Ø Full text online at www.ijmr.org.in Ø Submit online : http://www.journalonweb.com/ijmr India & COVID-19 (Part-IV)

R.N.I. Regd. No. 2223/57 © 2021 Indian Council of Medical Research, New Delhi The Indian Journal of Medical Research Available free full text online at www.ijmr.org.in; https://ijmr.icmr.org.in/ijmr/index.aspx

The Indian Journal of Medical Research is a biomedical journal with international circulation. It publishes original communications of biomedical research that advances or illuminates medical science or that educates the journal readers. It is issued monthly, in two volumes per year.

All correspondence regarding submission of manuscripts, reprints, subscription etc., should be addressed to the Editor-in-Chief, The Indian Journal of Medical Research, Indian Council of Medical Research, V. Ramalingaswami Bhawan, Ansari Nagar, New Delhi-110029. (Telephone: 91-11- 26589384 Fax: 91-11-26589497; e-mail: [email protected]; [email protected]). Guidelines for contributors to the Journal are published in each issue of the Journal, also available at the Journal websites.

Dr Anju Sharma Editor-in-Chief

Assistant Editor: Dr Albina Arjuman Nair Editorial Assistance: Shri Man Mohan Singh, Smt. Rachna Sharma, Shri Ram Kishore Suyal

Subscription rate and terms:

The total number of the issues of the Journal will be 12 per year (excluding Supplements). • ` 400.00 per copy (India) • US$ 45.00 per copy (airmail) • ` 4000.00 per annum (India) • US$ 450.00 per annum (airmail) [Rate includes postal charges]

No discount is available on individual, institute and agent subscription. Payment may be made by cheque/demand draft in favor of “Wolters Kluwer India Private Limited” payable at par Mumbai to below mentioned address. For more details, please visit www.ijmr.org.in/subscribe.asp

Postal Address: Wolters Kluwer India Private Limited, A-202, 2nd Floor, The Qube, C.T.S. No.1498A/2, Village Marol, Andheri (East), Mumbai - 400 059, India.

For subscription: Please contact Wolters Kluwer India Pvt. Ltd. at [email protected]

Note : The Editor-in-Chief or the Publisher assumes no responsibility for the statements and opinion of contributors. Editorial Board Chairperson : Dr Balram Bhargava, Director-General, Indian Council of Medical Research (ICMR) and Secretary, Department of Health Research, Government of India, New Delhi Members : Dr S.S. Abdool Karim, Director, CAPRISA, University of KwaZulu-Natal, Durban, South Africa Dr C. Adithan, Former Professor, Department of Pharmacology, Jawaharlal Institute of Postgraduate Medical Education & Research, Puducherry Dr M.J. Albert, Professor, Department of Microbiology, Faculty of Medicine, Kuwait University, Safat, Kuwait Dr Eesh Bhatia, Professor, Department of Endocrinology, Sanjay Gandhi Post Graduate Institute of Medical Sciences, Lucknow Dr K. Dheda, Professor of Respiratory Medicine, UCT Lung Institute, Department of Medicine, University of Cape Town, Cape Town, South Africa Dr S.K. Dwivedi, Professor, Department of Cardiology, King George’s Medical University, Lucknow Dr C. Dye, Director, Strategy, Policy & Information, Coordinator, Sustainable Development Goals, Office of The Director General, World Health Organization, Geneva, Switzerland Dr J.L. Excler, Senior Consultant, HIV Vaccine Clinical Development, US Military HIV Research Program, Walter Reed Army Institute of Research, Bethesda, MD, USA Dr N.K. Ganguly, Visiting Professor of Eminence, Translational Health Science and Technology Institute, Faridabad Dr Pramod K. Garg, Professor, Department of Gastroenterology and Human Nutrition, All India Institute of Medical Sciences, New Delhi Dr. S. E. Hasnain, Former Professor & Head, Institute of Molecular Medicine, Jamia Hamdard and Honorary Professor, Indian Institute of Technology, Delhi, New Delhi Dr T. Jacob John, 439, Civil Supplies Godown Lane, Kamalakshipuram, Vellore Dr V.M. Katoch, Former Secretary, DHR & Former Director-General, Indian Council of Medical Research, New Delhi Dr Ashok Kumar, Director Professor, Department of Obstetrics and Gynaecology, Maulana Azad Medical College, New Delhi Dr Lalit Kumar, Professor & Head, Department of Medical Oncology, Dr BRA-Institute Rotary Cancer Hospital (IRCH), All India Institute of Medical Sciences, New Delhi Dr Rajeev Kumar, Professor, Department of Urology, All India Institute of Medical Sciences, New Delhi Dr A. Malhotra, Professor of Medicine, Director of Sleep Medicine, UC San Diego School of Medicine, San Diego, USA Dr K.H. Mayer, Medical Research Director, Fenway Community Health, Fenway Institute, Boston, Massachusetts, USA Dr U.K. Misra, Professor, Department of Neurology, Sanjay Gandhi Post Graduate Institute of Medical Sciences, Lucknow Dr V. Mohan, President, Madras Diabetes Research Foundation, Chennai Dr Vimla V. Nadkarni, President, International Association of Schools of Social Work, Tata Institute of Social Sciences, Mumbai Dr G.B. Nair, Former Ag Regional Advisor, Research Policy & Cooperation Unit, Communicable Diseases Department, World Health Organization, New Delhi Lt. Gen (Dr) Velu Nair, Group Head, Medical Sciences & Senior Consultant, Hemato-Oncology and Bone Marrow Transplant, Comprehensive Blood and Cancer Center (CBCC), Apollo Hospitals International Ltd., Gandhinagar Dr Jagat Narula, Professor of Medicine, Associate Dean for Global Health, Mount Sinai School of Medicine, New York, USA Dr M. Pai, Director, McGill Global Health Programs, Associate Director, McGill International TB Centre, McGill University, Montreal, Canada Dr Prema Ramachandran, Director, Nutrition Foundation of India, New Delhi Dr B.S. Ramakrishna, Director, Institute of Gastroenterology, SRM Institutes for Medical Sciences, Chennai Dr Graham R. Serjeant, Professor, Department of Hematology, Sickle Cell Trust (Jamaica), Jamaica Dr S.K. Sharma, Former Professor & Head, Department of Medicine, All India Institute of Medical Sciences, New Delhi Dr Harpal Singh, Professor, Centre for Biomedical Engineering, Indian Institute of Technology, New Delhi Dr K.K. Talwar, Former Chairperson, Medical Council of India, New Delhi Dr Radhika Tandon, Professor of Ophthalmology, Dr. Rajendra Prasad Centre for Ophthalmic Sciences, All India Institute of Medical Sciences, New Delhi Contributors are welcome to submit their manuscripts online at http://www.journalonweb.com/ijmr Announcement The Indian Journal of Medical Research invites contributions in the section on “Clinical Images”. These are high quality image(s) of a clinical entity which is unique/rare along with a short and crisp write-up describing the condition and other information available, to be submitted by contributors from medical schools and other medical research institutions. Original, high quality (300 dpi resolution) images (JPEG or TIFF) will be considered for publication after peer evaluation. Contributors kindly note: 1. There should be a title page with a clear title of 6-8 words, name(s) of contributor(s) – (not >2), with highest academic degree and affiliation(s). 2. Also provide a corresponding address and e-mail. 3. The write up should be about 100-125 words. Specific Instructions: 1. Only two authors are allowed per clinical image, at least one of the authors should be a faculty associated with the department and hospital/institute where the case was first presented and diagnosed and followed up. 2. A duly signed patient’s consent form should be obtained by the authors (but not to be uploaded along with manuscript). In case the patient is deceased, the form should be signed by a family member or a close relative of the patient. The patient’s consent form should be as per the IJMR format (can be downloaded from our website). 3. The place (Department & Institute) and period of the study (month & year when the patient was first presented) should be incorporated within the first two lines of the text. 4. The treatment strategies employed should be briefly described with outcome. 5. Follow up details of the patient should be mentioned along with the duration of follow up and outcome. 6. Undertaking and copyright transfer forms should be submitted duly signed by both the authors. Instructions for Figures & Videos: 1. Should be unique and innovative with more than one techniques involved. 2. Figures should preferably be represented as different panels of a single image (not mandatory) 3. Only CT/MRI scans, ultrasound images, Echo-cardiographs and images of ultra-sonography, endoscopy, etc. will have low preference for consideration. 4. The above may be accompanied with some other images such as • Histopathology: fluorescent micrographs, unique kinds of staining, electron micrographs, confocal microscopy, etc. • Genetic characterization techniques such as karyotyping, FISH, etc. • Cases where surgical intervention is involved should be represented with before and after images of the area under focus. • Conditions with morphological abnormalities/ physical deformities may be depicted with relevant images of the same. 5. Videos (size not exceeding 1 MB) can be uploaded, preferably in MP4 or FLV format, not exceeding 30 seconds. The contributions can be submitted online at www.journalonweb.com/ijmr. Indian J Med Res 153, January & February 2021, pp 1-240

Special Issue - India & COVID-19 (Part-IV)

Guest Editors: Drs Rajesh Bhatia & Priya Abraham

Contents Pages

Editorial The quest continues for perfect COVID-19 vaccine Rajesh Bhatia ... 1 DOI: 10.4103/ijmr.IJMR_4165_20

Review Articles Cardiovascular manifestations of COVID-19: An evidence-based narrative review Yash Paul Sharma, Sourabh Agstam, Ashutosh Yadav, Anunay Gupta & Ankur Gupta ... 7 DOI: 10.4103/ijmr.IJMR_2450_20 An overview of preclinical animal models for SARS-CoV-2 pathogenicity Itti Munshi, Aditya Khandvilkar, Shrinivas M. Chavan, Geetanjali Sachdeva, Smita D. Mahale & Uddhav K. Chaudhari ... 17 DOI: 10.4103/ijmr.IJMR_3215_20 Emerging trends from COVID-19 research registered in the Clinical Trials Registry - India M. Vishnu Vardhana Rao, Atul Juneja, Mohua Maulik, Tulsi Adhikari, Saurabh Sharma, Jyotsna Gupta, Yashmin Panchal & Neha Yadav ... 26 DOI: 10.4103/ijmr.IJMR_2556_20 Use of convalescent plasma for COVID-19 in India: A review & practical guidelines Niranjan Shiwaji Khaire, Nishant Jindal, Lakshmi Narayana Yaddanapudi, Suchet Sachdev, Rekha Hans, Naresh Sachdeva, Mini P. Singh, Anup Agarwal, Aparna Mukherjee, Gunjan Kumar, Ratti Ram Sharma, Vikas Suri, Goverdhan Dutt Puri & Pankaj Malhotra ... 64 DOI: 10.4103/ijmr.IJMR_3092_20 Computed tomography chest in COVID-19: When & why? Mandeep Garg, Nidhi Prabhakar, Ashu Seith Bhalla, Aparna Irodi, Inderpaul Sehgal, Uma Debi, Vikas Suri, Ritesh Agarwal, Laxmi Narayana Yaddanapudi, Govardhan Dutt Puri & Manavjit Singh Sandhu ... 86 DOI: 10.4103/ijmr.IJMR_3669_20 (iv) Contents Pages

Systematic Review Comparison of the immunogenicity & protective efficacy of various SARS-CoV-2 vaccine candidates in non-human primates Labanya Mukhopadhyay, Pragya D. Yadav, Nivedita Gupta, Sreelekshmy Mohandas, Deepak Y. Patil, Anita Shete-Aich, Samiran Panda & Balram Bhargava ... 93 DOI: 10.4103/ijmr.IJMR_4431_20

Original Articles Demographic & clinical profile of patients with COVID-19 at a tertiary care hospital in north India Shiv Lal Soni, Kamal Kajal, L.N. Yaddanapudi, Pankaj Malhotra, Goverdhan Dutt Puri, Ashish Bhalla, Mini P. Singh, Inderpaul Singh Sehgal, Vipin Koushal, Neelam Varma, Manisha Biswal, P.V.M. Lakshmi, Sadhna Sharma, Vikas Suri, Z. Deepy, Sant Ram, Jaivinder Yadav, Navin Pandey, Prashant Sharma, Nabhajit Malik, Kapil Goyal, Aseem Mehra, Swapnajeet Sahoo, Ritin Mohindra, Jijo Francis, Mudit Bhargava, Karan Singla, Preena Babu, Amiy Verma, Niranjan Shiwaji Khaire & R.R. Guru ... 115 DOI: 10.4103/ijmr.IJMR_2311_20 Rapid chromatographic immunoassay-based evaluation of COVID-19: A cross-sectional, diagnostic test accuracy study & its implications for COVID-19 management in India Ankesh Gupta, Surbhi Khurana, Rojaleen Das, Deepankar Srigyan, Amit Singh, Ankit Mittal, Parul Singh, Manish Soneja, Arvind Kumar, Akhil Kant Singh, Kapil Dev Soni, Suneeta Meena, Richa Aggarwal, Neha Sharad, Anivita Aggarwal, Harshith Kadnur, Netto George, Komal Singh, Devashish Desai, Praveen Trilangi, Adil Rashid Khan, Vandana V. Kiro, Shivdas Naik, Bharthi Arunan, Shivam Goel, Diksha Patidar, Amit Lathwal, Lalit Dar, Anjan Trikha, Ravindra Mohan Pandey, Rajesh Malhotra, Randeep Guleria, Purva Mathur & Naveet Wig ... 126 DOI: 10.4103/ijmr.IJMR_3305_20 Drug repurposing for identification of potential inhibitors against SARS-CoV-2 spike receptor-binding domain: An in silico approach Santosh Kumar Behera, Namita Mahapatra, Chandra Sekhar Tripathy & Sanghamitra Pati ... 132 DOI: 10.4103/ijmr.IJMR_1132_20 Performance evaluation of Truenat™ Beta CoV & Truenat™ SARS-CoV-2 point-of-care assays for coronavirus disease 2019 Shantala Gowdara Basawarajappa, Ambica Rangaiah, Shashiraja Padukone, Pragya D. Yadav, Nivedita Gupta & Sathyanarayan Muthur Shankar ... 144 DOI: 10.4103/ijmr.IJMR_2363_20 Chloroquine nasal drops in asymptomatic & mild COVID-19: An exploratory randomized clinical trial Alok Thakar, Smriti Panda, Pirabu Sakthivel, Megha Brijwal, Shivram Dhakad, Avinash Choudekar, Anupam Kanodia, Sushma Bhatnagar, Anant Mohan, Subir K. Maulik & Lalit Dar ... 151 DOI: 10.4103/ijmr.IJMR_3665_20 (v) Contents Pages

SARS-CoV-2 detection in sewage samples: Standardization of method & preliminary observations Deepa Kailash Sharma, Uma Prajwal Nalavade, Kamlesh Kalgutkar, Nivedita Gupta & Jagadish Mohanrao Deshpande ... 159 DOI: 10.4103/ijmr.IJMR_3541_20 Phylogenetic classification of the whole-genome sequences of SARS-CoV-2 from India & evolutionary trends Varsha Potdar, Veena Vipat, Ashwini Ramdasi, Santosh Jadhav, Jayashri Pawar-Patil, Atul Walimbe, Sucheta S. Patil, Manohar L. Choudhury, Jayanthi Shastri, Sachee Agrawal, Shailesh Pawar, Kavita Lole, Priya Abraham, Sarah Cherian & ICMR-NIV NIC Team ... 166 DOI: 10.4103/ijmr.IJMR_3418_20 Modelling the spread of SARS-CoV-2 pandemic - Impact of lockdowns & interventions Manindra Agrawal, Madhuri Kanitkar & M. Vidyasagar ... 175 DOI: 10.4103/ijmr.IJMR_4051_20

Correspondences Prediction of potential small interfering RNA molecules for silencing of the spike gene of SARS-CoV-2 Kingshuk Panda, Kalichamy Alagarasu, Sarah S. Cherian & Deepti Parashar ... 182 DOI: 10.4103/ijmr.IJMR_2855_20 SARS-CoV-2 & influenza A virus co-infection in an elderly patient with pneumonia Ashok Munivenkatappa, Pragya D. Yadav, K. Swetha, Manjunatha Jayaswamy, Dimpal A. Nyayanit, Rima Rakeshkumar Sahay & T. J. Basavaraj ... 190 DOI: 10.4103/ijmr.IJMR_2711_20 Inactivation of SARS-CoV-2 by gamma irradiation Rajlaxmi Jain, Prasad Sarkale, Deepak Mali, Anita M. Shete, Deepak Y. Patil, Triparna Majumdar, Annasaheb Suryawanshi, Savita Patil, Sreelekshmy Mohandas & Pragya D. Yadav ... 196 DOI: 10.4103/ijmr.IJMR_2789_20 Impact of the COVID-19 pandemic on clinical ophthalmology Bharat Gurnani & Kirandeep Kaur ... 199 DOI: 10.4103/ijmr.IJMR_3883_20

Authors’ response Parul Chawla Gupta, Praveen Kumar M & Jagat Ram ... 200 DOI: 10.4103/0971-5916.307214 Modelling the spread of SARS-CoV-2 pandemic - Is this even close to a supermodel? Somdatta Sinha ... 201 DOI: 10.4103/ijmr.IJMR_4525_20 (vi) Contents Pages

Authors’ response Manindra Agrawal, Madhuri Kanitkar & M. Vidyasagar ... 204 DOI: 10.4103/0971-5916.307699 Section: Policy, Programme & Practice Policy Seroprevalence of antibodies to SARS-CoV-2 in healthcare workers & implications of infection control practice in India Ritu Gupta, Tanima Dwivedi, Smeeta Gajendra, Biswajeet Sahoo, Sanjeev Kumar Gupta, H. Vikas, Angel Rajan Singh, Anant Mohan, Sushma Bhatnagar, Sheetal Singh, Laxmitej Wundavalli & Randeep Guleria ... 207 DOI: 10.4103/ijmr.IJMR_3911_20

Programme COVID-19 & HIV/AIDS pandemics: Parallels & lessons Natasha Dawa & Jai Prakash Narain ... 214 DOI: 10.4103/ijmr.IJMR_2598_20 Safety of hydroxychloroquine in healthcare workers for COVID-19 prophylaxis Atiya R. Faruqui, Denis Xavier, Sandhya K. Kamat, Sujith J. Chandy, Bikash Medhi, Raakhi K. Tripathi, Yashashri C. Shetty, John Michael Raj, Sandeep Kaushal, S. Balakrishnan, Shubham Atal, Santanu K. Tripathi, Dinesh K. Badyal, Harihar Dikshit, Sukalyan Saha Roy, Niyati Trivedi, Suparna Chatterjee, Chetna Desai, C.D. Tripathi, Nirmala N. Rege, Pooja Gupta, R. Raveendran, Rajni Kaul & Nilima A. Kshirsagar ... 219 DOI: 10.4103/ijmr.IJMR_2294_20 Feasibility, efficiency & effectiveness of pooled sample testing strategy (pooled NAAT) for molecular testing of COVID-19 Shantanu Prakash, Om Prakash, Hricha Mishra, Danish N. Khan, Suruchi Shukla, Ajay Pandey, Kiran Rade, Nivedita Gupta, M.L.B. Bhatt & Amita Jain ... 227 DOI: 10.4103/ijmr.IJMR_2333_20

Practice Face mask - An essential armour in the fight of India against COVID-19 Samiran Panda, Harkiran Kaur, Lalit Dandona & Balram Bhargava ... 233 DOI: 10.4103/ijmr.IJMR_4486_20 Focussing on ‘mental hygiene’ along with ‘hand hygiene’ in the times of COVID-19 Mahadev Singh Sen, Nishtha Chawla & Rajesh Sagar ... 238 DOI: 10.4103/ijmr.IJMR_2960_20 Guidelines for Contributors ... vii Indian J Med Res 153, January & February 2021, pp 1-6 Quick Response Code: DOI: 10.4103/ijmr.IJMR_4165_20

Editorial

The quest continues for perfect COVID-19 vaccine

Eradication of smallpox, near elimination of folding during the vaccine production and storage poliomyelitis and neonatal tetanus and substantial before deployment5,6. The neutralizing antibodies to be reduction in impact of measles are ranked amongst generated by natural infection or through vaccination the greatest achievements of humankind ever. These act against the receptor-binding protein component triumphs are the outcomes of the availability and that binds onto angiotensin-converting enzyme 2 and concerted use of potent, safe and affordable specific obstructs the entry of the virus into the cell. Initial vaccines. In addition, protecting against 20 infectious evidence that only receptor-binding protein should be diseases, the vaccines prevent 2-3 million deaths incorporated in the vaccine is being revisited with the annually1. knowledge that there are several areas outside receptor binding domain (RBD) that can be the potential targets Apart from natural infections, vaccines are for neutralizing antibody7. considered as the safest and cost-effective intervention to induce protection against COVID-19. Will the Neutralizing antibodies are likely to produce vaccines currently undergoing clinical trials be able to vaccine-induced protection. However, as with some achieve this critical milestone is not evident as of today. other coronaviruses, the immune response may have The entire world is looking forward to COVID-19 short-lasting immunity not exceeding one year8. In vaccine to bring a rapid end to the pandemic. The most instances, vaccines inducing T-cell response unprecedented global quest for COVID-19 vaccine confer protection. T-cell-mediated immune responses is aimed at achieving what other public health through CD4+ and CD8+ provide broad and long- interventions have not been able to accomplish till date term protection against coronavirus infections. CD4+ to vanquish the pandemic. Vaccine is being touted as T-cells activate B-cells which lead to the production of the most potent weapon to induce immunity - adequate virus-specific antibody. CD8+ T-cells being cytotoxic, in its immunogenicity and safety to cut short the virus kill cells that have been invaded by the virus. In patients transmission. The vaccine is primarily aimed to protect with COVID-19, T cytopenia has been observed in 9-11 individuals and creating a pool of immune people that circulating CD4+ and CD8+ T-cells . SARS-CoV-2- comprises 60-70 per cent of entire population2,3, thus specific T-cells have been found in asymptomatic inducing herd immunity. individuals or those with mild symptoms. Patients suffering from COVID-19 had fewer T-cells than Immunology and selection of antigen for healthy controls12. COVID-19 vaccine Vaccine platforms SARS-CoV-2 is a novel virus. The viral determinants that need to be attacked to confer immunity remain Perhaps never in the history of combating infectious diseases, so many vaccine candidates undefined. While there are favourable precedents from were in varying stages of development as are for other respiratory viruses including coronaviruses4, the COVID-19 pandemic. Several new and diverse there are apprehensions that vaccination may mimic technology platforms are in use to expedite vaccine rapidly declining natural immunity to SARS-CoV-2. development13. In its description of the global The antigen of choice for COVID-19 vaccine landscape of COVID-19 vaccines, the WHO reports has been the SARS-CoV-2 spike protein, a type 1 over 163 vaccines in pre-clinical evaluation and 52 in protein that is metastable and should have correct clinical evaluation as of December 2, 202014. Broadly,

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 1 2 INDIAN J MED RES, January & February 2021 these vaccines can be categorized into five main types. are currently engaged in clinical trials on nucleic acid These include: replicating and non-replicating viral vaccines20. vector-based vaccines, whole virus-based (inactivated Recombinant protein vaccines have a targeted or attenuated), nucleic acid-based (DNA and RNA), approach towards a key antigen but warrant correct recombinant protein, peptide-based vaccines and virus- conformation of the protein15. The University of Oxford, like particles15,16 (Table I ). in collaboration with private sector, has developed a Live attenuated vaccines closely resemble chimpanzee adenovirus vaccine vector expressing the natural infection but have the potential of reverting wild type S protein (ChAdOx1 nCoV-19, also known to pathogenicity and causing disease among young as AZD1222)21. Clinical trial on this vaccine is ongoing and immunocompromised individuals17. Currently, no at multiple sites including in India. COVID-19 live attenuated vaccine is in clinical trial phase. Only one adenoviral vector-based vaccine has been approved by the Russian regulatory authorities22. Inactivated vaccines have proven efficacy for Yet, global community awaits data from Phase 3 several diseases and their productions can be easily clinical trial to assure itself of the safety and efficacy scaled up. The modern vaccine manufacturing units of the Russian vaccine. Phase 3 clinical trial of Russian provide appropriate biosafe environment for bulk vaccine (Sputnik V) in India is under the approval production of inactivated vaccine. One of the Indian process of the national regulatory authority23. Vaccine manufacturers (Bharat Biotech in collaboration with developed and manufactured by Pfizer has been the ICMR-National Institute of Virology) is currently licensed for use in the United Kingdom, United States moving forward with clinical trial for this category of of America, Canada and Bahrain24. vaccine18. Potential risks associated with vaccines Nucleic acid (DNA or RNA) vaccines have low cost of production in large volumes. Once taken up An undetermined risk of COVID-19 vaccine by the cells, these vaccines express the antigens that causing disease enhancement or an acute autoimmune have been encoded in the nucleic acid. Currently, more disease through a T-cell-mediated damage or adverse than 10 platforms are being used to develop nucleic effect due to antibody is yet to be explored. Vaccines acid vaccines. Successful outcome shall herald a new for many other diseases including influenza and era in vaccine technology, especially in pandemics measles have been associated with such unwanted when vaccines need to be designed, developed and damaging events25. Such events may be detected and disseminated swiftly15,19. Many leading global through post-marketing surveillance of COVID-19 (Moderna Inc.) and Indian companies (Zydus Cadila) vaccine. It is essential to generate reliable data on

Table I. Overview of soon‑to‑be‑available COVID‑19 vaccines Platform Manufacturer/Supplier Route of administration Doses Cold chain requirement (oC) Inactivated Bharat Biotech (Whole virion) IM 2 2‑8 Sinovac Viral vector Oxford/Astra Zeneca/SII IM 2 2‑8 Adenovirus Gamaleya Research Institute/ Dr Reddy’s Laboratory, India Protein Subunit Novavax IM 2 2‑8 (recombinant) GSK/Sanofi Biological E, India mRNA Moderna IM 2 ‑20 Pfizer at 2‑8 × 30 days ‑70 at 2‑8 × 5 days Live attenuated virus Codagenix/SII Inhalation 1, 2 2‑8 DNA Zydus Cadilla, India Intradermal 2‑8 IM, intramuscular; SII, serum Institute of India. Source: Ref. 24 BHATIA: COVID-19 VACCINE 3 long-term safety of vaccines to inspire confidence in Accelerator. It comprises the Bill and Melinda communities and their acceptance of vaccines. Gates Foundation, CEPI, Foundation for Innovative Diagnostics (FIND), GAVI Alliance. The Global Fund, Repurposed vaccines for COVID-19 Unitaid, Wellcome Trust, the WHO and the World In the absence of the specific immunizing agent, Bank37. Within the ACT Accelerator is a vaccine pillar several other vaccines have been under investigation (COVAX) which is co-led by Gavi Alliance, CEPI, with the hypothesis that these vaccines may modify WHO and many other partners. This COVAX Facility the response of the immune system of vaccines and has been set up to work with countries and vaccine enhance cytokine production to provide protection manufacturers to develop, manufacture and ensure against COVID-19. These include BCG26, oral polio access to vaccine. The Facility provides governments vaccine (OPV)27 and MMR (measles, mumps, and with the opportunity to have access to and benefit rubella)28. For BCG vaccine alone, three multicentric from a large portfolio of COVID-19 vaccines. randomized controlled trials are ongoing in three The goal of COVAX is to mobilize and deliver by different countries29. A measles vaccine trial to evaluate 2021 at least two billion doses of quality-approved its protection against COVID-19 is underway in vaccines38. Negotiations with vaccine manufacturers Egypt30, and the USA is assessing the efficacy of OPV for bulk purchase shall result in an affordable cost. It is against SARS-CoV-231. proposed to distribute these vaccines for priority use by the high-risk populations (viz. healthcare and frontline Production and deployment of vaccine workers), followed by for vaccinating up to 20 per cent The world is estimated to need around 16 billion of population as per national priority. Additional doses, doses of vaccine in immediate future. It is a huge if available, shall be made accessible to countries based challenge to meet this global requirement in a short on their needs and disease epidemiology39. period. Fortunately, many national and intercountry agencies are providing substantial financial and Challenges technical support to vaccine manufacturers to build Development of and access to a vaccine against up their capacity. Development of vaccines is an COVID-19 shall be a remarkable milestone but not the expensive proposition. A dengue vaccine had cost panacea to eliminate or contain the pandemic in short around US$ 1.5 billion32. Cost of investment in vaccine period. Challenges are numerous (Table II). These is miniscule as compared to the losses caused by the are financial, technical, logistical, social and strength pandemic. of existing health system in developing countries to address the issue of universal mass vaccination, Many countries and organizations are supporting especially with limited experience in managing timely development and production of adequate vaccination of adult population. Health authorities will quantities of vaccines and their access across the have to decide that with initially limited availability world. The Coalition for Epidemic Preparedness of vaccine which category of people becomes priority Innovations (CEPI) is supporting nine COVID-19 population on the basis of risk assessment. They will vaccine candidates33. Operation Warp Speed in the have to consider the social and political ramifications USA34 is supporting six candidate vaccines. Great of such decisions. Britain has allocated £250 million for development of a COVID-19 vaccine and also established a vaccine Logistics shall be a key consideration with all its task force35 to support national development, discovery complexities in reaching out to the entire population and approval of vaccines. GAVI (Global Alliance for through an efficient deployment of the vaccine with a Vaccines and Immunization) alliance and Bill and functional cold chain from production-to-vaccination Melinda Gates Foundation have provided US$ 300 journey. million to Serum Institute of India for producing 200 The clinical trials are conducted in defined adult million doses of COVID-19 vaccine, half of which populations. The vulnerable populations are excluded have been earmarked for the low- and the middle- from these. Since COVID-19 immunization is targeted for income countries36. entire global population, it shall require prior evidence of To facilitate and improve global access to efficacy and safety in several subpopulations, especially COVID-19 vaccines, the WHO has hosted a global the elderly, pregnant women, children below 18 yr of age collaboration – Access to COVID-19 Tools (ACT) and those who are immunocompromised or living with 4 INDIAN J MED RES, January & February 2021

Table II: Challenges in vaccination against COVID‑19 Category Challenge Political Prioritization of vulnerable populations. Selection of vaccine based upon efficacy and cost. Timely procurement of vaccine and ethical distribution. Programme Augmenting health system to reach out to target population. management Making available sufficient and functional cold chain up to last mile. Technical Monitoring efficacy, persistence of protection and safety in community and launching Phase 4 safety surveillance. Operational Timely procurement and efficient distribution. Managing cold chain. Enhancing capacity for efficient response. Data management. Community engagement including response to adverse reactions. Epidemiological Monitoring progress of pandemic and adjusting vaccination plans. Research Response to availability of second generation of better vaccines. Financial Mobilization of financial resources from within the country or through international development partners. Source: Ref. 39 co-morbidities. Role of vaccine in protecting the developing countries. While an affordable vaccine is elderly with or without co-morbidities (>60 yr of the need of the hour, high production and administration age) and inducing immunity in children in whom cost should force countries to innovate, prioritize this coronavirus has the potential to cause paediatric and think out of the box to make the best use of this inflammatory multisystem syndrome needs to be intervention with the sole objective to immediately explored on priority through the generation of eliminate the pandemic. unequivocal scientific evidence39. Will the national and international regulatory bodies consider the impact Earliest availability of COVID-19 vaccine is of vaccines on these subpopulations which have not projected to be late 2020 to mid-2021. However, it may been evaluated in clinical trials or the licensure shall take several months before global demand as well as be restricted to adult and healthy population only or a safety, immunogenicity and efficacy criteria are fully universal immunization will be permitted, shall be a met. This emphasizes the need for strong advocacy challenge for the regulatory bodies. and sustained implementation of proven public health preventive strategies including wearing masks, Basic technical issues that require unequivocal maintaining adequate social distance and isolation of evidence-based responses include definition of the ideal infectious individuals leading to swift containment of protection, type and duration of immunity to reduce outbreaks16. the disease, associated risk of disease potentiation and superiority of vaccination over the natural infection. Conflicts of Interest: None. The scientific community needs to accelerate efforts to produce evidence-based solutions for these issues. Rajesh Bhatia Former Director, Communicable Diseases, Conclusions World Health Organization South-East Asia Unprecedented and globally coordinated research Regional Office, New Delhi 110 002, India and efforts are likely to result in availability of some, [email protected] if not several, vaccines against COVID-19 in the next few months. The challenge would be to ensure their Received October 8, 2020 optimal and cost-effective use. Despite support from international community, References the cost of procurement of vaccine and its deployment 1. World Health Organization. COVID-19 vaccines. Available for every citizen may be exorbitant for most of the from: https://www.who.int/emergencies/diseases/novel- BHATIA: COVID-19 VACCINE 5

coronavirus-2019/covid-19-vaccines, accessed on September Respiratory Syndrome-coronavirus. Front Microbiol 2019; 27, 2020. 10 : 1781. 2. Randolph HE, Barreiro LB. Herd immunity: Understanding 18. Indian Council of Medical Research. COVID-19. Available COVID-19. Immunity 2020; 52 : 737-41. from: https://vaccine.icmr.org.in/covid-19-virus, accessed on 3. Kwok KO, Lai F, Wei WI, Wong SY, Tang JW. Herd immunity October 3, 2020. - estimating the level required to halt the COVID-19 epidemics 19. Tregoning JS, Kinnear E. Using plasmids as DNA vaccines for in affected countries. J Infect 2020; 80 : e32-3. infectious diseases. Microbiol Spectrum 2014; 2 : PLAS0028- 4. Sariol A, Perlman S. Lessons for COVID-19 immunity from 2014. other coronavirus infections. Immunity 2020; 53 : 248-63. 20. COVID-19 vaccine tracker. Available from: https://www.raps. 5. Zheng M, Song L. Novel antibody epitopes dominate the org/news-and-articles/news-articles/2020/3/covid-19-vaccine- tracker, accessed on December 12, 2020. antigenicity of spike glycoprotein in SARS-CoV-2 compared to SARS-CoV. Cell Mol Immunol 2020; 17 : 536-8. 21. Graham SP, McLean RK, Spencer AJ, Belij-Rammerstorfer S, Wright D, Ulaszewska M, et al. Evaluation of the 6. Walls AC, Young JP, Tortorici MA, Wall A, McGuire AT, immunogenicity of prime-boost vaccination with the Veesler D. Structure, function, and antigenicity of the SARS- replication-deficient viral vectored COVID-19 vaccine CoV-2 spike glycoprotein. Cell 2020; 181 : 281-92. candidate ChAdOx1 nCoV-19. NPJ Vaccines 2020; 5 : 69. 7. Seydoux E, Homad LJ, MacCamy AJ, Parks KR, Hurlburt NK, 22. Sputnik V. Vaccine. General information. Available from: Jennewein MF, et al. Analysis of a SARS-CoV-2-infected https://sputnikvaccine.com/about-vaccine/, accessed on individual reveals development of potent neutralizing September 7, 2020. antibodies with limited somatic mutation. Immunity 2020; 53 : 98-105.e5. 23. Russian Direct Investment Fund. RD’F and Dr. Reddy’s to cooperate on clinical trials and supply of 100 million doses 8. Seow J, Graham C, Merrick B, Acors S, Steel KJ, of sputnik V vaccine to India. Available from: https://www. Hemmings O, et al. Longitudinal evaluation and decline of drreddys.com/media/904781/sputnikv-india_dr-reddys.pdf, antibody responses in SARS-CoV-2 infection. medRxiv 2020; accessed on October 3, 2020. doi: 10.1101/2020.07.09.20148429. 24. Pfizer BioNTech. Pfizer and BioNTech celebrate historic first 9. Janice Oh HL, Ken-En Gan S, Bertoletti A, Tan YJ. authorization in the U>S> of vaccine to prevent COVID-19. Understanding the T cell immune response in SARS Available from: https://www.pfizer.com/news/press-release/ coronavirus infection. Emerg Microbes Infect 2012; 1 : e23. press-release-detail/pfizer-and-biontech-celebrate-historic- 10. Zheng HY, Zhang M, Yang CX, Zhang N, Wang XC, first-authorization, accessed on December 10, 2020. Yang XP, et al. Elevated exhaustion levels and reduced 25. Schonberger LB, Bregman DJ, Sullivan-Bolyai JZ, functional diversity of T cells in peripheral blood may predict Keenlyside RA, Ziegler DW, Retailliau HF, et al. Guillain- severe progression in COVID-19 patients. Cell Mol Immunol Barre syndrome following vaccination in the National 2020; 17 : 541-3. Influenza Immunization Program, United States, 1976-1977. 11. Chen Z, John Wherry E. T cell responses in patients with Am J Epidemiol 1979; 110 : 105-23. COVID-19. Nat Rev Immunol 2020; 20 : 529-36. 26. O’Neill LA, Netea MG. BCG-induced trained immunity: Can 12. Tan M, Liu Y, Zhou R, Deng X, Li F, Liang K, et al. it offer protection against COVID-19? Nat Rev Immunol 2020; Immunopathological characteristics of coronavirus disease 20 : 335-7. 2019 cases in Guangzhou, China. Immunology 2020; 160 : 27. Chumakov K, Benn CS, Aaby P, Kottilil S, Gallo R. Can 261-8. existing live vaccines prevent COVID-19? Science 2020; 13. Rauch S, Jasny E, Schmidt KE, Petsch B. New vaccine 368 : 1187-8. technologies to combat outbreak situations. Front Immunol 28. Fidel PL Jr., Noverr MC. Could an unrelated live attenuated 2018; 9 : 1963. vaccine serve as a preventive measure to dampen septic 14. World Health Organization. Draft landscape of COVID-19 inflammation associated with COVID-19 infection? mBio candidate vaccines. Available from: https://www.who.int/ 2020; 11 : e00907-20. publications/m/item/draft-landscape-of-COVID-19-candidate- 29. Curtis N, Sparrow A, Ghebreyesus TA, Netea MG. Considering vaccines, accessed on December 2, 2020. BCG vaccination to reduce the impact of COVID-19. Lancet 15. Tregoning JS, Brown ES, Cheeseman HM, Flight KE, 2020; 395 : 1545-6. Higham SL, Lemm NM, et al., Vaccines for COVID-19. Clin 30. ClinicalTrials.gov. Identifier: NCT04357028. Measles Exp Immunol 2020; 202 : 162-192 Vaccine in HCW (MVCOVID19); 2020. Available from: 16. Bhatia R, Abraham P. The enigmatic COVID-19 pandemic. https://clinicaltrials.gov/ct2/show/NCT04357028, accessed Indian J Med Res 2020; 152 : 1-5. on October 7, 2020. 17. Yong CY, Ong HK, Yeap SK, Ho KL, Tan WS. Recent 31. Global Polio Eradication Initiative. The use of oral polio advances in the vaccine development against Middle East vaccine (OPV) to prevent SARS-CoV2. Available from: 6 INDIAN J MED RES, January & February 2021

http://polioeradication.org/wp-content/uploads/2020/03/ news/government-launches-vaccine-taskforce-to-combat- Use-of-OPV-and-COVID-20200421, accessed on October 2, coronavirus, accessed on October 3, 2020. 2020. 36. Serum Institute of India Pvt. Ltd. Serum Institute of India to 32. Thomas SJ, Yoon IK. A review of Dengvaxia®: Development produce up to an additional 100 million COVID-19 vaccine to deployment. Hum Vaccin Immunother 2019; 15 : 2295-314. doses for India and low-and middle-inocme countries in 2021. 33. Coalition for Epidemic Preparedness Innovations. CEPI Available from: https://www.seruminstitute.com/news_sii_ establishes global network of laboratories to centralize gavi_bmgf.php, accessed on October 3, 2020. assessment of COVID-19 vaccine candidates. Available 37. World Health Organization. The access to COVID-19 from: https://cepi.net/news_cepi/cepi-establishes-global- tools CACT accelerator. Available from: https://www. network-of-laboratories-to-centralise-assessment-of-covid- who.int/initiatives/act-accelerator, accessed on October 19-vaccine-candidates/, accessed on October 3, 2020. 4, 2020. 34. US Department of Health and Human Services. Fact Sheet, 38. GAVI, The Vaccine Alliance. COVAX explained. Available explaining Operation Warp Speed. Available from: https:// from: https://www.gavi.org/vaccineswork/covax-explained, www.hhs.gov/coronavirus/explaining-operation-warp-speed/ accessed on October 4, 2020. index.html, accessed on October 4, 2020. 39. Koirala A, Joo YJ, Khatami A, Chiu C, Britton PN. Vaccines 35. Govt. UK. Government launches vaccine Taskforce to combat for COVID-19: The current state of play. Paediatr Respir Rev coronavirus. Available from: https://www.gov.uk/government/ 2020; 35 : 43-9. Quick Response Code: Review Article

Indian J Med Res 153, January & February 2021, pp 7-16 DOI: 10.4103/ijmr.IJMR_2450_20

Cardiovascular manifestations of COVID-19: An evidence-based narrative review

Yash Paul Sharma1, Sourabh Agstam2, Ashutosh Yadav3, Anunay Gupta2 & Ankur Gupta1

1Department of Cardiology, Advanced Cardiac Centre, Postgraduate Institute of Medical Education & Research, Chandigarh, 2Department of Cardiology, Vardhman Mahavir Medical College & Safdarjung Hospital, New Delhi & 3Department of Cardiology, Fortis Hospital, Mohali, Sahibzada Ajit Singh Nagar, Punjab, India

Received June 8, 2020

The recent outbreak of coronavirus disease 2019 (COVID-19) was declared a pandemic by the World Health Organization on March 11, 2020. Severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2), the causative agent of COVID-19, primarily involves the respiratory system with viral pneumonia as a predominant manifestation. In addition, SARS-CoV-2 has various cardiovascular manifestations which increase morbidity and mortality in COVID-19. Patients with underlying cardiovascular diseases and conventional cardiovascular risk factors are predisposed for COVID-19 with worse prognosis. The possible mechanisms of cardiovascular injury are endothelial dysfunction, diffuse microangiopathy with thrombosis and increased angiotensin II levels. Hyperinflammation in the myocardium can result in acute coronary syndrome, myocarditis, heart failure, cardiac arrhythmias and sudden death. The high level of cardiac troponins and natriuretic peptides in the early course of COVID-19 reflects an acute myocardial injury. The complex association between COVID-19 and cardiovascular manifestations requires an in-depth understanding for appropriate management of these patients. Till the time a specific antiviral drug is available for COVID-19, treatment remains symptomatic. This review provides information on the cardiovascular risk factors and cardiovascular manifestations of COVID-19.

