DOCSLIB.ORG

Analysis of the Formation of Flower Shapes in Wild Species and Cultivars

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Analysis of the Formation of Flower Shapes in Wild Species and Cultivars Gene 493 (2012) 113–123 Contents lists available at SciVerse ScienceDirect Gene journal homepage: www.elsevier.com/locate/gene Analysis of the formation of flower shapes in wild species and cultivars of tree peony using the MADS-box subfamily gene☆ Qingyan Shu a,⁎, Liangsheng Wang a, Jie Wu a,b, Hui Du a,b, Zheng'an Liu a, Hongxu Ren a,⁎⁎, Jingjing Zhang a,b a Beijing Botanical Garden, Institute of Botany, Chinese Academy of Sciences, 20 Nanxin Cun, Xiangshan, Haidian District, Beijing 100093, PR China b Graduate School of the Chinese Academy of Sciences, Beijing 100049, PR China article info abstract Article history: Tree peony (Paeonia suffricotisa) cultivars have a unique character compared with wild species; the stamen Accepted 3 November 2011 petalody results in increased whorls of petals and generates different flower forms, which are one of the Available online 21 November 2011 most important traits for cultivar classification. In order to investigate how petaloid stamens are formed, we obtained the coding sequence (666 bp) and genomic DNA sequence of the PsTM6 genes (belongs to B sub- Edited by Meghan Jendrysik family of MADS-box gene family) from 23 tree peony samples, Five introns and six exons consisted of the ge- nomic DNA sequence. The analysis of cis-acting regulatory elements in the third and fourth intron indicated Keywords: Tree peony that they were highly conserved in all samples. Partial putative amino acids were analyzed and the results Stamen petaloid suggested that functional differentiation of PsTM6 paralogs apparently affected stamen petalody and flower Cis-acting regulatory element shape formation due to due to amino acid substitution caused by differences in polarity and electronic charge. Sliding window analysis Sliding window analysis indicated that the different regions of PsTM6 were subjected to different selection Flower shape forces, especially in the K domain. This is the first attempt to investigate genetic control of the stamen petal- ody based on the PsTM6 sequence. This will provide a basis for understanding the evolution of PsTM6 and its the function of in determining stamen morphology of tree peony. Crown Copyright © 2011 Published by Elsevier B.V. All rights reserved. 1. Introduction all of them are native to China. The amount of stamen varied largely within different cultivars or species, some or all stamens can hetero- The genus Paeonia is divided into three sections, including Moutan, morphically develop into petals, which formed into many kinds of Onaepia and Paeonia. The tree peony (Paeonia suffruticosa), in the section cultivars. Due to the stamen petaloid, it formed into a large variety Moutan, is the most primitive, followed by Onaepia, while section Paeo- of flower shapes such as lotus, crown, chrysanthemum, rose, globular, nia is more recent and more evolved (Hong et al., 1998). It is deduced and crown-proliferation (ESM_Fig. 1), which is one of the most im- that woody plants from sect. Moutan is firstly derived from the ancestor portant bases for the classification of cultivars. In tree peony, it is of Paeonia. In sect. Moutan, according to the morphology of flowers (flo- very unique that the flower of the wild species only has 1–3 whorls ral disks), it can be divided into two subsections, namely subsect. Vagina- of petals named as single flower, in contrast, the cultivars have vari- tae (flower disk is leathery) and Delavayanae (flower disk is fleshy), the ous number of whorls of petals because of stamen petalody. Till content of paeonol and its analogs in the subsect. Vaginatae was lower now, there is no attempt to uncover the inherent mechanism by ex- than that of subsect. Delavayanae, which means that the former was con- ploring genes responsible for stamen or petal development. sidered more evolved as compared with the latter (Guo et al., 2008). Great