ± 2.5 points, which was statistically significant compared to baseline values. But the By means of the data of the statistical instruments the baseline improvement was only from micturition volume in one portion uniformity of clinical signs of urination disorders in patients of as in Group 1 at 31%. But the parameters of nocturnal polyuria both groups was proved. The distribution of patients by age is have not changed. Thus, it was found that in the presence of an presented in figure 1 and figure 2. imperative syndrome and nocturnal polyuria best results were obtained when the complex and use of oxybutynin desmopressin MELT than only with oxybutynin alone.

Under 7 years

8-11 years

12-14 years

15 years and older

Figure 2 Age ranges in group 1 (20 patients).

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

387 Morozov et al

Under 7 years

8-11 years

12-14 years

15 years and older

Figure 3 Age ranges in group 2 (30 patients).

In group 1, combined treatment with desmopressin MELT was oxybutynine in the form of dry mucous membranes, was an increase in the gaps without enuresis episodes during the observed in only one patient. week. If the original aspect ratio of "wet" and "dry" nights in both groups was 6: 1, then after 3 months of treatment in group The most interesting to us is the analysis of changes in clinical 1 ratio was 2: 5. In group 2, the ratio was 5: 3. The ratio of symptoms. Table Wisniewski for evaluation of clinical “dry” and “wet” nights was used as a measure of the siptomy includes 5 sections, each of which contains effectiveness of treatment after the first month and the characteristic 1) urge to urinate, 2) the quality of urinary indication to increase the dose of desmopressin MELT incontinence, 3) nocturnal enuresis, and 4) the amount of individually. In group 1, the use of desmopressin MELT in all urination per day and the volume of 1 portsii5) nocturnal urine children was started with a dose of 60 mg (1 tablet). However, volume. Patients in Group 1 score in the symptoms scores this dose was doubled (120 mg) after 1 month of treatment in changed due to the decline in nocturnal polyuria and increase children in age group of 8-11 years. In groups of over 12 years the effective volume of the bladder. Patients in Group 2 also as it was necessary to increase the initial dose of 120 mg after increased the amount of urination portion, but the state 1 month of use. The dose was increased to 180 mg in 5 remained the same nocturnal polyuria. When monitoring the patients. effectiveness of treatment of patients in group 2 at 1 month assessment has changed due to the increased volume of the Group 2 patients (age aspects shown in Fig. 3) were treated bladder urine (25-26 points), but the overall result was not according to standard procedure oxybutynine ICCS at the same statistically significant, due to the inability to provide a dosage, which is used in the 1st group. Doses were assigned reduction in the frequency of enuresis episodes per night. depending on age. Side effects associated with the use of

Figure 4 Dynamics of minimal voiding volume against the background of combined and basic therapy in children with OAB syndrome

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

The clinical significance of the combination of pathogenic therapy in children with overactive bladder syndrome (OAB) and nocturia 388 After 3 months of treatment, patients of this group on the base Conflict of interest with oxybutynine therapy maximum bladder capacity increased by 28%. Evaluation of clinical symptoms during this Authors would hereby like to declare that there is no conflict of period has changed with respect to 1) urgency, 2) an interests that could possibly arise. imperative urinary incontinence and effective volume, but this difference did not reach statistical significance when compared Reference with the initial value. In addition, the results compared with the results of Group 1 for the same period of treatment (Fig. 4). A Abrams P, Blaivas JG, Fowler CJ, Fourcroy JL, Macdiarmid more modest number of bedwetting episodes and did not SA, Siegel SW, Van Kerrebroeck P (2003) The role of change significantly in the persistent level of nocturnal neuromodulation in the management of urinary urge polyuria remaining in the 2nd group. In this case, the 17 incontinence. British Journal Urology International 91: 355- children (57%) the number of episodes of nocturnal enuresis 359. decreased from 2 to 1 day. Kramer-Welch test was set for uniform groups studied parameters. Indeed, after the first Bauer SB (2002) Special considerations of the overactive month of therapy results were statistically indistinguishable (p bladder in children. Urology- 60:43-48. DOI: = 0.049), but after three months difference reached statistical http://dx.doi.org/10.1016/S0090-4295(02)01793-4. significance for parameters such as the volume (p = 0.00088) and the number of nocturnal enuresis (p = 0.000017) episodes Dreiper N, Smit G (2007) The practical regression analyses. (Warne et al., 2012). The complicated regression, 2007: 912.

In comparison to the results of the 1st group with the results of Glazener CM, Evans JH (2002) Desmopressin for nocturnal group 2, it was found that in the presence of an imperative enuresis in children. Cochrane Database Systemic Review 3 sindromadroma and nocturnal polyuria best results were :CD002112. DOI: 10.1002/14651858.CD002112. obtained with the integrated use of desmopressin MELT and oxybutynine. The main therapy in the form of oxybutynin Nijman RJ (2004) Role of antimuscarinics in the treatment of increases bladder capacity by one-third, but as largely nonneurogenic daytime urinary incontinence in children. spontaneous bladder emptying occurs during nighttime Urology 63: 45-50. DOI: urination, polyuria continuing to provoke uncontrolled http://dx.doi.org/10.1016/j.urology.2003.11.004. emptying of the bladder at night. It does not improve a child's ability to hold urine. The uncontrolled long-term incontinence Raes A, Dehoorne J, Hoebeke P, Van Laecke E, lowers self-esteem of the patient. Results of present study are Donckerwolcke R, Vande Walle J (2006) Abnormal circadian in agreement with findings of the previous researchers rhythm of diuresis or nocturnal polyuria in a subgroup of (Abrams et al., 2003; Glazener & Evans, 2002). children with enuresis and hypercalciuria is related to increased sodium retention during daytime. Journal of Urology Conclusion 176:1147-1151. DOI: http://dx.doi.org/10.1016/j.juro.2006.04.054. In a study of 150 children aged 5-17 years nocturia was identified with complaints of enuresis and imperative Sureshkumar P, Bower W, Craig JC, Knight JF (2003) syndrome authors in 40% of patients. High incidence of Treatment of daytime urinary incontinence in children: a nocturia children with the OAB syndrome required systematic review of randomized controlled trials. Journal of administration of desmopressin MELT combinedly with basic Urology 170:196-200. DOI: medicine to stabilize the detrusor: oxybutynine. http://dx.doi.org/10.1097/01.ju.0000072341.34333.43.

The use of desmopressin MELT require dose adjustment after Vishnevsky EL (2005) The children with overactive bladder. 1 month of treatment in ¼ of cases in patients older than 12 Abstracts of Russian Urological association. Tyumen citу, Pp: years. Results of the combination therapy led to the achieve a 71-72. statistically significant reduction in the number of urinary incontinence episodes per day and night time in 4-6 weeks Vishnevsky EL, Loran OB, Pushkar DY, Petrov SB (2007) from the beginning of treatment. In group of children who Obstructive nocturia. Publisher: M .: ANMI, Pp. 162. received only basic therapy oxybutynine this effect was not observed. The positive results obtained in the treatment of Visniewsky EL, Loran OB, Wisniewski AE (2001) Clinical children in a combined way significantly increased the self- evaluation of urinary disorders,: M TERRA, Pp. 96; esteem of children and improve the quality of family life. Warne RT, Lazo M, Ramos T, Ritter N (2012) Statistical methods used in gifted education journals, 2006-2010. Gifted Child Quarterly 56: 134-149. doi: 10.1177/0016986212444122.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Journal of Experimental Biology and Agricultural Sciences, June - 2016; Volume – 4(IV)

Journal of Experimental Biology and Agricultural Sciences

http://www.jebas.org

ISSN No. 2320 – 8694

MOLECULAR IDENTIFICATION AND INTEGRATED MANAGEMENT OF THE Fusarium f. sp. cucumerinum THE CAUSAL AGENT OF Fusaruim WILT DISEASE OF Cucumis sativus L. IN IRAQ

Safaa N. Hussein

Assistant Lecturer, Environmental Engineering Department, Faculty of Engineering, Unv. of Al.Almustansiriyah, Baghdad, Iraq

Received – March 15, 2016; Revision – April 05, 2016; Accepted – May 21, 2016 Available Online – June 25, 2016

DOI: http://dx.doi.org/10.18006/2016.4(4).389.397

KEYWORDS ABSTRACT Fusarium oxysporum f. sp. cucumerinum This study was aimed to isolate and identify the phytopathogenic fungus Fusarium oxysporum f. sp. cucumerinum (Foc) the causal agent of the Fusarium vascular wilt disease of cucumber in the middle Chaetomium cupreum and south of Iraq. The results of study indicated the presence of the pathogen with percentage of appearance 71.43% with frequency 46.43%. Molecular identification carried out using polymerase Trichoderma viride chain reaction technique indicated the presence 18 isolates of Foc pathogenic group I and 6 isolate of Foc pathogenic group II. Among these, the isolate Foc-b3 was most virulent under in vitro pathogenicity Bacillus pumilus test on the cucumber seed and it exhibited 0% seed germination compared with control. An attempt of integrated management of F. oxysporum f. sp. cucumerinum under in vitro conditions was also carried Salicylic acid out in present study and a significant inhibition were reported on the application of various bioagents such as Chaetomium cupreum (Cc), Trichoderma viride (Tv) and Bacillus pumilus (Bp) on the potato Cucumber dextrose agar (PDA). Further, under greenhouse conditions, combined application (tetrainoculums) of Cc+Tv+Bp+ Salicylic acid (Sa) was significantly reduced the percentage of the disease incidence and PCR severity up to 0% as compared with the control where it was reported 97.50%, 75.72% respectively. Effect of this combination was also reported on the dry weight of the plants and significant improvement (0.975 gm/plant) was reported as compared to control (0.098 gm/plant).

All the article published by Journal of Experimental * Corresponding author Biology and Agricultural Sciences is licensed under a E-mail: [email protected] (Safaa N. Hussein) Creative Commons Attribution-NonCommercial 4.0 International License Based on a work at www.jebas.org. Peer review under responsibility of Journal of Experimental Biology and Agricultural Sciences.

Production and Hosting by Horizon Publisher India [HPI] (http://www.horizonpublisherindia.in/ ). All ______rights reserved. Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

390 Hussein

1 Introduction identification technique. Further, effort of disease management by using eco-friendly means by using biocontrol agents C. Cucumber (Cucumis sativus L.) is an important vegetable crop cupreum, T. viride, B. pumilus and plant growth regulator throughout the world; it has similar importance in Iraq also Salicylic acid was also attempt. (Saeed et al., 2015). Crop grown in various part of the country, and the area of cultivation reached 92.887.00 ha with total 2 Materials and methods production of 405.610.00 ton in 2013 (FAO, 2015). In Iraq, crop production is affected by various physical and biological 2.1 Sampling, isolation and identification factors, among these serious economic losses was caused by Fusarium vascular wilt disease which is caused by the Samples were collected from various cucumber grown areas of Fusarium oxysporum (Schlechtend.:Fr.) f. sp. cucumerinum Baghdad, Babil and Karbala provinces of Iraq during the (Owen) Snyder & Hansen (Armstrong & Armstrong, 1978). growing season in 2014-2015. Infected samples were collected Foc is a host specific pathogen (Armstrong et al., 1978) and from rhizosphere and basal segment of the stem. Collected widely distributed in many cucumber grown areas such as samples were washed by 1% Hypochlorite sodium for 1 min South Africa, Japan, Thailand, England, France, Germany and and cut off in to 0.5 cm, disinfected sample were rinsed twice Australasia (Booth, 1971; Plantwise, 2015). This disease was in sterile distilled water and dried. Four dried samples were recorded first time on the cucumber in1951 (Zitter et al., 1996) incubated in laminar flow bench on Petri plat containing while In Iraq, it was first time recorded in the province of sterilized PDA (CDH Bioscience Co., India) and incubated at Wasit in 2012 (Risan, 2012). Symptoms appear typically on 25±2 °C for 7 days. Fungus grown around the infected the plant as foliar wilting, necrotic lesions of the stem base segments were transferred individually on the separate PDA followed by vascular discoloration on the roots and stem and incubated for 7 days at same temperature (Hussein & (Vakalounakis, 1988; Vakalounakis et al., 2004). Three Juber, 2015). Fungal isolates were identified according to the physiological races of the Foc viz 1, 2 and 3 have been morphological characteristics described by (Booth, 1971; identified (Armstrong et al., 1978). Information regarding Booth 1977; Ellis, 1971; Domsch et al., 2007). Percentage of molecular identification and characterization are in scarcity the appearance and frequency of the fungi calculated according especially in context of Iraq. to method of Hussein & Juber (2014).

Disease management is a major problem for cultivars; various 2.2 Identification of F. oxysporum f. sp. cucumerinum using chemical, physical, biological and cultural practices are carried specific polymerase chain reaction (PCR) assays out for the management of this disease. Among these, biological control offers an eco-friendly means of plant 2.2.1 DNA extraction diseases management. Strategies of using beneficial microorganisms for controlling plant pathogens help in DNA of the initially isolated 31 fungal isolates which basically reducing the negative impacts of the chemicals on the identified as F. oxysporum based on the cultural and environment and human health and it also cost effective (Higa, microscopic morphology characteristics were extracted using 1991; Parr & Hornick, 1994). Various species such as Bacillus, the fungal DNA extraction kit (EZ-10 Spin Column Fungal Pseudomonas, Chaetomium, Trichoderma and Penicillium Genomic DNA Mini-Preps Kit, Bio Basic Inc., Canada) have been used widely in plant disease controlling (Vessey, according to the manufacture instructions. For this all the 2003).Trichoderma species are widely used as biocontrol isolates were purified by using single spore technique agents against plant pathogens since 1920s (Harman, 2006). according to the method given by Hussein & Juber (2015). Species belong to Chaetomium are normally found in the soil Mycelium with spores were harvested by sterilized glass rod and organic compost, and has potential of cellulose and other from each isolate individually and transferred into 1.5 ml clean organic materials degradation, species such as C. cupreum and eppendorf tubes and kept in -20 °C until DNA extraction C. globosum also has been proved to be good antagonistic process were established. agents against various plant pathogens (Soytong et al. 2001). Role of phytohormones such as Salicylic acid, Jasmonic acid, 2.2.2 Primers preparation Abscisic acid and ethylene in inducing systemic resistance in plants against the broad range of the pathogens through Four specific primers used to identify F. oxysporum f. sp. activating plant enzymes such as peroxidase (POD) and cucumerinum pathogenic group I, II, III and IV (Bioneer Co., polyphenol oxidase (PPO) has been well documented (War et South Korea) (Table 1). Primers were diluted individually by al., 2011). This study was amid to investigate the occurrence of adding sterile distilled water according to the company F. oxysporum f. sp. cucumerinum (Foc) in the middle and instructions to obtain the concentration of100 pmol/µl and south of Iraq, isolated pathogens were identified by molecular stored at -20 °C until uses.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Molecular identification and integrated management of the Fusarium f. sp. cucumerinum the causal agent of Fusaruim wilt disease… 391 Table 1 Specific primers and amplification conditions used in the PCR process.

primer of pathogenic group Sequence (5’ 3’) Annealing temp./ cycles I F: AGGTGACCGTCGTAGCAAG 54 °C/ 25 R: AGGTGACCGTTGAGAGGA II F: GGAGGGTGTTGGAGATGC 61 °C/ 35 R: GCAGGGTGTTACTCCAGGCAC III F: GATGACCGCCAATGTGTACT 62 °C/ 25 R: GATGACCGCCGACCTTGGCCG IV F: GGAGGGTGTTACAATCACAAT 55 °C/ 25 R: GGAGGGTGTTAAGCATTC F= Forward, R= Reverse (Najafiniya & Sharma ,2011)

2.2.3 Polymerase chain reaction (PCR) assays µl 6x DNA loading dye (Thermo Scientific, USA) and 4 µl deionized water were loaded into the hole of the agarose gel as Extracted fungal DNA were amplified using standard master well as negative control. The gels were visualized under U.V. mix (AccuPower PreMix series, Bioneer Co., South Korea) in light using U.V. Transilluminator and Jell documentation the PCR experiments, reaction mixture consist of 250 µM each system (Cleaver, UK). dNTP, 1.5 mM MgCl2, 30 mM KCL, 10 Mm Tris-HCL (pH 9.0), 1 U Taq DNA polymerase, 1.5 µl of each primer, 3µl 2.3 Pathogenicity test DNA template in concentration of 50 ng/µl and 14 µl sterile distilled water in eppendorf tube 0.2 ml, negative control were In-vitro pathogenicity test was conducted for the 31 isolated performed in all the experiments which was DNA template and purified fungal isolates of F. oxysporum, using filter paper replaced with sterile distilled water, the quality and technique. For this spore suspension were prepared by pouring concentration of the DNA were tested using spectrophotometer 10 ml of the sterile distilled water into fungal mycelium (NanoSpec Cube, Nanolytic, Germany) at the wavelength containing petri plate; mycelia were scraped by sterile glass 260/280 nm (Maniatis et al., 1982). Samples were enrolled into rod and pour the liquid from the plate into the cheese cloth the Thermocycler (Model 480, Perkin-Elmer Co., USA), placed folded over a sterile conical flask. The spore suspension amplification program have been organized for each primer in was prepared at 5x104 spore concentration by using sterile similar conditions except annealing temperature step which water and hemocytometer. Seeds of cucumber cultivar Green was specific to each primer particular (Table 1) according to Paris (Vilmorin/ France) uncoated with fungicide were surface the method of Najafiniya & Sharma (2011), each program sterilized and 10 seeds were transferred into each petri plate (9 started with 1 initial denaturation cycle at 95°C for 4 min, cm diameter) containing 5 layers of filter paper (9 cm followed by 25 cycles except with primer of pathogenic group diameter), each plate were watered with 1ml spore suspension II where it was 35 cycles, each cycle consist of denaturation and 3 ml sterile distilled water. All the plates were incubated at step at 95°C for 1 min, annealing step for 1 min at 54 °C, 61 25 °C for 14 days and watered as needed, each treatment has 4 °C, 62 °C, 55 °C for the primer of pathogenic group I, II, III, replicates. Percentage of the seed germination was calculated IV respectively, and an extension step at 72°C for 2 min, according to the formula below: followed by 1 cycle final extension step at 72°C for 7 min.

2.2.4 Gel electrophoresis

Amplification products were separated on the 1.5% agarose gel 2.4 In vitro antagonism assay (Bio Basic Inc., Canada) by adding 1 gm agarose to 100 ml TBE buffer (Tris-Borate-EDTA, 10x solution, Bio Basic Inc., Antagonistic activity was conducted on the PDA medium by Canada) which is consist of 0.089 M Tris Base, 0.189 M using dual culture technique with biocontrol fungi C. cupreum, Boric Acid, 0.112 M EDTA after diluted to 1x by adding 10 T. viride and B. pumilus against the fungal isolate Foc-b3 ml TBE buffer to 90 ml sterile distilled water and poured into according to the method of Lamsal et al. (2012). Among these, agarose electrophorsis kit (Model AE-6100, ATTO Co., C. cupreum and B. pumilus was obtained from previous study Japan), TBE buffer x1 concentration 1:10 ( TBE: sterile while the fungus T. viride which obtained from Ministry of distilled water) added to on the solid agarose gel in the agarose Science and Technology, Department of Agricultural EP kit, 10 µl of PCR products for each isolate individually and Research, Iraq. A disc of 0.5 cm of PDA containing 7 days old 2 µl of green DNA dye (Bio Basic Inc., Canada) mixed and pathogen was inculcated on the dual PDA plate (9 cm loaded into the holes of the agarose gel, 1 µl of the 1 kb DNA diameter) about 2 cm apart from the plate edge and similar dice ladder marker (Thermo Scientific, USA) mixed gently with 1 size of the bioagents Tv and Cc and 20 µl of the bacteria Bp

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

392 Hussein was inculcated individually on the opposite side of the plate Masood et al. (2010). Disease severity was estimated by using about 2 cm apart from the plate edge, separate plates of PDA the score-rating chart below which is described by Schneider were amended as a control containing a disc of the pathogen (1984) with simple modification: 0= No symptoms, 1= mild only, all the plates were incubated at 28 °C for 10 days. vascular discoloration in roots, 2= extensive vascular Inhibition effect was calculated by measuring the distance of discoloration in roots, 3= mild discoloration in crown, 4= the fungal growth radius of the pathogen toward the bioagents extensive discoloration in crown, 5= mild disintegration of compared with the control according to the following formula: crown and roots tissue, 6= extensive disintegration of crown and roots tissue, and 7= wilted or plant dead. The Percentage of disease severity index (DSI) was calculated by using the formula described by Grau & Radke (1982). The dry weights (Lamsal et al., 2012) of plants were also recorded during the study.

Where: R = is the radius of the pathogen in control plate, r = is 3 Results and Discussion the radius of the pathogen in dual culture plate. 3.1 Isolation and identification 2.5 Management of Fusarium wilt disease of cucumber under greenhouse conditions Results of the isolation study along with association number of fungi were indicated in (table 2). Among various isolated Greenhouse study was conducted to evaluate the disease pathogenic fungi, F. oxysporum was predominant, and it suppression and plant growth ability of selected bioagents Cc, exhibited 71.43%, 46.43% percentage of appearance and Tv, Bp and plant growth elicitor Sa (Merck Millipore Co., frequency respectively. Morphological characteristic of 7 days Germany) either individually or in combination. Inoculum of old Foc was white colony with a purple tinge, reverse pale the fungal isolates of Cc, Tv and Foc-b3 were prepared by purple pigment on the bottom of the plate, floccose texture, adding 5 disc (0.5 cm) of 7 days old fungal culture to the diameter ranched 4.5 - 5cm. The fungus formed small conical flask (500 ml) containing 200 gm autoclaved microconidia with oval shaped, ellipsoid, cylindrical, straight millet seeds (Pennisetum glaucum) and incubated at 25 °C for to curved with 1- 2 septate born on the simple phialides arising 14 days. Inoculum of the Bp was prepared on sterilized laterally on the hyphae or from short sparsely branched nutrient broth medium and incubated at 30 °C for 7 days with conidiophores, thin-walled macroconidia born on the branched constant shaking, spore density amended to 108 CFU. ml-1 by conidiophores appeared as fusoid shaped with a definite foot hemocytometer, while Sa solution was prepared at the cell with 3-5 septate, whilst terminal or intercalary concentration of 150 µg.ml-1. Mixture of the autoclaved soil chlamydospores were formed rarely with rough walled and compost (2:1) were filled into the plastic pots (13 cm arranged solitary or in chains (Booth, 1971 ; Compbell et al., diameter), inoculum of the pathogen was added as 1% (w/w) to 2013). the pots and watered, three days after inculation, pots were planted with 10 seeds of the cucumber, in the same time 40 3.2 Identification of F. oxysporum f. sp. cucumerinum using ml/pot of the Bp inoculum was added as soil drench, inoculum PCR assay of Cc and Tv added as 1% (w/w), the Sa solution was soil drenched as 40 ml/pot after 10 days of seeds planting. Pots are The PCR analyses of F. oxysporum were demonstrated that 24 arranged according to the completely randomized design isolates were belong to special form of F. oxysporum f. sp. (CRD) with 4 replicates in the greenhouse and watered as cucumerinum (table 3), among these 18 isolates were observed needed, percentage of seed germination calculated after 10 to amplify fragments with primer of the pathogenic group I days. Percentage of disease incidence was calculated after 8 and, their bands shown at 1.320 kb (Fig. 1). weeks of seed planting according to the formulas described by

Table 2 Fungi associated with the samples isolated from the collected root and shoot samples.

Fungus name Appearance )%( Frequency (%)

Aspergillus niger Van Tieghem 42.86 15.63 Cladosporium cladosporioides (Fresen.) G.A. de Vries 28.57 18.30 Fusarium oxysporum Schlesht 71.43 46.43 Fusarium solani (Mart.) Sacc. 21.43 10.71 Pencillium sp. 35.71 20.54 Phoma sp. 14.29 4.91 Rhizctonia solani (Kuhn) 7.14 2.23 Rhizopus sp. 28.57 13.39 Ulocladium atrum Preuss 14.29 3.13

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Molecular identification and integrated management of the Fusarium f. sp. cucumerinum the causal agent of Fusaruim wilt disease… 393 Table 3 Detection pathogenic group I, II, III and IV of F. oxysporum f. sp. cucumerinum using specific primers.

Isolate Primer Isolate Primer I II III IV I II III IV Control - - - - Foc-b9 + - - - Foc-g1 + - - - Foc-b10 - + - - Foc-g2 + - - - Foc-b11 + - - - Foc-g3 - + - - Foc-b12 + - - - Foc-g4 + - - - Foc-b13 - - - - Foc-g5 + - - - Foc-k1 - - - - Foc-g6 + - - - Foc-k2 + - - - Foc-g7 + - - - Foc-k3 - - - - Foc-b1 + - - - Foc-k4 - - - - Foc-b2 - - - - Foc-k5 - + - - Foc-b3 + - - - Foc-k6 + - - - Foc-b4 + - - - Foc-k7 - - - - Foc-b5 + - - - Foc-k8 + - - - Foc-b6 - + - - Foc-k9 - - - - Foc-b7 - + - - Foc-k10 - + - - Foc-b8 + - - - Foc-k11 + - - - Foc-1g - Foc-7g = Baghdad, Foc-1b - Foc-13b = Babil, Foc-1k - Foc-11k = Karbala

Figure 1 Gel electrophoresis of the amplification product from PCR using genomic DNA of F. oxysporum f. sp. cucumerinum isolates using specific primers. A. Primer of pathogenic group I, B. Primer of pathogenic group II, M. DNA ladder marker, C. Negative control.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

394 Hussein

Table 4 Pathogenicity effect of F. oxysporum isolates to Table 5 Inhibition effect of the bioagents against F. oxysporum cucumber seeds. in vitro.

Isolate Germination (%) Isolate Germination (%) Treatment Inhibition (%) Control 100.0 Foc-b9 30.0 Control 0.0 Foc-g1 40.0 Foc-b10 22.5 Foc-b3 + TV 82.69 Foc-g2 35.0 Foc-b11 30.0 Foc-b3 + Cc 68.85 Foc-g3 32.5 Foc-b12 22.5 Foc-b3 + Bp 66.92 Foc-g4 37.5 Foc-b13 60.0 LSD (0.05) = 0.65 Foc-g5 20.0 Foc-k1 65.0 Foc-g6 35.0 Foc-k2 22.5 Foc-b3= F. oxysporum f. sp. cucumerinum, Tv= T. viride, Foc-g7 22.5 Foc-k3 45.0 Cc= C. cupreum, Bp= B. pumilus Foc-b1 20.0 Foc-k4 47.5 Each number reflects 4 replicates. Foc-b2 47.5 Foc-k5 35.0 Foc-b3 5.0 Foc-k6 32.5 3.5 Management the Fusarium wilt disease of cucumber under Foc-b4 27.5 Foc-k7 57.5 greenhouse conditions Foc-b5 15.0 Foc-k8 25.0 Foc-b6 17.5 Foc-k9 52.5 The results indicated that all of the treatments used in this Foc-b7 42.5 Foc-k10 15.0 experiment were positively increased the percentage of the Foc-b8 40.0 Foc-k11 40.0 seed germination, while the percentage ranged between 75- SEM Value = 1.7 100% compared with the negative control (Pathogen alone) LSD (0.05) = 3.4 which shows only 52.5% seed germination (table 6). Disease management ability of various treatments under greenhouse Each number reflects 4 replicates. conditions varies and superiority was shown by the tetra

inoculum containing Tv+ Cc+ Bp+ Sa, treatment significantly Six isolates amplified with primer of the pathogenic group II reduced the percentage of disease incidence and severity up to and, their bands were shown at 0.770, while 7 isolates did not 0% as compared with the negative control which shows amplified with any of the four primers, it may be due to be 97.50% & 72.75% respectively (Figure 3). these isolates belonging to other form or due to technical error.

This combination was followed by the triinoculum of Tv+ Bp+ 3.3 Pathogenicity test Cc which exhibited 32.50%, 26.50% disease incidence and

severity respectively. All of the treatments increased the dry The 31 isolates of F. oxysporum showed variation in their weigh of the plants significantly, among these tetrainoculum pathogenicity, while the percentage of the seed germination shows superiority over the other treatments and exhibited was reported between 5 - 65% as compared to the control 0.975 gm/plant compared with the negative control which was which shows 100% germination (table 4). Among all the tested 0.098 gm/plant. These results are agreed with the results of isolates, Foc-b3 inhibit maximum seed germination and other studies, such as Soytong & Soytong (1997) where they exhibited 5% seed germination. Further, isolates belong to the found that the tomato plants treated with C. cupreum in the province Babil showed higher pathogenicity than other two form of mycofungicide completely prevented the damages provinces; this variation in the pathogenic ability between the caused by F. oxysporum in Thailand. Similar types of results isolates may be refer to the genetic variation between races of were obtained by John et al. (2010) those who reported that T. the fungus or may be due to the geographical distribution, viride is an effective bioagent against the plant pathogens F. properties of the soil and environmental conditions. oxysporum and Pythium arrhenomanes in soybean trial.

Further, they reported that T. viride not only controlled the 3.4 In vitro antagonism assay pathogens but also simultaneously increased the plant growth

and modified the rhizosphere of soybean plant. All the bioagents were effectively inhibited the mycelial growth of the pathogen on the PDA. In vitro comparison with The bioagents C. cupreum and T. viride suppressed the the control (fungus alone) which filled the petri plate after 10 pathogen through several mechanisms including days of incubation (table 5), the bioagent Tv was superior mycoparasitism, antibiosis and competition for space and which exhibited 82.69% percentage of inhibition this inhibition nutrient resources. The mycoparasitism activity of the T. viride was followed by Cc and Bp where they exhibited 68.85%, inducing its growth toward the pathogens, it creates coiling on 66.92% inhibition respectively (Fig. 2). These results are in the target fungi and induced inactivation of the pathogen’s agreement with Fitsum et al. (2014) who obtained high enzymes by producing several antifungal extracellular percentage of inhibition 80.39% in dual culture plate of T. enzymes such as protease. viride against Colletotrichum lindemuthianum in vitro.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Molecular identification and integrated management of the Fusarium f. sp. cucumerinum the causal agent of Fusaruim wilt disease… 395

A B C Figure 2 Inhibition effect of the bioagents against F. oxysporum using dual culture method. A.) Tv+ Foc-b3 , B.) Cc+Foc-b3 , C.) Bp+Foc-b3

Further it was also reported that enzymes secreted from T. PGPR generally enhance the plant growth directly through viride suppressed the enzymes produced by pathogens i.e. amending plant hormone or facilitate by resources such as chitinase and glucanase. These biocontrol agents, also playing phosphorus and nitrogen acquisition, and indirectly by the a big role in rhizosphere modification, biofertilization and forms of biological control agents through suppression stimolization of plant defense mechanisms (Harman, 2006). negative impact of the phytopathogens on plant growth The soil bacteria B. pumilus also inhabiting in the rhizosphere development (Ahemed & kibret, 2014). The phytohormone microbial growth and acting as one of the PGPR group Salicylic acid is also performing an essential role in plant (Hussein & Juber, 2015). This bacteria involved in promoting growth regulation and plant's reaction to the biotic and abiotic plant growth directly or indirectly through production of stresses by involving locally and systemically induced several regulatory chemicals in the rhizosphere area. The resistance (Halim et al. 2006).

Table 6 Effect of the bioagents on the Fusarium wilt disease of the cucumber under greenhouse conditions.

No. Treatment Germination )%( Incidence (%) Severity (%) Dry weight (gm/plant) 1 Control 100.0 0.0 0.00 0.396 2 Foc-3b + Tv 80.0 60.0 51.25 0.301 3 Foc-3b + Cc 77.5 67.5 56.50 0.230 4 Foc-3b + Bp 82.5 67.5 50.75 0.290 5 Foc-3b + Sa 75.0 70.0 62.00 0.129 6 Foc-3b + Tv + Cc 100.0 50.0 30.00 0.378 7 Foc-3b + Tv + Bp 100.0 52.5 41.50 0.404 8 Foc-3b + Tv + Sa 87.5 55.0 43.00 0.398 9 Foc-3b + Tv + Cc + Bp 100.0 32.5 26.50 0.562 10 Foc-3b + Tv + Cc + Sa 97.5 35.0 28.25 0.497 11 Foc-3b + Tv + Cc + Bp + Sa 100.0 0.0 0.00 0.975 12 Foc-3b + Cc + Bp 95.0 45.0 33.00 0.317 13 Foc-3b + Cc + Sa 95.0 47.5 41.25 0.249 14 Foc-3b + Bp + Sa 92.5 65.0 56.25 0.312 15 Tv 100.0 0.0 00.00 0.550 16 Cc 100.0 0.0 00.00 0.502 17 Bp 100.0 0.0 00.00 0.587 18 Sa 100.0 0.0 00.00 0.418 19 Foc-3b 52.5 97.5 72.75 0.098 SEM Value 7.3 9.4 10.53 0.114 LCD (0.05) 14.7 18.9 21.09 0.229 Each number reflects 4 replicates.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

396 Hussein

Figure 3 Fusarium wilt disease control under greenhouse condition. A= Tetrainoculum of (Tv+ Cc+ Bp+ Sa) , B= Negative control (Foc-b3), C= 1. Tetrainoculum of (Tv+ Cc+ Bp+ Sa) , 2. Control , 3. Negative control. D= 1. Negative control , 2. Control, 3. Tetrainoculum of (Tv+ Cc+ Bp+ Sa).

Conflict of interest Compbell CK, Johnson EM, Warnock DW (2013) Identification Pathogenic Fungi, 2nd edition. Blackwell Authors would hereby like to declare that there is no conflict of Publishing, John Wiley & Sons, Ltd., Publication, UK, Pp. interests that could possibly arise. 174- 175.

References Domsch KH, Gams W, Anderson T (2007) Compendium of Soil Fungi, 2nd edition. IHW-Verlag, Eching, Pp. 672. Ahemed M, Kibret M (2014) Mechanisms and applications of plant growth promoting rhizobacteria: Current perspective, Ellis MB (1971) Dematiaceous Hyphomycetes. Journal of King Saud University – Science 26: 1–20. Commonwealth Mycological Institute, Surrey, Kew, U.K. Pp. doi:10.1016/j.jksus.2013.05.001 608.

Armstrong GM, Armstrong JK (1978) Formae speciales and FAO (2015) Online, Food and Agriculture Organization. races of Fusarium oxysporum causing wilts of the FAOSTAT. Available on: Cucurbitaceae. Phytopathology 68:19-28. http://faostat3.fao.org/download/Q/QC/E/ access on 2015.

Armstrong GM, Armstrong JK, Netzer D (1978) Pathogenic Fitsum S, Amin M, Selvaraj T, Alemayehu A (2014) In vitro races of the cucumber-wilt Fusarium. Journal of Plant Disease evaluation of some fungicide and bioagents against common 62:824-828. bean anthracnose (Colletotricum lindemuthianum Sacc. & Booth C (1971) The Genus Fusarium, Commonwealth Magnus) Briosi & Cavara. African Journal of Microbiology Mycological Institute, Kew, Surrey, UK, Pp. 237. Research 8 : 2000-2005. doi:10.5897/AJMR2014.6825

Booth C (1977) Fusarium: Laboratory Guide to the Grau CR, Radke VL (1982) Resistance of soybean cultivar to Identification of the Major Species. Commonwealth Sclerotinia sclerotiorum. Journal of Plant disease 66 : 506-508. Mycological Institute, Kew, Surrey, UK, Pp.58.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Molecular identification and integrated management of the Fusarium f. sp. cucumerinum the causal agent of Fusaruim wilt disease… 397 Halim VA, Vess A, Scheeland D, Rosahl S (2006) The role of Table Discussion by USDA Scientists, October 7, 1993. salicylic acid and jasmonic acid in pathogen defence. Plant Published by the Nature Farming Research and Development Biology 8 : 307-313. Foundation, Lompoc, California, USA.

Harman GE (2006) Overview of mechanisms and uses of Plantwise Khnowldge Bank (2015) Available on Trichoderma spp. Phytopathology 96:190-194. doi: http://www.plantwise.org/KnowledgeBank/Datasheet.aspx?dsi 10.1094/PHYTO-96-0190 d=24622 access on 2016.

Higa T (1991) Effective microorganisms: A biotechnology for Risan MH (2012) Diagnosis of Fusarium oxysporum fungus mankind. In: Parr JF, Hornick SB, Whitman CE (Eds.) isolations and evaluation of the efficiency of the bacteria Proceedings of the First International Conference on Kyusei Bacillus subtilis and potassium phosphate in the inhibition of Nature Farming, Khon Kaen University, Thailand held on 17- fungi F. oxysporum f. sp. cucumerinum and F. oxysporum f.sp. 21st October, 1989. U.S. Department of Agriculture, melonis. Iraqi Journal of Science 53:513-523. Washington, D.C., USA. Saeed KS, Ahmed SA, Ahmed PH (2015) Effect of bio- Hussein S, Juber K (2014) First report of identification fertilizer and chemical fertilizer on growth and yield in Fusarium solani f. sp. cucurbitae race 1 and 2 the causal agent cucumber (Cucumis sativus) in greenhouse condition. Pakistan of crown and root rot disease of watermelon in Iraq. Journal of Biological Sciences 18: 129-134. doi: International Journal of Agriculture Innovation and Research 3 10.3923/pjbs.2015.129.134. : 974-978. Schneider RW (1984) Effects of nonpathogeneic strains of Hussein S, Juber K (2015) Identification of the causal agent of Fusarium oxysporum on celery root infection by Fusarium crown and root rot disease of watermelon and evaluation the oxysporum f. sp. apii and a novel use of the Lineweaver-Burk efficiency of the PGPR in controlling the disease under double reciprocal plot technique. Phytopathology 74: 646-653. greenhouse conditions. The Iraqi Journal of Agricultural Sciences. 46: 11-20. Soytong K, Kanokmedhakul S, Kukongviriyapa V, Isobe M (2001) Application of Chaetomium species (Ketomium®) as a John R, Tyagi R, Prevost D, Satinder K, Pouleurand S, new broad spectrum biological fungicide for plant disease Surampalli R (2010) Mycoparasitic Trichoderma viride as a control: A review article. Fungal Diversity 7: 1-15. biocontrol agent against Fusarium oxysporum f. sp. adzuki and Pythium arrhenomanesand as a growth promoter of soybean. Soytong K, Soytong K(1997) Chaetomium as a new broad Crop Protection 29: 1452-1459. doi: spectrum mycofungicide. Proceedings of the First International 10.1016/j.cropro.2010.08.004. Symposium on Biopesticides, Naresuan University, Pitsanulok, Thailand held on 27th – 31st October, 1997, Pp. 124-132. Lamsal K, Lim S, Kum Y Lee Y (2012) Application of rhizobacteria for plant growth promotion effect and biocontrol Vakalounakis DJ (1988) Diseases and Pests of Vegetable of anthracnose caused by Colletotrichum acutatum on pepper. Crops and Their Control. Technological Education Institute. Mycobiology 40: 244-251. doi: Heraklio, Crete, Greece, Pp. 108. 10.5941/MYCO.2012.40.4.244. Vakalounakis DJ, Wang Z, Fragkiadakis GA, Skaracis GN Maniatis T, Fritsch EF, Sambrook J (1982) Molecular (2004) Characterization of Fusarium oxysporum isolates Cloning: A Laboratory Manual. Cold Spring Harbor obtained from cucumber in China by pathogenicity, VCGs and Laboratory, Cold Spring Harbor, NY, USA. Pp. 545. RAPD. Plant Disease 88: 645–649.