Key words ACE inhibitors/angiotensin receptor blockers - ACE-2 - coronavirus disease 2019 - cytokine storm - endothelial dysfunction - heart failure - MERS - myocarditis - SARS-CoV-2

The World Health Organization declared (MERS-CoV), has infected 60,074,174 people and coronavirus disease 2019 (COVID-19), a pandemic killed 1,416,292 people globally till November 26, on March 11, 2020. The emergence of severe acute 20204. In India, SARS-CoV-2 has infected 9,256,223 respiratory syndrome coronavirus 2 (SARS-CoV-2) people and killed 136,696 people till November 29, infection, which causes COVID-19, was first detected in 20205. Although SARS-CoV-2 infects people of all age Wuhan, China, on December 12, 20191-3. SARS-CoV-2, groups, elderly people with underlying cardiovascular the seventh member of the family of human-infecting diseases and those with conventional cardiovascular coronaviruses, which includes SARS-CoV-1 and risk factors including male sex, diabetes, obesity and Middle East respiratory syndrome coronavirus hypertension are particularly vulnerable with high

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 7 8 INDIAN J MED RES, January & February 2021 morbidity and mortality6,7. Furthermore, patients (transmembrane protease serine 2) aids the ACE2 may have varied cardiovascular manifestations either receptor for internalization of the virus17,18. After upfront or after the resolution of symptoms of upper internalization inside the cell, SARS-CoV-2 duplicates, respiratory tract infection. Multiple case studies have proliferates and downregulates ACE2. ACE2 acts like noted acute coronary syndrome (ACS)8, myocarditis9, the gatekeeper of the renin-angiotensin-aldosterone cardiac arrhythmias10 and out-of-hospital cardiac arrest system (RAAS) pathway, catalyzes angiotensin II as terminal events in patients with COVID-1911. This to angiotensin 1-7, and has vasodilatory action in review was aimed to provide updated information on the circulatory system. The low levels of circulating the manifestations of COVID-19. ACE2 in COVID-19 perpetuate the RAAS pathway. ACE2 receptors are also present over the lymphocytes/ Epidemiology of SARS-CoV-2 dendritic cells, gastrointestinal tract, liver, kidney, SARS-CoV-2 is the seventh coronavirus known neurons and myocardium. High angiotensin II to infect humans; SARS-CoV-1, MERS-CoV and levels in the circulatory system cause inflammation, SARS-CoV-2 can cause severe disease, whereas the vasoconstriction, myocardial injury and thrombosis17-19 remaining four coronaviruses, that is HKU1, NL63, (Fig. 1). OC43 and 229E, are usually associated with mild COVID-19 and cardiovascular risk factors symptoms and account for around 15-30 per cent cases of common cold12,13. Similar to SARS-CoV-1, Multiple case series and retrospective studies bats likely served as reservoir hosts for SARS-CoV-2, have confirmed the association of cardiovascular and pangolins as the intermediate host, although this risk factors with COVID-19 mortality. Initial large is not confirmed14. The early transmission data from studies were from China and later Italy and the USA Wuhan, China, showed that the median age of patients added to it, confirming the association of COVID-19 was 59 yr and mean incubation period was 5.2 days. mortality with cardiovascular risk factors. In a recent The initial doubling time was 7.4 days; the basic series of 5700 patients of COVID-19 in the New reproductive rate was estimated to be 2.215. York City, USA, the most common cardiovascular disease was hypertension in 56.6 per cent of patients, SARS-CoV and MERS-CoV coronary artery disease (CAD) in 11.1 per cent of The angiotensin-converting enzyme 2 (ACE2) is patients, congestive heart failure in 6.9 per cent, the receptor for both SARS-CoV-1 and SARS-Cov-212. obesity in 41.7 per cent of patients and diabetes in 20 Aerosol and surface stability is similar for both16. 33.8 percent of patients . An initial larger study from The SARS-CoV-2 shares 80 per cent sequence China analyzed the demographic profile of 44,672 homology with SARS-CoV-117. The incubation confirmed cases of COVID-19 and showed that 4.2 period for all the three coronaviruses is around 2-12 per cent patients had cardiovascular diseases, 12.8 per days. Person-to-person transmission is assessed cent had hypertension and 5.3 per cent diabetes. The by the basic reproduction number (R ). The R for limitation of this study was that it was not age adjusted 0 0 and missing data on comorbid conditions in 53 per cent SARS-CoV-1 was 3; for MERS-CoV, R0 was 2-5 and 21 for SARS-CoV-2, it was 2-312. It means that one patient of cases . In other two small single-centre studies on COVID-19, the cardiovascular disease was present in of COVID-19 can spread infection to 2-3 susceptible 14,22 persons. 15 and 14.5 per cent of patients . The study of 144 patients with COVID-19 from India reported diabetes Relationship of SARS-CoV-2 and angiotensin- mellitus in 11.1 per cent, hypertension in 2.1 per cent converting enzyme 2 (ACE2) receptor and CAD in 0.7 per cent patients23. The spectrum SARS-CoV-1 enters into the cell with the help of of cardiovascular manifestations of COVID-19 is viral surface protein S (spike), which facilitates the highly variable from asymptomatic myocardial injury first step in the virus replication cycle into the target to out-of-hospital cardiac arrest. In the COVID-19 pandemic, the cumulative incidence of out-of-hospital cells. The S protein has two subunits - S1 and S2. The 11 S1 subunit engages with membrane-bound cellular cardiac arrest has increased significantly in Italy . receptor carboxypeptidase ACE2 present over the The cardiovascular manifestations of cell membrane of lung epithelial cells (pulmonary SARS-CoV-1 can be attributed either to direct viral alveolar type II cells), and the S2 subunit stalk injury or to an immunological response to the virus, mediates fusion to the infected cell3,18. TMPRESS2 as we see in myocarditis24,25 (Fig. 2). Direct invasion SHARMA et al: COVID-19 & CARDIOVASCULAR MANIFESTATIONS 9

Fig. 1. Pathogenesis of SARS-CoV-2 in COVID-19.The S1 subunit of spike S protein on the virus surface engages with membrane-bound cellular receptor carboxypeptidase ACE2 present over the cell membrane of lung epithelial cells (pulmonary alveolar type II cells), and S2 subunit stalk helps in cell fusion. TMPRSS2 protease aids in the attachment of ACE2 with virus S protein. After entry inside the cell, the virus replicates and destroys ACE2. The decrease in ACE2 (transmembranous and circulatory) perpetuates the RAAS pathway. Increase in angiotensin II levels in COVID-19 causes widespread injury by activation of ATR1 receptors. Activation of ATR1 causes vasoconstriction, inflammation, endothelial dysfunction, acute lung injury and myocardial injury. The physiological function of ACE2 is to degrade angiotensin II to angiotensin 1-7, and angiotensin I to angiotensin 1-9. Angiotensin 1-7 acts on MasR receptors on cell membranes, and has vasodilatory and antifibrotic effects. Black arrows represent upregulation and red arrows represent downregulation in COVID-19. ACE2, angiotensin-converting enzyme 2; ATR1, angiotensin II receptor 1; cACE2, circulatory angiotensin-converting enzyme 2; MasR, mitochondrial assembly receptor; RAAS, rennin-angiotensin-aldosterone system; TMPRSS2, transmembrane protease serine 2. Source: Refs 17-19.

Fig. 2. The proposed mechanism of cardiovascular manifestations of COVID-19. Hyperinflammatory state secondary to cytokine storm, increased angiotensin II, low ACE2 levels and APLA contribute to thrombus formation in coronary and pulmonary vasculature. APLA, antiphospholipid antibodies; IL, interleukin; IFN-γ, interferon-gamma; MCP, monocyte chemoattractant protein; TNF-α, tumour necrosis factor-alpha. Source: Refs 24, 25. 10 INDIAN J MED RES, January & February 2021 of the heart by the virus has been found in sporadic among 28 patients with STEMI, 17 (60.7%) had autopsy studies in SARS-CoV-1, and in a few cases critical disease and 11 (39.3%) had non-obstructive of SARS-CoV-226-28. The pathological specimen CAD. Delayed presentation of ACS has been of COVID-19 patients revealed microvascular reported worldwide, and it has been perceived that inflammation and thrombosis. Localized macrophage some patients have died of ACS without seeking activation releases cytokine such as interleukin-1β medical attention32,33. The majority of these deaths (IL-1β), tumour necrosis factor-alpha (TNF-α) and can be attributed to serious arrhythmias, and IL-6, which trigger hyperinflammation and endothelial mechanical complications leading to cardiogenic dysfunction. Lung tissue samples of patients with shock. In our earlier study, we analyzed the clinical COVID-19 showed complement-mediated severe characteristics and outcome in patients with a thrombotic microvascular injury syndrome, with delayed presentation after STEMI and complicated sustained activation of the alternative complement by cardiogenic shock and showed that the in-hospital pathway29. More than 70 per cent of patients with mortality was 42.9 per cent34. The American severe COVID-19 meet the criteria for disseminated Heart Association (AHA)/American College of intravascular coagulation30. Formation of thrombosis in Cardiology (ACC)/Society of Cardiovascular coronary microcirculation and endothelial dysfunction Angiography and Intervention (SCAI) proposed are hypothesized as the causative mechanism of specific guidelines regarding the management of myocardial injury in severe COVID-19 patients12,17,31. A ACS in the existing COVID-19 pandemic (Table)35. recent study of 100 recovered COVID-19 patients who (ii) Myocarditis: The increase in troponin and underwent cardiac magnetic resonance imaging (MRI), NT-proBNP (N-terminal pro-brain natriuretic revealed cardiac involvement in 78 (78%) patients and peptide) levels reflects the myocardial injury ongoing inflammation in 60 (60%) patients9. Another caused by the SARS-CoV-27. A few cases of autopsy study28 of 39 COVID-19 positive cases fulminant myocarditis have also been reported documented SARS-CoV-2 in myocardium in 24 of with COVID-197. Data are scarce on the cardiac 39 (61.5%) cases28. Viral load of >1000 copies/µg RNA imaging of COVID-19 patients. Echocardiography was documented in 16 of 39 (41%) cases. Higher levels revealed severe left ventricle systolic dysfunction of viral RNA were associated with higher cytokine in anecdotal reports36. Cardiac MRI demonstrated levels, however this was not associated with an influx marked biventricular myocardial interstitial oedema, of inflammatory cells28. along with diffuse late gadolinium enhancement involving the entire biventricular wall, suggestive Cardiovascular manifestations of COVID-19 of extensive myocardial injury37. In addition, COVID-19 can have the following cardiovascular myocarditis can manifest after complete resolution manifestations: of symptoms as dilated cardiomyopathy, as seen in (i) Myocardial infarction: COVID-19 can be a viral myocarditis. ST-segment elevation myocardial infarction (iii) Heart failure: Patients with COVID-19 can have (STEMI) mimic. ACS could be due to plaque symptoms such as dyspnoea, palpitations and rupture, coronary artery spasm, supply-demand fatigue, which can be attributed to heart failure. In mismatch or endothelial dysfunction due to cytokine an initial study from China nearly 18.7 per cent of storm. In the initial report from Wuhan, China, up 1099 adult inpatients of COVID-19 had dyspnoea to 27.8 per cent COVID-19 patients had an elevated on initial presentation38. Acute heart failure ranges troponin level, indicating myocardial damage from 4.1 to 23 per cent in various studies, and it during the index hospitalization for COVID7. In complicates the clinical course of COVID-197,38. a recent case series by Bangalore et al8, among The acute heart failure can be due to myocardial 18 patients with COVID-19 having STEMI, nine ischaemia, myocarditis or tachyarrhythmia. It is (50%) patients underwent coronary angiography difficult to differentiate the symptoms of acute and five among these nine patients underwent heart failure from acute respiratory distress percutaneous coronary angiography. The results syndrome. Increasing level of cardiac troponins showed a high prevalence of non-obstructive CAD, and NT-proBNP should raise suspicion regarding variable presentation and poor prognosis even after myocardial injury in COVID-19. revascularization as 13 (72%) patients died in the Patients with chronic heart failure are predisposed hospital. In another series from Lombardy, Italy31, to COVID-19 due to advanced age and the presence SHARMA et al: COVID-19 & CARDIOVASCULAR MANIFESTATIONS 11

Table. American College of Cardiology consensus statement on the management of acute coronary syndrome during the coronavirus disease 2019 (COVID-19) pandemic All patient with ACS should be evaluated in the ED. Patients should wear a face mask and undergo COVID-19 testing in ED serial 12-lead ECG, transthoracic ECHO and portable chest X-ray for equivocal symptoms or non-specific ECG findings. The management of ACS is summarized below In PCI-capable hospitals Definitive STEMI (classical clinical Primary PCI remains the standard of care for patients presenting to PCI centres, if it symptoms and ECG consistent with STEMI) can be done within 90 min of FMC Possible STEMI (unclear clinical symptoms, Initial non-invasive evaluation in the form of ECHO for assessment of wall motion equivocal, diffuse ST-segment elevation or abnormality, and coronary CT angiography in cases of divergent findings in ECG and delayed presentation) ECHO NSTEMI/USA Medical management. PCI should be offered in case of haemodynamic instability or high risk clinical features (GRACE score >140) Patients with cardiogenic shock and/or Patients with resuscitated OHCA or patients with cardiogenic shock should be OHCA subjected to coronary angiography in the presence of persistent ST-elevation in the ECG, and a concomitant wall motion abnormality on ECHO. Resuscitated OHCA in the absence of ST-elevation should be managed conservatively unless there is high suspicion of ACS In non-PCI-capable hospitals Definite STEMI Primary PCI remains the standard of care if patients can be transferred within 120 min of FMC from non-PCI centres to PCI-capable centres Pharmacoinvasive approach with fibrinolysis followed by transfer to a PCI centre when necessary (failed thrombolysis, rescue PCI or haemodynamic instability) is also recommended. NSTEMI/USA Medical management. PCI should be offered in case of haemodynamic instability or high risk clinical features (GRACE score >140) Patients with cardiogenic shock and/or Patients with resuscitated OHCA or patients with cardiogenic shock should be OHCA selectively considered for transfer to PCI-capable hospital in the presence of persistent ST-elevation in the ECG, and a concomitant wall motion abnormality on ECHO STEMI, ST-elevation myocardial infarction; NSTEMI; non-ST-elevation myocardial infarction; USA, unstable angina; ACS, acute coronary syndrome; OHCA, out-of-hospital cardiac arrest; ED, emergency department; ECG, electrocardiogram; ECHO, echocardiogram; FMC, first medical contact; CT, computed tomography; PCI, percutaneous coronary intervention; GRACE, Global Registry of Acute Coronary Events. Source: Ref. 35

of several comorbidities. There is a possibility arrhythmias, and mortality in the COVID-19 of an increase in heart failure precipitations in pandemic38. Though hydroxychloroquine (HCQ) is the COVID-19 pandemic. Patients with chronic a safe drug, it can precipitate TdP by prolonging the heart failure should remain compliant with their QT interval. Furthermore, the combination of HCQ medications. and azithromycin increases the odds of TdP by (iv) Arrhythmias: The incidence of malignant arrhythmia prolonging QT interval, in patients who are already was 5.9 per cent in an initial study of COVID-19 predisposed to arrhythmias39. A retrospective from China38. The worldwide cross-sectional survey cohort study of 40 patients with COVID-19 reported benign to potentially life-threatening showed that six (33%) of 18 patients developed arrhythmias in the hospitalized COVID-19 patients. an increase in QTc of ≥500 msec or greater on Atrial fibrillation followed by atrial flutter was combination therapy (HCQ and azithromycin) the most commonly reported tachyarrhythmia, versus one (5%) of 22 of those treated with whereas severe sinus bradycardia was the most HCQ alone (P=0.03), and there was no episode common bradyarrhythmia10. Arrhythmias can be of TdP40. In a cohort of 90 hospitalized patients the sequelae of hyperinflammation due to cytokine of COVID-19 reported by Mercuro et al41, 18 of storm, myocarditis or drug-induced Torsades de the 90 patients (20%) treated with HCQ alone Pointes (TdP). The high troponins were associated or in combination with azithromycin developed with the increased incidence of malignant QTc prolongation of ≥500 msec or more, and 12 INDIAN J MED RES, January & February 2021

one patient had TdP after stopping of drugs. The retrospective multicentric study by Rosenberg et al42 in 1438 COVID-19 patients on HCQ with and without azithromycin reported no association of HCQ with in-hospital mortality. In adjusted Coxproportional hazards models, compared with patients receiving neither drug, the mortality was not significantly differentfor patients receiving HCQ + azithromycin [hazard ratio (HR), 1.35], HCQ alone (HR, 1.08) or azithromycin alone (HR, 0.56)42. However, these studies were done in intensive care unit (ICU) settings with continuous monitoring of QTc, one is not certain about the implication of QTc prolongation in outpatients or Fig. 3. Complex interaction of ACE-i/ARBs and COVID-19. In non-ICU hospitalized patients, where continuous COVID-19, the virus downregulates ACE2, which acts as a receptor monitoring is not available. of SARS-CoV-2. The physiological function of ACE2 is to catalyze (v) Pulmonary embolism (PE): Recent studies angiotensin II to angiotensin 1-7, and acts like a gatekeeper of the RAAS pathway. This leads to angiotensin surge in COVID-19. The engrossed on PE as a silent cause of mortality ACE-i/ARBs inhibit RAAS pathway and upregulate the ACE2 level. in the COVID-19 pneumonia. The cumulative Red arrows represent downregulation and blue arrows represent incidence of PE was 20.6 and 23 per cent in two upregulation. ACE-i, angiotensin-converting enzyme inhibitors; different case series from Italy43,44. The PE was ARBs, angiotensin receptor blockers. frequently present in segmental arteries of the pulmonary artery44. After acute respiratory distress by inhibiting ACE. Angiotensin II is involved in the syndrome and myocarditis, PE is the most common inflammatory cascade of COVID-19 and reducing cause of mortality in patients with COVID-19. angiotensin II might benefit in COVID-19. There is a plausible association between the After the report by Sommerstein and Gräni53, hyperinflammatory state in COVID-19 and PE45. regarding the use of ACE inhibitors as a potential risk Moreover, the presence of antiphospholipid factor for fatal COVID-19, the potential beneficial antibodies in some cases of COVID-19 pneumonia and harmful effects of ACE inhibitors/ARBs have raises the suspicion of hypercoagulable state been debated in many studies. A population-based, in COVID-1924. The symptoms and signs of case-control study of 6272 patients of SARS-CoV-2 PE are difficult to recognize in the COVID-19 pneumonia and create a delay in the diagnosis in the Lombardy region of Italy showed no association of PE. Acute worsening of hypoxia, hypotension of ACE inhibitors/ARBs with overall COVID-19 and unexplained sinus tachycardia should alarm cases, or among patients who had a severe or fatal the diagnosis of PE. Echocardiography and CT course of the disease [adjusted odds ratio (AOR), pulmonary angiography could be performed after 0.83 for ARBs and 0.91 for ACE inhibitors], and a complete evaluation of symptoms, and a strong no association between these variables was found 54 55 suspicion of PE. D-dimers are usually raised due with regard to sex . Li et al , in 362 patients with to the cytokine storm in COVID-19 and will not hypertension hospitalized with COVID-19 infection, help in diagnosing PE25. showed no association of ACE inhibitors/ARBs with mortality. The retrospective study by Zhang Interaction between ACE2, COVID-19 and ACE et al56 favoured the use of ACE inhibitors/ARBs in inhibitors/angiotensin receptor blockers (ARBs) COVID-19 patients hospitalized with hypertension There is a complex relationship between ACE2, and showed a lower risk of all-cause mortality SARS-CoV-2 and ACE inhibitors/ARBs (Fig. 3). compared with ACE inhibitors/ARBs non-users Theoretically, ACE inhibitors/ARBs increase ACE2 (adjusted HR, 0.37; P=0.03). In another retrospective by upregulating mRNA levels in animal (rat) and analysis by Mehta et al57 among 18,472 patients human studies, the receptor of SARS-CoV-2, and tested for SARS-CoV-2, only 2285 patients (12.4%) might predisposes to viral entry into cell46-52. On the were taking ACE inhibitors/ARBs, which again other hand, ACE inhibitors reduce angiotensin II levels showed no association of ACE inhibitors/ARBs with SHARMA et al: COVID-19 & CARDIOVASCULAR MANIFESTATIONS 13

COVID-19 positivity. These four studies together protective equipment was associated with reduction provide tentative evidence that ACE inhibitors/ARBs in the odds of contracting COVID-1962. neither predispose nor are harmful in COVID-19 3. The use of investigations such as echocardiography patients and accordingly, ACE inhibitors/ARBs and troponins, as routine, in patients with should be continued in patients who are on these COVID-19 should be avoided63. However, when drugs for hypertension, heart failure or other clinical clinically indicated, these investigations may help indications, as is recommended by various societies/ in the diagnosis, management and prognosis of guidelines58. cardiovascular involvement. 4. Management of STEMI cannot be delayed, Treatment waiting for the result of COVID-19. If feasible, The management of cardiovascular manifestations a dedicated COVID-19 catheterization laboratory of COVID-19 is not standardized. Among the many is preferable35,64,65. The need is to protect HCWs antiviral drugs being tried for COVID-19, none has from contracting the infection from a suspected so far shown any significant benefit in critically ill COVID-19 patient. A summary of the guidelines patients16. In view of this, treatment mostly remains given by AHA/ACC/SCAI for management of symptomatic. Nonetheless, a few points can be ACS is presented in the Table and Figure 435. highlighted: 5. Patients with acute decompensated heart failure 1. Among the repurposed drugs, the role of HCQ should be managed according to the standard either alone or in combination with azithromycin guidelines. Low threshold should be kept for early in the treatment of COVID-19 is controversial59. or elective intubation in patients with respiratory Other antiviral drugs such as lopinavir-ritonavir, distress, to avoid the aerosolization associated remdesivir and favipiravir have not shown any with emergency intubation. Guideline-directed benefit on mortality. Remdesivir, however, showed medical therapy should be continued and, in a shorter duration to recovery60. The RECOVERY patients taking ACE inhibitors/ARBs, it should be trial showed that the use of dexamethasone (6 mg) continued. In treatment-naïve COVID-19 patients, for up to 10 days vs. usual care decreased 28 days guidelines are unclear regarding the starting of ACE mortality among patients receiving oxygen therapy inhibitors/ARBs67. and mechanical ventilation. No benefit was reported 6. Arrhythmias should be managed as per standard in patients who were not on any respiratory guidelines. Risk-benefit assessment should be done support61. There is not enough evidence for the usage and non-urgent procedures should be postponed of these drugs in cardiovascular manifestations of and refractory/life-threatening arrhythmias not COVID-19. controlled on medical therapy should be undertaken 2. Healthcare workers (HCW) should take stringent for electrophysiological study68. precautions to prevent themselves from getting Conclusion infected. A study by Chatterjee et al62 reported that HCQ prophylaxis after four or more maintenance The extent of the spread of COVID-19 is such that doses significantly reduced the odds of getting despite being predominantly a respiratory disease, many infected (AOR: 0.44; 95%). Use of personal patients are having cardiovascular involvement. Not

Fig. 4. Management of STEMI during the COVID-19 pandemic. ECG, electrocardiography; PPE, personal protective equipment. Source: Ref. 35. [Case classification: COVID-19 positive: any person meeting the laboratory criteria (reverse transcription-polymerase chain reaction positive for SARS-CoV-2); COVID-19 possible: any person meeting the clinical criteria (cough, fever, shortness of breath and sudden onset of anosmia, ageusia or dysgeusia) and COVID-19 probable case: any person meeting the clinical criteria with an epidemiological link or any person meeting the diagnostic criteria]66. 14 INDIAN J MED RES, January & February 2021 only patients with pre-existing cardiovascular diseases 10. Gopinathannair R, Merchant FM, Lakkireddy DR, and risk factors are at increased risk of morbidity and Etheridge SP, Feigofsky S, Han JK, et al. COVID-19 and mortality due to COVID-19, but also these patients cardiac arrhythmias: A global perspective on arrhythmia characteristics and management strategies. J Interv Card may directly present with cardiovascular complications Electrophysiol 2020; 59 : 329-33. such as myocardial infarction, myocarditis, heart 11. Baldi E, Sechi GM, Mare C, Canevari F, Brancaglione A, failure, arrhythmias or PE. Various gaps in research Primi R, et al. Lombardia CARe researchers. Out-of-hospital include the evidence-based management of various cardiac arrest during the COVID-19 outbreak in Italy. N Engl cardiovascular complications, care of chronic J Med 2020: 383 : 496-8. patients with cardiovascular issues not suffering from 12. Madjid M, Safavi-Naeini P, Solomon SD, Vardeny O. Potential COVID-19 and the ethical challenges in triage of these effects of coronaviruses on the cardiovascular system: A patients. Worldwide efforts are presently on to find review. JAMA Cardiol 2020; 5 : 831-40. antiviral drugs and vaccines against SARS-CoV-2. The 13. Wu F, Zhao S, Yu B, Chen YM, Wang W, Song ZG, et al. A need of the hour is to manage these patients with the best new coronavirus associated with human respiratory disease in evidence-based guidelines and to be on the cognizant of China. Nature 2020; 579 : 265-9. the new emerging data on a day-to-day basis. 14. Li Q, Guan X, Wu P, Wang X, Zhou L, Tong Y, et al. Early transmission dynamics in Wuhan, China, of Financial support & sponsorship: None. novel coronavirus-infected pneumonia. N Engl J Med 2020; 382 : 1199-207. Conflicts of Interest: None. 15. Huang C, Wang Y, Li X, Ren L, Zhao J, Hu Y, et al. Clinical features of patients infected with 2019 novel coronavirus in References Wuhan, China. Lancet 2020; 395 : 497-506. 1. World Health Organization. Report of the WHO-China Joint 16. Van Doremalen N, Bushmaker T, Morris DH, Holbrook MG, Mission on Coronavirus Disease 2019 (COVID-19). Available Gamble A, Williamson BN, et al. Aerosol and surface stability from: https://www.who.int/docs/default-source/coronaviruse/ of SARS-CoV-2 as compared with SARS-CoV-1. N Engl J who-china-joint-mission-on-covid-19-final-report.pdf, Med 2020; 382 : 1564-7. accessed on June 12, 2020. 17. Liu PP, Blet A, Smyth D, Li H. The science underlying 2. Zhu N, Zhang D, Wang W, Li X, Yang B, Song J, et al. A novel COVID-19: Implications for the cardiovascular system. coronavirus from patients with pneumonia in China, 2019. Circulation 2020; 142 : 68-78. N Engl J Med 2020; 382 : 727-33. 18. Hoffmann M, Kleine-Weber H, Schroeder S, Krüger N, 3. Zhou P, Yang XL, Wang XG, Hu B, Zhang L, Zhang W, et al. Herrler T, Erichsen S, et al. SARS-CoV-2 cell entry depends A pneumonia outbreak associated with a new coronavirus of on ACE2 and TMPRSS2 and is blocked by a clinically proven probable bat origin. Nature 2020; 579 : 270-3. protease inhibitor. Cell 2020; 181 : 271-80. e8. 4. World Health Organization. WHO Coronavirus Disease 19. Vaduganathan M, Vardeny O, Michel T, McMurray JJV, Pfeffer MA, Solomon SD. Renin-angiotensin-aldosterone (COVID-19) Dashboard. Available from: https://covid19. system inhibitors in patients with COVID-19. N Engl J Med who.int/, accessed on November 29, 2020. 2020; 382 : 1653-9. 5. Ministry of Health and Family Welfare, Government of India. 20. Richardson S, Hirsch JS, Narasimhan M, Crawford JM, COVID-19 India (updated 1 June 2020). Available from: McGinn T, Davidson KW, et al. Presenting characteristics, https://www.mohfw.gov.in, accessed on November 29, 2020. comorbidities, and outcomes among 5700 patients 6. Bonow RO, Fonarow GC, O’Gara PT, Yancy CW. Association hospitalized with COVID-19 in the New York City area. of coronavirus disease 2019 (COVID-19) with myocardial JAMA 2020; 323 : 2052-9. injury and mortality. JAMA Cardiol 2020; 5 : 751-3. 21. Epidemiology Working Group for NCIP Epidemic Response, 7. Shi S, Qin M, Shen B, Cai Y, Liu T, Yang F, et al. Association Chinese Center for Disease Control and Prevention. The of cardiac injury with mortality in hospitalized patients with epidemiological characteristics of an outbreak of 2019 novel COVID-19 in Wuhan, China. JAMA Cardiol 2020; 5 : 802-10. coronavirus diseases (COVID-19) in China. Zhonghua Liu 8. Bangalore S, Sharma A, Slotwiner A, Yatskar L, Harari R, Xing Bing Xue Za Zhi 2020; 41 : 145-51. Shah B, et al. ST-segment elevation in patients with COVID-19 22. Wang D, Hu B, Hu C, Zhu F, Liu X, Zhang J, et al. Clinical - A case series. N Engl J Med 2020; 382 : 2478-80. characteristics of 138 hospitalized patients with 2019 novel coronavirus-infected pneumonia in Wuhan, China. JAMA 9. Puntmann VO, Carerj ML, Wieters I, Fahim M, Arendt C, 2020; 323 : 1061-9. Hoffmann J, et al. Outcomes of cardiovascular magnetic resonance in patients recently recovered from coronavirus 23. Mohan A, Tiwari P, Bhatnagar S, Patel A, Maurya A, Dar L, disease 2019 (COVID-19). JAMA Cardiol 2020; 5 : 1265-73. et al. Clinico-demographic profile & hospital outcomes of SHARMA et al: COVID-19 & CARDIOVASCULAR MANIFESTATIONS 15