progress has been made on flower development genetics on Most plants of sect. Moutan are the diploid subshrub with numer- model plants like Arabidopsis, Antirrhinum and Petunia (Theissen et al., ous flowers of five carpels. Sect. Moutan contains 9 wild species and 2000). According to the ABCDE model of flower development, five clas- ses of transcription factors are responsible for the identities of four whorls of floral organs in a combinational manner. A and E-class Abbreviations: MADS, the first character of MCM1 from the budding yeast Saccharo- genes are responsible for the specification of sepals, A+B+E for petals, myces cerevisiae; AGAMOUS, from the thale cress Arabidopsis thaliana; DEFICIENS, from B+C+E for stamens, and C+E for carpels (Theissen et al., 2000; the snapdragon Antirrhinum majus; SRF, from the human Homo sapiens; ORF, Open fi reading frame; cDNA, DNA Complementary to RNA; RT-PCR, Reverse transcription- Melzer and Theißen, 2009). Among the ve classes genes, it is polymerase chain reaction; RACE, Rapid amplification of cDNA ends; UTR, Untranslated needed to mention B-class genes for petal and stamen identity, all region(s); dNTP, deoxyribonucleoside triphosphate. class B genes known to date belonging to subfamily DEFICIENS (DEF)/ ☆ Flower shape analysis of tree peony by MADS-box subfamily gene. GLOBOSA (GLO) have been studied more extensively and profoundly ⁎ Correspondence to: Q. Shu, Tel.: +86 10 62836655; fax: +86 10 62590348, +86 (Zahn et al., 2005), which indicated that two major gene duplication 10 62836010. ⁎⁎ Correspondence to: H. Ren, Tel: +86 10 62836010; fax: +86 10 62836010. events took place within this subfamily, one happened before extant E-mail addresses: [email protected] (Q. Shu), [email protected] (H. Ren). angiosperm and produced the DEF/AP3 (paleoAP3) and GLO/PI lineages. 0378-1119/$ – see front matter. Crown Copyright © 2011 Published by Elsevier B.V. All rights reserved. doi:10.1016/j.gene.2011.11.008 114 Q. Shu et al. / Gene 493 (2012) 113–123 Fig. 1. Sequence analyses of PsTM6. MADS, K and C domains were underlined and defined by double, single, and wave line respectively, as published by Ma et al.1991, between MADS and K domain was I domain. indicated for PI motif-derived and for paleoAP3 motif, K1 (positions 87–108), K2 (positions 121–135) and K3 (positions 142–168) sub-domains of K domain were indicated in shade, the conserved residue for amino acid at different positions were in bold. The reversed triangle filled in black indicated the positions of introns. The asterisk indicated a stop codon. It is thought that a new duplication of paleoAP3 gave origin to the which was helpful to understand the genetic control for the forma- two paralogous lineages, TM6 and euAP3 lineage before the diversifi- tion of flower shapes. The comparison of the evolutionary rates of cation of the major higher eudicot subclasses (Kramer et al., 1998). paralogous PsTM6 coding sequences might give some insights into The first TM6 member being discovered was tomato MADS box functional evolution. Based on the exons sequences, a Neighour- gene 6 (Pnueli et al., 1991), another two TM6 members have been joining tree of wild species was constructed to illustrate the relation- functionally characterized in petunia and tomato, which has been ship among them. This is the first attempt to use B class MADS-box suggested that possibly after euAP3/TM6 duplication, euAP3 genes gene to uncover their phylogenetic relationship. This will provide a acquired a role in petal development while TM6 began to control basic knowledge for the mechanism of stamen petaloid and the for- stamen development (Kramer et al., 2006). AP3/DEF belongs to the mation of flower shape in tree peony. MIKC-type MADS-domain proteins which consist of four domains in- cluding a MADS domain (M), an intervening region (I), a Keratin-like 2. Materials and methods domain (K) and a C-terminus (C). The Keratin-like domain, located betweenIandCdomain,isinvolvedinmediatingspecificprotein/ 2.1. Materials protein interactions (Zahn et al., 2005). In