Masood A, Saeed S, Iqbal N (2010) Methodology for the Vessey JK (2003) Plant growth promoting rhizobacteria as evaluation of symptoms severity of mango sudden death Biofertilizers. Plant and Soil 255: 571–586. doi: syndrome in Pakistan. Pakistan Journal of Botany 42: 1289- 10.1023/A:1026037216893. 1299. War AR, Paulraj MG, War MY Ignacimuthu S (2011) Role of salicylic acid in induction of plant defense system in chickpea Najafiniya M, Sharma P (2011) Specific PCR-based marker for (Cicer arietinum L.). Plant Signal & Behavior 6: 1787–1792. detection of pathogenic groups of Fusarium oxysporum f. sp. DOI: 10.4161/psb.6.11.17685 cucumerinum in India. Journal of Genetic Engineering and Biotechnology 9: 30-34. doi:10.1016/j.jgeb.2011.05.009. Zitter TA, Hopkins DL, Thomas CE (1996) Compendium of Cucurbit Diseases. American Phytopathological Society, St. Parr JF, Hornick SB (1994) Assessment of the Third Paul, MN, USA. Pp.11-17. International Conference on Kyusei Nature Farming: Round

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Journal of Experimental Biology and Agricultural Sciences, June - 2016; Volume – 4(IV)

Journal of Experimental Biology and Agricultural Sciences

http://www.jebas.org

ISSN No. 2320 – 8694

RESPONSE OF ALFALFA FORAGE TO PHOSPHORUS, BORON AND MANGANESE BASED FERTILIZING SYSTEMS

Maryam Kheirkhah1, Hamid Madani2,*, Shahram Lac3, Ghorban Nourmohammadi4 and Mani 3 Mojaddam

1Department of Agronomy, College of Agriculture, Khuzestan Science and Research branch, Islamic Azad University, Ahvaz, Iran 2Department of Agronomy, College of Agriculture, Arak Branch, Islamic Azad University, Arak, Iran. 3Department of Agronomy, College of Agriculture, Ahvaz Branch, Islamic Azad University, Ahvaz, Iran. 4Department of Agronomy, College of Agriculture, Science and Research Branch, Islamic Azad University, Tehran, Iran

Received – February 22, 2016; Revision – May 01, 2016; Accepted – June 28, 2016 Available Online – June 30, 2016

DOI: http://dx.doi.org/10.18006/2016.4(4).398.405

KEYWORDS ABSTRACT Alfalfa

Boron This study was conducted to explore the effect of phosphate solubilizing bacteria (PSB), boron (Borax and Boric acid) and manganese (manganese chelate and manganese sulfate) based fertilizers on forage Forage Yield production of alfalfa. Experiment was laid in a split plot factorial in the form of randomized complete block design with phosphorus bio-fertilizer rates (0 and 100 g.ha-1) in main plots, while boron (0, Borax -1 -1) Manganese foliar application of 1.0 lit.ha and Boric acid soil application 10 kg. ha and manganese fertilizer (0, manganese chelate foliar application 1.0 lit.ha-1 and manganese sulfate soil application 10 kg. ha-1) were Phosphate Solubilizing used in sub plots. The results showed that the highest dried forage yield was obtain by boron and Bacteria manganese foliar application and bio-phosphorus utilization about 24.00 t/ha. Thus, triple application of PSB, Mn and B (100 g.ha-1 as soil application and 1.0 lit.ha-1 of each Mn and B solutions) could be recommended as the best treatment for improve forage yield of alfalfa (cv. Ranger) under the experiment environmental conditions.

All the article published by Journal of Experimental * Corresponding author Biology and Agricultural Sciences is licensed under a E-mail: [email protected] (Hamid Madani) Creative Commons Attribution-NonCommercial 4.0 International License Based on a work at www.jebas.org. Peer review under responsibility of Journal of Experimental Biology and Agricultural Sciences.

Production and Hosting by Horizon Publisher India [HPI] (http://www.horizonpublisherindia.in/ ). All ______rights reserved. Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

399 Maryam et al

1 Introduction Excess uses of chemical fertilizers are the major problems for modern agriculture system and these are responsible for water Perennial crops such as Alfalfa (Medicago sativa L.) play an and soil contamination. Farmers are seeking for a viable important role in sustainable and dynamic agriculture and alternative of chemical fertilizers. Phosphate solubilizing human food production. With the attention given to sustainable bacteria can be applied as safer sources of phosphorus instead agriculture in recent decades, there is renewed interest in of chemical phosphorus fertilizers. Phosphorus can be legumes and cropping systems (Sweeney et al., 2011). Alfalfa considered as a growth limiting nutrition due to its low is one of the most important forage crops in world and also in availability to plants because its low solubility and fixation in Iran. Due to its high yield potential, protein content and soil (Soon, 1990; Thomazi et al 1990; Nahas, 2007). Phosphate palatability, it is widely grown in almost all regions of Iran solubilizing microorganisms have solved this problem to large (Hosseinirad et al., 2013). extend by dissolving insoluble phosphate via production of inorganic or organic acids or by decrease of pH and bring For sustainable production of Alfalfa, proper management of about the dissolution of bound forms of phosphate, providing biomass yield and total dry matter, soil and foliar application available phosphate that can be taken by the plants (Jana, 2007; of fertilizers management are required. Along with various Mohammadi & Sohrabi, 2012; Mardad et al., 2013). Among fertilizing agents, production of alfalfa is also limited by the various phosphorus solubilizing microorganisms, phosphate deficiency of Boron (Marschner, 1995; Dear & Wiear, 2004). solubilizes bacteria are very useful natural microbes that they According to Marschner (1995) boron is one of the can change the soil mineral phosphate to soluble phosphorus micronutrient that required for the normal growth and by production of organic acids and phosphatases acid development of plants and boron deficiency can be reduced the (Rodriguez & Fraga, 1999). Pseudomonas as one of the most crop yield. Further, Dear & Wiear (2004) reported that Alfalfa important plant growth-promoting bacteria (Singh et al., 2005; needs more boron as compared to barley crop. Sugar transport, Malboobi et al., 2009) can make 70% of unavailable cell wall stability, photosynthesis, nucleic acid metabolism, phosphorus, readily available for plant absorption (Chen, 2006; respiration metabolisms and hormonal activity are the most Kothamasi et al., 2006). important plant metabolisms in that boron play a major role (Welch, 1995, Marschner, 1995). Present study was conducted to explore the effect of simultaneous application of boron, manganese and phosphorus As good as boron, manganese is another necessary important solubilizing bacteria on the nutritional composition and plant element for the growth and developments of most crop plants growth and development of alfalfa crop in Iran environmental (Zhengguo et al., 2009) and its deficiency retarded the crop condition. production in many areas of the world (Eleyan et al., 2014). It is well reported that manganese played a key roles in 2 Materials and Methods photosynthesis, oxidation-reduction (redox) and metabolism of nitrogen in plants (Sadana et al., 2005; Inal & Gunes, 2008). 2.1 Experimental Site and soil conditions Further, Shenker et al. (2004) reported that an optimal amount of Mn increased growth and chlorophyll content of tomato This experiment was conducted in 2013 at the research farm of plants. The use of manganese sulfate fertilizer improves crop Marv-Dasht in central areas of Fars province, Iran (29° 52' S, production and plant photosynthesis because Mn is an activator 52° 48' N). This site located at 1605 meters above sea level of many enzymes in plant. with average annual rainfall of 320 mm in 2011 and 2012. The maximum and minimum temperatures are 41 and 9 °C, In case of fertilizers, peoples are more concern only about the respectively. Initially, field under cultivation of Alfalfa (First use of nitrogen fertilizers; very few farmers have knowledge year of growing of perennial Alfalfa) were selected for study. about the use of phosphorus fertilizers. Application of Soil samples were collected from the 30 cm depth and phosphorus fertilizer is also essential for crops (Aulakh et al., analyzed for estimation of soil physicochemical properties 2003). Influence of phosphorus fertilization on agronomic according to the methods described by Ryan et al. (2001). The performance of alfalfa has been well documented by various Soil chemical properties are presented in Table 1. The 10 year researchers (James et al., 1995; Li et al., 1998; Malhi et al., average annual precipitation ranged from 115-141 mm and the 2001; Reid et al., 2004). annual average temperature is 25-32oC (Hosseinirad et al., 2013).

Table 1. Chemical and physical properties of the soil at the experimental site.

Depth (cm) Soil texture pH se N (%) P (ppm) K (ppm) B (ppm) Mn ppm) OC % Ec (ms) 0-30 CL* 7.5 0.1 15 257.9 0.67 6.1 0.37 0.96 CL, Clay loam; OC, Organic Matter.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Response of alfalfa forage to phosphorus, boron and manganese based fertilizing systems 400 2.2 Experimental design 2.4 Statistical analysis

The treatments were Phosphate solubilizing bacteria (PSB), The achieved data in experiment subjected to the analysis of boron (Borax and Boric acid) and manganese (manganese variance method using SAS (version 9.1.3, 2004) software the chelate and manganese sulfate). Experiment was laid in a split means were compared based on Duncan multiple test at 5% plot factorial in the form of randomized complete block design level. that phosphorus bio-fertilizer rates (0 and 100 g.ha-1) in main plots and boron (0, Borax foliar application of 1.0 lit.ha-1 and 3 Results and Discussion Boric acid soil application 10 kg. ha-1) and manganese fertilizer (0, manganese chelate foliar application 1.0 lit.ha-1 and 3.1 Forage yield manganese sulfate soil application 10 kg. ha-1) were in sub plots. Alfalfa forage yield was significantly influenced by the application of PSB, B and Mn fertilizers either individually or Phosphorus bio-fertilizer treatments was a combination of in combination. Results of individual application are phosphorus solubilizing bacteria Pantoea agglomerans strains represented in table 2. Results of study suggested that forage P5 and Pseudomonas putida strain P13 included 1*109 CFU yield improved by adding B, Mn and Phosphorus solubilizing bacteria per 100 grams bio-fertilizer that registered as Barvar bacteria (PSB) especially when Mn was applied. At individual II®. For PSB treatments, 100 g.ha-1 PSB was mixed in 400 application, highest yield was obtained by using B as foliar liters of irrigation water and applied manually in soil as application (20.01 t.ha-1) and soil application B. While the fertigation. Boric acid and manganese chelate were foliar lowest one was related to treatments without any fertilizer application at 2 weeks after each cut stage and Borax and (10.40 t.ha-1) and highest yield giving treatment represents manganese sulfate were applied in soil after the first cut of 119.58 % increase in forage yield. Boron fertilizer applying in alfalfa manually in spring. both forms (soil/foliar), made an increase in forage yield (Table 3). Like B, application of PSB also improved plant The Alfalfa cultivar used in this study was Medicago sativa L. growth and it is not significantly differ that the foliar cv. Ranger. Total Eighteen plots were imposed in each blocks application of boron (Table 3). Also, result showed that the and a net plot area was 15 m2 (3.0m in 5.0m). The irrigation interaction of PSB1.BI (22.43 t.ha-1) and B1.Mn1 (21.61 t.ha- method was conducted by using classic sprinkler irrigation. 1) were suitable for producing higher forage yield and it shows superiority over the individual application but are not 2.3 Sampling and measurements significantly different.

Plants were harvested when 10% of fields crop have flowering. Using boron whether foliar or soil application without using of To avoid the marginal effect, the middle rows of each plot PSB didn’t show notable effect on forage yield increasing but were randomly harvested. Samples were cut 4.5 cm above the simultaneous application of boron and PSB resulted 110.06% soil surface. After harvesting, the samples were dried in in production increasing. In interaction, combined application electrical oven (72 hours at 40°C) and then weighted for forage of PSB1X B1 X Mn1 shows superiority (34 t.ha-1) over the yield. Samples were sent to the laboratory for determination of individual or combined application of any two fertilizers nitrogen and protein content by method described by Nelson & (Table 4), and also this treatment increased forage (103.31%) Sommers (1973). Lateral branches of plants were counted production in comparison to sample. manually for each plot.

Table 2 Means comparison of PSB. B and Mn on studied traits in alfalfa.

SOV Df Forage Lateral Nitrogen Nitrogen Protein Protein yield branches of stem of leaf of stem of leaf R 2 0.035 25020 0.035 0.019 1.394 0.744 PSB 1 7.826** 4417237** 6.892** 9.902** 269.219** 386.826** Error(PSB) 2 0.021 1114 0.005 0.001 1.107 1.055 B 2 15.354** 6989712** 7.265** 36.409** 283.818** 1422.248** B.PSB 2 0.79** 163136** 0.813** 0.748** 31.781** 29.253** Mn 2 1.358** 902826** 1.111** 1.11** 43.425** 43.386** Mn.PSB 2 0.008ns 29007* 0.001ns 0.022ns 0.048ns 0.892ns B.Mn 4 0.083** 11138ns 0.091** 0.026ns 3.584** 1.037ns B.Mn.SB 4 0.039* 24659* 0.056* 0.054* 2.05* 1.88* Error 32 0.013 9068 0.018 0.017 0.735 0.667 C.V. 3.46 7.68 5.37 3.67 5.37 3.67 *,**Significant at P=0.05 and P=0.01 levels, respectively. ns: Not Significant. CV: Coefficient Variation

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

401 Maryam et al

Table 3 Means comparison of PSB. B and Mn for treats of alfalfa

treatments Forage Lateral Nitrogen Nitrogen Protein Protein Yield Branches of stem of leaf of stem of leaf t.ha-1 # ha-1 % % % % PSB0 14.73 b 954.73 b 2.19 b 3.13 b 13.73 b 19.57 b PSB1 18.54 a 1526.7 a 2.91 a 3.98 a 18.19 a 24.92 a B0 11.37 c 530.86 c 1.84 b 1.92 b 11.51 c 12.03 b B1 20.01 a 1697.53 a 3.06 a 4.50 a 19.14 a 28.18 a B2 18.53 b 1493.83 b 2.75 ab 4.24 a 17.24 ab 26.53 ab Mn0 15.19 b 1008.64 c 2.29 a 3.29 a 14.32 b 20.61 b Mn1 17.93 a 1455.55 a 2.78 a 3.79 a 17.41 a 23.70 a Mn2 16.76 ab 1258.02 ab 2.58 a 3.58 a 16.15 a 22.42 ab PSB0 B0 10.68d 353.09 f 1.73f 1.73 d 10.81 f 10.83 d PSB0 B1 17.59b 1340.74 c 2.57c 3.96 b 16.07 c 24.74 b PSB0 B2 15.94c 1170.37 d 2.29d 3.71b 14.31 d 23.16 c PSB1 B0 12.07d 708.64 e 1.95e 2.12 c 12.21 e 13.24 d PSB1 B1 22.43 a 2054.32 a 3.55 a 5.06 a 22.21 a 31.63 a PSB1 B2 21.12 a 1817.28 b 3.22 b 4.79 ab 20.17 b 29.91 a PSB0 Mn0 13.33 e 767.90 d 1.94 f 2.90 e 12.15 f 18.16 d PSB0 Mn1 16.11 c 1155.56 c 2.42 d 3.36 cd 15.14 d 21.02 c PSB0 Mn2 14.76 d 940.74 d 2.22 e 3.12 d 13.90 e 19.52 d PSB1 Mn0 17.06 bc 1249.38 c 2.64 c 3.69 c 16.50 c 23.06 b PSB1 Mn1 19.75 a 1755.56 a 3.15 a 4.22 a 19.68 a 26.39 a PSB1 Mn2 18.81 b 1575.31 b 2.94 b 4.05 b 18.40 b 25.31 a B0 Mn0 10.63 e 314.81 f 1.68 f 1.73 e 10.51 f 10.81 e B0 Mn1 12.28 d 759.26 e 1.97 e 2.15 d 12.34 e 13.45 d B0 Mn2 11.22 e 518.52 e 1.87 e 1.89 e 11.68 e 11.81 de B1 Mn0 17.91 c 1414.81 c 2.65 cd 4.18 bc 16.56 cd 26.13 b B1 Mn1 21.61 a 1925.93 a 3.41 a 4.78 a 21.28 a 29.89 a B1 Mn2 20.52 a 1751.85 b 3.13 b 4.56 a 19.58 b 28.52 a B2 Mn0 17.06 c 1296.30 d 2.55 d 3.98 c 15.91 d 24.89 c B2 Mn1 19.91 b 1681.48 b 2.98 b 4.44 b 18.62 b 27.76 b B2 Mn2 18.63 b 1503.70 c 2.75 c 4.30 b 17.19 c 26.93 b Means in same columns followed by the same letter were not significantly different at the 5% level; PSBO (Treatment without P biofertilizer); B0 (Treatment without Borax); Mn0 (Treatment without Mn); B1 (Foliar application of 1 lit/ha borax); B2 (Soil application of 10 kg/ha boric acid); Mn1 (Foliar application of Mn @ 1 lit/ha); Mn2 (Soil application of manganese sulfate @10 kg. ha).

These result were coincide with findings of Turan et al. (2010), 592.96 branches ha-1) showing more 300 % increase in the who clarified that the highest yield of Alfalfa was obtained by number of lateral branches (Table 4). PSB and B rate using boron fertilizers. Similarly, Ahmed et al. (2010) reported significantly affected the Number of lateral branches that usage of bio-fertilizers which contains Azotobacter and (P<0.001). The best treatment in PSB and B interaction was Pseudomonas significantly have raised production of sorghum. recorded from PSB1B1 (Table 3). The Number of lateral Further, Kohno et al. (2008) reported a meaningfully increased branches in this interaction showing a colossal 481.81% in bean yield by using of manganese fertilizers. increase compared to PSB0X B0 (Table 3). Also, PSB and Mn interaction effects was significantly affected the Number of 3.2 Number of lateral branches lateral branches (P<0.05). The best treatment in PSB and Mn interaction was recorded from PSB1Mn1, so this treatment was Alfalfa lateral branches per hectare are an effective agent in caused 128.61% increase compared to P0Mn0 (Table 3). It can Alfalfa forage yield enhancing. It was significantly (P<0.05) be concluded that PSB can increase the availability of influenced by three factors as well as interactions (table 2). The phosphorus for producing high number lateral branches per highest number of lateral branches was obtained from triple hectare. The treatments containing PSB evidently performed interaction of B (Foliar), Mn (Foliar) and PSB by 2340.74 better than the treatment without PSB application. branches ha-1 while the lowest one was obtained in control by

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Response of alfalfa forage to phosphorus, boron and manganese based fertilizing systems 402 Application of phosphorus often caused re-growing of shoot increase in the N of stem and leaf, respectively (Table 4). At parts of Alfalfa in absence drought stress condition (Jiang et individual application, B is showing superiority over the other al., 2009). The results identified that deficiency of boron in treatments while in combination of two, combined application some plants such as Alfalfa, Red Clover, Turnip and some of PSB and B is superior to all other treatments (Table 3). Dual varieties of Cabbage will cause to reduction of production interaction of B. PSB, the best result of leaf nitrogen content because they need higher amount of this element (Tariq & was pertained to B1.PSB1 (Table 3). Furthermore, interaction Mott, 2007; Sherrell & Toxopeus, 2012). Further, Reinbott & of B X PSB and B X Mn on nitrogen content in alfalfa stems Blevins (2008) reported that application of boron and were significant (Table 2), also, the interaction between boron manganese increased number of branches in soybean crops and phosphorous increased 105.4% nitrogen content in stem which as a result made increasing in yield and yield component rather than treatment B0PSB0 (Table 3). Some studies have in this plant. recognized a positive correlation between nitrogen accumulation and utilization of phosphorous fertilizer (Waluyo 3.3 Nitrogen content in stem and leaf et al., 2004; Turan et al., 2010). Therefore phosphorous not only have important role on forage production but also Nitrogen is quantitatively most important nutrient that plants increased production with intensification of absorbing some obtain from soil. Well-managed Alfalfa crop effectively absorb elements such as nitrogen. Wicz (2000) studied 38 cultivars of mineralized N from fertilizer and remove residual nitrate from Alfalfa and identified that more appropriate soil fertility and the subsoil, irrigation water, and fix less N from the air. The nitrogen concentration in plant tissues have led to better value of legumes nitrogen fixing for improving production and protein digestion and absorption by livestock. higher yield can be achieved to balance soil elements by the application of bio-fertilizers (Kannaiyan, 2002). When two or 3.4 Protein content in stem and leaf more elements have a positive interaction with each other, synergistic effects occur. In this experiment, the synergistic Measurement of protein content as qualitative parameters in relationship between the elements boron, manganese and alfalfa forage is one of the most important ways to survey phosphorus has been created so that these elements have been Alfalfa standards forage quality. Protein content can estimated increased nitrogen uptake by Alfalfa. Triple interaction of B, through multiplying the nitrogen content by a coefficient Mn and PSB had significant effect (P<0.05) on nitrogen conversion (Mariotti et al., 2008). Moreover, Protein content content in both stem (3.94%) and leaf (5.37%) tissues while was directly correlated to the dry matter accumulation the minimum was gained from control (without any fertilizer) (Lemaire et al., 1994). (1.5% and 1.54%) showing a colossal 162.97 % and 248.62%

Table 4. Interaction effect of PSB. B. Mn for treats of alfalfa.

Treatment Forage Lateral Nitrogen Nitrogen Protein Protein Yield Branches of stem of leaf of stem of leaf t.ha-1 # ha-1 % % % % PSB0 B0 Mn0 20.40 f 162.96 g 1.50 g 1.54 g 9.38 h 9.63 h PSB0 B0 Mn1 21.55 e 629.63 e 1.93 ef 2.02 f 12.07 g 12.62 g PSB0 B0 Mn2 20.07 f 266.67 f 1.758 f 1.64 g 10.98 h 10.22 h PSB0 B1 Mn0 25.37 d 1125.93 d 2.22 de 3.67 de 13.88 e 22.91 de PSB0 B1 Mn1 29.22 c 1511.11 bc 2.86 c 4.19 c 17.89 c 26.21 c PSB0 B1 Mn2 28.18 c 1385.19 c 2.63 d 4.01 cd 16.45 cd 25.09 cd PSB0 B2 Mn0 24.22 d 1014.82 d 2.11 e 3.51 e 13.20 f 21.95 e PSB0 B2 Mn1 27.56 c 1325.93 c 2.47 d 3.88 d 15.47 d 24.25 d PSB0 B2 Mn2 26.04 d 1170.37 d 2.28 de 3.72 d 14.27 e 23.27 d PSB1 B0 Mn0 20.85 f 466.67 f 1.86 f 1.92 g 11.64 g 12.00 g PSB1 B0 Mn1 23.00 e 888.89 e 2.02 e 2.28 f 12.62 f 14.29 f PSB1 B0 Mn2 22.37 e 770.37 e 1.98 e 2.15 f 12.38 fg 13.41 f PSB1 B1 Mn0 30.44 b 1703.7 b 3.08 bc 4.69 b 19.24 bc 29.36 b PSB1 B1 Mn1 34.00 a 2340.74 a 3.95 a 5.37 a 24.68 a 33.58 a PSB1 B1 Mn2 32.85 a 2118.52 a 3.63 a 5.11 a 22.72 a 31.95 a PSB1 B2 Mn0 29.89 bc 1577.78 b 2.98 c 4.45 bc 18.63 c 27.84 c PSB1 B2 Mn1 32.26 a 2037.04 a 3.48 b 5.01 ab 21.77 b 31.29 a PSB1 B2 Mn2 31.22 b 1837.04 b 3.22 b 4.89 b 20.12 b 30.59 b Means in same columns followed by the same letter were not significantly different at the 5% level; PSBO (Treatment without P biofertilizer); B0 (Treatment without Borax); Mn0 (Treatment without Mn); B1 (Foliar application of 1 lit/ha borax); B2 (Soil application of 10 kg/ha boric acid); Mn1 (Foliar application of Mn @ 1 lit/ha); Mn2 (Soil application of manganese sulfate @10 kg. ha).

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

403 Maryam et al

Interaction effects of B, Mn and PSB had signification effect Conflict of interest on stem and leaf protein contents (P<0.05). Results revealed that factors which had significant differences in term of Authors would hereby like to declare that there is no conflict of nitrogen content in leaf and stem were also had significant interests that could possibly arise. differences in term of leaf and stem protein this is the endorsement of the validity of this study which indicated Reference coronation between amount of plant protein and amount of nitrogen in plant tissues. Ahmed AG, Orabi S, Gomaa AM(2010) Bio-organic farming of grain sorghum and its effect on growth, physiological and The highest protein content of stem (24.67%) and leaf yield parameters and antioxidant enzymes activity. Research (33.58%) was recorded from B (Foliar), Mn (Foliar) and PSB Journal of Agriculture and Biological sciences 6:270-279. combination (Table 4) while the lowest one are 9.38% and 9.63% was gained from control showing a colossal 162.95% Aulakh MS, Pasricha NS, Bahl GS (2003) Phosphorus and 248.6% increase in protein content of stem and leaf, fertilizer response in an irrigated soybean-wheat production respectively (Table 4). The highest protein content in alfalfa system on a subtropical, semiarid soil. Field Crops Research leaf was obtained by B and PSB interaction was concerned to 80: 99–109. doi:10.1016/S0378-4290(02)00172-7. B1PSB1 treatment (31.63%). Chen J (2006) The combined use of chemical and organic Results of current study revealed B1PSB1 raised 199.22% of fertilizers and/or bio fertilizer for crop growth and soil fertility. leaf protein in comparison to B0PSB0 significantly. Interaction International Workshop on Sustained Management of the Soil- of B X PSB and BX Mn also had significant effect on protein Rhizosphere System for Efficient Crop Production and content of alfalfa stem tissues. The highest stem protein was Fertilizer Use 16-20 October, 2006 Thailand. recorded in B and PSB interaction treatment in B1PSB1 level about 22.21% by means of increased 105.4% rather than Dear BS, Wiear RG (2004) Boron deficiency in pastures and B0PSB0 (Table 3). Furthermore, The highest interaction field crops. NSW Agriculture Available on between B and Mn was obtained from B1Mn1 treatment by http://www.agric.nsw.gov.au access on 25th December, 2015. 22.28% and 102.47% growth in stem protein content in comparison to B0Mn0(Table 3). Eleyan SED, Abodahab AA, Abdallah AM, Rabeh HA (2014) Effect of foliar application of manganese and iron on growth Since no information was available about reaction of alfalfa characters, yield and fiber properties of some Egyptian cotton ranger cultivar to studied fertilizers. cultivars (Gossypium barbadense L.). International Journal of Agriculture and Crop Sciences 7: 1283-1292. Results of study recognized the amount fertilizers include boron, manganese and phosphorus solubilizing bacteria which Hosseinirad A, Chaichi MR, Sadeghpour A (2013) Response studied in this research was appropriate because not only the of alfalfa seed yield and yield components to phosphorus studied treatments didn’t show any sign of toxic effects or fertilizing systems and seeding rate at semi-saline soil nutrient deficiency but also they caused notable increasing in conditions. Journal of Plant Nutrition 36:491-502. alfalfa production and other related characteristics. Also foliar DOI:10.1080/01904167.2012.748070. application of boron and manganese was detected as a better method rather than soil application. It was decided that Inal A, Gunes A (2008) Interspecific root interactions and micronutrients elements to be used with foliar application and rhizosphere effects on salt ions and nutrient uptake soil application and explore the effect of these fertilizers on the between mixed grown peanut/maize and peanut/barley in various growth and growth attributes with minimum toxicity. original saline-boron toxic soil. Journal of Plant Physiology 165: 490-503. doi:10.1016/j.jplph.2007.01.016. Conclusion James WF, Barko JW, Eakin HL (1995) Internal phosphorus Foliar application of boron, manganese and soil application of loading in Lake Pepin, Upper Mississippi River. Journal of phosphorus solubilizing bacteria simultaneously, could be Freshwater Ecology 10:269-276. improved alfalfa forage yield significantly and substantially. DOI:10.1080/02705060.1995.9663446. These elements not only individually improved forage production quality and quantity but also interaction of these Jana B (2007) Distribution pattern and role of phosphate three showed superiority advanced in alfalfa forage yield. As solubilizing bacteria in the enhancement of fertilizer value of an important outcome utilization of mentioned fertilizer rock phosphate in aquaculture ponds: state-of-the-art. In: management system is recommended for fill the gap between Velázquez E, Rodríguez-Barrueco C (Eds.) First International the alfalfa potential yield and average alfalfa forage production Meeting on Microbial Phosphate Solubilization, Development in the same condition. in Plant and Soil Sciences 102:229-238. DOI: 10.1007/978-1- 4020-5765-6_34

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Response of alfalfa forage to phosphorus, boron and manganese based fertilizing systems 404 Jiang HX, Shen YX, Zhai GY, Liu XB, Yuan PX (2009) Nahas E (2007) Phosphate solubilizing microorganisms: effect Effects of phosphate fertilizer on utilization of non-structural of carbon, nitrogen, and phosphorus sources. In: Velázquez E, carbohydrate in residual tissue of medicago sativa during early Rodríguez-Barrueco C (Eds.) First International Meeting on regrowth stage. Journal of Acta Pratacultural Science 18: 136- Microbial Phosphate Solubilization, Developments in Plant 141. and Soil Sciences 102:111-115. DOI: 10.1007/978-1-4020- 5765-6_15. Kannaiyan S (2002) Biofertilizers for sustainable crop production. Biotechnology of biofertilizers. Narosa Publishing Nelson DW, Sommers LE (1973) Determination of total House, New Delhi, India. nitrogen in plant material. Agronomy Journal 65: 109-112. doi:10.2134/agronj1973.00021962006500010033x Kohno Y, Foy CD, Fleming AL, Krizek DT (2008) Effect of manganese on concentrations of Zn, K, Ca and Mg in two bush Reid CR, Winward DL, Koenig RT (2004) A comparison of bean cultivars grown in solution culture. Journal of Plant liquid phosphoric acid and dry phosphorus fertilizer sources Nutrition 7:897-909. DOI:10.1080/01904168409363253. for irrigated alfalfa production on calcareous soils. Journal of Communication Soil Science and Plant Analysis 35:39-50. Kothamasi D, Kothamasi S, Bhattacharyya A, Kuhad RC, DOI:10.1081/CSS-120027633. Babu CR (2006) Arbuscular mycorrhizae and phosphate solubilising bacteria of the rhizosphere of the mangrove Reinbott TM, Blevins DG (2008) Response of soybean to ecosystem of Great Nicobar Island, India. Biology and Fertility foliar-applied boron and magnesium and soil-applied boron. of Soils 42:358-361. DOI: 10.1007/s00374-005-0035-8 Journal of Plant Nutrition 18: 179-200.

Lemaire G (1994) Growth dynamics and digestibility for two Rodriguez H, Fraga R (1999) Phosphate solubilizing bacteria genotypes of Lucerne have different morphology. Management and their role in plant growth promotion. Journal of and breeding of perennial Lucerne for diversified purposes, Biotechnology Advances 17: 319-339. doi:10.1016/S0734- Italy, Roma. 9750(99)00014-2.

Li R, Volence JJ, Joern BC, Cunningham SM (1998) Effect of Ryan J, Estefan G, Rashid A (2001) Soil and Plant Analysis phosphorus nutrition on carbohydrate and protein metabolism Laboratory Manual. Jointly Published by the International in alfalfa roots. Journal of Plant Nutrition 21: 459-474. Centre of Agriculture and Research in Dry Areas (ICARDA), Aleppo, Syria and National Agriculture Research Centre Malboobi MA, Owlia P, Behbahani M, Sarokhani E, Moradi S, (NARC), Islamabad. Yakhchali B, Delju A, Morrabi Heravi K (2009) Solubilization of organic and inorganic phosphates by three highly efficient Sadana US, Sharma P, Ortiz NC, Samal D, Claassen N (2005) soil bacterial isolates. World Journal of Microbiology and Manganese uptake and Mn efficiency of wheat cultivars are Biotechnology 25:1471-1477. DOI: 10.1007/s11274-009- related to Mn-uptake kinetics and root growth. Journal of Plant 0037-z. Nutrition and Soil Science 168: 581-589. DOI: 10.1002/jpln.200420491. Malhi SS, Zentner RP, Heier K (2001) Banding increases effectiveness of fertilizer P for alfalfa production. Nutrient Shenker M, Plessner OE, Tel-Or E (2004) Manganese nutrition Cycling Agro-ecosystems 59:1-11. effects on tomato growth, chlorophyll concentration, and superoxide dismutase activity. Journal of Plant Physiology Mardad I, Serrano A, Soukri A (2013) Solubilization of 161: 197-202. doi:10.1078/0176-1617-00931. inorganic phosphate and production of organic acids by bacteria isolated from a Moroccan mineral phosphate deposit. Sherrell CG, Toxopeus MRJ (2012) Effects of boron African Journal of Microbiology Research 7: 626-635. applications on yield and boron concentration of Lucerne (Medicago sativa L.) grown on yellow-brown pumice soils. Mariotti F, Tome D, Patureau MP (2008) Converting nitrogen New Zealand Journal of Experimental Agriculture 6:145-150. into protein-beyond 6.25 and jones’factors. Journal of Food Science and Nutrition 48: 177-184. Singh KK, Srinivasarao C, Masood A (2005) Root growth, nodulation, grain yield, and phosphorus use efficiency of lentil Marschner H (1995) Mineral nutrition of higher plants. as influenced by phosphorus, irrigation, and inoculation. Academic Press, San Diego, California, USA. Journal of Communications in Soil Science and Plant Analysis 36: 1919-1929. Mohammadi K, Sohrabi Y (2012) Bacterial bio fertilizers for sustainable crop production: a review. Research Journal of Soon YK (1990) Solubility and retention of phosphate in soils Agriculture and Biological Sciences 7: 307-316. of north western Canada prairie. Canadian Journal of Soil Science 70: 227 - 237.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

405 Maryam et al

Sweeney DW, Moyer JL, Jardian DJ, Whitney DA (2011) Waluyo SH, Lie T, Mannetje L (2004) Effect of phosphate on Nitrogen, phosphorus, and potassium effects on grain sorghum nodule primordial of soybean (Glycine Max Merrill) in acid production and stalk rot following alfalfa and birdsfoot trefoil. soils in Rhizotron experiments. Indonesian Journal of Journal of Plant Nutrition 34:1330-1340. Agricultural Science 5: 37-44.

Tariq M, Mott CJB (2007) The significance of boron in plant Welch RM (1995) Micronutrient nutrition of plants. Critical nutrition and environment –A Review. Journal of Agronomy 6: Reviews in Plant Sciences 14: 49-82. 1-10. DOI: 10.3923/ja.2007.1.10. Wicz A (2000) Rumen degradability of crud protein of dried Thomazi MD, Mello FAF, Arzolla S, Mello FA (1990) grass and Lucerne forage measured by in Sacco incubation and Phosphate fixation in soils of the Piracicaba Municipality. predicted by near infrared reflectance spectroscopy. Journal of Journal of Revista de Agricultura 65: 45 - 53. Animal Feed Science and Technology 54: 581- 597.

Turan M, Ketterings QM, Gunes A, Ataoglu N, Esringu A, Zhengguo Z, Longium X, Jinlian X, Chenglun L (2009) Effect Bilgili AV (2010) Boron fertilization of Mediterranean of manganese tailing on capsicum growth. Chinese Journal of aridisols improves lucerne (Medicago Sativa L.) yields and Geochemistry 28: 427-431 quality. Journal of Soil and Plant Science 60: 427-436.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Journal of Experimental Biology and Agricultural Sciences, June - 2016; Volume – 4(IV)

Journal of Experimental Biology and Agricultural Sciences

http://www.jebas.org

ISSN No. 2320 – 8694

EFFECT OF THE INTERACTIONS BETWEEN MOISTURE CONTENT, SEED STORAGE TIME AND USE OF PESTICIDES ON SEED GERMINATION, VIABILITY AND VIABILITY INDICATORS OF WHEAT CROP

Mohammad Ali JAHANBIN, Hasan Hüseyin GEÇİT and Saime ÜNVER İKİNCİKARAKAYA

Department of Agronomy and Plant breeding Ankara of University Ankara Turkey

Received – April 20, 2016; Revision – May 25, 2016; Accepted – June 28, 2016 Available Online – June 30, 2016

DOI: http://dx.doi.org/10.18006/2016.4(4).406.413

KEYWORDS ABSTRACT Wheat crop In order to determine the effect of moisture content, storage time and pesticide (fungicide & insecticide) Seed disinfectant application in wheat variety Bezostaja -1, an experiment was conducted in Split-Split plot, randomized complete block design with three replications for two years at Ankara University. The main plots have Storage time three seed moisture levels viz. standard, standard +1.5% and standard + 3 percent at the time of disinfect application. The Split plots (sub plot) have treatments like seed storage time viz: 0, 1, 2 and 14 months Moisture contents and sub- sub plot was pesticide application and types and pesticide level. In this study two pesticides viz. Diaconazole (% 1), Chlorpyrifos - ethyl (% 25 w p) was used either individually or in combination. Growth characteristics Various wheat characters which studied in present study are Coefficient of Velocity of Germination (CVG), Germination Index (GI), Germination Rate Index (GRI), Coleoptile length, Root length, Fresh weight and Dry weight. Result of study revealed that interactions between pesticides, seed storage and seed moisture content have significant effect (1%) on the various studied growth characteristics such as CVG, GI, GRI, Shoot length, root length, fresh weight and dry weight. Further, it was reported that the traits such as seed germination percentage, germination index, fresh weight and root length have very higher efficiency in the maintenance of seed for one to two months at the application of anti-fungal toxins with 9.5 % moisture Content. While minimum storage efficiency was reported when combination of pesticides (fungicide + insecticide) were applied at 12.5% moisture.

