DOCSLIB.ORG

An Abstract of the Thesis Of

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
An Abstract of the Thesis Of AN ABSTRACT OF THE DISSERTATION OF Derik Haggard for the degree of Doctor of Philosophy in Toxicology present on December 2, 2016. Title: Classifying Chemical Bioactivity by Coupling High-throughput Phenotypic Anchoring and Transcriptome Profiling in Zebrafish. Abstract approved: ______________________________________________________________ Robert L. Tanguay There are more than 87,000 chemicals in current use with little to no toxicity information available. Assessing such a large number of chemicals using traditional methods would take an unreasonable amount of time and money, and require the use a large number of animals. The incorporation of high- throughput in vivo model systems that can overcome limitations of in vitro screens while providing a rapid genome-wide view of chemical bioactivity are needed to help fully realize the vision of 21st century toxicity testing. In this dissertation, I employed transcriptomics using the high-throughput in vivo developmental zebrafish model to generate hypotheses regarding the mechanism of action of specific chemicals and to identify unique transcriptional signatures for a set of endocrine disrupting chemicals that can be used to classify the activity of known and unknown chemicals. We employed comparative transcriptomics in wild-type and ahr2-null zebrafish exposed to mono-substituted isopropylated triaryl phosphate (mITP), a component of the Firemaster 550 flame retardant mixture, and demonstrated that the cardiotoxic effects of mITP are likely mediated through inhibition of retinoic acid receptor signaling and not the aryl hydrocarbon receptor (AhR). Although mITP induced a transcriptional profile indicative of AhR activation in wild-type zebrafish, these signatures were not related to cardiotoxicity. I found that mITP exposure, independent of ahr2 status, decreased the expression of many Hox genes as well as enzymes responsible for retinoic acid metabolism, which are known to be regulated by retinoic acid receptors. Several of the dysregulated Hox genes are involved in cardiac cell lineage determination in early heart development, and in heart tube elongation and looping via cell recruitment in the second heart field. I also employed transcriptomics to investigate the mechanism of developmental toxicity of the antimicrobial agent, triclosan (TCS). Exposure to TCS resulted in robust transcriptome changes with a large number of transcripts being significantly decreased. Downstream functional analyses showed that many of the transcripts significantly affected by TCS are involved in liver functioning and development, suggesting that TCS is hepatotoxic in embryonic zebrafish. I also compared our transcriptomic analysis with the comprehensive in vitro bioactivity profile of TCS from the Environmental Protection Agency’s Toxicity Forecaster (ToxCast) program, and observed low concordance between these two screening strategies. Lastly, I conducted transcriptome profiling of 25 endocrine disrupting chemicals in order to identify discriminatory transcriptional signatures that would help classify chemicals with estrogen, androgen, or thyroid hormone activity. Clustered correlation analysis of the top 1000 significantly differentially expressed transcripts revealed four chemicals with highly similar and unique transcriptional profiles compared to the other 21 chemicals. These four chemicals included three known thyroid hormone receptor agonists, and one unknown chemical, which was later identified as a failed pharmaceutical with thyroid receptor agonist activity. I identified a panel of 27 transcripts as well as a unique pigmentation phenotype for these four chemicals which can be used in future chemical screens to detect other thyroid receptor agonist chemicals in zebrafish. Overall, the work presented here demonstrates the utility of phenotypically anchored whole genome transcriptomics in zebrafish to identify putative mechanisms of action for many chemicals. Furthermore, the information obtained from these types of analyses can be used to develop predictive models to classify the bioactivity of known and unknown chemicals, or can identify biomarkers that can be used in future high-throughput screens. Copyrighted by Derik Haggard December 2, 2016 All Rights Reserved Classifying