this study, the coding sequence and genomic DNA sequence of In this study, 9 wild species of Paeonia sect. Moutan, namely TM6 genes in tree peony were obtained and analyzed. The partial nu- P. jishanensis, P. ludlowii, P. ostii, P. decomposita, P. qiui, P. rockii, P. delavayi, cleotides and putative amino acids were compared among 9 wild spe- P. potaninii,andP. lutea, and 14 cultivars with different flower shapes cies and 14 cultivars to characterize the functional differentiation, were collected from Beijing Botanical Garden, Institute of Botany, the Q. Shu et al. / Gene 493 (2012) 113–123 115 Chinese Academy of Sciences and Yuzhong Peace Peony Garden, Gansu 2008). The primers for PCR amplification was as follows: Forward province, China (Table 1). For cultivars, the stamens in single flowers primer: 5-‘ATGGSTMGWGGRAAGATYGAGAT-3’; Reverse primer: R1: developed normally and completely, but some of them showed hetero- 5-‘AGCATAAAAGAAGAAGAGGGTAAAT’-3 (Genomic DNA sequence morphosis into petals and formed into different flower shapes, namely, for ‘Huai nian’); R2: 5-‘KSTGTAGGTAYCAGTCTGGGTTTTG’-3 (Partial part of stamens became petaloid (‘Taiyō’,ESM_Fig. 1B), or all stamens genomic DNA sequences for 23 samples). The PCR reaction mixture were petaloid in some cultivars and even disappeared (‘Hong lou cang (20 μl) was composed of 90 ng genomic DNA, 200 μM dNTPs, jiao’,ESM_Fig. 1E). Based on the degree of stamen petalody, the flower 2.5 mM MgCl2, 0.3 μM primers, 10× buffer, and 1 U Taq DNA poly- shape was classified into 7 types such as single form (‘Feng dan’,ESM_ merase (Transgen Biotech Ltd Co., Beijing). The amplification was car- Fig. 1A; ‘Dian dan er hao’), lotus form (‘Shu hua zi’), chrysanthemum ried out in an Eppendorf Mastercycler Gradient (Type 5331, form (‘He ping hong’, ‘Huai nian’, ‘Qing luo’ and ‘Taiyō’), rose form Eppendorf AG, Hamburg, Germany) using the following program: de- (‘Luo yang hong’,ESM_Fig.
Load more

Recommended publications
  • Transcriptomic Analysis Reveals Transcription Factors Related to Leaf Anthocyanin Biosynthesis in Paeonia Qiui
    molecules Article Transcriptomic Analysis Reveals Transcription Factors Related to Leaf Anthocyanin Biosynthesis in Paeonia qiui Jianrang Luo 1,2 ID , Jingjing Duan 1,2, Dan Huo 1,2, Qianqian Shi 1,2, Lixin Niu 1,2,* and Yanlong Zhang 1,2,* 1 College of Landscape Architecture and Art, Northwest A&F University, Yangling 712100, Shaanxi, China; [email protected] (J.L.); [email protected] (J.D.); [email protected] (D.H.); [email protected] (Q.S.) 2 National Engineering Research Center for Oil Peony, Yangling 712100, Shaanxi, China * Correspondence: [email protected] (L.N.); [email protected] (Y.Z.); Tel.: +86-029-8708-2878 (L.N.); +86-13892816263 (Y.Z.) Received: 4 November 2017; Accepted: 4 December 2017; Published: 8 December 2017 Abstract: Paeonia qiui is a wild species of tree peony. P. qiui has good ornamental value owing to its leaf color change in spring. So far, the molecular mechanism of leaf color change in P. qiui is unclear. This study analyzes the anthocyanin level and transcriptome of two different color stages in P. qiui leaf. The purplish-red leaf stage is rich in anthocyanin, while the green leaf has very low levels of anthocyanin. Transcriptome analysis reveals that 6678 differentially-expressed genes (DEGs) are up-regulated, and 14,667 are down-regulated in the purplish-red leaf. Among these DEGs, 40 MYB (v-myb avian myeloblastosis viral oncogene homolog) genes, 40 bHLH (MYC-like basic helix–loop–helix) genes, and 15 WD40 (WD-repeat protein) genes were found. Based on phylogenetic and alignment analysis with the deduced amino acid sequences with known transcription factors, Unigene0024459 (MYB1) is likely the R2R3-MYB that promotes anthocyanin biosynthesis; Unigene0050761 (MYB2) is likely the R2R3-MYB that represses anthocyanin biosynthesis; Unigene0005081 (bHLH1) and Unigene0006146 (WD40-1) are likely the bHLH and WD40 that participate in regulating anthocyanin biosynthesis.
    [Show full text]
  • Peony, a Future Crop for Alaska?