COVID-19 patients admitted at a tertiary care centre in north 37. Inciardi RM, Lupi L, Zaccone G, Italia L, Raffo M, India. Indian J Med Res 2020; 152 : 61-9. Tomasoni D, et al. Cardiac involvement in a patient with 24. Zhang Y, Xiao M, Zhang S, Xia P, Cao W, Jiang W, et al. coronavirus disease 2019 (COVID-19). JAMA Cardiol Coagulopathy and antiphospholipid antibodies in patients 2020; 5 : 819-24. with COVID-19. N Engl J Med 2020; 382 : e38. 38. Guo T, Fan Y, Chen M, Wu X, Zhang L, He T, et al. 25. Agstam S, Vijay J, Gupta A, Bansal S. Acute pulmonary Cardiovascular implications of fatal outcomes of patients embolism: An unseen villain in COVID-19. Indian Heart J with coronavirus disease 2019 (COVID-19). JAMA Cardiol 2020; 72 : 218-9. 2020; 5 : 811-8. 26. Oudit GY, Kassiri Z, Jiang C, Liu PP, Poutanen SM, 39. World Health Organization. The Cardiotoxicity of Penninger JM, et al. SARS-coronavirus modulation of Antimalarials: World Health Organization Malaria Policy myocardial ACE2 expression and inflammation in patients Advisory Committee Meeting. Available from: https://www. with SARS. Eur J Clin Invest 2009; 39 : 618-25. who.int/malaria/mpac/mpac-mar2017-erg-cardiotoxicity- report-session2.pdf, accessed on April 22, 2020. 27. Tavazzi G, Pellegrini C, Maurelli M, Belliato M, Sciutti F, Bottazzi A, et al. Myocardial localization of coronavirus 40. Bessière F, Roccia H, Delinière A, Charrière R, Chevalier P, in COVID-19 cardiogenic shock. Eur J Heart Fail Argaud L, et al. Assessment of QT intervals in a case series of 2020; 22 : 911-5. patients with coronavirus disease 2019 (COVID-19) infection treated with hydroxychloroquine alone or in combination 28. Lindner D, Fitzek A, Bräuninger H, Aleshcheva G, with azithromycin in an intensive care unit. JAMA Cardiol Edler C, Meissner K, et al. Association of cardiac infection 2020; 5 : 1067-9. with SARS-CoV-2 in confirmed COVID-19 autopsy cases. JAMA Cardiol 2020; 5 : 1281-5. 41. Mercuro NJ, Yen CF, Shim DJ, Maher TR, McCoy CM, ZimetbaumPJ, et al. Risk of QT interval prolongation 29. Magro C, Mulvey JJ, Berlin D, Nuovo G, Salvatore S, associated with use of hydroxychloroquine with or without Harp J, et al. Complement associated microvascular injury concomitant azithromycin among hospitalized patients testing and thrombosis in the pathogenesis of severe COVID-19 positive for coronavirus disease 2019 (COVID-19). JAMA infection: A report of five cases. Transl Res 2020; 220 : 1-3. Cardiol 2020; 5 : 1036-41. 30. Tang N, Li D, Wang X, Sun Z. Abnormal coagulation parameters are associated with poor prognosis in patients 42. Rosenberg ES, Dufort EM, Udo T, Wilberschied LA, with novel coronavirus pneumonia. J Thromb Haemost Kumar J, Tesoriero J, et al. Association of treatment with 2020; 18 : 844-7. hydroxychloroquine or azithromycin with in-hospital mortality in patients with COVID-19 in New York State. 31. Stefanini GG, Montorfano M, Trabattoni D, Andreini D, JAMA 2020; 323 : 2493-502. Ferrante G, Ancona M, et al. ST-elevation myocardial infarction in patients with COVID-19: Clinical and 43. Grillet F, Behr J, Calame P, Aubry S, Delabrousse E. Acute angiographic outcomes. Circulation 2020; 141 : 2113-6. pulmonary embolism associated with COVID-19 pneumonia detected with pulmonary CT angiography. Radiology 32. Tam CF, Cheung KS, Lam S, Wong A, Yung A, Sze M, 2020; 296 : E186-8. et al. Impact of coronavirus disease 2019 (COVID-19) outbreak on ST-segment-elevation myocardial infarction 44. Poissy J, Goutay J, Caplan M, Parmentier E, Duburcq T, care in Hong Kong, China. Circ Cardiovasc Qual Outcomes Lassalle F, et al. Pulmonary embolism in patients with 2020; 13 : e006631. COVID-19: Awareness of an increased prevalence. Circulation 2020; 142 : 184-6. 33. De Filippo O, D’Ascenzo F, Angelini F, Bocchino PP, Conrotto F, Saglietto A, et al. Reduced rate of hospital 45. Danzi GB, Loffi M, Galeazzi G, Gherbesi E. Acute pulmonary admissions for ACS during COVID-19 outbreak in Northern embolism and COVID-19 pneumonia: A random association? Italy. N Engl J Med 2020; 383 : 88-9. Eur Heart J 2020; 41 : 1858. 34. Sharma YP, Krishnappa D, Kanabar K, Kasinadhuni G, 46. Ferrario CM, Jessup J, Chappell MC, Averill DB, Brosnihan KB, Sharma R, Kishore K, et al. Clinical characteristics and Tallant EA, et al. Effect of angiotensin-converting enzyme outcome in patients with a delayed presentation after inhibition and angiotensin II receptor blockers on ST-elevation myocardial infarction and complicated by cardiac angiotensin-converting enzyme 2. Circulation cardiogenic shock. Indian Heart J 2019; 71 : 387-93. 2005; 111 : 2605-10. 35. Welt FGP, Shah PB, Aronow HD, Bortnick AE, Henry TD, 47. Sukumaran V, Veeraveedu PT, Gurusamy N, Sherwood MW, et al. Catheterization laboratory considerations Lakshmanan AP, Yamaguchi K, Ma M, et al. Olmesartan during the coronavirus (COVID-19) pandemic: From the attenuates the development of heart failure after ACC’s interventional council and SCAI. J Am Coll Cardiol experimental autoimmune myocarditis in rats through the 2020; 75 : 2372-5. modulation of ANG 1-7 mas receptor. Mol Cell Endocrinol 36. Hu H, Ma F, Wei X, Fang Y. Coronavirus fulminant myocarditis 2012; 351 : 208-19. saved with glucocorticoid and human immunoglobulin. Eur 48. Sukumaran V, Veeraveedu PT, Lakshmanan AP, Gurusamy N, Heart J 2020; ehaa190. Yamaguchi K, Ma M, et al. Olmesartan medoxomil 16 INDIAN J MED RES, January & February 2021

treatment potently improves cardiac myosin-induced dilated 59. Cavalcanti AB, Zampieri FG, Rosa RG, Azevedo LCP, cardiomyopathy via the modulation of ACE-2 and ANG 1-7 Veiga VC, Avezum A, et al. Hydroxychloroquine with or mas receptor. Free Radic Res 2012; 46 : 850-60. without Azithromycin in mild-to-moderate COVID-19. 49. Burchill LJ, Velkoska E, Dean RG, Griggs K, Patel SK, N Engl J Med 2020; 383 : 2041-52. Burrell LM. Combination renin-angiotensin system blockade 60. Wang Y, Zhang D, Du G, Du R, Zhao J, Jin Y, et al. and angiotensin-converting enzyme 2 in experimental Remdesivir in adults with severe COVID-19: A randomised, myocardial infarction: Implications for future therapeutic double-blind, placebo-controlled, multicentre trial. Lancet directions. Clin Sci (Lond) 2012; 123 : 649-58. 2020; 395 : 1569-78. 50. Campbell DJ, Zeitz CJ, Esler MD, Horowitz JD. Evidence 61. RECOVERY Collaborative Group, Horby P, Lim WS, against a major role for angiotensin converting enzyme-related Emberson JR, Mafham M, Bell JL, et al. Dexamethasone in carboxypeptidase (ACE2) in angiotensin peptide metabolism in hospitalized patients with COVID-19 - Preliminary report. the human coronary circulation. J Hypertens 2004; 22 : 1971-6. N Engl J Med 2020; NEJMoa2021436. 51. Furuhashi M, Moniwa N, Mita T, Fuseya T, Ishimura S, Ohno K, 62. Chatterjee P, Anand T, Singh KJ, Rasaily R, Singh R, Das S, et al. Urinary angiotensin-converting enzyme 2 in hypertensive et al. Healthcare workers & SARS-CoV-2 infection in India: patients may be increased by olmesartan, an angiotensin II A case-control investigation in the time of COVID-19. Indian receptor blocker. Am J Hypertens 2015; 28 : 15-21. J Med Res 2020; 151 : 459-67. 52. Epelman S, Shrestha K, Troughton RW, Francis GS, Sen S, 63. Kirkpatrick JN, Mitchell C, Taub C, Kort S, Hung J, Klein AL, et al. Soluble angiotensin-converting enzyme 2 in Swaminathan M. ASE statement on protection of patients and human heart failure: Relation with myocardial function and echocardiography service providers during the 2019 novel clinical outcomes. J Card Fail 2009; 15 : 565-71. coronavirus outbreak: Endorsed by the American College of Cardiology. J Am Coll Cardiol 2020; 75 : 3078-84. 53. Sommerstein R, Gräni C. Rapid response: Re: Preventing a COVID-19 pandemic: ACE inhibitors as a potential risk factor 64. European Society of Cardiology. ESC guidance for the for fatal COVID-19. BMJ 2020; 368 : m810. diagnosis and management of CV disease during the COVID-19 pandemic. Available from: https://www.escardio. 54. Mancia G, Rea F, Ludergnani M, Apolone G, Corrao G. org/Education/COVID-19-and-Cardiology/ESC-COVID-19- Renin-angiotensin-aldosterone system blockers and the risk Guidance, accessed on June 23, 2020. of COVID-19. N Engl J Med 2020; 382 : 2431-40. 65. Mahmud E, Dauerman HL, Welt FG, Messenger JC, Rao SV, 55. Li J, Wang X, Chen J, Zhang H, Deng A. Association of Grines C, et al. Management of acute myocardial infarction renin-angiotensin system inhibitors with severity or risk during the COVID-19 Pandemic. J Am Coll Cardiol of death in patients with hypertension hospitalized for 2020; 96 : 336-45. coronavirus disease 2019 (COVID-19) infection in Wuhan, 66. European Centre for Disease Prevention and Control. Case China. JAMA Cardiol 2020; 5 : 825-30. definition for coronavirus disease 2019 (COVID-19), as of 29 56. Zhang P, Zhu L, Cai J, Lei F, Qin JJ, Xie J, et al. Association May 2020. Available from: https://www.ecdc.europa.eu/en/ of inpatient use of angiotensin-converting enzyme inhibitors covid-19/surveillance/case-definition, accessed on June 13, and angiotensin II receptor blockers with mortality among 2020. patients with hypertension hospitalized with COVID-19. Circ 67. Mehra MR, Ruschitzka F. COVID-19 illness and heart failure: Res 2020; 126 : 1671-81. A missing link? JACC Heart Fail 2020; 8 : 512-4. 57. Mehta N, Kalra A, Nowacki AS, Anjewierden S, Han Z, 68. Lakkireddy DR, Chung MK, Gopinathannair R, Bhat P, et al. Association of use of angiotensin-converting Patton KK, Gluckman TJ, Turagam M, et al. Guidance for enzyme inhibitors and angiotensin II receptor blockers with cardiac electrophysiology during the coronavirus (COVID-19) testing positive for coronavirus disease 2019 (COVID-19). pandemic from the Heart Rhythm Society COVID-19 Task JAMA Cardiol 2020; 5 : 1020-6. Force; Electrophysiology Section of the American College 58. BansalS, AgstamS, GuptaA, GuptaP, IsserHS. Continue ACE of Cardiology; and the Electrocardiography and Arrhythmias inhibitors/ARB’S till further evidence in coronavirus disease Committee of the Council on Clinical Cardiology, American 2019 (COVID-19). Indian Heart J 2020; 72 : 212-3. Heart Association. Heart Rhythm 2020; 17 : e233-e241.

For correspondence: Dr Ankur Gupta, Department of Cardiology, Advanced Cardiac Centre, Postgraduate Institute of Medical Education & Research, Chandigarh 160 012, India e-mail: [email protected] Quick Response Code: Review Article

Indian J Med Res 153, January & February 2021, pp 17-25 DOI: 10.4103/ijmr.IJMR_3215_20

An overview of preclinical animal models for SARS-CoV-2 pathogenicity

Itti Munshi1, Aditya Khandvilkar1, Shrinivas M. Chavan1, Geetanjali Sachdeva1, Smita D. Mahale2 & Uddhav K. Chaudhari1

Departments of 1Primate Biology, 2Structural Biology, ICMR-National Institute for Research in Reproductive Health, Mumbai, Maharashtra, India

Received July 27, 2020

Severe acute respiratory syndrome coronavirus (SARS-CoV)-2 has caused millions of fatalities globally since its origin in November 2019. The SARS-CoV-2 shares 79 and 50 per cent genome similarity with its predecessors, severe SARS-CoV and Middle East respiratory syndrome (MERS) coronavirus, all belonging to the same genus, Betacoronavirus. This relatively new virus has stymied the effective control of COVID-19 pandemic and caused huge social and economic impact worldwide. The FDA-approved drugs were re-purposed to reduce the number of fatalities caused by SARS-CoV-2. However, controversy surrounds about the efficacy of these re-purposed antiviral drugs against SARS-CoV-2.This necessitates the identification of new drug targets for SARS-CoV-2. Hence, the development of pre-clinical animal model is warranted. Such animal models may help us gain better understanding of the pathophysiology of SARS-CoV-2 infection and will be effective tools for the evaluation and licensure of therapeutic strategies against SARS-CoV-2. This review provides a summary of the attempts made till to develop a suitable animal model to understand pathophysiology and effectiveness of therapeutic agents against SARS-CoV-2.

Key words Animal models - COVID-19 - pathogenesis - preclinical - SARS-CoV-2 - therapy - vaccine

Severe acute respiratory syndrome coronavirus SARS-CoV-2 genome shares 96.2 and 87 per cent (SARS-CoV)-2 is an enveloped positive-sense similarity with genomes of bat coronavirus, bat CoV single-stranded RNA virus, belonging to the genus RatG13 and bat SL CoVZXC21, respectively4,5. Betacoronavirus1.Though not as big scale as Thus, SARS-CoV-2 is believed to have a zoonotic SARS-CoV-2, the members of the same genus, i.e. origin1,4,5. SARS-CoV and Middle East respiratory syndrome coronavirus (MERS-CoV), have caused epidemic The transmission of COVID-19 occurs through in 2002 and 2012, respectively2,3. SARS-CoV-2 respiratory droplets. Incubation period of COVID-19 shares 79 and 50 per cent genome similarity with lasts for 14 days. However, the median duration for SARS-CoV and MERS-CoV, respectively1. Further, the onset of symptoms after exposure is around 4-5

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 17 18 INDIAN J MED RES January & February 2021 days6,7. The severity of clinical signs and symptoms of a recent study, New Zealand white rabbits exposed COVID-19 illness varies among patients. Individuals to SARS-CoV-2 virus at a dose of 106 tissue culture afflicted with COVID-19 may experience fever, chills, infectious dose 50 (TCID50) showed viral shedding dry cough, shortness of breath, fatigue, body pain, from nose, throat and rectum after 15, 11 and 5 days headache, loss of smell and taste, sore throat, runny nose, post-infection (d.p.i.), respectively. The infected vomiting and diarrhoea over the course of disease8-11. A rabbits remained asymptomatic throughout the few individuals infected with SARS-CoV-2 may remain study with severe bronchus-associated lymphoid asymptomatic12-14. tissue proliferation and macrophage infiltration in the alveoli20. More studies are needed to explain the Major reason underlying alarming COVID-19 absence of symptoms in rabbit and to conclusively pandemic in a short span is the lack of an effective determine the utility of rabbit as animal model to study therapeutic/prophylactic drug against SARS-CoV-2. SARS-CoV-2 infection. About 450 COVID-19 therapeutics are in pre-clinical trials15. These include viral, RNA, DNA, protein and Ferrets nanoparticle-based vaccines as well as re-purposed Ferrets are susceptible to many human respiratory therapeutics including vasodilator, immune modulator, viruses such as influenza virus, syncytial virus, para steroids, anti-inflammatory agents, anti-coagulatory influenza virus and coronavirus21-23. Ferrets reproduce the molecules, anti-parasitic and antiviral drugs. Antiviral clinical symptoms of viral diseases due to the presence drugs target viral replication, cellular entry and viral of viral receptors and the similarity of their respiratory trafficking16. Availability of ideal animal models would tract anatomy with that of humans24. ACE-2 is mainly help in assessment of the efficacy of vaccines before expressed in type II pneumocytes and serous epithelial their entry into the clinical trials. Animal models are also cells of tracheobronchial sub-mucosal glands in ferrets25. essential to assess the efficacy of drugs in vivo, since in The domain in ferret ACE-2 that binds the spike protein vitro evaluation of drugs may not suffice for clinical use. of SARS-CoV-2 differs by only two amino acids from For instance, hydroxychloroquine showed promising its human homologue domain. Ferrets infected intra- results against COVID-19 in vitro but failed to show any nasally (IN) at 105 TCID with SARS-CoV-2 virus, remedial effect in Cynomolgus macaques exposed to 50 isolated from Korean patients, recapitulated clinical SARS-CoV-217. pattern observed in humans26 (Table I). Infected animals The U.S. Food and Drug Administration (FDA) exhibited lethargy, cough at 2-6 d.p.i. and elevated approval of any therapeutic agent requires its efficacy body temperature at 2-8 d.p.i. Viral RNA copies were to be proven in at least two animal models. An ideal detected from 4 to 8 d.p.i. in nasal and saliva swabs26. animal model should imitate the clinical symptoms of In a study conducted by Shi et al32, ferrets were exposed a disease as observed in humans. Here, we present a at a dose of 105 plaque-forming units (pfu) with human comparative report on the replication and transmission SARS-CoV-2 isolates and environment isolates from capability of SARS-CoV-2 in various animal models. wet market in Wuhan. The ferrets exposed to human SARS-CoV-2 isolates showed an increase in body Non-primate models temperature and loss of appetite at 10 d.p.i., whereas Non-primate models popularly utilized for those exposed to environment isolates showed similar therapeutic screening include rabbits, ferrets, golden symptoms at 12 d.p.i. The viral replication in ferrets Syrian hamsters and mice. exposed to either of these isolates was observed in the nasal turbinate, soft palate and tonsils32 Rabbits . The delay in appearance of overt symptoms of SARS-CoV-2 SARS-CoV-2 uses angiotensin-converting enzyme 2 infection in this study32 compared with the study by (ACE-2) and transmembrane serine protease 2 Kim et al26 could be due to different viral strains or receptor to enter the cell18. The spike protein receptor sub-species of the ferrets used in the study. These binding domain (RBD) of SARS-CoV-2 interacts investigations revealed that ferrets were susceptible to strongly with rabbit ACE-2 compared with its SARS-CoV-2 infection, and hence, they could be used human homologue hACE-219. Rabbits are susceptible to screen re-purposed drugs for the efficacy against to MERS-CoV infection but show no significant SARS-CoV-2 infection. The ferrets have been used to histopathological changes or clinical symptoms. In screen lopinavir, ritonavir, hydroxychloroquine sulphate MUNSHI et al: PRECLINICAL SARS-CoV-2 ANIMAL MODELS 19

Table I. Symptoms observed after SARS‑CoV‑2 infection in humans and various animal models Animal/Human Days post Symptoms RNA load Reference infection (d.p.i) detected Humans 1‑5 Cough, chills, fever and shortness of breath Natural infection 8‑11 5‑10 Diarrhoea, vomiting, sore throat 10‑15 Fatigue, muscle weakness

Ferret 1‑5 Elevated body temperatures/loss of activity, cough 3.83 log10 copies/ 26 5‑10 Seroconversion ml on 4‑8 d.p.i. 10‑15 Mild peri‑bronchitis

Hamster 1‑10 Weight loss, seropositive/rapid breathing and 7 log10 TCID50/g 27 lethargy/triggered immune response, interstitial on 2‑7 d.p.i. inflammation HB‑01‑hACE2 1‑5 Weight loss/lung lesions/interstitial pneumonia/ 106.77 copies/ml 28 transgenic mice triggered immune response African Green 1‑5 Triggered immune response/increase in body 2‑4 log pfu/ml on 29 Monkey temperature/loss of appetite 2 d.p.i. 5‑10 Pulmonary lesions/seroconversion/pneumonia/ acute systemic inflammation 2 Cynomolgus 1‑5 Lungs infiltrated with neutrophils/pulmonary 10e TCID50/ 30 macaques lesions, ml on 2‑4 d.p.i. 10‑15 Seroconversion depending on age

Rhesus 1‑5 Loss of appetite/neutropenia and lymphopenia/ 7 log10 RNA 31 macaques pneumonia/lungs infiltrated with lymphocytes and copies/swab in oedema 2 d.p.i.

pfu, plaque‑forming units; TCID50, Tissue culture infectious dose 50

Table II. Animal model used to exhibit the effectiveness of repurposed drugs against SARS‑CoV‑2infection Repurposed drugs Mechanism of action Animal model Reference Lopinavir/ritonavir Protease inhibitors Ferrets 33 Favipiravir Nucleotide analogue. Inhibits the viral RdRp Syrian hamsters 34 Remdesivir (GS‑5734) Nucleotide analogue. Inhibits the viral RdRp Rhesus macaques 35 Hydroxychloroquine Increasing endosomal pH, Cynomolgus macaques, 33,34,36,37 immunomodulater, autophagy inhibitors ferrets and Syrian hamsters RdRp, RNA‑dependent RNA polymerase and emtricitabine-tenofovir for their efficacy against Hamsters SARS-CoV-233(Table II). Golden Syrian hamsters are susceptible to SARS-CoV Liu et al38 reported gene signatures of SARS- and SARS-CoV-2 infection39,40 but not to MERS- CoV-2 infection in ferrets for both short-term (three CoV41. Both SARS-CoV and SARS-CoV-2 use ACE-2 days) and long-term (21 days) infection. The genes to enter the cell. Comparison of hamster ACE-2 to its involved in the immune response showed higher human homologue shows that 29 amino acid residues expression during long-term SARS-CoV-2 infection are conserved between the human and hamster. The in ferrets. Further network analysis revealed that spike protein of SARS-CoV-2 interacts strongly with metabolic, glucocorticoid and reactive oxygen species- ACE-2 receptor of hamsters due to the presence of associated genes were enriched in both short- and long- asparagine at 82nd position in the ACE-2 receptor27,42. term infection models38. These studies suggest that High-affinity interaction between hamster ACE-2 ferrets are good model to study SARS-CoV-2 disease with SARS-CoV-2 RBD makes lung epithelial cells pathogenesis and potential targets for therapy. permissive to the virus. 20 INDIAN J MED RES January & February 2021

5.5 Syrian hamsters exposed to 1×10 TCID50 SARS- Transgenic mice CoV-2 showed progressive weight loss till six d.p.i, Wild mice are not susceptible to SARS-CoV-2. after which animals started gaining weight43. Viral RNA The Asn31 and Ser82 amino acids in mice ACE-2 was detected in respiratory tract, kidney and intestine prevent the interaction of ACE-2 with spike protein with serum neutralizing antibodies from 3 to 5 d.p.i.43. 27 RBD due to electrostatic or hydrophilic repulsion. Due Chan et al challenged golden Syrian hamsters IN with to the presence of ACE-2, His353 in mice cannot form SARS-CoV-2, isolated from a patient in Hong Kong, at 5 salt bridge with RBD. This poor interaction between a dose of 10 pfu. The hamster tested positive for SARS- mice ACE-2 and SARS-CoV-2 makes wild-type mice CoV-2 on four d.p.i. and lung histopathology showed an unsuitable model46. inflammation with alveolar haemorrhage and necrosis. The signs of lethargy, increased respiratory rate and However, genetic manipulation in standard inbred weight loss were observed 2-4 d.p.i. In addition, infected mouse strains (C57BL6, BALB/c or 129S) to express hamsters exhibited extra-pulmonary manifestations such human receptor ACE-2 and DPP4 has been used as an as myocardial degenerative changes, intestinal mucosal alternate strategy to develop SARS-CoV-2 permissive inflammation and lymphoid necrosis, similar to the mouse model47. Transgenic mice strain HB-01–expressing clinical manifestations such as heart failure, diarrhoea hACE2 receptor developed by Bao et al28 showed high and lymphopaenia seen in humans (Table I). In female susceptibility to IN inoculation of SARS-CoV-2 at a 6 dosage of 105 TCID . These mice showed marked hamsters exposed to 2×10 TCID50, viral replication was 50 observed in lungs on one d.p.i. whereas in ileum and weight loss, virus replication, infiltration of lymphocytes stools on 2-3 d.p.i. Clinical symptoms included slight and monocytes in alveolar interstitium and accumulation 28 weight loss, bronchopneumonia and peri-bronchial of macrophages in alveolar cavities at 3-5 d.p.i. . inflammation34. Transmission of SARS-CoV-2 through Similarly, another transgenic mouse (HFH4-hACE2 direct contact was established and faecal-oral route was mice) expressing the human ACE-2 protein created by 48 debunked34. Young and mature hamster model exposed to Jiang et al developed interstitial pneumonia upon IN 4 5.6 a dose of 10 pfu through IN and ocular routes developed inoculation of 3×10 TCID50 virus. The lung lesions were pneumonia, pulmonary oedema, alveolar haemorrhage similar to the lesions observed in COVID-19–infected and a dose-dependent change in body weight44. Unlike humans. The tissue tropism of SARS-CoV-2 infection observations made by Chan et al27, viral titre was and viral quantification revealed lungs as the major site similar in lung and nasal turbinate. Administration of of infection. SARS-CoV-2 viral RNA was also detected 48 convalescent plasma in infected hamsters reduced the in the eye, heart and brain in some infected mice . viral replication in the respiratory tract44. Further, an Another transgenic mice developed using adenovirus aged hamster model has been developed by Osterrieder vector also successfully imitated the manifestations of 49 50 et al45. Aged hamsters exposed IN to SARS-CoV-2 at a SARS-CoV-2 infection . Sun et al utilized CRISPR/ dose of 1×105 pfu presented more weight loss compared Cas9 knock in technology to express hACE2 receptor to younger hamsters. However, no difference in body in C57BL6 mice. Aged hACE2-expressing mice lost 10 per cent body weight, while no symptoms were observed temperature was noted between the two groups. Although 5 the viral titres at initial time points were higher in young in young mice after inoculation with 4×10 pfu SARS- hamsters, rapid clearance of virus was seen in younger CoV-2 infection. Viral replication was observed in lung, trachea and brain tissue (~7-8 log RNA copies/g). hamsters. Faster recovery was associated with a higher 10 Infection via intragastric route was also established in level of neutralizing antibody titres and a higher influx of 50 immune cells in the lungs in aged hamsters45. these mice . Thus, transgenic mice can be useful tool to study the pathophysiology of the SARS-CoV-2 infection. The passive immunization of hamsters on one d.p.i. with convalescent serum, from SARS-CoV-2 infected Primate models hamsters, resulted in reduced viral load27. This suggests Non-human primates (NHPs) models are that hamsters recapitulate clinical symptoms of human phylogenetically closest to humans, with 93.54 per cent COVID-19 and can be useful for research on convalescent genome similarity51. Akin to humans, NHPs models plasma therapy27. Syrian hamsters have also been also tested positive after exposure to the SARS-CoV-2 employed as an infection model to test favipiravir and and showed clinical symptoms such as mild-to-severe hydroxychloroquine against SARS-CoV-234 (Table II). pneumonia, elevated body temperature, viral shedding, MUNSHI et al: PRECLINICAL SARS-CoV-2 ANIMAL MODELS 21 chest radiographic abnormality, inflammation and were similar to those of mild cases of COVID-19 in immune cell infiltration within lungs51-53. humans. In addition, the infected rhesus macaques were protected from re-infection53. Rhesus macaques that are Despite significant homology in ACE-2 receptors protected from re-infection of SARS-CoV-2 is further between human and NHPs, differences were observed substantiated by a study, conducted by Deng et al55. in the viral latency and clinical features of COVID-19. These differences could be attributed to subtle Among the new world monkeys, marmosets immunological variations and expression levels of have been used to study the viral infection. However, ACE-2 between the two species. NHP models are compared with marmosets, old world monkeys seem to believed to be more approximate to human in terms of be a better animal model as reported in the comparative recapitulating human SARS-CoV-2 infection. study conducted by Lu et al51. Rhesus macaques, Cynomolgus macaques and marmosets were exposed Some of the COVID-19–associated conditions such to SARS-CoV-2 with 106 pfu dose. Among the three, as effects of SARS-CoV-2 in aged individuals can be the old-world monkeys were reported to support viral studied using NHPs. Yu et al54 developed an aged NHPs replication with clinical symptoms similar to humans. infected with SARS-CoV-2. Old NHPs developed more Clinical manifestations of viral infection included a rise severe interstitial pneumonia compared with young in body temperature, abnormal computed tomography monkeys. Such models can provide insight into the scans, lymphopaenia, esoinopenia, inflammation in liver various causes of high mortality in aged individuals54. and heart, viral shedding. Moreover, viral RNA copies African Green monkey (Chlorocebuss abaeus) were detected in nasal and oral swabs in old world challenged with viral isolates, obtained from Italy, monkeys51. through intratracheal (IT) and IN routes showed elevated In addition to investigating viral pathogenesis, body temperature and acute systemic inflammation on some drugs have been tested for their efficacy against two d.p.i. and multifocal pulmonary lesions on five coronaviruses in NHPs. Remdesivir and lopinavir/ d.p.i. Viral RNA was detected in the mucosal swabs ritonavir have been tested against SARS-CoV and and bronchoalveolar lavage (BAL) fluid29 (Table I). MERS-CoV in the marmoset model, respectively56. In another study, cynomolgus macaques (Macaca fascicularis) were inoculated with SARS-CoV-2 A DNA vaccine candidate expressing various isolates, through IT and IN routes30. The Cynomolgus spike protein immunogens has been tested on rhesus macaques were susceptible to infection without any macaques57. The vaccine protected against SARS- overt clinical symptoms. However, viral shedding and CoV-2 as evident by substantial reductions in viral replication were observed in respiratory tract, ileum, loads in BAL and nasal swabs, in immunized animals57 colon and tonsil. All these macaques inoculated with (Table III). An intramuscular dose of ChAdOx1 SARS-CoV-2 showed seropositivity and lung lesions nCoV-19 (adenovirus vector) vaccine candidate in on 14 d.p.i. Viral RNA was detected in nasal swabs rhesus macaques protected against the challenge from with the highest titre in older macaques on four d.p.i30 SARS-CoV-2 in both upper and lower respiratory (Table I). Chandrashekar et al31, inoculated rhesus tract. Vaccination resulted in the absence of any lesion macaques (Macacamulatta) with SARS-CoV-2 through from pneumonia and the absence of viral RNA in the IN and IT routes at a dose of 104 pfu. The viral RNA lung tissue58. The utility of NHPs in testing of vaccine was detected on two d.p.i. and symptoms such as loss is further corroborated by a study conducted by of appetite and interstitial pneumonia were observed. Yadav et al59, which tested three different whole virion- These macaques were also protected from re-infection inactivated vaccines including BBV152 vaccine, in with SARS-CoV-2 after 35 d.p.i. indicating neutralizing rhesus macaques. In the study59, 20 macaques were antibodies generated in the primary infection, could divided into four groups consisting of five each. One protect macaques against secondary infection31 (Table group received placebo while other three groups were I). These findings were replicated by Shan et al53 where vaccinated with three different vaccine using two-dose rhesus macaques infected with SARS-CoV-2 developed vaccine regimen. All the macaques were challenged pneumonia, and the virus could be detected in the with SARS-CoV-2 14 days after the administration respiratory tract tissues including trachea, bronchus of second dose of the vaccine. Three weeks after and lungs. The symptoms exhibited by rhesus macaque immunization, significantly increased levels of 22 INDIAN J MED RES January & February 2021

Table III. Animal model used to exhibit the effectiveness of vaccines against SARS‑CoV‑2 infection Vaccine type Design strategy Animal model Reference DNA vaccine Full length and truncated forms of Rhesus macaques 58 SARS‑CoV‑2 Spike gene Vector (ChAdOx1 Adenovirus vector expressing Rhesus macaques and mice 59 nCoV‑19) SARS‑CoV‑2 Spike protein Inactivated virus Undisclosed Rhesus macaques 60 RNA vaccine SARS‑CoV‑2 S gene mRNA encapsulated Rhesus macaques and mice 61,62 in nanoparticle Inactivated virus Inactivation of virus using β‑propiolactone Rhesus macaques, mice and rats 63 DNA vaccine (INO‑4800) Construct with SARS‑CoV‑2 S gene Mice and guinea pigs 64

neutralizing antibody (IgG) titre were detected from infection and can recapitulate the clinical features the vaccinated group. Histopathological examination of COVID-19 including lung histology, pulmonary revealed the absence of pneumonia in vaccinated inflammation and pneumonia. The limitations with group compared with placebo group which exhibited transgenic mice are aberrant expression of receptor interstitial pneumonia, presence of antigen in alveolar on all cells types which may change tissue or cellular epithelium and macrophages59.Similarly, other vaccine tropism of virus. Golden Syrian hamsters have also candidates such as RNA vaccine and inactivated exhibited symptoms as seen humans such as weight vaccine (Table III) have been tested on rhesus macaques loss, viral replication in the upper respiratory tract and to understand the vaccine-mediated immune response presence of antibody in the plasma. However, caveat and to evaluate the efficacy of vaccine60,62. with hamster model is limited availability of research reagents compared with mice. Conclusion Animal models can be utilized to identify Although the clinical presentations of COVID-19 novel targets, host cell-virus interactions, to study are now being better understood, the pathophysiology immunological response at different stages of the and long-term sequelae of disease are yet to be disease and to invent antiviral drugs or vaccines against completely known in humans. Animal models could SARS-CoV-2. However, continuous refinement is play an important role in bridging gap between needed to develop suitable animal model recapitulating SARS-CoV-2 infection and disease progression of COVID-19 pathogenesis and its sequelae in human. COVID-19. Significant progress has been made in the development of small and large animal models for Acknowledgment: The first author (IM) acknowledges the understanding pathogenesis of SARS-CoV-2 infection. Lady Tata Memorial Trust for fellowship. The second author (AK) NHPs are phylogenetically closest to humans and acknowledges the Council of Scientific and Industrial Research, show natural susceptibility to SARS-CoV-2 infection. New Delhi, for fellowship. The third author (SMC) thanks Science The comparable susceptibility has been attributed and Engineering Research Board for providing fellowship. to homologue hACE2 receptor present in NHPs. However, the severity of COVID-19 progression Financial support & sponsorship: Authors acknowledge and the development of symptoms in the NHPs are the Indian Council of Medical Research, Department of Health relatively milder as compared to severe cytokine storm Research, Government of India, for financial support. and fatality seen in humans. Limited numbers of NHPs have been used to develop comorbid and aged model Conflicts of Interest: None. mimicking the human conditions; however, NHPs pose substantial limitations on their use in high-throughput References studies involving large number of animals. 1. Lu R, Zhao X, Li J, Niu P, Yang B, Wu H, et al. Genomic characterisation and epidemiology of 2019 novel coronavirus: Genetically engineered transgenic mice expressing Implications for virus origins and receptor binding. Lancet hACE-2 receptor are permissive to SARS-CoV-2 2020; 395 : 565-74. MUNSHI et al: PRECLINICAL SARS-CoV-2 ANIMAL MODELS 23

2. World Health Organization. WHO SARS (Severe Acute 16. Mckee DL, Sternberg A, Stange U, Laufer S, Naujokat C. Respiratory Syndrome). Available from: https://www.who.int/ Candidate drugs against SARS-CoV-2 and COVID-19. ith/diseases/sars/en/, accessed on October 15, 2020. Pharmacol Res 2020; 157 : 104859. 3. World Health Organization. Middle East respiratory 17. Maisonnasse P, Guedj J, Contreras V, Behillil S, Solas C, syndrome coronavirus (MERS-CoV). Available from: https:// Marlin R, et al. Hydroxychloroquine use against SARS- www.who.int/news-room/fact-sheets/detail/middle-east- CoV-2 infection in non-human primates. Nature 2020; 585 : respiratory-syndrome-coronavirus-(mers-cov), accessed on 584-7. October 15, 2020. 18. Hoffmann M, Kleine-Weber H, Schroeder S, Krüger N, 4. Lau SK, Luk HK, Wong AC, Li KS, Zhu L, He Z, et al. Herrler T, Erichsen S, et al. SARS-CoV-2 cell entry depends Possible bat origin of severe acute respiratory syndrome on ACE2 and TMPRSS2 and is blocked by a clinically proven coronavirus 2. Emerg Infect Dis 2020; 26 : 1542-7. protease inhibitor. Cell 2020; 181 : 271-280.e8. 5. Chan JF, Kok K. Correction to: Genomic characterization of 19. Zhao X, Chen D, Szabla R, Zheng M, Li G, Du P, et al. Broad the 2019 novel human-pathogenic coronavirus isolated from a and differential animal ACE2 receptor usage by SARS-CoV-2. patient with atypical pneumonia after visiting Wuhan. Emerg J Virol 2020; 94 : e00940-20. Microbes Infect 2020; 9 : 540. 20. Mykytyn AZ, Lamers MM, Okba NM, Breugem TI, van den 6. Lauer SA, Grantz KH, Bi Q, Jones FK, Zheng Q, Doel PB, van Run P, et al. Susceptibility of rabbits to SARS- CoV-2. Emerg Microbes Infect 2021; 10 : 1-7. Meredith HR, et al. The incubation period of coronavirus disease 2019 (COVID-19) from publicly reported confirmed 21. Capraro GA, Johnson JB, Kock ND, Parks GD. Virus cases: Estimation and application. Ann Intern Med 2020; growth and antibody responses following respiratory tract 172 : 577-82. infection of ferrets and mice with WT and P/V mutants of the paramyxovirus Simian Virus 5. Virology 2008; 376 : 416-28. 7. Li Q, Guan X, Wu P, Wang X, Zhou L, Tong Y, et al. Early transmission dynamics in Wuhan, China, of novel coronavirus- 22. Chan KF, Carolan LA, Korenkov D, Druce J, Mccaw J, infected pneumonia. N Engl J Med 2020; 382 : 1199-207. Reading PC, et al. Investigating viral interference between influenza a virus and human respiratory syncytial virus in a 8. Guan W, Ni Z, Hu Y, Liang W, Ou C, He J, et al. Clinical ferret model of infection. J Infect Dis 2018; 218 : 406-17. characteristics of coronavirus disease 2019 in China. N Engl J Med 2020; 382 : 1708-20. 23. Park SJ, Kim EH, Kwon HI, Song MS, Kim SM, Kim YI, et al. Altered virulence of highly pathogenic avian influenza (Hpai) 9. Chen N, Zhou M, Dong X, Qu J, Gong F, Han Y, et al. h5n8 reassortant viruses in mammalian models. Virulence Epidemiological and clinical characteristics of 99 cases of 2018; 9 : 133-48. 2019 novel coronavirus pneumonia in Wuhan, China: A descriptive study. Lancet 2020; 395 : 507-13. 24. Enkirch T, von Messling V. Ferret models of viral pathogenesis. Virology 2015; 479-80 : 259-70. 10. Huang C, Wang Y, Li X, Ren L, Zhao J, Hu Y, et al. Clinical 25. Martina BE, Haagmans BL, Kuiken T, Fouchier RA, features of patients infected with 2019 novel coronavirus in Rimmelzwaan GF, van Amerongen G, et al. SARS virus Wuhan, China. Lancet 2020; 395 : 497-506. infection of cats and ferrets. Nature 2003; 425 : 915. 11. Wang D, Hu B, Hu C, Zhu F, Liu X, Zhang J, et al. Clinical 26. Kim Y Il, Kim SG, Kim SM, Kim EH, Park SJ, Yu KM, et al. characteristics of 138 hospitalized patients with 2019 novel Infection and rapid transmission of SARS-CoV-2 in ferrets. coronavirus-infected pneumonia in Wuhan, China. J Am Med Cell Host Microbe 2020; 27 : 704-9.e2. Assoc 2020; 323 : 1061-9. 27. Chan JF, Zhang AJ, Yuan S, Poon VK, Chan CC, Lee AC, 12. Pan X, Chen D, Xia Y, Wi S, Li T, Ou X, et al. Asymptomatic et al. Simulation of the clinical and pathological manifestations cases in a family cluster with SARS-CoV-2 infection. Lancet of coronavirus disease 2019 (COVID-19) in golden Syrian Infect Dis 2020; 20 : 410-1. hamster model: Implications for disease pathogenesis and 13. Hu Z, Song C, Xu C, Jin G, Chen Y, Xu X, et al. Clinical transmissibility. Clin Infect Dis 2020; 71 : 2428-46. characteristics of 24 asymptomatic infections with COVID-19 28. Bao L, Deng W, Huang B, Gao H, Liu J, Ren L, et al. The screened among close contacts in Nanjing, China. Sci China pathogenicity of SARS-CoV-2 in hACE2 transgenic mice. Life Sci 2020; 63 : 706-11. Nature 2020; 583 : 830-3. 14. Wang Y, Liu Y, Liu L, Wang X, Luo N, Li L. Clinical outcomes 29. Woolsey CB, Borisevich V, Prasad AN, Agans KN, Deer DJ, in 55 patients with severe acute respiratory syndrome Dobias NS, et al. Establishment of an African green monkey coronavirus 2 who were asymptomatic at hospital admission model for COVID-19 and protection against re-infection. Nat in Shenzhen, China. J Infect Dis 2020; 221 : 1770-4. Immunol 2020; 22 : 86-98. 15. BIO. COVID-19 Therapeutic Development Tracker. 30. Rockx B, Kuiken T, Herfst S, Bestebroer T, Lamers MM, Available from: https://www.bio.org/policy/human- Munnink BB, et al. Comparative pathogenesis of COVID-19, health/vaccines-biodefense/coronavirus/pipeline- MERS, and SARS in a nonhuman primate model. Science tracker, accessed on December 8, 2020. 2020; 368 : 1012-5. 24 INDIAN J MED RES January & February 2021