Chemical Bioactivity by Coupling High-throughput Phenotypic Anchoring and Transcriptome Profiling in Zebrafish. by Derik Haggard A DISSERTATION submitted to Oregon State University in partial fulfillment of the requirements for the degree of Doctor of Philosophy Presented December 2, 2016 Commencement June 2017 Doctor of Philosophy dissertation of Derik Haggard presented on December 2, 2016. APPROVED: Major Professor, representing Toxicology Head of the Department of Environmental and Molecular Toxicology Dean of the Graduate School I understand that my dissertation will become part of the permanent collection of Oregon State University libraries. My signature below authorizes release of my dissertation to any reader upon request. Derik Haggard, Author ACKNOWLEDGEMENTS There are many people that have aided, provided guidance, and given me the confidence to pursue a career in toxicology. First and foremost, I want to express my most sincere appreciation to Dr. Robert Tanguay for being my research advisor and mentor throughout my time at Oregon State University. Not only did he allow me to join the amazing research environment his lab represents, but he has provided continuous support and opportunities to better myself as a scientist and as a person. Without his guidance and encouragement, I would not be who I am today, nor would I have discovered the challenge, excitement, and rewards the field of computational toxicology has to offer. I would also like to extend my deepest gratitude to my undergraduate mentor, Dr. Sara Heggland, who was kind enough to allow a lowly freshman the opportunity to experience a research lab, and had the patience to keep me there for four years. I would never have been inspired to continue on to graduate school, nor would I have found a love of researching endocrine disrupting chemicals without her. Dr. Pamela Noyes also deserves particular thanks for her help and constructive discussions on the experimental design of my dissertation research described in Chapter 4. From surviving the challenging summer of 2014, to her assistance with screening and helping in the mornings of RNA collections, her help was paramount to the success of that project, and I am so very thankful. There have been so many great friendships and thoughtful discussions with so many people over my 6 years here that acknowledging everyone would likely double the length of this dissertation. I want to thank all of the members of the Tanguay lab that I have worked with: Jane LaDu for training me when I first joined that lab; Siba Das for being my primary mentor during my rotation in the lab; Jill Franzosa, Britton Goodale, Galen Miller, Margaret Corvi, Kate Saili, Kitae Kim, Andrea Knecht, Joe Fisher, Leah Wehmas, Yasmeen Nkrumah-Elie, and Sean Bugel for being the original members of the lab when I joined, who had profound effects on my initial research directions, and gave thoughtful advice and encouragement as I was finding my place in the lab; Cory Gerlach, Amber Roegner, Mitra Geier, Anna Chlebowski, Mike Garland, Lindsay St. Mary, Paroma Chatterjee, Courtney Roper, and Gloria Garcia for our conversations and assistance during my later stages in the lab; Chris Sullivan for help and support at the command line throughout my time here. I would also like to thank all of my committee members (both past, present, and temporary) who have helped guide my research and evaluate my ability to be a successful scientist: Nancy Kerkvliet, Michael Freitag, Siva Kolluri, David Hendrix, Kim Anderson, and Anna Harding. I would like to thank the staff at the Sinnhuber Aquatic Research Laboratory for all of their help and support: Chapell Miller, Greg Gonnerman, Eric Johnson, Michael Simonich, and Carrie Barton. Lisa Truong for all of her help with manuscript organization and career advice and encouragement. I would also like to thank Katrina Waters at the Pacific Northwest National Laboratory, for guidance during the chemical selection process and microarray analysis advice for the research presented in Chapter 3 and 4. I would also like to thank the many people in the Department of Environmental and Molecular Toxicology for their support, conversations, administrative assistance, and for allowing me the opportunity to even apply as a graduate student to this esteemed research program. I also thank the National Institutes of Health and the Environmental Protection