Novel Cloning Vectors for Bacillus Thuringiensis JAMES A

APPLIED AND ENVIRONMENTAL MICROBIOLOGY, Nov. 1990, p. 3420-3428 Vol. 56, No. 11 0099-2240/90/113420-09$02.00/0 Copyright © 1990, American Society for Microbiology Novel Cloning Vectors for Bacillus thuringiensis JAMES A. BAUM,* DOLORES M. COYLE, M. PEARCE GILBERT, CHRISTINE S. JANY, AND CYNTHIA GAWRON-BURKE Ecogen Inc., 2005 Cabot Boulevard West, Langhorne, Pennsylvania 19047-1810 Received 28 June 1990/Accepted 22 August 1990

Seven replication origins from resident plasmids of Bacillus thuringienis subsp. kurstaki HD263 and HD73 were cloned in Escherichia coli. Three of these replication origins, originating from plasmids of 43, 44, and 60 MDa, were used to construct a set of compatible shuttle vectors that exhibit structural and segregational stability in the Cry- strain B. thuringiensis HD73-26. These shuttle vectors, pEG597, pEG853, and pEG854, were designed with rare restriction sites that permit various adaptations, including the construction of small recombinant plasmids lacking antibiotic resistance genes. The crylA(c) and cryllA insecticidal crystal protein genes were inserted into these vectors to demonstrate crystal protein production in B. thuringiensis. Introduction of a cloned crylA(c) gene from strain HD263 into a B. thuringiensis subsp. aizawai strain exhibiting good insecticidal activity against Spodoptera exigua resulted in a recombinant strain with an improved spectrum of insecticidal activity. Shuttle vectors of this sort should be valuable in future genetic studies of B. thuringiensis as well as in the development of B. thuringiensis strains for use as microbial pesticides.