    Peony - A Future Crop for Alaska? Item Type Report Authors Fitzgerald, Doreen Publisher Agricultural and Forestry Experiment Station, School of Natural Resources & Agricultural Sciences, University of Alaska Fairbanks Download date 02/10/2021 15:52:44 Link to Item http://hdl.handle.net/11122/2695 Peony— a future crop for Alaska? Agriculture & Forestry Experiment Station University of Alaska Fairbanks Misc. Publication MP-04-1 Peony—A Future Crop for Alaska? Doreen Fitzgerald hether commercial growers in Alaska might someday export peonies for the cut fl ower market is the subject of a ten-year research project at the Agricultural and Forestry and Experi- Wment Station (AFES). The peony is a long-lived, low- maintenance, and cold-tolerant plant that produces a high-value crop. Exporting fl owers from as far north as Fairbanks may seem unlikely, but the late bloom period of high-latitude peonies actually provides a commercial advantage: they would be marketed when they’re unavailable from other North American pro- ducers. A commercial crop from Alaska could extend the peony season for national cut fl ower markets. The peony plant produces a succession of blooms over about eight weeks. At lower latitudes, they bloom mostly in May and June. At Dutch fl ower auctions, according to the International Cut Flower Manual, 52 percent of all peony cut fl ower stem sales occur in May, 44 percent in June. Peonies are also grown com- mercially in Chile, where they are ready for market in January and February. In Alaska, due to the late spring, peonies bloom from mid to late summer (July and August).
    [Show full text]
  • Transcriptome Sequencing of Purple Petal Spot Region in Tree Peony Reveals Differentially Expressed Anthocyanin Structural Genes
    ORIGINAL RESEARCH published: 04 November 2015 doi: 10.3389/fpls.2015.00964 Transcriptome sequencing of purple petal spot region in tree peony reveals differentially expressed anthocyanin structural genes Yanzhao Zhang†, Yanwei Cheng*†,HuiyuanYa†, Shuzhen Xu and Jianming Han Life Science Department, Luoyang Normal University, Luoyang, China The pigmented cells in defined region of a petal constitute the petal spots. Petal spots attract pollinators and are found in many angiosperm families. Several cultivars of tree peony contain a single red or purple spot at the base of petal that makes the flower more attractive for the ornamental market. So far, the understanding of the molecular mechanism of spot formation is inadequate. In this study, we sequenced Edited by: the transcriptome of the purple spot and the white non-spot of tree peony flower. Traud Winkelmann, Leibniz Universität Hannover, We assembled and annotated 67,892 unigenes. Comparative analyses of the two Germany transcriptomes showed 1,573 differentially expressed genes, among which 933 were Reviewed by: up-regulated, and 640 were down-regulated in the purple spot. Subsequently, we Kevin Davies, The New Zealand Institute for Plant & examined four anthocyanin structural genes, including PsCHS, PsF3 H, PsDFR,and Food Research Ltd., New Zealand PsANS, which expressed at a significantly higher level in the purple spot than in the Anne Behrend, white non-spot. We further validated the digital expression data using quantitative real- Leibniz Institute of Vegetable and Ornamental Crops, Germany time PCR. Our result uncovered transcriptome variance between the spot and non-spot *Correspondence: of tree peony flower, and revealed that the co-expression of four anthocyanin structural Yanwei Cheng genes was responsible for spot pigment in tree peony.
    [Show full text]
  • Genetic Diversity of Paeonia Rockii (Flare Tree Peony) Germplasm Accessions Revealed by Phenotypic Traits, EST-SSR Markers and Chloroplast DNA Sequences
    Article Genetic Diversity of Paeonia rockii (Flare Tree Peony) Germplasm Accessions Revealed by Phenotypic Traits, EST-SSR Markers and Chloroplast DNA Sequences Xin Guo, Fangyun Cheng * and Yuan Zhong Beijing Advanced Innovation Center for Tree Breeding by Molecular Design, Peony International Institute, Beijing Key Laboratory of Ornamental Plants Germplasm Innovation & Molecular Breeding, National Engineering Research Center for Floriculture, Key Laboratory of Genetics and Breeding in Forest Trees and Ornamental Plants of Ministry of Education, School of Landscape Architecture, Beijing Forestry University, Beijing 100083, China; [email protected] (X.G.); [email protected] (Y.Z.) * Correspondence: [email protected]; Tel.: +86-010-62338027 Received: 16 May 2020; Accepted: 10 June 2020; Published: 12 June 2020 Abstract: Research Highlights: This study, based on the first collection of cultivated Paeonia rockii (flare tree peony, FTP) germplasm across the main distribution area by our breeding desires, comprehensively evaluates these accessions by using phenotypic traits, expressed sequence tag (EST)-simple sequence repeat (SSR) markers and chloroplast DNA sequences (cpDNA). The results show that these accessions collected selectively by us can represent the genetic background information of FTP as a germplasm of tree crops. Background and Objectives: FTP has high cultural, ornamental and medicinal value traditionally, as well as recently presenting a significance as an emerging edible oil with high α-linolenic acid contents in the seeds. The objectives of this study are to reveal the characteristics of the genetic diversity of FTP, as well as to provide scientific suggestions for the utilization of tree peony breeding and the conservation of germplasm resource. Materials and Methods: Based on the phenotypic traits, EST-SSR markers and chloroplast DNA sequence variation, we studied the diversity of a newly established population of 282 FTP accessions that were collected and propagated by ourselves in our breeding project in recent years.