Agency who provided the funding necessary to conduct my studies. Throughout my time here, I have made a many great friendships from people affiliated and unaffiliated with the research department for which I am deeply grateful. To those who helped keep my sanity by climbing, exploring, going to Timbers games, and showing me the joys of surfing on the Oregon Coast. I am so thankful to TJ Newton, for his love and support through the struggles, anxieties, and trials of being with a graduate student/mad scientist. Lastly, I would like to thank my family. To my brother, Mason: Thank you for always being there and letting me enjoy our mutual love of fly fishing with you whenever I visited. To my father: Thank you for always encouraging my pursuits in higher education and for teaching me to be independent. To my mother: I would have never made it this far without your love
Load more

Recommended publications
  • Detailed Review Paper on Retinoid Pathway Signalling
    1 1 Detailed Review Paper on Retinoid Pathway Signalling 2 December 2020 3 2 4 Foreword 5 1. Project 4.97 to develop a Detailed Review Paper (DRP) on the Retinoid System 6 was added to the Test Guidelines Programme work plan in 2015. The project was 7 originally proposed by Sweden and the European Commission later joined the project as 8 a co-lead. In 2019, the OECD Secretariat was added to coordinate input from expert 9 consultants. The initial objectives of the project were to: 10 draft a review of the biology of retinoid signalling pathway, 11 describe retinoid-mediated effects on various organ systems, 12 identify relevant retinoid in vitro and ex vivo assays that measure mechanistic 13 effects of chemicals for development, and 14 Identify in vivo endpoints that could be added to existing test guidelines to 15 identify chemical effects on retinoid pathway signalling. 16 2. This DRP is intended to expand the recommendations for the retinoid pathway 17 included in the OECD Detailed Review Paper on the State of the Science on Novel In 18 vitro and In vivo Screening and Testing Methods and Endpoints for Evaluating 19 Endocrine Disruptors (DRP No 178). The retinoid signalling pathway was one of seven 20 endocrine pathways considered to be susceptible to environmental endocrine disruption 21 and for which relevant endpoints could be measured in new or existing OECD Test 22 Guidelines for evaluating endocrine disruption. Due to the complexity of retinoid 23 signalling across multiple organ systems, this effort was foreseen as a multi-step process.
    [Show full text]
  • Genetic Variability in the Italian Heavy Draught Horse from Pedigree Data and Genomic Information
    Supplementary material for manuscript: Genetic variability in the Italian Heavy Draught Horse from pedigree data and genomic information. Enrico Mancin†, Michela Ablondi†, Roberto Mantovani*, Giuseppe Pigozzi, Alberto Sabbioni and Cristina Sartori ** Correspondence: [email protected] † These two Authors equally contributed to the work Supplementary Figure S1. Mares and foal of Italian Heavy Draught Horse (IHDH; courtesy of Cinzia Stoppa) Supplementary Figure S2. Number of Equivalent Generations (EqGen; above) and pedigree completeness (PC; below) over years in Italian Heavy Draught Horse population. Supplementary Table S1. Descriptive statistics of homozygosity (observed: Ho_obs; expected: Ho_exp; total: Ho_tot) in 267 genotyped individuals of Italian Heavy Draught Horse based on the number of homozygous genotypes. Parameter Mean SD Min Max Ho_obs 35,630.3 500.7 34,291 38,013 Ho_exp 35,707.8 64.0 35,010 35,740 Ho_tot 50,674.5 93.8 49,638 50,714 1 Definitions of the methods for inbreeding are in the text. Supplementary Figure S3. Values of BIC obtained by analyzing values of K from 1 to 10, corresponding on the same amount of clusters defining the proportion of ancestry in the 267 genotyped individuals. Supplementary Table S2. Estimation of genomic effective population size (Ne) traced back to 18 generations ago (Gen. ago). The linkage disequilibrium estimation, adjusted for sampling bias was also included (LD_r2), as well as the relative standard deviation (SD(LD_r2)). Gen. ago Ne LD_r2 SD(LD_r2) 1 100 0.009 0.014 2 108 0.011 0.018 3 118 0.015 0.024 4 126 0.017 0.028 5 134 0.019 0.031 6 143 0.021 0.034 7 156 0.023 0.038 9 173 0.026 0.041 11 189 0.029 0.046 14 213 0.032 0.052 18 241 0.036 0.058 Supplementary Table S3.