All the article published by Journal of Experimental * Corresponding author Biology and Agricultural Sciences is licensed under a E-mail: [email protected] (Mohammad Ali JAHANBIN) Creative Commons Attribution-NonCommercial 4.0 International License Based on a work at www.jebas.org. Peer review under responsibility of Journal of Experimental Biology and Agricultural Sciences.

Production and Hosting by Horizon Publisher India [HPI] (http://www.horizonpublisherindia.in/ ). All ______rights reserved. Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

407 JAHANBIN et al

1 Introduction in Ankara Turkey. Seeds of Bezostaja-1 bread wheat variety were used for this study. Two chemical materials viz fungicide Wheat is one of the most important cereal crops in the world, and insecticide included Diaconazol (1%) and Chlorpyrifos - together with rice and maize; it provides more than 60% of the ethyl (25% WP) were collected from local vendor and used calories and proteins of human nutrition (Nord et al., 2009). either individually or in combination. Study was conducted by From last few decades despite of increasing crop yield split- split plot method in a randomized complete block design intensive agricultural and monoculture systems adversely with three replications. Three level of seed moisture content affected its production. Although, use of fertilizers, herbicides, viz. 9.5% (as control), 11 and 12.5% was considered as main pesticides and modified seeds have significant effect on the plot; seed moisture content (11 and 12.5%) was adjusted by crop production but according to world pesticides trade adding water. Storage time (0, 1, 2, 14 month) was considered continues use of stable insecticides and pesticides induced as sub factor (split plot) and pesticide treatment included resistance in the pest or insect and losses resulting from pest without pesticide (control), fungicide alone, insecticide alone damage continuously increases (Gliessman, 2000). Further, and combination of both was considered as sub – sub factor although use of improved seeds and cultural practices can be a (split – split plot). Hundred healthy seeds for each treatment better option of pesticides but farmers still rely on the use of were selected manually by hand picking method. Various pesticides and they continuously increased dose of pesticide growth attributes such as Seed germination, Coefficient of for getting more production this operation not only increase the velocity of germination (CVG), Germination rate (GI), cost of farming but also cause health and environmental Germination rate index (GRI), Coleoptile length, Root length, hazards (Clark & Scott, 1982). This excess use of pesticides plantlet fresh and dry weight was calculated according to also responsible for the loss of biodiversity by destroying soil method given by Sharafizad et al.(2013). In order to measured micro-organisms and other organisms, sometime these detail (CVG, GI, and GRI):CVG is characterized by speed and pesticides reached to the ground water and also contaminate acceleration of germination and calculated from the following (Lu & Terry, 1995). equation (Maguire, 1962).

Among various factors which influencing crop productivity, CVG= G1+G2+G3+…Gn / (1× G1) + (2×G2) + (3× G3) +… seed quality and seed moisture contents are most important (N × Gn) one. According to Dupriez & De Leener (1989) best quality seed have high germination capacity and resultant seedlings Whereas G1-Gn: the number of germinations since the first are vigor than the poor quality seeds. Seed quality is a day until the last day. condition under which mother plants were raised such as moisture and temperature regimes during fruit maturation, and Germination Index (GI) and germination rate index (GRI) was fertilizer application (Chowdhury, 1999). Farmers and crop calculated by the equation given by Throneberry & Smith producer used seed treatment for increasing the seed quality (1955), for this following formula was used. along with yield and to reduce the transmission of pathogens (Khanzada et al., 2002). The purpose of these seed treatments GI = (n× N1) + (7× N2) + (6× N3) + (5× N4) +…+ (1×Nn) are to control seed-borne pathogens or to protect seeds from soil borne pathogens (Ashley & Martin, 2003(. According to Whereas N= the number of seed germination, n= day end Khanzada et al. (2002) 80-90 percent farmers were used pesticides even after the harvesting seed disinfectant for GRI= G1/1+G2 /2+G3/3+…Gn/n preventing their harvested crop from post harvesting insect and pests )Borgen, 2004). Here Gn = the number of germination seed in n day, n= day end Efficacy of seed treatment depends on various factors such as physiological & physical conditions of the seed, storage All the collected data were analyzed with SPSS version 19.1 conditions, storage time and types of disinfectant used. were grouped according to Duncan test and the relationship Therefore producers should be aware about the types of between characteristics revealed. pesticides used and its active ingredients. Information’s regarding the effect of moisture contents and proper time of 3 Results and Discussion pesticide application in wheat production is in scarcity; therefore present study has been under taken to evaluate the Analysis of interaction between moisture content of seed effect of various moist contents on the pesticide application storage time and pesticide applications suggested a significant and on various germination components of the wheat crops. difference at level 1% for all the studied germination characteristic and component such as percent seed 2 Materials and Methods germination, coefficient of velocity of germination (CVG), germination index (GI), germination rate index (GRI), Present study was conducted in the cropping season of 2013- coleoptiles length, root length, fresh weight and dry weight. 2014 at the agricultural research station of Ankara University

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Effect of the interactions between moisture content, seed storage time and use of pesticides on seed germination,… 408 Further, in case of trilateral interaction between seed storage fungicide with a two-month storage period and 9.5% seed time, seed moisture content and application of pesticides moisture while the lowest germination percent (75.33%) was (fungicides and insecticides) most of the studied trait was reported in the combined application of pesticides and reported significant at 1% while some traits such as GI, GRI, herbicide along with one month storage at 12.5% moisture and coleoptile length was reported significant at 5%. (Table 2). In general, germination percentage reduced with the increasing storage time and reducing moisture. Govender et al. 3.1 Effect of interaction on seed germination (2007) reported that corn seed kept in storage for one year under natural conditions can reduce seed germination and this In seed Germination characteristics, highest germination reduction in germination may be because of the infection of percentage (99%) was reported from the treatment containing pathogenic fungi under storage condition.

Table 1 Analysis of variance study between various interaction such as seed moisture, storage time and pesticide application.

Components of germination Source df PSG CVG GI GRI Coleoptil Root Fresh Dry e Length length Weight Weight L 2 4.04 2. 06 1.93 2.14 2.06 0.44 0.09 0.66 Seed moisture 2 17.57* 7.33 20.94** 21.81** 23.29** 4.17 5.28 0.12 Error 4 Storage time 3 18.81** 5.76** 20.14** 22.02** 12.01** 4.75 * 45.75** 14.22 ** Seed moisture 6 7.77** 7.55** 3.53 * 4.81** 1.48 5.32 ** 24.09** 3.64** × Storage time Error 18 Pesticide 3 10.99** 18.31** 3.64* 4.18** 183.24** 24.56** 3.89 * 6.91** Seed moisture 6 4.83** 5.21** 2.63* 2.57* 3.00 * 1.89 1.04 2.07 × pesticide Storage time 9 3.93** 6.77** 1.50 1.89 5.38 ** 5.67 ** 1.47 1.64 × pesticide Seed moisture 18 7.53** 8.34 ** 3.77** 4.08** 1.98 * 2.31** 2.88** 2.28** × Storage time × pesticide Error 72 Coefficient of 2.49 0.31 1.83 1.95 10.96 11.47 7.08 7.07 Variation % ** Values are significant probability; here CVG (Coefficient of velocity of germination); GI (germination index); GRI (germination rate index); FGP (Final germination percent), RL (root length), FWS (fresh weight seedling), DWS (dry weight seedling) and PSG (Percent seed germination).

Table 2 Effect of pesticide, storage time and moisture content interaction on seed germination.

Treatments Percentage 0 Month 1 Month Storage 2 Months Storage 14 months Germination (No Storage ) storage Free from pesticides 12.5 % Moisture 98.67 98.67 96.67 94.67 11% Moisture 97.00 97.00 98.00 93.33 9.5% Moisture 97.00 97.00 96.00 96.00 Only Pesticides 12.5 % Moisture 98.67 95.00 97.00 96.00 11% Moisture 95.33 97.67 96.00 91.33 9.5% Moisture 98.00 96.00 99.00 96.00 Only Herbicide 12.5 % Moisture 96.67 97.67 95.00 89.67 11% Moisture 94.67 94.00 97.67 92.00 9.5% Moisture 96.00 98.67 97.00 94.33 Herbicide + Pesticide 12.5 % Moisture 97.67 75.33 97.33 92.33 in combination 11% Moisture 97.00 97.67 95.33 88.33 9.5% Moisture 96.67 98.00 96.00 94.33

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

409 JAHANBIN et al Table 3 Effect of pesticide, storage time and moisture content interaction on Coefficient of velocity of germination .

Treatments Percentage 0 Month 1 Month 2 Months 14 months Germination (No Storage ) Storage Storage storage Free from pesticides 12.5 % Moisture 25.01 25.00 25.09 25.01 11% Moisture 25.00 25.05 25.01 25.14 9.5% Moisture 25.04 25.03 25.02 25.01 Only Pesticides 12.5 % Moisture 25.01 25.05 25.08 25.03 11% Moisture 25.10 25.03 25.04 25.16 9.5% Moisture 25.04 25.03 25.00 25.02 Only Herbicide 12.5 % Moisture 25.03 25.03 25.13 25.24 11% Moisture 25.09 25.05 25.03 25.12 9.5% Moisture 25.04 25.03 25.05 25.03 Herbicide + Pesticide in 12.5 % Moisture 25.04 25.87 25.05 25.16 combination 11% Moisture 25.08 25.07 25.03 25.34 9.5% Moisture 25.07 25.05 25.09 25.08

3. 2 Effect of interaction on coefficient of germination velocity coefficient. Further, Zare & Tavili, (2000) compared the seed priming with different levels of salicylic acid and reported a Coefficient of Germination Velocity was calculated by the significant effect of these two on coefficient of seed formula proposed by Maguire (1962), among various tested germination, these observation favor the findings of this study. highest coefficient of germination velocity was 25.87 and it was reported in the treatment containing combination 3.3 Effect of interaction ongermination index pesticides at 12.5% moisture on the one month storage time. This coefficient was immediately (25.34) followed by the At Germination index trait, the highest index value of 1986 combination of pesticides and herbicide along with 11 percent was reported in the seeds treated with fungicide after one moisture and 14 months storage period. No significant month storage and at 9.5 percent moisture contents while differences was reported among various treatments and this lowest germination index (1755) was reported in the seed thing indicated that storage time and moisture was not treated by pesticides with 12.5 percent moisture content and adversely affected the coefficient of germination, although one month storage (Table 4). With increasing storage time and some reduction was reported with storage time and reducing decreasing moisture content germination index were found moisture,it seems that the effect of pesticides on short storage reduced. Study conducted by Clark & Scott (1982) suggested times would be increased CVG (Table 3). Results are in that seed disinfection by pesticides affect germination index. agreement with the findings of Sharafizan et al. (2013) those Similar type of findings was reported by Randhawa et al. have reported a significant effect of seed priming and drought (1985). condition and interaction between these two on germination

Table 4 Effect of pesticide, storage time and moisture content interaction on Germination index.

Treatments Percentage Germination 0 Month 1 Month 2 Months 14 months (No Storage) Storage Storage storage Free from pesticides 12.5 % Moisture 1977a 1973a 1961 ab 1897 d 11% Moisture 1940 b 1956b 1964 ab 1911cd 9.5% Moisture 1907 cd 1948 b 1928 bc 1924c Only Pesticides 12.5 % Moisture 1977a 1916 c 1964 ab 1928 bc 11% Moisture 1939 b 1961 ab 1932 bc 1875de 9.5% Moisture 1972a 1928 bc 1980a 1922c Only Herbicide 12.5 % Moisture 1941 b 1961 ab 1940 b 1865e 11% Moisture 1918c 1896d 1961ab 1876 de 9.5% Moisture 1932bc 1981a 1956ab 1895 d Herbicide + Pesticide in 12.5 % Moisture 1962 ab 1755f 1963ab 1888 d combination 11% Moisture 1944 b 1915 c 1969ab 1871 de 9.5% Moisture 1895d 1976a 1948 b 1907 cd Value without common letter is showing statistically significant difference

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Effect of the interactions between moisture content, seed storage time and use of pesticides on seed germination,… 410 Table 5 Effect of pesticide, storage time and moisture content interaction on Germination rate index.

Treatments Percentage 0 Month 1 Month 2 Months 14 months Germination (No Storage ) Storage Storage storage Free from pesticides 12.5 % Moisture 1.030a 1.027ab 1.023ab 0.987d 11% Moisture 1.010bc 1.020b 1.023ab 0.993c 9.5% Moisture 1.017b 1.017b 1.003bc 1.003bc Only Pesticides 12.5 % Moisture 1.030a 0.993c 1.020b 1.003bc 11% Moisture 1.010bc 1.020b 1.007bc 0.973e 9.5% Moisture 1.027ab 1.007bc 1.030a 1.003bc Only Herbicide 12.5 % Moisture 1.010bc 1.023ab 1.010bc 0.967e 11% Moisture 1.000c 0.990c 1.023ab 0.973e 9.5% Moisture 1.007bc 1.033a 1.020b 0.983d Herbicide + Pesticide in 12.5 % Moisture 1.023ab 0.897 1.023ab 0.980d combination 11% Moisture 1.010bc 1.027ab 0.997c 0.970e 9.5% Moisture 1.017b 1.030a 1.013bc 0.990c Value without common letter is showing statistically significant difference

3.4 Effect of interaction on germination rate index In case of Coleoptile length, maximum coleoptile length (5.44 cm) was reported in the seed stored for one month and having Highest rate index (10.03) was reported in the seed stored for 9.5% moisture and having pesticide treatment. Very little one month and treated by fungicide with moisture content difference was reported in all storage time and all three 9.5% while lowest index (0.879) was reported in one month moisture levels. However, the shortest coleoptile length stored seed and treated by fungicide along with pesticide at (1.33cm) was reported from the treatment containing pesticides 12.5 percent moisture (Table 5).Shamsaddin et al. (2007) in combination with 1 month storage time and 12.5% seed reported a significant reduction in GRI as a result of seed moisture content. Further, it can be concluded that the storage; this storage time reduced the ability of holding Coleoptile length was significantly affected by the storage time moisture in Stocked seeds. Further, Gholinejad (2011) and and application of pesticide, combined application of herbicide Tavakolikakhaki & Beheshti (2010) reported that GRI can be and pesticide caused maximum reduction in coleoptiles length reduced when seeds exposed to various stressor substances. (Table 6). Findings of present study are in agreement with the Pesticide is also one of the stressors and it reduced seed's GRI findings of Mandani et al. (2011) those have reported that long in long-term storage conditions. time storage caused a significant reduction in coleoptile length of wheat. They observed shortest coleoptile length after 14 3.5 Effect of interaction on coleoptile length days of storage under pesticide application and the longest length in the control condition to which no pesticide was applied.

Table 6 Effect of pesticide, storage time and moisture content interaction on Coleoptile Length (cm).

Treatments Percentage Germination 0 Month 1 Month 2 Months 14 months (No Storage ) Storage Storage storage Free from pesticides 12.5 % Moisture 5.333a 5.160ab 5.167ab 4.573c 11% Moisture 4.713bc 4.833bc 5.120ab 4.740bc 9.5% Moisture 5.233ab 5.440a 5.067b 4.673bc Only Pesticides 12.5 % Moisture 3.840e 3.907 de 3.820e 3.447ef 11% Moisture 4.187d 3.720e 3.807e 3.827e 9.5% Moisture 3.893de 3.587ef 4.060de 4.147d Only Herbicide 12.5 % Moisture 2.480gh 2.840g 3.213f 3.787e 11% Moisture 3.187f 3.100f 3.507ef 3.653ef 9.5% Moisture 4.087de 3.360f 4.273d 3.907de Herbicide + Pesticide in 12.5 % Moisture 2.367gh 1.333h 2.540gh 3.460ef combination 11% Moisture 2.473gh 2.760g 2.853g 3.273f 9.5% Moisture 3.047f 2.360gh 3.560ef 3.347f Value without common letter is showing statistically significant difference

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

411 JAHANBIN et al

Table 7 The effect of pesticide, storage time and moisture content interaction on root length (cm).

Treatments Percentage 0 Month 1 Month 2 Months 14 months Germination (No Storage ) Storage Storage storage Free from pesticides 12.5 % Moisture 10.73d 9.847de 10.20d 9.320e 11% Moisture 11.08c 10.49d 12.45b 8.800ef 9.5% Moisture 11.37c 11.19c 11.22c 9.567e Only Pesticides 12.5 % Moisture 7.940f 7.953f 8.440ef 9.860de 11% Moisture 8.093f 8.893ef 9.447e 8.240f 9.5% Moisture 10.56d 8.333f 9.013ef 9.893de Only Herbicide 12.5 % Moisture 11.11c 10.50d 11.42c 10.09de 11% Moisture 10.43d 11.17c 10.43d 9.907de 9.5% Moisture 11.33c 13.07a 11.37c 8.853ef Herbicide + Pesticide in 12.5 % Moisture 9.613e 3.507g 9.400e 9.960de combination 11% Moisture 9.613e 9.660e 9.780de 10.19d 9.5% Moisture 9.867de 9.600e 9.880de 10.20d Value without common letter is showing statistically significant difference

3.6 Effect of interaction on root length seedling 3.7 Effect of interaction on fresh weights seedling

Trends of root length show similarity with the trends observed Highest average fresh weight 1.90g was reported from the in coleoptile length, maximum root length (13.07cm) was treatment with herbicide at 1 month storage in 9.5% seed reported in the seed having 9.5% moisture content and stored moisture content. Seed with 9.5% moisture and without storage for 1 month along with treated by herbicides. Seed with 11 period and pesticide have 1.86g fresh weigh which is not percent moisture without pesticide application and stored for significantly different from the highest fresh weight showing two months follow the highest root length. The lowest root treatments. Minimum fresh weight of seedlings (1.24g) has length (3.51cm) was reported in the seed stored for one month been identified with the combination of pesticides and and treated with pesticides combination at 12.5% moisture herbicides during the 1months maintenance of the 12.5% seed (Table 7). Results are in agreement with the findings Mandani moisture content (Table 8). With the storage time fresh weight et al. (2011) reported increase in the length of root and reduced and after 14 months storage least fresh weight was seedling establishment under the influence of seed size and reported for all treatments. Fresh weight at the beginning of the percentage of material content announced; however, at long- germination is affected by the vigor of seeds (Mathews & term maintenance seed weight is diminished. Mohammadi KhajeHosseini, 2006). The vigor is less favorable with (2008) reported that the percentage of normal root in Glycine increasing storage period or storage conditions Esmailzadeh et max reduced when the storage time was increased. al. (2008).

Table 8 Effect of pesticide, storage time and moisture content interaction on fresh weight (g).

Treatments Percentage Germination 0 Month 1 Month 2 Months 14 months (No Storage ) Storage Storage storage Free from pesticides 12.5 % Moisture 1.640cd 1.753bc 1.673cd 1.573d 11% Moisture 1.683c 1.837ab 1.690c 1.747bc 9.5% Moisture 1.867a 1.723bc 1.717bc 1.720bc Only Pesticides 12.5 % Moisture 1.623cd 1.790b 1.603d 1.570d 11% Moisture 1.577d 1.823ab 1.700c 1.557d 9.5% Moisture 1.837ab 1.723bc 1.680c 1.643cd Only Herbicide 12.5 % Moisture 1.760bc 1.810ab 1.617cd 1.730bc 11% Moisture 1.723bc 1.837ab 1.727bc 1.447e 9.5% Moisture 1.830ab 1.903a 1.893a 1.583d Herbicide + Pesticide in 12.5 % Moisture 1.723bc 1.240f 1.700bc 1.630cd combination 11% Moisture 1.587d 1.813ab 1.750bc 1.557d 9.5% Moisture 1.700c 1.747bc 1.650cd 1.717bc Value without common letter is showing statistically significant difference

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Effect of the interactions between moisture content, seed storage time and use of pesticides on seed germination,… 412 Table 9 The effect of pesticide, storage time and moisture content interaction on Dry weight (g).

Treatments Percentage 0 Month 1 Month 2 Months 14 months Germination (No Storage ) Storage Storage storage Free from pesticides 12.5 % Moisture 0.2467d 0.2467d 0.3000b 0.2067e 11% Moisture 0.2667c 0.2600c 0.2867bc 0.2300de 9.5% Moisture 0.2733c 0.2733c 0.2500cd 0.2633c Only Pesticides 12.5 % Moisture 0.2400d 0.2733c 0.2833bc 0.2667c 11% Moisture 0.2467d 0.3000b 0.2833bc 0.2700c 9.5% Moisture 0.3100b 0.3133b 0.2600c 0.2367de Only Herbicide 12.5 % Moisture 0.2633c 0.2567cd 0.3033b 0.2467d 11% Moisture 0.2800bc 0.2833bc 0.2800bc 0.2467d 9.5% Moisture 0.2467d 0.2800bc 0.2833bc 0.2667c Herbicide + Pesticide in 12.5 % Moisture 0.2867bc 0.3733a 0.2967bc 0.2733c combination 11% Moisture 0.2733c 0.2900bc 0.2700c 0.3133b 9.5% Moisture 0.2833bc 0.2767c 0.2700c 0.2600c Value without common letter is showing statistically significant difference

3.8 Effect of interaction on dry weight seedling storage time on seed germination, seedling dry weight, shoot length, root length and root to shoot ratio and reported a The highest value in dry weight was 0.373 g and it was significant differences among these traits. The results showed reported from the treatment containing pesticide and herbicide that the seed germination percentage, germination rate and combination along with one month stored seed with 12.5% other factors measured in seedling cannot predicted under seed moisture, this was followed by the 14 month storage with laboratory conditions. However, based on this experimental 11 percent moisture and one month storage with 9.5 percent results we cannot concluded on the non-use of pesticides, moisture in combination with pesticide and herbicides. . The fungicides or insecticides for the seed treatment but it can be minimum dry weight is 0.207g was reported in the seed stored conclude use of these pesticides can not necessarily increase for 14 months and moisture maintain on 12.5% without the percentage and rate of germination of wheat. However, the pesticide content (Table 9). Soltani et al. (2007) reported that interaction between the type of fungicide and seed moisture extended storage time significantly increases the start and end content and storage time affect the characteristics of different time of seed germination. In addition, increasing storage period pesticides. decreases dry seedling weight (Mandani et al., 2011). Conflict of interest Overall result of this study suggested that various traits such as germination percentage, germination index, fresh weight, and Authors would hereby like to declare that there is no conflict of root length show highest efficiency on one or two moth storage interests that could possibly arise. at 9.5 percent moisture content and herbicide application. While the same traits show minimum efficacy on 12.5 percent References moisture and combined application of pesticide and herbicide for the same duration. Various evidences show that the best Ashley RO, Martin G (2003) spring wheat seed treatment treatment for germination of wheat seeds is disinfection by demonstration. Annual Report Agronomy Section Dickinson fungicides for a shorter period of one to two months in the Research Extension Center. Available at http://www. standard moisture content (9.5%). At other tests conducted by ag.ndsu.nodak.edu/dickinso/research/2003/agron03i.htm Clark & Scott (1982) reported that treatment of wheat seed access on 12th December, 2015. with fungicide was effective on germination rate and seed germination while the same study suggested that the treatment Borgen A (2004) Organic seed treatment to control common of the seed with fungicides have negative impact and it is not bunt (Tilletiatritici) in wheat. Seed Testing International 128: only reducing the seed germination but also reducing the 8-9. Available on http://orgprints.org/4909/1/4909.pdf access efficiency. In present study, some studied traits such as CVG on 12th December, 2015. and dry weight of seedlings, show highest efficiency on one month storage at 12.5% moisture and combination of Chowdhury MA, Mahmood N, Rashid TR, Khaliq I (1999) pesticides (fungicide + insecticide) content. Similar type of Effect of leaf removal on grain yield and its components in observation was reported by Tavakolikakhaki & Beheshti spring wheat. Rachis (ICARDA), Barley and Wheat Newsletter (2010). Further, according to Clark & Scot (1982) the effects 18: 75-78. of fungicides on and seedling dry weight were not significant. Tavakolikakhaki & Beheshti (2010) studied the effect of

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

413 JAHANBIN et al

Clark SM, Scott DJ (1982) Effects of carboxin, benomyl and Matthews S, Khajeh Hosseini M (2006) Mean germination captan on the germination of wheat during the Post-harvest time as an indicator of emergence performance in soil of seed dormancy period (1982). Seed Science and Technology 10: 87- lots of maize (Zea mays). Seed Science and Technology 34: 94. 339-347.

Dupriez H, De Leener P (1989) African Gardens and Orchards: Mohammadi H (2008) the effect of storage on dynamic of seed Growing Vegetables and Fruits. Macmillan Publishers Ltd., storage and seedling growth of soybean. Proceedings of the London, Pp. 333. International Congress of Agronomy, Society for Agronomy and Plant Breeding, Karaj, Iran 8:166 -174. Esmailzadeh J, Aharizadeh S, Dabagh A, Tabataba-Vakili H (2008) Effect of seed deterioration seed storage Germination Nord M, Coleman-Jensen A, Andrews M, Carlson S (2009) Percentage and seedling growth of two corn hybrids. Household food security in the United States, Department of Proceeding of the international congress of agronomy, society Agriculture, Economic Research Service. Washington (DC): for agronomy and plant breeding, Karaj, Iran 6:216 – 222. U.S. 2010 Nov. Economic Research Report No. ERR-108: 6.

Gholinejad E (2011) Effect of salutary on germination Randhawa HS, Sharma HL, Kaur J, Dhaliwal AS (1985) Effect component in wheat genotypes. Seed Science and Technology of fungicides on germination and seed mycoflora on wheat journal. under different storage conditions. Pesticides 2: 36-38.

Gliessman SR (2000) Agroecology: Ecological Processes in Shamsaddin Saied M, Farahbakhsh H, MaghsoodiMude AA Sustainable Agriculture. CRC Press, Boca Raton, Florida Pp.3- (2007) 17. Effects of Salt Stress on Germination, Vegetative Growth and Govender V, Aveling TAS, Kritzinger Q (2007) The effect of some Physiological Characteristics of Canola. Journal of Water traditional storage methods on germination and vigour of and Soil Science 11: 191-202. maize (Zea mays L.) from northern KwaZulu-Natal and southern Mozambique. South African Journal of Botany 74: Sharafizad M, Naderi A, Siadat SA, Sakinejad T, Lak S (2013) 190-196. doi:10.1016/j.sajb.2007.10.006. Effect of Salicylic Acid Pretreatment on Germination of Wheat under Drought Stress. Journal of Agricultural Science 5: 179- Khanzada KA, Aslam Rajput M, Sarwar Shah G, 199. DOI: http://dx.doi.org/10.5539/jas.v5n3p179. MubeenLodhi A, Farrakh Mehboob (2002) Effect of Seed Dressing Fungicides for the Control of Seedborne Mycoflora Soltani A, Kamkar B, Galeshi S, AkramGhaderi F (2007) of Wheat. Asian Journal of Plant Sciences 1: 441-444. DOI: Effect of seed storage on resource depletion and heteroterophic 10.3923/ajps.2002.441.444. growth of wheat seedling. Iranian Journal of Agricultural Sciences 15: 229-259. Lu YC, Terry CK (1995) Implication of sustainable agriculture for the world food situation. Food Reviews International 11: Tavakolikakhaki H, Beheshti A (2010) Wheat seed treatment 255-280. DOI:10.1080/87559129509541042. and seed vigor indices from the perspective of its impact on the environment. Journal of Agro ecology 2:168-174. Maguire JD (1962) Seed of germination aid in selection and evaluation for seedling emergence and vigor. Crop Science 2: Throneberry GO, Smith FG (1955) Relation of respiratory 176-177. enzymatic activity to corn seed viability. Plant physiology 30: 337-343. Mandani F, RiahiniaSh, Khajehoseyni M (2011) check the storage time and seed size on germination and seed vigor traits Zare S, Tavili A (2000) Study effect different level salicylic of different wheat varieties. Journal of Seed Science and acid on improvement germination traits fox Mulberry plant Technology 2:14-24. under drought and salinity range and natural sources. Iran Bulletin 1: 29-39.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Journal of Experimental Biology and Agricultural Sciences, June - 2016; Volume – 4(IV)

Journal of Experimental Biology and Agricultural Sciences

http://www.jebas.org

ISSN No. 2320 – 8694

INFLUENCE OF ORGANIC AND MINERAL FERTILIZERS ON THE ANTIOXIDANTS AND TOTAL PHENOLIC COMPOUNDS LEVEL IN TOMATO (Solanum lycopersicum) VAR. MONGAL F1

Abdoulaye SEREME1, Christophe DABIRE1, Moumouni KOALA2, Marius K SOMDA3 and Alfred S TRAORE3

1Département Substances Naturelles/ IRSAT/ CNRST; 03 BP 7047 Ouagadougou 03; Burkina Faso;Tel: 226 78285534 2Département Médecine et Pharmacopée Traditionnelle/ IRSS/ CNRST ; 03 BP 7047 Ouagadougou 03 ; Burkina Faso ; Tel : 226 76294617 3Département de Biochimie-Microbiologie; Université de Ouagadougou ; 03 BP 7021 Burkina Faso ; tel : 226 78805242

Received – April 18, 2016; Revision – May 04, 2016; Accepted – June 28, 2016 Available Online – June 30, 2016

DOI: http://dx.doi.org/10.18006/2016.4(4).414.420

KEYWORDS ABSTRACT Tomato The availability of secondary metabolites in various plant parts can be influenced qualitatively and Fertilization quantitatively by managing ecological factors or farming practices. Purpose of this study was to determine the impact of organic and mineral fertilization on the content of phenolic compounds and Antioxidants antioxidant activity in fruit of the tomato Mongal F1 variety. Experimentation was carried out in a randomized block factorial design. Results of study revealed that plant treated by organic fertilizers have Total phenols 16.36± 0.07mg Trolox Equivalent (TE)/100g fresh tomato (ft) antioxidant activity and 6.96± 0.63mg Gallic Acid Equivalent (GAE)/100g ft total phenols content while the plant treated by mineral fertilizer have 15.57± 0.05 mg TE/100g ft for antioxidant activity and 6.09± 0.13mg GAE/100g ft for total phenols content. Furthermore, it was reported that, as compared to mineral fertilization, organic fertilization significantly increases the antioxidant activity and phenolic compounds production in Mongal F1 tomato variety. This increase is probably due to the availability of various major and minor elements in organic fertilizer contrary to mineral fertilizer which has only three major elements, nitrogen, phosphorus, and potassium. 79 days after transplanting, fruit ripping has no obvious effect on the accumulation of these compounds.

All the article published by Journal of Experimental * Corresponding author Biology and Agricultural Sciences is licensed under a E-mail: [email protected] (Abdoulaye SEREME) Creative Commons Attribution-NonCommercial 4.0 International License Based on a work at www.jebas.org. Peer review under responsibility of Journal of Experimental Biology and Agricultural Sciences.

Production and Hosting by Horizon Publisher India [HPI] (http://www.horizonpublisherindia.in/ ). All ______rights reserved. Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

415 Sereme et al

1 Introduction the soil could also stimulate the biosynthesis of these natural products. It has also been shown that the levels of fertilization In Burkina Faso, agriculture is the main source of income for in nitrogen, phosphorus, potassium and calcium can affect the the population and the mainstay of the country's food security. production of secondary metabolites in plants (Oloyede et al., It employs more than 80% of the population and contributes 2012; Sabrina et al., 2012; Omar et al., 2012; Vignesh et al., for about 33% to the Gross Domestic Product (GDP) 2012), and therefore that the presence of macronutrients is (MAHRH, 2011). Tomato production comes second after essential for plant growth and has a significant effect on the onion bulb and generates significant foreign currency influx accumulation of polyphenols and antioxidants (Parr et al., for the national economy. The national tomato production is 2000). 157,086 tons a year and remains the most profitable vegetable farming in the country with total sales valued at €117 million A reaction of plants to these stimuli varies with the plants and (MAHRH, 2011). It is the main source of income for used fertilizers but mechanism is not well understood. Further, vulnerable populations in the fight against malnutrition and the use of these techniques to induce plants to produce poverty. The main destinations of export tomatoes are Ghana, secondary metabolites (and therefore potentially increase their Togo, Benin, Equatorial Guinea and Ivory Coast. nutritional value) is not common. The overall objective of this study was to explore the effect of organic and mineral fertilizer Research on natural antioxidants is interesting in more than on the production of total antioxidants and polyphenols in the one way because it could lead to the production of natural fruit of Mongal f1 tomato variety. substitutes to potentially toxic synthetic antioxidants such as butylatehydroxyanisole and butylatehydroxytoluen, which are 2 Materials and Methods commonly used for the conservation of certain foods (Fukumoto & Mazza, 2000; Lako et al., 2007; Koala et al., The study was conducted at the headquarters of the Research 2013a, Koala et al., 2013b). Natural antioxidants have Institute for Applied Sciences and Technologies, located at the preventive action against chronic diseases such as cancer, industrial area of Ouagadougou – Burkina Faso. The study area cardiovascular disease including risk factors such as was located at the geographical coordinate 12° 25' North hypertension, diabetes, and obesity (Diaz et al., 1997; Renaud latitude, 1° 29' West longitude and altitude of 435m (IGB, et al., 1998; Willcox et al., 2004). Food intake of natural 2014). antioxidants known for their role in strengthening the immune system plays a major role in the prevention of this category of 2.1 Materials diseases but also infectious diseases and even the aging process and neurodegenerative diseases which are often linked to the The tomato variety Mongal F1 used in this study was obtained deficit in antioxidants (Arts et al., 2005). Polyphenols and from the National Institute for Agricultural Research (INRA, carotenoids are natural antioxidants with beneficial effects on France). This variety was chosen because of its easy human health (Osganian et al., 2003; Melendez-Martinez et al., availability and nature of growing efficiently under dry hot 2004; Tapiero et al., 2004; Stahl & Sies, 2005; Li et al., 2011). weather or in wet tropical areas corresponding to Burkina Antioxidants are therefore a dual weapon which can be used to Faso. It is also resistant to nematodes as well as bacterial and protect individuals at risk of over-nutrition but especially those fungal diseases (Aïssa et al., 2014). The organic fertilizer used most vulnerable to under-nutrition, infectious and parasitic in this study was well-decomposed livestock manure while the diseases such as young children, the elderly, pregnant women mineral fertilizer consisted of N-P-K (23-14-23). and lactating women (Rice-Evans &Packer, 1998; Milner, 1999). 2.2 Methods

There is a growing interest to develop simple methods to Farming operations such as land preparation, nursery watering increase the concentration of polyphenols in foods in order to and mulching, transplanting, weeding/ hoeing, fertilizing, strengthen their overall nutritional value (Parr & Bolwell, harvesting and pest treatment were performed as per the 2000; Schreiner, 2005; Schreiner & Huyskens-Keil, 2006). The instructions manual of the variety. The experiment was literature suggested that many environmental factors and conducted in a Factorial Block with 4 replications. The two cropping practices could influence the biosynthesis of studied factors were fertilization (OF- Organic Fertilization; polyphenols and antioxidants (Daniel et al., 1999; Premuzic et MF- Mineral Fertilization; C- Control) and harvest periods al., 2001 ; Premuzic et al., 2002 ; Jeffery et al., 2003 ; (R1, R2, R3) which correspond to fruit physiological maturity, Schreiner, 2005 ; Dragovic-Uzelac et al., 2007). Polyphenols to evaluate the effect of maturation on total phenolic contents and carotenoids are also produced by plants throughout their and antioxidant level in the fruits. development for various reasons such as defense against microorganisms, insects, and herbivores (Dixon & Paiva, Nine factorial combinations which studied were C/R1, C/R2, 1995). Exposure to ultraviolet radiation (Rozema et al., 1997), C/R3, OF/R1, OF/R2, OF/R3, MF/R1, MF/R2, MF/R3. environmental stresses (Ehrhart, 2014), allelopathic Spacing between two blocks was 2.5m and elementary plots interactions (Mann et al., 1987), and availability of nutrients in were 1.5m apart. Each plot consisted of 4 rows of 3m in length.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Influence of organic and mineral fertilizers on the antioxidants and total phenolic compounds level in tomato (Solanum lycopersicum) var. Mongal F1 416 Spacing between adjacent rows was 0.8 m and plants within 2.2.2 Determination of total phenols each row were 0.5 m apart. Two border lines were planted on both sides in each plot to reduce border effects. The first Total phenols content was determined by the Folin-Ciocalteu harvesting operation (R1) was carried out at 79 days after method modified by Singleton et al. (1999). This Folin- transplanting which corresponds to fruit physiological Ciocalteu reagent was prepared with phosphormolybdate of maturity. The second and third harvests (R2 and R3) were tungsten. It oxidized in a basic environment, the hydroxyl performed 85 and 89 days after transplanting, respectively. groups of the phenolic compounds present in the sample. The reduced molecules (quinones, oxides, etc.) have blue color 2.2.1 Determination of antioxidant activity which intensity is proportional to the polyphenols content of the sample. Total phenols content was determined by a The antioxidant activity of tomato fruit was determined by the calibration curve established from different concentrations of ABTS method (Roginsky & Lissi, 2005). It is the ability of an gallic acid (3,4,5-trihydroxybenzoic acid). Absorbance was antioxidant relative to trap the cation radical ABTS • +. The measured with a microplate spectrophotometer (Microplate antioxidant power was measured according to the Trolox Autoreader MP96; SAFAS Instruments) at 760 nm wavelength Equivalent Antioxidant Capacity (TEAC) method (Re et al., by using a 96-well plate (glass vials 250 μL) after incubating 1999). The principle of this method is that the total antioxidant the plate for 30 min at 37°C. Distilled water was used as a activity of a molecule is derived from its ability to inhibit the blank. Total phenolic contents of the samples determined from radical 2,2'-azinobis- (3-ethylenzothiazoline-6-sulfonicacid) the calibration curve equation (y = 46.41x + 0.063, R2 = 0.998) (ABTS• +). Trolox (6-hydroxy-2,5,7,8-tetramethylchroman-2- were expressed in mg of gallic acid equivalents (GAE) per carboxylic acid) is used as a reference antioxidant. Its cyclic gram of fresh weight. All measurements were performed in molecular structure is similar to that of vitamin E (α- three replications. Results are expressed in gram gallic acid tocopherol), (Cuvelier et al., 2003). which was equivalent (GAE) to 100g of plant material.