The gram-positive soil bacterium Bacillus thuringiensis approach will depend on the availability of suitable cloning produces proteinaceous parasporal crystals that are toxic to vectors. a select variety of insect species. Over two dozen varieties of In this report, we describe the cloning of seven replication B. thuringiensis representing different flagellar antigens (5) origins derived from resident plasmids of B. thuringiensis and insecticidal activities against lepidopteran, dipteran, or subsp. kurstaki HD263 and HD73 and the construction of coleopteran larvae have been identified (11). Since its intro- cloning vectors based on three of these replication origins. duction as a product in the early 1960s, B. thuringiensis has These vectors have features that should prove useful in the become the major biological pesticide in use worldwide, with development of commercial strains of B. thuringiensis and in several subspecies currently being used as active ingredients future genetic studies of this important organism. (3). The components of the parasporal crystals, often referred MATERIALS AND METHODS to as delta-endotoxins or insecticidal crystal proteins (ICPs), represent a diverse group of proteins that differ extensively Bacterial strains and plasmids. B. thuringiensis subsp. in structure and insecticidal activity (11). The composition of kuirstaki HD263 and HD73 were obtained from the collection ICPs found in B. thuringiensis strains varies considerably; of Dulmage (8). Strain HD73-26 is a cured derivative of even strains of the same serotype can exhibit substantial HD73 that contains a cryptic 4.9-MDa plasmid (7). Strain differences in insecticidal activity. ICPs are encoded by HD73-26-10 is an HD73-26 transconjugant strain containing genes typically found on large plasmids (>30 MDa) (10, 13), a crylA(c) ICP-encoding 44-MDa plasmid from HD263 as some of which can be transferred conjugatively. Conjugal well as the 4.9-MDa plasmid. Strain HD263-6 is a cured transfer of ICP-encoding plasmids has been successfully derivative of HD263 lacking the 44-MDa plasmid (2). B. employed at the commercial level to construct B. thurin- thuringiensis subsp. aizawai EG6346 is a cured derivative of giensis strains with improved insecticidal activities (3). Al- strain EG6345 that contains several non-crylA ICP genes. though it provides a "natural" means of altering the ICP Strain EG6345 contains, in addition to the ICP genes found gene composition of B. thuringiensis, the use of conjugation in EG6346, a cryIA(b) gene located on a 45-MDa plasmid. is limited to mobilizable genes and strains that are amenable Both EG6345 and EG6346 were obtained from the Ecogen to conjugation and by plasmid incompatibility. A recombi- strain collection. Escherichia coli TG1 (Amersham Corp.), nant DNA approach to B. thuringiensis strain construction XL-1 Blue (Stratagene Corp.), and GM2163 (kindly provided offers a greater degree of flexibility than that afforded by by New England BioLabs Inc.) were used as host strains for conjugation. subcloning. Plasmids pTZ18u and pTZ19u (U.S. Biochemi- Numerous ICP genes have been cloned, and their prod- cal Corp.) were used as cloning vectors. Plasmid pMI1101, ucts have been assessed for insecticidal activity (11). In which harbors the chloramphenicol acetyltransferase gene addition, an efficient transformation system for B. thurin- (cat) from pC194 (12), was a gift from Michelle Igo. giensis has been developed by employing electroporation DNA manipulations. Standard recombinant DNA proce- (15, 17, 23). Thus, it should be possible to manipulate the dures were performed as described by Maniatis et al. (19). production, regulation, and activity of ICPs by molecular Plasmids from B. thuringiensis HD73-26-10 and HD263-6 genetic techniques and to construct improved B. thuringien- were isolated as described by Kronstad et al. (13). Plasmids sis strains for use as microbial pesticides. The success of this from E. coli were prepared by a small-scale alkaline lysis procedure (19). For Southern blot analysis, DNAs were resolved on 1% agarose gels (Tris-phosphate buffer [19]) and transferred to Zeta-probe membranes (Bio-Rad Corp.) by * Corresponding author. using the alkaline blotting procedure recommended by the 3420 VOL. 56, 1990 NOVEL CLONING VECTORS FOR B. THURINGIENSIS 3421 manufacturer. Hybridization probes were prepared by using 500 bp the random primer method of Feinberg and Vogelstein (9). Transformants of B. thuringiensis HD73-26 harboring amp f recombinant plasmids were analyzed on 0.8% agarose gels cat- plac ori - by using a modified Eckhardt lysis procedure (10). For ...... 4.- restriction enzyme analysis, B. thuringiensis transformants 8u E were grown for 6 h at 30°C in brain heart infusion (Difco) EI- _ ~~~~~pTZ1 The cells were pelleted in a ~~~~~~~~~~~~...... containing 0.5% glycerol. microfuge, frozen on dry ice, and thawed at room tempera- S BSmEStKSmBXbSPSpH ture. DNA was extracted from the cell pellets by using the E. FIG. 1. Linear restriction map of replicon cloning vector coli alkaline lysis procedure. DNAs were sequenced accord- pEG588. An EcoRI fragment from pMI1101 harboring the chloram- ing to the dideoxy chain termination method (22) with phenicol acetytransferase (cat) gene of pC194 (dark-shaded box) [cx-355]dATP and the Sequenase DNA sequencing kit (U.S. was inserted into the EcoRI site of the E. coli vector pTZ18u (light-shaded box) as shown. Restriction sites: B, BamHI; E, EcoRI; templates were prepared Biochemical Corp.). Sequencing H, Hindlll; K, KpnI; P, PstI; S, Sall; S, SmaI; Sp, SphI; St, SstI; from double-stranded DNA by procedures outlined in the Xb, XbaI. Other abbreviations: f, fl phage replication origin; ori, Sequenase manual. Synthetic oligonucleotides were gener- replication origin of pTZ18u; amp, beta-lactamase gene; cat, chlor- ated on an Applied Biosystems 380B DNA Synthesizer and amphenicol acetyltransferase gene. purified by the oligonucleotide purification cartridge method recommended by the manufacturer. Transformation of B. thuringiensis. Transformation was ics model 300A computing densitometer and purified performed by the electroporation procedure of Mettus and CryIA(c) and CryllA proteins as standards. Macaluso (20) with the Bio-Rad Gene Pulser apparatus. Western blot analysis. Crystal proteins resolved on 7.5% Electroporated cells were grown in Luria broth containing SDS-polyacrylamide gels were transferred to nitrocellulose 0.2 ,ug of chloramphenicol per ml for 1 to 2 h at 37°C before filters (Millipore HATF, 0.45-,um pore size) by electropho- plating on NSM plates (23 g of Bacto nutrient agar per liter, resis in 12 mM Tris-96 mM glycine-20% (vol/vol) methanol. 1 mM MgCl2, 0.7 mM CaCl2, 0.05 mM MnCl2) containing 5 The filters were blocked by incubation in 5% (wt/vol) nonfat ,ug of chloramphenicol per ml. dry milk-10 mM Tris hydrochloride (pH 7.5)-0.9% (wt/vol) temper- Cloning of an ICP gene from HD263. A cryIA(c) gene NaCl-0.09% (wt/vol) sodium azide for 1 h at room were located on the 44-MDa plasmid of B. thuringiensis HD263 ature. After a 10-min rinse in 0.3% Tween 80, the filters antibodies at a was cloned in E. coli by using the bacteriophage cloning incubated with CryIA(c) protein-specific vector Lambda-Dash (Stratagene). Plasmid DNA from the 1:200 dilution in TBSN (10 mM Tris hydrochloride, 0.9% which harbors the 44- NaCl, 0.1% [wt/vol] globulin-free bovine serum albumin, transconjugant strain HD73-26-10, 0.09% sodium azide, 0.05% [vol/vol] Triton X-405) for 1 h. was partially digested with MboI to yield MDa plasmid, After subsequent washes with TBSN, TBSN-0.05% SDS, DNA fragments in the 15- to 30-kb range. This DNA was intestinal alkaline phos- and TBSN, the filters were incubated for several hours with then dephosphorylated with calf a second antibody consisting of anti-mouse alkaline phos- phatase (Boehringer Mannheim Corp.), ligated to BamHI- phatase-conjugated immunoglobulin G (Sigma Chemical digested bacteriophage vector DNA, and packaged into Co.) at a 1:1,000 dilution in TBSN. After thorough washing phage particles by using packaging extracts prepared from E. with TBSN and double-distilled water, the alkaline phos- coli BH2688 and BH2690 (19). Strain NM539 (Stratagene) phatase-specific color reaction was developed with 5-bromo- was used as the host strain for phage propagation. Clones 4-chloro-3-indoyl phosphate and Nitro Blue Tetrazolium harboring the crylA(c) gene were identified by plaque hy- (Sigma). bridization with a 720-bp EcoRI fragment from the cryIA(a) Bioassay. Activity against lepidopteran larvae was deter- gene of HD263 as a probe (unpublished data, this laborato- mined by topically applying 100 p1l of serially diluted spore- ry). The identity of the cryIA(c) gene was confirmed by crystal preparations to 3 ml of an agar-based artificial diet in restriction endonuclease mapping. a plastic feeding cup (600-mm2 surface). One neonate larva ICP preparation and SDS-PAGE. B. thuringiensis strains was placed in each cup and scored for mortality after 7 days. were grown in M55 medium, which contained the following Fifty percent lethal concentrations were determined by (per liter): 1.5 g of potato dextrose broth, 2.65 g of nutrient probit analysis as described by Daum (4) by an eight-dose broth, 0.1 g of L-methionine, 330 [lI of 1 M MgCl2, 10 ,ul of testing procedure with 30 larvae per dose. The assays were 0.5 M MnCl2, and 50 ml of 20x M55 salts [176 g of NaCl, 100 performed in duplicate. g of K2HPO4, 100 g of KH2PO4, 13.3 g of (NH4)2SO4, and 4.2 g of citric acid per liter, 20 puM CuCI2 2H20, 20 p.M Na2MoO4, 20 puM Zn-sodium citrate)]. Strains were grown RESULTS at 30°C for 3 days until fully sporulated and lysed. Spore- Cloning of B. thuringiensis replication origins. To facilitate crystal preparations were examined by phase-contrast mi- the cloning of B. thuringiensis plasmid replication origins, a croscopy and sodium dodecyl sulfate-polyacrylamide gel plasmid was constructed that requires such sequences to electrophoresis (SDS-PAGE). Samples (100 ,ul) from the replicate in B. thuringiensis. Briefly, a 1.5-kb EcoRI frag- lysed cultures were centrifuged for 5 min in a microfuge, and ment from pMI1101 containing the cat gene of pC194 (12) the pellets were washed once with 1 ml of 10 mM Tris was inserted into the EcoRI site of the E. coli cloning vector hydrochloride (7.5)-l mM EDTA-1 mM EGTA. The spore- pTZ18u to provide a selectable marker that is functional in crystal suspensions were centrifuged again, and the resultant B. thuringiensis. The resultant construct, pEG588, contain- pellets were dried and suspended in 100 pul of 2x Laemmli ing the desired orientation of the cat gene is shown in Fig. 1. buffer at 95°C for 5 min (14). Crystal proteins were resolved This plasmid, as expected, would not replicate in B. thu- on either 7.5 or 10% gels. Crystal protein concentrations ringiensis (data not shown). were determined by densitometry with a Molecular Dynam- The resident plasmids of B. thuringiensis HD263 were 3422 BAUM ET AL. APPL. ENVIRON. MICROBIOL.