    [Show full text]
  • Topoisomerase Ii Inhibitors Induce an Illegitimate Genome Rearrangement Common in Infant Leukemia
    TOPOISOMERASE II INHIBITORS INDUCE AN ILLEGITIMATE GENOME REARRANGEMENT COMMON IN INFANT LEUKEMIA by Bhawana Bariar A dissertation submitted to the faculty of The University of North Carolina at Charlotte in partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biology Charlotte 2013 Approved by: ______________________________ Dr. Christine Richardson ______________________________ Dr. Mark Clemens ______________________________ Dr. Laura Schrum ______________________________ Dr. Pinku Mukherjee ______________________________ Dr. Anthony Fodor ii ©2013 Bhawana Bariar ALL RIGHTS RESERVED iii ABSTRACT BHAWANA BARIAR. Topoisomerase II inhibitors induce an illegitimate genome rearrangement common in infant leukemia. (Under the direction of DR. CHRISTINE RICHARDSON) Infant acute leukemias account for ~30% of all malignancy seen in childhood across the Western world. They are aggressive and characterized by rapid onset shortly after birth. The majority of these have rearrangements involving the MLL (mixed lineage leukemia) gene. Although MLL fusion to more than 75 genes have been identified, AF9 is one of its most common translocation partners. Since MLL breakpoint sequences associated with infant acute leukemia are similar to those in secondary AML following exposure to the topoisomerase II (topo II) poison etoposide, it has been hypothesized that exposure during pregnancy to biochemically similar compounds may promote infant acute leukemia. Some studies have shown an epidemiological link between bioflavonoid intake
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Supplemental Materials ZNF281 Enhances Cardiac Reprogramming
    Supplemental Materials ZNF281 enhances cardiac reprogramming by modulating cardiac and inflammatory gene expression Huanyu Zhou, Maria Gabriela Morales, Hisayuki Hashimoto, Matthew E. Dickson, Kunhua Song, Wenduo Ye, Min S. Kim, Hanspeter Niederstrasser, Zhaoning Wang, Beibei Chen, Bruce A. Posner, Rhonda Bassel-Duby and Eric N. Olson Supplemental Table 1; related to Figure 1. Supplemental Table 2; related to Figure 1. Supplemental Table 3; related to the “quantitative mRNA measurement” in Materials and Methods section. Supplemental Table 4; related to the “ChIP-seq, gene ontology and pathway analysis” and “RNA-seq” and gene ontology analysis” in Materials and Methods section. Supplemental Figure S1; related to Figure 1. Supplemental Figure S2; related to Figure 2. Supplemental Figure S3; related to Figure 3. Supplemental Figure S4; related to Figure 4. Supplemental Figure S5; related to Figure 6. Supplemental Table S1. Genes included in human retroviral ORF cDNA library. Gene Gene Gene Gene Gene Gene Gene Gene Symbol Symbol Symbol Symbol Symbol Symbol Symbol Symbol AATF BMP8A CEBPE CTNNB1 ESR2 GDF3 HOXA5 IL17D ADIPOQ BRPF1 CEBPG CUX1 ESRRA GDF6 HOXA6 IL17F ADNP BRPF3 CERS1 CX3CL1 ETS1 GIN1 HOXA7 IL18 AEBP1 BUD31 CERS2 CXCL10 ETS2 GLIS3 HOXB1 IL19 AFF4 C17ORF77 CERS4 CXCL11 ETV3 GMEB1 HOXB13 IL1A AHR C1QTNF4 CFL2 CXCL12 ETV7 GPBP1 HOXB5 IL1B AIMP1 C21ORF66 CHIA CXCL13 FAM3B GPER HOXB6 IL1F3 ALS2CR8 CBFA2T2 CIR1 CXCL14 FAM3D GPI HOXB7 IL1F5 ALX1 CBFA2T3 CITED1 CXCL16 FASLG GREM1 HOXB9 IL1F6 ARGFX CBFB CITED2 CXCL3 FBLN1 GREM2 HOXC4 IL1F7
    [Show full text]
  • UNIVERSITY of CALIFORNIA, IRVINE Combinatorial Regulation By