    [Show full text]
  • Complete Chloroplast Genome Sequence and Phylogenetic Analysis of Paeonia Ostii
    molecules Article Complete Chloroplast Genome Sequence and Phylogenetic Analysis of Paeonia ostii Shuai Guo 1,2,†, Lili Guo 1,†, Wei Zhao 1,†, Jiang Xu 2, Yuying Li 1, Xiaoyan Zhang 2,3, Xiaofeng Shen 2, Mingli Wu 2,4 and Xiaogai Hou 1,* 1 College of Agricultural (College of Tree Peony), Henan University of Science and Technology, Luoyang 471023, Henan, China; [email protected] (S.G.); [email protected] (L.G.); [email protected] (W.Z.); [email protected] (Y.L.) 2 Institute of Chinese Materia Medical, China Academy of Chinese Medical Sciences, Beijing 100700, China; [email protected] (J.X.); [email protected] (X.Z); [email protected] (X.S.); [email protected] (M.W.) 3 College of Life Science, Huaibei Normal University, Huaibei 235000, Anhui, China 4 College of Pharmacy, Hubei University of Chinese Medicine, Wuhan 430065, Hubei China * Correspondence: [email protected]; Tel: +86-0379-6998-0776 † These authors contributed equally to this work. Received: 22 December 2017; Accepted: 24 January 2018; Published: 26 January 2018 Abstract: Paeonia ostii, a common oil-tree peony, is important ornamentally and medicinally. However, there are few studies on the chloroplast genome of Paeonia ostii. We sequenced and analyzed the complete chloroplast genome of P. ostii. The size of the P. ostii chloroplast genome is 152,153 bp, including a large single-copy region (85,373 bp), a small single-copy region (17,054 bp), and a pair of inverted repeats regions (24,863 bp). The P. ostii chloroplast genome encodes 111 genes, including 77 protein-coding genes, four ribosomal RNA genes, and 30 transfer RNA genes.
    [Show full text]
  • Paeonia Rockii) and the Qinling Mountains As a Geographic Barrier Driving the Fragmentation of a Large Population
    Genetic Structure of the Tree Peony (Paeonia rockii) and the Qinling Mountains as a Geographic Barrier Driving the Fragmentation of a Large Population Jun–hui Yuan1,3,4, Fang–Yun Cheng1,2*, Shi–Liang Zhou3* 1 Landscape Architecture College of Beijing Forestry University, Haidian District, Beijing, China, 2 National Flower Engineering Research Center, Key Laboratory for the Genetic and Breeding of Forestry Trees and Ornamental Plants, Beijing, China, 3 State Key Laboratory of Systematic and Evolutionary Botany, Institute of Botany, the Chinese Academy of Sciences, Haidian District, Beijing, China, 4 Gansu Forestry Technological College, Tianshui, Gansu, China Abstract Background: Tree peonies are great ornamental plants associated with a rich ethnobotanical history in Chinese culture and have recently been used as an evolutionary model. The Qinling Mountains represent a significant geographic barrier in Asia, dividing mainland China into northern (temperate) and southern (semi–tropical) regions; however, their flora has not been well analyzed. In this study, the genetic differentiation and genetic structure of Paeonia rockii and the role of the Qinling Mountains as a barrier that has driven intraspecific fragmentation were evaluated using 14 microsatellite markers. Methodology/Principal Findings: Twenty wild populations were sampled from the distributional range of P. rockii. Significant population differentiation was suggested (FST value of 0.302). Moderate genetic diversity at the population level (HS of 0.516) and high population diversity at the species level (HT of 0.749) were detected. Significant excess homozygosity (FIS of 0.076) and recent population bottlenecks were detected in three populations. Bayesian clusters, population genetic trees and principal coordinate analysis all classified the P.