For the formation of the radical ABTS • +, 10 mg ABTS are 2.3 Statistical analysis dissolved in 2.6 ml of distilled water simultaneously, 1.7 mg of persulfate potassium were dissolved in the same volume of All analysis was conducted in three replications, and data were distilled water. These two solutions were mixed together and processed in Microsoft Excel 2013 while analysis of variance placed in a dark at room temperature for 12 to 16 hours. And (ANOVA) was performed using the software "XLSTAT then, the ABTS • + solution was diluted 1/200 by adding version 7.5.2". methanol. An aliquot of 500 µl diluted tomato extract was mixed with the 2 ml of the ABTS• + - ethanol solution. After 3 Results and Discussion 15 min of incubation in the dark, absorbance is reed at 734 nm, using a microplate (spectrophotometer SAFAS, MP96). The Results of the total phenolic content and antioxidant activity of test was replicated three times and the results expressed as tomato variety Mongol F1 during maturation are presented in µlmol Trolox Equivalent per 100 g of fresh material referring the table 1. to the standard range.

Table 1 Effect of organic and mineral fertilizers application on the content of total phenols and antioxidant activity during tomato maturation.

Treatments Content of total phenols (mg GAE /100g ft) Antioxidant Activity(AOA) (mg Trolox Equivalent/100g ft) C/R1 7.33 ± 0,12b 16.20 ± 0.03b C/R2 6.65 ± 0.18d 16.35 ± 0.01ab C/R3 6.00 ± 0.10f 16.26 ± 0.05c OF/R1 7.70 ± 0.20a 16.26 ± 0.04c OF/R2 7.00 ± 0.05c 16.41 ± 0.04a OF/R3 6.17 ± 0.04e 16.37 ± 0.04ab MF/R1 6.16 ± 0.12e 15.54 ± 0.03e MF/R2 6.20 ± 0.33e 15.53 ± 0.02e MF/R3 5.90 ± 0.12f 15.65 ± 0.01d In the same column, values with different superscript letters are significantly different (P<0.001); E- Trolox Equivalent; ft - fresh tomato; fm – fresh matter; GAE- Gallic Acid Equivalent; OF-Organic Fertilization; MF-Mineral Fertilization; C- Control; R1 - harvesting 79 days after planting, R2 - harvesting 85 days after planting, R3- harvesting 89 days after planting.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

417 Sereme et al

3.1. Antioxidant activity phenolic content for melon. These species are considered as interesting sources of natural antioxidants. Results of the present study revealed that the antioxidant activity of samples varies between 15.53 and 16.41 mg TE Levels of total phenols in present the study are lower than /100g fresh weight. These values correspond to treatment those from the literature (Toor & Savage 2005; Zoran et al., MF/R2 and OF/R2, respectively. Among various 2014). This would undoubtedly be related to plant varieties, combinations, organically fertilized tomatoes have a higher cultural practices or methods of analysis used by these authors. antioxidant activity than tomatoes under mineral fertilization Indeed, the literature showed that the micronutrient content of and the control (without fertilization) for all harvests. Overall, fresh fruits of different tomato varieties can vary significantly maturation has a positive effect for the accumulation of and it depending on the crop variety itself (Lenucci et al., antioxidants and total phenols. 2006). Cropping practices, environmental factors, fruit maturity period and post-harvest storage can also cause Results in the table are in agreement with the findings of Wu et changes in the composition of fruits of the same variety (Raffo al. (2013) who reported higher antioxidant activity of 5.5 mmol et al., 2002; Slimestad & Verheul, 2005; Luthria et al., 2006). TE/100g fresh jujubes under organic fertilization while this Part of the effective antioxidant activity of tomato could be value was only 4 mmol TE/100g fresh jujubes under mineral also attributed to their phenolic compounds, mainly fertilization. The increases in secondary metabolites and chlorogenic acid, rutin and gallic acid. The present study of the antioxidant potential may be caused by the presence of various AOA in relation with GAE showed a slight correlation (r2 = major and minor elements in organic fertilizers while in case of 0.478) between AOA and GAE. mineral fertilizer only three basic mineral elements (i.e. nitrogen, potassium and phosphorus) are available (Ibrahim et Correlation revealed that the highest GAE had not the highest al., 2013). Furthermore, the use of organic manure increases AOA which is contrary with some previous studies on potatoes soil fertility by improving its physical, chemical, and which showed that polyphenolic compounds are mainly biological properties (Khalil et al., 2007). Lowest levels of responsible for the antioxidative activity of plant extracts antioxidants were observed in the presence or absence of (Huang et al., 2005). The present study on tomato showed that mineral fertilizers. These results are in agreement with several polyphenols are slightly responsible for antioxidant activity of authors those who reported that mineral nutrition has little or plant extracts since they contributed only 48% polyphenols no effect on the production of polyphenols and antioxidants in content. Furthermore, it was also reported that carotenoids are some plants (Pavla & Pokluda, 2008; Gupta- Elera et al., 2012; powerful natural antioxidants and tomato fruit contained Marilou et al., 2012). Premuzic et al. (2001) found in cherry almost 449μg/100 fmof β-Carotene and 2573 μg/100 fm of tomato that vitamin C (a powerful antioxidant) content was lycopene (USDA, 2007). Total carotenoid contents assessed in higher under organic fertilization or fertilization combining tomato certainly contributed to increase their AOA. Phenolic mineral and organic inputs than under exclusive mineral compound content decrease during fruit ripening regardless of fertilization. the of fertilization type (organic or inorganic)

3.2. Total phenols content Conclusion

The total phenols content of the tomato samples was between Results of the present work highlight the importance of organic 5.90 mg to 7.70 mg GAE/100g fresh tomato for all treatments. fertilization in the accumulation of total antioxidants and Fruits sample collected from plants under organic fertilization polyphenols in tomato variety Mongal F1. The antioxidant showed overall higher total phenols contents than those under activity of tomatoes is reported higher than that of certain fruits mineral fertilization during maturation. The biosynthesis of consumed in Burkina Faso as a source of natural antioxidants. polyphenols seemed to be positively influenced by the Results showed that tomato variety Mongal F1 is therefore a application of organic fertilizers. These results are in good source of natural antioxidants, and could potentially be agreement with the observations of Toor & Savage (2005) who used as a nutraceutical or functional food. In addition, tomato, obtained an average of 12.7 mg GAE / 100g from fresh tomato. a vegetable widely consumed fresh or processed, is recognized Zoran et al., (2014) reported very high amount of phenolic through the literature for its nutritional qualities and richness in compounds in their study on tomato although they are in micro-components such as carotenoids (especially lycopene), agreement with our results for the fertilization. They found phenolic compounds and vitamin C. 50.83 and 29.98 mg GAE/100g fresh tomato from organic and mineral fertilizations, respectively. Like tomatoes, other fruits Acknowledgements such as peach and pear (Carbonaro et al., 2002), strawberry (Reganold et al., 2010) and jujubes (Wu et al., 2013) also This work was undertaken with the financial support of the showed similar type of phenolic content values. Cieslik et al. West Africa Agricultural Productivity Program/National (2006) conducted study on the total phenol content of certain Center of Specialization – Fruits and Vegetables (WAAPP / fruits and reported 28.1 mg GAE/100 mg for kiwi, 11.6 mg CNS-FL), to whom we express our sincere thanks. GAE/100 mg for watermelon and 7.8 mg GAE/100 mg

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Influence of organic and mineral fertilizers on the antioxidants and total phenolic compounds level in tomato (Solanum lycopersicum) var. Mongal F1 418 Conflict of interest Gupta-Elera G, Garrett A, Martinez A, Kraus RD, Robison R, O’Neill K (2012) A Comparison of Antioxidant Properties in Authors would hereby like to declare that there is no conflict of Organic and Conventional Blueberries. Journal of Food interests that could possibly arise. Research 1: 1-7. DOI: http://dx.doi.org/10.5539/jfr.v1n3p1.

References Huang D, Ou B, Prior RL (2005) The chemistry behind dietary antioxidant capacity assays. Journal of Agriculture Food Aïssa K, Ali KA, Patrick D, Boubacar DA, Adamou H (2014) Chemistry 53: 1841-1856. DOI: 10.1021/jf030723c. Les semences disponibles au Niger. Communications des sociétés GSN semences et Technisem. RECA-Niger. 3ème éd. Ibrahim MH, Jaafar HZ, Karimi E, Ghasemzadeh A (2013) Impact of Organic and Inorganic Fertilizers Application on the Arts, ICW, Hollman PCH (2005) Polyphenols and disease risk Phytochemical and Antioxidant Activity of Kacip Fatimah in epidemiological studies. The American Journal of Clinical (Labisia pumila Benth). Molecules 18:10973-10988. doi: Nutrition 81: 317S-325S. 10.3390/molecules180910973.

Carbonaro M, Mattera M, Nicoli S, Bergamo P, Cappelloni M IGB (2014) Carte administrative des provinces du Burkina (2002) Modulation of antioxidant compounds in organic vs Faso. Ed. Ministère de l’Administration Territoriale. conventional fruit (Peach, Prunus persica L. and Pear, Pyrus communis L.). Journal of Agriculture and Food Chemistry 50: Jeffery EH, Brown AF, Kurilich AC, Keck AS, Matusheski N, 5458–5462. DOI: 10.1021/jf0202584. Klein BP, Juvik JA (2003) Variation in content of bioactive components in broccoli. Journal of Food Composition and Cieslik E, Greda A, Adamus W (2006) Contents of Analysis16 : 323-330. doi:10.1016/S0889-1575(03)00045-0. polyphenols in fruit and vegetables. Food Chemistry 94: 135- 142. doi:10.1016/j.foodchem.2004.11.015. Khalil MY, Moustafa AA, Naguib NY (2007) Growth, phenolic compounds andantioxidant activity of some medicinal Cuvelier C, Dotrppe O, Istasse L (2003) VitE : Etat des plants grown under organic farming condition. World Journal connaissances chez les carnivores domestiques. Métabolisme, of Agricultural Sciences 3: 451–457. besoins et apports. Annales de Médecine Vétérinaire 147 : 367-382. Koala M, Hema A, Somé K, Palé E, Sérémé A, Belem J, Nacro M (2013b) Evaluation of Eight Orange Fleshed Sweet Daniel O, Meier MS, Schlatter J, Frischknecht P (1999) potato varieties for Their Total Antioxidant, Total Carotenoid Selected phenolic compounds in cultivated plants: ecologic and Polyphenolic Contents. Journal of Natural Sciences functions, health implications, and modulation by pesticides. Research 3: 67-72. Environmental Health Perspectives 107: 109-114. Koala M, Hema A, Somé K, Palé E, Sérémé A, Belem J, Nacro Diaz MN, Frei B, Vita JA, Keaney JF Jr (1997) Antioxidants M (2013a) Effects of Organic and Mineral Fertilizers on total and atherosclerotic heart disease. New England Journal of Antioxidant, polyphenolic and carotenoid contents of Orange medicine 337: 408-416. fleshed sweet potato tubers. Journal of Natural Sciences Research 3: 23-30. Dixon RA, Paiva NL (1995) Stress-induced Phenylpropanoid Metabolism. The Plant Cell 7: 1085-1097. doi: Lako J, Trenerry VC, Wahlqvista M, Wattanapenpaiboona N, 10.1105/tpc.7.7.1085. Sotheeswaran S (2007) Phytochemical flavonols, carotenoids and the antioxidant properties of a wide selection of Fijian Dragovic-Uzelac V, Levaj B, Murky V, Bursac D, Boras M fruits, vegetables and other readily available foods. Food (2007) The content of polyphenols and carotenoids in three Chemistry 101 : 1727-1741. apricot cultivars depending on stage of maturity and doi:10.1016/j.foodchem.2006.01.031. geographical region. Food Chemistry 102 : 966–975. doi:10.1016/j.foodchem.2006.04.001. Lenucci MS, Cadinu D, Taurino M, Piro, G and Dalessandro G (2006) Antioxidant composition in cherry and high-pigment Ehrhart L (2014) ORAC, Antioxydant : comprendre les tomato cultivars. Journal of Agricultural and Food Chemistry résultats. Happy berry infos.http://www.happyberry.fr/post-1- 54: 2606-2613. DOI: 10.1021/jf052920c. valeur-orac-antioxydant-lire-resultats-fruits.html - Consulté le 07/05/15 Li H, Parry JW (2011) Phytochemical Compositions, Antioxidant Properties, and Colon Cancer Antiproliferation Fukumoto LR, Mazza G (2000) Assessing Antioxidant and Effects of Turkish and Oregon Hazelnut. Food and Nutrition Prooxidant Activities of Phenolic Compounds. Journal of Sciences 2: 1142-1149. DOI: 10.4236/fns.2011.210153. Agricultural and Food Chemistry 48: 3597-3604. DOI: 10.1021/jf000220w.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

419 Sereme et al

Luthria DL, Mukhopadhyay S, Krizek DT (2006) Content of Horticulturae 559 : 601-606. total phenolics and phenolic acids in tomato (Lycopersicon DOI : 10.17660/ActaHortic.2001.559.88 esculentum Mill.) fruits as influenced by cultivar and solar UV radiation. Journal of Food Composition and Analysis 19: 771- Premuzic Z, Garate A, Bonilla I (2002) Production of lettuce 777. doi:10.1016/j.jfca.2006.04.005. under different fertilization treatments, yield and quality. Acta Horticulturae 571: 65-72. MAHRH (Ministèredel'Agriculture, del'Hydraulique et des RessourcesHalieutiques), (2011) Rapport d’analyse du module Raffo A, Leonardi C, Fogliano V, Ambrosino P, Salucci M, maraîchage, Pp.214. Gennaro L, Bugianesi R, Giuffrida F, Quaglia G (2002) Nutritional value of cherry tomatoes (Lycopersicon esculentum Mann J (1987) Secondary Metabolism, 2nd ed.; Oxford Cv. Naomi F1) harvested at different ripening stages. Journal University Press: Oxford, UK, 1987; chapter 7. of Agricultural and Food Chemistry 50: 6550-6556. DOI: 10.1021/jf020315t Marilou Mante Benitez, Constancio C De Guzman (2012) Antioxidant Content of Bitter Gourd (MomordicaCharantiaL.) Re R, Pellegrini N, Proteggente A, Pannala A, Yang M, Rice- Grown in Different Nutrient Amendments UMT 11th Evans C (1999) Antioxidant activity applying an improved International Annual Symposium on Sustainability Science and ABTS radical cation decolorization assay. Free Radical Management held on 09th – 11th at Terengganu, Malaysia. Biology and Medicine 26: 1231-1237. doi:10.1016/S0891- 5849(98)00315-3. Melendez-Martinez AJ, Vicario IM, Heredia FJ (2004) Importancia nutricional de los pigmentos carotenoides. Reganold JP, Andrews PK, Reeve JR, Carpenter-Boggs L, Archivos Latinoamericanos de Nutrición 54: 149-55. Schadt CW, Alldredge JR, Ross CF, Davies NM, Zhou JZ (2010) Fruit and soil quality of organic and conventional Milner JA (1999) Functional foods and health promotion. strawberry agroecosystems. PLoS One5, e12346. Journal of Nutrition 129: 1395S-1397S. http://dx.doi.org/10.1371/journal.pone.0012346.

Oloyede FM, Obisesan IO, Agbaje GO, Obuotor EM (2012) Renaud SC, Guéguen R, Schenker J, d'Houtaud A (1998) Effect of NPK Fertilizer on Chemical Composition of Pumpkin Alcohol and mortality in middle-age men from Eastern France. (Cucurbitapepo Linn.) Seeds. The Scientific World Journal, Epidemiology 9:184-188. Article ID 808196 Pp: 1-5. http://dx.doi.org/10.1100/2012/808196. Rice-Evans C, Packer L Eds. (1998) Flavonoids in Health and Disease; Marcel-Dekker: New York. Omar NF, Hassan SA, Yusoff UK, Abdullah NA, Wahab PE, Sinniah U (2012) Phenolics, flavonoids, antioxidant activity Roginsky V, Lissi EA (2005) Review of methods to determine and cyanogenic glycosides of organic and mineral-base chain-breaking antioxidant activity in food. Food chemistry 92: fertilized cassava tubers. Molecules 17: 2378-2387. doi: 235-254. doi:10.1016/j.foodchem.2004.08.004. 10.3390/molecules17032378. Rozema J, van de Staaij J, Bjorn LO, Caldwell M (1997) UV- Osganian SO, Stampfer MJ, Rimm E, Spiegelman D, Manson B as an environmental factor in plant life: stress and regulation. JE, Willet WC (2003) Dietary carotenoids and risk of coronary Trends in Ecology & Evolution 12, 22-28. doi:10.1016/S0169- artery disease in women 1’2’3. The American Journal of 5347(96)10062-8. Clinical Nutrition 77: 1390-1399. Sabrina B, Reda DM, Houria EB (2012) Induction of Parr AJ, Bolwell GP (2000) Phenols in the plant and in man. Antioxidant Enzyme System by a Nitrogen Fertilizer Npk in The potential for possible nutritional enhancement of the diet Wheat Triticum Durum. Advances in Environmental Biology by modifying the phenols content and profile. Journal of the 6 : 85-88. Sciences of Food and Agriculture 80: 985-1012. DOI: 10.1002/(SICI)1097-0010(20000515)80:7<985::AID- Schreiner M (2005) Vegetable crop management strategies to JSFA572>3.0.CO;2-7. increase the quantity of phytochemicals. European Journal of Nutrition 44: 85-94. DOI: 10.1007/s00394-004-0498-7. Pavla B, Pokluda R (2008) Influence of Alternative Organic Fertilizers on the Antioxidant Capacity in Head Cabbage and Schreiner M, Huyskens-Keil S (2006) Phytochemicals in fruit Cucumber. Notulae Botanicae Horti Agrobotanici Cluj- and vegetables: health promotion and postharvest elicitors. Napoca 36 : 63-67. Critical Review in Plant Sciences 25: 267-278. DOI: 10.1080/07352680600671661. Premuzic Z, de los Ríos A, Clozza M, Vilella F, Mirabelli E, Accorinti C (2001) Influence of fertilization on the production Singleton VL, Orthofer R, Lamuela-Raventos RM (1999) and Vitamin C and sugar content of "Cherry" tomatoes. Acta Analysis of total phenols and other oxidation substrates and

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Influence of organic and mineral fertilizers on the antioxidants and total phenolic compounds level in tomato (Solanum lycopersicum) var. Mongal F1 420 antioxidants by means of Folin-Ciocalteu reagent. Methods in http://www.nal.usda.gov/fnic/foodcomp/Data/SR16/reports/sr1 Enzymology 299 : 152-178. doi:10.1016/S0076- 6fg11.pdf, U.S. agricultural research service. 6879(99)99017-1. Vignesh R, Venkatesh NR, Meenakshisundaram B, Jayapradha Slimestad R, Verheul MJ (2005) Content of chalconaringenin R (2012) Novel Instant Organic Fertilizer and Analysis of its and chlorogenic acid in cherry tomatoes is strongly reduced Growth Effects on Spinach. Journal of Biological Sciences 12 : during postharvest ripening. Journal of Agricultural and Food 105-110. DOI: 10.3923/jbs.2012.105.110. Chemistry 53: 7251-7256. DOI: 10.1021/jf050737d. Willcox J K, Ash SL, Catignani G L (2004)Antioxidants and Stahl W, Sies H (2005) Bioactivity and protective effect of prevention of chronic diseases. Critical Reviews in Food natural carotenoids. Biochimica et Biophysica Acta (BBA) - Science and Nutrition 44 : 275-95. Molecular Basis of Disease 1740: 101-107. DOI:10.1080/10408690490468489.

Tapiero H, Townsend DM, Tew KD (2004)The role of Wu CS, Gao QH, Kjelgren RK, Guo XD, Wang M (2013) carotenoids in the prevention of human pathologies. Yields, Phenolic Profiles and Antioxidant Activities of Biomedicine & Pharmacotherapy 58: 100-110. Ziziphus jujube Mill. In Response to Different Fertilization doi:10.1016/j.biopha.2003.12.006. Treatments. Molecules 18: 12029-12040. doi: 10.3390/molecules181012029. Toor RK, Savage GP (2005) Antioxidant activity in different fractions of tomatoes. Food Research International 38:487-494. Zoran IS, Nikolaos K, Ljubomir S (2014) Tomato fruit quality doi:10.1016/j.foodres.2004.10.016. from organic and conventional production. In: Pilipavicius V (Ed) Organic agriculture towards sustainability. Rijeka, USDA (2007) National nutrient database for standard Croatia: In Tech Europe. pp., 147-169. reference,

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Journal of Experimental Biology and Agricultural Sciences, June - 2016; Volume – 4(IV)

Journal of Experimental Biology and Agricultural Sciences

http://www.jebas.org

ISSN No. 2320 – 8694

EFFECTS OF INTEGRATED MANAGEMENT OF BIO AND CHEMICAL FERTILIZERS ON YIELD OF MAIZE HYBRIDS (Zea mays L.)

Fatemeh Nouraki1, Mojtaba AlaviFazel2,*, Ahmad Naderi3, EbrahimPanahpoor4 and ShahramLak5

1Department of Agronomy, Khuzestan Science and Research Branch, Islamic Azad University, Ahvaz, Iran 2Department of Agronomy, Ahvaz Branch, Islamic Azad University, Ahvaz, Iran 3Faculty of Agriculture and Natural Resources Research Center of Khuzestan, Ahvaz, Iran 4Department of Soil Science, Ahvaz Branch, Islamic Azad University, Ahvaz, Iran 5Department of Agronomy, Ahvaz Branch, Islamic Azad University, Ahvaz, Iran

Received – April 18, 2016; Revision – May 04, 2016; Accepted – June 28, 2016 Available Online – June 30, 2016

DOI: http://dx.doi.org/10.18006/2016.4(4).421.426

KEYWORDS ABSTRACT

Maize Fertilizer management plays an important role in obtaining satisfactory yields from maize. In addition, fertilizer management is essential for achieving sustainable agriculture and protecting the environment. Fertilization Management The reported experiment was conducted in the summers of 2013-2014 in the Aghili region in the north Hybrids of Khuzestan Province. The experiment was conducted as four replicates using split plots randomized complete block design (RCBD). The experiments consisted of four levels (25, 50, 75, and 100 %) of Environment chemical fertilizers nitrogen (urea) and phosphorus (Triple superphosphate) and level of bio fertilizers (Control and 100 %), which were the main factors. The sub factor was three types of maize hybrids, which were single cross 704, single cross 701(SLD45/1/2-1× MO17), and single cross Mobin (SLD 45/1/2-1× SLH 2/29/14/2-4/1).The highest yields were obtained from the single cross 704 with 25% chemical and 100% bio-fertilizers (12,875 kg/ha) and it was followed by single cross 704 with 50% chemical and 100% bio-fertilizers (12,385 kg/ha), while the lowest yield was obtained from the single cross Mobin with 25% chemical and 100% bio fertilizers (10,215 kg/ha). The yield and component yield differences were observed between treatments so that the grain yield and biological yield as well as number of grains per row were significant at the 1% level and there were no significant differences between the other components.

All the article published by Journal of Experimental * Corresponding author Biology and Agricultural Sciences is licensed under a E-mail: [email protected] (Mojtaba AlaviFazel) Creative Commons Attribution-NonCommercial 4.0 International License Based on a work at www.jebas.org. Peer review under responsibility of Journal of Experimental Biology and Agricultural Sciences.

Production and Hosting by Horizon Publisher India [HPI] (http://www.horizonpublisherindia.in/ ). All ______rights reserved. Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

422 Nouraki et al

1 Introduction factors responsible for lower grain yield in many different countries, including Iran, but fertilizer management plays an Maize (Zea mays L.) is an important cereal crop in Iran, and it important role for obtaining satisfactory yields and to increase ranks third in worldwide production after wheat and rice crop productivity. Nutrient management may be achieved by (Kusaksiz, 2010). It is grown for fodder as well as for grain in the involvement of organic sources, bio-fertilizers, and micro- Iran. Approximately 320,000 hectares of field corn were grown nutrients (Singh et al., 2002). According to the Mohammed et with a production of 2,560,000 tons at an average grain yield al. (2001), the use of bio-fertilizers offers agronomic and of 8,000 kg/ha in Iran in 2012 (Rahmany & Nouraki, 2015). environmental benefits to intensive farming systems in Egypt, Nitrogen is a basic component that played a decisive role in the and the data showed that using Azospirillum brasilense or intensification of plant production (Scharf, 2002). It is the most commercial bio fertilizers in cereals with a half N rate critical element for plant growth and plays a key role in many (144kgN/ha) caused a significant increase in yield. Further, metabolic and physiological functions (Balasubramaniyan & seed inoculation with Rhizobium, phosphorus solubilizing Palaniappan, 2001).The levels of the application of nitrogen bacteria, and organic amendment increased the seed production and phosphorus, the location, and the variety all have effects of the crop (Panwar et al., 2006).Therefore, the present study on the final yield of corn. Previous work has indicated that was conducted to evaluate the effects of individual or there is a significant response to the application of nitrogen combined application of chemical and biological fertilizers on fertilizers in the yields obtained from maize (Bundy & Carter, the yield and yield components of three types of maize hybrids. 1988). The main factor that limits growth and grain filling is the availability of nitrogen (El-Douby et al., 2001; Zeidan et 2 Materials and Methods al., 2006). Chemical fertilizers are needed to supplement the nutrients in the soil. Heavy doses of chemical fertilizers and The experiment was conducted in the cropping season of 2013- pesticides are commonly used to enhance corn yields. A low 2014 at the Aghili region in the north of Khuzestan Province of nitrogen content in the soil leads to poor absorption of Iran. Soil has been tested by the laboratory that the physical micronutrients by plants, which may be insufficient for the and chemical properties of the study area soil can be seen in complete development of the plant tissue (Szulc, 2013). On the table 1.The experiment was laid out in a split plot with a other hand, an excessive accumulation of mineral nitrogen in randomized complete block design (RCBD) with four the soil poses a risk of water pollution as a result of nitrate replications. The treatments included four levels (25, 50, 75, leaching by precipitation (Ladha et al., 2005). Organic manure and 100% the recommended amount) of chemical fertilizer is cheap and could be used as a substitute for chemical application and level (Control and 100%) of bio fertilizer fertilizers (Delate & Camberdella, 2004). The application of application, which were the main factors. The sub factor was bio fertilizers has become of great necessity to get a yield of three types of maize hybrids viz single cross 704, single cross sufficient high quality and to avoid environmental pollution 701(SLD45/1/2-1× MO17), and single cross Mobin (SLD (Shevananda, 2008).Biological fertilizers are obviously an 45/1/2-1× SLH 2/29/14/2-4/1). The plots were prepared for the important part of a sustainable agricultural system and have an maize to be planted by plowing, fertilizing, and leveling. The important role in crop production by maintaining soil fertility size of each plot was 6×5 m² and each block has 12 treatments. (Chen, 2006). According to Zeid (2008), a compound organic For the experiment, the distance between rows to rows was 75 fertilizer and urea or a combination of urea and polyamines cm with six rows per treatment, and irrigation was applied significantly enhanced yield, growth, and the chlorophyll when the plants required it. The main factor had four levels index. related to the chemical and bio-fertilizers applied while there were three levels representing the maize hybrids for the sub The use of renewable resources and inputs is one of the factor. The applications of the chemical fertilizers were made fundamental principles of sustainable agriculture that enables up of urea, triple superphosphate, and potassium sulphate at maximum crop productivity and minimal environmental risk levels of 46%, 46%, and 50% respectively, while nitroxin (Kizilkaya 2008). At present in Iran, diverse maize genotypes (Azospirillum sp., Pseudomonas sp., and Azotobacter sp.) and i.e., single cross and double cross hybrids, synthetics, and biosuperphosphate microbial (including Baccilus caogulans) composites, are being grown. These genotypes respond were the bio-fertilizers that were applied in the form of seed differently to various agro management practices, especially inoculation and fertilization. The bio-fertilizers were applied plant density and nutrition management. There are many together with the irrigation water at the eight leaf stage.

Table 1Soil’s chemical and physical properties

Depth EC PH OC ( %) ppm) ) P ppm)) K Clay (%) Sand (%) Silt (%) Texture (Ms/cm) 0-30 4.07 8.46 0.507 8 180 24 34 42 Loam 30-60 2.69 8.5 0.351 7 170 24 34 42 Loam

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Effects of Integrated Management of Bio and Chemical Fertilizers on yield of Maize Hybrids (Zea mays L.) 423 Table 2 Results of ANOVA of component yield and maize yield.

Source of variance df 1000 - grain Number of grains Number of Grain Biological Harvest weight per row rowsper ear yield yield index

Year 1 113800** 3661.97** 7.0313* 112.575* 736.160** 467.67** Block(year) 6 4196ns 44.67ns 0.6967ns 17.190* 42.642* 84.69ns Fertilization 3 654ns 3.93ns 3.1346ns 3.822ns 31.145* 43.58ns Year× Fertilization 3 4486ns 55.42ns 0.7089ns 6.512ns 21.916ns 89.98ns Error 18 1481 24.22 1.3774 3.515 10.145 52.15 Hybrid 2 18059** 1219.97** 25.8256** 47.742** 58.628* 204.27* Year× Hybrid 2 2003ns 99.56** 0.7181ns 15.210* 94.983** 215.53* Fertilization × Hybrid 6 1296ns 20.88ns 1.0911ns 6.028ns 7.466ns 142.86* Fertilization × 6 3828** 58.91* 0.6745ns 7.632ns 20.688* 83.42ns Hybrid× Year Error 48 285.02 3.8654 0.4329 0.8297 2.18 15.49 C.V (%) - 6.11 3.91 3.38 7.11 6.25 8.02 Ns represents to Not-significant, ** = significant at 0.01% and * significant at 0.05%

To record the grain and biological yield data, the two central was the highest while the 100% chemical fertilizer alone gave rows in each treatment were harvested, sun dried, then dried in the amount of11, 165kg/ha, which was the lowest yield. The an oven with a temperature of 70°C for 48 hours, and weighed. results of the interaction of bio and chemical fertilizer Harvest index was calculated by the following formula. The applications on the hybrids’ yield and yield components are recorded data were statistically analyzed using the Minitab 14, shown in table 4. The bio-fertilizer with H1F4 treatment MSTAT-C version 2.10 software. The purpose of the analysis resulted in the maximum yield of 12,875 kg/ha, while the 50% of variance was to determine the significant effect of the chemical fertilizer with 100% biological fertilizer from H1F3 treatments on the corn. Dancan’s tests were used at 5% level gave the second greatest yield of 12,385 kg/ha. It has been for the average separation of the parameters. reported that the amount of chemical fertilizer can be reduced Harvest index = grain yield/biological yield×100 by 50% when a phosphate soluble and growth promoting bacteria are applied to corn without reducing the yield 3 Results and discussion (Yazdani et al., 2009). Other studies determined that plant growth was improved even when the nitrogen fertilizer applied 3.1 Grain Yield (kgha-¹) was reduced by 30-35% as long as the seeds had been inoculated with growth promoting bacteria. An increase in the The analysis of variance showed that the two years of testing in biomass of the microbial community was related to the soil terms of grain yield at the 5% level were statistically health as this had an effect on the balance and availability of significant (table2).The difference in the combination of nutrients in the rhizosphere of the roots that lead to a higher chemical fertilizer, biological fertilizer, and yield remained yield (Boddey & Dobereiner, 1988; El-kholy et al., 2005; Biari significant, but according to table 3 50% chemical fertilizer et al., 2008) with100% bio-fertilizer gave 11,715 Kg/ha grain yield, which

Table 3 Effect of individual application of chemical and biofertilizers on various growth parameters of the corn plants.

Treatments 1000 - grain Number of grains Number of row Grain yield Biological yield Harvest index weight (g) per row per ear (kgha-¹) (kgha-¹) (%) b a a d d a F1(control) 330.95 32.69 14.18 11165 19580 57.37 b a a c c a F2 330.25 32.68 14.17 11230 19720 57.4 a a a a a a F3 336.55 32.82 14.63 11715 21075 56.18 b a a b b a F4 332.70 32.34 14.24 11260 20065 56.24 b a a a a a H1(control) 317.35 34.65 14.36 12140 21005 58.19 a b a c c a H2 339.25 29.5 14.8b 10840 19680 55.37 a ab a b b a H3 340.95 31.98 13.79 11070 19710 56.77 Results are mean of four replicates; Means in each column followed by similar letter (s) are not significantly different at 5% probability level using Dancan’s Test; F1 (100% chemical fertilizers); F2 (100% Biological and 75% chemical fertilizers); F3 (100% Biological and 50% chemical fertilizers); F4 (100% Biological and 25% chemical fertilizers); H1 (Single cross 704); H2 (Single cross Mobin); H3 (Single cross 701)

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

424 Nouraki et al

Table 4 Effect of combined application of chemical and biofertilizers on various growth parameters of the corn plants.

Treatments 1000 - grain Number of Number of Grainyield Biological yield Harvest index weight (g) grains per row rowsper ear (kgha-¹) (kgha-¹) (%)

f a cd e g ab H1F1(control) 307.00 36.60 14.10 11580 19860 58.74 a cd ab g i b H2F1 346.00 29.14 14.99 11105 19480 57.42 b b e i h bc H3F1 341.05 32.63 13.51 10990 19510 56.64 f a c c b bc H1F2 310.85 35.68 14.46 11820 21220 56.31 c c cd j l b H2F2 335.40 30.49 14.00 10870 19005 57.25 b b de h k ab H3F2 341.85 32.21 13.72 11100 19030 58.95 e a cd b a ab H1F3 321.55 36.34 14.00 12385 21860 57.56 b c a f e c H2F3 341.85 30.10 15.11 11205 20300 55.57 a b cd d d c H3F3 346.15 32.01 14.04 11585 21055 55.39 d a c a c a H1F4 327.40 37.50 14.23 12875 21180 60.5 c d b l f d H2F4 333.65 28.25 14.68 10215 19935 51.21 c b d k j b H3F4 337.05 31.26 13.80 10680 19085 57.01 Results are mean of four replicates; Means in each column followed by similar letter (s) are not significantly different at 5% probability level using Dancan’s Test; F1 (100% chemical fertilizers); F2 (100% Biological and 75% chemical fertilizers); F3 (100% Biological and 50% chemical fertilizers); F4 (100% Biological and 25% chemical fertilizers); H1 (Single cross 704); H2 (Single cross Mobin); H3 (Single cross 701)

3.2 Weight of 1000-grain (gr) cross Mobin. From previous results it can be observed that the use of growth stimulating bacteria and supplement chemical Based on the results of study, in terms of the 1000-grain fertilizer could increase the ear weight, number of rows, and weight, a significant difference was reported at the 1% level. number of seeds per row in corn (Yazdani et al., 2009). Seed The difference for the combination of biological fertilizer with inoculation with Rhizobium bacteria, phosphate solubilizing grain weight was not significant (table2). The hybrid effect on bacteria, and organic modification increased the production of grain weight was significant at the 1% level (table3) given that seed crops (Panwar et al., 2006). they were in a statistical range, but the Karun single cross hybrids had the highest amount of 340.95gr.The highest 1000 3.4 Number of Rows per Ear grain weight (336.55 gr) was recorded (table 2) for the combination of 50% chemical fertilizer with 100% biological The results of the ANOVA from table 2 revealed that only fertilizer and single cross 701(Karun) with 50% integrated tested hybrids at the 1% significant level had an effect on the fertilization as the amount of 346.15gr, which was the second number of rows per ear (table 1) and the other main effects and highest treatment. In addition, Dhillon et al. (1980) and interactions on the number of kernel rows per ear was not- Gholami et al. (1999) reported an increase in seed weight in significant. According to table 3, highest number of rows, with the presence of biological fertilizer. Research has also reported 14.36, belonged to the hybrid (Single cross 704). According to an increase in the grain weight of corn from an application of the results presented in table 4 the hybrid combination of 50% biological fertilizer (Mohammed et al., 2001). chemical fertilizer and biological fertilizer had 15.11 and the hybrid with 100% chemical fertilizer had 14.99 tows per ear 3.3 Number of Grains per Row and it was the highest, while the Karun treatment with100% chemical fertilizer had the lowest value of 13.51 for the The number of grains is an important yield contributing trait number of kernel rows per ear. Hamidi et al. (2007) and that can greatly affect the economic return. Based on the Nassiri Rad et al. (2011) increased the number of rows per ear results of testing number of kernels per row, there is a of corn with seed inoculation by Azotobacter and Azospirillum significant difference at the 1% level (table2). The difference species. for the combination of biological fertilizer on the number of grains per row was not significant. The hybrid impact on the 3.5 Biological Yield (kgha-¹) number of kernels per row has significant effect at the 1% level (table 3), so that the single cross 704 had the highest number Based on the results of the two years of testing in terms of the (36.45) and the Mobin hybrid had the lowest number (29.5) of biological yield at the 1% level, a significant difference was kernels per row. According to table 4, the highest number of reported among various traits (table 2).The difference for the kernels per row belonged to hybrid 704 with the 25% chemical combination of biological fertilizer on the biological yield was fertilizer and biological fertilizer (37.50) and the minimum significant at the 5% level. As shown in table 3, 50% chemical (28.25) number of grains per row was recorded in the 25% fertilizer with biological fertilizer gave 21,075kg/ha biological chemical fertilizer with 100% biological fertilizer and single yield and it was the highest while 100% chemical fertilizer

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Effects of Integrated Management of Bio and Chemical Fertilizers on yield of Maize Hybrids (Zea mays L.) 425 alone gave an amount of19,580kg/ha as the lowest yield. The growth promoting rhizobacteria in arid region of Iran. Journal hybrid effect on the yield was significant at the 5% level; as of Biological Sciences 8:1015-1020. DOI: shown in table 3 single cross 704 had a value of 21,005 kg/ha 10.3923/jbs.2008.1015.1020. as the highest and the Mobin hybrid with the amount of19,680 kg/ha was the lowest yield. According to the analysis of the Boddey RM, Dobereiner J (1988) Nitrogen fixation association variance, there was no significant interaction between the with grasses and cereals: Recent results and perspective for fertilizer and hybrid traits, but according to the results in table future research. Plant and Soil 108: 53-65. DOI: 4 the largest treatment belonged to the hybrid 704, with 50% 10.1007/BF02370099. chemical fertilizer with the biological fertilizer and the amount of 21,860kg/ha. These findings are similar to those reported by Bundy LG, Carter PR (1988) Corn hybrid response to nitrogen Ullah et al. (2008) and Enan (2009). fertilization in northern Corn Belt. Journal of Production Agriculture 1 : 99-104. 3.6 Harvest Index (%) Chen J (2006) The combined use of chemical and organic The physiological ability of a hybrid to convert total dry matter fertilizers and/or bio-fertilizer for crop growth and soil fertility. in to grain yield is determined by its harvest index (HI). The International Workshop on Sustained Management of the Soil data (table 2) revealed that a significant effect on the harvest Rhizosphere System for Efficient Crop Production and index was observed among the hybrids and interaction Fertilizer Use held on 16-20 October, 2006 at Thailand Pp. 11. treatments, but there was no significant affect among the fertilization treatments. According to table 3, the single cross Delate K, Camberdella CA (2004) Agro-ecosystem 704 had the highest harvest index of 58.19. performance during transition to certified organic grain production. Agronomy Journal 96: 1288-1298. Conclusion doi:10.2134/agronj2004.1288.