    UNIVERSITY OF CALIFORNIA, IRVINE Combinatorial regulation by maternal transcription factors during activation of the endoderm gene regulatory network DISSERTATION submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY in Biological Sciences by Kitt D. Paraiso Dissertation Committee: Professor Ken W.Y. Cho, Chair Associate Professor Olivier Cinquin Professor Thomas Schilling 2018 Chapter 4 © 2017 Elsevier Ltd. © 2018 Kitt D. Paraiso DEDICATION To the incredibly intelligent and talented people, who in one way or another, helped complete this thesis. ii TABLE OF CONTENTS Page LIST OF FIGURES vii LIST OF TABLES ix LIST OF ABBREVIATIONS X ACKNOWLEDGEMENTS xi CURRICULUM VITAE xii ABSTRACT OF THE DISSERTATION xiv CHAPTER 1: Maternal transcription factors during early endoderm formation in 1 Xenopus Transcription factors co-regulate in a cell type-specific manner 2 Otx1 is expressed in a variety of cell lineages 4 Maternal otx1 in the endodermal conteXt 5 Establishment of enhancers by maternal transcription factors 9 Uncovering the endodermal gene regulatory network 12 Zygotic genome activation and temporal control of gene eXpression 14 The role of maternal transcription factors in early development 18 References 19 CHAPTER 2: Assembly of maternal transcription factors initiates the emergence 26 of tissue-specific zygotic cis-regulatory regions Introduction 28 Identification of maternal vegetally-localized transcription factors 31 Vegt and OtX1 combinatorially regulate the endodermal 33 transcriptome iii
    [Show full text]
  • Creb5 Establishes the Competence for Prg4 Expression in Articular Cartilage
    ARTICLE https://doi.org/10.1038/s42003-021-01857-0 OPEN Creb5 establishes the competence for Prg4 expression in articular cartilage Cheng-Hai Zhang1, Yao Gao1, Unmesh Jadhav2,3, Han-Hwa Hung4, Kristina M. Holton5, Alan J. Grodzinsky4, ✉ Ramesh A. Shivdasani 2,3,6 & Andrew B. Lassar 1 A hallmark of cells comprising the superficial zone of articular cartilage is their expression of lubricin, encoded by the Prg4 gene, that lubricates the joint and protects against the devel- opment of arthritis. Here, we identify Creb5 as a transcription factor that is specifically expressed in superficial zone articular chondrocytes and is required for TGF-β and EGFR signaling to induce Prg4 expression. Notably, forced expression of Creb5 in chondrocytes 1234567890():,; derived from the deep zone of the articular cartilage confers the competence for TGF-β and EGFR signals to induce Prg4 expression. Chromatin-IP and ATAC-Seq analyses have revealed that Creb5 directly binds to two Prg4 promoter-proximal regulatory elements, that display an open chromatin conformation specifically in superficial zone articular chondrocytes; and which work in combination with a more distal regulatory element to drive induction of Prg4 by TGF-β. Our results indicate that Creb5 is a critical regulator of Prg4/lubricin expression in the articular cartilage. 1 Department of Biological Chemistry and Molecular Pharmacology, Blavatnik Institute at Harvard Medical School, Boston, MA, USA. 2 Department of Medical Oncology and Center for Functional Cancer Epigenetics, Dana-Farber Cancer Institute, Boston, MA, USA. 3 Departments of Medicine, Brigham & Women’s Hospital and Harvard Medical School, Boston, MA, USA. 4 Department of Biological Engineering, Massachusetts Institute of Technology, Cambridge, MA, USA.