TABLE 1. B. thuringiensis plasmid replication origin clones Resident Insert CloneClone plasmid" (MDa) size (kb) pEG588-2 4.9 6.8 pEG588-20a 5.2 6.0 pEG588-4a 5.4 6.2 pEG588-23a 7.5 5.4 pEG599b 43 2.8 pEG851' 44 2.25 pEG588-14a 60 2.3 a Resident B. thuringiensis plasmid from which the replication origin was derived. Only representative replication origin clones are listed. b Subcloned from pEG588-13a (Fig. 3). ' Subcloned from pEG588-8 (Fig. 3). S $ S 07 FIG. 2. Southern blot analysis of resident plasmids in B. thuringiensis HD263-6 (A) and HD73-26-10 (B). CsCl gradient-purified plasmid DNAs were resolved by agarose gel electrophoresis and plasmid DNA isolated from strain HD263-6, a cured deriv- transferred to nylon membranes for hybridization analysis. The ative of HD263 lacking the 44-MDa plasmid. A total of 24 replication origin clones listed in Table 1, representing seven dif- replication origin clones (pEG588-la through pEG588-24a) ferent B. thuringiensis plasmid replication origins, were used as were obtained from HD263-6, and these were compiled into hybridization probes: 1, pEG851; 2, pEG599; 3, pEG588-14a; 4, six distinct homology groups based on Southern blot analy- pEG588-23a; 5, pEG588-20a; 6, pEG588-4a; 7, pEG588-2. Final ses with replication origin inserts from several recombinant membrane washes were performed in 0.3x SSC (1x SSC is 0.15 M plasmids as hybridization probes (data not shown). NaCl plus 0.015 M sodium citrate)-0.1% SDS at 65°C. L, linear Subsequently, the resident B. thuringiensis plasmid from DNA fragments; M, linear lambda DNA. which each homology group was derived was identified by Southern blot analysis of HD263-6 and HD73-26-10 plasmids chosen as the source of plasmid replication origins. Strain by using the smallest replication origin insert of each homol- HD263 contains resident plasmids of 130, 110, 60, 44, 43, ogy group as a hybridization probe (Table 1, Fig. 2). In- 7.5, 5.4, 5.2, and 4.9 MDa (2). This strain also contains cluded in this analysis were the replication origin inserts in several ICP genes of the cryIA and cryII class, several of pEG851 and pEG588-2, derived from the 44- and 4.9-MDa which have been cloned and characterized in our laboratory plasmids, respectively. Interestingly, the replication origin (6, 20; this report). To clone the replication origin from the fragments from the 4.9-, 7.5-, 43-, 44-, and 60-MDa plasmids 44-MDa plasmid of HD263, plasmid DNA from HD73-26-10 showed no homology with other B. thuringiensis plasmids. (a transconjugant strain harboring this plasmid and a 4.9- The recombinant plasmid containing the replication origin MDa plasmid) was digested with MboI to yield DNA frag- fragment from the 5.4-MDa plasmid (pEG588-4a) showed ments in the 2- to 15-kb range. An equimolar concentration partial homology to the 4.9-MDa plasmid but not vice versa. of this DNA was ligated to BamHI-digested pEG588, and the In addition, the recombinant plasmid containing the replica- entire ligation reaction was used to transform the Cry- strain tion origin fragment from the 5.2-MDa plasmid (pEG588-20a) B. thuringiensis HD73-26 to chloramphenicol resistance showed strong homology to the 43-MDa plasmid but not vice (Cm'). Twenty-one Cmr transformants were recovered and versa. analyzed on agarose gels for the presence of novel plasmids Construction of B. thuringiensis-E. coli shuttle vectors. The by using a modified Eckhardt lysis procedure (10). The novel smallest replication origin inserts obtained from the 43-, 44-, recombinant plasmids were designated pEG588-1 through and 60-MDa plasmids of B. thuringiensis HD263 were con- pEG588-21. The smallest B. thuringiensis replication origin tained on plasmids pEG588-13a, pEG588-8, and pEG588- insert among the 21 clones, isolated from plasmid pEG588-8 14a, respectively (Fig. 3). The replication origins from the (see Fig. 3), was used as a hybridization probe for Southern 43- and 44-MDa plasmids were subsequently localized to blot analysis. Recombinant plasmids from 18 transformants smaller restriction fragments by subcloning directly into B. hybridized strongly to the pEG588-8 probe (data not shown). thuringiensis HD73-26. Plasmid pEG599, containing the A subclone of the replication origin fragment of pEG588-8, replication origin from the 43-MDa plasmid (ori 43), con- designated pEG851, was subsequently shown to hybridize to sisted of a 2.8-kb XbaI fragment from pEG588-13a inserted the 44-MDa plasmid in strain HD73-26-10 (Fig. 2). The three into the XbaI site of pEG588 (Table 1, Fig. 3). Plasmid remaining Cmr transformants contained novel plasmids, pEG851, containing the replication origin from the 44-MDa designated pEG588-2, pEG588-18, and pEG588-21, that hy- plasmid (ori 44), consisted of the 3.75-kb EcoRI-HindIII bridized strongly on Southern blots to a hybridization probe fragment of pEG588-8 inserted into pTZ19u (cleaved at the consisting of the 4.9-MDa plasmid of strain HD73-26 (data EcoRI and HindIII sites), thereby replacing the multiple not shown). These HD73-26 transformants also showed a cloning site of pTZ19u with a DNA fragment containing the reduction in, or absence of, the resident 4.9-MDa plasmid of cat gene and the B. thuringiensis replication origin (Table 1, strain HD73-26, suggesting that the novel plasmids exhibit Fig. 3). Plasmids pEG851, pEG599, and pEG588-14a were some degree of incompatibility with the 4.9-MDa plasmid found to replicate stably in B. thuringiensis HD73-26: recom- (data not shown). The replication origin fragment in binants harboring these plasmids yielded 96 to 100% Cmr pEG588-2 was subsequently shown to hybridize to the colonies after 18 generations in the absence of selection. 4.9-MDa plasmid of strains HD73-26-10 and HD263-6 (Fig. Because of their apparent stability and the small size of their 2). inserts, these three plasmids were selected for development The replication origins of other plasmids derived from as a set of compatible shuttle vectors. strain HD263 were obtained in similar fashion by using Figure 4 illustrates the strategy used to construct a B. VOL. 56, 1990 NOVEL CLONING VECTORS FOR B. THURINGIENSIS 3423