    [Show full text]
  • Next-Generation Genome Sequencing of Sedum Plumbizincicola Sheds
    plants Article Next-Generation Genome Sequencing of Sedum plumbizincicola Sheds Light on the Structural Evolution of Plastid rRNA Operon and Phylogenetic Implications within Saxifragales 1,2, 1, 1 3 1 1 Hengwu Ding y, Ran Zhu y, Jinxiu Dong , De Bi , Lan Jiang , Juhua Zeng , Qingyu Huang 1, Huan Liu 3, Wenzhong Xu 4, Longhua Wu 3,* and Xianzhao Kan 1,2,* 1 The Institute of Bioinformatics, College of Life Sciences, Anhui Normal University, Wuhu 241000, Anhui, China; [email protected] (H.D.); [email protected] (R.Z.); [email protected] (J.D.); [email protected] (L.J.); [email protected] (J.Z.); [email protected] (Q.H.) 2 The Provincial Key Laboratory of the Conservation and Exploitation Research of Biological Resources in Anhui, Wuhu 241000, Anhui, China 3 National Engineering Laboratory of Soil Pollution Control and Remediation Technologies, Institute of Soil Science, Chinese Academy of Sciences, Nanjing 210008, Jiangsu, China; [email protected] (D.B.); [email protected] (H.L.) 4 Key Laboratory of Plant Resources, Institute of Botany, Chinese Academy of Sciences, Beijing 100093, China; [email protected] * Correspondence: [email protected] (L.W.); [email protected] (X.K.); Tel.: +86-25-8688-1128 (L.W.); +86-139-5537-2268 (X.K.) These authors equally contributed to this work. y Received: 27 August 2019; Accepted: 28 September 2019; Published: 29 September 2019 Abstract: The genus Sedum, with about 470 recognized species, is classified in the family Crassulaceae of the order Saxifragales. Phylogenetic relationships within the Saxifragales are still unresolved and controversial.
    [Show full text]
  • Template TC/49
    G TC/49/2 Rev.2 ORIGINAL: Englisch DATUM: 14. März 2013 INTERNATIONALER VERBAND ZUM SCHUTZ VON PFLANZENZÜCHTUNGEN Genf TECHNISCHER AUSSCHUSS Neunundvierzigste Tagung Genf, 18. bis 20. März 2013 PRÜFUNGSRICHTLINIEN Vom Verbandsbüro erstelltes Dokument 1. Dieses Dokument erteilt Informationen zu folgenden Entwicklungen bezüglich der Prüfungsrichtlinien: I. ANZUNEHMENDE PRÜFUNGSRICHTLINIEN II. ZUSÄTZLICHE MERKMALE III. KORREKTUREN AN PRÜFUNGSRICHTLINIEN IV. VON DEN TECHNISCHEN ARBEITSGRUPPEN IM JAHR 2012 BEHANDELTE ENTWÜRFE VON PRÜFUNGSRICHTLINIEN V. VON DEN TECHNISCHEN ARBEITSGRUPPEN IM JAHR 2013 ZU BEHANDELNDE ENTWÜRFE VON PRÜFUNGSRICHTLINIEN VI. PRÜFUNGSRICHTLINIEN AUF DER UPOV-WEBSITE TC/49/2 Rev.2 Seite 2 I. ANZUNEHMENDE PRÜFUNGSRICHTLINIEN 2. Der Technische Ausschuß (TC) nahm auf seiner siebenundvierzigsten Tagung vom 4. bis 6. April 2011 zur Kenntnis, daß der Rat auf seiner dreiundvierzigsten ordentlichen Tagung vom 22. Oktober 2009 in Genf die Praxis gebilligt habe, nach der die Prüfungsrichtlinien vom TC im Auftrag des Rates aufgrund des vom Rat gebilligten Arbeitsprogramms angenommen werden, ohne daß die einzelnen Prüfungsrichtlinien dem Rat zur Prüfung vorgelegt werden (vergleiche Dokument C/43/17 „Bericht“, Absatz 38). 3. Auf seiner sechsundvierzigsten ordentlichen Tagung vom 1. November 2012 in Genf nahm der Rat die Arbeiten des TC, der Technischen Arbeitsgruppen (TWP) und der Arbeitsgruppe für biochemische und molekulare Verfahren und insbesondere für DNS-Profilierungsverfahren (BMT), wie in Dokument C/46/10 dargelegt, zur Kenntnis und billigte die in Dokument C/46/10 enthaltenen Arbeitsprogramme (vergleiche Dokument C/46/18 „Bericht über Entscheidungen“, Absatz 38). 4. Für das Jahr 2012 war für jede der bestehenden TWP eine Tagung angesetzt. Auf jenen Tagungen wurde entschieden, dem TC die Entwürfe der Prüfungsrichtlinien in Anlage I zur Annahme vorzulegen.