31. Chandrashekar A, Liu J, Martino AJ, McMahan K, Mercad NB, 45. Osterrieder N, Bertzbach LD, Dietert K, Abdelgawad A, Peter L, et al. SARS-CoV-2 infection protects against Vladimirova D, Kunec D, et al. Age-dependent progression of rechallenge in rhesus macaques. Science 2020; 369 : 812-7. SARS-CoV-2 infection in syrian hamsters. Viruses 2020; 12 : 32. Shi J, Wen Z, Zhong G, Yang H, Wang C, Huang B, et al. 779. Susceptibility of ferrets, cats, dogs, and other domesticated 46. Wan Y, Shang J, Graham R, Baric RS, Li F. Receptor animals to SARS-coronavirus 2. Science 2020; 368 : 1016-20. recognition by the novel coronavirus from Wuhan: An analysis 33. Park SJ, Yu KM, Kim Y I, Kim SM, Kim EH, Kim SG, et al. based on decade-long structural studies of SARS coronavirus. Antiviral efficacies of FDA-approved drugs against SARS- J Virol 2020; 94 : 1-9. COV-2 infection in ferrets. MBio 2020; 11 : e01114-20 47. Sun J, Zhuang Z, Zheng J, Li K, Wong RLY, Liu D, et al. 34. Kaptein SJ, Jacobs S, Langendries L, Seldeslachts L, Generation of a broadly useful model for COVID-19 ter Horst S, Liesenborghs L, et al. Antiviral treatment pathogenesis, vaccination, and treatment. Cell 2020; 182 : of SARS-CoV-2-infected hamsters reveals a weak 734-43.e5. effect of favipiravir and a complete lack of effect for 48. Jiang RD, Liu MQ, Chen Y, Shan C, Zhou YW, Shen XR, et al. hydroxychloroquine. Available from: https://www.biorxiv.org/ Pathogenesis of SARS-CoV-2 in transgenic mice expressing content/10.1101/2020.06.19.159053v1, accessed on February human angiotensin-converting enzyme 2. Cell 2020; 182 : 24,2021. 50-8.e8. 35. Williamson BN, Feldmann F, Schwarz B, Meade- 49. Hassan AO, Case JB, Winkler ES, Thackray LB, Kafai NM, White K, Porter DP, Schulz J, et al. Clinical benefit of Bailey AL, et al. A SARS-CoV-2 infection model in mice remdesivir in rhesus macaques infected with SARS-CoV-2. demonstrates protection by neutralizing antibodies. Cell 2020; Nature 2020; 585 : 273-6. 182 : 744-53.e4. 36. Maisonnasse P, Guedj J, Contreras V, Behillil S, Solas 50. Sun SH, Chen Q, Gu HJ, Yang G, Wang YX, Huang XY, et al. C, Marlin R, et al. Hydroxychloroquine in the treatment A mouse model of SARS-CoV-2 infection and pathogenesis. and prophylaxis of SARS-CoV-2 infection in non-Human Cell Host Microbe 2020; 28 : 124-33.e4. primates. Nature 2020; 585 : 584-7. 51. Gibbs RA, Rogers J, Katze MG, Bumgarner R, Weinstock 37. Rosenke K, Jarvis M, Feldmann F, Schwarz B, Okumura A, GM, Mardis ER, et al. Evolutionary and biomedical insights Lovaglio J, et al. Hydroxychloroquine proves ineffective in from the rhesus macaque genome. Science 2007; 316 : 222- hamsters and macaques infected with SARS-CoV-2. JCI 34. Insight 2020; 5 : e143174. 52. Lu S, Zhao Y, Yu W, Yang Y, Gao J, Wang J, et al. Comparison 38. Liu HL, Yeh IJ, Phan NN, Wu YH, Yen MC, Hung JH, et al. of SARS-CoV-2 infections among 3 species of non-human Gene signatures of SARS-CoV/SARS-CoV-2-infected ferret primates. Signal Transduct Target Ther 2020; 5 : 157. lungs in short- and long-term models. Infect Genet Evol 2020; 85 : 104438. 53. Munster VJ, Feldmann F, Williamson BN, van Doremalen N, Pérez-Pérez L, Schulz J, et al. Respiratory disease in rhesus 39. Roberts A, Lamirande EW, Vogel L, Jackson JP, Paddock CD, macaques inoculated with SARS-CoV-2. Nature 2020; 585 : Guarner J, et al. Animal models and vaccines for SARS-CoV 268-72. infection. Virus Res 2008; 133 : 20-32. 54. Shan C, Yao YF, Yang X Lou, Zhou YW, Gao G, 40. Lamirande EW, DeDiego ML, Roberts A, Jackson JP, Peng Y, et al. Infection with novel coronavirus (SARS-CoV-2) Alvarez E, Sheahan T, et al. A live attenuated severe acute causes pneumonia in Rhesus macaques.Cell Res 2020; 30 : respiratory syndrome coronavirus is immunogenic and 670-7. efficacious in golden syrian hamsters. J Virol 2008; 82 : 7721-4. 55. Yu P, Qi F, Xu Y, Li F, Liu P, Liu J, et al. Age-related rhesus 41. de Wit E, Prescott J, Baseler L, Bushmaker T, Thomas T, macaque models of COVID-19. Anim Model Exp Med 2020; Lackemeyer MG, et al. The Middle East respiratory syndrome 3 : 93-7. coronavirus (MERS-CoV) does not replicate in syrian hamsters. PLoS One 2013; 8 : 3-8. 56. Deng W, Bao L, Liu J, Xiao C, Liu J, Xue J, et al. Primary exposure to SARS-CoV-2 protects against reinfection in 42. Luan J, Lu Y, Jin X, Zhang L. Spike protein recognition of Rhesus macaques. Science 2020; 369 : 818-23. mammalian ACE2 predicts the host range and an optimized ACE2 for SARS-CoV-2 infection. Biochem Biophys Res 57. Sheahan TP, Sims AC, Graham RL, Menachery VD, Commun 2020; 526 : 165-9. Gralinski LE, Case JB, et al. Broad-spectrum antiviral GS- 5734 inhibits both epidemic and zoonotic coronaviruses. Sci 43. Mohandas S, Jain R, Yadav P, Shete-Aich A, Sarkale P, Transl Med 2017; 9 : eaal3653. Kadam M, et al. Evaluation of the susceptibility of mice & hamsters to SARS-CoV-2 infection. Indian J Med Res 2020; 58. Yu J, Tostanosk LH, Peter L, Mercad NB, McMahan K, 151 : 479-82. Mahrokhia SH, et al. DNA vaccine protection against 44. Imai M, Iwatsuki-Horimoto K, Hatta M, Loeber S, SARS-CoV-2 in rhesus macaques. Science (80- ) 2020; 369 : Halfmann PJ, Nakajima N, et al. Syrian hamsters as a small 806-11. animal model for SARS-CoV-2 infection and countermeasure 59. van Doremalen N, Lambe T, Spencer A, Belij-Rammerstorfer S, development. Proc Natl Acad Sci U S A 2020; 117 : 16587-95. Purushotham J, Port J, et al. ChAdOx1 nCoV-19 vaccination MUNSHI et al: PRECLINICAL SARS-CoV-2 ANIMAL MODELS 25

prevents SARS-CoV-2 pneumonia in rhesus macaques. Nature 62. McKay PF, Hu K, Blakney AK, Samnuan K, Brown JC, 2020; 586 : 578-82. Penn R, et al. Self-amplifying RNA SARS-CoV-2 lipid nanoparticle vaccine candidate induces high neutralizing 60. Yadav P, Kumar S, Patil D, Mohandas S, Shete A, Bhati G, antibody titers in mice. Nat Commun 2020; 11 : 3523. et al. Remarkable immunogenicity and protective efficacy 63. Gao Q, Bao L, Mao H, Wang L, Xu K, Yang M, et al. of BBV152, an inactivated SARS-CoV-2 vaccine in rhesus Development of an inactivated vaccine candidate for SARS- macaques. Nat Commun 2021; 12 : 1386. CoV-2. Science 2020; 369 : 77-81. 61. Callaway E. Coronavirus vaccine trials have delivered their 64. Smith TR, Patel A, Ramos S, Elwood D, Zhu X, Yan J, et al. first results ‑ But their promise is still unclear. Nature 2020; Immunogenicity of a DNA vaccine candidate for COVID-19. 581 : 363-4. Nat Commun 2020; 11 : 2601.

For correspondence: Dr Uddhav K. Chaudhari, Division of Primate Biology, ICMR-National Institute for Research in Reproductive Health, Jehangir Merwanji Street, Parel, Mumbai 400 012, Maharashtra, India e-mail: [email protected] Quick Response Code: Review Article

Indian J Med Res 153, January & February 2021, pp 26-63 DOI: 10.4103/ijmr.IJMR_2556_20

Emerging trends from COVID-19 research registered in the Clinical Trials Registry - India

M. Vishnu Vardhana Rao†, Atul Juneja†, Mohua Maulik, Tulsi Adhikari†, Saurabh Sharma†, Jyotsna Gupta, Yashmin Panchal & Neha Yadav

Clinical Trials Registry-India, †ICMR-National Institute of Medical Statistics, New Delhi, India

Received June 16, 2020

Since the beginning of the year, the deadly coronavirus pandemic, better known as coronavirus disease 2019 (COVID-19), brought the entire world to an unprecedented halt. In tandem with the global scenario, researchers in India are actively engaged in the conduct of clinical research to counter the pandemic. This review attempts to provide a comprehensive overview of the COVID-19 research in India including design aspects, through the clinical trials registered in the Clinical Trials Registry - India (CTRI) till June 5, 2020. One hundred and twenty two registered trials on COVID-19 were extracted from the CTRI database. These trials were categorized into modern medicine (n=42), traditional medicine (n=67) and miscellaneous (n=13). Of the 42 modern medicine trials, 28 were on repurposed drugs, used singly (n=24) or in combination (n=4). Of these 28 trials, 23 were to evaluate their therapeutic efficacy in different severities of the disease. There were nine registered trials on cell- and plasma-based therapies, two phytopharmaceutical trials and three vaccine trials. The traditional medicine trials category majorly comprised Ayurveda (n=45), followed by homeopathy (n=14) and others (n=8) from Yoga, Siddha and Unani. Among the traditional medicine category, 31 trials were prophylactic and 36 were therapeutic, mostly conducted on asymptomatic or mild-to-moderate COVID-19 patients. This review would showcase the research being conducted on COVID-19 in the country and highlight the research gaps to steer further studies.

Key words Ayurveda, Yoga and Naturopathy, Unani, Siddha, Homeopathy - clinical trials - CTRI-India - convalescent plasma therapy - COVID-19 - drug trials - registration - vaccine trials

The novel coronavirus disease 2019 (COVID-19), tirelessly to not only save lives but also search for caused by severe acute respiratory syndrome effective treatment modalities against the deadly virus. coronavirus 2 (SARS-CoV-2), was first reported from Drug development is a costly and time-consuming Wuhan, China, in December 2019. Since then, the process and is not feasible in the context of the disease has spread worldwide and as of June 5, 2020, immediate global challenge. Therefore, drug 1 there were 6,824,499 cases and 408,307 deaths globally . repurposing strategies are being considered to develop In the absence of any vaccine or definitive safe and effective treatment regimens against the therapeutic strategy, medical scientists are working disease. Currently, an array of drugs used for the other

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 26 RAO et al: COVID-19 TRIALS IN CTRI, INDIA 27 health conditions are being studied for the treatment trials on COVID-19 registered in the CTRI (as on of COVID-19 in several hundred clinical trials around June 5, 2020), 42 were on the modern system of the globe2. medicine, 67 on the traditional system of medicine and 13 miscellaneous (Table I). Overall, there were Globally, clinical trial registries may be considered the best source to review the ongoing clinical trial 23 single-armed trials, 68 randomized trials and scenario as crucial details pertaining to proposed six cluster randomized trials, while there were intervention, study type and design, sample size, and 17 non-randomized and eight other (unspecified study outcomes and phase of the trial are publicly available. design) trials. Most of these trials were either Phase 2 The Clinical Trials Registry - India (CTRI), one of the (n=31) or Phase 2/3 (n=13) trials or Phase 3 (n=23) primary registries of the World Health Organization’s or Phase 3/4 (n=7) trials. Phase was not applicable International Clinical Trial Registry Platform (ICTRP), for 34 trials, and there were only two Phase 1 and is one such database3,4. five Phase 1/2 trials (Tables II-IV). Of the remaining trials, four trials were marked as Phase 4 trials and The CTRI, set up under the aegis of the Indian two as post-marketing surveillance studies. There was Council of Medical Research (ICMR), is managed a wide variation in sample size in the registered trials by the ICMR-National Institute of Medical Statistics, ranging from 6 to 50,000. New Delhi. The CTRI is a free online registry that prospectively registers clinical trials being conducted Modern medicine in India and also in countries which do not have a Trials registered in this category (n=42) are primary registry of their own. With the emergence of subdivided into drug trials (n=28), of which 24 trials the pandemic in India, there has been a steady increase are on individual drugs which primarily evaluate in the registration of clinical trials on COVID-19 in their therapeutic efficacy (n=19) as do all of the four the CTRI. Here, we present a comprehensive overview combination of drug trials (such as the global Solidarity of the COVID-19 trials registered in the CTRI trial). These trials are being conducted in patients with (Tables I-IV). While the results of these trials will varying severity of COVID-19 ranging from mild to decide whether or not any of these proposed therapies moderate to severe. The severity of COVID-19 has not are likely to be of use, information about these would been specified in seven of these drug trials (Table I). help to identify lacunae as well as plan and guide future Others include trials on phytopharmaceuticals (n=2) clinical research. cell- and plasma-based therapies (n=9) and biological Trial data extraction products (n=3). Only one of these is a prophylactic trial on healthy volunteers and all cell- and plasma-based One hundred and twenty three registered therapy trials are on either moderate/moderate to COVID-19 trials were extracted from the CTRI severe or severe (n=5) COVID-19 patients. While the database using the term %covid% in the different key features of these registered trials are presented in fields of the CTRI data set. These trials were manually Table II, these are briefly discussed below. screened and analyzed. One trial was excluded because COVID-19 was in the exclusion criteria in that trial. Drug trials The remaining 122 trials were tabulated into three Antivirals categories: modern medicine (including drug trials as well as phytopharmaceuticals, cell- and plasma-based Solidarity trial: The Solidarity trial is an international therapies and biological products trials); traditional clinical trial initiated by the WHO to help find medicine covering Ayurveda, Yoga and Naturopathy, an effective treatment for COVID-195. The trial Unani, Siddha, Homeopathy (AYUSH) trials and compares four treatment options remdesivir; miscellaneous trials. lopinavir/ritonavir; lopinavir/ritonavir with interferon beta-1a and chloroquine or COVID-19 trial scenario in India hydroxychloroquine (HCQ) against standard of Multiple therapeutic and preventive trials care, to assess their relative effectiveness against including those in the traditional systems of COVID-19. The Solidarity trial has been planned medicine are being conducted in India with the as an open-labelled, randomized, parallel-group, common global objective of demonstrating efficacy multiple-arm trial with a total sample size of as well as safety for all in need. Of the 122 clinical 7000 participants, of whom 1500 participants are 28 INDIAN J MED RES, January & February 2021

Table I. An overview of 122 COVID‑19 trials registered in the Clinical Trials Registry ‑ India# Intervention Number Type of trial Participant health condition Modern medicine (n=42) Drug (n=28) Individual drugs 24 Therapeutic efficacy=19 Healthy volunteers at high risk ‑ 4 Prophylactic efficacy=5 Healthy volunteers at moderate/high risk ‑ 1 Mild COVID‑19 ‑ 5 Mild‑to‑moderate COVID‑19 ‑ 1 Moderate COVID‑19 ‑ 1 Moderate‑to‑severe COVID‑19 ‑ 2 Severe COVID‑19 ‑ 4 Severity not specified ‑ 6 Combination drugs 4 Therapeutic efficacy=4 Moderate COVID‑19 ‑ 1 Mild, moderate, severe COVID‑19 ‑ 1 Non‑severe and severe COVID‑19 ‑ 1 Severity not specified ‑ 1 Phytopharmaceutical (n=2) Phytopharmaceutical 2 Therapeutic efficacy=2 Asymptomatic/mild COVID‑19 ‑ 1 Moderate COVID‑19 ‑ 1 Cell‑ and plasma‑based therapies (n=9) Cell‑ and plasma‑based 9 Therapeutic efficacy=9 Moderate COVID‑19 ‑ 1 therapies Moderate‑to‑severe COVID‑19 ‑ 1 Severe COVID‑19 ‑ 5 Severity not specified ‑ 2 Biological products (n=3) Vaccine 3 Therapeutic efficacy=2 Healthy volunteers at high risk ‑ 1 Prophylactic efficacy=1 Moderate‑to‑severe COVID‑19 ‑ 1 Severe COVID‑19 ‑ 1 Traditional medicine (n=67) Ayurveda (n=45) Classical individual 11 Therapeutic efficacy=1 Healthy volunteers at high risk ‑ 1 agents Prophylactic efficacy=10 Healthy volunteers in the community ‑ 9 Asymptomatic/mild symptoms ‑ 1 Classical combination 10 Therapeutic efficacy=4 Healthy volunteers at high risk ‑ 1 preparations* Prophylactic efficacy=6 Healthy volunteers in the community ‑ 5 Asymptomatic/mild symptoms ‑ 3 Mild‑to‑moderate COVID‑19 ‑ 1 Patented products 24 Therapeutic efficacy=18 Healthy volunteers at high risk ‑ 5 Prophylactic efficacy=6 Healthy volunteers in the community ‑ 1 Asymptomatic/mild symptoms ‑ 3 Asymptomatic/mild/moderate symptoms ‑ 2 Mild symptoms ‑ 4 Mild‑to‑moderate COVID‑19 ‑ 6 Moderate COVID‑19 ‑ 1 Moderate‑to‑severe COVID‑19 ‑ 1 Severe COVID‑19 ‑1 Yoga (n=3) Yoga* 3 Therapeutic efficacy=2 Healthy volunteers at high risk ‑ 1 Stress management=1 Asymptomatic/mild symptoms ‑ 1 Asymptomatic/uncomplicated illness/mild pneumonia ‑ 1 Contd... RAO et al: COVID-19 TRIALS IN CTRI, INDIA 29

Intervention Number Type of trial Participant health condition Unani (n=2) Unani 2 Prophylactic efficacy=2 Healthy volunteers at risk ‑ 2 Siddha (n=3) Siddha 3 Therapeutic efficacy=2 Healthy volunteers in community and healthcare workers ‑ 1 Prophylactic efficacy=1 Asymptomatic ‑ 1 Asymptomatic/mild/moderate symptoms ‑ 1 Homeopathy (n=14) Homeopathy 14 Therapeutic efficacy=8 Healthy volunteers in community ‑ 3 Prophylactic efficacy=6 Healthy volunteers at high risk ‑ 3 Asymptomatic ‑ 1 Asymptomatic/mild symptoms ‑ 1 Mild ‑ 4 Moderate ‑ 1 Mild/moderate/severe symptoms ‑ 1 Miscellaneous (n=13) Miscellaneous 13 Therapeutic efficacy=2 Healthy volunteers ‑ 4 Prophylactic efficacy=1 Severe COVID‑19 ‑ 1 Process‑of‑care changes=9 Severity not specified ‑ 4 Diagnostic=1 Other (non‑COVID‑19) ‑ 4 #Registered trials as on June 5, 2020; *Two Ayurveda classical combination trials included yoga and one yoga trial included Ayurveda interventions. In addition, one Ayurveda trial was in combination with homeopathy and one miscellaneous trial with combination of modern medicine, Ayurveda and homeopathy

to be enrolled from India from 24 sites. The trial is Chloroquine: Two open-labelled, randomized being conducted in India with the support of ICMR. controlled trials are being conducted to determine the efficacy of chloroquine in COVID-19 patients In addition, a single-centre trial is also underway to who present with severe acute respiratory illness assess the safety and efficacy of antiviral combination (CTRI/2020/04/024479, CTRI/2020/04/024729). therapy such as lopinavir–ritonavir combination and HCQ with ribavirin in severe COVID-19-infected Hydroxychloroquine (HCQ): In India, the ICMR has patients (CTRI/2020/06/025575). proposed a prophylactic dosing schedule of HCQ for healthcare workers9. In this regard, a principal Favipiravir: A nucleoside precursor, favipiravir, investigator (PI)-initiated trial on 500 participants inhibits the influenza virus as well as a number of is currently underway wherein the recommended other RNA viruses6. In keeping with global trends, prophylactic dosing regimen is being compared with a randomized, open-label, multicentre study to an alternative dosing pattern for the prevention of new evaluate the efficacy and safety of favipiravir in infection and adverse outcomes in those at high risk addition to standard supportive care in patients with of infection (CTRI/2020/03/024402). A double-blind, mild-to-moderate COVID-19 is currently underway at Phase 3 clinical trial, sponsored by the Armed Forces 12 sites across India (CTRI/2020/05/025114). Medical Services, aims to evaluate the efficacy of two different doses of HCQ and also to compare the Antimalarials efficacy of HCQ with or without azithromycin in mild, During this pandemic time, chloroquine moderate and severe COVID-19-infected patients. This and HCQ have generated much interest in the trial is being conducted at six sites across the country global community as potential therapeutic agents with 300 participants. against COVID-197. An open-label non-randomized In view of the large-scale use of HCQ in India, trial showed that HCQ - azithromycin was associated a study to document the pharmacokinetics of HCQ with viral load reduction in COVID-19 patients8. in the Indian population has also been registered 30 INDIAN J MED RES, January & February 2021

Contd... KA UK CG, MH (7 sites), GJ (3 sites), DL RJ (2 sites), (2 sites), MP DL, TN (5 sites), MH (7 sites), GJ (4 sites), TS, GJ, AP States and UTs

# Command Airforce, Hospital Bengaluru DCGI approval: N/A AIIMS, Rishikesh DCGI approval: N/A Glenmark Pharmaceuticals Ltd, Mumbai DCGI approval: Yes WHO and ICMR, New Delhi DCGI approval: Yes Sponsor and regulatory status ‑ 2 ‑ 2 virus ‑ PCR result of both ‑ PCR negativity in Number of days hospitalization RT oropharyngeal swab and nasopharyngeal swab) 1. Time to clinical Time 1. recovery to 2019 ‑ nCoV Time 2. RT upper respiratory tract specimen until cessation Time of oral shedding SARS ‑ CoV (time frame: up to 28 days) (time in days to a from randomization negative SARS ‑ CoV cause mortality, All ‑ cause mortality, subdivided by the severity of disease at the time of randomization, measured using patient records throughout the study Primary outcome 32 175 150 size 1500 Sample N/A Phase 3/ Phase 4 Phase 3 Phase 3 Phase Open label Open label Open label Open label Blinding Antivirals Antimalarials Drug trials (n=28) Randomized, parallel ‑ group trial Randomized, parallel ‑ group, multiple ‑ arm trial Randomized, parallel ‑ group trial Randomized, parallel ‑ group, multiple ‑ arm trial Study design

Arm 1: Chloroquine phosphate Arm 2: Standard treatment Arm 1: Favipiravir Arm 2: Standard treatment Arm 2: HCQ, ribavirin, standard treatment (S) Arm 1: HCQ, ribavirin, standard treatment (NS) ritonavir, Arm 3: Lopinavir, ribavirin, standard treatment (S) Arm 4: Standard treatment (NS) Arm 5: Standard treatment Arm 5: Standard treatment Arm 3: Lopinavir with ritonavir Arm 4: Lopinavir with ritonavir plus interferon and standard treatment Arm 1: Remdesivir and standard treatment Arm 2: Chloroquine or HCQ and standard treatment Intervention details

* * 19 registered in the Clinical Trials Registry ‑ India Trials II. Details of modern medicine trials (n=42) on COVID ‑ 19 registered in the Clinical Table CTRI/2020/04/024479 CTRI/2020/05/025114 CTRI/2020/06/025575 Solidarity trial CTRI number CTRI/2020/04/024773 4 3 2 Serial number 1 RAO et al: COVID-19 TRIALS IN CTRI, INDIA 31 Contd... States and UTs HR KL DL TN, KA, DL Sponsor and regulatory status AIIMS New Delhi DCGI approval: N/A PI Aster initiated, Malabar Institute of Medical Sciences, Kozikhode DCGI approval: N/A AIIMS, New Delhi DCGI approval: N/A Institute George for Global Health India, New Delhi DCGI approval: N/A

ii ) time to

) rate of cure or iii Primary outcome The Ct values on 1. days 0, 3, 7, 10 shall be plotted on a graph for all patients. The rate of decline 2. for each patient shall be calculated. The time to cure (COVID ‑ 19 RT PCR ‑ ve) shall be determined. The two groups shall 3. be compared for ( i ) rate of decline Ct values; ( cure; ( alternate outcome Infected non ‑ infected Progression to moderate ‑ to severe disease Laboratory ‑ confirmed symptomatic COVID ‑ 19 cases 60 500 166 size 6950 Sample Phase Phase 2 Phase 3 Phase 2 N/A Blinding Open label Open label Open label Open label Study design Other Randomized, parallel ‑ group, active controlled trial Other Randomized, parallel ‑ group trial

Intervention details Arm 1: Topical chloroquine Topical Arm 1: and standard treatment Arm 2: Standard treatment Arm 1: HCQ Arm 2: HCQ (ICMR regimen) Arm1: HCQ Arm 2: Standard treatment Arm 1: HCQ along with standard treatment Arm 2: Standard treatment CTRI number CTRI/2020/04/024729 CTRI/2020/03/024402 CTRI/2020/05/025022 CTRI/2020/05/025067 Serial number 5 6 7 8 32 INDIAN J MED RES, January & February 2021 Contd... UP UP (4 sites), DL, GJ MH DL DL States and UTs

Armed Forces Medical Services, New Delhi DCGI approval: N/A ICMR, New Delhi DCGI approval: N/A Lady Hardinge Medical College, New Delhi DCGI approval: N/A AIIMS New Delhi DCGI approval: N/A Sponsor and regulatory status

5. Hospitalized not on supplemental oxygen 6. Not hospitalized with limitation of activity (due to continued symptoms) 7. Not hospitalized without limitation in activity (no symptoms) 1. Death 2. Hospitalized on invasive mechanical ventilation or extracorporeal mechanical ventilation 3. Hospitalized on non ‑ invasive ventilation or high ‑ flow nasal cannula oxygen therapy 4. Hospitalized on supplemental oxygen Pharmacokinetics of HCQ Proportion of patients having virologic cure on day 6 in each of the groups 1. Proportion of patients with negative viral titre on day 7 2. Proportion of patients with negative viral titre on day 14 Primary outcome 300 400 120 100 size Sample Phase 3 N/A Phase 2 Phase 2 Phase Participant and outcome assessor blinded N/A N/A Open label Blinding Immunomodulators Randomized, parallel group trial Other Randomized, parallel ‑ group trial Randomized, parallel ‑ group trial Study design

Arm 1: HCQ Arm 1: Imatinib Arm 2: Standard treatment Arm 1: HCQ Arm 2: HCQ (high dose) Arm 3: HCQ and Azithromycin Arm 1: Ciclesonide Arm 2: HCQ Arm 3: Ivermectin Arm 4: Standard treatment Intervention details * * CTRI/2020/05/025242 CTRI/2020/04/024806 CTRI number CTRI/2020/04/024948 CTRI/2020/04/024904 10 12 Serial number 11 9 RAO et al: COVID-19 TRIALS IN CTRI, INDIA 33 Contd... States and UTs DL (3 sites), MH (3 sites), KA TS, TN, MH (3 sites), HR (4 sites) DL, UP (2 sites) CG, MP, DL, CH DL, MP, CH CG, MP, DL, CH

Sponsor and regulatory status Biocon Biologics India Limited, Bengaluru DCGI approval: Yes Medanta Institute of Education and Research, Gurgaon DCGI approval: Yes Cadila Pharmaceuticals Limited, Ahmedabad DCGI approval: Yes Cadila Pharmaceuticals Limited, Ahmedabad DCGI approval: Yes Cadila Pharmaceuticals Limited, Ahmedabad DCGI approval: Yes Primary outcome One ‑ month mortality rate Proportion showing progressive COVID ‑ 19 disease from moderate to severe, or from severe disease to death Improvement in dysfunction (or organ occurrence of new dysfunction) organ based on change in score and ordinal SOFA scale Number of patients with increased disease severity Numder of individuals acquiring COVID ‑ 19 infection 30 40 180 480 size 4000 Sample Phase Phase 2 Phase 3 N/A Phase 3 Phase 3 Blinding Open label Open label Participant, investigator and outcome assessor blinded Participant, investigator and outcome assessor blinded Participant, investigator and outcome assessor blinded Study design Randomized, parallel ‑ group, active controlled trial Randomized, parallel ‑ group, active controlled trial Randomized, parallel ‑ group, placebo ‑ controlled trial Randomized, parallel ‑ group, placebo ‑ controlled trial Randomized, parallel ‑ group, placebo ‑ controlled trial

Intervention details Arm 1: Itolizumab, and Tocilizumab Arm 1: standard treatment Arm 2: Standard treatment Arm 1: Mycobacterium w Arm 1: Mycobacterium w Arm 1: Mycobacterium w Arm 2: Standard treatment and standard treatment Arm 2: Placebo and standard treatment and standard treatment Arm 2: Placebo and standard treatment Arm 2: Placebo CTRI number CTRI/2020/05/024959 CTRI/2020/05/025369 CTRI/2020/04/024846 CTRI/2020/05/025271 CTRI/2020/05/025277 Serial number 13 14 15 16 17 34 INDIAN J MED RES, January & February 2021 Contd... UK States and UTs MP DL TN MP

PI initiated, AIIMS Rishikesh DCGI approval: N/A Sponsor and regulatory status R D Gardi Medical College, Ujjain DCGI approval: N/A Max Super Speciality Hospital, New Delhi DCGI approval: N/A Christian Medical Vellore College, DCGI approval: N/A RD Gardi Medical College, Ujjain DCGI approval: N/A

‑ 2 infection rate Conversion of COVID ‑ 19 status to negative SARS ‑ CoV Primary outcome Clinical improvement, as defined by live from the discharge hospital, a decrease of at least two points from baseline on a modified ordinal scale. Confirm the antivirus effectiveness of ivermectin on coronavirus i.e. , COVID ‑ 19 then to explore its potential use in the combating to COVID ‑ 19 pandemic Reduction in the viral load in patients with haematological illnesses who are admitted with COVID ‑ 19 infection Effect of ivermectin on eradication of for virus at Test virus. 1, 3 and 5 days from beginning of trial drug started for the patient in the hospital 50 50 50 50 200 size Sample Phase Phase 4 Phase 2 N/A Phase 2 Blinding Participant and investigator blinded Open label Open label Open label Open label Anthelmintics Study design Randomized, parallel ‑ group, placebo ‑ controlled trial Single ‑ arm trial Non ‑ randomized, active controlled trial Randomized, parallel ‑ group, active controlled trial Randomized, parallel ‑ group trial ,

Intervention details Arm 2: Placebo Arm 1: Mycobacterium w Arm 1: Melatonin (heat killed) Arm 1: Ivermectin and standard treatment Arm 2: Standard treatment Arm 1: Ivermectin Arm 2: Standard treatment Arm 1: Ivermectin, and standard treatment Arm 2: Standard treatment CTRI number CTRI/2020/05/025350 CTRI/2020/06/025613 CTRI/2020/04/024858 CTRI/2020/05/025068 CTRI/2020/05/025224 Serial number 18 19 20 21 22 RAO et al: COVID-19 TRIALS IN CTRI, INDIA 35 Contd... UP States and UTs MP DL MH

SGPGI, Lucknow DCGI approval: N/A Sponsor and regulatory status R D Gardi Medical College, Ujjain DCGI approval: N/A Lady Hardinge Medical College, New Delhi DCGI approval: N/A Tata Memorial Tata Centre, Mumbai DCGI approval: N/A

‑ PCR ‑ 2 virus ‑ PCR for ) fall in 1 score ii ) new requirement iii ) new requirement of iv ) mortality i Proportion of patients having virologic cure on day 6 score; Respiratory SOFA ( of respiratory assist devices (HFNC, NIV); ( mechanical ventilation; ( Primary outcome 1. Resolution of sign and symptoms of COVID ‑ 19 2. Negative RT done 48 h after ivermectin dose 3. Change/reduction in Ct value as reported in RT SARS ‑ CoV assay Percentage of patient with treatment failure: ( Proportion of patients who suffer clinical deterioration OR viral persistence at day 10 from the date of randomization (excluding the date of randomization) 48 186 300 size 2000 Sample Phase Phase 2 Phase 2 Phase 3 Phase 3 Blinding N/A Open label Participant and investigator blinded Open label Antihypertensive Antioxidant/pro ‑ oxidant Study design Randomized, parallel ‑ group trial Randomized, parallel ‑ group trial Randomized, parallel ‑ group, placebo ‑ controlled trial Randomized, parallel ‑ group, multiple ‑ arm trial ‑

Intervention details Arm 2: Standard treatment Arm 1: Ivermectin Arm 2: No intervention Arm 1: Niclosamide Arm 1: Losartan Arm 2: Placebo Arm 1: Resveratrol ‑ copper and standard treatment Arm 2: Sodium ‑ copper chlorophyllin and standard treatment Arm 3: Standard treatment CTRI number CTRI/2020/05/025333 CTRI/2020/04/024949 CTRI/2020/05/025319 CTRI/2020/05/025336 Serial number 23 24 25 26 36 INDIAN J MED RES, January & February 2021 Contd... States and UTs MH DL (2 sites), KA, TN, UP (2 sites), MH (4 sites), GJ AP, CG, MH (6 sites), TS, MP, HR, UP, JK, DL, TN GJ (3 sites)

Sponsor and regulatory status Memorial Tata Centre, Mumbai DCGI approval: N/A Dr Reddys Laboratories Limited, Hyderabad and INMAS, DRDO, Delhi DCGI approval: Yes Sun Pharmaceutical Industries Limited, Goregaon, Mumbai DCGI approval: Yes Intas Pharmaceuticals Ltd, Ahmedabad DCGI approval: N/A

Primary outcome to clinical Time improvement, defined as a 2 ‑ point improvement on a 7 ‑ point ordinal scale Time to clinical Time improvement Clinical improvement defined as patient meeting discharge criteria OR a 2 ‑ point improvement (from time of enrolment) in disease severity rating on the 7 ‑ point ordinal scale Proportion of patients showing clinical improvement. Characterize virologic and clinical response 40 200 210 100 size Sample Phase Phase 2 Phase 2 Phase 2 Phase 2 Blinding Open label Open label Open label Open label Antineoplastic Phytopharmaceuticals (n=2) Study design Randomized, parallel ‑ group, multiple ‑ arm trial Randomized, parallel ‑ group, active controlled trial Randomized, parallel ‑ group trial Non ‑ randomized active controlled trial ‑

AQCH and

Intervention details Arm 1: Resveratrol ‑ copper tablets, and standard treatment Arm 2: Sodium ‑ copper chlorophyllin and standard treatment Arm 3: Standard treatment Arm 1: 2 ‑ deoxy D glucose and standard treatment Arm 2: Standard treatment Arm 1: Purified standard treatment Arm 2: Standard treatment Thymoquinone and Arm 1: standard treatment Arm 2: Standard treatment CTRI number CTRI/2020/05/025337 CTRI/2020/06/025664 CTRI/2020/05/025397 CTRI/2020/05/025167 Serial number 27 28 29 30 RAO et al: COVID-19 TRIALS IN CTRI, INDIA 37

Contd... States and UTs MH (7 sites), BR, MP (3 sites), TS (2 sites) GJ (6 sites), KA (4 sites), UP PY, (4 sites), DL, TN (5 sites), HR, CH, PB, RJ (2 sites) (2 sites) DL DL KA (2 sites)