1 kb

E cat s H f amp plac I, *~. I .4- - pEG588-8 6MEMEEmisw I...... 1. pTZ18u I Sp XbS PSpH E * cat s ori 44 *plac amp f pEG851 _ 1 ~~~~~~~~~~~~~~~~~~.::...... E sp H pTZ1 9u E

cat s B ori 60 f amp plac pEG588-14a I I E sp E H XbS PSpH pTZI8u E

pEG588-1 3a cat S P H H Xb E f amp plac - I I I I I I I ZI. E Sp Xb S P Sp H pTZl 8u E

plac amp f ori 43 Sp cat 4 -40 _ ~ pEG599 !~~ I E pTZ18U H Sp PS Xb E Xb B Sm K St E Sm B'S E FIG. 3. Linear restriction maps of replication origin clones from the 43-, 44-, and 60-MDa plasmids of strain HD263. For clarity, the replication origins have been labeled ori 44 (44-MDa plasmid), ori 60 (60-MDa plasmid), and ori 43 (43-MDa plasmid). Light-shaded boxes represent pTZ18u or pTZ19u sequences. Dark-shaded boxes represent the cat gene fragment from pMI1101. Open boxes represent replication origin fragments from B. thuringiensis. Abbreviations for restriction endonuclease sites are given in the legend to Fig. 1. Plasmids pEG851 and pEG599 are subclones derived from plasmids pEG588-8 and pEG588-13a, respectively.

thuringiensis-E. coli shuttle vector based on the replication insert. The 2.3-kb Sall fragment was ligated to the 4.36-kb origin of the 44-MDa plasmid (ori 44). An SphI site located SalI fragment of pEG597 (Fig. 4), containing the cat gene downstream of the cat gene on pEG851 was removed by and pTZ19u, to yield pEG852 (Fig. 5). An SfiI site was digesting plasmid DNA with SphI, using T4 polymerase to inserted at the XbaI site by using an SfiI-XbaI linker that remove the 3' overhangs, and ligating the blunt ends to- restores the XbaI site on one side of the inserted linker. The gether. Subsequently, the EcoRI site was replaced with an desired orientation shown in Fig. 5 was selected by DNA NotI site by cleaving the plasmid with EcoRI and inserting sequence analysis. Subsequently, an MCS was inserted at an NotI linker with EcoRI-compatible ends. Finally, a mul- the unique BamHI site to yield the shuttle vector pEG853. tiple cloning site (MCS) was inserted at the unique HindIII The orientation of the MCS was selected by restriction site to yield the shuttle vector pEG597. The sequence and enzyme analysis and confirmed by sequence analysis. Sub- orientation of the MCS were confirmed by DNA sequence sequently, the 2.8-kb XbaI fragment from pEG599 (Fig. 3) analysis. was inserted in place of the 2.3-kb XbaI fragment of pEG853, The pair of NotI sites in pEG597 allows for subsequent thus replacing ori 60 with ori 43 to yield the shuttle vector deletion of the pTZ19u segment from the vector, thereby pEG854 (Fig. 5). Plasmid pEG854 contained all of the converting the shuttle vector into a B. thuringiensis plasmid restriction site modifications present in pEG853. In addition with a single antibiotic resistance gene. The pair of Sall sites to the pairs of NotI and Sall sites found in pEG597, plasmids enables recovery of a DNA fragment containing the B. pEG853 and pEG854 also contained a pair of Sfil sites thuringiensis replication origin and any gene inserted into flanking the B. thuringiensis replication origin fragment and the multiple cloning site. This feature provides a means of multiple cloning site. The pair of XbaI sites flanking the B. constructing an ICP-encoding plasmid composed entirely of thuringiensis replication origin segment could be used to B. thuringiensis DNA or, alternatively, a B. thuringiensis construct additional shuttle vectors, as illustrated by the plasmid combined with a different selectable or nonselect- construction of pEG854 (Fig. 5). The characteristics of able marker gene (see Discussion). shuttle vectors pEG597, pEG853, and pEG854 are listed in The strategy used to construct shuttle vectors based on Table 2. the replication origins isolated from the 60-MDa (ori 60) and Expression of crystal protein genes in B. thuyingiensis. To 43-MDa (ori 43) plasmids is illustrated in Fig. 5. The repli- demonstrate the utility of vectors pEG597, pEG853, and cation origin from the 60-MDa plasmid is contained on a pEG854 for expressing ICP genes in B. thuringiensis, two 2.3-kb fragment flanked by SalI sites in plasmid pEG588-14a distinct crystal protein genes were inserted into each of the (Fig. 3). In the process of cloning ori 60, the BamHI site three plasmids. The first gene, cryIIA, previously referred to present in pEG588 was restored at one end of the cloned as cryBI (6), encodes the P2 delta-endotoxin or CrylIA ICP 3424 BAUM ET AL. APPL. ENVIRON. MICROBIOL.