Results of this study indicated that various treatments have Dhillon G, Kler GS, Walia AS, Chahal VPS (1980) Effect of significant effect on the grain yield and yield components. Azotobacterchroococcumand seed size on growth and yield of According to the results bacteria have positive role in the maize. India Journal of Agronomy 25:244-2490 production of bio-fertilizers and hormones which play a significant role in regulating plant growth while mixing them El-Douby KA, Ali EA, Toaima SEA (2001) Effect of nitrogen with chemical fertilizers as a supplement the level and depth of fertilizer defoliation and plant density on maize grain yield. the roots. This combination also increases the rate of water and Egypt Journal of Agricultural Research., 79: 965-981. nutrient absorbance which raise the rate of growth and photosynthesis. These combination also increase the grain El-Kholy MA, El-Ashry S, Gomaa AM(2005)Biofertilization yield, yield components, and biological function, it has been of Maize Crop and its Impact on Yield and Grains Nutrient found that bio-fertilizers can be combined with chemical Content under Low rats of Mineral Fertilizers. Journal of fertilizers in a complementary way to reduce the excessive Applied Sciences Research 1: 117-121. amount of chemical fertilizers used to grow corn. It was shown that the mixing of biological fertilizers with chemical Enan MR (2009) Genotoxicity of the herbicide 2, 4- fertilizers could reduce the needs of chemical fertilizers upto dichlorophenoxyacetic acid (2, 4-D): Higher plants as 25% and these results are comparable to the application of monitoring systems, American-Eurasian Journal of Sustainable 100% chemical fertilizers. Therefore, the best hybrid maze is Agriculture 3: 452-459 the single cross 704 that has good yield potential when the chemical fertilizer is used at either 25% or 50% of the current Gholami A, Kochaki A, Mazaheri D, Ghalavand A (1999) application when mixed with the bio-fertilizer. Assessment effect of different strain Micorhiza on growth maize Iran. Crop Science Journal 3:45-47. Conflict of interest Hamidi A, Ghalavand A, DehghanShoar M, Malakuti MJ, Authors would hereby like to declare that there is no conflict of Asgharzadeh A, Chokan R (2007) The effects of application of interests that could possibly arise. plant growth promoting rhizobacteria (PGPR) on the yield of fodder maize (Zea mays L.) Pajouhesh & Sazandegi 70: 16-22. References Kizilkaya R (2008) Yield response and nitrogen concentration Balasubramaniyan P, Palaniappan SP (2001)Nutrient of spring wheat inoculated with Azotobacter chroococcum management. In: Principles and practices of agronomy. strains. Ecological Engineering 33:150-156. Agrobios, India. 185- 188. Kusaksiz T (2010) Adaptability of some new maize (Zea mays Biari A, Gholami A, Rahmani HA (2008) Growth promotion L.) cultivars for silage production as main crop in and enhanced nutrient uptake of maize by application of plant

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

426 Nouraki et al

Mediterranean environment. Turkish Journal of Field Crops 15 Shevananda ( 2008) Influence of bio-fertilizers on the : 193-197. availability of nutrients (N, P and K) in soil in relation to growth and yield of Stevia rebaudiana grown in South India. Ladha KJ, Pathak H, Krupnik TJ, Six J, van Kessel C (2005) International Journal of Applied Research in Natural Products Efficiency of fertilizer nitrogen in cereal production: 1: 20-24. Retrospects and prospects. Advances in Agronomy 87: 85-156. doi:10.1016/S0065-2113(05)87003-8. Singh DK, Pandey AK, Pandey UB, Bhonde SR (2002) Effect of Farmyard Manure Combined with Foliar Application of Mohammed AS, AbdelMonem MA, Khalifa HE, Beider M, NPK Mixture and Micronutrients on Growth, Yield and ElGhandour IA, Galal YGM (2001) Using biofertilizers for Quality of Onion. Newsletter-National Horticultural maize production : response and economic return under Research and Development Foundation 21-22 :1-7. different irrigation treatments. Journal of Sustainable Agriculture19:41-48. Szulc P ( 2013) Effects of soil supplementation with urea and magnesium on nitrogen uptake, and utilization by two different Naserirad H, Soleymanifard A, Naseri R (2011) Effect of forms of maize (Zea mays L.) differing in senescence rates. integrated application of bio-fertilizer on grain yield, yield Polish Journal of Environmental Studies 22 : 239 -248. components and associated traits of maize cultivars. American- Eurasian Journal of Agricultural and Environmental Science 10 : 271-277. Ullah W, Khan MA, Arifullah SH, Sadiq M (2008) Evaluation of integrated weed management practices for maize. Pakistan Panwar AS, Singh NP, Saxena DC, Hazarika UK (2006) Yield Journal of Weed Sciences Research14: 19-32. and quality of groundnut seed as influence by phosphorus, biofertilizer and organic manures. Indian Journal of Hill Yazdani M, Bahmanyar MA, Pirdashti H, Esmaili MA (2009) Farming 15:68-71. Effect of phosphate solubilization microorganisms and plant growth promoting rhizobacteria on yield and yield components Rahmany H, Nouraki F (2015) Effect of replacing of corn. International Journal of Biological and Life Sciences Nicosulfuron and Foramsulfuron plus Cultivation instead of 1: 2-6 Atrazin and Alachlor in Maize (S.c.704) in the North of Khuzestan in Iran. International Journal of Agriculture and Zeidan MS, Amany A, Bahr-El- Kramany MF (2006)Effect of Crop Sciences 8 : 302-306. Nfertilizer and plant density on yield and quality of maize in sandy soil. Research Journal of Agriculture and Biological Scharf PC, Wiebold WJ, Lory JA (2002) Corn yield response Sciences 2: 156-161. to nitrogen fertilizer timing and deficiency level. Agronomy Journal 94 : 435-441.DOI: 10.2134/agronj2002.0435 Zeid IM (2008) Effect of arginine and urea on polyamines content and growth of bean under salinity stress. Acta Physiologiea Plantarum 28: 44-49

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Journal of Experimental Biology and Agricultural Sciences, June - 2016; Volume – 4(IV)

Journal of Experimental Biology and Agricultural Sciences

http://www.jebas.org

ISSN No. 2320 – 8694

EFFECT OF BENZYLADENINE AND SALICYLIC ACID ON BIOCHEMICAL TRAITS OF TWO CULTIVARS OF CARNATION

1 1,* 2 3 Anita Ramtin , Sepideh Kalatejari , Roohangiz Naderi and Mohammad Matinizadeh

1Department of Horticulture, Science and Research branch, Islamic Azad University, Tehran, Iran 2Department of Horticultural Sciences, Faculty of Agricultural Sciences and Natural Resources, University of Tehran, Karaj, Iran 3Department of Forest, Research Institute of Forest and Rangelands, Tehran, Iran

Received – February 11, 2016; Revision – April 30, 2016; Accepted – May 12, 2016 Available Online – June 30, 2016

DOI: http://dx.doi.org/10.18006/2016.4(4).427.434

KEYWORDS ABSTRACT Carnation Plant growth regulators have significant effect on the delaying senescence in buds and flowers. Present Benzyladenine study was conducted to find out the effects of Salicylic acid and Benzyl adenine spraying on various biochemical traits such as membrane stability index, chlorophyll a, and b content, total chlorophyll Salicylic Acid content, sugar content, catalase, and peroxidase enzymes activity, and proline content in Carnation. Study was conducted in a split plot design with three replications and various concentrations of Spraying hormones, cultivars of carnation and measurement time was used as a factor of interaction. Results of study showed that all the traits were significantly affected by spraying of these tow hormones. Cultivar Biochemical traits factor was most effective in chlorophyll a, b, and total chlorophyll content, catalase enzyme activity, proline content and sugar content. Among these two hormones, spraying of Salicylic acid @ 100 µM was found most effective treatment. Further, time of measurements and cultivar factors were also found effective in all of traits.

All the article published by Journal of Experimental * Corresponding author Biology and Agricultural Sciences is licensed under a E-mail: [email protected] (Sepideh Kalatejari) Creative Commons Attribution-NonCommercial 4.0 International License Based on a work at www.jebas.org. Peer review under responsibility of Journal of Experimental Biology and Agricultural Sciences.

Production and Hosting by Horizon Publisher India [HPI] (http://www.horizonpublisherindia.in/ ). All ______rights reserved. Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

428 Ramtin et al

1 Introduction richness by stimulating cell division. Lately, numerous postharvest technologies have been established for enhancing Carnation (Dianthus caryophyllus L.) is one of the most postharvest of fresh and perishable products including fruit, popular ornamental flower and it is well known throughout the vegetables and cut flowers. world for its beauty, diversity of colors, excellent keeping quality, and wide flower range (Kharrazi et al. 2011). It Salicylic acid is a messenger molecule regulating belongs to family Caryophyllaceae and has more than 300 developmental procedures and it control the biotic and abiotic species (Jurgens et al., 2003). Members of the genus Dianthus stresses (Zarghami et al. 2014). It also inhibiting ethylene are fairly diverse, as their origins range from Southern Russia biosynthesis and delaying fruit senescence (Kademi & Ershadi to Alpine Greece and the Auvergne mountains of France. The 2013). Further, responses of environmental stresses in plants Dianthus species are adapted to the cooler Alpine regions of could be modulated by salicylic acid signaling (Yao & Tian, Europe and Asia, and are also found in Mediterranean coastal 2004; Supapvanich & Promyou, 2013; Ramtin et al., 2015). regions (Australian Government 2006). The genus Dianthus The purpose of this experiment was to study effects of these contains both annual and perennial caespitose plants; among plants growth regulators spray on important biochemical these some of its species are cultivated for hundreds of years characteristics of two carnations cultivars with time concern. for ornamental purposes. Modern cut-flower varieties of carnation have been selected for its flower size, petal number, 2 Materials and methods stem length, and disease resistance. Since 19th century, it is extensively produced for commercial purpose under field and Study was conducted under greenhouse condition at the in green house conditions. After transferring germplasm to USA, Tehran, Iran. The experimental design was complete carnation breeding and growing for the cut-flower market randomized design (CRD) in a split plot design with three became very popular in the USA (OGTR 2006). replications. Various concentration of growth regulators (SA 50µM, SA 100 µM, SA 200µM, BA 50 µM, BA 100 µM, Regulation of the growth of ornamental plants for commercial BA150 µM, and Control), different cultivars (Spray, and purposes is a vital aspect in the ornamental production. Both Standard), and three measured times (3 days after harvest, 6 practical requirements and aesthetic aspect must be considering days after harvest, and 9 day after harvest) was taken as a in order supplying high quality product for buyers (John Carey factor of interaction, indicating change of important enzymes & Mark 2008). According to Arias & López (2010), method and substances in cut carnation during postharvest. Spraying used for commercial production should always favor the on plants were two times, first spraying was before bud improvement in visual (size, compactness, branching, color, opening and another spraying was three days before harvest. etc.) and physiological quality (resistance to stresses, leaving Membrane stability index were determined by method the rest, improve the postharvest, etc.) of carnation. Breeding described by Sairam (1994), while chlorophyll a, chlorophyll b of carnation is not an easy task because of flower texture, its and total chlorophyll content was determined by the method flowers are normally protandrous and outcross occurred given by Arnon (1967) with some modification. Further, sugar typically (Behroozian et al. 2013). Further, stem and leaf content by Dey (1990), catalase, and peroxidase enzymes tissues of carnation plants also contain natural antisenescence activity by Rani et al. (2004), and proline content was factors which is also an obstacle in the large scale production estimated by Bates et al. (1973). (Isinger 1977). Now in these days, commercial flower producer used various plant growth regulators for increasing 3 Results delayed senescence of buds, flowers, or leaves (John Carey & Mark 2008). 3.1 Treatment factor

The cytokinins are plant specific phytohormones (Bubán, According to ANOVA (table 1), all the studied traits were 2000) which play a central role in the regulation of cell cycle significantly affected by spraying various concentrations of and numerous developmental processes. These are present in plant growth hormones (p≤0.01). Further, time measurements all plant tissues but are abundant in root tip, shoot apex and factor was also effective on all the studied traits (p≤0.01). immature seeds (Schmülling, 2004). Cytokinins are well Similarly, cultivar factor such as chlorophyll a, b, and total known to defer leaf senescence in carnation and rose flowers. chlorophyll content, catalase enzyme activity, proline content The main group of synthetic cytokinins includes N6 substituted (p≤0.01) and sugar content (p≤0.05) was also effective on. adenines like kinetin (6-furfurylaminopurine), benzyl adenine Among various concentrations, 100 µM concentration of (6-benzylaminopurine, BA), 6-benzylamino-9- salicylic acid caused highest stability in membrane while (tetrahydropyran-2-yl) -9H- purine; PBA (Bubán, 2000). control plants had the lowest stability. A significant effect of Recently, a synthetic cytokinin benzyl adenine (BA) has been benzyl adenine spray was reported on the chlorophyll content released in the U.S. as configure for use on ornamental plants and highest total chlorophyll content was related to 100 µM (John Carey & Mark 2008). It elicits the plant growth and spray of benzyl adenine in return while control plants had the development responses, setting blossoms and stimulating fruit lowest total chlorophyll content.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Effect of benzyladenine and Salicylic Acid on biochemical traits of two cultivars of carnation 429 Table 1 Variance of analysis results for three studied factors.

SOV df Mean of square MSI TChl Chl a Chl b TSS CAT POD Pro Rep 2 33.489 7.0E-7 2.5E-7 4.4E-8 5.9E-9 0.0005 0.0041 5.248 HS 6 1114.3** 2.1 E- 6** 7.3E-7** 1.2E-7** 1.3E-7** 0.002** 0.004** 16.7** HS error 12 26.41 2.2E-9 8.2E-9 1.0E-9 8.0E-10 1.5E-5 0.0003 0.442 MT 2 4647.3** 2.2E-6** 2.8E-7** 4.0E-7** 7.4E-7** 7.6E-5** 0.0007** 1.86** MT*HS 12 28.7** 1.4E-8** 2.3E-8** 3.5E-9** 2.2E-9* 5.1E-5** 4.6E-5 ns 1.98 ** MT error 4 5.075 3.0E-8 1.4E-8 2.2E-9 3.5E-9 0.00004 0.00015 0.828 CV 1 42.21* 1.1E-6** 5.1E-7** 5.2E-7** 2.7E-7** 0.00056** 0.007045** 0.933* HS*CV 6 294.56** 8.8E-8** 3.4E-8** 1.3E-8** 1.4E-8** 0.00035** 0.00045** 1.004** MT*CV 2 879.01** 1.0E-6** 4.1E-7** 5.2E-8** 3.2E-8** 0.0001** 0.0007** 2.494** MT*HS*CV 12 8.76 ns 1.5E-8** 3.2E-8** 3.2E-9** 5. 8E-9** 0.00003** 0.00002ns 0.448** CV error 2 249.86 9.9E-7 3.8E-7 4.7E-8 4.9E-9 0.0014 0.00008 0.0564 Total 64 6.86 4. 9E-9 5.3E-9 9.6E-10 1.1E-9 9.7E-6 0.00004 0.1589 * Significant at P ≤ 0.05; **, Significant at P ≤ 0.01, ns= non-significant; here Membrane stability index (MSI), Total chlorophyll content (TChl), chlorophyll a content (Chl a), chlorophyll b content (Chl b), Total soluble sugar (TSS), Catalase activity (CAT), Peroxidase Activity (POD), Proline content (Pro), Hormone spraying (HS), Measured time (MT), Cultivar (CV).

Table 2 Effect of the various hormone concentrations on the various studied characteristics of carnation.

MSI TChl Chl a Chl b TSS CAT POD Pro SA 50μM 53.027a 0.00166c 0.000829c 0.000424d 0.00074a 0.0297b 0.0459bc 4.1417b SA 100μM 56.563a 0.00187b 0.001019a 0.000538a 0.00073a 0.0474a 0.07365a 4.524a SA 200μM 45.715c 0.00124e 0.000613d 0.000371e 0.000597c 0.0200c 0.0491b 4.2512b BA 50μM 44.594c 0.00152d 0.000816c 0.000445c 0.000628b 0.0232c 0.0369d 3.2167d BA 100μM 49.795b 0.00192a 0.000961b 0.000514b 0.000617 bc 0.03122b 0.0435c 3.7368c BA 150μM 38.923d 0.00127e 0.000625d 0.000385e 0.000564d 0.0176d 0.03147d 2.4952e Control 34.001e 0.00102f 0.000461e 0.00031f 0.00051e 0.0135e 0.02750e 1.9527f Means in a column followed by the same letter are not significantly different at 5% level; results are the mean of three replicates

Table 3 Effect of the time periods on the various growth characteristics of carnation.

MSI TChl Chl a Chl b TSS CAT POD Pro 1st Time 57.532a 0.00172a 0.0009a 0.000497a 0.000732a 0.0279a 0.0484a 3.66779a 2nd Time 43.894b 0.0015b 0.00073b 0.000466b 0.000669b 0.0256b 0.0433b 3.50412a 3rd Time 36.84c 0.00126c 0.0007b 0.000316c 0.000477c 0.0255b 0.0402c 3.25019b Means in a column followed by the same letter are not significantly different at 5% level, results are the mean of three replicates.

Also chlorophyll a, b content under the influence of 100µM spray of 100 µm salicylic acid while the least activity was salicylic acid, increased to the highest value although the caused by spraying benzyl adenine 150 µM, and control. Also lowest content of chlorophyll a, b was related to control. spraying salicylic acid 100 µM raised the value of proline Spraying with salicylic acid improved sugar content. The content (table 2). highest value of sugar content was gained by Salicylic acid 50, 100 µM treatments. Salicylic acid enhanced catalase enzyme 3.2 Time factor activity that the most catalase activity was gained by spraying salicylic acid 100 µM. Similarly, results of peroxidase enzyme Results of time factor study revealed that value of various activity revealed that the enzyme activity was increased by studied factors changes with the time (p≤0.01) (table 1) and spraying salicylic acid and the highest activity was related to this value was decreased with the passing of time (table 3).

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

430 Ramtin et al

Table 4 Mean comparison of carnation cultivars and its effects on various characters.

MSI TChl Chl a Chl b TSS CAT POD Pro Spray 45.5097b 0.001405b 0.00082a 0.00036b 0.00058b 0.02424b 0.03652b 3.38797b Standard 46.6673a 0.00159a 0.00069b 0.00049a 0.00067a 0.02848a 0.05148a 3.5601a Means in a column followed by the same letter are not significantly different at 5% level; results are the mean of three replicates.

Table 5 Effect of the double interaction between hormone*cultivar on various studied traits of carnation.

Double interaction MSI TChl Chla Chlb TSS CAT POD Pro (Hormone*Cultivar) SA50μM * spray 48.858cd 0.00154e 0.000729e 0.000465b 0.000808a 0.029474b 0.041074e 4.197423b SA50μM * standard 57.197b 0.00179c 0.000929c 0.000382c 0.000668b 0.02996b 0.050746d 4.085926bc SA100μM * spray 50.609c 0.00174c 0.000927c 0.000516ab 0.00064bc 0.047305a 0.064623b 4.334373b SA100μM * standard 62.518a 0.00202a 0.001112a 0.000561ab 0.000822a 0.047428a 0.082686a 4.71358a SA200μM * spray 47.642cd 0.00120g 0.000500g 0.000304d 0.000564c 0.022577c 0.032873f 3.947815bc SA200μM * standard 43.789d 0.00129g 0.000726e 0.000439b 0.000632bc 0.021379c 0.065262b 4.554606ab BA50μM * spray 42.552d 0.00138f 0.000788e 0.000357c 0.000589c 0.021529c 0.033678f 3.218254c BA50μM * standard 46.636cd 0.00166d 0.000841d 0.000533ab 0.000668b 0.024826bc 0.040101e 3.215047c BA100μM * spray 47.766cd 0.00189b 0.000876d 0.000586a 0.000564c 0.019314d 0.031779f 3.306853c BA100μM * standard 51.826c 0.00196a 0.001046b 0.000443b 0.000670b 0.043129a 0.055149c 4.166836b BA150μM * spray 36.307e 0.00110h 0.000635f 0.000284d 0.000536c 0.016115e 0.027472g 2.760892d BA150μM * standard 41.539d 0.00144f 0.000614f 0.000487b 0.000591c 0.018955de 0.035467f 2.229564d Ctrl * spray 28.630f 0.00093i 0.000441h 0.000252d 0.000499d 0.013236f 0.024158g 1.950168e Ctrl * standard 39.372de 0.00110h 0.00048h 0.00036c 0.0052d 0.01378ef 0.03093f 1.95512d Means in a column followed by the same letter are not significantly different at 5% level; results are the mean of three replicates.

Table 6 Effect of the double interaction between hormone*measuring time double interaction on studied traits of carnation.

(Hormone*Measuring time) MSI TChl Chla Chlb TSS CAT Pro SA50µM * 1sttime 61.8100ab 0.00184bc 0.000873de 0.000514b 0.000825a 0.03028de 4.5949bc SA50µM * 2ndtime 50.6633bc 0.00168cd 0.000823ef 0.000472bc 0.000796ab 0.03101de 3.9299ef SA50µM * 3rdtime 46.6083c 0.00147e 0.000791efg 0.000285h 0.000593def 0.02786def 3.9002ef SA100µM * 1sttime 64.8867a 0.00207ab 0.001086a 0.000591a 0.00084a 0.054845a 4.9021a SA100µM * 2ndtime 55.0667b 0.00186bc 0.001006abc 0.000585a 0.000803ab 0.0443b 4.7575ab SA100µM * 3rdtime 49.7370cde 0.00169cd 0.000967bc 0.000439bcd 0.000551fg 0.04295bc 3.912345ef SA200µM * 1sttime 57.8600b 0.00152d 0.000731fghi 0.000458bcd 0.000701cd 0.021981efg 4.36244cd SA200µM * 2ndtime 43.8280cd 0.00129g 0.000642hi 0.000416cde 0.000633cde 0.021848efg 4.193794cde SA200µM * 3rdtime 35.4583d 0.00092h 0.000466l 0.000239hij 0.000459hi 0.022104efg 4.197395cde BA50µM * 1sttime 57.1383b 0.00170cd 0.00089de 0.000516b 0.000746c 0.023508efg 4.011608ef BA50µM * 2ndtime 42.5617cd 0.00155d 0.000801efg 0.000481bc 0.000655cde 0.023436efg 3.087849hi BA50µM * 3rdtime 34.0817d 0.00131f 0.000753fgh 0.000338fg 0.000485h 0.022588efg 2.550495jkl BA100µM * 1sttime 60.2833ab 0.00212a 0.001045ab 0.000597a 0.000747c 0.03566d 4.20515cde BA100µM * 2ndtime 47.7433c 0.00196b 0.000941bcd 0.000515b 0.000641cde 0.028069def 3.7409efg BA100µM * 3rdtime 41.3600cd 0.00170cd 0.000897de 0.000431bcd 0.000462hi 0.0299de 3.2645h BA150µM * 1sttime 53.0200bc 0.00152d 0.000713fghi 0.000454bcd 0.000665cde 0.01587hij 2.8492ij BA150µM * 2ndtime 36.0200d 0.00132f 0.000594hij 0.000446bcd 0.000609def 0.017609ghi 2.6575jk BA150µM * 3rdtime 27.7283e 0.00097jk 0.000568ijk 0.000257hi 0.000418ij 0.019126gh 1.979m Ctrl * 1sttime 47.7230c 0.00127ghi 0.000632hi 0.000359f 0.000603def 0.01325hijk 1.8815m Ctrl * 2ndtime 31.3750de 0.00102g 0.000458l 0.000344fg 0.000547fg 0.01422hijk 2.9141ij Ctrl * 3rdtime 22.9050e 0.00076m 0.000293m 0.000224ijk 0.000373jk 0.01305hijk 1.0624n Means in a column followed by the same letter are not significantly different at 5% level; results are the mean of three replicates.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Effect of benzyladenine and Salicylic Acid on biochemical traits of two cultivars of carnation 431 Table 7 Effect of the double interaction between measuring time * cultivar double interaction on studied traits of carnation.

Double interaction MSI TChl Chla Chlb TSS CAT POD Pro (measuring time*cultivar) 1sttime * spray 52.84b 0.001668ab 0.0007c 0.000474b 0.000692b 0.0268ab 0.05215a 3.4745b 1sttime * standard 62.22a 0.001769a 0.001a 0.000555a 0.000773a 0.0294a 0.05219a 3.8610a 2ndtime * spray 46.75c 0.001445b 0.00081b 0.000378c 0.000647bc 0.0290a 0.03652c 3.249c 2ndtime * standard 41.04d 0.001607ab 0.000647d 0.000521a 0.000691b 0.0242b 0.05009ab 3.446bc 3rdtime * spray 33.27e 0.001001c 0.000657d 0.000235d 0.000401d 0.0216c 0.02840d 3.054d 3rdtime * standard 40.41d 0.001516b 0.000742c 0.000397c 0.000554c 0.0270ab 0.04464b 3.759ab Means in a column followed by the same letter are not significantly different at 5% level; results are the mean of three replicates.

3.3 Cultivar factor benzyl adenine 100 µM × 1st time of measurement × standard carnation while the value of chlorophyll a content, Total Results of cultivar factor study revealed that cultivars reaction solvable sugar content, catalase enzyme activity, and proline to treatments in measured traits were significantly different content were higher under the influence of salicylic acid 100 with cultivars (p≤0.01). Generally standard cultivar gained the µM × 1st time of measurement × standard carnation. (table 8). higher value in all the traits except chlorophyll a content, which was reported higher in the spray cultivar (table 4). 4 Discussions

3.4 Interaction effects The results of this research are coordinated with other published reports. According to Hamidimoghadam et al. Results of study showed that membrane stability index, (2014) studied effects of nano-silver, gibberellic acid and chlorophyll a, b, total chlorophyll, sugar content, catalase, benzyl adenine on some postharvest quality characteristics and peroxidase enzymes activity and proline content were affected vase life of ‘Pinkcastellaro’ carnation cut flowers. They by double interaction (spraying hormones × cultivars) indicated that singular applying of GA3, NS, and BA showed a (p≤0.01). Among these, double interaction of salicylic acid 100 better influence on quality and vase life of 'Pinkcastellaro' µM × standard carnations, got the highest values in membrane carnation cut flower. Asil & Karimi (2010) applied Benzyl stability index, total chlorophyll, chlorophyll a, total solvable adenine (0, 25, 50 or 75 mg L-1) for improving quality and vase sugar content, catalase, peroxidase enzymes activity and life of cut Eustoma flowers. It has been reported that all proline content while interaction of benzyl adenine 100 µM × mentioned concentration of benzyladenine prolonged the vase standard carnations improved the value of chlorophyll b life, although, spraying 25, 50 mgL-1 benzyladenine were more content only (table 5). effective on extending vase life of cut Eustoma flowers, decreasing ethylelne production, reducing leaves chlorophyll Similarly, double interaction of spraying hormones and time and anthocyanin degradation beside that positive effects of caused changes in all of considered traits except peroxidase salicylic acid on retarding flower senescence was represented enzyme activity. Interaction of salicylic acid 100 µM × 1st (Ezhilmathi et al., 2007; Hatamzadeh et al., 2012). time of measurement made the highest values in membrane stability index, chlorophyll a, total solvable sugar content, Ataii et al. (2015) reported that spraying of salicylic acid catalase enzyme activity and proline content. Further, delaying the postharvest senescence of Lisianthus cut flowers. chlorophyll b content, and total chlorophyll content were They reported that this spraying increasing the catalase and reported higher in the interaction of benzyl adenine 100 µM × ascorbate peroxidase activities and reducing lipoxygenase 1st time (table 6). (LOX) enzyme activity as a factor for peroxiding lipids of membrane, vase life could be extended and flower senescence Also double interaction of time and cultivars had significant could be retarded via preserving membrane integrity by influence on all the tested parameters (p≤0.01) and the highest salicylic treatment. Further, Hatamzadeh et al. (2012) reported values of studied traits were related to interaction of 1st time of that Vase solution of 150 mg/L salicylic acid has positive measurement × standard carnation (tab 7). influence in vase life of Gladiolus cut spikes by retarding fresh weight loss and lipid peroxidation and enrich the antioxidant Triple interaction (spraying hormones × time× cultivars) also activity of Peroxidase. Furthermore various studies recognized had an influence on chlorophyll a, b and total chlorophyll, the effects of drought stress, salicylic acid and jasmonic acid sugar content, catalase enzyme activity, and proline content on Hill reaction, chlorophyll a, chlorophyll b, chlorophyll a+b, (p≤0.01). The highest values of studied trait affected by triple -carotene and Xanthophyll were significant on Dracocephalum interaction (spraying hormones × time× cultivars) including moldavica L. total chlorophyll and chlorophyll b content under influence of

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

432 Ramtin et al Table 8 Effect of the triple interaction between hormone*measuring time * cultivar double on various studied traits of carnat ion.

Triple interaction TChl Chla Chlb TSS CAT Pro SA 50 µM * 1sttime * spray 0.00187cd 0.00106bc 0.00051hij 0.00080def 0.0308ij 4.8450b SA 50 µM * 1sttime * standard 0.00181def 0.00068kl 0.00052hi 0.00086bc 0.0298ijk 4.3448cd SA 50 µM * 2ndtime * spray 0.00160hi 0.00095def 0.00038p 0.00078defg 0.0295ijk 3.9438cde SA 50 µM * 2ndtime * standard 0.00175fg 0.00064lm 0.00056de 0.00081de 0.0326i 3.9161cde SA 50 µM * 3rdtime * spray 0.00113qrs 0.00078hij 0.00025w 0.00043rst 0.0282kl 3.8035def SA 50 µM * 3rdtime * standard 0.00181def 0.00087fgh 0.00032st 0.0008fgh 0.0276klm 3.9969cde SA 100 µM * 1sttime * spray 0.002067b 0.00099cde 0.00060ab 0.00075fghi 0.0530b 5.1715a SA 100 µM * 1sttime * standard 0.002078b 0.00117a 0.00057bcd 0.00094a 0.0567a 5.2208a SA 100 µM * 2ndtime * spray 0.00176fg 0.00113ab 0.00058bc 0.00073ghi 0.04743d 4.2943cd SA 100 µM * 2ndtime * standard 0.00197bc 0.00081hij 0.00061ab 0.00088b 0.04117ef 4.6328bc SA 100 µM * 3rdtime * spray 0.00138lmn 0.00104bcd 0.00037pq 0.00045rs 0.03815g 3.5375defg SA 100 µM * 3rdtime * standard 0.00199bc 0.00097def 0.00051hij 0.00066jk 0.04776d 4.2874cd SA 200 µM * 1sttime * spray 0.00159hi 0.00098def 0.00041no 0.00068j 0.02515mn 4.5776bc SA 200 µM * 1sttime * standard 0.00144kl 0.00049pq 0.00051hij 0.00072hi 0.01881opqr 4.1474cd SA 200 µM * 2ndtime * spray 0.00123opq 0.00068kl 0.00033s 0.00063jk 0.02258no 3.6984def SA 200 µM * 2ndtime * standard 0.00135mno 0.00060lmn 0.00050ijk 0.00064jk 0.02112op 4.6893bc SA 200 µM * 3rdtime * spray 0.00078w 0.00052op 0.00017y 0.00039tuv 0.02000opq 3.5676defg SA 200 µM * 3rdtime * standard 0.00106rst 0.00041qr 0.00031stu 0.00053nop 0.02421mno 4.8273b BA 50 µM * 1sttime * spray 0.00173fg 0.00101cde 0.00048kl 0.00072hi 0.02318no 4.2282cd BA 50 µM * 1sttime * standard 0.00166fgh 0.00077hij 0.00055ef 0.00077efg 0.02384mno 3.7951def BA 50 µM * 2ndtime * spray 0.00141klm 0.00084hi 0.00036qr 0.00065jk 0.02153op 3.2834efg BA 50 µM * 2ndtime * standard 0.00170fgh 0.00067kl 0.00060ab 0.00066jk 0.02535mn 2.8923ghi BA 50 µM * 3rdtime * spray 0.00100stu 0.00067kl 0.00023x 0.00040tu 0.01988opq 2.1432kl BA 50 µM * 3rdtime * standard 0.00161hi 0.00093def 0.00045m 0.00057mn 0.02529mn 2.9578ghi BA 100 µM * 1sttime * spray 0.00199bc 0.00113ab 0.00060ab 0.00066jk 0.02049opq 3.4011efg BA 100 µM * 1sttime * standard 0.00224a 0.00096def 0.00062a 0.00083cd 0.05084bc 3.1279efgh BA 100 µM * 2ndtime * spray 0.00207b 0.00108bc 0.00041no 0.00061jkl 0.01931opqr 2.8294ghi BA 100 µM * 2ndtime * standard 0.00184cde 0.00072jk 0.00060ab 0.00068j 0.03684gh 4.6524bc BA 100 µM * 3rdtime * spray 0.00155hij 0.00094def 0.00032st 0.00042rst 0.01814pqr 3.6901def BA 100 µM * 3rdtime * standard 0.00184cde 0.00095def 0.00054efg 0.00050pq 0.04172e 4.7202bc BA 150 µM * 1sttime * spray 0.00150ijkl 0.00089fg 0.00037pq 0.00065jk 0.01671rs 2.8442ghi BA 150 µM * 1sttime * standard 0.00153ijk 0.00053op 0.00053fgh 0.00068j 0.01503rstu 2.4709jk BA 150 µM * 2ndtime * spray 0.00112qrs 0.00056no 0.00032st 0.00059klm 0.01612rst 2.1372kl BA 150 µM * 2ndtime * standard 0.00153ijk 0.00063lm 0.00058bc 0.00063jkl 0.01911opqr 1.8207klmn BA 150 µM * 3rdtime * spray 0.00068x 0.00045pq 0.00016yz 0.00037uv 0.01552rstu 3.3013efg BA 150 µM * 3rdtime * standard 0.00126op 0.00069kl 0.00035qrs 0.00047r 0.02274no 2.3971jk Ctrl * 1sttime * spray 0.00139lmn 0.00079hij 0.00035rs 0.00059klm 0.01495rstu 1.9600klm Ctrl * 1sttime * standard 0.00173fg 0.00101cde 0.00038pq 0.00062jkl 0.01155vw 1.8029klmn Ctrl * 2ndtime * spray 0.00166fgh 0.00077hij 0.00027v 0.00055no 0.01324uv 1.1912o Ctrl * 2ndtime * standard 0.00141klm 0.00084hi 0.00042n 0.00055no 0.01287uv 2.6994hij Ctrl * 3rdtime * spray 0.00170fgh 0.00067kl 0.00014z 0.00036uvw 0.01152vw 0.9337op Ctrl * 3rdtime * standard 0.00100stu 0.00067kl 0.00031stu 0.00039tuv 0.01693rs 3.1288efgh Means in a column followed by the same letter are not significantly different at 5% level; results are the mean of three replicates.

It was indicated the use of Jasmonic acid and salicylic acid chlorophyll contents of rose (cv. ‘Angelina’). About of using increased antioxidant and non antioxidant defense is power salicylic acid, the maximum number of flower, diameter of (Abbaspour & Rezaei, 2014). Another study revealed foliar stalk and total chlorophyll contents reported at 14 ppm and application of salicylic acid (SA) and jasmonic acid (JA) most of flower diameter, stalk length and fresh weight was significantly affected number of flower, diameter of flower, measured in 21 ppm (Jahanbazi et al., 2014). diameter of stalk, stalk length, fresh weight and total

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Effect of benzyladenine and Salicylic Acid on biochemical traits of two cultivars of carnation 433 Conclusion Dey PM (1990) Methods in plant biochemistry. Vol-II. Carbohydrates. (Publ.) Academic Press London. There were progressive effects of plants hormones on studied traits in both of spray and standard carnations. Although, the Ezhilmathi K, Singh VP, Arora A, Sairam RK (2007) Effect of plants hormones which were applied on standard carnations 5-sulfosalicylic acid on antioxidant activity in relation to vase indicated much better effects than spray carnation, all life of Gladiolus cut flowers. Plant Growth Regulation 51: 99- measured traits improved. Results of this study showed that 108. DOI: 10.1007/s10725-006-9142-2 salicylic acid 100 µM, and benzyl adenine 100 µM had more effects than others. Due to their ease of use and positive Hamidimoghadam E, Rabiei V, Nabigol A, Farrokhi J (2014) effects on morphological parameters, spraying of benzyl Postharvest Quality Improvement of Carnation (Dianthus adenine and salicylic acid are one of the best methods in caryophyllus L.) Cut Flowers by Gibberellic Acid, Benzyl floriculture. Adenine and Nano Silver. Agricultural Communications 2: 28- 34. Conflict of interest Asil MH, Karimi M (2010) Efficiency of Benzyladenine Authors would hereby like to declare that there is no conflict of reduced ethylene production and extended vase life of cut interests that could possibly arise. Eustoma flowers. Plant Omics Journal 3:199-203.

References Hatamzadeh A, Hatami M, Ghasemnezhad M (2012) Efficiency of salicylic acid delay petal senescence and Abbaspour H, Rezaei H (2014) Effects of Salicylic acid and extended quality of cut spikes of Gladiolus grandiflora cv Jasmonic acid on Hill Reaction and Photosynthetic Pigment ‘wing’s sensation’. African Journal of Agricultural Research 7: (Dracocephalum moldavica L.) in Different Levels of Drought 540-545.DOI: http://dx.doi.org/10.5897/ajar11.962 Stress. International journal of Advanced Biological and Biomedical Research 2 : 2850-2859. Isinger W (1977) Role of cytokinins in carnation flower senescence. Plant Physiolology 59, 707-709. DOI: http://dx. Arias BS, Lopez MJA (2010) Control of growth and doi.org/10.1104/pp.59.4.707 development of ornamental plants, the Polytechnic University of Cartagena available on Jahanbazi T, Mortezaienejad F, Jafararpoor M (2014) Impact www.interempresas.net/Horticola/Articulos/45284-Control- of salicylic acid and jasmonic acid on keeping quality of rose del-crecimiento-y-desarrollo-de-plantas-ornamentales.html (cv. ‘Angelina’) flower. Journal of Novel Applied Sciences 3 : access on 26th November, 2015. 1328-1335.