Sponsor and regulatory status ICMR, New Delhi DCGI approval: Yes Institute of Liver and Biliary Sciences, New Delhi DCGI approval: Yes Max Super Speciality Hospital, New Delhi DCGI approval: Yes International Stemcell Services Ltd, Bengaluru DCGI approval: Yes

i ) ( i ) progression to ARDS (P/F ratio severe 100) or ( ii ) all ‑ cause mortality at 28 days Primary outcome Composite measure of the avoidance of : Proportion of patients remaining free of mechanical ventilation in both groups The primary outcome was a composite measure of the avoidance of : ( progression to severe ARDS (P/F ratio 100) and ( ii ) all ‑ cause mortality at 28 days effects measured by chest side efficacy, Safety, radiograph. Improvement of clinical symptoms including duration of respiratory distress, fever, pneumonia, cough, sneezing, and diarrhoea within three days of the convalescent plasma transfusion 40 24 452 100 size Sample Phase Phase 2 Phase 2 Phase 2 Phase 1/2 Blinding N/A Open label Open label N/A Cell and plasma based therapies (n=9) Study design Randomized, parallel ‑ group, active controlled trial Randomized, parallel ‑ group, active controlled trial Randomized, parallel ‑ group trial Non ‑ randomized, active controlled trial

Intervention details Arm 1: Convalescent plasma Arm 2: Standard treatment Arm 1: Convalescent plasma and standard treatment Arm 2: Random donor plasma and standard treatment Arm 1: Convalescent plasma Arm 2: Standard treatment Arm 1: Convalescent plasma along with standard treatment Arm 2: Standard treatment

CTRI number CTRI/2020/04/024775 PLACID trial CTRI/2020/04/024706 CTRI/2020/04/024915 CTRI/2020/04/024804 Serial number 31 32 33 34 38 INDIAN J MED RES, January & February 2021 Contd... States and UTs MH TN WB, TS, MH, TN, DL WB KA

Sponsor and regulatory status Ltd, Wockhardt Mumbai DCGI approval: Yes Government of Nadu Tamil DCGI approval: Yes Apollo Hospitals Enterprise Limited, New Delhi DCGI approval: Yes CSIR, New Delhi DCGI approval: Yes International Stemcell Services Ltd, Bengaluru DCGI approval: Yes

2. To identify the To 2. immune correlates for response to plasma therapy Primary outcome of Avoidance progression to severe ARDS Progression to severe ARDS (P/F ratio 100) and all ‑ cause mortality at one month Composite measure of the ( i ) all ‑ cause mortality at 28 days; ( ii ) improvement score post of SOFA transfusion 1. All ‑ cause mortality Safety of cytokine cocktail therapy 6 20 90 80 100 size Sample Phase Phase 2 N/A Phase 2 Phase 2 Phase 1 Blinding Open label N/A N/A Open label Open label Study design Randomized, parallel ‑ group trial Randomized, parallel ‑ group trial Randomized, parallel ‑ group, active controlled trial Randomized, parallel ‑ group trial Trial Single ‑ arm

Intervention details Arm 1: Convalescent plasma Arm 2: Standard treatment Arm 1: Convalescent plasma and standard treatment Arm 2: Standard treatment Arm 1: Convalescent plasma Arm 2: Standard treatment Arm 1: Convalescent plasma Arm 2: Standard treatment Arm 1: Cytokine cocktail therapy CTRI number CTRI/2020/05/025299 CTRI/2020/05/025346 CTRI/2020/05/025328 CTRI/2020/05/025209 CTRI/2020/05/025432 Serial number 35 36 37 38 39 RAO et al: COVID-19 TRIALS IN CTRI, INDIA 39 Contd... States and UTs OR, CG, MH (17 sites), DL (4 sites), GA, KL, UP, AP, WB, CH, HR, RJ, GJ, TN, KA (2 sites) PY Sponsor and regulatory status Serum Institute of India Pvt Ltd, Pune DCGI approval: Yes PI initiated, JIPMER, Puducherry DCGI approval: N/A

Primary outcome 1. Number of individuals with laboratory ‑ confirmed COVID ‑ 19 infection 2. Number of individuals with laboratory ‑ confirmed COVID ‑ 19 infection among other high risk individuals 3. Number of laboratory ‑ confirmed COVID ‑ 19 infection with severe, critical or life ‑ threatening disease as assessed by investigator among HCWs 4. Number of laboratory ‑ confirmed COVID ‑ 19 infection with severe, critical or life ‑ threatening disease as assessed by investigator among other high ‑ risk individuals Proportion of HCW Proportion of HCW with symptomatic COVID ‑ 19 disease size 5946 1826 Sample

Phase Phase 3 N/A Blinding Participant, investigator, outcome assessor and date ‑ entry operator blinded Participant, investigator, outcome assessor and date ‑ entry operator blinded Vaccines Biological products (n=3) Study design Randomized, parallel ‑ group, placebo controlled trial Randomized, parallel ‑ group, placebo controlled trial ‑ VPM1002 Intervention details Arm 1: Recombinant BCG vaccine Arm 2: Placebo Arm 1: BCG ‑ Denmark (Green Signal) Arm 2: Placebo CTRI number CTRI/2020/04/024749 CTRI/2020/04/024833 Serial number 40 41 40 INDIAN J MED RES, January & February 2021 not N/A, States and UTs MH investigator; Principal Sponsor and regulatory status Medical Education and Drugs Department, Mumbai DCGI approval: Yes

PI, polymerase chain ‑ PCR, reverse transcription polymerase ., standard of care, standard care of treatment standard care i.e ., standard of care, Organization. Health Primary outcome 1. Total duration of Total 1. hospitalization with COVID ‑ 19 symptoms 2. Decrease in viral titre 3. Duration of COVID ‑ 19 symptoms World 60 size Sample WHO, Phase Phase 2 Research; India; HCQ, healthcare workers; RT HCQ, healthcare ‑ India; Blinding Participant blinded Industrial and Scientific of Study design Non ‑ randomized, active controlled trial Council CSIR, Sciences; Combination therapy trials are mentioned in only one category to avoid duplication. Table data are as per information provided by trialist. provided as per information are data Table duplication. to avoid in only one category mentioned are trials therapy Combination * Intervention details Arm 1: BCG Arm 2: Saline plus standard treatment Medical of Institute CTRI number CTRI/2020/05/025013 Postgraduate Registered trials as on June 5, 2020, trials Registered ; CTRI, Clinical Trials Registry Trials hirsutus ; CTRI, Clinical of Cocculus AQCH, aqueous extract applicable; Arunachal AR: Andhra Pradesh; AP: (UTs): Territories failure assessment; NS, non ‑ severe; S, Ct, cycle threshold. States and Union organ sequential SOFA, reaction; Pradesh; JK: Jammu and Kashmir; JH: Jharkhand; KA: Karnataka; HR: Haryana; HP: Himachal GA: Goa; GJ: Gujarat; Assam; BR: Bihar; CG: Chhattisgarh; AS: Pradesh; TN: SK: Sikkim; Rajasthan; RJ: Punjab; PB: Odisha; OR: N: Nagaland; Mizoram; MZ: Meghalaya; ML: MN: Manipur; Maharashtra; MH: Pradesh; MP: Madhya Kerala; KL: DH: Dadra and Nagar Andaman and Nicobar Islands; CH: Chandigarh; AN: Telangana; TS: Bengal; West WB: UP: Uttar Pradesh; UK: Uttarakhand; Tripura; TR: Nadu; Tamil Puducherry Haveli; DD: Daman and Diu; DL: Delhi; LD: Lakshadweep; PY: The keyword ‘Standard treatment’ has been used for uniformity and includes the following category as mentioned by the trialist as mentioned the following category and includes has been used for uniformity The keyword ‘Standard treatment’ COVID ‑ 19, coronavirus MoHFW. per as guidelines treatment and care supportive best treatment, standard local ‑ level protocol, treatment standard management, supportive and DRDO, Sciences; Allied and Medicine of Nuclear INMAS, Research, Institute of Medical ICMR, Indian Council Sciences; of Medical All India Institute AIIMS, disease 2019; SGPGI, HCQ, College; Hydroxychloroquine; R D Gardi Medical College, Ruxmaniben Deepchand Sanjay Organisation; Defence Research and Development Gandhi Serial number # 42 RAO et al: COVID-19 TRIALS IN CTRI, INDIA 41 Contd... States and UTs GJ (5 sites) RJ TS TN, KL WB, PB, (2 sites), MH sites), NL, MP, RJ (2 sites), UP, AS, BR (2 sites), GJ (2 KA, HP, sites), AP RJ (2 sites) HP AP TS # Sponsor and regulatory status IPGTRA, Jamnagar DCGI approval: N/A NIA, Jaipur DCGI approval: N/A NIIMH (CCRAS), Hyderabad DCGI approval: N/A CCRAS, New Delhi DCGI approval: N/A University, Ayurved Jodhpur DCGI approval: N/A CCRAS, New Delhi DCGI approval: N/A CCRAS, New Delhi DCGI approval: N/A NIIMH (CCRAS), Hyderabad DCGI approval: N/A ‑ PCR Incidence rate of COVID ‑ 19 infection Comparative assessment of incidence of COVID ‑ 19 Comparative assessment of occurrence of COVID ‑ 19 infection Primary outcome Comparative assessment of occurrence of COVID ‑ 19 infection Time Clinical cure rate: to get a negative status of COVID ‑ 19 Incidence of COVID ‑ 19 positive cases as confirmed by RT Comparative assessment of occurrence of COVID ‑ 19 infection in healthy volunteers Comparative assessment of occurrence of COVID ‑ 19 infection 40 5000 1500 1200 5000 20000 12000 40000 Sample size Phase N/A Phase 2/3 Phase 2/3 N/A N/A N/A Phase 1/2 Phase 2/3 Classical (n=21) Ayurveda (n=45) Ayurveda Individual agents (n=11) Blinding Open label Open label Open label N/A Open label N/A N/A Open label Study design Other Randomized, parallel ‑ group trial Non ‑ randomized, active controlled trial Non ‑ randomized, multiple ‑ arm trial Single ‑ arm trial Single ‑ arm trial Randomized, parallel ‑ group trial Non ‑ randomized, active controlled trial

Intervention details Arm 1: Guduchi Ghana Vati Arm 2: Nil Arm 1: Guduchi Ghana Vati Arm 2: Nil Arm 1: Guduchi Ghana Vati Arm 2: Standard prophylactic care Arm 1: Guduchi Ghan Vati Arm 2: Standard prophylactic care Arm 1: Guduchi Ghana Vati Arm 1: Guduchi Ghana Vati Arm 1: Guduchi Arm 2: Standard prophylactic care Arm 1: Ashwagandha + standard prophylactic care Arm 2: Standard prophylactic care Details of AYUSH trials (n=67) on coronavirus disease 2019 registered in the Clinical Trials Registry ‑ India Trials trials (n=67) on coronavirus disease 2019 registered in the Clinical AYUSH III. Details of Table CTRI number CTRI/2020/06/025525 CTRI/2020/05/025488 CTRI/2020/05/025485 CTRI/2020/05/025385 CTRI/2020/05/025370 CTRI/2020/05/025213 CTRI/2020/05/025088 CTRI/2020/05/025429 Serial number 1 2 3 4 5 6 7 8 42 INDIAN J MED RES, January & February 2021 Contd... DL States and UTs MH AP AP

AIIA, New Delhi DCGI approval: N/A Sponsor and regulatory status Ministry of AYUSH; CSIR, New Delhi DCGI approval: N/A Ministry of AYUSH, New Delhi DCGI approval: N/A Ministry of AYUSH, New Delhi DCGI approval: N/A

bala of an

‑ 2 infection free individual Immuno ‑ stimulation leading to non ‑ development of symptoms COVID ‑ 19 in risk population exposed to infected individuals ( Bala will be assessed by using specialized proforma including dasvidhapareeksha and other questionnaires which will reveal the physical and mental health of an individual) Improvement in Primary outcome ( i ) Proportion of SARS ‑ CoV participants on completion of study ( ii ) Proportion of participants contracting COVID ‑ 19 during the study period Comparative assessment of occurrence of COVID ‑ 19 infection Comparative assessment of occurrence of COVID ‑ 19 infection 400 1200 1200 50000 Sample size Phase 2 Phase Phase 2 Phase 2/3 Phase 2/3 Open label Blinding Open label Open label N/A Combination interventions (n=10) Randomized, parallel ‑ group trial Study design Randomized, parallel ‑ group, active controlled trial Randomized, parallel ‑ group trial Other

3.Rock salt and turmeric Arm 1: Guduchi Ghana Vati 2.Anu taila preventive 4. Ayush guidelines Arm 2: Standard prophylactic care Intervention details Arm 1: Ashwagandha Arm 2: HCQ Arm 1: Ashwagandha Arm 1: Yashtimadhu CTRI/2020/05/025171 CTRI number CTRI/2020/05/025332 CTRI/2020/05/025166 CTRI/2020/05/025093 12 Serial number 9 10 11 RAO et al: COVID-19 TRIALS IN CTRI, INDIA 43 Contd... States and UTs (3 sites) DL MH UP GJ MP

Sponsor and regulatory status CCRAS, New Delhi DCGI approval: N/A Siddhivinayak Pain Pune Relief Center, DCGI approval: N/A GS Ayurveda GS Ayurveda Medical College and Hospital, Ghaziabad DCGI approval: N/A Parul Institute of Ayurved, Vadodara DCGI approval: N/A ABVGMC, Vidisha DCGI approval: N/A ‑ PCR ‑ PCR) Primary outcome Incidence of COVID ‑ 19 positive cases (as confirmed by RT COVID ‑ 19 test and acute phase reactants such as LDH, CBC, CRP, D ‑ dimer, ferritin, troponin, cardiac INR and myoglobin, PT appearance of respiratory symptoms Complete blood picture, serum ferritin, C ‑ reactive protein, LDH, troponin, nucleic acid amplification test and RT Efficacy in the management of mild and asymptomatic cases of COVID ‑ 19 patients Episodes and severity of symptoms of respiratory tract infection (cold, sore throat, dry cough, breathlessness) 50 10 30 50 1324 Sample size Phase Phase 3/4 N/A N/A N/A Phase 3 Blinding Open label Investigator blinded Participant and investigator blinded N/A Open label Study design Single ‑ arm trial Randomized, parallel ‑ group trial Cluster randomized trial Randomized, parallel ‑ group trial Single ‑ arm trial

Intervention details Arm 1: Guduchi Ghana or (Sanshamani Vati) Vati Sudarshana Ghanavati or Ashwagandha Arm 1: Curcumin with black pepper Arm 2: Standard treatment Arm 1: Piper betel with the combination of swarnabhasma (herbomineral combination) Arm 1: Kiratiktadi Kwath; Ashwagandha churna; Yoga exercises; immunobooster Kwath Ayush Arm 2: Standard treatment , Arm 1: Samshamani Vati Sudarshan Ghana Vati, Murrchhita Khadiradi Vati, (for Nasya, Taila Tila Arsenic Album 30 * * CTRI number CTRI/2020/05/025069 CTRI/2020/05/025482 CTRI/2020/06/025637 CTRI/2020/04/024731 CTRI/2020/05/025341 Serial number 13 14 15 17 16 44 INDIAN J MED RES, January & February 2021 Contd... States and UTs HR DL

Sponsor and regulatory status Ministry Of AYUSH, New Delhi DCGI approval: N/A AIIA, New Delhi DCGI approval: N/A

bala of an

2. Progress of disease as per clinical severity score (COCSS) 3. Number of days treatment, hospitalization, type of care and site treatment at hospital, oxygen support requirement, days of ventilation required, period of convalescence and return to normal life activity 4. Number of days taken to test negative for COVID, from total days to discharge hospital 5. Profiling according to Primary outcome 1. Percentage of patients progressing to serious/ critical stage of disease tridosha 6. Defining the disease according to Ayurveda Improvement in individual Bala will be assessed by using specialised proforma including and dashavidhapareeksha other questionnaires which will reveal the physical and mental health of an individual 60 140 Sample size Phase Phase 3 Phase 2 Blinding N/A Open label Study design Non ‑ randomized, active controlled trial Randomized, parallel ‑ group trial

Samshamani Intervention details Arm 1: Kashaya (decoction) cordifolia of Tinospora stem Piper longum fruit, and standard treatment Arm 1: Tab ; Herbal tea; application Vati of Anu taila; Haridra khanda Arm 2: Standard prophylactic care Arm 2: Standard treatment CTRI number CTRI/2020/04/024882 CTRI/2020/05/025178 Serial number 18 19 RAO et al: COVID-19 TRIALS IN CTRI, INDIA 45 Contd... MH DL MH DL States and UTs UP CCRAS, New Delhi DCGI approval: N/A CCRAS, New Delhi DCGI approval: N/A Ministry of AYUSH, Ministry of AYUSH, New Delhi DCGI approval: N/A Ch Brahm Prakash Charak Ayurved Sansthan, New Delhi DCGI approval: N/A Sponsor and regulatory status GS Ayurveda GS Ayurveda Medical College and Hospital, Hapur DCGI approval: N/A

‑ 2

Clinical cure rate: Time Time Clinical cure rate: to negative conversion of SARS ‑ CoV 1. Mean time (days) for clinical recovery as per defined clinical recovery criteria 2. Number of patients showing ‘clinical recovery’ 2. Proportion of patients showing clinical recovery 1. Mean time (days) for clinical recovery Time taken and number Time of patients progressing from asymptomatic to symptomatic condition Primary outcome 1. Efficacy in boosting and Vyadhikshamatwa prevention against communicable diseases. 2. Will help in overcoming Will 2. the anxiety level and stress of HCQs 60 40 50 30 420 Sample size Phase 3/4 Phase 3 Phase 2 Phase 3 Phase N/A Patented products (n=24) Patented products (n=24) Open label N/A Open label N/A Blinding N/A Randomized, parallel ‑ group, active controlled trial Single ‑ arm trial Randomized, parallel ‑ group, active controlled trial Single ‑ arm trial Study design Single ‑ arm trial

); ); ); and

‑ 64 Arm 1: AYUSH Arm 2: Standard treatment ‑ 64 Arm 1: AYUSH ‑ 64 as add AYUSH Arm 1: on to standard treatment as add Arm 2: Yashtimadhu on to standard treatment Arm 3. Sanshamani Vati Plus; as add ‑ on standard treatment Arm 4: Standard treatment Golden Milk (milk with longa ) Curcuma Tinospora cordifolia Tinospora Amalaki Churna (powder of Phyllanthus emblica Intervention details Arm 1: Sanshamani Vati cordifolia (Tinospora Nagaradi kwath (decoction of Zingiber officinale, chebula Terminalia Arm 1: Kiratiktadi Kwath (Astadashang Kwath) Sharangdhar Samhita ‑ kwath prakaran; Ashwgandhachurna with Yoga milk; * CTRI/2020/05/025156 CTRI/2020/05/025335 CTRI/2020/06/025557 CTRI/2020/05/025398 CTRI number CTRI/2020/05/025276 23 24 22 21 Serial number 20 46 INDIAN J MED RES, January & February 2021 Contd... States and UTs DL CH TS DL GJ (2 sites), MH (2 sites), RJ DL KA

Sponsor and regulatory status CCRAS, New Delhi DCGI approval: N/A CCRAS, New Delhi DCGI approval: N/A NIIMH (CCRAS), Hyderabad DCGI approval: N/A CCRAS, New Delhi DCGI approval: N/A Dabur India Ltd, Ghaziabad DCGI approval: N/A CCRAS, New Delhi DCGI approval: N/A Sri Sri Tattva, Bangalore DCGI approval: N/A

‑ 2 ‑ 2

‑ PCR of nasopharyngeal ‑ PCR 2. Proportion of patients showing ‘clinical recovery’ positivity as estimated by RT swab positivity as estimated by RT Recovery in the signs and symptoms as fever and respiratory distress Primary outcome 1. Mean time (days) for clinical recovery as per defined clinical recovery criteria 2. Number of patients showing ‘clinical recovery’ 1. Mean time (days) for clinical recovery (day of randomization to the day of clinical recovery) Comparative assessment of occurrence of COVID ‑ 19 infection Percentage of participants with SARS CoV 1. Comparative assessment of incidence COVID ‑ 19 2. Comparative assessment of incidence other non ‑ COVID 19 infections Percentage of participants with SARS CoV 50 40 80 50 600 200 5000 Sample size Phase 3/4 Phase Phase 2/3 Phase 2/3 Phase 2/3 Phase 3/4 N/A Phase 3 Open label Blinding N/A Open label Open label N/A Open label N/A Single ‑ arm trial Study design Single ‑ arm trial Randomized, parallel ‑ group, active controlled trial Non ‑ randomized, active controlled trial Single ‑ arm trial Randomized, parallel ‑ group trial Randomized, parallel ‑ group trial

Tulsi arka Tulsi

Intervention details ‑ 64 Arm 1: AYUSH ‑ 64 Arm 1: AYUSH Arm 2: Standard treatment Arm 1: Chyawanprash Arm 2: Standard prophylactic care Arm 1: Chyawanprash Arm 1: Chyawanprash with milk Arm 2: Milk Arm 1: Chyawanprash Arm 2: Standard prophylactic care Arm 1: Shakti drops; turmeric plus; CTRI number CTRI/2020/05/025338 CTRI/2020/05/025214 CTRI/2020/05/025484 CTRI/2020/05/025425 CTRI/2020/05/024981 CTRI/2020/05/025275 CTRI/2020/06/025592 Serial number 25 26 27 28 29 30 31 RAO et al: COVID-19 TRIALS IN CTRI, INDIA 47 Contd... States and UTs RJ, DL, MH AP, TN MH MH MH

Sponsor and regulatory status Dalmia Centre for Research and Development, Noida DCGI approval: N/A Apex Laboratories Pvt Ltd, Chennai DCGI approval: N/A Health Solutions, Pune DCGI approval: N/A Health Solutions, Pune DCGI approval: N/A BVG Life Sciences Ltd, Pune DCGI approval: N/A

‑ 2 rate ‑ PCR at 2 ) SpO iii 1. Time taken for clinical Time 1. which is defined recovery, as: ( i ) normalization of pyrexia and body pain; Primary outcome 1. Changes in scores of Respiratory the St. George Questionnaire from baseline visit to EOT 2. Changes in scores of the Leicester Cough Questionnaire from baseline visit to EOT ( ii ) respiratory rate <24/ minute; ( day 5, 10 and 15 3. Reduction of viral load >94%; ( iv ) relief from cough and maintenance of above for > 72 h 2. Proportion of patients with swabs negative for COVID ‑ 19 in RT Prevention of onset or complications of COVID infection Mortality 1. Number of days for negative PCR confirmatory test from nasopharyngeal swab for SARS ‑ CoV 2. Serum levels of CD4, CD8, NK cell panel CD16/ IgM, IgG CD56, CRP, 30 30 60 100 120 Sample size Phase 3/4 Phase Phase 3 Phase 2 Phase 2/3 Phase 1/2 N/A Blinding Participant, investigator and outcome assessor blinded N/A N/A Open label Randomized, parallel ‑ group trial Study design Randomized, parallel ‑ group, placebo ‑ controlled trial Single ‑ arm trial Single ‑ arm trial Randomized, parallel ‑ group trial

Arm 2: Standard treatment Intervention details Astha ‑ 15 capsule Arm 1: and standard treatment Arm 1: Clevira tablet Arm 2: Placebo and standard treatment Arm 1: SUVED + Reimmungen Arm 1: SUVED + Reimmungen Arm 1: ShatPlus and standard treatment Arm 2: Standard treatment CTRI number CTRI/2020/06/025590 CTRI/2020/05/025483 CTRI/2020/05/025334 CTRI/2020/05/025343 CTRI/2020/05/025340 Serial number 32 33 34 35 36 48 INDIAN J MED RES, January & February 2021 Contd... States and UTs GJ (2 sites), MH KA KA KA MH

Sponsor and regulatory status Shukla Ashar Impex Pvt Ltd, Rajkot DCGI approval: N/A Pankajakasthuri Herbal Research Foundation, Thiruvananthapuram DCGI approval: N/A Mi Lab LifeSciences Pvt Ltd, Bengaluru, DCGI approval: N/A Vopec Pharmaceuticals Pvt Ltd, Chennai DCGI approval: N/A Shree Bharadi Ayurvedic, Maharashtra DCGI approval: N/A

2. Symptom resolution: fever 3. Symptom resolution: cough 4. Symptom resolution: shortness of breath The odds of ratio for improvement on a 7 ‑ point ordinal scale on day 15 the worst score Each day, from the previous day will be recorded Primary outcome 1. Rate of recovery Improvement in patients who are assessed daily for symptoms which include cough, fever with or without chills and difficulty in breathing for the period they are in quarantine 1. Improvement Early recovery and reduced mortality in patients who are assessed daily for symptoms which include cough, fever with or without chills and difficulty in breathing 30 30 30 112 120 Sample size Phase Phase 2 Phase 4 Post marketing surveillance Post marketing surveillance Phase 2 Blinding Open label Outcome assessor blinded N/A N/A N/A Study design Randomized, parallel ‑ group, active controlled trial Other Single ‑ arm trial Non ‑ randomized, active controlled trial Single ‑ arm trial

Intervention details Arm 1: Aayudh advance H Arm 1: ZingiVir Arm 2: N/A tablets Arm 1: MyVir Arm 2: Standard treatment Amrta Karuna syrup Arm 1: Arm 2: Standard treatment Pinak Tab Arm 1: bacteria, viruses Arm 2: Standard treatment CTRI number CTRI/2020/05/025161 CTRI/2020/04/024883 CTRI/2020/05/024967 CTRI/2020/06/025527 CTRI/2020/05/025326 Serial number 37 38 39 40 41 RAO et al: COVID-19 TRIALS IN CTRI, INDIA 49 Contd... States and UTs RJ MH (2 sites), MH KA AP

Sponsor and regulatory status Patanjali Research Institute, Haridwar; NIMS, Jaipur DCGI approval: N/A Shree Dhootapapeshwar Limited, Mumbai DCGI approval: N/A Pankajakasthuri Herbal Research Foundation, Thiruvananthapuram DCGI approval: N/A Natural Solutions, Mumbai DCGI approval: N/A

‑ PCR ‑ PCR of ‑ 2 RT ‑ PCR confirmed nasopharyngeal swab Primary outcome clearance as Virological measured by RT Prevention of incidence COVID ‑ 19 infection The odds of ratio for improvement on a 7 ‑ point ordinal scale on day 15 and clearance of medically attended lung infection due to RT COVID ‑ 19 infection to a negative Time 1. SARS ‑ CoV oropharyngeal of both result swab and nasopharyngeal swab. 2. Clinical cure based on assessment of clinician’s symptoms a. Change in positive COVID ‑ 19 status on day 8 and day 15 3. Clinical outcomes a. Proportion of patients on WHO progression scale 0 to 10 on day 8 and 15 30 120 275 135 Sample size Phase N/A Phase 4 Phase 4 N/A Blinding NIL N/A Outcome assessor blinded Participant and investigator blinded

Study design Randomized, parallel ‑ group, placebo ‑ controlled trial Single ‑ arm trial Randomized, parallel ‑ group, placebo ‑ controlled trial Randomized, parallel ‑ group, placebo ‑ controlled trial ‑ H

; Anu Taila Intervention details pure Tablet Arm 1: Ashwagandha 500 mg; Pure Giloy extract; tablet pure tulsi extract; Swasari Ras Arm 2: Placebo therapy Tablet AOIM ‑ Z Arm 1: Arm 1: Zingivir Arm 1: Virulina Arm 2: Standard treatment CTRI number CTRI/2020/05/025273 CTRI/2020/05/025222 CTRI/2020/05/025434 CTRI/2020/06/025556 Serial number 42 43 44 45 50 INDIAN J MED RES, January & February 2021 Contd... States and UTs HR PY TN (4 sites) KA TS, JK, KA, UP, MH, DL

Sponsor and regulatory status National Cancer Institute, Jhajjar DCGI approval: N/A JIPMER, Puducherry DCGI approval: N/A Government Yoga Yoga Government And Naturopathy Medical College, Chennai DCGI approval: N/A Ministry of AYUSH, New Delhi DCGI approval: N/A CCRUM, New Delhi DCGI approval: N/A i.e ., Primary outcome Depression, anxiety and stress levels in patients assessed using DASS ‑ 21 questionnaire PSQI for sleep quality from asymptomatic/ uncomplicated/mild pneumonia to moderate/ severe stages 1. Incidence of COVID ‑ 19 cases 2. Improvement in immune status using ISQ Time to progress next Time stage of severity 1. Incidence of COVID ‑ 19 cases 2. Improvement in immune status using ISQ 84 200 658 4000 40000 Sample size Phase N/A N/A Phase 3/4 Phase 2 Phase 3 Unani (n=2) Blinding N/A N/A N/A Open label N/A Yoga and Naturopathy (n=3) Yoga Study design Randomized, parallel ‑ group trial Randomized, parallel ‑ group trial Nonrandomized, active controlled trial Other Non-randomized, multiple ‑ arm trial

Khameera e Tiryaq Nadi Behidana Intervention details Arm 1: Meditation and breathing exercises and standard treatment Alternate nostril Arm 1: breathing and guided meditation; (1) Shodhan Pranayama ; (2) Panchakosha meditation The control Arm 2: group will not receive the intervention. Arm 2: Standard treatment Arm 1: Joshanda (decoction) of the following: (Cydonia oblonga), Unnab (Zizyphus jujube), myxa) and Sapistan (Cordia Khameera Marwareed Arm 1: Joshanda (decoction) and Marwareed Arm 2: Joshanda (decoction) and Arba Arm 3: Standard prophylactic care Arm 2: Standard treatment Arm 1: Yoga and Yoga Arm 1: Naturopathy, immune ‑ boosting agents pepper, Tulsi such as ginger Adhimaduram, turmeric, steam inhalation, gargling, Sun bath aromatherapy * CTRI number CTRI/2020/06/025523 CTRI/2020/05/025162 CTRI/2020/05/025320 CTRI/2020/06/025650 CTRI/2020/05/025254 Serial number 46 47 48 49 50 RAO et al: COVID-19 TRIALS IN CTRI, INDIA 51 Contd... States and UTs TN TN TN UP MH

Sponsor and regulatory status Eminentlabs Business Solutions Pvt Ltd, Chennai DCGI approval: N/A CCRS, Chennai; Ministry of AYUSH, New Delhi DCGI approval: N/A Government Stanley Medical College, Chennai DCGI approval: N/A Aid Cancer Society, Lucknow DCGI approval: N/A Life Force Foundation Trust, Mumbai DCGI approval: N/A ‑ 2 ‑ 2 in two ‑ 2, reduction in Proportion of patients confirmed as negative for SARS ‑ CoV consecutive throat/nasal swabs (taken 24 h apart) at day 15/day16 Occurrence of COVID ‑ 19 infection Number of patients with viral fever/COVID ‑ 19 Primary outcome Reduction in incidence of clinical symptoms of COVID ‑ 19, negative conversion of SARS ‑ CoV viral load of SARS ‑ CoV at the end of treatment and examine the levels immune markers and inflammatory markers Number of patients turning symptomatic 86 50 1000 21500 10000 Sample size Phase 2 Phase N/A Phase 1/2 N/A Phase 2 Siddha (n=3) Homeopathy (n=14) Open label Blinding N/A Open label N/A Participant and outcome assessor blinded Other Study design Non ‑ randomized, active controlled trial Randomized, parallel ‑ group trial Non ‑ randomized, active controlled trial Cluster randomized trial

; Arm 1: Kabasura Kudineer and Bramanandhabairavam Arm 2: Standard treatment Intervention details Arm 1: Kabasura Kudineer Nilavembukudineer Arm 2: Standard prophylactic care Arm 1: Kabasura Kudineer C, zinc Vitamin Arm 2: supplementation Aconite 30 + Arm 1: Allium Arsenic album 30 + cepa 30 + Influenzum Gelsmium 30 + Eupatorium Thuja 0 30 + Echinacia 0 Arsenic album 30c Arm 1: Arm 2: Bryonia alba 30c Arm 3: Camphora 1M Arm 4: Coronavirus ‑ related nosodes (30c potency); Arm 5: Matching placebo pills CTRI/2020/06/025625 CTRI number CTRI/2020/05/025298 CTRI/2020/05/025215 CTRI/2020/06/025530 CTRI/2020/05/025491 51 Serial number 52 53 54 55 52 INDIAN J MED RES, January & February 2021 Contd... States and UTs KL TS, TN, DL, AP, RJ, WB, KL, GJ MH, UP, CG DL UP UP

Sponsor and regulatory status Government Homeo Kerala Dispensary, DCGI approval: N/A CCRH, New Delhi DCGI approval: N/A Sai Nidan Homeopathy Clinic, Chhattisgarh DCGI approval: N/A CCRH, New Delhi DCGI approval: N/A Naiminath Homoeopathic Medical College Hospital and Research Centre, Agra DCGI approval: N/A Naiminath Homoeopathic Medical College Hospital and Research Centre, Agra DCGI approval: N/A ‑ PCR/end of Confirmation of diagnosis for COVID ‑ 19 infection based on RT quarantine period Confirmation of diagnosis for COVID ‑ 19 infection/ end of quarantine period as per standard protocol Primary outcome COVID ‑ 19 in quarantined persons Clinical recovery (COVID ‑ 19 negative) or death Clinical outcome in terms of recovery patient or requirement of life support (ventilator)/death Clinical recovery (COVID ‑ 19 negative) or appearance of symptoms requiring conventional treatment 800 100 100 100 33000 10000 Sample size Phase N/A Phase 2/3 Phase 2/3 N/A Phase 2/3 Phase 3 Blinding Participant and investigator blinded N/A Open label N/A Open label Participant blinded Study design Cluster randomized trial Cluster randomized trial Cluster randomized trial Single ‑ arm trial Randomized, parallel ‑ group, placebo ‑ controlled trial Single ‑ arm trial

Intervention details Arsenicum album Arm 1: 30 Arm 2: No. 40 size globules medicated with alcohol 90% v/v is used as placebo Arsenicum album Arm 1: 30c Arm 2: No intervention Arsenic album 30c Arm 1: Arsenic album 30c Arm 1: Arsenic album 30c Arm 1: (variable dose potency and frequency) and standard treatment Arm 2: Placebo and standard treatment Arsenic album, Arm 1: Bryonia alba, Gelsemium, Antimonium tartaricum, horridus Crotalus CTRI number CTRI/2020/05/025272 CTRI/2020/05/025205 CTRI/2020/05/025049 CTRI/2020/05/024986 CTRI/2020/05/024969 CTRI/2020/04/024926 Serial number 56 57 58 59 60 61 RAO et al: COVID-19 TRIALS IN CTRI, INDIA 53 Contd... States and UTs UP MH RJ MH MH

Sponsor and regulatory status Naiminath Homoeopathic Medical College Hospital and Research Centre, Agra DCGI approval: N/A Healthcare Welling Private Limited, Mumbai DCGI approval: N/A Aarogya Homoeopathic Medical College and Hospital, Jaipur; Ministry of New Delhi AYUSH, DCGI approval: N/A PI initiated, Homeo clinic, Gondia ‑ Maharashtra DCGI approval: N/A Life Force Foundation Trust, Mumbai DCGI approval: N/A Primary outcome Clinical recovery (COVID ‑ 19 negative) or death. Percentage of patient admissions to critical care Prophylactic effect Serologically negative blood test for COVID ‑ 19 Safety measure in terms of investigations (PCR) blood parameters 10 100 100 300 100 Sample size Phase Phase 3 Phase 1/2 Phase 4 Phase 3 Phase 1 Blinding Participant blinded Open label Participant and investigator blinded N/A Open label Study design Randomized, parallel ‑ group, placebo ‑ controlled trial Cluster randomized trial Randomized, parallel ‑ group, placebo ‑ controlled trial Randomized, parallel ‑ group, active controlled trial Single ‑ arm trial Bryonia alba, Intervention details Arsenic album, Arm 1: Bryonia alba, Gelsemium, Antimonium tartaricum, horridus Crotalus Arm 2: Placebo Arsenic album, Arm 1: Camphora, Justicia Helleborus niger, adhatoda Arm 1: Bryonia alba 30C Arm 2: Identical placebo Arm 1: Cadamba 200 Arm 1: CNV01 CTRI number CTRI/2020/04/024905 CTRI/2020/04/024857 CTRI/2020/06/025558 CTRI/2020/04/024947 CTRI/2020/05/025496 Serial number 62 63 64 65 66 54 INDIAN J MED RES, January & February 2021 Scientific of States and UTs MH (2 sites) Council CSIR, Sponsor and regulatory status Auto Bajaj Ltd, Maharashtra DCGI approval: N/A Homoeopathy; PCR, reverse transcription polymerase chain polymerase transcription ‑ PCR, reverse in Research for Primary outcome Clinical recovery of patient or requirement of life support (ventilator)/death Council 100 Central Sample size CCRH, Phase Phase 2 Siddha; in Blinding Open label Research for Council , standard of care, standard care of treatment and supportive management, standard treatment protocol, local ‑ level protocol, treatment standard management, supportive and of treatment care standard of care, i.e. , standard Study design Randomized, parallel ‑ group, placebo ‑ controlled trial Central reactive protein; LDH, lactate dehydrogenase; CBC, complete CBC, dehydrogenase; LDH, lactate protein; C ‑ reactive CRP, India; of General DCGI, Drugs Controller 21items; ‑ CCRS,