1 kb

cat > S orl 44 < Etlac ^ amp f 4.- pEG851 ...... E ~~~~~~~~~~~~~~~~~~~~.Sp H pTZ19u E Sph I T4 POLYMERASE + dNTPs T4 LIGASE

E S H E

I Eco RI INSERT Not I LINKER

N S H N

I Hind III INSERT MCS

cat orl 44 plac amp f 4 - ' 4 - pEG597 ...... N S l ZpTZ1 9u N B X P St Sp Sm H E S N FIG. 4. Construction of shuttle vector pEG597. The figure depicts the strategy used to remove the SphI (Sp) site, replace the EcoRI (E) site with a Notl (N) site, and insert an MCS as described in Results. The sequence of the MCS (top strand), starting with the BamHI site, is 5' GGATCCCTCGAGCTGCAGGAGCTCGCATGCCCCGGGAAGCTTGAATTCGTCGACGCGGCCGC 3'. X, XhoI. Abbreviations for the remaining restriction endonuclease sites are given in the legend to Fig. 1. that exhibits insecticidal activity against both lepidopteran formants were examined for crystal protein production. and dipteran larvae (6, 24). The second gene, cryIA(c), Transformants were first characterized by restriction en- encodes the P1 delta-endotoxin or CryIA(c) ICP, which zyme analysis of plasmid DNAs to confirm the structural exhibits relatively potent insecticidal activity against a vari- stability of the recombinant plasmids (data not shown). ety of lepidopteran insect pests (11). Subsequently, the transformants were grown for 3 days at The cryIIA gene, located on a 4.0-kb BamHI-HindIII 30°C in M55 medium in the presence or absence of 5 ,ug of fragment in pEG201 (6), was inserted into the BamHI and chloramphenicol per ml. Crystals harvested from the lysed Hindlll sites of pEG597 to generate pEG864 (Table 2). The cultures were viewed by phase-contrast microscopy and same gene was inserted as a 4.0-kb BamHI-HpaI fragment analyzed by SDS-PAGE (Fig. 6A). HD73-26 recombinants into the BamHI and HpaI sites of pEG853 and pEG854 harboring either pEG858, pEG862, or pEG864 produced to yield plasmids pEG858 and pEG862, respectively. The large rounded or cuboidal crystals, often larger than the cryIA(c) gene, located on a 5.0-kb SphI-SalI fragment iso- spore, that yielded a -70-kDa protein on SDS gels. This lated from a bacteriophage clone of HD73-26-10 plasmid protein comigrated with purified CrylIA crystal protein. DNA (see Materials and Methods), was inserted into all Similarly, HD73-26 recombinants harboring either pEG857, three vectors at the SphI and XhoI sites to yield plasmids pEG861, or pEG863 produced bipyramidal crystals typical pEG863, pEG857, and pEG861. The six constructs are listed of cryIA-type crystal proteins. The crystal protein from in Table 2. these recombinant strains comigrated with purified CryIA(c) The ICP-encoding plasmids (Table 2) were introduced into crystal protein on SDS gels at an apparent molecular mass of the Cry- strain HD73-26 by electroporation, and the trans- -133 kDa (Fig. 6A). VOL. 56, 1990 NOVEL CLONING VECTORS FOR B. THURINGIENSIS 3425

1 kb

S Xb orl 60 B S l

cat plor60 +4Wac amp f pEG852 ~... - l N SXb H EBSN pTZ19u N

Xba I I INSERT Sfi I LINKER

N SSfXb H EBSN N

Bam HI ~~~~~~~~~~~~...... j INSERT MCS cat orl 60 ptac amp f pEG853 - 4.,-, 4 - -.. N S Sf Xb H E pTZ19u N Xb P KSm AvBX St C Hp Sp Eg Sf SN (MCS) Xba I REPLACE ORI 60 FRAGMENT WITH Xba I FRAGMENT FROM pEG599 CONTAINING ORI 43 cat orl 43 plac amp f .4- ~- -~ pEG854 ...... N S Sf Xb N Xb PKSmAvBXStCHpSp EgSfSN FIG. 5. Construction of shuttle vectors pEG853 and pEG854. The 2.3-kb Sall fragment (ori 60) from pEG588-14a was ligated to the 4.35-kb SalI fragment (pTZ19u-cat) from pEG597 to give pEG852. An Sfil (Sf) site was inserted at the XbaI (Xb) site, and an MCS was inserted at the BamHI (B) site as shown to give pEG853. Removal of ori 60 by XbaI digestion and insertion of the 2.8-kb XbaI fragment (ori 43) from pEG599 (Fig. 3) yielded pEG854. The sequence of the multiple cloning site (top strand), starting with the XbaI site, is 5' TCTAGACTG CAGGTACCCGGGCCTAGGATCCCTCGAGCTCATCGATGTTAACGCATGCGGCCGATCGGGCCGATCCGTCGACGCGGCCGC 3'. Av, AvrII; C, Clal; Eg, EagI; Hp, HpaI. Abbreviations for the remaining restriction sites are given in the legend to Fig. 1.