Arnon AN (1967) Method of extraction of chlorophyll in the John Carey D, Mark K (2008) the Effects of Benzyladenine on plants. Agronomy Journal 23:112-121. Ornamental Crops. A thesis submitted to the Graduate Faculty of North Carolina State University in partial fulfillment of the Ataii D, Naderi R, Khandan-Mirkohi A (2015) Delaying of requirements for the Degree of Master of Science. Raleigh, Postharvest Senescence of Lisianthus Cut Flowers by Salicylic North Carolina Acid Treatment. Journal of Ornamental Plants 5: 67-74. Jurgen A, Witt T, Gottrsberger G (2003) flower scent Australian Government (2006) The Biology and Ecology of composition in Dianthus and Saponaria species. Biological Dianthus caryophyllus L. (Carnation). Department of Health Systematic and Ecology. 31: 345-357. DOI: and Ageing Office of the Gene Technology Regular 1-22. http://dx.doi.org/10.1016/s0305-1978(02)00173-4

Bates LS, Waldren RP, Teare ID (1973) Rapid determination Khademi Z, Ershadi A (2013) Postharvest application of of free proline for water-stress studies. Plant and Soil 39: 205- salicylic acid improves torability of peach (Prunus persica cv. 207. DOI: 10.1007/BF00018060. Elberta) Fruits. International Journal of Agriculture and crop Sciences. 5: 651-655. Behroozian M, Jafari A, Farsi M (2013) RAPD analysis of genetic variation within and among natural populations of two Kharrazi M, Nemati H, Tehranifar A, Bagheri A, Sharifi A species of Dianthus L. (Caryophyllaceae) in NE Iran. The (2011) In Vitro Culture of Carnation (Dianthus caryophyllus Iranian Journal of Botany 19: 194–201. L.) Focusing on the Problem of Vitrification. Journal of Biodiversity and Environmental Sciences 5: 1-6. Bubán T (2000) The use of benzyladenine in orchard fruit growing: a mini review. Plant Growth Regulation 32: 381–390. OGTR (2006) The biology and ecology of Dianthus DOI: 10.1023/A:1010785604339 caryophyllus L. (Carnation). Australian Government. Department of health and ageing, Office of the Gene Technology Regulator.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

434 Ramtin et al

Ramtin A, Kalatejari S, Naderi R, Matinizadeh M (2015) Supapvanich S, Promyou S (2013) Efficiency of Salicylic Acid Effect of Pre-harvest Foliar Application of Benzyl adenine and Application on Postharvest Perishable Crops. Springer Salicylic acid on Carnation cv. Spray and Standard. Biological Science+Business Media Dordrecht. _15. 339-355. DOI: Forum – An International Journal 7: 955-958 10.1007/978-94-007-64286

Rani P, Meena Unni K, Karthikeyan J (2004) Evaluation of Yao H, Tian S (2005) Effects of pre- and post-harvest antioxidant properties of berries. Indian journal of Clinical application of salicylic acid or methyl jasmonate on inducing Biochemistry 19 :103-110. DOI: 10.1007/BF02894266. disease resistance of sweet cherry fruit in storage. Postharvest Biology and Technology 35: 253-262.DOI: Sairam RK (1994) Effect of moisture stress on physiological 10.1016/j.postharvbio.2004.09.001 activities of two contrasting wheat genotypes. Indian Journal of Experimental Biology 32:584-593. Zarghami M, Shoor M, Ganjali A, Moshtagi N, Tehranifar A (2014) Effect of salicylic acid on morphological and Schmülling T (2004) Cytokinin. In: Lennarz W, Lane MD ornamental characteristics of petunia hybrid at drought stress. (Eds) Encyclopedia of Biological Chemistry. Academic Indian Journal of Fundamental and Applied Life Sciences 4 : Press/Elsevier Science. 523-532

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Journal of Experimental Biology and Agricultural Sciences, June - 2016; Volume – 4(IV)

Journal of Experimental Biology and Agricultural Sciences

http://www.jebas.org

ISSN No. 2320 – 8694

HISTOPATHOLOGICAL STUDY OF TOXICITY MIXTURE OF CASHEW APPLE JUICE (Anacardium occidentale), COW MILK AND YOGURT ON THE WISTAR RAT

BOKOSSA YAOU Innocent1, AGBODJOGBE Daniel2, DJOGBE Anayce A. Mikponsè1,*, LOKO Frédéric2, DARBOUX Raphaël3, LOZES Evelyne2, TCHEKESSI C. K. Célestin1 et Pivot SACHI1, 1 4 BLEOUSSI Roseline and MENSAH Guy Apollinaire

1Laboratory of Microbiology and Food Technologies, University of Abomey-Calavi, 01 BP 526 Cotonou Postal sorting 2Biomedical Analysis Laboratory of the Polytechnic School of Abomey-Calavi, BP 2009 Cotonou 3Histology Laboratory of the Faculty of Health Sciences of the University of Abomey-Calavi, ISBA, Cotonou 4National Institute of agricultural research of Benin 01 BP 884 Recette Principale, Cotonou 01(Benin)

Received – April 19, 2016; Revision – May 04, 2016; Accepted – June 28, 2016 Available Online – June 30, 2016

DOI: http://dx.doi.org/10.18006/2016.4(4).435.439

KEYWORDS ABSTRACT Dairy products The purpose of this study was to confirm or to deny the general opinion Benin people that the Cashew apple juice simultaneous consumption of dairy products, cow milk, yogurt (fermented cow's milk) with cashew apple juice is toxic to human and the animal. Histopathological examinations were performed on thirty Toxicity Wistar rats consist of ten batches. Each batch is consisted of three rats. The first batch has served as a control and the remaining nine were treated differently. Cow milk, yogurt and cashew apple juice either Histopathology alone or mixed with each others were administered to each rat at the rate of 2.0 ml / 200g of body weight. Histological observation of removed organs (stomach, liver and kidneys) within the treated Wistar rats batch showed that the organs of rats treated with cashew apple juice / cow milk /yogurt (respectively batch 2, 3, and 4) was not showing any structural abnormality. Similar types of findings were reported for the rat group treated with a mixture of juice and milk. However, it was reported that the juice-yogurt association has some action on the liver but it did affect the functioning or anatomy of other analyzed organs. It can be conclude that the juice and cow milk mixture are not toxic to animal cells, but the juice-yogurt mixture has some toxic effect on the liver cells only.

All the article published by Journal of Experimental * Corresponding author Biology and Agricultural Sciences is licensed under a E-mail: [email protected] (DJOGBE Anayce A. Mikponsè) Creative Commons Attribution-NonCommercial 4.0 International License Based on a work at www.jebas.org. Peer review under responsibility of Journal of Experimental Biology and Agricultural Sciences.

Production and Hosting by Horizon Publisher (http://publisher.jebas.org/index.html ). All ______rights reserved. Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

436 BOKOSSA et al

1 Introduction Human Biology Unit of the Faculty of Health Sciences of Cotonou. The cashew (Anacardium occidentale) is a multi-virtues tree and its fruit is rich in nutrient elements such as vitamins, 2.2 Experimental setup proteins and fermentable sugars (Cirad-Gret, 2002; Arouna et al., 2010). Besides its agroforestry importance, the fruit Ten sets of 3 rats each were formed among these the first set (cashew nuts & cashew apple) of cashew tree provide specific was used as control rat while the rest nine sets of rat had products which are highly sought outside the Benin (Aina, received various treatments of 2ml for 200g body weight. 1996; Gagnon, 1998; Arouna et al., 2010). Fruit of cashew tree Among these, the set 2, 3 and 4 have been given only cow's contains about 47% of oil which is quite close to the almond milk, juice and the yogurt respectively. While the rats of set 5, (RIC-International, 2004). Beyond the nuts, cashew tree also 6 and 7 have received a mixture of juice and cow milk in offers cashew apple. This is edible and constitutes the fleshy different proportions. Finally 8, 9 and 10 set were treated at the part of the fruit. But it is often neglected during the harvest of mixture of juice-yogurt (Table 1). All set of rats were nuts and rots in vain, yet it contains five times more vitamin C acclimated for fourteen days to farming conditions from the pet than an orange and is very rich in carbohydrates, fiber, mineral of the Human Biology Unit of Cotonou's Faculty Health salts and vitamins (Assunção & Mercadante, 2003). The Sciences. Ethical guide line proposed by University was cashew apple juice is rich in polyphenolic compounds and also followed strictly and before being sacrified, rats were has diversify carotenoids profile (Assunção & Mercadante, anesthetized with chloroform. 2003; Abreu et al., 2005; de Brito et al., 2007; Michodjehoun- Mestres, 2009; Michodjehoun-Mestres et al., 2009; Pinto de Table 1 Various treatments imposed to the Wistar of rats Abreu 2012). More than 450,000 tons of cashew apples were left to rot in Benin; this is a great loss ( Adégbola et al., 2011; Batches of Treatment Padonou et al., 2015). It was cultivated by about 200,000 the rats households and contributes in average to 24.87% in the total Batch 1 Control income of farm producers (SNV-AFP-ICCO, 2012). In Benin it is an interesting alternative and is the second agricultural Batch 2 Cashew apple juice (2 ml/200g of body weight) export product after cotton (Degla, 2015). Set in 10th place Batch 3 Milk (2 ml/200g of body weight) worldwide with only 2% of the volume of exported nuts and Batch 4 Yogurt (2 ml/200g of body weight) 2nd of West African exporting countries after Guinea Bissau, Batch 5 0.5ml milk +1.5ml juice/200g of body weight Benin has experienced over the five year period from 1997 to 2001 an annual growth rate of exports of 33% nuts in value Batch 6 0.75ml milk +1.25ml juice/200g of body weight and 40% in volume (Aïvodji & Anasside, 2009). Cashew apple Batch 7 1ml milk + 1ml juice/200g of body weight can be used directly for food. Its juice is an ideal medium for Batch 8 0.5ml yogurt + 1.5ml juice/200g of body weight culturing yeast for the production of bioethanol (Bokossa- Yaou, 1993; Gbohaïda et al., 2015; Gbohaïda et al., 2016). Batch 9 0.75ml yogurt +1.25ml juice/200g of body weight Many farmers reported the occurrence of poisoning in cattle Batch 10 1ml yogurt + 1ml juice/200g of body weight promoted with cashew apples (Filho & Soto-Blanco, 2012). In Benin, Ivory Coast and several other African countries, the The abdominal cavity of each rat has been incised and the consumption of cashew apple with milk is considered organs such as stomach, liver and kidneys were removed and incompatible (Soro, 2012; Lacroix, 2003). This belief has a fixed in formaldehyde at 10%. These organs were then cut and negative impact on the consumption of cashew apple juice; then placed in numbered cassettes. Finally, the tapes were what hinders the development of this apple. Therefore present immersed in a formaldehyde solution at 10% for 72 hours to be study was undertaken to check the statements that fall within fixed. Traffic operations, coating, cutting with a microtome, the popular belief in Wistar rats. spread, dyeing and setting were performed according to classic histological techniques (Beaumont & Cassier, 1970; Maynard 2 Materials & Methods et al., 2014).

2.1 Preparation of Cashew apple juice 3 Results and Discussion

The plant material cashew apple variety red was harvested Table 1 shows the experimental device which used for from the Dassa-Zoumè local area, at the center of Benin. histopathological analyzes. Results of histopathological Cashew apple fruits were cut into small pieces and crushed analysis revealed that the treatments containing juice, milk and them under laboratory conditions, the resulting mash was yogurt, singly or combination of juice and milk did not have pressed using a press to extract the juice. The animal products any impact on the integrity of the stomach cells, kidney and cow milk were collected from farmers and then sterilized in the hepatic and the conditions of stomach, liver and kidney are laboratory; yogurt was made from the same milk (cow milk identical to control rats (figure 1-7). fermented). Wistar albino rats were selected in the pet of

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Histopathological study of toxicity mixture of cashew apple juice (Anacardium occidentale), cow milk… 437

Figure1 Histological structure of the Figure 2 Histological structure of the Figure 3 Histological structure of the stomach of the control rats FG - liver of the control rats TH - Hepatic kidney of the control rat G - glandular sheet. bays; H – Hepatocytes; CV - Glomerule Centrilobular vein; CS = Sinusoids capillary.

Figure 4 Histological structure of the Figure 5 Histological structure of the Figure 6 Histological structure of the stomach of the rats after 14 days of liver of the rats after 14 days of the kidney of the rats after 14 days of the the treatment of juice – milk mixture treatment of juice - milk mixture treatment of juice - milk mixture

Figure 7 Histological structure of the Figure 8 Histological structure of the Figure 9 Histological structure of the stomach of the rats after 14 days of liver of the rats after 14 days of the kidney of the rats after 14 days of the the treatment of juice - yoghurt treatment of juice - yoghurt mixture, treatment of juice - yoghurt mixture mixture showing periportal steatosis (ST)

There is no literature on the effects of the consumption of 1.25 mL of juice + 0.75 mL of yoghurt to 200g of body weight cow's milk and cashew apple juice mixture. On the other hand, (Figure 10). figures 8 and 10 showed some differences in the state of the liver cell of the rat than the control rats. Group 8, 9 and 10 The association yogurt + juice then translated a frank hepatic were treated with juice and yogurt mixture and the liver of cytolysis for rats of batch 9 and 10. According to Fromenty et these groups rat showed an anomaly when compare with the al. (2012), this periportal steatosis may be because of the control group (Figures 8 & 10). After 14 days of treatment a accumulation of lipid in hepatocytes mainly as triglycerides. periportal steatosis in one hand is observed for a mixture of 1 This accumulation of triglycerides is often caused by obesity, mL of juice + 1mL of yoghurt to 200g of body weight (Figure diabetes of type 2, alcohol poisoning and drugs. 8) and a periportal necrosis on the other hand, to a mixture of

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

438 BOKOSSA et al

Figure 10 Histological structure of the liver of the rats after 14 days of the treatment of juice - yoghurt mixture, showing the destruction of hepatics bays and necrosis cells (NC)

Yogurt also contains lipids and its association with the cashew Third African Association of Agricultural Economists (AAAE) apple juice would therefore be a favorable factor in the and 48th Agricultural Economists Association of South Africa formation of triglycerides. The rats of these same batches (AEASA) Conference, Cape Town, South Africa, 2010. didn’t show any abnormalities in case of stomach and kidney (Figures 7 & 9). This study checked the hepatic toxicity of Assunção RB, Mercadante AZ (2003) Carotenoids and cashew apple juice and yogurt mixture. In the other hand, the ascorbic acid composition from commercial products of cashew apple juice, cow's milk and yogurt eaten alone didn’t cashew apple (Anacardium occidentale L.). Journal of Food show any detectable toxicity in present study. Results of study Composition and Analysis 16: 647-657. doi:10.1016/S0889- suggested the precaution of avoiding the combination of 1575(03)00098-X. cashew apple and yogurt can ensure that apple consumption in complete safety. These are the results are a preliminary study Beaumont A, Cassier P (1970) Travaux pratiques de biologie that may be the basis of further research, exploration of the animale: zoologie, embryologie histologie, Dunod Université. toxicity of this mixture in animal model is required. Bokossa-Yaou IP (1993) Etude des possibilités d'utilisation Conflict of interest biotechnologique de la mélasse de canne à sucre de la République du Bénin pour l'obtention de l'éthanol et autres Authors would hereby like to declare that there is no conflict of bioproduits. Thèse de Doctorat, Institut d’Industrie Alimentaire interests that could possibly arise. de Plovdiv.

References CIRAD-GRET (2002) Anacarde. Mémento de l’Agronome. France: Ministère des Affaires étrangères. Abreu F, Perez AM, Dornier M, Reynes M (2005) Potentialités de la microfiltration tangentielle sur membranes minérales de Brito ES, de Araújo MCP, Lin LZ, Harnly J (2007) pour la clarification du jus de pomme de cajou. Fruits 60: 33- Determination of the flavonoid components of cashew apple 40, DOI: http://dx.doi.org/10.1051/fruits:2005010. (Anacardium occidentale) by LC-DAD-ESI/MS. Food Chemistry 105: 1112-1118. Adégbola IPY, Adekambi ISA, Ahouandjinou IMC (2011) doi:10.1016/j.foodchem.2007.02.009. Analyse de la perfomance des chaines de valeurs de la filière anacarde au Bénin. Bénin: Institut National des Recherches Degla P (2015) Technical Efficiency in Producing Cashew Agricoles du Bénin/ Ministère de l’Agriculture, de l’Elevage et Nuts in Benin’ s Savanna Zone, West Africa. Quarterly de la Pêche (MAEP). Journal of International Agriculture 54: 117-132.

Aina M (1996) L’anacardier dans le système de production au Filho MRR, Soto-Blanco B (2012) Poisoning by Cashew niveau paysan: une approche de rentabilité économique et de la Apple (Anacardium occidentale L.) in Cattle. Acta Scientiae gestion du terroir dans la commune rurale d’Agoua (Zou). Veterinariae 40: 1083. Thèse d’Ingénieur Agronome, FSA UNB, Pp. 112. Fromenty B, Fautrel A, Eliat PA (2012) Quantification de la Aïvodji J, Anasside A (2009). Élaboration des règles de stéatose hépatique chez la souris par spectroscopie RMN in stabilisation et de soutien des prix pour la filière anacarde. vivo et analyse d'images histologiques. France: Université de ONS, Projet d’Appui à la Sécurisation des Revenus des Rennes 1. Exploitants Agricoles (PASREA) Pp. 73. Gagnon B (1998) Etude de la filière anacarde au Bénin. Arouna A, Adegbola PY, Adekambi SA (2010) Estimation of Programme «entreprenariat Bénin» Bénin. Rapport définitif. the economic efficiency of cashew nut production in Benin. In: Pp. 87.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Histopathological study of toxicity mixture of cashew apple juice (Anacardium occidentale), cow milk… 439 Gbohaïda V, Mossi I, Adjou ES, Agbangnan P, Yehouenou cashew apple (Anacardium occidentale L.). Food Chemistry BB, Sohounhloué DC (2015) Morphological and 112: 851-857. doi:10.1016/j.foodchem.2008.06.056. Physicochemical Characterizations of Cashew Apples from Benin for their use as Raw Material in Bioethanol Production. Padonou SW, Olou D, Houssou P, Karimou K, Clovis M, International Journal of Pharmaceutical Sciences Review and Todohoue JD, Mensah GA (2015) Comparaison de quelques Research 35: 7-11. techniques d’extraction pour l’amélioration de la production et de la qualité du jus de pommes d’anacarde. Journal of Applied Gbohaïda V, Mossi I, Adjou ES, Dossa CPA, Wotto DV, Biosciences 96: 9063-9071. Avlessi F, Sohounhloue DC (2016) Évaluation du pouvoir fermentaire de Saccharomyces cerevisiae et de S. Pinto De Abreu FA (2012) Etude d'un procédé intégrant la carlsbergensis dans la production de bioéthanol à partir du jus microfiltration tangentielle pour la production d'extraits de la pomme cajou. Journal of Applied Biosciences 101: 9643- concentrés et purifiés en caroténoïdes à partir de pommes cajou 9652. doi: http://dx.doi.org/10.4314/jab.v101i1.10 (Anacardium occidentale L.). Thèse de Doctorat en Génie des procédés, Montpellier 2. Lacroix E (2003) Les anacardiers, les noix de cajou et la filière anacarde à Bassila et au Bénin. Térra Systems. RIC-INTERNATIONAL (2004) Filière anacarde au Bénin: programme de recherche & développement-analyse sectorielle. Maynard R, Downes N, Finney B (2014) Histological Groupe SeHoMi, sEhoml Group. Bénin. Techniques: An Introduction for Beginners in Toxicology. Royal Society of Chemistry. SNV-AFP-ICCO (2012) Projet 72-01-02-015 « Alliance anacarde ». Bénin. Michodjehoun-Mestres L (2009) Etude des composes phénoliques de la pomme cajou (Anacardium occidentale L.). Soro D (2012) Couplage des procédés membranaires pour la Thèse de Doctorat en chimie, Montpellier 2. clarification et la concentration du jus de pommes de cajou: performances et impacts sur la qualité des produits. Thèse de Michodjehoun-Mestres L, Souquet JM, Fulcrand H, Bouchut Doctorat en Génie des procédés, Montpellier, SupAgro. C, Reynes M, Brillouet JM (2009) Monomeric phenols of

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Journal of Experimental Biology and Agricultural Sciences, June - 2016; Volume – 4(IV)

Journal of Experimental Biology and Agricultural Sciences

http://www.jebas.org

ISSN No. 2320 – 8694

EFFECT OF MAGNEVIST CONJUGATED DENDRIMER ON Bax/Bcl2 GENE EXPRESSION LEVELS IN MCF-7 CANCER CELLS

Sara Fattah1, BaharJavani1, MostafaSaffari1, SeyedAtaollah Sadat Shandiz3 and Mehdi ShafieeArdestani2,*

1Islamic Azad University Pharmaceutical Sciences Branch (IAUPS), No 99, Yakhchal,Gholhak,ShariatiTehran ,Iran 2Department of Radiopharmacy, Faculty of Pharmacy, Tehran University of Medical Sciences, Tehran, Iran 3Young Researchers and Elite Club, East Tehran Branch, Islamic Azad University, Tehran, Iran

Received – March 29, 2016; Revision – April 08, 2016; Accepted – June 28, 2016 Available Online – June 30, 2016

DOI: http://dx.doi.org/10.18006/2016.4(4).440.447

KEYWORDS ABSTRACT

Magnevist conjugated In recent years, investigating pharmacogenetics and effects of corona protein nanomaterial in biological dendrimer applications has been seriously considered for the treatment of human diseases. In this study, the mechanism of apoptosis induced by Magnevist conjugated dendrimer was investigated to compare Real-time PCR Magnevist as a contrasting agent on MCF-7 cells. Cytotoxicity effects of new Magnevist conjugated MCF-7 dendrimer was evaluated by using MTT assay. Also, In order to demonstrate the effect of drugs on the apoptosis, a quantitative method real-time PCR was used. The interaction of plasma proteins was Apoptosis investigated by Magnevist conjugated dendrimer compared with Magnevist using SDS-PAGE technique to determine the fate of nanoparticles. Result of study revealed that it quite significantly affects Bax and Corona protein increasing apoptosis. Its effect on Bcl2 is more than net gadopentetic acid and almost equivalent to the effect of dendrimer alone. In fact, a significant increase was observed in Bax compared to the control group, and no significant effect was observed on BCL2 gene. Also, corona protein was investigated and the protein with weight less than 70 kDa was observed around a nanoparticle that seems albumin protein with a molecular weight of 67 kDa. Conducted study revealed the acceptable therapeutic effect of Magnevist conjugated dendrimer and it was comparable with in vitro Magnevist model of breast cancer. Therefore, the use of the denderimer can be effective on increasing expression of some pro- apoptoticgenes and provided a new perspective in clinical diagnostic.

All the article published by Journal of Experimental * Corresponding author Biology and Agricultural Sciences is licensed under a E-mail: [email protected] (Mehdi Shafiee Ardestani) Creative Commons Attribution-NonCommercial 4.0 International License Based on a work at www.jebas.org. Peer review under responsibility of Journal of Experimental Biology and Agricultural Sciences.

Production and Hosting by Horizon Publisher (http://publisher.jebas.org/index.html ). All ______rights reserved. Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

441 Fattah et al

1 Introduction consumed through injection (Hijazi & Boulieu, 2002; Milenic et al 2004). After cardiovascular diseases, cancer is the second leading cause of death in the United States of America (Abdelhady, In fact, this compound is composed of N- methyl-glucosamine 2012). In developing countries men, the most common types of salt of gadolinium-containing DTPA complex. It is reported cancers are prostate, lung, colorectal cancers, while in MAGNEVIST® brand and is prepared as a sterile aqueous, a women these are breast, lung and colorectal cancers. However, clear, colorless to pale yellow solution for intravenous in developed countries this picture slightly changes and the injections. Dendrimers are spherical hyper branched units that most common types of cancers in men included stomach, lung have polymer branches with different size. They also have and liver and in women these are breast, cervical and stomach symmetrical spherical shape and a lot of spaces in their cancers (Anand et al., 2008). Now in these days, the main structure, in which drugs can be safely placed (Milenic et al., focus of cancer research is to search anticancer agents with 2004). Each of the dendrimer branches is called dendron. high safety coefficient and more acceptability rate among Ideally a dendrimer is divided into three parts including core, patients (Carr et al., 1984; Wray et al., 2005; Deuflhard et al., inner shell and the outer shell (Mansfield & Pykett, 1978). The 1997). Recently, treatment based on the molecular markers/ synthetized dendrimers should have different capabilities in technique proved very much progressive and showed high each of these areas for controlling properties such as solubility, specificity against tumor cells. These techniques opened new thermal stability and the number of branches. Moreover, they doors in the field of cancer research and reduced the risk of also can have protein or polymer cores (linear, branchedand toxicity (Wang et al., 2008). spherical).

In addition, they can be used in combination with The objective of present study was to investigate the radio chemotherapy or radiation therapy for synergistic anti-cancer pharmacogenetic effects of Magnevist conjugated dendrimer activity. Therefore, the targeted treatment has been as a new compared with Magnevist on cytotoxicity and the Bcl2. and promising approach for cancer treatment (Fox, 2000).The Further, the effects of plasma protein aggregation or binding phenomenon of apoptosis are playing important role in the on the Magnevist conjugated dendrimer compared with cancer management. In this process without damaging the Magnevist protein corona technique was also investigated in surrounding cells or tissues unwanted, damaged and dangerous the present study. cells can be removed. Apoptosis induction is one of the most important methods for destroying cancer cells without 2 Materials and Methods complication (Abdelhady, 2012). Cancer cells normally escape from apoptosis; one of the reasons for this is the change in the 2.1 Dendrimer synthesis expression of genes involved in the regulation of this process (Carr et al., 1984). Initially, 2.5 to 3 mL of liquid polyethylene glycol (600) was taken in the container and it was followed by the addition of More anti-cancer agents apply their therapeutic effects by 4mL of DMSO solvent. Afterwards, 1g of DCC (D inducing programmed cell death. The Bcl-2 protein can play a cyclohexane Hexyl carbo di imide) was added in this solution. vital role in the creation and inhibition of apoptosis in cells. Later on, citric acid dendrimer was synthesized with This protein regulates the activity of caspase enzymes in polyethylene glycol core in the first stage and in the end of this apoptosis pathway. Further, this Bcl-2 protein releases dendrimers were functionalized in the presence of DCC using cytochrome c from mitochondria, which leads to activation of imidazole functional groups. After 5 minutes of this, 1 mL of caspase-9 and then caspase-3. It ultimately leads to the cell citric acid was added in this mixture (Reaction was performed suicide (Cree, 2011). Gadolinium-containing drugs could be at room temperature) and left it for two hours. divided into different types based on ligands binding to them (chelates), the most important are DTPA, HP-DO3, and 2.2 Purification DTPA-BMA. In purification, synthesized dendrimer were separated from the These ligands can be linear or cyclic (Klajnert & Bryszewska, impurities such as citric acid, and unreacted DCC. In the first 2001). In theory, cyclic gadolinium chelates are more stable step of purification, 5ml of water was added in this synthesized than linear ones. Moreover, these compounds can be ionic or dendrimer solution, DCC is insoluble in water while the nonionic. Nonionic solutions produce lower osmolarity rate in dendrimers are soluble. This mixture was passed through the the solution and hence are more appropriate contrast agents. simple filter paper where dissolved dendrimers passed through Now in these days, many researches are actively involved in the paper while precipitate DCC remained on filter paper. In the design and construction of ligands due to their tight binding second step of purification, the mixture passed through to the gadolinium ion. Gadopentetate dimeglumine drug is one sephadex advanced column for the separation of citrus of the oldest contrast agents used in MRI. It is approved by solutions impurities. American Food and Drug Administration (FAD) and is

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Effect of Magnevist conjugated dendrimer on Bax/Bcl2 Gene Expression Levels in MCF-7 Cancer Cells 442 2.3 Adding the dendrimer to the gadopentetic acid drug and re-dissolving of RNA. Cells were separated by using trypsin and PBS at 1100rpm centrifugation. These separated In this step, 5ml of gadopentetic acid (469) mixed with 5ml of cells were mixed with 1 ml of cold RNA extraction solution, dendrimer (234.5) in a vial and the mixture was sonicated for this mixture were homogenized on vertex shaker. 10 minutes in sonicator (model KST 7703) and stored at Homogenized samples were incubated five minutes at room refrigerator. temperature and 200ml of chloroform was added in this mixture. These microtubes are now shaken strictly by hand for 2.4 Determine the viability percentage by MTT test assay 15 seconds and stored at room temperature for 5 minutes.

The breast cancer MCF-7 cell line was purchase from pasture After five minutes, these tubes were centrifuged for 15 minutes institute of Iran. For performing MTT assay, cells were at 12000 rpm at 4°C. Supernatant colorless aqueous solution cultured in 96-well cell culture containers containing RPMI1640 were separated and collected in other micro tubes. Isopropyl medium supplemented by 10% fetal bovine serum (FBS). alcohol was added in these tubes supernatant aqueous solution Different concentrations of Magnevist conjugated dendrimer containing tubes and again the samples were centrifuged at (0, 3.125, 6.25, 12.5, 25, 50 and 100 M) were prepared and 12000 rpm for 15 minutes at 4°C. Extracted RNA was 100 ml of each of pre-made concentrations of gadopentetic sediment on the bottom of the tube and the supernatant were acid nanoparticle was added in cultured cells. 100 mL of MTT emptied. RNA pallets were washed one with 75% ethanol and (0.5%) dye was added in to each cultured well. This was dried in the air for 5 to 10 minutes. These RNA pallets were followed by the storing cultural plate in incubator and later on dissolving in DEPC water and stored at -70⁰C. Later, the cells were evacuated and 100 mL of DMSO is added to each quantity and purity of the extracted RNA was determined using plate and the culture container is placed at room temperature photo-nanometer (IMPLEN GmbH, Germany). For for 30 minutes. In the next stage, the absorption rate was complementary DNA (cDNA) synthesis, the Revert AidTM measured at 570 nm using Elisa Reader. The survival rate of First Strand cDNA Synthesis Kit (Fermentas, USA) were used Magnevist conjugated dendrimer treated breast cancer cells, according to protocol. The reaction mixture contains 1g of was calculated by using following formula: RNA, 5 L reaction buffer, 0.5L of primer Oligo (dT), 0.5 mL of randomized hexamer primer, 2-ml deoxynucleotide Cytotoxicity percentage = 1- (mean absorbance of toxicant triphosphate mixture (10 mM), 1 µl of the enzyme RNase treated cells) / (mean absorbance of negative control) × 100 inhibitor (20 units per microliter), 1 µl reverse transcriptase M-

MulV and H2O DEPC (to a final volume of 20L). The PCR To determine the 50% lethal dose of Magnevist conjugated reaction was performed using iCycler Thermal Cycler (Bio- dendrimerin MCF-7 cell lines of cancer cells, all information Rad, Hercules, CA, USA). obtained (toxicity amount) from samples and controls were investigated using Pharm-PCS statistical package software and 2.6 Primer Design the exact amount of the related IC50 was determined. In order to design primers, the cDNA sequences of genes were 2.5 Identification and estimation of gene expression by PCR initially obtained from GenBank and then best gene region was determined for these primers using Primer express software Initially, 2×106 cells were poured into T-25 flasks and were v.3.0 (Applied Biosystems, USA). To ensure the accuracy of treated by using different concentrations of Magnevist the primer sequences and the absence of their non-specific conjugated dendrimer for 24 hrs. RNA of the selected cells binding to sequences in other parts of the genome, primers were extracted by a method given by Hahn et al. (2011) in five were blasted (http://www.ncbi.nlm.nih.gov/blast) (Table 1). steps i.e. homogenization, separation, precipitation, washing

Table 1 Primers used in real time PCR reactions for present study.

Gene of interest Primer sequence Bcl-2 Forward: 5'- TGTGGATGACTGAGTACCTGAACC-3' Reverse: 5'-CAGCCAGGAGAAATCAAACAGAG-3 ' Bax Forward: 5'-TTGCTTCAGGGTTTCATCCAG-3' Reverse: 5'-AGCTTCTTGGTGGACGCATC-3' GAPDH Forward: 5'-CGTCTGCCCTATCAACTTTCG-3' Reverse: 5'-CGTTTCTCAGGCTCCCTCT-3'

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

443 Fattah et al

2.7 Real-time RT- PCR 3 Results

Real Time PCR method was carried out in 3 steps in first step, 3.1 MTT assay denaturation of cDNA molecules and activation of the polymerase enzyme was done as follows: 95° C for 10 In order to evaluate the toxicity effects of samples, various minutes; while in the second stage at 95 °C for 15 seconds and dilutions were prepared and transferred to each well 96-well 60 °C for 1 minute, 40 consecutive cycles was carried out, and plates. Afterwards, MTT testing phases were read with an in the final stage for drawing melting curve as 95° C for 15 ELISA reader (Figure 1). seconds, 60°C for 30 seconds 95° C for 15 seconds.

Real-time PCR reactions were performed in a final volume of 20 ml for triplet repeats. The combination of each reaction contains 10 µl of SYBR-Green PCR Master Mix (Applied Biosystems, Warrington, UK), 1 µl of reverse and forward 400 nM primers specific for each gene, 5 µl of cDNA (300 mg) and the rest distilled water were added until the final volume of 20 ml was obtained.

PCR amplification curves were plotted for each reaction. Data analysis was performed by comparing the threshold cycle. In this study, the ratio of the target gene (Bax, Bcl2) to the reference gene (GAPDH) was calculated using the formula ΔΔCt through 2 -ΔΔCt. The calculation formula is as follows: Figure 1 Assay of Cytotoxicity of Magnevist conjugated dendrimeron MCF-7 cells by MTT assay along with ELISA ΔCt = Ct target-Ct reference reader

ΔΔCt = ΔCt test sample - ΔCt control sample MTT assay test was used to evaluate the survival rate of MCF- 7 cells against different concentrations of Magnevist Relative expression: 2 -ΔΔCt conjugated dendrimer. In control 100% of the cells are alive and cell viability rate is gradually reduced by increasing the 2.8 Statistical analysis of data dose of Magnevist conjugated dendrimeras (Figure1). A significant toxicity was observed at the increasing of Dicomwork, Matlab and Excel were used for statistical concentrations. With increasing the concentration of analysis of data and the calculation of T1, T2. Micro Dicom Magnevistconjugated dendrimer a significant gradual reduction also was used to observe the MR images. To quantitatively in the viability of cells was reported. A significant effect in the compare data, SPSS software and Post hoc Tukey test were toxicity level was reported in the concentration range started used. And if the data were compared in group, one way from 6.5 to 50, dose above these level are not significantly

ANOVA test was used. differ from each other’s (p <0.01). As is clear from IC50, proper concentration level was 68.81M from this study.

Figure 2 Survival percentages of MCF7 cells against different concentrations of Magnevist conjugated dendrimer within 24 hours

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Effect of Magnevist conjugated dendrimer on Bax/Bcl2 Gene Expression Levels in MCF-7 Cancer Cells 444

Figure 3 Curve of gene expression changes in MCF7 cell lines with Dendrimer, the Magnevist conjugated dendrimer and Magnevist alone after 24 hours (*: P ≤ 0.05, ** P ≤ 0.01). Comparisons are made for each gene compared with the same gene in the control group

3.2 Real time PCR changing concentration). Further, Gadopentetic acid nanoparticle (gadopentetic acid and dendrimer) affect the The effect of Magnevist conjugated dendrimer was expression of on Bax and Bcl2 genes and its effect on Bax investigated and compared it with pure Magnevist alone on gene was higher than the total effect of dendrimers and apoptosis gene expression. A significant result was observed gadopentetic acid. In fact, it affects Bax quite significantly and regarding the effect of the Magnevist conjugated dendrimeron, increases apoptosis. Further, its effect on Bcl2 gene is more however such result was not reported for Bax and Bcl2.The than the impact of pure gadopentetic acid and is approximately impact of dendrimers on the Bax and Bcl2 genes was not equivalent to the effect of dendrimer alone. In fact, compared significant but the expression of these gene were increased at to the control group, a significant increase was observed in Bax some level (In this study best effect showing treatment was compared with the control group and there was little impact on used for testing effect but these effect may change with Bcl2.