Medicine; Trials with combination therapy (involving more than one system of AYUSH) are mentioned in only one category to avoid duplication. AYUSH AYUSH to avoid duplication. in only one category are mentioned AYUSH) therapy (involving more than one system of with combination Trials * Unani Intervention details Arm 1: Homoeopathic medicine and standard treatment Arm 2: Placebo and standard treatment in Research for CTRI number CTRI/2020/04/024925 Council Registered trials as on June 5, 2020, Registered standard treatment, best supportive care, treatment guidelines as per MOHFW. The term ‘Standard prophylactic care’ has been used for uniformity which represents the terminologies has been used for uniformity care’ The term ‘Standard prophylactic as per MOHFW. guidelines best supportive care, treatment standard treatment, AYUSH, College; Medical Government Vajpayee Atal Bihari ABVGMC, Ayurveda; of Institute All India AAIA, COVID ‑ 19. against measures preventive for standard used by the trialist CCRUM, Sciences; Ayurvedic in for Research Council COVID ‑ 19, coronavirus disease 2019; CCRAS, Central Unani, Siddha and Homeopathy; and Naturopathy, Yoga Ayurveda, Central includes Ayurveda, Yoga, Unani, Siddha, Homeopathy trials. Table data are as per information provided by trialist. The keyword ‘Standard treatment’ and has been used for uniformity for used been has and treatment’ ‘Standard keyword The trialist. by provided information per as are data Table trials. Homeopathy Siddha, Unani, Yoga, Ayurveda, includes trialist by the as mentioned category following the includes and Serial number 67 # blood count; PT INR, prothrombin time international normalized ratio; NK, natural killer. States and Union Territories (UTs): AP: Andhra Pradesh; AR: Arunachal Pradesh; AS: Assam; AS: Arunachal Pradesh; AR: Andhra Pradesh; AP: (UTs): Territories States and Union ratio; NK, normalized natural killer. INR, prothrombin time international blood count; PT MP: Madhya Kerala; KL: KA: Karnataka; JH: Jharkhand; Kashmir; and JK: Jammu Pradesh; HP: Himachal Haryana; HR: GJ: Gujarat; GA: Goa; Chhattisgarh; CG: Bihar; BR: Tripura; TR: Nadu; Tamil TN: SK: Sikkim; OR: Odisha; PB: Punjab; RJ: Rajasthan; N: Nagaland; MZ: Mizoram; MN: Manipur; ML: Meghalaya; Pradesh; MH: Maharashtra; Diu; and DD: Daman Nagar Haveli; DH: Dadra and CH: Chandigarh; Islands; and Nicobar Andaman AN: Telangana; TS: Bengal; West WB: Pradesh; UP: Uttar UK: Uttarakhand; Puducherry DL: Delhi; LD: Lakshadweep; PY: and Industrial Research; IPGTRA, Institute for Post Graduate Teaching and Research in Ayurveda; JIPMER, Jawaharlal Institute of Postgraduate Medical Education and Research; Education Medical of Postgraduate Institute JIPMER, Jawaharlal Ayurveda; in and Research Teaching for Post Graduate IPGTRA, Institute Research; and Industrial PI, Principal Jaipur; Sciences Medical of Institute (CCRAS); NIMS, National Heritage Medical Indian of Institute NIIMH (CCRAS), National Ayurveda; of Institute NIA, National RT worker; HCQ, healthcare Index; Quality Sleep PSQI, Pittsburgh questionnaire; status ISQ, immune applicable; N/A, not investigator; stress scale and anxiety DASS ‑ 21, depression, reaction; RAO et al: COVID-19 TRIALS IN CTRI, INDIA 55 Contd... States and UTs RJ PY DL AP DL RJ (2 sites)

#

Sponsor and regulatory status PI initiated, MB Medical Hospital RNT College Udaipur DCGI approval: N/A JIPMER, Puducherry DCGI approval: N/A AIIMS, New Delhi DCGI approval: N/A Medicare Pvt Win Ltd, Vijaywada DCGI approval: N/A AIIMS, New Delhi DCGI approval: N/A PI initiated Medical College, RNT Udaipur DCGI approval: N/A ‑ PCR AI module ‑ thorax and of COVID ‑ 19 after topical lignocaine use Anxiety (assessed as a continuous variable on HADS) Need for emergency room visit or re ‑ hospitalization Change in emotional functioning by DASS ‑ 21, physical functioning by change in performance score (Karnofsky Performance Scale) score and change in respiratory functional parameters Comparing the reduction in the progression, transmission of disease assessed by viral load Sensitivity of nasal and throat swabs for RT Assess sensitivity and specificity of by performing chest CT X ‑ ray, Primary outcome voice sampling 15 96 30 size 128 2978 1650 Sample N/A N/A N/A N/A N/A N/A Phase N/A Open label NIL N/A N/A N/A Blinding Non ‑ randomized, multiple ‑ arm trial Randomized, parallel ‑ group trial Non ‑ randomized, active controlled trial Randomized, parallel ‑ group trial Single ‑ arm trial Non ‑ randomized, multiple ‑ arm trial Study design

‑ scan of

‑ scan thorax and Arm 3: Voice sampling Voice Arm 3: AI module Arm 4: Normal chest X ‑ ray, individuals’ CT voice sampling Arm 1: Brief tele ‑ counselling model for coping with psychological concerns associated with COVID ‑ 19 Arm 1: ‑ consultation Tele Arm 2: Standard arm with routine follow up visits Arm 1: Home ‑ based prehabilitation Arm 1: Povidone ‑ iodine and intranasal gargles application Arm 2: Normal saline Arm 1: Topical lignocaine lozenges Arm 1: Chest X ‑ ray artificial intelligence module Arm 2: CT AI thorax module Intervention details Details of miscellaneous trials (n=13) on coronavirus disease 2019 registered in the Clinical Trials Registry ‑ India Trials Details of miscellaneous trials (n=13) on coronavirus disease 2019 registered in the Clinical IV. Table CTRI/2020/05/025248 CTRI/2020/05/025492 CTRI/2020/05/025331 CTRI/2020/05/024962 CTRI/2020/05/024983 CTRI/2020/04/024776 CTRI number 1 2 3 4 5 6 Serial number 56 INDIAN J MED RES, January & February 2021 Contd... States and UTs DL DL DL OR AP UP

Sponsor and regulatory status AIIMS, New Delhi DCGI approval: N/A AIIMS, New Delhi DCGI approval: N/A AIIMS, New Delhi DCGI approval: N/A AIIMS, Bhubaneswar DCGI approval: N/A Medical College, GSL Rajahmundry DCGI approval: N/A Siddhartha Hospital, Agra DCGI approval: N/A Time to intubation Time to intubation Time Intubation time Prepare a module for non ‑ anaesthesiology trainees to handle ventilators in COVID ‑ 19 patients Primary outcome Difference in the area under the curve (adjusted to survival time) for lung injury Murray’s score in the first 4 days Protection from COVID ‑ 19 infection 60 50 60 26 40 110 size Sample 2/3 N/A N/A N/A N/A Phase Phase Phase 3 Participant and outcome assessor blinded Outcome assessor blinded NIL Participant and outcome assessor blinded Blinding Participant blinded Participant and investigator blinded Randomized, parallel ‑ group trial Randomized, cross ‑ over trial Randomized, parallel ‑ group, active controlled trial Single ‑ arm trial Study design Randomized, parallel ‑ group trial Randomized parallel ‑ group active controlled trial

Arm 1: Lowest driving pressure ‑ guided PEEP Arm 1: CMAC video laryngoscope Arm 2: McGrath MAC video laryngoscope Arm 1: Touren non ‑ channelled video laryngoscope Vision Arm 2: King channelled video laryngoscope Arm 1: COVID Ambu barrier box with King vision video laryngoscope Arm 2: COVID barrier box with Macintosh laryngoscope Arm 1: Simulation ‑ based training of ventilatory management of COVID ‑ 19 patients Intervention details Arm 2: Conventional lung protective ventilation strategy Arm 1: Chlopromazine + NBE extract concoction + cholecalciferol + Azadirachta indica bark extract concoction + Arsenicum album Arm 2: Standard tea + treatment * CTRI/2020/05/025071 CTRI/2020/05/025489 CTRI/2020/06/025522 CTRI/2020/06/025589 CTRI/2020/04/024747 CTRI/2020/05/025490 CTRI number 7 8 9 10 11 12 Serial number RAO et al: COVID-19 TRIALS IN CTRI, INDIA 57

(CTRI/2020/05/025242). In addition, with respect to the growing body of scientific data, regarding risks DCGI, associated with the use of HCQ, particularly QTc States and UTs MH prolongation and cardiac arrhythmias7, a Phase 2 trial is underway to assess the effect of topical i.e., nasal application of chloroquine in early-stage COVID-19 intelligence; on viral load and cure rates (CTRI/2020/04/024729). Immunomodulators artificial

AI, Ciclesonide: A Phase 2 trial being conducted at a Sponsor and regulatory status SSV Phytopharmaceuticals, Mumbai DCGI approval: N/A government medical college in New Delhi plans to evaluate not only the effects of HCQ but also that of ciclesonide, a glucocorticoid, and ivermectin, an investigator; anthelmintic drug, in 120 patients with moderate COVID-19 infection (CTRI/2020/04/024948).

principal Imatinib: Imatinib, which inhibits BCR - ABL

PI, tyrosine kinase, revolutionized the treatment of Improvement in symptoms of ambulatory patients which include cough, fever with or without chills and difficulty in breathing Primary outcome chronic myelogenous leukaemia10. Imatinib has been reported to significantly reduce titres of SARS-CoV College; 30

size and Middle East respiratory syndrome (MERS)-CoV, Sample which depend on ABL kinase activity to fuse and enter 11,12 Medical into the cells . An open-label, randomized, parallel-

Phase group Phase 2 trial with imatinib in 100 patients with Phase 3

Tagore mild COVID-19 has been registered in the CTRI (CTRI/2020/04/024806). Nath Itolizumab: This is an anti-CD6 humanized monoclonal N/A Blinding IgG1 antibody which acts upstream by inhibiting the

Ravindra co-stimulation of T cells, resulting in decreased release of signature cytokines of Th1 and Th17 cells13,14. Sponsored by an Indian pharmaceutical company, this Hospital, open-label, Phase 2, randomized, parallel-group, active Single ‑ arm trial Study design controlled multicenter trial is being conducted on

Bhupal 30 patients with moderate-to-severe COVID-19 to assess mortality rates and possible effects on the dreaded cytokine release syndrome (CTRI/2020/05/024959). Combination trials with modern medicine, Ayurveda and homeopathy. Table data are as per information provided by trialist. data are as per information Table and homeopathy. Ayurveda trials with modern medicine, Combination * Maharana Tocilizumab: Interleukin-6 (IL-6) is believed to play an important role in this syndrome, and an IL-6 receptor

College, blocker, tocilizumab, has generated global interest as a 15 Arm 1: Shreepad Shree formulation Vallabh Intervention details potential agent for patients with severe COVID-19 . A multicentric, randomized, Phase 3 trial to evaluate Medical the clinical outcomes and safety of tocilizumab

RNT along with standard of care in patients with cytokine release syndrome associated with moderate-to-severe COVID-19 infection has been registered in the CTRI Hospital

polymerase chain reaction. States and Union Territories (UTs): AP: Andhra Pradesh; AR: Arunachal Pradesh; AS: Assam; BR: Bihar; AS: Pradesh; Arunachal AR: Andhra Pradesh; AP: (UTs): Territories States and Union chain reaction. ‑ PCR, reverse transcription polymerase (CTRI/2020/05/025369). Registered trials as on June 5, 2020, CTRI/2020/04/024659 CTRI number 19, coronavirus disease 2019; JIPMER, Jawaharlal Institute of Postgraduate Medical Education and Research; Education Medical of Postgraduate Institute COVID ‑ 19, coronavirus disease 2019; JIPMER, Jawaharlal Sciences; of Medical India Institute All AIIMS, MB # 21, depression, anxiety and stress scale 21 items; 21 stress scale and anxiety DASS ‑ 21, depression, scale; depression and anxiety HADS, hospital applicable; N/A, not of India; General Drugs Controller RT KL: Kerala; MP: Madhya Pradesh; JK: Jammu and Kashmir; JH: Jharkhand; KA: Karnataka; HR: Haryana; HP: Himachal GA: Goa; GJ: Gujarat; CG: Chhattisgarh; Nadu; Tamil TN: SK: Sikkim; Rajasthan; RJ: Punjab; PB: Odisha; OR: Nagaland; N: Mizoram; MZ: Meghalaya; ML: MN: Manipur; MH: Maharashtra; Pradesh; Andaman and Nicobar Islands; CH: Chandigarh; DH: Dadra Nagar AN: Telangana; TS: Bengal; West WB: UP: Uttar Pradesh; UK: Uttarakhand; Tripura; TR: Puducherry Haveli; DD: Daman and Diu; DL: Delhi; LD: Lakshadweep; PY: Mycobacterium w: It is a saprophytic cultivable mycobacterium which is a potent immunomodulator. 13 Serial number When used as an adjuvant to multidrug therapy, it has been reported to have significant benefits in patients 58 INDIAN J MED RES, January & February 2021

with tuberculosis, leprosy and HIV-AIDS16,17. Three in the process causes internalization and destruction of industry-sponsored trials are proposed to be undertaken ACE223. The major complications of COVID-19 are with this agent in 40 critically ill COVID-19 patients, possibly caused by excessive angiotensin II activation 480 hospitalized but not critically ill patients as well due to loss of ACE2 and can be potentially reversed as 4000 individuals at high risk of contracting the by angiotensin receptor blockers such as losartan24. A disease. In addition, a Phase 2 observational study with randomized, parallel-group, placebo-controlled trial of heat killed Mycobacterium w as add-on therapy is also losartan for the prevention of COVID-19 complications underway on 50 hospitalized COVID-19 patients at a has been registered and is being conducted in an private medical college (CTRI/2020/05/025350). academic setting (CTRI/2020/05/025319). Melatonin: Melatonin is a remarkably safe and Antioxidant/pro-oxidant agent established anti-inflammatory and anti-oxidative Resveratrol-copper and sodium-copper-chlorophyllin: molecule with significant evidence suggesting its It has been hypothesized that following microbial potential for limiting virus-related diseases, which may infection, cell-free chromatin (cfCh) particles are extend to COVID-19 as well18. Melatonin has also been released from dying cells, causing apoptosis and reported to possess significant immunomodulatory inflammation in the adjoining host cells. This process effects in cancer19. A clinical trial on melatonin is triggers a vicious cycle leading to sepsis25. The novel underway to evaluate its role on COVID-19 infection pro-oxidant combination of resveratrol and copper has rate along with immune response in high-risk groups been reported to inactivate cfCh and demonstrated after eight weeks of treatment (CTRI/2020/06/025613). improved survival in animal models of sepsis26. Anthelmintics The commonly used food colorant and dietary Ivermectin: This broad-spectrum antiparasitic agent supplement, sodium copper chlorophyllin (SCC), has been shown to have potent in vitro antiviral activity has been reported to have significant antimutagenic against a variety of viruses. In in vitro studies, a single and antioxidant properties27. Two trials with dose has been shown to bring a significant reduction in resveratrol-copper and SCC as add-on treatment to the replication of SARS-CoV-220. This has generated standard treatment in asymptomatic/mildly symptomatic interest in the possibility of repurposing the drug for patients (Phase 3 trial) as well as hospitalized patients the management of COVID-19. A total of four clinical (Phase 2 trial) with COVID-19 have been registered trials (CTRI/2020/04/024858, CTRI/2020/05/025068, (CTRI/2020/05/025336, CTRI/2020/05/025337). CTRI/2020/05/025224, CTRI/2020/05/025333) with Antineoplastic ivermectin are underway, three of which aim to establish the therapeutic efficacy of ivermectin in 2-deoxy-D-glucose (2-DG): A glucose analogue, COVID-19 patients. The fourth trial is investigating the 2-deoxy-D-glucose, is believed to have profound prophylactic effect of ivermectin on 2000 healthcare effects on a range of diseases such as cancer, viral workers or healthy contacts (including children) of infection and ageing-related morbidity28. Recent COVID-19 patients. The primary outcome for this in vitro studies suggest the potential benefits of using study is resolution of signs and symptoms of COVID-19 2-DG to mitigate COVID-19 infection29,30. A Phase 2 and negative reverse transcription-polymerase chain trial to determine the safety and efficacy of the drug reaction (RT-PCR) done 48 h after drug administration. as an adjunctive therapy to standard of care in patients with moderate-to-severe COVID-19 is underway at Niclosamide: Used to treat tapeworm infestation, 12 sites (CTRI/2020/06/025664). niclosamide inhibits ATP production by uncoupling of oxidative phosphorylation. It has been reported to have Phytopharmaceutical products in vitro antiviral activity21,22. A randomized, parallel- Purified aqueous extract of Cocculus hirsutus group trial which proposes to investigate the virologic (AQCH) cure rates of niclosamide in patients with mild-to- very mild COVID-19 infection has been registered An industry-sponsored trial has been registered (CTRI/2020/04/024949). with aqueous extract of Cocculus hirsutus which is a phytopharmaceutical product derived from the Antihypertensive tropical, climbing shrub C. hirsutus. This plant has Losartan: Angiotensin-converting enzyme 2 (ACE2) been reported to have significant medicinal properties is a functional receptor for SARS-CoV-2 infection and in a variety of disease conditions including viral RAO et al: COVID-19 TRIALS IN CTRI, INDIA 59 infection31. The trial is proposed to be conducted at Bacille Calmette-Guérin (BCG) is believed to stimulate 14 sites across the country on patients with moderate the general immune response with a consequent faster COVID-19 (CTRI/2020/05/025397). response to infections that could reduce the severity of disease and lead to quicker recovery rates37. In India, Thymoquinone mass immunization with BCG has been underway since Nigella sativa, commonly known as black cumin, 194838. The global interest in BCG was recently sparked has shown a wide spectrum of biological activities, the when Miller et al39, reported a negative correlation most prominent being antioxidant, anti-inflammatory between BCG immunization status of a country and and antimicrobial activities32. An open-label, two-arm, mortalities due to COVID-19. In the CTRI, currently, parallel study is being conducted to evaluate the efficacy there are three BCG vaccine trials registered. One of and safety of thymoquinone, a phytopharmaceutical these is on the BCG-Denmark (Green Signal) vaccine compound extracted from Nigella sativa seeds, for the prevention of COVID-19 in 1826 healthcare compared to best supportive care in patients with workers, whereas the other is a Phase 3 trial of COVID-19 (CTRI/2020/05/025167). recombinant BCG VPM1002 vaccine for the reduction in infection incidence and severity of COVID-19 in 5946 Cell- and plasma-based therapies high risk individuals. Both these trials are triple-blinded, Convalescent plasma therapy (CPT) randomized, parallel-group, placebo-controlled trials (CTRI/2020/04/024833 and CTRI/2020/04/024749, For immediate short-term immunity, convalescent respectively). A single-blind, single-centre Phase 2 trial plasma therapy (CPT) has generated particular interest on 60 patients, is evaluating the therapeutic efficacy of as it appears to be safe, to be clinically effective and BCG in COVID-I9 (CTRI/2020/05/025013). reduces mortality in times of large-scale epidemics33-35. The ICMR has developed a protocol, which is Traditional medicine approved by the Drugs Controller General of India, for During this pandemic, the potential of traditional a multicentre trial (PLACID trial) to test the efficacy medicine is being actively explored through the of convalescent plasma obtained from recovered conduct of clinical trials to identify prophylactic as COVID-19 patients for administration to moderately ill well as therapeutic agents. The AYUSH approach to COVID-19 patients. This is a multicentre, randomized, manage the outbreak broadly comprises: preventive and parallel-group, open-label, active controlled Phase 2 prophylactic, symptom management of COVID-19-like trial to be conducted on 452 patients at 39 sites in India illnesses and add-on interventions to the conventional (CTRI/2020/04/024775). In addition, two other trials care40. Trials in the AYUSH system of medicine have have been registered which are being conducted by been registered in the CTRI (n=67) and include Ayurveda private hospitals on 100 patients each (n=45), Yoga and Naturopathy (n=3), Unani (n=2), (CTRI/2020/04/024915, CTRI/2020/05/025328). Further, Siddha (n=3), Homeopathy (n=14) trials (Table III). five additional small trials have also been registered investigating the role of CPT in hospitalized severely Ayurveda ill COVID-19 patients (CTRI/2020/04/024706, Ayurveda is a comprehensive system of medicine CTRI/2020/04/024804, CTRI/2020/05/025299, CTRI/ that has been practiced in India for >5000 years41. 2020/05/025346, CTRI/2020/05/025209). A total of 45 Ayurveda trials (Tables I and III) are currently registered in the CTRI. These are categorized Cytokine cocktail therapy as individual agents (11 trials) or combination A Phase 1 trial to evaluate the safety and tolerability preparations (10 trials, of which 3 trials include other of cytokine cocktail therapy in healthy volunteers from systems of AYUSH such as homeopathy and/or yoga) healthy donors (derived by T cells) has been registered as available under classical interventions. In addition, (CTRI/2020/05/025432). This trial is being conducted there are 24 trials registered on patented ayurvedic at Bengaluru, Karnataka. products. Four major plant products are under investigation, namely Tinospora cordifolia, Withania Biological products somnifera, Glycyrrhiza glabra and Curcuma longa Vaccines (only in combination with other agents). As per reports, vaccine against COVID-19 is While the classical interventions, individual and being developed in about 90 institutions worldwide36. combination trials (n=21), are mostly designed to 60 INDIAN J MED RES, January & February 2021 assess their prophylactic efficacy (n=16) in either AYUSH 64: A multiplant formulation, AYUSH-64, healthy human volunteers in the community or those at has been demonstrated to be useful in several research risk (n=16), the trials with patented products (n=24) are studies carried out over several decades to treat febrile primarily investigating the therapeutic efficacy (n=18) infections including malaria and is considered to in patients ranging from asymptomatic to moderate to possess anti-inflammatory and immunomodulatory severe COVID-19 patients (Table I). effects47. One of its components, Glycyrrhiza glabra or Yashtimadhu, has demonstrated potential as a wound- Classical interventions healing, anti-ulcer and anti-inflammatory agent48. Guduchi: Tinospora cordifolia, commonly In addition, recent studies reveal that Yashtimadhu named as Guduchi, is used in a variety of may interfere with viral entry as well as replication, conditions in the traditional Ayurvedic literature42. thereby impacting the severity of infection49. Further, Guduchi has been reported to possess a range AYUSH-64 along with standard care has been shown to of activities (antipyretic, anti-inflammatory, be effective in influenza-like illnesses with potential for antioxidant, anti-infective, anti-neoplastic and better outcomes50. While a community-based clinical immuno-modulatory effects) notable in the context of study on 1200 healthy but at-risk individuals has been COVID-1943. Currently, in the CTRI, there are seven registered in the CTRI to evaluate the preventive registered trials investigating the role of only Guduchi, role of only Yashtimadhu, there are five trials on the in healthy high risk individuals in the community to test proprietary formulation, AYUSH 64 (Table III). its role as a preventive agent against COVID-19. Four Chyawanprash: This is an ancient Indian polyherbal of these are large trials with sample size ranging from formulation prepared according to a traditional 5000 to 40,000 (the latter has 20 sites across India). Ayurvedic recipe. It consists of about 50 different In addition, there are three trials exploring the effects medicinal herbs including Emblica officinalis of Guduchi in combination with other agents. One of (Indian gooseberry or Amla), a rich source of vitamin C, these is being conducted on 50,000 police personnel in as well as processed minerals and is considered as an Delhi (Table III). essential health supplement51. Currently, four trials Ashwagandha: Withania somnifera (Ashwagandha) are registered which are investigating the preventive is well known for its anti-inflammatory, antitumour, role of Chyawanprash in high risk healthcare anti-stress, antioxidant, immunomodulatory, hemopoietic workers/containment zone population as well as the and rejuvenating properties44. In addition, it has been community (Table III). 45 demonstrated to inhibit certain RNA viruses . The Yoga and naturopathy role of Ashwagandha in the prevention of COVID-19 is being investigated in three trials registered in the Stress is known to suppress the immune system and is believed to be the harbinger of many diseases CTRI, one of which is on 5000 high-risk participants 52,53 (CTRI/2020/05/025429). including respiratory infections . Evidence supports the role of meditation in regulating the stress response Turmeric: The antiviral effects of curcumin, a plant and impacting virus-specific immune response54,55. derivative of turmeric, have been demonstrated in Further, Pranayama has been shown to have a in vitro studies, which makes it an antiviral drug positive impact on lung function56. Currently, three candidate46. Evaluation of the effects of curcumin and yoga trials are registered, of which two randomized, adjuvants in COVID-19 patients, in terms of changes parallel-group trials focus on the role of Pranayama in acute-phase reactants and clinical outcome, is and meditation in the prevention as well as treatment of being evaluated in a randomized, parallel-group trial COVID-19. In addition, in one trial, yoga is being tried on 50 patients (CTRI/2020/05/025482). In addition, in combination with naturopathy and Ayurvedic agents polyherbal compounds are being investigated for (CTRI/2020/05/025320). immunomodulatory and antiviral properties and their Unani potential as therapeutic and prophylactic agents. The Unani system of medicine, originally from Patented products Greece, has been influenced by Ayurveda, Siddha and Currently, there are 24 trials registered on patented Chinese systems of medicine. Even though an ancient products including AYUSH-64 patented by Central system, Unani medicine also recommends isolation Council for Research in Ayurvedic Sciences. and quarantine during an epidemic. In addition, it also RAO et al: COVID-19 TRIALS IN CTRI, INDIA 61 recommends (i) cleanliness, (ii) health boosting and on mental health, clinical practice in general and immune-modulation, and (iii) use of drugs57. Two trials in particular for oncology patients. Findings and investigating the prophylactic role of Unani medicine: observations from these studies would likely help one is on 4000 participants and the other on 40,000 develop better guidelines for the care of the most participants, have been registered in population at risk vulnerable in these pandemic times. of contracting COVID-19 (Table III). Concluding remarks Siddha Notwithstanding the deadly virulence of the The Siddha system, one of the six accepted branches SARS-CoV-2 and the enforcement of widespread of Indian systems of medicine, is particularly popular physical restrictions, medical researchers in India in southern India. Although it is similar to Ayurveda have risen to the dual challenge of caring for the sick in certain aspects, these are two distinct streams of and testing potential therapeutic options. This article medicine58. There are three Siddha trials registered culls the data of 122 COVID-19-related trials from investigating the role of Kabasura Kudineer, a Siddha the data of over 27,000 trials registered in the CTRI formulation alone and in combination as a preventive and presents a concise and comprehensive overview agent in the management of asymptomatic COVID-19 of the pharmacological and clinical aspects of the patients (Table III). registered trials. This also provides a comprehensive insight into the COVID-19 clinical research underway Homeopathy in the country through CTRI database. This would Homeopathy focuses on patient characteristics encourage researchers to critically review CTRI data, rather than disease per se59. There has been a call to identify gaps particularly methodological and design utilize the benefits of homeopathy as a therapeutic aspects of research and further decide on acceptability system suitable to cope with this pandemic60,61. Several of the results. We hope that this information would homeopathic agents have been recommended by the help researchers to not only understand the clinical Ministry of AYUSH, Government of India, for the research scenario, but also encourage healthy debate, prevention of COVID-19. Of the 14 homeopathic trials train researchers to avoid obvious errors/oversights, registered in the CTRI, most (n=11) are of Arsenicum steer clear of repetitive research and indirectly promote album 30 or Bryonia alba (Table III). the quality of research in the country. Miscellaneous trials Acknowledgment: The CTRI was set up with financial support from the ICMR, Ministry of Health and Family Welfare; Thirteen trials have been categorized as Department of Science and Technology, Government of India; and miscellaneous trials as these explore a range of World Health Organization, India Office, New Delhi, India. The interventions such as nutraceuticals, process-of-care CTRI website is hosted by the National Informatics Centre Services changes (n=9) and critical care-related trials and Inc., New Delhi, India. Authors acknowledge the support provided include management of non-COVID-19 patients in by the following: Servshri Anoop Upadhyay, Harish Kumar, and the pandemic (Table I). Some of these trials evaluate Din Bandhu, and Ms Noori Dua and Ms Deepty Rathi in the initial methods to minimize infection risks, whereas others screening of the trials and typographical work. compare different types of video laryngoscopes for ease of intubation while wearing personal protective Financial support & sponsorship: None. equipment (Table IV). Some of the other registered trials in this category include efficacy of nutraceuticals, Conflicts of Interest: None. feasibility of developing a novel artificial intelligence algorithm to screen COVID-19, telemedicine and References ventilatory management training to ramp up capacity. 1. Worldometers. COVID-19 coronavirus pandemic. Available Observational studies from: https://www.worldometers.info/coronavirus/, accessed on October 6, 2020. Apart from the clinical trials, the CTRI has 2. COVID-19 treatment guidelines. Available from: https:// registered observational studies on COVID-19 as well. covid19treatmentguidelines.nih.gov/introduction/, accessed Due to the imposition of lockdown and the imperative on June 11, 2020. need for social distancing, observational studies have 3. Clinical Trials Registry ‑ India. Available from: http://www. been undertaken to assess the impact of COVID-19 ctri.nic.in/Clinicaltrials/login.php, accessed on June 11, 2020. 62 INDIAN J MED RES, January & February 2021

4. World Health Organization. International Clinical Trials 18. Zhang R, Wang X, Ni L, Di X, Ma B, Niu S, et al. COVID-19: Registry Platform (ICTRP). Available from: https://www.who. Melatonin as a potential adjuvant treatment. Life Sci int/ictrp/en, accessed on June 11, 2020. 2020; 250 : 117583. 5. World Health Organization. “Solidarity” clinical trial for 19. Moradkhani F, Moloudizargari M, Fallah M, Asghari N, COVID-19 treatments. Available from: https://www.who. Heidari Khoei H, et al. Immunoregulatory role of melatonin int/emergencies/diseases/novel-coronavirus-2019/global- in cancer. J Cell Physiol 2020; 235 : 745-57. research-on-novel-coronavirus-2019-ncov/solidarity-clinical- 20. Caly L, Druce JD, Catton MG, Jans DA, Wagstaff KM. The trial-for-covid-19-treatments, accessed on June 11, 2020. FDA-approved drug ivermectin inhibits the replication of 6. Jordan PC, Stevens SK, Deval J. Nucleosides for the treatment SARS-CoV-2 in vitro. Antiviral Res 2020; 178 : 104787. of respiratory RNA virus infections. Antivir Chem Chemother 21. Xu J, Shi PY, Li H, Zhou J. Broad spectrum antiviral agent 2018; 26 : 1- 19. niclosamide and its therapeutic potential. ACS Infect Dis 7. Pastick KA, Okafor EC, Wang F, Lofgren SM, Skipper CP, 2020; 6 : 909-15. Nicol MR, et al. Hydroxychloroquine and chloroquine for treatment of SARS-CoV-2 (COVID-19). Open Forum Infect 22. Guthappa R. Molecular docking studies of N-acetyl cysteine, Dis 2020; 7 : ofaa130. zinc acetyl cysteine and niclosamide on SARS-CoV-2 protease and its comparison with hydroxychloroquine. ChemRxiv 2020. 8. Gautret P, Lagier JC, Parola P, Hoang VT, Meddeb L, Mailhe M, doi: 10.26434/chemrxiv.12161493.v1. et al. Hydroxychloroquine and azithromycin as a treatment of COVID-19: results of an open-label non-randomized clinical 23. Hoffmann M, Kleine-Weber H, Schroeder S, Krüger N, trial. Int J Antimicrob Agents 2020; 56 : 105949. Herrler T, Erichsen S, et al. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven 9. Advisory on the use of hydroxychloroquine as prophylaxis for protease inhibitor. Cell 2020; 181 : 271-80.e8. SARS-CoV-2 infection; 2020. Available from: https://www. mohfw.gov.in/pdf/AdvisoryontheuseofHydroxychloroquinas 24. Kai H, Kai M. Interactions of coronaviruses with ACE2, prophylaxisforSARSCoV2infection.pdf, accessed on June 11, angiotensin II, and RAS inhibitors-lessons from available 2020. evidence and insights into COVID-19. Hypertens Res 2020; 43 : 648-54. 10. Iqbal N, Iqbal N. Imatinib: a breakthrough of targeted therapy in cancer. Chemother Res Pract 2014; 2014 : 357027. 25. Mittra I, Samant U, Sharma S, Raghuram GV, Saha T, Tidke P, et al. Cell-free chromatin from dying cancer cells integrate 11. Sisk JM, Frieman MB, Machamer CE. Coronavirus S into genomes of bystander healthy cells to induce DNA protein-induced fusion is blocked prior to hemifusion by Abl damage and inflammation. Cell Death Discov 2017; 3 : 17015. kinase inhibitors. J Gen Virol 2018; 99 : 619-30. 26. Mittra I, Pal K, Pancholi N, Tidke P, Siddiqui S, Rane B, et al. 12. Cherian SS, Agrawal M, Basu A, Abraham P, Cell-free chromatin particles released from dying host cells Gangakhedkar RR, Bhargava B. Perspectives for repurposing are global instigators of endotoxin sepsis in mice. PLoS One drugs for the coronavirus disease 2019. Indian J Med Res 2020; 151 : 160-71. 2020; 15 : e0229017. 13. Singh V. Clinical outcome of a novel anti-CD6 biologic 27. Ferruzzi MG, Failla ML, Schwartz SJ. Sodium copper itolizumab in patients of psoriasis with comorbid conditions. chlorophyllin: in vitro digestive stability and accumulation Dermatol Res Pract 2016; 2016: 1316326. by Caco-2 human intestinal cells. J Agric Food Chem 2002; 50 : 2173-9. 14. Krupashankar DS, Dogra S, Kura M, Saraswat A, Budamakuntla L, Sumathy TK, et al. Efficacy and safety of 28. Xi H, Kurtoglu M, Lampidis TJ. The wonders of 2-deoxy-D- itolizumab, a novel anti-CD6 monoclonal antibody, in patients glucose. IUBMB Life 2014; 66 : 110-21. with moderate to severe chronic plaque psoriasis: results of 29. Balkrishna A, Thakur P, Singh S, Dev S, Jain V, a double-blind, randomized, placebo-controlled, phase-III Varshney A, et al. Glucose antimetabolite 2-Deoxy- study. J Am Acad Dermatol 2014; 71 : 484-92. D-Glucose and its derivative as promising candidates 15. Zhang C, Wu Z, Li JW, Zhao H, Wang GQ. Cytokine release for tackling COVID-19: Insights derived from in silico syndrome in severe COVID-19: interleukin-6 receptor docking and molecular simulations. Authorea 2020. antagonist tocilizumab may be the key to reduce mortality. Int doi: 10.22541/au.158567174.40895611. J Antimicrob Agents 2020; 55 : 105954. 30. Balkrishna A, Pokhrel S, Singh J, Varshney A. Withanone 16. Chahar M, Rawat KD, Reddy PVJ, Gupta UD, Natarajan M, from Withania Somnifera may inhibit novel coronavirus Chauhan DS, et al. Potential of adjunctive Mycobacterium (COVID-19) entry by disrupting interactions between viral w (MIP) immunotherapy in reducing the duration of s-protein receptor binding domain and host ACE2 receptor; standard chemotherapy against tuberculosis. Indian J Tuberc 2020. doi: 10.21203/rs.3.rs-17806/v1 2018; 65 : 335-44. 31. Meena MK, Singh N, Meena R, Patni V. Quantitative 17. Sehgal IS, Bhalla A, Puri GD, Yaddanapudi LN, determination of gallic acid from methanolic extract of Singh M, Malhotra P, et al. Safety of an immunomodulator Cocculus hirsutus using HTPLC. Int J Pharm Bio Arch Mycobacterium w in COVID-19. Lung India 2020; 37 : 279-1. 2016; 7 : 6-10. RAO et al: COVID-19 TRIALS IN CTRI, INDIA 63

32. Khader M, Eckl PM. Thymoquinone: an emerging natural and antifungal activity of curcumin. Biomed Res Int drug with a wide range of medical applications. Iran J Basic 2014; 2014 : 186864. Med Sci 2014; 17 : 950-7. 47. AYUSH-64. An ayurvedic antimalarial drug. Available from: 33. Marano G, Vaglio S, Pupella S, Facco G, http://www.ccras.nic.in/sites/default/files/viewpdf/IEC_ Catalano L, Liumbruno GM, et al. Convalescent plasma: Communication/Ayush%2064.pdf, accessed on June 11, 2020. new evidence for an old therapeutic tool? Blood Transfus 48. Das D, Agarwal SK, Chandola HM. Protective effect of 2016; 14 : 152-7. Yashtimadhu (Glycyrrhiza glabra) against side effects of 34. World Health Organization. WHO Blood Regulators Network radiation/chemotherapy in head and neck malignancies. Ayu (BRN): Position paper on collection and use of convalescent 2011; 32 : 196-9. plasma or serum as an element in Filovirus outbreak response. 49. Maurya DK. Evaluation of Yashtimadhu Available from: https://www.who.int/bloodproducts/brn/ (Glycyrrhiza glabra) active phytochemicals against novel BRN_PositionPaperConvPlasmaFiloviruses_FINALWEB coronavirus (SARS-CoV-2). Research Square 2020. 14August2014.pdf?ua=1, accessed on June 11, 2020. doi.org/10.21203/rs.3.rs-26480/v1. 35. Rajendran K, Krishnasamy N, Rangarajan J, 50. Gundeti MS, Bhurke LW, Mundada PS, Murudkar S, Rathinam J, Natarajan M, Ramachandran A. Convalescent Surve A, Sharma R, et al. AYUSH 64, a polyherbal plasma transfusion for the treatment of COVID-19: Systematic Ayurvedic formulation in Influenza like Illness: review. J Med Virol 2020; 10.1002/jmv.25961. Results of a pilot study. J Ayurveda Integr Med 2020. 36. Yang L, Tian D, Liu W. Strategies for vaccine development of doi:10.1016/j.jaim.2020.05.010. COVID-19. Sheng Wu Gong Cheng Xue Bao 2020; 36 : 593-604. 51. Sharma R, Martins N, Kuca K, Chaudhary A, Kabra A, 37. Tanner R, Villarreal-Ramos B, Vordermeier HM, Rao MM, et al. Chyawanprash: A traditional Indian bioactive McShane H. The humoral immune response to BCG health supplement. Biomolecules 2019; 9 : 161. vaccination. Front Immunol 2019; 10 : 1317. 52. Salleh MR. Life event, stress and illness. Malays J Med Sci 38. Neelakantan V. Tuberculosis control in postcolonial South 2008; 15 : 9-18. India and beyond: Fractured sovereignties in international 53. Maxwell L, Barrett B, Chase J, Brown R, Ewers T. health, 1948-1960. Wellcome Open Res 2017; 2 : 4. Self-reported mental health predicts acute respiratory 39. Miller A, Reandelar MJ, Fasciglione K, Roumenova V, infection. WMJ 2015; 114 : 100-4. Li Y, Otazu GH. Correlation between universal BCG 54. Househam AM, Peterson CT, Mills PJ, Chopra D. The vaccination policy and reduced morbidity and mortality effects of stress and meditation on the immune system, for COVID-19: an epidemiological study. medRxiv 2020. human microbiota, and epigenetics. Adv Mind Body Med doi: 10.1101/2020.03.24.20042937. 2017; 31 : 10-25. 40. Advisory from Ministry of AYUSH for meeting the challenge 55. Morgan N, Irwin MR, Chung M, Wang C. The effects of mind- arising out of spread of coronavirus (COVID-19) in India. body therapies on the immune system: Meta-analysis. PLoS Available from: https://www.ayush.gov.in/docs/125.pdf, One 2014; 9 : e100903. accessed on June 11, 2020. 56. Budhi RB, Payghan S, Deepeshwar S. Changes in lung 41. Mishra L, Singh BB, Dagenais S. Ayurveda: a historical function measures following Bhastrika Pranayama perspective and principles of the traditional healthcare system (Bellows Breath) and running in healthy individuals. Int J in India. Altern Ther Health Med 2001; 7 : 36-42. Yoga 2019; 12 : 233-9. 42. Saha S, Ghosh S. Tinospora cordifolia: One plant, many roles. 57. Nikhat S, Fazil M. Overview of Covid-19; its prevention and Anc Sci Life 2012; 31 : 151-9. management in the light of Unani medicine. Sci Total Environ 43. Upadhyay AK, Kumar K, Kumar A, Mishra HS. Tinospora 2020; 728 : 138859. cordifolia (Willd.) Hook. f. and Thoms. (Guduchi) ‑ validation 58. Muthiah K, Ganesan K, Ponnaiah M, Parameswaran S. of the Ayurvedic pharmacology through experimental and Concepts of body constitution in traditional Siddha texts: A clinical studies. Int J Ayurveda Res 2010; 1 : 112-21. literature review. J Ayurveda Integr Med 2019; 10 : 131-4. 44. Mishra LC, Singh BB, Dagenais S. Scientific basis for the 59. Poitevin B. Integrating homoeopathy in health systems. Bull therapeutic use of Withania somnifera (ashwagandha): A World Health Organ 1999; 77 : 160-6. review. Altern Med Rev 2000; 5 : 334-46. 60. Kalliantas D, Kallianta M, Karagianni CS. Homeopathy 45. Ganguly B, Umapathi V, Rastogi SK. Nitric oxide induced by combat against coronavirus disease (Covid-19). Z Gesundh Indian ginseng root extract inhibits infectious Bursal Disease Wiss 2020; 1-4. virus in chicken embryo fibroblasts in vitro. J Anim Sci 61. Ministry of AYUSH, Government of India. Homeopathy for Technol 2018; 60 : 2. prevention of coronavirus infections. Available from: https:// 46. Moghadamtousi SZ, Kadir HA, Hassandarvish P, Tajik H, pib.gov.in/PressReleasePage.aspx?PRID=1600895, accessed Abubakar S, Zandi K. A review on antibacterial, antiviral, on June 11, 2020.