Plasmid pEG863 (Table 2) contained both the replication was not noticeably affected by the presence or absence of origin and the cryIA(c) gene from the 44-MDa plasmid of chloramphenicol, suggesting that the ICP-encoding plasmids strain HD263. Strains HD73-26(pEG863) and HD73-26-10 replicate stably. In subsequent stability tests, HD73-26 re- (containing the 44-MDa plasmid) were used to compare the combinants containing ICP-encoding plasmids derived from levels of CryIA(c) protein produced by identical genes pEG597 yielded 70 to 80% Cmr colonies after 18 generations located on related native and recombinant plasmids in the in the absence of selection, whereas recombinants contain- same host background. SDS-PAGE of crystal preparations ing ICP-encoding plasmids derived from pEG853 or pEG854 from strains HD73-26(pEG863) and HD73-26-10 indicated yielded 97 to 99% Cmr colonies after 18 generations in the that pEG863 and the 44-MDa plasmid yielded similar levels absence of selection. of CryIA(c) protein (Fig. 6B). Introduction of crylA(c) into a complex strain background. Production of crystal protein in the recombinant strains An ICP-encoding recombinant plasmid was introduced into a 3426 BAUM ET AL. APPL. ENVIRON. MICROBIOL.

TABLE 2. Shuttle vectors and derivatives nubilalis, and Plutella xylostella and maintained the activity Plasmid Size (kb) Relevant characteristics of the strain against S. exigua. Overall, the insecticidal activity of the recombinant strain was also significantly pEG597 6.6 Contains ori 44 better than that of the cryIA(b)-containing strain EG6345. pEG853 6.6 Contains ori 60 pEG854 7.2 Contains ori 43 pEG863 11.6 pEG597 + cryIA(c), ori 44 DISCUSSION pEG864 10.6 pEG597 + cryIIA, ori 44 pEG857 11.6 pEG853 + cryIA(c), ori 60 In this report we describe the cloning of seven plasmid pEG858 10.6 pEG853 + cryIIA, ori 60 replication origins from B. thuringiensis subsp. kurstaki pEG861 12.2 pEG854 + cryIA(c), ori 43 HD263 and HD73 and the construction ofB. thuringiensis-E. pEG862 11.2 pEG854 + cryIIA, ori 43 coli shuttle vectors pEG597, pEG853, and pEG854, containing replication origins from the resident 44-, 60-, and 43-MDa plasmids of strain HD263, respectively. These shuttle vectors were designed to facilitate the B. thuringiensis strain harboring multiple ICP genes to manipulation of cloned ICP genes and plasmid replication examine the effect of the cloned ICP gene on insecticidal origins in B. thuringiensis. For example, restriction sites for activity. Specifically, plasmid pEG863 [containing crylA(c)] NotI, Sall, and were introduced into the plasmids to was introduced into strain EG6346, a novel B. thuringiensis Sfil strain that exhibits allow for the systematic excision of non-B. thuringiensis good insecticidal activity against DNA after the cloning of ICP genes in E. coli and before the Spodoptera exigua but lacks cryIA-type genes. For compar- ison, the related strain EG6345 (see Materials and Methods) transformation of B. thuringiensis. Restriction sites for NotI and are well suited for this purpose, since they should be was also tested in the bioassay. Spore-crystal preparations Sfil of EG6345, EG6346, and the recombinant strain EG6346 exceptionally rare in the B. thuringiensis genome (30% G+C). Deletion of the pTZ19u portion of the vectors by (pEG863) were prepared from lysed M55 cultures and examined by SDS-PAGE (Fig. 7A) and Western blot analysis (Fig. NotI digestion and self-ligation provides a convenient and 7B). Western blot analysis with CryIA(c) protein-specific reliable means of constructing small B. thuringiensis plasmids containing a single selectable marker gene, cat. The cat antibodies confirmed that was CryIA(c) protein produced in gene can be used to monitor or maintain the recombinant strain EG6346(pEG863) but not in strains the stability of EG6345 and ICP-encoding recombinant plasmids during fermentation. EG6346 (Fig. 7B). Interestingly, CryIA(c) pro- However, a desirable feature of live recombinant duction appeared to be higher in the recombinant strain B. thuringiensis strains destined for use as biopesticides would pre- HD73-26(pEG863). The spore-crystal preps were used di- sumably be the absence of DNA from other biological rectly in quantitative bioassays against a variety of insect species (Table 3). Introduction of pEG863 into EG6346 sources, particularly antibiotic resistance genes. To this end, enhanced the insecticidal activity of the strain against He- self-ligated Sfil or Sall fragments containing a B. thuringien- liothis sis replication origin and an ICP gene (inserted into the zea, Heliothis virescens, Trichoplusia ni, Ostrinia multiple cloning site) could be introduced into B. thuringiensis by cotransformation with an unstable selectable plasmid, resulting in small ICP-encoding plasmids devoid of foreign DNA. At the very least, DNA fragments containing an ICP gene and a B. thuringiensis replication origin could be - A combined with alternative marker genes. a 40 D073-26 RECOMBRIA t4c Other features of the vectors are worth noting. The positions of the XbaI sites in pEG853 and pEG854 permit the substitution of B. thuringiensis replication origin fragments, thereby facilitating the construction of additional vectors. The lac promoter from pTZ19u is oriented in such a way that, with the proper manipulations, cloned ICP genes can be expressed in E. coli as well as in B. thuringiensis. This feature could be useful for genetic studies of ICP structure and function. Adjacent to the lac promoter is the T7 RNA polymerase promoter, useful for the in vitro synthesis of RNA. In addition, the fl replication origin can be used in E. coli to generate single-stranded DNA suitable for DNA sequence analysis and site-directed mutagenesis. Finally, since the three replication origins were derived from com- FIG. 6. SDS-PAGE analysis of spore-crystal preparations from patible plasmids, they could provide the means for con- HD73-26 recombinant strains harboring crystal protein genes. (A) structing complex B. thuringiensis strains de novo. Strains harboring cryIA(c)-containing recombinant plasmids pro- Shuttle vectors containing cryIA(c) or cryIIA yielded duce a CryIA-type protein, whereas strains harboring cryIIA -con- significant amounts of crystal protein when introduced into taining recombinant plasmids produce a CrylIA-type protein. the Cry- strain HD73-26. In the case of the cryIIA-contain- Recombinant strains are designated according to ICP-encoding ing plasmids, the amount of CryllA protein produced (0.17 plasmids as listed in Table 2. Purified P1 [CrylA(c)] and P2 (CryIlA) to 0.25 ,ug of protein per ,ul of M55 culture lysate) was four- crystal proteins were included as standards. M55 cultures were to fivefold than grown in the presence (+) or absence (-) of 5 p.g of chloramphenicol higher that normally obtained with B. thu- per ml. (B) Strains HD73-26(pEG863) and HD73-26-10 produce ringiensis HD263. Comparable results have been obtained comparable levels of CryIA(c) toxin. Strain HD73-26-10 is a trans- with cryIIA-containing recombinant plasmids that employ conjugant strain of HD73-26 harboring the cryIA(c)-containing 44- the replication origin from pBC16 (J. Chambers, A. Jelen, MDa plasmid of strain HD263. and C. Gawron-Burke, unpublished data). CryIA(c) protein VOL. 56, 1990 NOVEL CLONING VECTORS FOR B. THURINGIENSIS 3427