    [Show full text]
  • Genome-Wide DNA Methylation Analysis of KRAS Mutant Cell Lines Ben Yi Tew1,5, Joel K
    www.nature.com/scientificreports OPEN Genome-wide DNA methylation analysis of KRAS mutant cell lines Ben Yi Tew1,5, Joel K. Durand2,5, Kirsten L. Bryant2, Tikvah K. Hayes2, Sen Peng3, Nhan L. Tran4, Gerald C. Gooden1, David N. Buckley1, Channing J. Der2, Albert S. Baldwin2 ✉ & Bodour Salhia1 ✉ Oncogenic RAS mutations are associated with DNA methylation changes that alter gene expression to drive cancer. Recent studies suggest that DNA methylation changes may be stochastic in nature, while other groups propose distinct signaling pathways responsible for aberrant methylation. Better understanding of DNA methylation events associated with oncogenic KRAS expression could enhance therapeutic approaches. Here we analyzed the basal CpG methylation of 11 KRAS-mutant and dependent pancreatic cancer cell lines and observed strikingly similar methylation patterns. KRAS knockdown resulted in unique methylation changes with limited overlap between each cell line. In KRAS-mutant Pa16C pancreatic cancer cells, while KRAS knockdown resulted in over 8,000 diferentially methylated (DM) CpGs, treatment with the ERK1/2-selective inhibitor SCH772984 showed less than 40 DM CpGs, suggesting that ERK is not a broadly active driver of KRAS-associated DNA methylation. KRAS G12V overexpression in an isogenic lung model reveals >50,600 DM CpGs compared to non-transformed controls. In lung and pancreatic cells, gene ontology analyses of DM promoters show an enrichment for genes involved in diferentiation and development. Taken all together, KRAS-mediated DNA methylation are stochastic and independent of canonical downstream efector signaling. These epigenetically altered genes associated with KRAS expression could represent potential therapeutic targets in KRAS-driven cancer. Activating KRAS mutations can be found in nearly 25 percent of all cancers1.
    [Show full text]
  • Supplementary Figure S4
    18DCIS 18IDC Supplementary FigureS4 22DCIS 22IDC C D B A E (0.77) (0.78) 16DCIS 14DCIS 28DCIS 16IDC 28IDC (0.43) (0.49) 0 ADAMTS12 (p.E1469K) 14IDC ERBB2, LASP1,CDK12( CCNE1 ( NUTM2B SDHC,FCGR2B,PBX1,TPR( CD1D, B4GALT3, BCL9, FLG,NUP21OL,TPM3,TDRD10,RIT1,LMNA,PRCC,NTRK1 0 ADAMTS16 (p.E67K) (0.67) (0.89) (0.54) 0 ARHGEF38 (p.P179Hfs*29) 0 ATG9B (p.P823S) (0.68) (1.0) ARID5B, CCDC6 CCNE1, TSHZ3,CEP89 CREB3L2,TRIM24 BRAF, EGFR (7p11); 0 ABRACL (p.R35H) 0 CATSPER1 (p.P152H) 0 ADAMTS18 (p.Y799C) 19q12 0 CCDC88C (p.X1371_splice) (0) 0 ADRA1A (p.P327L) (10q22.3) 0 CCNF (p.D637N) −4 −2 −4 −2 0 AKAP4 (p.G454A) 0 CDYL (p.Y353Lfs*5) −4 −2 Log2 Ratio Log2 Ratio −4 −2 Log2 Ratio Log2 Ratio 0 2 4 0 2 4 0 ARID2 (p.R1068H) 0 COL27A1 (p.G646E) 0 2 4 0 2 4 2 EDRF1 (p.E521K) 0 ARPP21 (p.P791L) ) 0 DDX11 (p.E78K) 2 GPR101, p.A174V 0 ARPP21 (p.P791T) 0 DMGDH (p.W606C) 5 ANP32B, p.G237S 16IDC (Ploidy:2.01) 16DCIS (Ploidy:2.02) 14IDC (Ploidy:2.01) 14DCIS (Ploidy:2.9) -3 -2 -1 -3 -2 -1 -3 -2 -1 -3 -2 -1 -3 -2 -1 -3 -2 -1 Log Ratio Log Ratio Log