Figure 4 Results of corona protein, protein identification based on the size specified in gel electrophoresis

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

445 Fattah et al

3.3 Identification of corona protein The PEG was used at the core of the dendrimer (molecular surface engineering) and its surrounding units are citric acid A protein weighing less than 70 kDa, and another protein (Krebs cycle intermediates) (First Strategy). Therefore, the weighting 22 kDa were seen in the plasma serum, which is resulting dendrimer is a biodegradable dendrimer and has no attached to the nanoparticle. As shown in Figure 4, it seems significant toxicity. This dendrimer has a negative charge; that the albumin protein with a molecular weight of 67 kDa is therefore, it doesn't interact with the negatively charged cell the protein less than 70 kDa around gadopentetic acid surface and does not destroy the cell membrane. It also has a nanoparticle. lot pores for the purpose of drug loading (Fox, 2000). In this study, lower doses of the drug were exposed to the dendrimer; 4 Discussions therefore, the drug loading was considered to be 100 percent (Anand et al., 2008). Nanostructures with hydrophilic surface Considering the fact many genetic changes are needed in order smaller than100 nm are mostly capable to escape from their to cause cancer. Further, there are many cancers which are molecular phagocytic system. Hydrophobic nanoparticles are hereditary, in such cases a strong possibility of tumor quickly picked up by the RES organs. Thus, hydrophilic development arises even after the treatment or surgery (Hahn particles remain more time in the circulation and are picked up et al., 2011). Result of study revealed that Magnevist to a lesser extent by the liver (Gensel et al., 1990; Franc & conjugated dendrimer have concentration and time dependent Kakkar, 2009). killing effect on MCF-7 cancer cells. Further, these dendrimer inhibited the expression of mRNA and anti-apoptotic gene of The results of this study show positive effects of conjugating Bcl-2 while these nanoparticls increased the expression of Bax the Magnevist on the dendrimer, which ultimately increases the and this express was significantly higher than the individual quality of the drug delivery and improves anti-tumor effects of exposure of Magnevist drug. Clearly, recognizing the the compound. Present study also shows that Magnevist expression pattern importance of genes involved in apoptosis is conjugated dendrimer compared with the gadopentetic acid very important in response to metastatic activity of anticancer drug alone, more inhibited anti-apoptotic Bcl-2 gene drugs. The results of this study show significant therapeutic expression and increased gene expression of Bax genes over use of drug loaded on dendrimers against the breast cancer time. Different studies revealed that Bcl-2 gene plays an cells. According to these investigations, the clinical studies on important role in cancer development. It was reported that Bcl2 the animal and human models are necessary to confirm the gene expression increased the possibilities in 70% women effect of gadopentetic acid and Magnevist conjugated on breast cancer. Also, in preclinical models of prostate cancer dendrimer. Previous studies showed the in vitro acceptable Inhibition of Bcl2 over expression can be associated with effect of gadopentetic acid loaded on the dendrimer model on apoptosis of cancer cells (Tan et al., 2006). Bcl2 gene product breast cancer as compared to the normal cell. plays a role in inducing growth, survival and inhibition of programmed cell death. While Bax protein induces Therefore, the use of Magnevist (as loaded on the dendrimer) programmed cell death in cells and its performance is unlike can be effective on the expression of certain apoptotic genes. Bcl-2 protein. Bcl-2 and Bax proteins form homodimer and Based on this study and previous studies, it can be conclude heterodimer structures. that nanogadopentetic acid compound has powerful anticancer effects on cancer cells and derivatives of this compound could These two proteins are related factors that regulate play an important role in treating these types of cancers in the programmed cell death process (Sakakura et al., 1997). The future. So if the clinical process of the drug is approved, the effect of gadolinium in inducing the apoptosis macrophage was Magnevist conjugated on dendrimer can be applied in a clinical investigated by Mizgerd et al. (1996), according to this 10 setting for patients with breast cancer in the future. The minutes making cells subject to gadolinium, significantly dendrimer used in this study is composed of a PEG core and induces cell death through the induction of the apoptosis two surrounding citric acids and compared with other mechanism up to 24 hours (Mizgerd et al., 1996). Further, dendrimers, has unique features. The most prominent of which Greisberg et al. (2001) described that gadodiamide increases is biodegradable. In most of synthesized dendrimers, the production of proteoglycans, decreases the cell birth and interaction of dendrimer positive charges with the negatively induces apoptosis in chondrocyte. Greisberg et al. (2001) charged cell membrane as a result of the destructed membrane investigated the effect of short term placement of chondrocyte causes hole formation and the lysis of dendrimers cell, which to gadolinium. The cell growth was reduced while exposing to in biological systems cause toxicity, some of which include gadolinium (in a dose-dependent manner) and chondrocyte cytotoxicity, blood and hemolytic toxicity (Kobayashi & apoptosis was also induced in a dose-dependent manner Brechbiel, 2004).There are two overall strategies to reduce the (Greisberg et al., 2001). Salakou et al. (2007) conducted study toxicity of dendrimers i.e. first is to design and synthesis of on patients with myasthenia gravis underwent cystectomy, biodegradable dendrimers using biodegradable core and Bcl2 ratio to Bax was measured in patients with different branched units or intermediate metabolic pathways and second disease classifications. It was concluded that if this ratio is less is engineering the molecular level, which is done by than 1, it is considered a good marker for caspase activation acetylation of the, PEGylation and carbohydration of and apoptosis process adjustment (Salakou et al., 2007). In molecules (Weinmann et al., 1984.( another study Chiu & Su (2009) studied the effect of curcumin

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Effect of Magnevist conjugated dendrimer on Bax/Bcl2 Gene Expression Levels in MCF-7 Cancer Cells 446 on MDA-MB-231cancer cells. The study showed that Fox KR (2000) Targeting DNA with triplexes. Current molecular mechanisms of curcumin inhibits the generation of medicinal chemistry 7:17-37. DOI: MDA-MB-231 through increased expression of p21, an 10.2174/0929867003375506. increase of Bcl2 ratio to Bax and subsequent apoptosis induction. And this mechanism can create therapeutic potential Franc G, Kakkar AK (2009) Diels–Alder “Click” Chemistry in of curcumin for breast cancer cells. Designing Dendritic Macromolecules. Chemistry A European Journal 15:5630-5639. DOI: 10.1002/chem.200900252. Conclusion Gensel PG, Johnson NG, Strother PK (1990) Early Land Plant Present study confirmed the anti-cancer effects of Magnevist Debris. Palaios 5: 520-547. DOI: 10.2307/3514860. conjugated dendrimer. Further, it is needed to study its impact on the human and animal model. Considering the anti-cancer Greisberg JK, Wolf JM, Wyman J, Zou L, Terek RM (2001) properties of the samples presented in this study, it is Gadolinium inhibits thymidine incorporation and induces recommended to study the anticancer effects in proteome level apoptosis in chondrocytes. Journal of Orthopaedic Research of breast cancer cell lines for further exploration. With more 19:797-801. extensive knowledge of the properties of nanoparticles, size, shape, surface structure, thickness, degree of porosity, Hahn MA, Singh AK, Sharma P, Brown SC, Moudgil BM chemistry, etc can be selected based on the purpose of this (2011) Nanoparticles as contrast agents for in-vivo bioimaging: study. current status and future perspectives. Analytical and Bioanalytical Chemistry 399:3-27. DOI: 10.1007/s00216-010- Conflict of interest 4207-5.

Authors would hereby like to declare that there is no conflict of Hijazi Y, Boulieu R (2002) Contribution of CYP3A4, interests that could possibly arise. CYP2B6, and CYP2C9 isoforms to N-demethylation of ketamine in human liver microsomes. Drug Metabolism and References Disposition 30:853-858.

Abdelhady HG (2012) Morphological and Nanomechanical Klajnert B, Bryszewska M (2001) Dendrimers: properties and Investigations of Magnevist Nano-encapsulated Dendrimers by applications. Acta biochimica polonica 48:199–208. Atomic Force Microscopy. The Libyan Journal of Pharmacy &Clinical Pharmacology 1: 48154. DOI: Kobayashi H, Brechbiel MW (2004) Dendrimer-Based http://dx.doi.org/10.5542/LJPCP.v1i0.48154. Nanosized MRI Contrast Agents. Current Pharmaceutical Biotechnology 5: 539-549. DOI: 10.2174/1389201043376571. Anand P, Kunnumakkara AB, Sundaram C, Harikumar KB, Tharakan ST, Lai OS, Sung B, Aggarwal BB (2008) Cancer is Mansfield PI, Pykett PG (1978) Momis Human whole body a preventable disease that requires major lifestyle changes. line-scan imaging by NMR. British Journal of Radiology Pharmaceutical Research 25: 2097-2116. doi: 10.1007/s11095- 51:921-922. 008-9661-9. Milenic DE, Brady ED, Brechbiel MW (2004) Antibody- Carr DH, Brown J, Bydder GM, Steiner RE, Weinmann HJ, Targeted Radiation Cancer Therapy. Nature Reviews Drug Speck U, Hall AS, Young IR (1984) Gadolinium-DTPA as a Discovery 3: 488-499. doi:10.1038/nrd1413. contrast agent in MRI: initial clinical experience in 20 patients. American Journal of Roentgenology143:215-224. DOI: Mizgerd JP, Molina RM, Stearns RC, Brain JD, Warner AE 10.2214/ajr.143.2.215. (1996) Gadolinium induces macrophage apoptosis. Journal of Leukocyte Biology 59:189-195. Chiu TL, Su CC (2009) Curcumin inhibits proliferation and migration by increasing the Bax to Bcl-2 ratio and decreasing Sakakura C, Sweeney EA, Shirahama T, Igarashi Y, Hakomori NF-kappaBp65 expression in breast cancer MDA-MB-231 S, Tsujimoto H, Imanishi T, Ogaki M, Ohyama T, Yamazaki J, cells. International Journal of Molecular Medicine. 23: 469- Hagiwara A, Yamaguchi T, Sawai K, Takahashi T (1997) 475. DOI: 10.3892/ijmm_00000153. Overexpression of Bax sensitizes breast cancer MCF-7 cells to cisplatin and etoposide. Surgery Today 27: 676-679. DOI: Cree IA (2011) Cancer cell culture: methods and protocols. 10.1007/BF02388231. Humana Press, New York, Pp. 165-169. Salakou S, Kardamakis D, Tsamandas AC, Zolota V, Deuflhard P, Seebass M, Stalling D, Beck R, Hege HC (1997) Apostolakis E, Tzelepi V, Papathanasopoulos P, Bonikos DS, Hyperthermia Treatment Planning in Clinical Cancer Therapy: Papapetropoulos T, Petsas T, Dougenis D (2007) Increased Modelling, Simulation and Visualization. Preprint SC Pp. 97– Bax/Bcl-2 ratio up-regulates caspase-3 and increases apoptosis 26.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

447 Fattah et al in the thymus of patients with myasthenia gravis. In vivo 21: Magnevist)-A Tumor Targeting MRI Contrast Agent. Acta 123-32. Biophysica Sinica 24:315-322.

Tan C, Dlugosz PJ, Peng J, Zhang Z, Lapolla SM, Plafker SM, Weinmann HJ, Brasch RC, Press WR, Wesbey GE (1984) Andrews DW, Lin J (2006) Auto-activation of the apoptosis Characteristics of gadolinium-DTPA complex: a potential protein Bax increases mitochondrial membrane permeability NMR contrast agent. American Journal of Roentgenology and is inhibited by Bcl-2. The Journal of Biological Chemistry 142:619-624. DOI: 10.2214/ajr.142.3.619. 281:14764-14775. doi: 10.1074/jbc.M602374200. Wray CJ, Ahmad SA, Matthews JB, Lowy AM (2005) Surgery Wang ZQ, Liang S, Song-Ping W, Korotcov A, Xing-Jie L for Pancreatic Cancer: Recent Controversies and Current (2008) Transferrin Liposome Nanoparticle (TfNIR-LipNBD- Practice. Gastroenterological.128:1627-1647. DOI: http://dx.doi.org/10.1053/j.gastro.2005.03.035.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Journal of Experimental Biology and Agricultural Sciences, June - 2016; Volume – 4(IV)

Journal of Experimental Biology and Agricultural Sciences

http://www.jebas.org

ISSN No. 2320 – 8694

HYPERSPECTRAL IMAGING (HSI): APPLICATIONS IN ANIMAL AND

DAIRY SECTOR

Abhinav Kumar1, Sonal Saxena2,*, Sameer Shrivastava2, Vandana Bharti1, Upendra Kumar1 and Kuldeep Dhama3

1Department of Computer Science & Engineering, Birla Institute of Technology, Mesra, Jharkhand India 2Division of Veterinary Biotechnology, Indian Veterinary Research Institute, Izatnagar. U.P. India 3Division of Pathology, Indian Veterinary Research Institute, Izatnagar. U.P. India

Received – May 03, 2016; Revision – May 23, 2016; Accepted – June 18, 2016 Available Online – June 30, 2016

DOI: http://dx.doi.org/10.18006/2016.4(4).448.461

KEYWORDS ABSTRACT Hyperspectral Imaging (HSI) Hyperspectral imaging (HSI), also known as imaging spectroscopy or 3D spectroscopy, combines imaging and spectroscopy into a single system. With a high resolution measurement of spectral Applications signatures, HSI is able to provide critical information of the target. Thus it is useful for various scientific and industrial applications, including food safety and disease diagnosis. Due to constantly increasing Animal demands for safe animal products, there is pressure on the processing sector for applications of advanced, high throughput methods for non-destructive quality analysis of animal products. In this Dairy context, HSI finds its applications for grading, classification, quality & composition analysis of animal products including meat, egg, milk etc. Further, the technique is also a useful tool in poultry sector for assessment of wholesomeness and quality control of chicken carcasses, as well as, chicken meat products. In fish industry also, the technique has established its potential for determining freshness and quality attributes of sea-foods. Apart from quality control of animal products, HSI has also demonstrated its usefulness for disease diagnosis in animal models and for detection of mammary cancers in dogs. Thus, the future of HSI technology in animal industry is promising and associated with multivariate analysis, HSI technique will further dominate in animal products authentication and analysis in the future also.

All the article published by Journal of Experimental * Corresponding author Biology and Agricultural Sciences is licensed under a E-mail: [email protected] (Sonal Saxena) Creative Commons Attribution-NonCommercial 4.0 International License Based on a work at www.jebas.org. Peer review under responsibility of Journal of Experimental Biology and Agricultural Sciences.

Production and Hosting by Horizon Publisher India [HPI] (http://www.horizonpublisherindia.in/ ). All ______rights reserved. Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

449 Abhinav et al

1 Introduction Technological advances leading to development of advanced low cost systems have widened scope for its application over Computer-aided diagnostic approaches are now approaching the past twenty years. Apart from food quality analysis, the stage where the routine use of such technologies is hyperspectral imaging is now being used in medicine for becoming a reality (Kruppinski, 2004; Rampun et al., 2016; disease diagnosis. Very high resolution spectral information Bekker et al., 2016). Hyperspectral imaging (HSI) is one such obtained by HSI enables detection of minor differences in the technology which has proved its usefulness for various reflectance &/or fluorescence signatures of animal tissues and scientific and industrial applications including remote sensing thus, hyperspectral image data represents a promising tool for (Tanvir & Michael, 1990; Prasad et al., 2000; Ramakrishanan non-destructive tissue analysis and disease diagnosis. The & Bharti, 2015), environmental monitoring (Moroni et al., technique has also been studied in various animal models and 2013), geological search (Kruse et al., 2003; Ramakrishanan dogs for cancer diagnosis. The technique has been used & Bharti, 2015), atmospheric composition analysis (Etzion et extensively in animal sector and all the potential applications al., 2014), military target recognition (Richter, 2005), medical of the technology in this context are covered extensively in this diagnostics (Akbari et al., 2011), and food safety inspection review. (Kamruzzaman et al., 2011). HSI combines conventional imaging, as well as, spectroscopy to obtain spatial information 2 Principles of Hyperspectral Imaging from target across a broad spectral range (Li et al., 2011). The technique hyperspectral imaging (HSI) is also called as Several narrow band images at different wavelengths are imaging spectroscopy as it combines properties of imaging and produced by the system, which can be utilized to identify and spectroscopy. It studies and measures spectra acquired through characterize the target analyte over a wide spectral range. HSI reflection of the electromagnetic radiation from the object systems even allow studying the targets in ultraviolet (UV), under study. A typical hyperspectral imaging system (HIS) near-infrared (NIR) or infrared (IR) regions, where the human encompasses: (i) a source of light to illuminate the object, (ii) a eye is unable to function. In comparison to conventional lens for focusing and delineating field of view, (iii) a cameras and other imaging technologies, hyperspectral spectrograph for splitting the light into different spectral bands imaging systems (HIS) provide spectral signatures for each (iv) a camera for capturing final spatial–spectral images & (v) image from a number of narrow, adjacent spectral channels at a a software to monitor the image acquisition. Choice of the very high resolution (a few nanometres), narrow waveband mode applied for image acquisition relies largely on the (≤10-2 λ) and wide spectral range (200-2500 nm) (Akbari et properties of the sample being analyzed. Basically there are al., 2009). The measurement of high-resolution spectral three modes for acquisition: (1) Reflectance, (2)Transmittance signatures helps in revealing important information about the and (3 ) Interactance, which mainly differs in configurations of object, which is otherwise not possible with traditional lighting and detector systems. Differences between these 3 cameras. The acquired multidimensional spectral signature not acquisition modes results in dissimilar effects of data only reflects the external characteristics of the analyte, but also acquisition from the same object. In Interactance mode, a blend reveals their internal quality information. Although the of reflectance and transmittance modes, the source of light and technology was initially developed by NASA for remote detector are on the similar side of the object under study sensing activities, decrease in price of these systems enables (Nicola et al., 2007). HSI in reflectance mode is able to detect them to be used now for food quality analysis in laboratories external properties of the target like target shape, its color, size, (Gowen et al., 2007). etc., but is unable to determine internal quality parameters effectively. On the other hand, transmittance mode is useful in Since the global demand for livestock products is estimated to detecting internal characteristics as well (Ariana & Lu, 2008). rise by more than 60 percent by 2050, the livestock sector is The interactance mode is suitable for measuring turbid liquids, under substantial pressure to increase the amount of safe as semi-solid and solid substances (Reich, 2005). well as, nutritious animal products in the future. Thus, to satisfy ever-increasing demands of the consumers, rapid non- The technology involves image acquisition in the visible and destructive methods are required for safety and quality IR or NIR regions. Then these images are combined to form a assessment of animal products. Recently, HSI has emerged as a 3 dimensional hyperspectral cube, and finally the images are potential non-destructive technique for food quality evaluation visualized as sections of the hypercube with its one spectral and has gained interest for meat & meat products analysis. and two spatial dimensions. Every spectral pixel of the Many studies are now focusing on HSI technology for safety hypercube refers to a spectral signature, i.e., spectrum of the and quality assessment of animal products.HSI has now corresponding spatial region, and it records complete spectrum opened up new avenues for non-destructive prediction of of the spatial point which is imaged. In other words, recorded multiple attributes for quality and safety analysis of animal spectrum specifies the sample’s ability for scattering or products such as meat (Kamruzzaman et al., 2011), fish absorbing the exciting light, thus characterizing the inherent (Sivertsen et al., 2011a), egg (Abdel-Nour & Ngadi, 2011) and properties of the sample. With combined properties of milk (Qin & Lu,2006). imaging and spectroscopy, the HSI technique results in unparalleled capabilities for sample detection, which is not

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Hyperspectral Imaging (HSI): Applications in Animal and Dairy Sector 450 possible with either spectroscopy or imaging alone. Besides characteristics (Qiao et al., 2007b; Barbin et al., 2012b), qualitative information, quantitative data can be retrieved from chemical composition (Barlocco et al., 2006; Barbin et the data cube to predict the distribution of numerous al.,2012c,) and microbial spoilage (Wang et al., constituents within the sample. The precision of HSI sensors is 2011;Barbin et al., 2012c; Tao et al., 2012), in pork; measured as spectral resolution. The spectral resolution is  Muscle discrimination (Kamruzzaman et al., 2011), defined as the thickness of the narrowest spectral feature which determination of sensory and quality characteristics can be resolved by the sensor. The bands in the HSI images are (Kamruzzaman et al., 2012a; Kamruzzaman et al., very narrow (ranging from 5nm–20nm) and range from UV to 2013a), and chemical composition (Kamruzzaman et al., thermal IR regions (Muhammad et al., 2012) and thus 2012b); hyperspectral images acquire a very high spectral resolution  Authenticity analysis (Kamruzzaman et al., 2012c), & resulting in better identification and discrimination of the adulteration (Kamruzzaman et al., 2013b) in lamb; target. detection of faecal contaminants (Park et al., 2007), tumors (Nakariyakul & Casasent, 2008; Nakariyakul & 3 HSI for quality and safety analysis of meat and meat Casasent, 2009), bacterial spoilage (Feng et al., 2013a; products Feng et al., 2013b),and freshness of chicken (Grau et al., 2011); Animal products are good sources of protein and vital  Prediction of contaminants (Segtnan et al., 2009a; micronutrients in diet (Ikutegbe & Sikoki, 2014). Due to Segtnan et al., 2009b), composition (ElMasry & Wold, increasing awareness among consumers, demands for superior 2008, Wu et al., 2012), and freshness (Sivertsen et al., quality meat & meat products is continuously rising. Thus 2011b; Sone et al., 2012) in fish. modern meat industry requires quality control measures for supply of high quality meat and meat products. 3.1 Grading and classification of meat Conventionally, meat inspection is done by manual inspection which is labour-intensive, time-consuming and sometimes Grading and classification of meat is an important requirement lacks accuracy. Hence, newer approaches and techniques for for meat industry. Grading of meat is generally done by meat quality and safety analysis are need of the hour for meat manual inspection based on certain standards for grading &/or industry. A number of techniques are now being explored for chemical methods. Manual inspection and chemical procedures evaluating quality & safety of food products (Liu et al., 2003; are time-consuming, and destructive. Besides, there are Zheng et al., 2006a, Zheng et al., 2006b; Kumar & Mittal, chances of manual errors. Thus to overcome these, HSI have 2010; Quevedo & Aguilera, 2010; Fathi et al.,2011). In the been successfully applied for classification of meat (Elmasry & past decade, near-infrared (NIR) spectroscopy has been applied Sun, 2010; Barbin et al., 2012a).For pork, Qiao et al. (2007a) for analysis of food products as it provides analysis with lower first reported use of HSI technique for authentication wherein, costs, higher accuracy and minimal sample processing. pork samples were differentiated into 5 grades i.e.,(1) reddish, Moreover, several quality parameters can be analyzed firm, and non-exudative (RFN), (2) reddish, soft, and simultaneously (Wu et al., 2008; Stubbs et al., 2010; exudative (RSE),(3) pale, soft, and exudative(PSE) pork Klaypradit et al., 2011). However, it has limited scope as it is (4)pale, firm, and non-exudative (PFN)and (5) dark, farm, and unable to determine distribution of chemical constituents dry (DFD); with a classification accuracy of 85.7%. Further, within the sample. Therefore, HSI technique has been explored Barbin et al. (2012a) classified porcine meat into three grades for simultaneous detection &/ or quantification and localization (RFN, PSE and DFD), with an accuracy of 96%, using 900– of chemical constituents of the sample. Due to combined 1700 nm long-wave NIR spectral range. Results of these features of imaging and spectroscopy, HSI has emerged as a studies demonstrated usefulness of hyperspectral imaging in promising technique for non-destructive food quality, as well NIR region for classification and grading of pork. Further, the as, safety analysis (Sun & Brosnan, 2003; Du & Sun, 2005; effectiveness of HSI for lamb quality inspection has also been Jackman et al., 2008; Sun, 2008a; Sun, 2008b). Particularly in demonstrated by Kamruzzaman et al. (2011).The technique the meat industry, the technology has gained significant was found to be efficient for the discrimination of three types attraction. Quality aspects of meat and meat products which of muscles of lamb; namely psoas major (PM), longissimus are currently studied using HIS includes dorsi (LD), and semitendinosus (ST) muscle, which have entirely different anatomical localization. The researchers  Examination of tenderness (Naganathan et al., 2008a; (Kamruzzaman et al., 2012c) were also able to differentiate the Naganathan et al.,2008b;ElMasry et al., 2012a; Wu et LD muscle of beef, pork, and lamb with an accuracy of al., 2012a), pH (ElMasry et al.,2012a), color (ElMasry 98.67% in minced pork, beef, and lamb. Furthermore, in et al., 2012a, Wu et al., 2012a), water content and water cooked turkey ham slices also, classification as well as holding capacity (ElMasry et al., 2011b), chemical authentication could be successfully achieved using NIR composition (Kobayashi et al., 2010; ElMasry et hyperspectral imaging (ElMasry et al., 2011a). In the spectral al.,2012b), and spoilage by microbes (Peng et al., 2011) range of 900–1700 nm, the technique was also found to be in beef; useful for differentiation of frozen-thawed pork from fresh  Classification, grading (Qiao et al., 2007a; Barbin et al., pork (Barbin et al., 2013) and classification of Spanish cooked 2012a), and prediction of sensory and quality

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

451 Abhinav et al ham (Talens et al., 2013) apart from pork fat from different correlation with sensory panel scores but, the technique is time subcutaneous layers (Foca et al., 2013). consuming and requires trained manpower. Recently, Wu et al. (2010; 2012d) used HIS technique to determine Warner- 3.2 Prediction of quality attributes Bratzler shear force (WBSF). The same group further used HSI within the spectral range of 400–1100 nm (Tao et al., 2012) for Another emerging application of HSI is the prediction of investigation of pork tenderness. Further partial least squares quality parameters and distribution map of chemical regression (PLSR) models were developed and important constituents in the food. This potent technology has been used wavelengths in 900–1700nm spectral region were identified for successfully for determining various quality and compositional the assessment of WBSF for beef (ElMasry et al., 2012a) and attributes of meat and meat products such as fat content, lamb (Kamruzzaman et al., 2013a), resulting in good prediction of meat tenderness, sensory attributes, moisture prediction results. content, water holding capacity (WHC), colour, pH, protein content etc. 3.2.3 Prediction of water content and water holding capacity (WHC) 3.2.1 Determination of fat content Being vital component of food, water is an important attribute As fat is an essential standard for quality assessment criteria, for quality assessment of food products (Delgado & Sun, 2002; HSI has also been investigated for assessing the assessing Sun & Woods, 1993; Sun & Woods, 1994a; Sun & Woods, proportions of fat in meat and meat products. Scientists have 1994b; Sun & Woods, 1994c; Sun & Woods, 1997). Apart applied HSI technique in interactance mode in the short-wave from meat, in meat products also determination of water NIR region (760 to 1040 nm) for developing on-line model for content is essential. Researchers have applied PLSR models for beef fat content evaluation (Wold et al., 2011) and pork HSI in 900–1700 nm range for delineating water content in trimmings (O'Farrell et al., 2010). Further, a push broom HSI beef (ElMasry et al., 2013) and pork (Barbin et al., 2012c). in the reflectance mode (900–1700 nm) has also been Using similar methods, water content has also been estimated developed for rapid non-destructive determination of fat in in lamb (Kamruzzaman et al., 2012b), cooked ham (Talens et uncut as well as minced lamb (Kamruzzaman et al., 2012b), al., 2013) and pre-sliced turkey hams (Iqbal et al., 2013). The beef (ElMasry et al., 2013), pork (Barbin et al., 2012c) and results of these studies indicated effectiveness of HSI cooked ham (Talens et al., 2013).In yet another study, HSI technique for prediction of water content. Kandpal et al. (2013) images within range of 1000–2300 nm were acquired for used HIS in 400–1,000 nm spectral range for determining determining total fat content in beef cuts (Kobayashi et al., water content in cooked chicken and developed PLSR model 2010).Recently, Huang et al. (2014) used GLCM and gabor for extraction of correlation between the HSI spectra and water filter based HIS technique in fresh loin cut for prediction of content. Besides water content, another attribute of concern for intramuscular fat content. Besides total fat content, HSI has consumers purchasing meat, is water holding capacity (WHC). also been proved useful for prediction percentage of saturated WHC (indicated as drip loss) is an important meat quality fatty acid, as well as, unsaturated fatty acid, and key fatty acids indicator because decrease in WHC correlates with reduced such as myristic, palmitic, stearic, myristoleic, palmitoleic, processing quality (Prevolnik et al., 2010). In the recent years oleic and linoleic in beef cuts (Kobayashi et al., 2010). scientists have also applied HSI techniques in pork, beef, and Undoubtedly, these studies indicate the usefulness of lamb for determining WHC (ElMasry et al., 2011b; Barbin et hyperspectral imaging for the non-destructive analysis of fat al., 2012b; Kamruzzaman et al., 2012a). and fat attributes in meat and meat products. 3.2.4 Colour, pH and protein content analysis 3.2.2 Prediction of Sensory parameters such as meat tenderness Market value of meat and meat products highly depends upon Apart from above mentioned quality parameters, meat quality physical characteristics such as colour parameters (Wu & Sun, is also evaluated based on human senses i.e., taste sight, smell, 2012) and pH.HSI is also useful for prediction of other criteria touch, and hearing. Thus, HSI has also been used for prediction for quality assessment, like pH, color, and protein content and of sensory qualities of meat products, such as tenderness, has demonstrated its efficacy for prediction of pH and colour flavor, juiciness etc. (Barbin et al., 2012b; Kamruzzaman et al., in pork, beef, lamb and sliced turkey hams (Barbin et al., 2013a).Tenderness is important criteria for consumer 2012b; ElMasry et al., 2012a; Kamruzzaman et al., 2012a; perception of meat and meat products quality assessment. The Iqbal et al., 2013). Further, the NIR hyperspectral imaging assessment of tenderness in meat using HSI technique has been technique along with PLSR modelling showed respectable explored recently (Elmasry & Sun, 2010).Meat toughness is ability for determination of protein content in lamb generally represented by Warner-Bratzler shear force (WBSF), (Kamruzzaman et al., 2012b), porcine meat (Barbin et al., which is determined instrumentally. Although, using Warner- 2012b), beef (ElMasry et al., 2013), and Spanish cooked ham Bratzler for meat toughness determination yields best (Talens et al., 2013) with high accuracy.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Hyperspectral Imaging (HSI): Applications in Animal and Dairy Sector 452

Figure 1 Determination of microbial spoilage distribution of muscle foods. (A) Distribution of Enterobacteriaceae in chicken fillets. (B) Distribution of TVC in salmon fillets. (C) Distribution of E.coli in grams carp fish fillets. [Source: reprinted with the permission from Jun-Hu Cheng, Da-Wen Sun.2015. Recent applications of Spectroscopic and Hyperspectral Imaging Technique with Chemometric Analysis for Rapid Inspection of Microbial Spoilage in Muscle Foods. Comprehensive Reviews in Food Science and Food Safety, 14(4): 478-490. (@2015 Institute of Food Technologists® John Wiley and Sons )]

3.3 Microbial spoilage detection life of raw beef and pork. Peng et al. (2011) studied the microbial spoilage process (TVC determination) in beef using There is rapid growth of spoilage bacteria on moist nutritious hyperspectral imaging system (HIS) (400–1,000 nm) in meat surface of meat, if not stored properly (Ellis & Goodacre, scattering mode. In pork meat also, HSI has been explored for 2001).When total viable count (TVC) of bacteria increases TVC determination (Tao et al., 2010; Wang et al., 2010; Wang over a certain threshold value, the meat & meat products et al., 2011).HSI techniques have also been applied for becomes unacceptable for human consumption and thus TVC quantitative detection of Pseudomonas (Feng & Sun, 2013a), is an important indicator for evaluating safety of meat & meat and Enterobacteriaceae (Feng et al., 2012) in pork. The products. Conventional methods for detection of bacterial technique has also been utilized for determination of spoilage in meat comprises of microbiological, chemical and psychrotrophic plate count (PPC) and TVC in chilled porcine physical techniques (Nychas et al., 2008), which are laborious, muscle (Barbin et al., 2012d). time-consuming, require specialized laboratory procedures and manpower. Moreover, most of the techniques are destructive 3.4 Physical contaminants and defects detection (Ellis et al., 2004). Recently, in meat industry HSI has been applied in the area of microbial spoilage detection (Peng et al., Consumers always want to be assured that the meat products in 2011; Wang et al., 2011; Tao et al., 2012; Feng &Sun, 2013a, the market are safe, wholesome and free of contaminants & Feng & Sun, 2013b; Feng et al., 2013). Findings from these diseases. However, identification of various sorts of studies clearly indicate the utility of HSI in determining contaminants in meat & meat products is a challenging task bacterial activity leading to change in meat quality. and requires development of rapid reliable tests. Due to its Quantitative information on bacterial contamination in beef potential advantages, HSI can be successfully employed to and pork samples was also determined using HSI. Further the replace current manual inspection techniques. Although, studies also showed usefulness of HSI in prediction of shelf equally effective for other meat species also, most research on

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

453 Abhinav et al

HSI for detection of physical contaminants and defects has real-time detection of contaminated chickens (Yoon et al., been conducted on poultry carcasses (Nakariyakul & Casasent, 2011; Chao et al., 2014). Researchers have also developed 2008; Nakariyakul & Casasent, 2009). In the past decade, imaging systems for contamination detection in chicken USDA Agricultural Research Service (ARS) has successfully carcasses in an off-line mode (Windham et al., 2003; Lawrence developed HSI techniques for visualizing different et al., 2004).On the basis of differences in the spectra of contaminants and defects in chicken carcasses (Windham et healthy and systemically diseased chicken, HIS was applied for al., 2005a; Windham et al., 2005b; Yoon et al., 2007) and these identification of systemically diseased carcasses (Yang et al., systems are in use for online inspection of poultry 2006; Chao et al., 2007; Chao et al., 2008; Yang et al., 2010). carcasses(Elmasry & Sun, 2010). Recently, Yoon et al. (2011) HIS was also found to be useful for microbial spoilage developed a prototype HIS based on line-scanning for online detection (TVC) in chicken filets (Feng & Sun, 2012). identification of ingesta and faecal material on chicken Hyperspectral florescence imaging, yet another potential carcasses with detection accuracies from 89% and 98% application of HSI was used for skin tumor detection on depending on the algorithms used for detection (Yoon et al., poultry carcasses with 76–98% overall detection accuracies 2011). Further, HSI systems have been designed for online (Kim et al., 2004; Kim et al., 2010; Nakariyakul & Casasent, inspection of carcasses and discrimination of systemically 2007; Nakariyakul & Casasent, 2009). diseased chicken from wholesome ones at a high speed of approximately 140 birds per minute(Chao et al., 2010; Yang et Due to increasing throughput of egg industry, visual inspection al., 2010). of eggs by humans (candling), becomes a bottleneck in egg sorting chain. Thus, HIS based systems have been developed to 3.5 Detection of adulterants provide solution for a number of egg problems, for example detection of blood spots in shell eggs (Schouenberg, 2003). Various meat products (patties, sausages, meatballs, etc) Technique has also been used for detection of infertile, require minced meat materials, which are attractive targets for contaminated, and dead eggs (Chalker, 2003). During early adulteration (Kamruzzaman et al., 2012c, Kamruzzaman et al., incubation periods, detection of infertility using HSI would 2013b). Due to mincing structural characteristics of meat help hatcheries in removing infertile or problematic eggs, thus muscle are removed and thus it is often challenging to reducing costs and incubator space. Further, contamination due differentiate between different types of meat. Often, meat to exploding contaminated eggs will also be minimized. products are also adulterated with low-cost materials such as Another quality control aspect in production of designer eggs gelatin, offals or organ meats, flour etc. (Wu et al. 2013; Morsy is estimation of PUFA, i.e.,ω-3 polyunsaturated fatty acids. & Sun, 2013). Such adulteration can cause serious health risks HSI systems have been successfully employed to classify eggs for example allergic reaction to an adulterant (Zhao et al., according their PUFA content in a rapid and non-destructive 2014). Several biochemical, immunological and molecular manner (Abdel-Nour & Ngadi, 2011).Thus, HSI have a bright techniques have been utilized for detection of adulterants in future in poultry industry for quality control of designer eggs minced meat. Although, these techniques are efficient in and detection of defects in developing eggs. detection of adulterants, most of them are destructive, time consuming, and requires specialized laboratories. HSI has 4.1 HSI for quality and safety analysis of sea-foods emerged recently as an effective tool for rapid, non-destructive detection of contaminants in food products (Kamruzzaman et Sea-food products enrich human and pet foods with excellent al., 2014). Recently, Kamruzzaman et al. (2013b) developed a protein, fat and other nutritional components. Due to low rapid technique based on HIS in 900–1700 nm range for concentration of saturated fats and empty calories (good for detection of adulteration of pork, kidney, lung, heart, and in weight control), with high protein content, fish and other minced lamb. The study used PCA for identification of the seafood are a fantastic source of nutrition for dogs. Therefore most adulterated minced lamb.. Gelation is another material, evaluation of fish and other sea-foods quality is important for often used for adulteration for prawns and shrimps, which human and pet health. Sea-foods are highly perishable and being transparent isn’t easily identified by naked eyes. Wu et therefore rapid techniques for non-destructive monitoring of al. (2013) recently used HSI for successful detection of gelatin quality as well as safety parameters are required. Due to its adulteration in prawns. potential for food quality analysis, HSI has been exploited for safety and quality assessment of sea-foods such as trout, sea 4 Applications of HSI in poultry sector bass, salmon, halibut and cod. Recently, HSI has emerged as a method of choice to provide non-destructive evaluation of In poultry, most work related to HSI has been done for freshness of fish. In 2006, the technique was first applied for detection of faecal contaminants and ingesta (Park et al., 2007; moisture and texture prediction (Casas et al., 2006), and then in Windham et al., 2003; Windham et al., 2005a, Windham et al., 2010, it was used for determination of fat distribution in fishes 2005b; Yoon et al., 2007; Nakariyakul & Casasent, 2008, (Elmasry & Sun, 2010). Since then, the technique has emerged Nakariyakul & Casasent, 2009).The differences between as a potential alternative to traditional analytical methods for spectral properties of normal skin and the contaminants were rapid non-destructive prediction of nematode contamination exploited for detection of contaminants. Researchers have used (Sivertsen et al., 2011a; Sivertsen et al.,2012; Coelho et al, these differences for developing an online imaging system for 2013), determination of physical and chemical constituents

