• Abstract and Figures
• Public Full-text

Copyright Ó 2008 by the Genetics Society of America DOI: 10.1534/genetics.108.093922 Note Transcriptional Control and Protein Specialization Have Roles in the Functional Diversification of Two Dicer-Like Proteins in Magnaporthe oryzae Naoki Kadotani, Toshiki Murata, Nguyen Bao Quoc, Yusuke Adachi and Hitoshi Nakayashiki1 Laboratory of Plant Pathology, Kobe University, Kobe 657-8501, Japan Manuscript received July 14, 2008 Accepted for publication August 15, 2008 ABSTRACT Quantitative RT–PCR and overexpression studies of two Dicer-like proteins, MoDcl1 and MoDcl2, in Magnaporthe oryzae indicated that the functional diversification of the MoDcl1 and MoDcl2 proteins in RNA- mediated gene silencing pathways was likely to have arisen from both transcriptional control and protein specialization. ICER is a member of the RNase III superfamily of belongs to the broad category of gene silencing pathways D bidentate nucleases that process long dsRNA exemplified by RNAi, in which a specific mRNA is precursorsintoshorter units (21–30 nt)thatsubsequently targeted for degradation via an siRNA-mediated path- act as specificity determinants in various RNA-mediated way (referred to as ‘‘RNAi pathway’’ hereafter). MSUD gene silencing pathways. Genome sequencing projects silences the expression of such genes that cause un- have revealed that Dicer-like (DCL) proteins are evolu- paired DNA during meiosis in the zygote. Quelling has tionarily conserved in a widerange of eukaryotic genomes been shown to be mediated by qde-1 (RdRP) (Cogoni although the number of DCL proteins in the genome and Macino 1999), qde-2 (Argonaute) (Cogoni and varies among different organisms. Mammals have only Macino 2000), and two redundantly functioning Dicer one DCL protein, which participates in at least two dif- proteins, dcl-1/sms-3 and dcl-2 (Galagan et al. 2003; ferent types of gene silencing pathways, namely, siRNA Catalanotto et al. 2004), with a probable greater and miRNA pathways (Billy et al.2001;Hutvagner contribution of dcl-2 to the pathway (Catalanotto et al. 2001). In contrast, multiple DCL proteins have been et al. 2004; Maiti et al. 2007). Interestingly, MSUD uses found in other organisms such as Drosophila melanogaster paralogous proteins of the quelling components such as and Arabidopsis thaliana. The multiple DCL proteins are sad-1 (RdRP) (Shiu et al. 2001) and sms-2 (Argonaute) shown to mainly function in discrete RNA silencing (Lee et al. 2003). Recently, DCL-1/SMS-3 protein but not pathways with some overlap in specificity (Jaskiewicz DCL-2 protein was shown to be required for MSUD and and Filipowicz 2008). It is of interest to know how the to colocalize with SAD-1 and SMS-2 in the perinuclear functional diversification of paralogous Dicer proteins region (Alexander et al. 2008). has been achieved along with the development of various In the rice blast fungus Magnaporthe oryzae, two DCL RNA silencing pathways during evolution. genes, designated MoDcl1 and MoDcl2 (formerly Mdl1 In the model filamentous fungus Neurospora crassa, and Mdl2, respectively), have been identified (Kadotani two different forms of RNA-mediated gene silencing, et al.2004).MoDcl1 and MoDcl2 are orthologous to namely, quelling (Romano and Macino 1992) and Neurospora dcl-1/sms-3 and dcl-2, respectively. We pre- meiotic silencing by unpaired DNA (MSUD) (Aramayo viously reported that, in Magnaporthe, MoDcl2 was solely and Metzenberg 1996; Shiu et al. 2001), have been responsible for the RNAi pathway in mycelia (Kadotani identified. Quelling operates during the vegetative phase et al. 2004). Therefore, unlike Neurospora, no redun- while MSUD acts during the meiotic phase. Quelling dancy between the two DCL proteins was observed, suggesting a clear functional diversification of the M. oryzae Dicers. Here we show that this functional diversifi- 1Corresponding author: Laboratory of Plant Pathology, Kobe University, 1-1, Rokkodai-cho, Nada-ku, Kobe 657-8501, Japan. cation likely stems from a combination of transcriptional E-mail: [email protected] control and protein specialization. Genetics 180: 1245–1249 (October 2008) 1246 N. Kadotani et al. TABLE 1 Absolute quantitative RT–PCR (qRT–PCR) analysis of MoDcl1 and MoDcl2 in the overexpressing trans- formants and wild type of Magnaporthe oryzae mRNA copies (per 25 ng total RNA) Relative fold to wild type Strain MoDcl1 MoDcl2 MoDcl1 MoDcl2 Wild type (Br48) 689.1 6 97.8a 9,267.7 6 935.8 1 1 tMoDcl1-OE11 248,853.2 6 15,017.6 NE 361.2 tMoDcl1-OE12 154,310.5 6 8,766.6 NE 223.9 tMoDcl1-OE13 224,692.2 6 3,004.1 NE 326.1 tMoDcl2-OE21 NE 24,372.4 6 1,662.2 2.6 tMoDcl2-OE22 NE 252,251.5 6 19,721.7 27.2 tMoDcl2-OE23 NE 13,400.5 6 1,140.8 1.4 Quantitative RT–PCR (qRT–PCR) analysis was performed with real-time PCR (Applied Biosystems 7500 or 7300 real-time PCR system) and SYBR Green fluorescence detection (SYBR GreenER two-step qRT–PCR kit for uni- versal; Applied Biosystems, Foster City, CA). Total RNA was extracted from fungal mycelia grown in liquid media as described previously (Kadotani