Ratio Log Ratio 12DCIS 0 ASPM (p.S222T) Log Ratio Log Ratio 0 FMN2 (p.G941A) 20 1 2 3 2 0 1 2 3 2 ERBB3 (p.D297Y) 2 0 1 2 3 20 1 2 3 0 ATRX (p.L1276I) 20 1 2 3 2 0 1 2 3 0 GALNT18 (p.F92L) 2 MAPK4, p.H147Y 0 GALNTL6 (p.E236K) 5 C11orf1, p.Y53C (10q21.2); 0 ATRX (p.R1401W) PIK3CA, p.H1047R 28IDC (Ploidy:2.0) 28DCIS (Ploidy:2.0) 22IDC (Ploidy:3.7) 22DCIS (Ploidy:4.1) 18IDC (Ploidy:3.9) 18DCIS (Ploidy:2.3) 17q12 0 HCFC1 (p.S2025C) 2 LCMT1 (p.S34A) 0 ATXN7L2 (p.X453_splice) SPEN, p.P677Lfs*13 CBFB 1 2 3 4 5 6 7 8 9 10 11
    [Show full text]
  • SUPPLEMENTARY MATERIAL Bone Morphogenetic Protein 4 Promotes
    www.intjdevbiol.com doi: 10.1387/ijdb.160040mk SUPPLEMENTARY MATERIAL corresponding to: Bone morphogenetic protein 4 promotes craniofacial neural crest induction from human pluripotent stem cells SUMIYO MIMURA, MIKA SUGA, KAORI OKADA, MASAKI KINEHARA, HIROKI NIKAWA and MIHO K. FURUE* *Address correspondence to: Miho Kusuda Furue. Laboratory of Stem Cell Cultures, National Institutes of Biomedical Innovation, Health and Nutrition, 7-6-8, Saito-Asagi, Ibaraki, Osaka 567-0085, Japan. Tel: 81-72-641-9819. Fax: 81-72-641-9812. E-mail: [email protected] Full text for this paper is available at: http://dx.doi.org/10.1387/ijdb.160040mk TABLE S1 PRIMER LIST FOR QRT-PCR Gene forward reverse AP2α AATTTCTCAACCGACAACATT ATCTGTTTTGTAGCCAGGAGC CDX2 CTGGAGCTGGAGAAGGAGTTTC ATTTTAACCTGCCTCTCAGAGAGC DLX1 AGTTTGCAGTTGCAGGCTTT CCCTGCTTCATCAGCTTCTT FOXD3 CAGCGGTTCGGCGGGAGG TGAGTGAGAGGTTGTGGCGGATG GAPDH CAAAGTTGTCATGGATGACC CCATGGAGAAGGCTGGGG MSX1 GGATCAGACTTCGGAGAGTGAACT GCCTTCCCTTTAACCCTCACA NANOG TGAACCTCAGCTACAAACAG TGGTGGTAGGAAGAGTAAAG OCT4 GACAGGGGGAGGGGAGGAGCTAGG CTTCCCTCCAACCAGTTGCCCCAAA PAX3 TTGCAATGGCCTCTCAC AGGGGAGAGCGCGTAATC PAX6 GTCCATCTTTGCTTGGGAAA TAGCCAGGTTGCGAAGAACT p75 TCATCCCTGTCTATTGCTCCA TGTTCTGCTTGCAGCTGTTC SOX9 AATGGAGCAGCGAAATCAAC CAGAGAGATTTAGCACACTGATC SOX10 GACCAGTACCCGCACCTG CGCTTGTCACTTTCGTTCAG Suppl. Fig. S1. Comparison of the gene expression profiles of the ES cells and the cells induced by NC and NC-B condition. Scatter plots compares the normalized expression of every gene on the array (refer to Table S3). The central line
    [Show full text]
  • A Conserved Tissue-Specific Homeodomain-Less Isoform of MEIS1 Is Downregulated in Colorectal Cancer
    Thomas Jefferson University Jefferson Digital Commons Department of Microbiology and Immunology Faculty Papers Department of Microbiology and Immunology 8-17-2011 A conserved tissue-specific homeodomain-less isoform of MEIS1 is downregulated in colorectal cancer. Richard C Crist Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Jacquelyn J Roth Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Scott A Waldman Department of Pharmacology and Experimental Therapeutics, Thomas Jefferson University, Philadelphia Arthur M Buchberg Department of Microbiology and Immunology, Thomas Jefferson University, Philadelphia Follow this and additional works at: https://jdc.jefferson.edu/mifp Part of the Gastroenterology Commons, Medical Genetics Commons, Medical