For correspondence: Dr Mohua Maulik, Clinical Trial Registry - India, ICMR-National Institute of Medical Statistics, New Delhi 110 029, India e-mail: [email protected] Quick Response Code: Review Article

Indian J Med Res 153, January & February 2021, pp 64-85 DOI: 10.4103/ijmr.IJMR_3092_20

Use of convalescent plasma for COVID-19 in India: A review & practical guidelines

Niranjan Shiwaji Khaire1, Nishant Jindal1, Lakshmi Narayana Yaddanapudi2, Suchet Sachdev3, Rekha Hans3, Naresh Sachdeva4, Mini P. Singh5, Anup Agarwal6, Aparna Mukherjee6, Gunjan Kumar6, Ratti Ram Sharma3, Vikas Suri1, Goverdhan Dutt Puri2 & Pankaj Malhotra1

Departments of 1Internal Medicine, 2Anaesthesia & Intensive Care, 3Transfusion Medicine, 4Endocrinology & 5Virology, Postgraduate Institute of Medical Education & Research, Chandigarh & 6Clinical Trial & Health System Research Unit, Division of Epidemiology & Communicable Diseases, Indian Council of Medical Research, New Delhi, India

Received July 19, 2020

Convalescent plasma (CP) therapy is one of the promising therapies being tried for COVID-19 patients. This passive immunity mode involves separating preformed antibodies against SARS-CoV-2 from a recently recovered COVID-19 patient and infusing it into a patient with active disease or an exposed individual for prophylaxis. Its advantages include ease of production, rapid deployment, specificity against the target infectious agent, and scalability. In the current pandemic, it has been used on a large scale across the globe and also in India. However, unequivocal proof of efficacy and effectiveness in COVID-19 is still not available. Various CP therapy parameters such as donor selection, antibody quantification, timing of use, and dosing need to be considered before its use. The current review attempts to summarize the available evidence and provide recommendations for setting up CP protocols in clinical and research settings.

Key words Antibody-dependent enhancement - anti-SARS-CoV-2 antibodies - convalescent plasma - COVID-19 - donor selection - neutralizing antibodies - passive immunization

COVID-19 in India Convalescent plasma (CP), an overview The cases of COVID-19 in India, the pandemic Convalescent plasma (CP) is a mode of passive caused by SARS-CoV-2, has reached to 10,582,647 and immunization wherein preformed antibodies against total deaths above 152,000 on January 19, 20211. There an infectious agent are infused into a susceptible is currently no proven specific therapy, and multiple host with the aim of either preventing or treating novel and repurposed molecules are being used on an the infection2 (Fig. 1). CP was widely used in the experimental basis. The lack of effective therapeutic past to treat several bacterial (diphtheria, tetanus, options has been a major hurdle in our pandemic pneumococcal pneumonia and meningococcemia) mitigation measures. and viral infections (rabies, poliomyelitis and

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 64 KHAIRE et al: CONVALESCENT PLASMA FOR COVID-19 IN INDIA 65

Fig. 1. Overview of convalescent plasma (CP) therapy. The Figure shows the process of CP donation and its use in a patient with COVID-19. CP contains over a thousand types of proteins. Apart from the antibodies against SARS-CoV-2, various other proteins may contribute to the beneficial effects of CP administration, including anti-inflammatory cytokines, complement and clotting factors. measles) in the pre-antibiotic era3-5. Safer and more disease and provide the recommendations for setting standardized modalities such as hyperimmune up CP protocols in clinical and research settings. globulins and monoclonal antibodies are currently Immunological aspects of convalescent plasma available against diseases caused by agents such as Clostridium tetani, hepatitis A and B, rabies therapy in COVID-19 and respiratory syncytial virus4 (Fig. 2). CP still CP therapy involves collecting plasma from an retains an important place in the management of individual who has recently recovered from infection and infections caused by novel pathogens because of infusing it into an at-risk individual2,19 (Fig. 1). Such plasma the rapidity and ease with which it can be put to contains several humoral factors capable of providing clinical use (Table I). Hence, it has been widely immunity, but the most important one is believed to be the used during almost all recent epidemics, including polyclonal antibodies against the target agent18. CP confers H1N1 influenza6,7, SARS8,9, Middle East respiratory immune-protection by numerous mechanisms (Fig. 3). 10,11 12,13 syndrome (MERS) and Ebola . Most of the Direct viral neutralization by neutralizing antibodies literature from these epidemics is in the form of case (NAbs) and the immunomodulatory actions that limit host reports or series. There are very few randomized damage are important mechanisms in COVID-1918. control trials (RCTs)14,15 or systematic reviews and meta-analyses16,17. Past experience unequivocally Immunological studies have demonstrated a diverse attests to CP’s safety with very few adverse events antibody repertoire in the serum of recently recovered reported17,18. Pooled analyses suggest the benefit patients20. Antibodies directed against the receptor-binding of CP use in diseases such as H1N1, SARS and domain of the viral spike protein (S-RBD) bind them, limit Argentine haemorrhagic fever, especially when cell entry, and inhibit the virus amplification. Laboratory used early in the illness16,17. Data from across studies have shown potent neutralizing activity by such the globe regarding various aspects of CP use are antibodies repertoire against the live virus21-25. The majority accumulating at a fast pace. The current review aims of patients achieve seroconversion within two weeks of to summarize the available evidence in COVID-19 symptom onset21,26-28 (Fig. 4). While data regarding the 66 INDIAN J MED RES, January & February 2021

Table I. Suitability of convalescent plasma (CP) use during outbreaks by novel pathogens Rapidity of deployment CP can be put to clinical use as soon as a pool of individuals recovered from the illness is available Ease of production and Plasma collection and infusion are relatively straightforward and commonly performed procedures. use Most healthcare workers will be familiar with the procedure and will require no extra training. In resource‑constraint settings, convalescent whole blood can also be used instead of plasma Accessibility The expertise and equipment to perform plasmapheresis, storage and deployment are commonly available in most tertiary care centres around the globe Specificity The CP, by its very nature, is specific against the targeted infectious agent. In a few instances, such as the 1918 Spanish flu, CP was used even before the identification of the pathogenic agent. The use of CP locally will help prepare a product with specific action against the particular antigenic variant prevalent in that particular geographical area Immediate onset of action Helps confer immediate protection to individuals already suffering from the disease Safety Risks of CP infusion are minimal, and it is a safe therapy Scalability Can be easily scaled up to the level of a large population Source: Ref. 2

Fig. 2. Post-donation modifications of convalescent plasma (CP). The Figure shows the possible post-donation modifications to CP to create safer, more potent, standardized passive immunization products such as hyperimmune globulins and monoclonal antibodies against SARS-CoV-2. long-term duration of this humoral response in COVID-19 serial dilutions of the plasma with a standard dose of are still evolving, studies conducted during the SARS the live virus and inoculation of this mixture in a culture epidemic have shown that this antibody response is short- medium. The dilution of the plasma that prevents the lasting, with peak levels at around 3-4 months followed by culture of the virus or its cytopathic effect is defined as gradual waning over the next two years29. the neutralizing titre of the plasma30. However, these Measurement of antiviral activity of convalescent assays are not available on a large scale for CP therapy plasma: Neutralizing antibody titers because of accessibility and standardization problems. The neutralizing activity of CP directly quantifies The use of commercially available serological the plasma’s protective activity and has been used as assays as alternatives to neutralizing assays is an a gold standard for the quantification of its efficacy. attractive option. A few recent publications have These are functional assays that involve incubating demonstrated a good correlation of several such KHAIRE et al: CONVALESCENT PLASMA FOR COVID-19 IN INDIA 67

Fig. 3. Mechanisms of action of convalescent plasma (CP). The Figure depicts the multiple possible mechanisms of action of CP. Of note, there are multiple non-antibody-based as well as non-viral neutralization-based mechanisms of action. Hence, CP with low or absent anti-SARS-CoV-2 antibodies can theoretically provide beneficial effect when administered to COVID-19 patients. ADCC, antibody dependent cellular cytotoxicity.

Fig. 4. Current understanding of the relevant immunological concepts in COVID-19. The Figure explains the current concepts in the humoral immune response of COVID-19. (i) IgM antibody production starts at around 4-7 days, peaks by approximate week three and wanes gradually by 3-4 months from symptom onset20,21,28. (ii) IgG antibody production starts at around 10-14 days. The disappearance of IgG response is not exactly known; however, based on data during the earlier SARS epidemic, it is expected to be short-lasting and be undetectable in most individuals by 24-36 months29. (iii) Period of infectivity peaks a couple of days before symptom onset. serological titres, especially assays targeting the S-RBD Blood Centre (NYBC) found that two commercial domain and neutralizing assays23,24,31-33. The New York assays (by Abbott and ORTHOS) showed a good 68 INDIAN J MED RES, January & February 2021

Table II. Challenges in the development of assays for antibody titre quantification for convalescent plasma (CP) therapy Problems in the availability of neutralizing assays Suggested solutions Requires handling of live virus. Development of safer alternatives to Requires biosafety level 3 laboratory. neutralization assays such as using a Complex methodology. non‑infective pseudo‑typed virus24,32. High turnaround time. Use of ELISA and other serological Not amenable for automation. assays to quantify antibodies in CP. Not amenable for high throughput testing. Currently being done in India in NIV, Pune, on a research basis only. Problems in the standardization of antibody assays Suggested solutions Variability in reported assays in literature with respect to Accumulating data from RCTs will (i) Methodology and reagents. help determine what cut‑offs should be (ii) Platforms used (neutralizing assays, ELISA, CLIA, high throughput serological used for high antibody titre CP. assays, lateral flow assays, etc.). Comparative studies between (iii) Target antigen (S, N, others), target isotype (IgA, IgM, IgG1, IgG2, IgG3). neutralization assays and various types (iv) Cut‑offs used to define high titre antibodies. For instance, USFDA recommends of serological assays are needed, and CP with neutralizing titres >1:16038 while the European Commission recommends several are currently underway. >1:320 by neutralizing assay39. The RCT from Wuhan, China, used donors with Ideally, these surrogates of antibody titres >1:640 measured by an IgG ELISA detecting S‑RBD domain, neutralization assays need to be tested corresponding to 1:20 by neutralizing assays by their laboratory analysis33. The for efficacy in an RCT setting before recent EUA by the USFDA uses S/CO ratio >12 by the ORTHO‑VITROS assay to widespread use. define high titre plasma40. RCTs, randomized controlled trials; EUA, Emergency Use Authorization; ELISA, enzyme‑linked immunosorbent assay; CLIA, chemiluminescent immunoassay; NIV, National Institute of Virology; USFDA, U.S. Food and Drug Administration correlation with NAb titres in a study of serum from (39/40) possessed NAb titres >1:16043. However, 370 CP donors34. The ConCOVID group investigators recent reports have shown more variations. In the from the Netherlands found a good correlation of a NYBC report, 55 per cent of the screened 370 CP commercially available ELISA with neutralization donors did not have high titre antibodies, while 10 per assays32,35. The assay manufactured by EuroImmun AG cent had very high levels34. The ConCOVID group has also been shown to correlate with neutralization reported similar findings in a cohort of 115 plasma assays36 and used in a RCT from Spain37. Another issue donors, with 43 per cent screened donors having in the antibody titre measurement of CP is the wide neutralizing titres >1:320 and 10 per cent with titres variability in the methodology and cut-offs used in the >1:128035. In other studies, the proportion of donors literature (Table II). Ideally, these parameters need to found lacking in high titre antibodies ranged from 25 be standardized and validated in clinical trials before to 50 per cent23,44,45, with about 10-20 per cent having clinical use. very high antibody levels of more than 20 times the cut-off limits, the so-called super-donor phenotype45. Ideal donor Older age, male gender and clinical features such as A potential CP donor for COVID-19 is a healthy moderate-to-severe disease27, high C-reactive protein adult who has recently recovered from COVID-19 (CRP) and lymphocytopaenia23,46 have been found infection and remained asymptomatic for a minimum to be associated with higher NAb titres. Notably, of 14 days. This period is based on the estimates of asymptomatic individuals have been found to mount a antibody kinetics and period of infectivity (Fig. 4). very transient and low titre antibody response47. These Documented nasopharyngeal swab PCR negativity clinical and demographic factors may help guide the before CP donation is no longer mandatory in most selection of suitable donors. CP protocols across the globe41. Based on the available Ideally, donor selection should be based on their antibody kinetics data, the ideal window for donation NAb titres, but such an approach is currently not feasible is 3-4 months after symptom onset29. in India (Table II). Due to the unavailability of such There is a wide variability in the titres of anti- assays, most clinical and trial protocols are proceeding SARS-CoV-2 antibodies within donors42. Initial data with CP therapy without quantification of antibody from China showed that a high proportion of donors titres. Of note, the compassionate use programmes KHAIRE et al: CONVALESCENT PLASMA FOR COVID-19 IN INDIA 69 in the USA and Israel followed this approach and Donated plasma is frozen at less than −30°C determined antibody titres of the infused plasma (preferably −40 to −80°C) within 8-24 h of collection units post hoc, and their findings have been recently and can be stored for up to 12 months. Pathogen published36,48. The Indian Council of Medial Research inactivation by techniques such as photochemical (ICMR)-sponsored PLACID trial also followed this inactivation or solvent detergent treatment and pooling strategy. The antibody titres in this study were found from multiple donors are other post-donation processing to be low, with a median neutralization titre of 1:40 options to improve the safety and quality (Fig. 2). 49 [interquartile range (IQR) 1:30-1:80] . These findings Clinical use of convalescent plasma have highlighted the hazards of proceeding with CP therapy without appropriate antibody quantification in Despite the widespread use and publicity of CP, real time. For now, it seems to be a reasonable strategy it remains an experimental therapy. Conclusive proof to screen potential CP donors for the presence of anti- of its efficacy and the parameters of its effective use SARS-CoV-2 antibodies using commercially available remain to be firmly established. In such a situation, it serological tests to exclude donors with low anti- is advisable to use CP only under a research protocol SARS-CoV-2 antibodies. after discussing the experimental nature and potential risks of CP use with the recipient. Process of plasma donation The use of CP can be envisioned primarily in four A prospective donor should fulfil the standard clinical settings. The factors related to the dosing of donor screening criteria, as per the Drugs and CP in different settings are summarized in Tables III Cosmetics Rules, 194550, and the COVID-19 advisory and IV. A cardinal principle is that earlier use in the from National Blood Transfusion Council (NBTC)51. course of illness is expected to be more beneficial2,4. Plasma donation is a voluntary exercise and requires Early in the course of the disease, the viral burden is informed consent. Although whole blood can be used in less, and the infection is not yet firmly established. resource-limited settings, plasmapheresis remains the The hypothesized mechanism of action of CP is by preferred method of CP donation because of the larger prevention or delay in the establishment of infection collection volume of plasma, the feasibility of repeated long enough to allow for the host immune response collections and the minimal impact on the donor’s to clear the infection. In the latter stages of illness, haemoglobin. Up to 15 per cent of total blood volume the hyper-inflammatory state is the major driver of (400-800 ml per session) can be safely donated in a morbidity. The ongoing tissue damage maintains the single sitting41,52-54. Recommendations allow for serial inflammatory state as a vicious cycle, and control of plasma donations by a single donor with a minimum viral replication may have a minimal effect on disease gap of seven days between consecutive plasmapheresis course. As a corollary, CP may be expected to be an sessions54,55. effective modality for post-exposure prophylaxis.

Table III. Clinical use and dosing of convalescent plasma use Setting Description Suggested dosing Post‑exposure High risk contacts such as healthcare workers or contacts of One unit of 50‑100 ml plasma prophylaxis COVID‑19 patients who have high risk comorbidities Asymptomatic‑ These patients are asymptomatic to mildly symptomatic with no organ 1‑2 units of standard volume (200‑ to‑mild illness dysfunction. Treatment is with an intent to prevent organ dysfunction. 250 ml) plasma Further sub‑classification in this category includes patents with high risk comorbidities such as age, obesity, hypertension and T2DM Moderate‑to‑ Patients with organ dysfunction, hypoxia, ARDS, requiring oxygen 2‑4 units of standard volume (200‑ severe illness supplementation 250 ml) plasma Critically ill Patients on life support such as mechanical ventilator and ECMO Higher doses up to 7 units of standard volume plasma, administered once daily Note: The hypothesized dose is based on the estimate of viral load in the patient. Hence, the doses to be used are lower in mild illness and higher in severe illness. At the same time, the expected benefit of CP in severe and critically ill patients is thought to be minimal. T2DM, type 2 diabetes mellitus; ARDS, acute respiratory distress syndrome; ECMO, extracorporeal membrane oxygenation Source: Ref. 2 70 INDIAN J MED RES, January & February 2021

Table IV. Factors to be considered to determine the accurate dose of convalescent plasma (CP) Variables required to decide the exact dose of CP Exact antibody titre of the infused unit of CP The clinical setting for which CP is being administered (Table III) Desired levels of antibody in the recipient known to confer protection in the particular setting* Total body plasma volume of the recipient (based on height and weight) In vivo pharmacokinetics of the infused antibodies* Hypothetical calculation of CP dose CP infusion has been planned for an 80 kg patient with moderate disease. The CP available has antibody titres of 1:160. The hypothetical target antibody titre for protection in this setting of moderate disease is 1:20. The total plasma volume of the patient at 40 ml/kg would be 3200 ml. Infusing plasma of volume x would give a final concentration of (1/160) × (x/3200+x)=1/20. Completing the calculation, the dose of CP needed to be administered would be approximately 450 ml or 6 ml/kg. *Parameters which are not currently known Source: Ref. 2

Table IV shows the suggested dosing for use of CP in reactions was very low (<1%), and only two serious different clinical settings. adverse events could be conclusively attributed to plasma therapy. Another theoretical concern is the Accumulating evidence suggests that any potential benefit of CP use may be found in mild and moderate antibody-mediated enhancement of infectivity, a 33,43 phenomenon described with several viral infections illness rather than the critically ill . Studies during 58,59 the SARS epidemic showed CP to be more useful in such as dengue . It is believed to occur when an symptomatic patients who were seronegative and PCR individual harbours pre-existing antibodies against positive8. Results from the RCT from the Netherlands a closely related strain of the virus (such as the suggest the need to choose such seronegative SARS-CoV-1, MERS or other coronaviruses). It COVID-19 patients early in the course of illness35. is hypothesized that these pre-existing antibodies However, the shortages of high antibody titre donors are sub-neutralizing in nature and mask the viral preclude the use in prophylactic or mild illness settings epitopes from immune recognition, thus facilitating on a large scale. Thus, in the current scenario, the intracellular entry and survival, leading to a 58 potential use of CP may be prioritized in the following paradoxical worsening of the illness . There is no settings: (i) Post-exposure prophylaxis for healthcare evidence available to suggest the role of antibody- workers; (ii) Post-exposure prophylaxis of individuals mediated enhancement in COVID-19. with comorbidities at higher risk of severe illness; Worldwide use of convalescent plasma in COVID-19 and (iii) Treatment of symptomatic individuals with moderate disease, especially in the first week of illness. The earliest reports of CP use came from China. These and other initial reports have been summarized Risks of convalescent plasma use in Table V. By early March, CP therapy was adopted in Despite the use of guideline-based screening the USA, Italy, Israel, Spain and several other countries strategies, CP carries a non-zero risk of transfusion- on compassionate grounds in severely ill patients or as associated infections. Other complications include part of clinical trials. Several large single-arm studies allergic reactions, transfusion-related acute lung from these centres (Table VI) provided a proof of injury (TRALI) and transfusion-associated circulatory concept and established the feasibility and safety of CP overload (TACO). COVID-19 patients with their in COVID-19. These have reinforced the general theme compromised respiratory reserve are especially that earlier administration is associated with better vulnerable to TRALI/TACO, which may be difficult outcomes. The limitations of these studies included to distinguish from the progression of COVID-19. In small sample sizes, absent or non-randomized control the periodically published safety analyses from the arms, simultaneous use of multiple experimental Expanded Access Program (EAP) in the USA where therapies and a non-uniform study design and donor the safety data of the first 500056 and later 20,000 selection criteria. Most of these studies were in severe patients57 have been reported, the incidence of these and critically ill patients. KHAIRE et al: CONVALESCENT PLASMA FOR COVID-19 IN INDIA 71 Contd... Three patients weaned off the Results Clinical and radiological improvement to home in all, three being discharged to a step ‑ down and one discharged In one patient assessed for facility. viral load by PCR, there was rapid viral clearance. Rapid clinical improvement, including oxygenation improvement in fever, status and viral PCR. One could from be extubated and discharged the hospital; other required tracheostomy but could be weaned off from ventilator. Improvement in clinical features, laboratory parameters (lymphocyte count, CRP), variable radiological clearing. Clearance of viral shedding in 7/10. Mechanical ventilation and HFNC weaned from 2 and 1 patient, 7 Overall, 3 discharged, respectively. improved. Better outcomes in those treated before day 14. Significant benefit in outcomes as compared to a historical cohort (3 deaths, 6 stable, 1 improved). Improvement in clinical features score), laboratory SOFA (fever, IL ‑ 6, PCT), parameters (CRP, scan radiological clearing on CT and viral shedding measured by PCR. the other ventilator and discharged, two stables on ventilator with one weaned off ECMO until time of reporting

‑ 2 by IgG ELISA. ‑ 2 antibody titre >1:1000 and Convalescent plasma characteristics Donor characteristics: Not mentioned. Donor antibody levels: Not done pre ‑ transfusion. Plasma dose: 1 ‑ 8 units per patient (200, 300, 900 and 2400 ml in each patient). Plasma infusion timing: Median 18 days (16 ‑ 19) after symptoms. Donor characteristics: Male donor in 20s with since symptom Time symptomatic COVID. resolution not mentioned. Donor antibody levels: Positive for anti ‑ SARS CoV 500 ml given in two Total Plasma dose: divided doses. Plasma infusion timing: Day 22 and 6 after symptom onset. Donor characteristics: Not mentioned. Donor antibody levels: Neutralization antibody titre>1:640. Plasma dose: 1 unit of 200 ml plasma, treated with methylene blue photochemistry for pathogen inactivation. Plasma infusion timing: Median 16.5 days ‑ 20) after symptoms (11 60 yr, Age 18 ‑ 60 yr, Donor characteristics: asymptomatic for at least 10 days. Severity of COVID not mentioned. Donor antibody levels: ELISA for Donor antibody levels: ELISA anti ‑ SARS CoV neutralization antibody titre >1:40. Plasma dose: 2 units of 200 ‑ 250 ml each, the same day as the donation. Plasma infusion timing: Median 22 days (14 ‑ 24) after symptoms

Initial case reports and series in the use of convalescent plasma (CP) COVID ‑ 19 V. Table

Study design Control arm: Nil Blinding: Nil Randomization: Nil Other treatments: methylprednisolone, antivirals (a combination of antivirals in all) Study type: Case series n=4 three on a Study population: Critically ill, 1 NIV, 2 ECMO, on CRRT mechanical ventilator, Study type: Case series n=2 Study population: Critically ill, on mechanical ventilation Control arm: Nil Blinding: Nil Randomization: Nil Other treatments: methylprednisolone, lopinavir/ritonavir Study type: Case series n=10 Study population: Critically ill patients, 3 on mechanical 3 on HFNC, 2 nasal prongs, 1 pregnant ventilator, patient Control arm: Nil Blinding: Nil Randomization: Nil Other treatments: methylprednisolone, multiple lines of antivirals Study type: Case series n=5 Study population: Critically ill, all on mechanical ventilation, one on ECMO, all with high viral load at the time of infusion plasma. Control arm: Nil Blinding: Nil Randomization: Nil Other treatments: methylprednisolone, antivirals arbidol, darunavir, lopinavir/ritonavir, (favipiravir, interferon ‑ alpha 1b)

61

43 60 62 Shen et al Ahn et al Duan et al Zhang et al Study (Guangdong, China) published on March 31, 2020 (Seoul, Korea) published on April 2, 2020 (Wuhan, China) (Wuhan, published on April 6, 2020 (Shenzhen, China) published on March 27, 2020 72 INDIAN J MED RES, January & February 2021 organ The sequential SOFA, cannula; review of these five uncontrolled nasal Symptomatic and radiological improvement in all symptomatic patients. No ICU admission, Three patients were PCR deaths. negative seen before plasma infusion, decision to infuse because of persistent symptoms and radiological findings, and one patient was asymptomatic PCR ‑ positive patient 100 per cent viral clearance in plasma group versus 21 per cent in comparator group. Mortality of 5/6 and 14/15 in the two groups Results studies could demonstrate rise in neutralizing antibody titres as well viral clearance A use may case series suggests that CP be beneficial in COVID ‑ 19. flow

high

HFNC, therapy;

replacement renal Donor characteristics: Donation after at least three weeks of asymptomatic period. Donor antibody levels: Not done. Plasma dose: 1 ‑ 3 units per patient. Plasma infusion timing: Relatively late as compared to other studies. Median 32 days (32 ‑ 39) from symptom onset. Donor characteristics: Asymptomatic for two Donor characteristics: weeks, rest details not mentioned. Donor antibody levels: positive for IgG, no quantification of titre available. however, Plasma dose: 1 ‑ 2 units of plasma, median volume 300 ml. Plasma infusion timing: Median 21.5 days (17 ‑ 23) after diagnosis Convalescent plasma characteristics The review contains details of the CP The review contains details of the CP preparations and dosing used in individual studies

continuous

CRRT,

immunoglobulin;

intravenous

IVIG, Control arm: Nil Blinding: Nil Randomization: Nil Antivirals such as arbidol and Other treatments: corticosteroids Study type: Case series n=6 Study population: Mild to moderately ill patients, including one asymptomatic patient. 4/6 requiring supplemental oxygen, 0/6 in ICU or mechanical ventilator. Study type: Retrospective observational study. n=6 Study population: Critically ill, with respiratory failure, 5 4 on ECMO. on ventilator, Control arm: Contemporary matched cohort, n=15 Blinding: Nil Randomization: Nil Other treatments: methylprednisolone 4/6, IVIG 5/6, other details not mentioned Study design Study type: Systematic review of CP studies until April studies until Study type: Systematic review of CP 19, 2020. n=27 participants from 5 studies. Randomization: None in all 5 studies. Other treatments: Not applicable. Study population: Not applicable. Blinding: None in all 5 studies procalcitonin; , 65 PCT,

reactive protein; PCR, polymerase chain reaction; CT, computed CT, reaction; chain PCR, polymerase protein; C ‑ reactive CRP, unit; care ICU, intensive 2; coronavirus syndrome respiratory acute ‑ 2, severe et al 64

63 failure assessment Zeng et al Rajendran Ye et al SARS ‑ CoV tomography; (Wuhan (Wuhan Huoshenshan Hospital ‑ the newly built dedicated COVID hospital in Wuhan, China) published April 15, 2020 on (Zhengzhou, China) published April 29, 2020 on Study systematic review published on May 1, 2020 KHAIRE et al: CONVALESCENT PLASMA FOR COVID-19 IN INDIA 73

Contd... Significantly improved clinical outcomes as compared with control arm. Significant mortality benefit as compared to control arm in non ‑ intubated patients, but not patients (HR 0.19). Overall, in median follow days (1 ‑ 28) plasma arm, 71.8 per up of 11 and 12.8 per cent had cent were discharged died. point At day 14, 19 patients had at least 1 ‑ point improvement of clinical status (WHO were discharged, 6 ‑ point ordinal scale), 11 AE reported. 3 deteriorated, 1 death. No patients three and One patient had skin rash had thrombotic events during follow up. IgG No clear correlation between ELISA titre and outcomes. On long ‑ term follow only two remained up, 20 discharged, intubated, none on ECMO. Of the 26 units transfused, 5 units were of low titre of CP (arbitrarily defined as <150 with 2 units below 50) whereas 7 were of titres 1350 or more Results Within first four hours of infusion, SAE first four hours of infusion, SAE Within n=36, incidence <1 per cent, mortality 0.3 per cent. 25/36 reported SAE deemed related to transfusion (mortality=4, severe allergic TRALI=11, TACO=7, reaction=3). Only 2/36 SAE deemed definitely related to infusion. 4/15 deaths (3 possibly related, deemed related to CP 1 probably related, none definitely related) seven days mortality whole cohort 14.9 per cent. No report of thrombosis associated SAE.