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Hyperspectral Imaging (HSI): Applications in Animal and Dairy Sector 454 such as moisture (ElMasry & Wold 2008; Wu et al., 2012c; He been used by Woodcock et al. (2008) for determining cheese et al, 2013), WHC (Wu & Sun, 2013b), colour distribution quality, as well as, authenticity. (Wu & Sun, 2012; Wu et al. 2013); texture (Wu et al., 2012a), ice fraction (Stevik et al., 2010), pH (He et al., 2012), fat So far, in milk industry HSI has been used mainly to detect content (ElMasry & Wold, 2008; Elmasry & Sun, 2010); adulterants such as melamine. Adulteration of melamine freshness (Ivorra et al., 2013), detection of microbial spoilage (2,4,6-triamino-1,3,5-triazine) in food is an important safety (Wu & Sun, 2013a); storage time determination (Huang et al., issue. In 2007, adulteration of pet food with melamine was the 2011), and detection of adulterants (Dissing et al., 2011). Most reason behind death of many pets (Tyan et al., 2009). Fu et al., studies preferred Salmon for prediction of quality aspects, (2014) successfully used HSI technique for melamine detection while a number of different fish species were considered for in milk powders. Qin et al. (2013)used Raman hyper-spectral moisture and fat determination by HSI technique. Recent imaging to detect multiple adulterants in milk powder. research have also proven utility of the technique in detection of parasites such as nematodes and fish ridges (Elmasry & Sun, 4.3 HSI in animal disease diagnosis and surgery 2010; Sivertsen et al., 2011a; Sivertsen et al., 2012).Researchers have also established HIS based automated Apart from food quality analysis, HSI applications have systems for nematode detection in full size cod filets operating extended in the area of disease diagnosis. Since animal tissues at a belt speed of 25 mm/s (Sivertsen et al., 2011a) and 400 have certain optical features corresponding to their chemical mm/s (Sivertsen et al., 2012) to meet the industrial characteristics, HSI is useful for determining physiologic and requirements. pathologic alterations at tissue level. Thus the technique can determine healthy or diseased status of the tissue effectively. Another potential application of HSI in fish industry is Since the technique is based on camera, and is a non- freshness determination (Menesatti et al., 2010;Elmasry & destructive technique, without any requirement of close Sun, 2010; Zhu et al., 2013).Researchers have extracted contact, it is useful in a wide range of medical applications for spectral and textural characteristics from hyperspectral images example in disease diagnosis or for monitoring surgical for successful differentiation of fresh, slow frozen-thawed and treatments. Moreover, it is useful in providing quantitative fast frozen-thawed fish filets (Zhu et al., 2013). Further, the information related to oxygen saturation in the tissues of cases technique is also useful for detection of expired smoked suffering from vascular disease (Kellicut et al., 2004). Further, salmon (Ivorra et al., 2013).HSI was also used to differentiate it is also useful during intestinal surgery for prediction of between sea cage cultured and concrete tank cultured sea bass ischemic regions of the intestine during surgery (Akbari et al., (Sone et al., 2012). Thus, recent research has demonstrated the 2010) and for diagnosis of hemorrhagic shock (Cancio et al., utility of HSI for monitoring all steps during the production 2006). In diabetic patients, HSI has been found to be useful for and supply of sea-foods. prediction and follow-up of foot ulcers for healing (Khaodhiar et al., 2007). An important application of HIS in medicine is 4.2 Applications of HSI in dairy industry discrimination of cancerous tissue from healthy tissue (Martin et al., 2006).Thus, apart from determining quality and safety Dairy products consist of complex assemblies of dissolved, attributes of livestock products, the technique can also be used suspended and emulsified substances, such as carbohydrates, for non-destructive diagnosis of diseases such as fat, proteins, minerals and vitamins. Traditional methods for cancers(Siddiqi et al., 2008; Akbari et al., 2011;Liu et al., analysis of dairy food require destruction of samples and, are 2012). time consuming, as well as, laborious. The HIS technique has amazing potential in dairy industry as a non-destructive In veterinary medicine, HSI has not been exploited to full analysis tool for wide range of applications. However, to date extent, however, it has been used for quantitative assessment of there are few published applications of HSI related to dairy canine mammary tumours (Manea et al., 2015), including, (i) industry. As fat concentration of milk varies spatially, HSI identification of the tissue types in the tumour affected area, technique holds promise for measuring size distribution of (ii) generation of a map for representing different tissue types, milk fat globules during homogenization. Applications of HIS and, (iii) analysis of this map & assessment of the apparent in this context could help in characterizing effects of area of each identifiable tissue type. The utility of the homogenization parameters on particle size distribution. This technique for cancer and other disease diagnosis has also been could lead to accurate prediction of the end-point for the demonstrated on various animal models (Fei et al., 2012). homogenization parameters. Qin & Lu (2006) have used the Further, it has also been exploited for detection of tumours technique for prediction of milk fat content by application of (Kim et al., 2004; Kong et al., 2004; Nakariyakul & Casasent, imaging in reflectance line-scanning mode. Further, the 2007) and systemic diseases (Yang et al., 2006;Yang et al., technique has scope for developing quality control systems for 2010)in chicken carcasses. Moreover, as HSI can differentiate the cheese-making process. During cheese making process, between healthy and diseased tissues, the technique can be changes in the light-scattering properties of milk are observed used as a monitoring tool during surgery for improving the due to modifications in the size and distribution of fat globules. chances of removal of all cancerous tissue by enhancing These changes can be successfully used for non-destructive visualization of cancerous tissue during surgery (Panasyuk et monitoring of cheese-making process.HSI based technique has al., 2007). Therefore, the technique provides reliable, real-time

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

455 Abhinav et al evaluation of intra-operative margins during surgery. This Informatics and Personalised Medicine 2:201-216. DOI: application would be of great value for cancer surgery in http://dx.doi.org/10.1504/IJFIPM.2009.027592. animals and should be further explored for veterinary applications. Akbari H, Kosugi Y, Kojima K, Tanaka N (2010) Detection and Analysis of The Ischemia Using Visible and Invisible 5 Conclusion, challenges and future prospective Hyperspectral Imaging. IEEE Transactions of Biomedical Engineering 57 : 2011-2017. DOI: Applications of HSI delineated through this review 10.1109/TBME.2010.2049110. undoubtedly prove the usefulness of HSI in livestock and poultry sector. As the technique is rapid, non-destructive, Akbari H, Uto K, Kosugi Y, Kojima K, Tanaka N (2011) reagent-less and applicable for analysis of broad range of Cancer detection using infrared hyperspectral imaging. Cancer quality attributes, currently designed low-cost systems has now Science 102:852-857. doi: 10.1111/j.1349-7006.2011.01849.x. moved the technology from laboratories to meat, poultry and fish screening, as well as, processing lines. However, Ariana DP, Lu R (2008) Quality evaluation of pickling compared to standard cameras, systems for HSI are still cucumbers using hyperspectral reflectance and transmittance expensive and for further extending the utility of technique in imaging: Part II. Performance of a prototype. Sensing and animal industry, new models with comparatively lower cost are Instrumentation for Food Quality and Safety 2:152–160. DOI required. Further, the potential of HSI for animal disease 10.1007/s11694-008-9058-9. diagnosis and in dairy sector needs to be explored further. Inspite of the fact that conventional methods for milk & milk Barbin D, ElMasry G, Sun DW, Allen P (2012a) Near-infrared products testing in the dairy industry could be complemented hyperspectral imaging for grading and classification of pork. with HSI for more precise & rapid evaluation, only few Meat Science 90:259–268. applications of HSI have been explored so far in this direction. The technique holds promise for safety evaluation of dairy Barbin D, ElMasry G, Sun DW, Allen P (2012b) Predicting products during all stages of processing: from raw milk to quality and sensory attributes of pork using near-infrared value-added milk products, and to waste products hyperspectral imaging. Analytica Chimica Acta 719:30–42. classification. To conclude, the future of hyperspectral systems applied to animal industry is promising as the technology has Barbin D, ElMasry G, Sun DW, Allen P, Noha M (2012d) shown a remarkable potential for animal products quality Non-destructive assessment of microbial contamination in evaluation, apart from its applicability in animal disease porcine meat using NIR hyperspectral imaging. Innovative diagnosis. Food Science and Emerging Technologies17:180–191.

Abbreviations Barbin D, Sun DW, Su C (2013) NIR hyperspectral imaging as non-destructive evaluation tool for the recognition of fresh and HSI Hyperspectral imaging frozen–thawed porcine longissimus dorsi muscles. Innovative HIS Hyperspectral imaging systems Food Science and Emerging Technologies18:226–236. TVC Total viable count WHC Water holding capacity Barbin, D, ElMasry G, Sun DW, Allen P (2012c).Non- IR Infrared destructive determination of chemical composition in intact NIR Near infrared and minced pork by near-infrared hyperspectral imaging. Food PLSR Partial least squares regression Chemistry 138:1162–1171. WBSF Warner-Bratzler shear force. Barlocco N , Vadell A, Ballesteros F, Galietta G , Cozzolino D Conflict of interest (2006) Predicting intramuscular fat, moisture and Warner Bratzler shear force in pork muscle using near-infrared Authors would hereby like to declare that there is no conflict of reflectance spectroscopy. Animal Science 82: 111-116. interests that could possibly arise. Bekker AJ, Shalhon M, Greenspan H, Goldberger J (2016) References Multi-View Probabilistic Classification of Breast Microcalcifications. Medical Imaging, IEEE Transactions Abdel-Nour N, Ngadi M (2011) Detection of omega-3 fatty on 35:645 - 653. acid in designer eggs using hyperspectral imaging. International Journal of Food Sciences and Nutrition 62 : 418– Cancio LC, Batchinsky AI, Mansfield JR, Panasyuk S, Hetz K, 422. doi: 10.3109/09637486.2010.542407. Martini D, Jordan BS, Tracey B, Freeman JE (2006) Hyperspectral imaging: a new approach to the diagnosis of Akbari H, Kosugi Y, Kojima K, Tanaka N (2009) hemorrhagic shock. The Journal of Trauma 60:1087-1095. Hyperspectral Image Segmentation and its Application in DOI: 10.1097/01.ta.0000217357.10617.3d. Abdominal Surgery. International Journal of Functional

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Hyperspectral Imaging (HSI): Applications in Animal and Dairy Sector 456 Casas C, Martinez O, Guillen MD, Pin C , Salmeron J (2006) Analytica Chimica Acta 514:193–201. Textural properties of raw Atlantic salmon (Salmo salar) at doi:10.1016/j.aca.2004.03.060. three points along the fillet, determined by different methods. Food Control 17:511-515. doi:10.1016/j.foodcont.2005.02.013. ElMasry G ,Iqbal A, Sun DW, Allen P, Ward P (2011a) Quality classification of cooked: sliced turkey hams using NIR Chalker II BA (2003) Methods and apparatus for non- hyperspectral imaging system. Journal of Food Engineering invasively identifying conditions of eggs via multi-wavelength 10:333–344. doi:10.1016/j.jfoodeng.2010.10.031. spectral comparison. U.S. Patent 6,535,277. Elmasry G, Sun DW (2010) Meat quality assessment using a Chao K, Kim MS, Chan DE (2014) Control interface and hyperspectral imaging system. In Sun DW (Ed.), Hyperspectral tracking control system for automated poultry inspection. imaging for food quality analysis and control. Academic Computer Standards & Interfaces 36:271–277. Press/Elsevier San Diego, California, USA, 1:175-240 doi:10.1016/j.csi.2011.03.006. ElMasry G, Sun DW, Allen P (2011b) Non-destructive Chao K, Yang CC, Chen YR, Kim MS, Chan DE (2007) determination of waterholding capacity in fresh beef by using Hyperspectral-multispectral line-scan imaging system for NIR hyperspectral imaging. Food Research International automated poultry carcass inspection applications for food 44:2624–2633. doi:10.1016/j.foodres.2011.05.001. safety. Poultry Science 86 : 2450–2460. doi: 10.3382/ps.2006- 00467. ElMasry G, Sun DW, Allen P (2012a) Near-infrared hyperspectral imaging for predicting colour: pH and tenderness Chao K, Yang CC, Kim MS, Chan DE (2008) High throughput of fresh beef. Journal of Food Engineering 110:127–140. spectral imaging system for wholesomeness inspection of doi:10.1016/j.jfoodeng.2011.11.028. chicken. Applied Engineering in Agriculture 24 :475–485. ElMasry G, Sun DW, Allen P (2012b) Chemical-free Chao KL, Yang CC, Kim MS (2010) Spectral line-scan assessment and mapping of major constituents in beef using imaging system for high-speed non-destructive wholesomeness hyperspectral imaging. Journal of Food Engineering 117:235– inspection of broilers. Trends in Food Science & Technology 246. doi:10.1016/j.jfoodeng.2013.02.016. 21:129–137. doi:10.1016/j.tifs.2009.08.001. ElMasry G, Sun DW, Allen P (2013) Chemical-free Coelho PA, Soto ME , Torres SN, Sbarbaro DG, Pezoa JE assessment and mapping of major constituents in beef using (2013) Hyperspectral transmittance imaging of the shell-free hyperspectral imaging. Journal of Food Engineering 117 :235– cooked clam Mulinia edulis for parasite detection. Journal of 246. doi:10.1016/j.jfoodeng.2013.02.016. Food Engineering 117:408–416. doi:10.1016/j.jfoodeng.2013.01.047. ElMasry G, Wold JP (2008) High-speed assessment of fat and water content distribution in fish fillets using online imaging Delgado AE, Sun DW (2002) Desorption isotherms for cooked spectroscopy. Journal of Agricultural Food Chemistry and cured beef and pork. Journal of Food Engineering 51:163– 56:7672–7677. doi: 10.1021/jf801074s. 170. doi:10.1016/S0260-8774(01)00053-X. Etzion Y, Kolatt T, Shoshany M, Broday DM (2014) Night- Dissing BS, Nielsen ME, Ersboll BK, Frosch S (2011) time ground hyperspectral imaging for urban-scale remote Multispectral imaging for determination of astaxanthin sensing of ambient PM--modal concentrations retrieval. concentration in salmonids. PLoS One 6(5):e19032. Environmental Science and Technology 48 :1787-94. DOI: http://dx.doi.org/10.1371/journal.pone.0019032. 10.1021/es403843t.

Du CJ, Sun DW (2005) Comparison of three methods for Fathi M, Mohebbi M, Razavi SM (2011) Application of image classification of pizza topping using different colour space analysis and artificial neural network to predict mass transfer transformations. Journal of Food Engineering 68 :277–287. kinetics and color changes of osmotically dehydrated kiwifruit. doi:10.1016/j.jfoodeng.2004.05.044. Food and Bioprocess Technology 4 :1357–1366. DOI: 10.1007/s11947-009-0222-y Ellis DI, Goodacre R (2001) Rapid and quantitative detection of the microbial spoilage of muscle foods: current status and Fei BW, Akbari H, Halig LV (2012) Hyperspectral imaging future trends. Trends Food Science Technology 12:414–424. and spectralspatial classification for cancer detection. The 5th doi:10.1016/S0924-2244(02)00019-5. IEEE International Congress on Image and Signal Processing (CISP 2012) and the 5th International Conference on Ellis DI, Broadhurst D, Goodacre R (2004) Rapid and BioMedical Engineering and Informatics (BMEI 2012), quantitative detection of the microbial spoilage of beef by Chongqing, China, October 16-18, 2012. Fourier transform infrared spectroscopy and machine learning.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

457 Abhinav et al

Feng YZ, Sun DW (2012) Determination of total viable count He HJ, Wu D, Sun DW (2013) Non-destructive and rapid (TVC) in chicken breast fillets by near-infrared hyperspectral analysis of moisture distribution in farmed Atlantic salmon imaging and spectroscopic transforms. Talanta 105:244–249. (Salmo salar) fillets using visible and near-infrared doi: 10.1016/j.talanta.2012.11.042. hyperspectral imaging. Innovative Food Science & Emerging Technologies 18: 237–245. Feng YZ, Elmasry G, Sun DW, Scannell AG, Walsh D, Morcy N (2012) Near-infrared hyperspectral imaging and partial least Huang H, Liu L, Ngadi MO, Gariépy C (2014) Rapid and non- squares regression for rapid and reagentless determination of invasive quantification of intramuscular fat content of intact Enterobacteriaceae on chicken fillets. Food Chemistry 138 pork cuts. Talanta 119:385–395. :1829–1836. doi: 10.1016/j.foodchem.2012.11.040. Huang H, Liu L, Ngadi MO, Simpson BK (2011) Feng YZ, Elmasry G, Sun DW, Scannell AG, Walsh D, Morcy Hyperspectral evaluation of changes in vacuum-packed cold- N (2013a) Near infrared hyperspectral imaging and partial smoked salmon during storage. In Proceedings of the least squares regression for rapid and reagentless determination International CIGR Technical Symposium, Nantes, France. of Enterobacteriaceae on chicken fillets. Food Chemistry 138:1829–1836. doi: 10.1016/j.foodchem.2012.11.040. Ikutegbe V, Sikoki F (2014) Microbiological and biochemical spoilage of smoke-dried fishes sold in West African open Feng YZ, Sun DW (2013a) Determination of total viable count markets. Food Chemistry 161:332–6. (TVC) in chicken Breast fillets by near-infrared hyperspectral imaging and spectroscopic transforms. Talanta 105:244–249. Iqbal A, Sun DW, Allen P (2013) Prediction of moisture, color doi:10.1016/j.talanta.2012.11.042. and pH in cooked,pre-sliced turkey hams by NIR hyperspectral imaging system. Journal of Food Engineering 117 : 42–51. Feng YZ, Sun DW (2013b) Near-infrared hyperspectral imaging in tandem with partial least squares regression and Ivorra, E, Girón, J, Sánchez, AJ, Verdú S, Barat JM, Grau R genetic algorithm for non-destructive determination and (2013) Detection of expired vacuum-packed smoked salmon visualization of Pseudomonas loads in chicken fillets. Talanta based on PLS-DA method using hyperspectral images. Journal 109:74–83. doi:10.1016/j.talanta.2013.01.057. of Food Engineering 117 : 342–349.

Foca G, Salvo D, Cino A, Ferrari C, Lo Fiego DP, Minelli G, Jackman P, Sun DW, Du CJ, Allen P (2008) Prediction of beef Ulrici A (2013) Classification of pig fat samples from different eating quality from colour, marbling and wavelet texture subcutaneous layers by means of fast and non-destructive features. Meat Science 80 :1273–1281. analytical techniques. Food Research International 52 :185– 197. doi:10.1016/j.foodres.2013.03.022. Kamruzzaman M, Barbin D, ElMasry G, Sun DW, Allen P (2012c) Potential of hyperspectral imaging and pattern Fu X, Kim MS, Chao K, Qin J, Lim J, Lee H, Garrido-Varo recognition for categorization and authentication of red meat. A, Pérez-Marín D, Ying Y (2014) Detection of melamine in Innovative Food Science and Emerging Technologies 16:316– milk powders based on NIR Hyperspectral imaging and 325. spectral similarity analyses. Journal of Food Engineering 124 : 97–104 Kamruzzaman M, ElMasry G, Sun DW, Allen P (2011) Application of NIR hyperspectral imaging for discrimination Gowen AA, O'Donnell CP, Cullen PJ, Downey G, Frias JM of lamb muscles. Journal of Food Engineering 104:332–340. (2007) Hyperspectral imaging — An emerging process analytical tool for food quality and safety control. Trends in Kamruzzaman M, ElMasry G, Sun DW, Allen P (2012a) Food Science & Technology 18 : 590–598. Prediction of some quality attributes of lamb meat using near- doi:10.1016/j.tifs.2007.06.001. infrared hyperspectral imaging and multivariate analysis. Analytica Chimica Acta 714:57–67. Grau R, Sánchez AJ, Girón J, Iborra E, Fuentes A, Barat JM (2011) Nondestructive assessment of freshness in packaged Kamruzzaman M, ElMasry G, Sun DW, Allen P (2012b) Non- sliced chicken breasts using SW-NIR spectroscopy.Food destructive prediction and visualization of chemical Research International 44:331–337. composition in lamb meat using NIR hyperspectral imaging doi:10.1016/j.foodres.2010.10.011. and multivariate regression.Innovative Food Science and Emerging Technologies 16:218–226. He HJ, Wu D, Sun DW (2012) Application of hyperspectral imaging technique for non-destructive pH prediction in salmon Kamruzzaman M, ElMasry G, Sun DW, Allen P (2013a) Non- fillets. Proceedings of the 3rd CIGR International Conference destructive assessment of instrumental and sensory tenderness of Agricultural Engineering (CIGR-AgEng,Valencia,Spain). of lamb meat using NIR hyperspectral imaging. Food Chemistry 141 : 389–396.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Hyperspectral Imaging (HSI): Applications in Animal and Dairy Sector 458 Kamruzzaman M, Haque ME, Ali MR (2014) Hyperspectral Kruse Fred A, Boardman Joseph W, Huntingto Jonathan F imaging technique for offal quantification in minced meat. (2003) Comparison of Airborne Hyperspectral Data and EO-1 Journal of Bangladesh Agricultural University 12 : 189–194. Hyperion for Mineral Mapping. IEEE transactions on geoscience and remote sensing 41 : 1388-1400. Kamruzzaman M, Sun DW, ElMasry G, Allen P (2013b) Fast detection and visualization of minced lamb meat adulteration Kumar S, Mittal GS (2010) Rapid detection of microorganisms using NIR hyperspectral imaging and multivariate image using image processing parameters and neural network. Food analysis. Talanta 103:130–136. and Bioprocess Technology 3 :741–751. DOI 10.1007/s11947- 008-0122-6. Kandpal LM, Lee H, S Kim Moon, Changyeun Mo, Byoung- Kwan Cho (2013) Hyperspectral Reflectance Imaging Lawrence KC, Windham WR, Park B, Smith DP, Poole GH Technique for Visualization of Moisture Distribution in (2004) Comparison between visible6 NIR spectroscopy and Cooked Chicken Breast Sensors. Basel 13: 13289–13300. hyperspectral imaging for detecting surface contaminants on poultry carcasses. Proceedings of SPIE - The International Kellicut DC, Weiswasser JM, Arora S, Freeman JE, Lew RA, Society for Optical Engineering 5271:35–42. doi: Shuman C, Mansfield JR, Sidawy AN (2004) Emerging 10.1117/12.516153 Technology: Hyperspectral Imaging. Perspectives in Vascular Surgery and Endovascular Therapy 16:53-57. doi: Li J, Rao X, Ying Y (2011) Detection of common defects on 10.1177/153100350401600114. oranges using hyperspectral reflectance imaging. Computers and Electronics in agriculture 78:38–48. Khaodhiar L, Dinh T, Schomacker KT, Panasyuk SV, Freeman JE, Lew R, Vo T, Panasyuk AA, Lima C, Giurini JM, Lyons Liu Y, Lyon BG, Windham WR, Realini CB, Pringle TDD, TE, Veves A (2007) The use of medical hyperspectral Duckett S (2003) Prediction of colour, texture, and sensory technology to evaluate microcirculatory chaves in diabetic foot characteristics of beef steaks by visible and near infrared ulcers and to predict clinical outcomes. Diabetes Care 30:903- reflectance spectroscopy: A feasibility study. Meat Science 910. http://dx.doi.org/10.2337/dc06-2209. 65:1107–1115.

Kim MS, Chen YR, Kong SG (2004) Detection of skin tumors Liu Z, Wang H, Li Q (2012) Tongue Tumor Detection in on chicken carcasses using hyperspectral fluorescence Medical Hyperspectral Images. Sensors 12:162-174. imaging. Transactions of the American Society of Agricultural Engineers 47:1785–1792. Manea D, Calin MA, Miclos S, Savastru D, Negreanu R (2015) Method for assessing mammary tumours based on Kim MS, Park B, Yoon SC, Windham WR, Lawrence KC, hyperspectral imaging. Romanian reports in physics 67: 1503– Heitschmidt GW, Chao K, Tu SI (2010) Line-scan 1511. hyperspectral imaging for real-time poultry fecal detection. In: Kim MS, Tu SI, Chao K (Eds). Proc. SPIE 7676, Sensing for Martin ME, Wabuyele MB, Chen K, Kasili P, Panjehpour M, Agriculture and Food Quality and Safety II, Florida : 76760I- Phan M, Overholt B, Cunningham G, Wilson D, Denovo RC, 76760I-10. Vo-Dinh T (2006) Development of an advanced hyperspectral imaging (HSI) system with applications for cancer detection. Klaypradit W, Kerdpiboon S, Singh RK (2011) Application of Annals of Biomedical Engineering 34:1061-1068. DOI: artificial neural networks to predict the oxidation of menhaden 10.1007/s10439-006-9121-9 fish oil obtained from Fourier transform infrared spectroscopy method. Food and Bioprocess Technology 4 :475–480. Menesatti, P, Costa C, Aguzzi J (2010) Quality evaluation of fish by hyperspectral Imaging. In Sun DW (Ed.), Hyperspectral Kobayashi KI, Matsui Y, Maebuchi Y,Toyoto T, Nakauchi S imaging for food quality: Analysis and control (pp. 273–294). (2010) Near infrared spectroscopy and hyperspectral imaging San Diego, California, USA: Academic Press/Elsevier. for prediction and visualisation of fat and fatty acid content in intact raw beef cuts. Journal of Near Infrared Spectroscopy Moroni M, Lupo E, Marra E, Cenedese A (2013) 18:301–315. doi: http://dx.doi.org/10.1255/jnirs.896. Hyperspectral Image Analysis in Environmental Monitoring: Setup of a New Tunable Filter Platform. Procedia Kong SG, Chen YR, Kim I, Kim MS (2004) Analysis of Environmental Sciences 19: 885–894 hyperspectral fluorescence images for poultry skin tumor inspection. Applied Optics 43 :824–833. Morsy N, Sun DW (2013) Robust linear and non-linear models of NIR spectroscopy for detection and quantification of Kruppinski EA (2004) Computer-aided detection in clinical adulterants in fresh and frozen-thawed minced beef. Meat environment: Benefits and challenges for radiologists. Science 93 : 292-302. Radiology 231:7-9. DOI: http://dx.doi.org/10.1148/radiol.2311031864.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

459 Abhinav et al

Muhammad A, Lee S, Haq E, Mushtaq Q (2012) Hyperspectral Peng Y, Zhang J, Wang W, Li Y, Wu J, Huang H, Gao, Jiang Remote Sensing: Dimensional Reduction and Endmember XW (2011) Potential prediction of the microbial spoilage of Extraction. International Journal of Soft Computing and beef using spatially resolved hyperspectral scattering profile. Engineering 2:170-175. Journal of Food Engineering 102:163–169.

Naganathan GK, Grimes LM, Subbiah J, Calkins CR , Samal Prasad ST, Ronald BS, Pauw ED (2000) Hyperspectral A, Meyer GE (2008b) Partial least squares analysis of near- vegetation indices and their relationships with agricultural crop infrared hyperspectral images for beef tenderness prediction. characteristics. Remote Sensing Environment 71:158-182. Sensing and Instrumentation for Food Quality and Safety 2:178–188. Prevolnik M, Candek-Potokar M, Skorjanc D (2010) Predicting pork water-holding capacity with NIR spectroscopy Naganathan GK, Grimes LM, Subbiah J, Calkins CR, Samal in relation to different reference methods. Journal of Food GEA (2008a) Meyer, Visible/ near-infrared hyperspectral Engineering 98 :347–352. imaging for beef tenderness prediction. Computer Electronics and Agriculture 64:225–233. Qiao J, Wang N, Ngadi MO, Gunenc A, Monroy M, Gariepy C, Prasher SO (2007a) Pork quality classification using a Nakariyakul S, Casasent DP (2007) Contaminant detection on hyperspectral imaging system and neural network. poultry carcasses using hyperspectral data: Part II. Algorithms International Journal Food Engineering 3 :6. for selection of sets of ratio features. In: Tu, SI (Ed.). International Society for Optics and Photonics. Optics East, Qiao J, Wang N, Ngadi MO, Gunenc A, Monroy M, Gariepy SPIE, Boston :67610S- 67610S-12. C, Prasher SO (2007b) Prediction of drip-loss: pH and color for pork using a hyperspectral imaging technique. Meat Nakariyakul S, Casasent DP (2008) Hyperspectral waveband Science 76:1–8. selection for contaminant detection on poultry carcasses. Optical Engineering 47:087202–087209. doi: Qin J, Chao K, Kim MS (2013) Simultaneous detection of 10.1117/1.2968693 multiple adulterants in dry milk using macro-scale Raman chemical imaging. Food Chemistry 138 : 998-1007. Nakariyakul S, Casasent DP (2009) Fast feature selection algorithm for poultry skin tumor detection in hyperspectral Qin J, Lu R (2006) Hyperspectral diffuse reflectance imaging data. Journal of Food Engineering 94:358–365. for rapid, noncontact measurement of the optical properties of doi:10.1016/j.jfoodeng.2009.04.001 turbid materials. Applied Optics 45 : 8366-73.

Nicola BM, Beullens, EB, Peirs A, Saeys W, Theron KI, Quevedo R, Aguilera JM (2010) Computer vision and Lammertyna J (2007) Nondestructive measurement of fruit and stereoscopy for estimating firmness in the salmon (Salmon vegetable quality by means of NIR spectroscopy: a review. salar) fillets. Food and Bioprocess Technology 3 : 561–567 Postharvest Biology and Technology 46:99–118. Ramakrishnan D, Bharti R (2015) Hyperspectral remote Nychas GJE, Skandamis PN, Tassou CC, Koutsoumanis KP sensing and geological applications. Current Science (2008) Meat spoilage during distribution. Meat Science 78:77– 108(5):879-891. 89. Rampun A, Chen Z, Malcolm P, Tiddeman B, Zwiggelaar R O'Farrell M, Wold JP, Hoy M, Tschudi J, Schulerud H (2010) (2016) Computer-aided diagnosis: detection and localization of On-line fat content classification of in homogeneous pork prostate cancer within the peripheral zone. International trimmings using multispectral near infrared interactance Journal for Numerical Methods in Biomedical Engineering 32 : imaging. Journal of Near Infrared Spectroscopy 18 :135–146. e02745- e02765 .doi: 10.1002/cnm.2745.

Panasyuk SV, Yang S, Faller DV, Ngo D, Lew RA, Freeman Reich GW (2005) Near-infrared spectroscopy and imaging: JE, Rogers AE (2007) Medical hyperspectral imaging to basic principles and pharmaceutical applications. Advanced facilitate residual tumor identification during surgery. Cancer Drug Delivery Reviews 57:109–1143. Biology and Therapy 1:439-46 Richter R (2005) Hyperspectral Sensors for Military Park B, Kise M, Lawrence K, Windham W, Smith D, Thai C Applications.Meeting Proceedings RTO-MP-SET-094, (2007) Real-time multispectral imaging system for online Keynote 1. Neuilly-sur-Seine, France: RTO, In Emerging EO poultry fecal inspection using unified modeling language. Phenomenology : KN1-1 – KN1-4. Sensing and Instrumentation for Food Quality and Safety 1:45–54. Schouenberg KOP (2003) Method and device for detecting undesired matter in eggs. U.S. Patent 6,504,603.

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

Hyperspectral Imaging (HSI): Applications in Animal and Dairy Sector 460 Segtnan V.H, Høy M, Sørheim O, Kohler A, Lundby F, Wold Sun DW, Woods JL (1993) The moisture-content relative- JP, Ofstad R (2009b) Noncontact salt and fat distributional humidity equilibrium relationship of wheat - A review. Drying analysis in salted and smoked salmon fillets using X-ray Technology 11:1523–1551. computed tomography and NIR interactance imaging. Journal of Agricultural Food Chemistry 57:1705–1710. Sun DW, Woods JL (1994a) The selection of sorption isotherm equations for wheat-based on the fitting of avaliable data. Segtnan VH, Høy M, Lundby F, Narum B, Wold JP (2009a) Journal of Stored Products Research 30 : 27–43. Fat distributional analysis in salmon fillets using non-contact near infrared interactance imaging a sampling and calibration Sun DW, Woods JL (1994b) Low-temperature moisture strategy. Journal of Near Infrared Spectroscopy 17:247–253. transfer characteristics of wheat in thin-layers. Transactions of the Asae 37(6):1919–1926. Siddiqi AM, Li H, Faruque F, Williams W, Lai K, Hughson M, Bigler S, Beach J, Johnson W (2008) Use of hyperspectral Sun DW, Woods JL (1994c) Low-temperature moisture imaging to distinguish normal, precancerous, and cancerous transfer characteristics of Barley - Thin -layers models and cells. Cancer Cytopathology 114:13-21. doi: equilibrium isotherms. Journal of Agricultural Engineering 10.1002/cncr.23286. Research 59: 273–283.

Sivertsen AH, Heia K, Hindberg K, Godtliebsen F (2012) Sun DW, Woods JL (1997) Simulation of the heat and Automatic nematode detection in cod fillets (Gadusmorhua L) moisture transfer process during drying in deep grain beds. by hyperspectral imaging. Journal of Food Engineering 111 : Drying Technology 15 : 2479–2508. 675–681 Talens P, Mora L, Morsy N, Barbin, DF, ElMasry G, Sun DW Sivertsen AH, Heia K, Stormo SK, Elvevoll E, Nilsen H (2013) Prediction of water and protein contents and quality (2011a) Automatic nematode detection in cod fillets classification of Spanish cooked ham using NIR hyperspectral (Gadusmorhua) by transillumination hyperspectral imaging. imaging. Journal of Food Engineering 117(3):272–280. Journal of Food Science 76 : S77–S83. Tanvir HD, Michael DS (1990) High resolution derivative Sivertsen AH, Kimiya T, Heia K (2011b) Automatic freshness spectra in remote sensing. Remote Sensing Environment assessment of cod (Gadusmorhua) fillets by 33:55-64. Vis/Nirspectroscopy. Journal of Food Engineering 103:317– 323. Tao FF, Peng YK, Li YY, Chao KL, Dhakal S (2012) Simultaneous determination of tenderness and Escherichia coli Sone I, Olsen RL, Sivertsen AH, Eilertsen G, Heia K (2012) contamination of pork using hyperspectral scattering Classification of fresh Atlantic salmon (Salmo salar L.) fillets technique. Meat Science 90:851–857. stored under different atmospheres by hyperspectral imaging. Journal of Food Engineering 109:482–489. Tao FF, Wang W, Li YY, Peng YK, Wu JH, Shan JJ (2010) A rapid non-destructive measurement method for assessing the Stevik AM, Duun AS, Rustad T, O'Farrell M, Schulerud H, total plate count on chilled pork surface. Spectroscopy and Ottestad S (2010) Ice fraction assessment by near-infrared Spectral Analysis 30 :3405–3409. spectroscopy enhancing automated superchilling process lines. Journal of Food Engineering 100 : 169–177. Tyan YC, Yang MH, Jong SB, Wang CK, Shiea J (2009) Melamine contamination. Analytical and Bioanalytical Stubbs TL, Kennedy C, Fortuna AM (2010) Using NIRS to Chemistry 395 : 729–735. predict fiber and nutrient content of dryland cereal cultivars. Journal of Agricultural and Food Chemistry 58:398–403. Wang W, Li C, Gitaitis R, Tollner E, Rains G, Yoon SC (2010) Near-infrared Hyperspectral Reflectance Imaging for Sun DW (2008a) Computer vision technology for food quality Early Detection of Sour Skin Disease in Vidalia Sweet Onions. evaluation. Academic Press / Elsevier, San Diego, California, ASABE Annual International Meeting. Pittsburgh, USA, 583. Pennsylvania: American Society of Agricultural and Biological Sun DW (2008b) Infrared spectroscopy for food quality Engineers, St. Joseph, Michigan (Paper No. 1009106). analysis and control. Academic Press / Elsevier, San Diego, California, USA, 583. Wang W, Peng WY,Huang H, Wu J (2011) Application of hyper-spectral imaging technique for the detection of total Sun DW, Brosnan T (2003) Pizza quality evaluation using viable bacteria count in pork. Sensor Letters 9:1024–1030. computer vision -part 1 - Pizza base and sauce spread. Journal of Food Engineering 57 : 81–89. Windham W, Smith DP, Park B, Lawrence K, Feldner PW (2003) Algorithm development with visible6 near-infrared

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org

461 Abhinav et al spectra for detection of poultry feces and ingesta. Transactions distribution in salmon fillet. Innovative Food Science & of the ASAE 46 :1733–1738. Emerging Technologies 16:361–372.

Windham WR, Heitschmidt GW ,Smith DP, Berrang ME Wu JH, Peng YK, Li Y, Wang W, Chen JJ, Dhakal S (2012a) (2005b) Detection of ingesta on pre-chilled broiler carcasses Prediction of beef quality attributes using VIS/NIR by hyperspectral imaging. International Journal of Poultry hyperspectral scattering imaging technique. Journal of Food Sciences 4 :959–964. Engineering 109:267–273.

Windham WR, Smith DP, Berrang ME, Lawrence KC, Feldner Wu JH, Peng YK, Chen, JJ, Wang W, Gao XD, Huang H PW (2005a) Effectiveness of hyperspectral imaging system for (2010) Study of spatiallyresolved hyperspectral scattering detecting cecal contaminated broiler carcasses. International images for assessing beef quality characteristics. Spectroscopy Journal of Poultry Sciences 4:657–662. and Spectral Analysis 30 :1815–1819.

Wold JP, O'Farrell M, Hoy M, Tschudi J (2011) On-line Yang CC, Chao K, Chen YR, Kim MS , Chan DE (2006) determination and control of fat content in batches of beef Development of fuzzy logic based differentiation algorithm trimmings by NIR imaging spectroscopy. Meat Science 89 and fast line-scan imaging system for chicken inspection. :317–324. Biosystems Engineering 95 : 483–496.

Woodcock T, Fagan C, O’Donnell C, Downey G (2008) Yang CC, Chao K, Kim MS, Chan DE, Early HL, Bell M Application of Near and Mid-Infrared Spectroscopy to (2010) Machine vision system for on-line wholesomeness Determine Cheese Quality and Authenticity. Food and inspection of poultry carcasses. Poultry Science 89 : 1252– Bioprocess Technology 1: 117-129. 1264.

Wu D, He Y, Feng S, Sun D-W (2008) Study on infrared Yoon SC, Lawrence KC, Park B, Windham WR (2007) spectroscopy technique for fast measurement of protein content Statistical model-based thresholding of multispectral images in milk powder based on LS-SVM. Journal of Food for contaminant detection on poultry carcasses. Transactions of Engineering 84 :124–131. the ASABE 50:1433–1442.

Wu D, Shi H, He Y, Yu X , Bao Y (2013) Potential of Yoon SC, Park B, Lawrence KC, Windham WR, Heitschmidt hyperspectral imaging and multivariate analysis for rapid and GW (2011) Line-scan hyperspectral imaging system for real- noninvasive detection of gelatin adulteration in prawn. Journal time inspection of poultry carcasses with fecal material and of Food Engineering 119 : 680-686. ingesta. Computers and Electronics in Agriculture 79 :159– 168. Wu D, Shi H, Wang S, He Y, Bao Y,Liu K (2012c) Rapid prediction of moisture content of dehydrated prawns using Zhao M, Downey G, Donnell CO (2014) Detection of online hyperspectral imaging system.Analytica Chimica Acta adulteration in fresh and frozen beefburger products by beef 726:57–66. offal using mid-infrared ATR spectroscopy and multivariate data analysis. Meat Science 96:1003-1011. Wu D, Sun DW (2012) Colour measurements by computer vision for food quality control — A review. Trends in Food Zheng CX, Sun DW, Zheng LY (2006a) Recent developments Science & Technology, 29:5–20. and applications of image features for food quality evaluation and inspection - a review. Trends in Food Science & Wu D, Sun DW (2013a) Potential of time series-hyperspectral Technology 17 : 642–655. imaging (TS-HSI)for non-invasive determination of microbial spoilage of salmon flesh. Talanta 111: 39–46. Zheng CX, Sun DW, Zheng LY (2006b) Recent applications of image texture for evaluation of food qualities - a review. Wu D, Sun DW (2013b) Application of Visible and near Trends in Food Science & Technology 17:113–128. infrared hyperspectral imaging for non-invasively measuring distribution of water-holding capacity in salmon flesh. Talanta Zhu F, Zhang D, He Y, Liu F, Sun DW (2013) Application of 116: 266–276 visible and near infrared hyperspectral imaging to differentiate between fresh and frozen-thawed fish fillets. Food and Wu D, Sun DW, He Y (2012d) Application of long-wave near Bioprocess Technology 6 : 2931-2937. infrared hyperspectral imaging for measurement of color

______Journal of Experimental Biology and Agricultural Sciences http://www.jebas.org