Microbiology Commons, Oncology Commons, and the Pathology Commons Let us know how access to this document benefits ouy Recommended Citation Crist, Richard C; Roth, Jacquelyn J; Waldman, Scott A; and Buchberg, Arthur M, "A conserved tissue-specific homeodomain-less isoform of MEIS1 is downregulated in colorectal cancer." (2011). Department of Microbiology and Immunology Faculty Papers. Paper 25. https://jdc.jefferson.edu/mifp/25 This Article is brought to you for free and open access by the Jefferson Digital Commons. The Jefferson Digital Commons is a service of Thomas Jefferson University's Center for Teaching and Learning (CTL). The Commons is a showcase for Jefferson books and journals, peer-reviewed scholarly publications, unique historical collections from the University archives, and teaching tools. The Jefferson Digital Commons allows researchers and interested readers anywhere in the world to learn about and keep up to date with Jefferson scholarship. This article has been accepted for inclusion in Department of Microbiology and Immunology Faculty Papers by an authorized administrator of the Jefferson Digital Commons.
    [Show full text]
  • Large Scale Transgenic and Cluster Deletion Analysis of the Hoxd Complex Separate an Ancestral Regulatory Module from Evolutionary Innovations
    Downloaded from genesdev.cshlp.org on September 30, 2021 - Published by Cold Spring Harbor Laboratory Press RESEARCH COMMUNICATION where groups of genes acquired shared enhancer se- Large scale transgenic and quences acting independently of colinearity. For in- cluster deletion analysis of the stance, the early phase of Hoxd gene expression in limb buds is regulated in a colinear fashion, whereas expres- HoxD complexseparate an sion of the same genes in digits is concurrent, rather than ancestral regulatory module colinear (Nelson et al. 1996). In the HoxD complex, gene recruitment involved in from evolutionary innovations many instances the design of potent enhancer sequences, which regulate several genes at once. We proposed ear- François Spitz,1 Federico Gonzalez,1 lier that expression of four genes in developing digits was Catherine Peichel,2,3 Thomas F. Vogt,2,4 controlled by a unique enhancer that displays poor pro- Denis Duboule,1,5 and József Zákány1 moter specificity as it influenced foreign promoters when targeted to the locus (van der Hoeven et al. 1996; 1Department of Zoology and Animal Biology, University Hérault et al. 1999). Targeted deletions in the posterior of Geneva, Sciences III, 1211 Geneva 4, Switzerland; HoxD complex placed this enhancer somewhere up- 2Department of Molecular Biology, Princeton University, stream of Evx2, outside the cluster (Kondo and Duboule Princeton, New Jersey 08544, USA 1999). Likewise, several genes respond to a gut enhancer sequence that is required to form the ileo-coecal sphinc- The ancestral role of the Hox gene family is specifying ter (Zakany and Duboule 1999) and is localized either in morphogenetic differences along the main body axis.
    [Show full text]