    [Show full text]
  • Woody Peony Culture and Care
    Woody Peony Culture and Care Groups, General Information, Growing and Planting ___________________________________________ 3 GROUPS, ALLOWING CHOICES FOR THE GARDENER Woody peonies can be categorized into three main groups. Each group has unique floral characteristics, plant habits, climate tolerances and cultural needs. Most can be grown in USDA Hardiness Zones 4-8, but other climate variables (other than temperature) may impact their growth. GROUP 1: PAEONIA SUFFRUTICOSA CULTIVARS Tree Peonies have been grown for centuries in China and Japan. These plants are mainly from the man-made species P. suffruticosa, which has been selectively bred in China for centuries. P. suffruticosa does not occur in nature and is actually a hybrid group of plants derived from 4 to 6 species. In Japan, P. suffruticosa cultivars are referred to as 'Moutan' (Bouton) and in China 'Mudan'. They are among the most cherished plants in these nations and should receive much greater attention in American gardens. Many cultivars available are historic hybrids that may be hundreds of years old, giving testimony to their durability. The Japanese and Chinese suffruticosa selections are less tolerant of wet conditions and are often damaged during rainy seasons, especially in heavy soils. Plants originating from China have typically been the most available at low prices. Unfortunately the Chinese P. suffruticosa cultivars were genetically selected to grow best in semi-arid conditions--making them a poor choice for most American gardens. All are certainly beautiful, but have also caused many an American gardener to regard woody peonies as difficult to grow. However, there are many choices to suit the diverse American gardener's needs.
    [Show full text]
  • Paeonia 01-19
    PAEONIA Volume 11, No. 2 June, 1980 REQUIRED READING – TABLE OF CONTENTS 1. "The Peonies" by John C. Wister, $3.50 Page 1, More on Colchicine, (also pp 9 &10) from American Peony Society.. _______ ……….. Don Hollingsworth 250 Interlachen Rd., Hopkins, MN 55343 Page 2, Correspondence between Elisabeth 2. The Bulletins of the American Peony Georgiadou and Chris Laning Society. Page 4, Making Crosses for Double Flowers The PAEONIA is authorized by Miss Silvia Having New Colors, Saunders. ……….. Don Hollingsworth Editors are Chris and Lois Laning, Page 6, Letter (Colchicine) from L.J. Dewey 553 West F Avenue, Kalamazoo, Page 8, Polygene Concept, ….. Chris Laning Michigan, 49007. Suggested yearly contribution to cover Page 10, "First Aid" for Plants, Chris Laning expenses of printing and mailing is $2.50 (In the U.S.A.) COMMENT ON INBREEDING ARTICLE Don Hollingsworth Dear Chris: March 1, 1980 I have your article on inbreeding and am pleased that you are promoting this. The inbreeding I have been doing with F1 hybrids as seed parents has been almost entirely using pollens of closely related plants. It is perhaps useful for me to again share the identity of some that have been seed producers. (All F1, and triploid, except perhaps Claire de Lune.) SLP Hybrids Other Paladin Claire de Lune * Red Red Rose * (Lacti x Good Cheer) various with SLP group Lustrous Sophie For pollen parents I use related parents or F2 of Laura Magnuson * the same group; tetraploids when the pod Cardinals Robe * parent is a triploid. Bravura This is, of course, just one of the levels at Lovely Rose which one might start an inbred line.