et al. 2004), and reverse transcribed into cDNAs using a SuperScript III RT– PCR system (Invitrogen). Sets of specific primers for MoDcl1 (MDL1-Fw: CCCGTGGATACTGTGGTAATGG, MDL1-Rv: GCAATGTCGATTGGAATATCAAGAC) and MoDcl2 (MDL2-Fw: CGCTCTACTTCCAGTCCCTTTC, MDL2-Rv: TGGTCACGTCTGGATCAAAGC) as well as for two internal controls, actin (Mo-actin-F: GCGGTTA CACCTTCTCTACCAC, Mo-actin-R: AGTCTGGATCTCCTGCTCAAAG), and b-tubulin genes (Mo-tub-F: CGA GACCTTCTGCATTGACAAC, Mo-tub-R: GGCCGAAACCAGGTAGTTCA), were used in the analysis. The copy numbers of the MoDcl1 and MoDcl2 transcripts relative to the total RNA were determined by real-time RT– PCR with reference to standard plasmids carrying MoDcl1 and MoDcl2 cDNAs, respectively. NE, not examined. a Standard deviation. First, we examined the expression levels of MoDcl1 (tMoDcl2-OE). Surprisingly, GFP silencing was also ob- and MoDcl2 mRNAs in the vegetative mycelia of the M. served in the MoDcl1-OE lines (tMoDcl1-OE), although oryzae isolate Br48 (a wheat-infecting strain) by quanti- the average level of silencing was significantly lower than tative RT–PCR (qRT–PCR). Three independent qRT– those in the tMoDcl2-OE and wild-type strains (P , 0.01 PCR analyses indicated that 689.1. 6 97.8 copies of by t-test). MoDcl1 and 9267.7 6 935.8 copies of MoDcl2 tran- To address whether MoDcl1 protein is capable of scripts on average were detected in 25 ng of total RNA producing siRNAs, three strongly silenced transform- from mycelia (Table 1). Therefore, the average copy ants (categorized in the 0–20% class in Figure 1) were number of MoDcl2 mRNA was 13.5 times higher than picked up from the tMoDcl1-OE lines as well as from the that of MoDcl1 mRNA in vegetative mycelia of M. oryzae. tMoDcl2-OE lines and subjected to Northern blot To examine whether different levels of transcriptional analysis. Consistent with the phenotypic observations activity could play a role in the functional diversification in Figure 1, lower levels of GFP siRNA accumulation of MoDcl1 and MoDcl2 proteins in RNA silencing path- were, in general, detected in the tMoDcl1-OE lines ways in M. oryzae, we performed overexpression (OE) compared to the tMoDcl2-OE lines (Figure 2). Next we experiments. The full-length MoDcl1 and MoDcl2 cDNAs performed qRT–PCR to examine the transcriptional were introduced into the OE vector, pGT, which carries levels of MoDcl1 and MoDcl2 mRNA in the OE lines. multiple cloning sites between the Aspergillus nidulans The results showed that MoDcl1 and MoDcl2 mRNAs gpdA (glyceraldehyde-3-phosphate dehydrogenase) pro- were overexpressed, on average, by 303.7- and 10.4-fold, moter (2kbinlength)andA. nidulans trpC terminator respectively, relative to the wild-type strain (Table 1). (0.5 kb). A GFP-expressing MoDcl2 knockout (KO) The absolute expression levels of the target genes dif- mutant, which was previously constructed by a conven- fered significantly among the OE lines but were at com- tional gene replacement method, was transformed with parable levels in lines strongly expressing either MoDcl1 the MoDcl1 or MoDcl2 OE vectors together with a GFP- or MoDcl2 (e.g., tMoDcl1-OE13 and tMoDcl2-OE22 in silencing plasmid, pEGFP-SA-neo (Kadotani et al. 2004). Table 1). These results indicated the following. First, the As a control, pEGFP-SA-neo was introduced into a GFP- overexpressed MoDcl1 protein was capable of generat- expressing wild-type strain. The resulting transformants ing siRNAs that functioned in the RNAi pathway in M. were classified into five categories on the basis of the oryzae. Second, the MoDcl1 protein appeared to be less relative GFP fluorescence levels to their parent strains efficient in Dicer activity since siRNA accumulation was (Figure 1). The results revealed that the RNAi phenotype lower in the tMoDcl1-OE lines than in the tMoDcl2-OE of the parent strain (MoDcl2 KO mutant) was completely lines, despite the relatively higher gene expression levels restored to the wild-type levels in the MoDcl2-OE lines of the MoDcl1 gene in the transformants. Note 1247 Figure 2.—Northern blot analysis of GFP siRNAs in the MoDcl1 and MoDcl2 overexpressing transformants. Three MoDcl1 and MoDcl2 overexpressing transformants each were subjected to siRNA analysis. Low-molecular-weight RNA was extracted and hybridized with a GFP probe as described pre- viously (Kadotani et al. 2004). DNA oligonucleotides (30 and igure F 1.—Overexpression of MoDcl1 cDNA partially re- 21 mer) were used as molecular size markers. Equal loading of stored hairpin RNA-induced gene silencing in the MoDcl2 total RNA was estimated by ethidium bromide staining of pre- KO mutant. The overexpression (OE) vectors of cMoDcl1 dominant RNAs. M, oligonucleotide markers; C, parent strain and cMoDcl2 were introduced into the GFP-expressing (GFP-expressing MoDcl2 knockout mutant); tMoDcl1-OE11– MoDcl2 knockout mutant by the cotransformation method 13, transformants with the cMoDcl1 OE vector; tMoDcl2- with the GFP silencing construct, pEGFP-SA-neo carrying OE21–23, transformants with the cMoDcl2 OE vector.

Load more

  5

Copy Link