C,, V0

CI 4D et e w 0 0 0 co c 04 CE) 0o .: i0 0 P0:C 'A.a...0* ....iSt B |X:X-E w

FIG. 7. SDS-PAGE (A) and Western blot (B) analyses of duplicate spore-crystal preparations from B. thuringiensis EG6345, EG6346, and EG6346(pEG863). (A) Three protein bands are detected in crystal preparations from strain EG6345, and two protein bands are detected in crystal preparations from the related strain EG6346. (B) Western blot analysis using antibodies specific for the CryIA(c) protein demonstrates expression of the cryIA(c) gene in strain EG6346(pEG863). production in the HD73-26 recombinant strains was esti- sumably compete with cryIA(c) for transcriptional and/or mated to be 0.2 to 0.3 j.ig of protein per p,l of M55 culture translational factors. It is known, for instance, that the lysate, approximately twofold lower than the amount of promoter regions of some crystal protein genes are highly CryIA protein produced by strains such as HD1 or HD263, conserved and appear to require a specific RNA polymerase which harbor multiple cryIA-type genes. The comparable containing a new sigma subunit (1, 11). Although the level of levels of CryIA(c) protein produced by the recombinant CryIA(c) production in strain EG6346(pEG863) is lower than plasmid pEG863 and the cryIA(c)-containing 44-MDa plas- that observed in strain HD73-26(pEG863), the EG6346 mid in strain HD73-26 suggest that ICP-encoding recombi- recombinant strain exhibits significant improvements in in- nant plasmids may, in some instances, behave similarly to secticidal activity over the recipient strain, EG6346. ICP-encoding native (resident) plasmids in B. thuringiensis. Other shuttle vectors employing plasmid replication ori- The expression of ICP genes on the shuttle vectors still gins from B. thuringiensis have been described in the liter- appears to be linked to sporulation in B. thuringiensis, since ature. Small cryptic plasmids from B. thuringiensis have crystal protein could only be observed by microscopy in been cloned directly into E. coli (16, 18, 21), resulting in sporulating cultures. Mettus and Macaluso (20) have shown bifunctional vectors, but the size of many of these constructs that the expression of cryIA and crylIA genes introduced limits their usefulness as shuttle vectors. Lereclus et al. (15) into B. thuringiensis on recombinant plasmids is sporulation have reported the construction of a shuttle vector for B. dependent, provided transcription is directed by the native thuringiensis by employing a replication origin fragment ICP gene promoter. Experiments employing translational from the small cryptic plasmid pHT1030 of B. thuringiensis fusions between crylIIA or crylA(c) and lacZ suggest that subsp. thuringiensis. Shuttle vectors based on pHT1030 the sporulation-linked regulation of these genes is main- (e.g., pHT3101) appear to exhibit segregational stability in tained on shuttle vectors, provided there is no transcription Bacillus subtilis (16). from vector-borne promoters proceeding through the cry The shuttle vectors described in this report have features gene (Baum and Jelen, unpublished data). that should facilitate the development of improved B. thu- Western immunoblot analysis indicates that the produc- ringiensis-based microbial insecticides. The vectors can be tion of CryIA(c) protein in strain HD73-26(pEG863) is used to construct B. thuringiensis strains with novel combi- greater than that in strain EG6346(pEG863). This may be due nations of ICP genes, resulting in improved insecticidal to the additional ICP genes contained in EG6346 that pre- activities against a broader spectrum of target pests. The