    [Show full text]
  • Paeonia: a Systematic Review Yong Yang1,2,3,4,Miaosun1,2,3,4, Shanshan Li1,5, Qihang Chen2,3,4, Jaime A
    Yang et al. Horticulture Research (2020) 7:107 Horticulture Research https://doi.org/10.1038/s41438-020-0332-2 www.nature.com/hortres REVIEW ARTICLE Open Access Germplasm resources and genetic breeding of Paeonia: a systematic review Yong Yang1,2,3,4,MiaoSun1,2,3,4, Shanshan Li1,5, Qihang Chen2,3,4, Jaime A. Teixeira da Silva6, Ajing Wang1,5, Xiaonan Yu2,3,4 andLiangshengWang1,5 Abstract Members of the genus Paeonia, which consists of globally renowned ornamentals and traditional medicinal plants with a rich history spanning over 1500 years, are widely distributed throughout the Northern Hemisphere. Since 1900, over 2200 new horticultural Paeonia cultivars have been created by the discovery and breeding of wild species. However, information pertaining to Paeonia breeding is considerably fragmented, with fundamental gaps in knowledge, creating a bottleneck in effective breeding strategies. This review systematically introduces Paeonia germplasm resources, including wild species and cultivars, summarizes the breeding strategy and results of each Paeonia cultivar group, and focuses on recent progress in the isolation and functional characterization of structural and regulatory genes related to important horticultural traits. Perspectives pertaining to the resource protection and utilization, breeding and industrialization of Paeonia in the future are also briefly discussed. Introduction Paeoniflorin and paeonol are unique chemical compo- 1234567890():,; 1234567890():,; 1234567890():,; 1234567890():,; The genus Paeonia was placed in the Ranunculaceae nents in the roots of Paeonia, so several species of before the 20th century. According to the characteristic Paeonia were initially utilized as medicinal plants5. Wild arrangement of stamens, Worsdell1 separated Paeonia Paeonia species were introduced and domesticated in from rose in the Ranunculaceae and moved it to the China approximately 1500 years ago, as well as in med- Paeoniaceae.
    [Show full text]
  • Peonies in the Netherlands
    a PROGRAMA DE INNOVACIÓN TERRITORIAL GOBIERNO DE CHILE ■ PLtNDAOON PARA LA Ii~NOV'At-ION AL-a IC MINo)Acurk INFORMES DE AVANCE TÉCNICOS - PARTE 2 S ■ ■ ■ ■ ■ ~ PROGRAMAS DE INNOVACIÓN ~■ TERRITORAL ■ ■ ■ ■ ~■ ESTUDIOS ■ ■ INFORME TÉCNICO FINAL ■ ■ ■ ■ ■ ■ ■ ■ ■ ■ ■ ■ INFORME TÉCNICO DE AVANCE DE ESTUDIOS EJECUTOR: Vital Berry Marketing S.A. NOMBRE DEL ESTUDIO: Estudios de mercado de peonías CÓDIGO: EST-2007-0255 N° INFORME: Final PERIODO: Desde: Enero 2008 asta: O t~br 2008 NOMBRE Y FIRMA COORDINADOR ESTUDIO: Enrique Acevedo Herl USO INTERNO FIA FECHA RECEPCIÓN 1. Resumen ejecutivo del estudio (máximo 1 página) El resumen debe mencionar brevemente la metodología utilizada y a la obtención de aquellos resultados más relevantes, basándose en los objetivos general y específicos propuestos. Deberá explicar brevemente el grado de alcance de los resultados y emitir un juicio sobre los principales impactos técnicos, económicos y sociales alcanzados en el contexto del Programa. Se contrato los servicios de la empresa holandesa FBI (Flowers Best Interes) para realizar el estudio de mercado holandés. Finalmente esta empresa declinó hacer el estudio americano dado la dificultad para ellos de disponer de suficiente información relevante para un buen resultado. La ASOEX recomendó tres empresas que podrían hacer el estudio solicitado. Dos de ellos aceptaron y nos hicieron llegar sus respectivas propuestas. Promar International de UK con un estimado de £ 15.500 y Perishables Group de USA con un estimado de US$65.850. Se acordó no hacer el estudio bajo estos costos y se procederá a reunir información en distintas fuentes existentes. La información de las giras comerciales y la obtenida en otros estudios realizados anteriormente sería suficiente de acuerdos a los fondos con que cuenta el Programa.
    [Show full text]