TABLE 3. Insecticidal activity of native and recombinant B. thuringiensis strainsa LC50, ng of ICP/cm2 (95% confidence interval) Strain Heliothis zea S. exigua Ostrinia nubilalis Heliothis virescens Trichoplusia ni Plutella xylostella EG6345 48.0 (39.5-59.7) 9.3 (5.0-15.0) 2.0 (1.4-2.8) >7.6 16.0 (8.3-28.3) >7.6 EG6346 54.2 (44.2-68.7) 15.1 (12.1-18.9) 6.1 (4.8-7.9) >6.1 22.3 (8.1-67.6) >6.1 EG6346(pEG863) 21.6 (17.6-27.5) 8.9 (7.3-10.9) 1.5 (0.9-3.1) 2.6 (1.8-4.1) 5.2 (4.2-6.3) 1.0 (0.4-1.5) a Bioassays were performed on spore-crystal preparations from M55 liquid cultures. 3428 BAUM ET AL. APPL. ENVIRON. MICROBIOL. segregational stability of these vectors, and the apparent radiolabeling DNA restriction endonuclease fragments to high sporulation-linked regulation of ICP genes contained on such specific activity. Anal. Biochem. 137:266-267. vectors, will permit detailed studies of ICP gene regulation in 10. Gonzalez, J. M., Jr., H. T. Dulmage, and B. C. Carlton. 1981. the native host. Last, further investigations of the B. thu- Correlation between specific plasmids and delta endotoxin pro- ringiensis plasmid replication origins will shed light on the duction in Bacillus thuringiensis. Plasmid 5:351-365. mechanisms of plasmid replication and maintenance in this 11. Hofte, H., and H. R. Whiteley. 1989. Insecticidal crystal proteins commercially important organism. of Bacillus thuringiensis. Microbiol. Rev. 53:242-255. 12. Horinouchi, S., and B. Weisblum. 1982. Nucleotide sequence and functional map of pC194, a plasmid that specifies inducible ACKNOWLEDGMENTS chloramphenicol resistance. J. Bacteriol. 150:815-825. We thank R. Gene Groat and James Mattison for supplying us 13. Kronstad, J. W., H. E. Schnepf, and H. R. Whiteley. 1983. with CryIA(c)-specific antibodies, Amy Jelen for assistance with the Diversity of locations for Bacillus thuringiensis crystal protein Western blot analysis, and William Donovan for his critical reading genes. J. Bacteriol. 154:419-428. of the manuscript. 14. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of T4 bacteriophage. Nature (London) LITERATURE CITED 227:680-685. 15. Lereclus, D., 0. Arantes, J. Chaufaux, and M.-M. Lecadet. 1989. 1. Brown, K. L., and H. R. Whiteley. 1988. Isolation of a Bacillus Transformation and expression of a cloned endotoxin gene in thuringiensis RNA polymerase capable of transcribing crystal Bacillus thuringiensis. FEMS Microbiol. Lett. 60:211-218. protein genes. Proc. Natl. Acad. Sci. USA 85:4166-4170. 2. Carlton, B. C., and J. M. Gonzalez, Jr. 1985. Plasmids and 16. Lereclus, D., S. Guo, V. Sanchis, and M.-M. Lecadet. 1988. delta-endotoxin production in different subspecies of Bacillus Characterization of two Bacillus thuringiensis plasmids whose thuringiensis, p. 246-252. In J. A. Hoch and P. Setlow (ed.), replication is thermosensitive in B. subtilis. FEMS Microbiol. Molecular biology of microbial differentiation. American Soci- Lett. 49:417-422. ety for Microbiology, Washington, D.C. 17. Mahillon, J., W. Chungjatupornchai, J. Decock, S. Dierickx, F. 3. Currier, T. C., and C. Gawron-Burke. 1989. Commercial devel- Michiels, M. Peferoen, and H. Joos. 1989. Transformation of opment of Bacillus thuringiensis bioinsecticide products, p. Bacillus thuringiensis by electroporation. FEMS Microbiol. 111-143. In J. P. Nakas and C. Hagedorn (ed.), Biotechnology Lett. 60:205-210. of plant-microbe interactions. McGraw-Hill Book Co., New 18. Mahillon, J., F. Hespel, A.-M. Pierssens, and J. Delcour. 1988. York. Cloning and partial characterization of three small cryptic 4. Daum, R. J. 1970. Revision of two computer programs for probit plasmids from Bacillus thuringiensis. Plasmid 19:169-173. analysis. Bull. Entomol. Soc. Am. 16:10-15. 19. Maniatis, T., E. F. Fritsch, and J. Sambrook. 1982. Molecular 5. de Barjac, H. 1981. Identification of H-serotypes of Bacillus cloning: a laboratory manual. Cold Spring Harbor Laboratory, thuringiensis, p. 35-43. In H. D. Burges (ed.), Microbial control Cold Spring Harbor, N.Y. of pests and plant diseases 1970-1980. Academic Press, Inc., 20. Mettus, A.-M., and A. Macaluso. 1990. Expression of Bacillus New York. thuringiensis 8-endotoxin genes during vegetative growth. Appl. 6. Donovan, W. P., C. C. Dankocsik, M. P. Gilbert, and C. Environ. Microbiol. 56:1128-1134. Gawron-Burke. 1988. Amino acid sequence and entomocidal 21. Miteva, V. I., and R. T. Grigorova. 1988. Construction of a activity of the P2 crystal protein. J. Biol. Chem. 263:561-567. bifunctional genetically labelled plasmid for Bacillus thuringien- 7. Donovan, W. P., J. M. Gonzalez, Jr., M. P. Gilbert, and C. sis subsp. israelensis. Arch. Microbiol. 150:496-498. Dankocsik. 1988. Isolation and characterization of EG2158, a 22. Sanger, F., S. Nicklen, and A. Coulson. 1977. DNA sequencing new strain of Bacillus thuringiensis toxic to coleopteran larvae, with chain terminating inhibitors. Proc. Natl. Acad. Sci. USA and nucleotide sequence of the toxin gene. Mol. Gen. Genet. 74:5463-5467. 214:365-372. 23. Schurter, W., M. Geiser, and D. Mathe. 1989. Efficient trans- 8. Dulmage, H. T., C. C. Beegle, H. de Barjac, D. Reich, G. formation of Bacillus thuringiensis and Bacillus cereus via Donaldson, and J. Krywienczyk. 1982. Bacillus thuringiensis electroporation: transformation of acrystalliferous strains with a cultures available from the U.S. Department of Agriculture. cloned delta-endotoxin gene. Mol. Gen. Genet. 218:177-181. U.S.D.A.-A.R.S. agricultural reviews and manuals, ARM-S-30/ 24. Widner, W. R., and H. R. Whiteley. 1989. Two highly related Oct. U.S. Department of Agriculture, Agricultural Research insecticidal crystal proteins of Bacillus thuringiensis subsp. Service, New Orleans. kurstaki possess different host range specificities. J. Bacteriol. 9. Feinberg, A. P., and B. Vogelstein. 1984. A technique for 171:965-974.