2 antibody titre in CP ‑ 2 antibody titre in CP single patient received second

Donor characteristics: Not mentioned Anti ‑ spike Donor antibody levels: antibody titres >1:320 Plasma dose: 2 units of approximately 250 ml each Plasma infusion timing: Median four days (1 ‑ 7) from admission to transfusion Donor characteristics: n=9. Age 23 ‑ 67 Donor characteristics: n=9. All had symptomatic COVID, one yr. requiring Asymptomatic hospitalization. for at least 14 days before donation. for Donor antibody levels: ELISA anti ‑ SARS CoV ranged from 0 to 1350 Plasma dose: One transfusion of 300 ml A plasma. transfusion after six days. Plasma infusion timing: median 10 days (7.5 ‑ 12.5 IQR) after symptoms Convalescent plasma characteristics Donor characteristics: Not mentioned Donor antibody levels: Not mentioned, (samples archived for antibody titre analysis in future) Plasma dose: 1 ‑ 2 units (200 500 ml) per recipient Plasma infusion timing: Not mentioned

Large cohort studies and randomized control trials in COVID ‑ 19 VI. Large Table

Study type: Single ‑ arm intervention study n=39 Study population: Severe or life ‑ threatening illness, 4 on mechanical ventilator Control arm: Cohort of controls identified by propensity score ‑ based matching from a pool of 4152 contemporary patients (n=78) Blinding: Nil Randomization: Nil Other treatments: Corticosteroids, HCQ, IL6 and IL1 antivirals, stem cell therapy, inhibitors Study type: Single ‑ arm intervention study. n=25 Study population: Severe or life ‑ threatening COVID. 1 on ECMO. 12 on mechanical ventilator, Control arm: Nil Blinding: Nil Randomization: Nil Other treatments: Anti ‑ inflammatory (corticosteroids, tocilizumab) in 72 per cent, HCQ + azithromycin in 100 per cent, remdesivir, ribavirin lopinavir/ritonavir, Study design Study type: Single ‑ arm intervention study Control arm: Nil Blinding: Nil Randomization: Nil n=5000 Study population: Severe or life ‑ threatening illness, 66 per cent in ICU, 72 respiratory failure. Other treatments: Not mentioned

44 56

66 et al York, USA) (New York, published as a pre ‑ print on May 22, 2020 Joyner et al (Houston, USA) published on May 31, 2020 Study Salazar Liu et al (USFDA expanded (USFDA access programme for convalescent plasma with patients from >2000 centres across USA) published as a pre ‑ print on May 14, 2020 2 1 3 S. No. 74 INDIAN J MED RES, January & February 2021 cohort Contd... disease severe in difference in one week and 3 of 7 were Study stopped after 103 of the planned 200 patients enrolled. Primary outcome or of clinical improvement (discharge improvement in 2 points on a 6 ‑ point scale) achieved in 59 per cent of study group versus 43 per cent in control arm (HR 1.4). Significant (91 vs. 68% HR 2.15 P =0.03) as compared to critically ill (20.7% vs. 24.7% HR 0.88 P =0.83). No difference in day 28 mortality, Early virological clearance time to discharge. in Study group seen. (Neg PCR at 72 h AEs post ‑ transfusion Two 87% vs. 37.5%) that improved with supportive care (6.5%) within seven days of CP 3 deaths (6.5%) within seven days of CP administration. Mortality in a concurrent cohort with same eligibility criteria, mortality was 30 per cent. 26 out of patients weaned off CPAP patients required ECMO after Two extubated. AEs possibly related serious Two enrolment. Plasma infusion was interrupted in one to CP. case 10 per cent deaths and 25 per cent discharges 10 per cent deaths and 25 discharges received within by day 7. No deaths if CP 7 days of hospitalization. In control group, at 25 per cent death and 35 discharge VTE in both day 7. 20 per cent incidence of groups. Significant difference in remdesivir use between two groups. Results

®

Donor characteristics: 8 donors, all symptomatic with mild illness, not donation requiring hospitalizations. CP after 28 days of symptom ‑ free period Donor antibody levels: 7/8 positive for IgG and high positive in 1 moderate positive in 3 by EuroImmun 55 yr, Age 18 ‑ 55 yr, Donor characteristics: at least two weeks ago, 2 discharged nasopharyngeal swabs negative by PCR. Antibody titres in Donor antibody levels: products determined by neutralization CP targeting antibody titres as well ELISA IgG antibody against S ‑ RBD domain. Positive correlation between the two units with ELISA assays found. CP titres above 1:640 only were selected for infusion Plasma dose: 4 ‑ 13 ml/kg plasma given per patient. 96 per cent received single unit of plasma 200 ml Plasma infusion timing: Symptom onset to randomization time, median 30 days (20 ‑ 39 IQR) Donor characteristics: Not mentioned Donor antibody levels: Neutralizing antibody titres >1:80 250 ‑ 300 ml Plasma dose: 1 ‑ 3 units of CP each Plasma infusion timing: Mean time of symptom onset 14 days Plasma dose: 1 unit of CP Plasma infusion timing: Median four days (1 ‑ 7) days from admission to transfusion Convalescent plasma characteristics

Study type: Single ‑ arm intervention study. n=20 Study population: Severe and critically ill patients, one ‑ third on mechanical ventilator. WHO Age, co ‑ morbidities, Control arm: score ‑ matched control group. and SOFA Blinding: Nil Randomization: Nil Other treatments: Azithromycin, HCQ. Half Other treatments: of control group received remdesivir Study type: Open ‑ label, multicentre randomized control trial n=103 Study population: Severe or life ‑ threatening illness Blinding: Nil Yes Randomization: Antivirals, antibacterials, Other treatments: steroids, IVIG, Chinese herbal medicine Blinding: Nil Randomization: Nil n=46 Study population: Moderate ‑ to severe and 7 30 on CPAP ARDS, with high CRP. on MV. Control arm: Cohort of controls identified by propensity score ‑ based matching from a pool of 4152 contemporary patients (n=78) Antibiotics, HCQ, Other treatments: anticoagulation Study type: Single ‑ arm intervention study Study design

31 (Italy) 67 (Wuhan, (Wuhan, et al 33 (Seattle, USA) published on May 19, 2020 China) published on June 3, 2020 Hegerova et al Li et al published on May 26, 2020 Perotti Study 6 5 4 S. No. KHAIRE et al: CONVALESCENT PLASMA FOR COVID-19 IN INDIA 75

Contd...

administration. No ‑ 2 antibodies at enrolment. AEs related to CP ‑ fold rise in neutralizing titres. No Study halted pre ‑ maturely after 86 of the 200 patients enrolled as DSMB had target concerns about study design. 53 of the 66 patients tested (80%) already had anti ‑ SARS CoV of the Median antibody titres by PRNT tested 56 the patients in study as well donors screened by neutralizing as 115 antibody titres was comparable (1:160 vs. 1:160). N ‑ Abs were detected in 46 with titre >1:20 in 44 of the 56 patients. No difference day 15 disease hospital stay, in mortality, severity in the two arms. Among 9 study ‑ arm patients with day 7 caused N ‑ Ab testing, administration of CP four AE or SAE was observed plasma ‑ related Mortality in CP group 4.8 per cent versus Mortality in CP Around 15 per control arm 28.5 per cent. cent of patients were seropositive on day 0 these patients also of enrolment; however, showed benefit from CP significant Four patients died all deaths in life threatening disease cohort. 15 severely ill patients avoided ICU care or mechanical ventilation. 10 patients with life ‑ threatening illness could be extubated. Most patients had significant decrease in respiratory support administration. requirement by day 7 of CP Although this study provides evidence even without antibody titre for use of CP determination, key information regarding CP use such as donor characteristics, dose given are not mentioned Results

2 IgG ELISA and ‑ 2 IgG ELISA

Donor characteristics: Detailed analysis screened donor characteristics and of 115 their antibody titres have been described. Donor antibody levels: Neutralizing antibody assay by plaque reduction neutralizing test was performed in 115 from 9 donors was potential donors. CP infused in study arm with median titre of 1:640 (IQR 1:320 ‑ 1:1280) Plasma dose: Single dose of 300 ml on day of enrolment. Repeat dosing on 5 improvement showing clinical those not in and still PCR positive. Plasma infusion timing: Mean duration of symptoms before enrolment was 10 days (6 ‑ 15 IQR) Donor characteristics: Not mentioned Donor antibody levels: Plasma tested by anti SARS ‑ CoV those with IgG index >1.25 selected for donation Plasma dose: Not mentioned Plasma infusion timing: Mean duration of symptoms of whole cohort 15.7 days Donor characteristics: Not mentioned Donor antibody levels: Not available for screening Plasma dose: Not mentioned Plasma infusion timing: Not mentioned Convalescent plasma characteristics

Blinding: Nil Yes Randomization: Other treatments: Not mentioned n=86 At enrolment 13 per cent Study population: ICU or mechanically ventilated patients Study type: Open ‑ label, multicentre randomized control trial Study type: Parallel arm intervention study 28 in observation n=49 (21 received CP, arm) Study population: COVID ‑ 19 patients with hypoxia. Overall critically ill population with >50 per cent on mechanical ventilator Blinding: Nil Randomization: Nil. Patients allotted to study arm based on availability of Exact allocation ABO compatible CP. methodology not mentioned Control arm: Nil Other treatments: Not mentioned Study type: Single ‑ arm intervention study n=31 Study population: Severe or life ‑ threatening illness Blinding: Nil Randomization: Nil Control arm: Nil Other treatments: Not mentioned Study design

35

68 69 et al (14 centres across Netherlands) published as a pre ‑ print on June 3, 2020 (Baghdad, Iraq) published as a pre ‑ print on September 1, 2020 Rasheed et al (University of USA) Wisconsin, published as a pre ‑ print on May 22, 2020 Hartman Study Gharbharan et al 8 7 9 S. No. 76 INDIAN J MED RES, January & February 2021

Contd... <0.001). 76 per cent patients received single unit CP. 76 per cent patients received single unit CP. units >90 per cent of patients received CP with antibody titre >1:1350. Significant reduction in mortality within 28 days CP transfused group as compared to the matched controls. Difference was significant in CP recipients infused within 72 h of admission This and with antibody titres >1:1350. benefit also extended to multiple secondary outcomes. Comparison of this group with CP recipients recipients after 72 h and also CP with lower titres of antibodies yielded significant differences in mortality Results Seven days mortality in patients transfused within three days of diagnosis versus more ( P than four days was 8.7 versus 11.9 Similar findings seen in 30 days mortality. Dose response curve seen with dose of This analysis was infused IgG titres. performed on 3082 patients. Seven days with mortality in patients who received CP IgG titres >18.45 S/CO, between 4.62 and 18.45 S/CO and <4.62 was 8.9 per and 13.7 per cent, respectively cent, 11.6 ( P =0.048) Similar findings also seen in 30 Overall, the survivors in days mortality. as this cohort received higher volume of CP compared with the non ‑ survivors. Median neutralizing antibody titres in CP There was was 1:160 (IQR ‑ 1:640). and good correlation between the ELISA In patients receiving CP assay. the PRNT with antibody level <4 units, 36.7 per cent improved by day 14, and in patients with CP >4, 68.4 per cent improved, a difference that was significant.

post

2 IgG CLIA and ‑ 2 IgG CLIA

2 antibody titre targeting ‑ 2 antibody titre targeting . 2 Convalescent plasma characteristics Donor characteristics: 18 ‑ 65 yr old donors, 14 days asymptomatic with one PCR negative before donation. for Donor antibody levels: ELISA anti ‑ SARS CoV Spike protein, developed in house was of 1:1350 in this assay. Titre used. corresponds to 1:160 in neutralization assay. Plasma dose: One to two units of CP administered. Second unit transfused if patient had clinical worsening as per pre ‑ defined criteria and in patients with BMI >30 kg/m Donor characteristics: Symptom free for 14 days, rest details NA Donor antibody levels: Measured Anti SARS ‑ CoV hoc by quantified by the S/CO ratio. unit infusion At least one CP Plasma dose: Plasma infusion timing: 40 per cent subjects infused within three days of diagnosis and 85 per cent within 10 days. required two negative Donor characteristics: and donation swabs before nasopharyngeal swab. negative last after 14 days period Not known at levels: Donor antibody Antibody titres the time of infusion. ELISA were determined by commercial EuroImmun by manufactured kit of the the S1 domain AG targeting spike protein as well neutralizing assay. antibody titres using PRNT doses of 200 Two dose: Plasma other given 24 h from each ml CP Median 10 days Plasma infusion timing: from PCR positivity.

analysis of CP Post hoc analysis of CP

Study design Study type: Single ‑ arm intervention study n=316 Study population: Severe or life ‑ threatening 1 on COVID. 12 on mechanical ventilator, ECMO. Control arm: Propensity score based 251 matched controls from the same institute transfused were compared to 136 CP patients. Blinding: Nil Randomization: Nil Other treatments: Steroids, azithromycin, tocilizumab, remdesivir n=35,322 CP recipients n=35,322 CP Study type: recipients under a compassionate use programme with correlation of infused antibody titres with clinical outcomes. Study population: High proportion of severely ill patients with 52.3 per cent in ICU and 27.5 per cent on mechanical ventilation Control arm: Nil Blinding: Nil Randomization: Nil Study type: Prospective cohort study n=49 Study population: 22 per cent moderate, 78 per cent severely ill with 66 mechanically ventilated. Blinding: Nil Randomization: Nil

(US 70 (Israel) 48 36 et al Joyner et al Study (Houston, USA) published on August 3, 2020 Salazar EAP COVID ‑ 19 EAP Plasma Consortium) published as a pre ‑ print on August 12, 2020 published on August 12, 2020 Maor et al 11 10 12 S. No. KHAIRE et al: CONVALESCENT PLASMA FOR COVID-19 IN INDIA 77

‑ 2 Contd... units use arm had benefits These differences The infused CP There was a difference in secondary Overall mortality of 37 per cent in the whole group. Mortality in severe group was 13 per cent versus in critical group was 55 cent. ARDS and outcomes such as progression of hospital stay in both the groups was not associated with reduction in CP mortality (13.6% in intervention arm and 14.6% in control arm) or prevention of progression to severe disease. Overall, the used was of a poorer antibody quality of CP titre with median neutralizing antibody titres of 1:40 (IQR 1:30 ‑ 1:80). CP in earlier resolution of symptoms, decrease oxygen requirement and virological clearance. AE was 10 events in 235 patients Incidence of infusion was and in 3 patients (1.3%) CP suspected to be associated with mortality. Subgroup analysis revealed no benefit of CP use in patients given infusion within three days of symptom onset or those given relatively high titre antibodies of>1:80. 83 per cent of study subjects already had detectable Nab titres in serum at the time of enrolment with median of 1:90 (IQR 1:30 ‑ 1:240) Results 0 versus 14 per cent patients progressed to death or mechanical ventilation in plasma and control arm. Mortality rates were 0 per cent and 9.3 per at day 15 in the plasma as well control arm. were not significant. titres median with of>1:80 titres antibody had of 1:292 (IQR 1:238 ‑ 1:451). 49.4 per cent patients were positive for anti ‑ SARS CoV arm, antibodies at enrolment. 6 SAEs in CP infusion. none were related to CP post

Donor characteristics: Not mentioned in detail. Donor antibody levels: Donors had antibody levels >1:320. Plasma dose: Two doses of 200 ml plasma Two Plasma dose: infused 1 ‑ 2 h apart Plasma infusion timing: Mean 12.6 days after symptom onset in severely ill patients and 23.1 days after symptom onset in critically ill group donors, Young Donor characteristics: with pre ‑ dominantly mean age 34 yr, mild illness with median of 41 days post ‑ diagnosis of COVID 19. Donor antibody levels: No quantification was done before use of CP. Quantification by neutralizing antibody titres using micro ‑ neutralization test was performed in the archived plasma samples post hoc . doses of 200 ml plasma Two Plasma dose: infused 24 h apart. Plasma infusion timing: Median duration of symptoms before enrolment was 10 IQR) days (6 ‑ 11 Convalescent plasma characteristics Donor characteristics: Complied with EU donation. requirements for CP Donor antibody levels: Donors had antibody levels >1.1. Neutralization assay was performed by a microneutralization assay using a pseudovirus ‑ based assay. Neutralization assay was performed hoc . Plasma dose: Single unit of 250 ml CP. Plasma infusion timing: Median duration of symptoms before enrolment was eight days (6 ‑ 9 IQR) ratio 2 /FiO 2

Study type: Open ‑ label, multicentre randomized control trial n=464 Study population: Moderately ill COVID ‑ 19 patients with PaO Study type: Open ‑ label, single arm, phase II trial n=38 Study population: Severely and critically ill patients Blinding: Nil Randomization: Nil between 200 and 300 Blinding: Nil Yes Randomization: Other treatments: Corticosteroids, tocilizumab, HCQ, lopinavir/ remdesivir, ritonavir Study design Study type: Open ‑ label, multicentre randomized control trial arm, 43 in SOC arm). n=81 (38 in CP Study population: Moderately ill COVID ‑ 19 patients with either infiltrates within on CXR or hypoxia room air, 12 days of onset illness. Excluded patients with high ‑ flow devices or ventilators Blinding: Nil Yes Randomization: Other treatments: Corticosteroids, tocilizumab, HCQ, lopinavir/ remdesivir, ritonavir

49 71 et al (14 centres 37 (39 centres across India) published on October 22, 2020 Agarwal et al (Connecticut, USA) published as a pre ‑ print September 1, 2020 ‑ Sola Avendano et al Study Ibrahim across Spain) published as a pre ‑ print on September 1, 2020 15 13 14 S. No. 78 INDIAN J MED RES, January & February 2021

CXR, ratio; off cut to signal S/CO, There was a significantly increased event; use. No difference in mortality (10.96% CP in control arm); No significant arm, 11.43% difference in clinical outcomes measured WHO ordinal scale (OR according to the 0.83 with 95% CI 0.52 to 1.35) at day 30. Among 215 patients with baseline antibody titres available, 46.5% were negative and median titre was 1:50. Five FNHTR reactions group. were noted in the CP Significant decrease in the cytokine levels there was no However, patients receiving CP. clinically significant difference in outcomes duration of oxygen requirement in mortality, Subgroup analysis revealed or hospital stay. reduction in mortality as well duration of hypoxia in patients aged <67 years. Study interrupted at 76% of recruitment due and 31% of to logistical issues. 16% of CP placebo arm experienced severe disease. There was a dose dependant response with outcomes better in patients with high titre CP antibody titres on day 2 in the treatment arm as compared with the control arm. Overall suggestive of beneficial effect in this cohort Results adverse

serious SAE,

range;

interquartile IQR, Donor antibody levels: Median titre of 1:3200 (IQR 1:800 to 1:3200) by the The N ‑ Ab titre assay. COVIDAR ELISA units and the was available for 125 CP median titre was 1:300 (IQR 1:136 to 1:511). Plasma dose: Single unit of plasma, either from single donor or pooled two to five donors. Median infusion volume 500 based correction of infused Weight ml. plasma volume was used. Plasma infusion timing: Median duration of symptoms to enrolment was 8 days (5 ‑ 10 IQR) Donor antibody levels: Antibody levels Donor antibody levels: and a tested by EuroImmun ELISA S/ A surrogate neutralizing antibody kit. CO ratio >1.5 was taken for selecting donors of CP. units of 200 ml each. Two Plasma dose: Plasma infusion timing: Median duration of admission to enrolment was 4 days. Donor antibody levels: CP units with Donor antibody levels: CP antibody titres >1:1000 by the COVIDAR assay. ELISA Plasma dose: Single unit of plasma, 250 ml infused. 72 h of Within Plasma infusion timing: diagnosis. Convalescent plasma characteristics syndrome; <93%, 2

distress ≥2) patients on

respiratory

acute

ARDS, Other treatments: Corticosteroids, anti ‑ viral agents. or P/F ratio <300 mSOFA failure mechanical ventilation, multiorgan excluded. Yes Blinding: in 2:1 ratio Yes; Randomization: Study type: Open label, single centre randomized placebo control trial n=80 Study Population: Moderate to severely ill COVID ‑ 19 patients Blinding: No Yes. Randomization: Azithromycin, Other treatments: HCQ, Ivermectin, Doxycycline, Corticosteroids, Remdesivir. Tocilizumab, n=160 Study Population: Elderly COVID patients aged >75 yr with mild disease. Yes Blinding: Yes Randomization: Study type: Multicentre randomized double blind, placebo control trial Study design Study type: Open label, multicentre randomized placebo control trial n=333 (208 in CP arm, 105 in placebo arm) n=333 (208 in CP 2:1 Study Population: Mild to moderately ill COVID ‑ 19 patients (room air SpO ratio; hazard

72

HR, 74 et al (12 centres 73 Ray et al ray; SAE, serious adverse events; CPAP, continuous positive airway pressure; MV, mechanical ventilation; VTE, venous thromboembolism; DSMB, Data VTE, venous thromboembolism; ventilation; mechanical pressure; MV, airway positive continuous CPAP, events; SAE, serious adverse X ‑ ray; chest test; EU, European Union; SOC, CXR, chest X ‑ ray; standard of care; IL ‑ 6, interleukin 6; plaque reduction neutralization and Safety Monitoring Board; PRNT, FNHTR, febrile non hemolytic transfusion reaction related acute lung injury; TACO, transfusion ‑ associated circulatory TACO, acute lung injury; TRALI, transfusion ‑ related AEs, adverse events; HCQ, hydroxychloroquine; convalescent plasma; CP, overload; (Kolkata, India) published as a pre ‑ print on November 28, 2020 Simonovich et al (Multiple centres in Argentina) published as a pre ‑ print on January 6, 2021 Libster Study in Argentina) in Argentina) published on November 24, 2020 18 17 16 S. No. KHAIRE et al: CONVALESCENT PLASMA FOR COVID-19 IN INDIA 79

The largest experience of systematic use of CP in vs. 14%), there was no significant outcome difference COVID-19 comes from the USA. Apart from the on- between the two arms. Moreover, 80 per cent of the going clinical trials and the compassionate use under the enrolled patients had anti-SARS-CoV-2 antibodies Emergency Investigational New Drug (eIND) license in their serum at baseline with titres comparable to from FDA, CP has been made accessible to patients those of the 115 convalescent donors. The titres of and clinicians under the EAP of the USFDA75. Under the infused CP units were higher than these baseline this programme, more than 80,000 units of CP were recipient titres, and more than a four-fold rise of titres infused, and the safety analysis of this programme was within a week could be demonstrated amongst CP mentioned earlier56,57. The group recently published recipients. The RCT was halted for revision of design their post hoc analysis after determining the NAb titres since the investigators reasoned that administering in 35,322 patients48 (Table VI, row 10). The two main CP to already seropositive patients would confer no findings were that infusion of CP within three days of additional benefit35. diagnosis compared to later showed benefit in seven- Another RCT from Spain was halted prematurely day mortality (8.7 vs. 11.9%, P<0.001) and that there due to a fall in recruitment37 (Table VI, row 13). The was a dose-response curve for mortality with respect data on 81 patients enrolled who received high titre to infused antibody titres. The patients who received CP with median titres of 1:292 (IQR 168-882) showed CP units with low, medium and high antibody titres a mortality benefit at day 14 compared to the control had a mortality of 13.7, 11.6, and 8.9 per cent. The arm; however, the number of events was very low. antibody titres were not known at the time of the administration of CP. Hence, the arm with low-titre CP Most recently, the ICMR-sponsored PLACID 49 can be considered an internally blinded control arm76. trial also published its findings (Table VI, row 15). Similarly, Israel’s compassionate CP use programme This open-label RCT could recruit its target, unlike has also shown a dose-response curve between titres the earlier RCTs and randomized 462 patients. There and mortality in their post hoc antibody titre analysis was no difference in mortality or progression to severe involving 49 patients. Several other single-arm studies disease between the plasma and the control arm. have been published, a few with matched control arm A high proportion of participants had anti-SARS- with claims of CP use efficacy (Tables V and VI). CoV-2 antibodies at the time of enrolment, and their antibody titres were higher than those of CP donors. This evidence, although compelling, has not been This trial replicated the real-world use of CP, wherein replicated in the initial RCTs on CP. The first RCT the antibody titres of CP were not known a priori. on CP therapy in COVID-19 was an open-label RCT However, the median antibody titres in the infused CP from seven centres in Wuhan33 (Table VI, row 5). It units were significantly lower than the EAP or the Israel was terminated early due to slow recruitment, with compassionate use data36,48. The median NAb titres of only 103 of the target 200 individuals enrolled. This infused plasma in this study were 1:40. Whether this trial employed high titre CP units and showed a higher reflects the heterogeneity of antibody responses in rate of clinical improvement in severely ill patients the Indian population versus the Western population but not in the critically ill. There was earlier symptom remains to be seen. This experience established the resolution and viral clearance in the CP arm. The need to have adequate antibody testing for CP done limitations were the lost statistical power due to early before its use in any trial setting. termination, lower dosing than other studies and the long median time of >30 days from symptom onset to Another important RCT on CP use was published plasma infusion33. in November 2020 by the PlasmAr group from Argentina73 (Table VI, row 17). They enrolled 333 A multicentre open-label RCT from 14 centres patients of mild to moderately severe COVID acute from the Netherlands randomized 86 of the planned respiratory distress syndrome (ARDS). However, no 462 patients and gave CP to 4335 (Table VI, row 9). mortality or difference in clinical outcome could be CP with median neutralizing titres 1:640 was infused. demonstrated between the two groups. The median The cohort was predominantly with mild illness and titre of neutralizing antibody used in the study was admitted early in the course of disease with a median 1:300, although the median time of administration was time from symptom onset of 10 days. While there was eight days, a relatively later time period in the course a trend towards mortality benefit in the CP arm (26 of disease. Only 39 patients were enrolled within 80 INDIAN J MED RES, January & February 2021

72 h of symptoms, a number too small to test the from the recently published PLACID trial from India49 hypothesis of administration of CP within first three including a large-scale trial called the PLATINA, which days of illness. Conversely another double blind RCT is an open-label RCT of CP use in severe COVID-19 from Argentina by the INFANT-COVID-19 group illness, recruiting in 21 centres across Maharashtra conducted in elderly patients with mild COVID disease (CTRI/2020/06/026123). who were given high titre CP72. The results showed Convalescent plasma use in India decreased progression to severe disease in patients who received CP and favoured the use of CP in this group If proven beneficial in COVID-19, CP may be a (Table VI, row 16). In particular, all the recipients of CP promising treatment option for India. However, efforts received the infusion within 72 h of diagnosis. Another will have to be made to make antibody testing available smaller RCT conducted in a single centre in Kolkata in before any large-scale CP use programme in the country, 80 patients demonstrated a significant decrease in the after learning from the PLACID trial experience49. hyperinflammatory cytokine response in patients with Setting up a centralized antibody titre determination mild to moderate COVID ARDS74 (Table VI, row 18). system under the aegis of a competent authority may Although there was no demonstrable clinical benefit help overcome such problems. Another operational in terms of survival, duration of hypoxia or duration requirement would be to ensure that patients receive of hospital stay, there was some benefit noted in the CP units as soon as possible, ideally targeting infusions subgroup of patients aged below 67 years74. within three days of diagnosis. The scarcity of donors is another major problem. Creating a CP stockpile CP therapy has been granted the Emergency Use large enough to treat patients, provide prophylaxis for Authorization in the USA on August 23, 202040. The healthcare workers and provide enough raw material high titre CP units in this authorization have been for producing purified products in the future requires defined as having antibody titre with signal/cut-off a major public health initiative. Motivating eligible ratio >1240. donors for multiple sessions of plasmapheresis is Is there a need for further randomized control trial necessary to overcome these shortages. for convalescent plasma use in COVID-19? Voluntary blood donation has always been Until now, in the RCTs the infusion of high-quality a challenge in India80, and these problems are CP in the requisite number of patients could not be compounded further for CP. Multiple barriers for done either due to poor recruitment or poor titres of CP donation exist among donors. The most common antibodies. The two RCTs from Argentina72,73 which reasons for reluctance to donate include fear of visiting could infuse high antibody titre plasma to the target a healthcare facility during an epidemic, fear of population showed contrasting results. While there waning of immunity and risk of reinfection due to CP was no benefit in infusion of plasma in moderate to donation. The imposition of lockdowns and curfews severely ill patients in the PlasmAr study73, there was also leads to restricted mobility of donors to visit CP benefit when it was given in mildly ill elderly pateints donation sites. within three days of diagnosis in INFANT-COVID-19 The Drug Controller General of India has group72. While more than 100,000 units of CP has been approved the drug to be administered only under a trial used worldwide, there is still not unequivocal evidence protocol. The Ministry of Health and Family Welfare for or against CP use. Therefore, there remains a need (MoHFW) guidelines for the treatment of COVID-19 for further scientifically designed RCTs to answer lists CP as an off-label experimental therapy option81. these questions. There are hypotheses to suggest that These guidelines recommend using CP after the even seropositive patients may derive the benefit of measurement of antibody titres by neutralization CP use by augmentation of natural antibody response, assays or anti-S-RBD IgG ELISA, which may not be immunomodulatory actions and avoidance of cytokine possible in most centres of the country. For the design storm77. However, these aspects can be explored once of clinical and research protocols guidelines issued by the efficacy of CP’s use has been established. global regulatory bodies such as WHO82, International At present, there are over 100 registered trials Society of Blood Transfusion (ISBT)52,83, USFDA38 worldwide investigating CP in COVID-1975,78,79. Apart and European Commission39 may be useful. KHAIRE et al: CONVALESCENT PLASMA FOR COVID-19 IN INDIA 81

Social and ethical implications of convalescent Avoidance of monetary or other coercion is necessary plasma in India to avoid the exploitation of CP donors. Plasma donation appeals should be only of pro-social altruistic nature CP therapy for COVID-19 presents with its and should be completely voluntary. It is necessary own unique social and ethical challenges. Although to ensure that available plasma is rationed in an unproven in efficacy, there is a demand for CP therapy, unbiased and evidence-based manner. Documentation especially in critically ill hospitalized patients. of outcomes should be mandatory. The formation of a

Table VII. Recommendations for various aspects of convalescent plasma (CP) therapy Setting of use CP use to be recommended only under well‑designed RCT protocols designed keeping in mind the lessons learnt from the available data CP donor Recovered PCR proven COVID‑19 patient. Should have had symptomatic illness with at least fever as one symptom. Preferable if has had moderate‑to‑severe illness. >14 days after resolution of symptoms. Within four months of symptom onset. No documentation of NP swab negativity necessary if >28 days symptom‑free. High neutralizing antibody titre or its surrogate serological marker to be ensured before donation. Exact titre remains to be defined, but titre>1:160 should be targeted. CP donation after informed consent, ensuring lack of monetary or other coercion. Antibody Ideally with neutralizing antibody assay. quantification In the absence of availability of neutralizing antibody titres, it is reasonable to screen with available serological of CP assays for quantification of anti‑SARS‑CoV‑2 antibodies. Process of Donation by plasmapheresis. donation Up to 15 per cent total blood volume per donation. Serial donations possible with gap of seven days between donations with monitoring of haemoglobin, total protein and albumin of the donor. Ideal patient To be given under institute specific protocol with pre‑defined inclusion, exclusion criteria and monitoring protocol. selection for Administration with prophylactic intent or in mild illness to be prioritized over severe and critical illness. CP Preferably within 7‑10 days of disease onset or three days of COVID‑19 diagnosis. Preferably administered to seronegative patients. Detailed informed consent to be administered including experimental nature of illness, possible risks, lack of proven efficacy, lack of standardized antibody titre testing. ABO compatible plasma to be infused over 30‑60 min with monitoring for infusion reactions. Dosing of CP No definite recommendations available based on current data. RT, real‑time; NP, nasopharyngeal swab

Table VIII. Passive immunization in COVID‑19 in India Initiative Current status/suggestions for future Stock piling of CP in India for Initiatives such as plasma banks to be established. Such projects need to be set up use in expected future seasonal nationwide. CP donor screening and harvesting should continue even after resolution of rebounds of COVID‑19 current epidemic situation. Serial donations by eligible donors should be encouraged. Production of anti‑SARS‑CoV‑2 Hyper-immune globulin production started in Japan and the USA79. Indian hyper‑immune globulin pharmaceutical industry should gear up for the production of plasma products and indigenous hyper‑immune globulin. Production of anti‑SARS‑CoV‑2 Antibodies from animals such as horse21 and llama84 have been shown to have in vitro serum from non‑human sources efficacy against SARS‑CoV‑2. Exploration of this modality with laboratory as well as clinical studies is needed. Development of anti‑SARS‑CoV‑2 Multiple efforts are underway globally. Knowledge of the antibody isotype and monoclonal antibodies target viral epitope which confers best protection can help design better and effective antibodies against SARS‑CoV‑2. 82 INDIAN J MED RES, January & February 2021 nationwide registry of CP use may go a long way to 8. Cheng Y, Wong R, Soo YO, Wong WS, Lee CK, Ng MH, et al. address these issues. Use of convalescent plasma therapy in SARS patients in Hong Kong. Eur J Clin Microbiol Infect Dis 2005; 24 : 44-6. Conclusions 9. Yeh KM, Chiueh TS, Siu LK, Lin JC, Chan PK, Peng MY, CP may be a promising and safe treatment option et al. Experience of using convalescent plasma for severe for COVID-19 and is feasible in the Indian setting. Its acute respiratory syndrome among healthcare workers in a Taiwan hospital. J Antimicrob Chemother 2005; 56 : 919-22. efficacy in this setting remains to be unequivocally established. Further research on donor selection, 10. Ko JH, Seok H, Cho SY, Ha YE, Baek JY, Kim SH, et al. antibody cut-offs, precise indications of use and Challenges of convalescent plasma infusion therapy in Middle East respiratory coronavirus infection: A single centre dosing is required before more widespread CP use experience. Antivir Ther 2018; 23 : 617-22. becomes possible. Emerging evidence points out 11. Arabi YM, Hajeer AH, Luke T, Raviprakash K, Balkhy H, the necessity of measuring antibody titres in infused Johani S, et al. Feasibility of using convalescent plasma plasma units and selecting high titre units for infusion. immunotherapy for MERS-CoV infection, Saudi Arabia. The recommendations regarding various aspects of CP Emerg Infect Dis 2016; 22 : 1554-61. therapy are summarized in Table VII. The development 12. Sahr F, Ansumana R, Massaquoi TA, Idriss BR, Sesay FR, of more potent modalities such as hyper-immune Lamin JM, et al. Evaluation of convalescent whole blood globulins would be the next step in enhancing passive for treating Ebola Virus Disease in Freetown, Sierra Leone. immune transfer-based therapeutics for COVID-19 J Infect 2017; 74 : 302-9. (Table VIII). 13. van Griensven J, Edwards T, Baize S; Ebola-Tx Consortium. Efficacy of convalescent plasma in relation to dose of Ebola The graphics for the article were designed Acknowledgment: virus antibodies. N Engl J Med 2016; 375 : 2307-9. by huephoria (http://huephoria.in/). 14. van Griensven J, Edwards T, de Lamballerie X, Semple MG, Gallian P, Baize S, et al. Evaluation of convalescent plasma None. Financial support & sponsorship: for Ebola virus disease in guinea. N Engl J Med 2016; 374 : 33-42. Conflicts of Interest: None. 15. Maiztegui JI, Fernandez NJ, de Damilano AJ. Efficacy of immune plasma in treatment of Argentine haemorrhagic fever References and association between treatment and a late neurological 1. Worldometer. Coronavirus: India. Available from: https:// syndrome. Lancet 1979; 2 : 1216-7. www.worldometers.info/coronavirus/country/india/, accessed 16. Mair-Jenkins J, Saavedra-Campos M, Baillie JK, Cleary P, on January 19, 2021. Khaw FM, Lim WS, et al. The effectiveness of convalescent 2. Bloch EM, Shoham S, Casadevall A, Sachais BS, Shaz B, plasma and hyperimmune immunoglobulin for the treatment Winters JL, et al. Deployment of convalescent plasma for the of severe acute respiratory infections of viral etiology: A prevention and treatment of COVID-19. J Clin Invest 2020; systematic review and exploratory meta-analysis. J Infect Dis 130 : 2757-65. 2015; 211 : 80-90. 3. Casadevall A, Scharff MD. Serum therapy revisited: 17. Devasenapathy N, Ye Z, Loeb M, Fang F, Najafabadi BT, Animal models of infection and development of passive Xiao Y, et al. Efficacy and safety of convalescent plasma antibody therapy. Antimicrob Agents Chemother 1994; for severe COVID-19 based on evidence in other severe 38 : 1695-702. respiratory viral infections: A systematic review and meta- analysis. CMAJ 2020; 192 : E745-55. 4. Casadevall A, Dadachova E, Pirofski LA. Passive antibody therapy for infectious diseases. Nat Rev Microbiol 2004; 2 : 18. Rojas M, Rodríguez Y, Monsalve DM, Acosta-Ampudia Y, 695-703. Camacho B, Gallo JE, et al. Convalescent plasma in COVID-19: Possible mechanisms of action. Autoimmun Rev 2020; 19 : 5. Garraud O, Heshmati F, Pozzetto B, Lefrere F, Girot R, 102554. Saillol A, et al. Plasma therapy against infectious pathogens, as of yesterday, today and tomorrow. Transfus Clin Biol 2016; 19. Marano G, Vaglio S, Pupella S, Facco G, Catalano L, 23 : 39-44. Liumbruno GM, et al. Convalescent plasma: New evidence for an old therapeutic tool? Blood Transfus 2016; 14 : 152-7. 6. Zhou B, Zhong N, Guan Y. Treatment with convalescent plasma for influenza A (H5N1) infection. N Engl J Med 2007; 20. Siracusano G, Pastori C, Lopalco L. Humoral immune 357 : 1450-1. responses in COVID-19 patients: A window on the state of the 7. Hung IF, To KK, Lee CK, Lee KL, Chan K, Yan WW, art. Front Immunol 2020; 11 : 1049. et al. Convalescent plasma treatment reduced mortality in 21. Zhou P, Yang XL, Wang XG, Hu B, Zhang L, Zhang W, et al. patients with severe pandemic influenza A (H1N1) 2009 virus A pneumonia outbreak associated with a new coronavirus of infection. Clin Infect Dis 2011; 52 : 447-56. probable bat origin. Nature 2020; 579 : 270-3. KHAIRE et al: CONVALESCENT PLASMA FOR COVID-19 IN INDIA 83

22. Tian X, Li C, Huang A, Xia S, Lu S, Shi Z, et al. Potent 36. Maor Y, Cohen D, Paran N, Israely T, Ezra V, Axelrod O, et al. binding of 2019 novel coronavirus spike protein by a SARS Compassionate use of convalescent plasma for treatment of coronavirus-specific human monoclonal antibody. Emerg moderate and severe pneumonia in COVID-19 patients and Microbes Infect 2020; 9 : 382-5. association with IgG antibody levels in donated plasma. 23. Wu F WA, Liu M, Wang Q, Chen J, Xia S, et al. Neutralizing EClinicalMedicine 2020; 26 : 100525. antibody responses to SARS-CoV-2 in a COVID-19 recovered 37. Avendano-Sola C, Ramos-Martinez A, Munez-Rubio E, patient cohort and their implications. medRxiv 2020. Ruiz-Antoran B, Malo de Molina R, Torres F, et al. Convalescent doi: 101101/2020033020047365. plasma for COVID-19: A multicenter, randomized clinical 24. Okba NM, Müller MA, Li W, Wang C, GeurtsvanKessel CH, trial. medRxiv 2020. doi: 10.1101/2020.08.26.20182444. Corman VM, et al. Severe acute respiratory syndrome 38. U.S. Food and Drug Administration. Recommendations for coronavirus 2-specific antibody responses in coronavirus Investigational COVID-19 Convalescent Plasma. Available disease patients. Emerg Infect Dis 2020; 26 : 1478-88. from: https://www.fda.gov/vaccines-blood-biologics/ 25. Suthar MS, Zimmerman MG, Kauffman RC, Mantus G, investigational-new-drug-ind-or-device-exemption-ide- Linderman SL, Hudson WH, et al. Rapid generation of process-cber/recommendations-investigational-covid-19- neutralizing antibody responses in COVID-19 patients. Cell convalescent-plasma, accessed on October 18, 2020. Rep Med 2020; 1 : 100040. 39. European Commission Directorate-General for Health and 26. Prompetchara E, Ketloy C, Palaga T. Immune responses in Food Safety. An EU Programme of COVID-19 Convalescent COVID-19 and potential vaccines: Lessons learned from Plasma Collection and Transfusion. Available from: http:// SARS and MERS epidemic. Asian Pac J Allergy Immunol isbtweb.org/fileadmin/user_upload/Deirdre_Fehily_Belgium. 2020; 38 : 1-9. pdf, accessed on October 18, 2020. 27. Zhao J, Yuan Q, Wang H, Liu W, Liao X, Su Y, et al. Antibody 40. U.S. Food and Drug Administration. Clinical Memorandum. responses to SARS-CoV-2 in patients of novel coronavirus EUA 26382: Emergency Use Authorization (EUA) Request disease 2019. Clin Infect Dis 2020; 28 : ciaa344. (original request 8/12/20; amended request 8/23/20). Product: COVID-19 Convalescent Plasma. Available from: https:// 28. Guo L, Ren L, Yang S, Xiao M, Chang D, Yang F, et al. Profiling www.fda.gov/media/141480/download, accessed on October early humoral response to diagnose novel coronavirus disease 18, 2020. (COVID-19). Clin Infect Dis 2020; 71 : 778-85. 41. Bloch EM, Goel R, Wendel S, Burnouf T, Al-Riyami AZ, 29. Liu W, Fontanet A, Zhang PH, Zhan L, Xin ZT, Baril L, et al. Ang AL, et al. Guidance for the procurement of COVID-19 Two-year prospective study of the humoral immune response convalescent plasma: Differences between high- and low- of patients with severe acute respiratory syndrome. J Infect middle-income countries. Vox Sang 2020; 10.1111/vox.12970. Dis 2006; 193 : 792-5. 42. Robbiani DF, Gaebler C, Muecksch F, Lorenzi JCC, Wang Z, 30. Amanat F, Stadlbauer D, Strohmeier S, Nguyen TH, Cho A, et al. Convergent antibody responses to SARS-CoV-2 Chromikova V, McMahon M, et al. A serological assay to in convalescent individuals. Nature 2020; 584 : 437-42. detect SARS-CoV-2 seroconversion in humans. Nat Med 2020; 26 : 1033-6. 43. Duan K, Liu B, Li C, Zhang H, Yu T, Qu J, et al. Effectiveness of convalescent plasma therapy in severe COVID-19 patients. 31. Hegerova L, Gooley TA, Sweerus KA, Maree C, Bailey N, Proc Natl Acad Sci U S A 2020; 117 : 9490-6. Bailey M, et al. Use of convalescent plasma in hospitalized patients with COVID-19: Case series. Blood 2020; 136 : 759-62. 44. Salazar E, Perez KK, Ashraf M, Chen J, Castillo B, Christensen PA, et al. Treatment of coronavirus disease 2019 32. GeurtsvanKessel CH, Okba NM, Igloi Z, Embregts CW, (COVID-19) patients with convalescent plasma. Am J Pathol Laksono BM, Leijten L, et al. Towards the next phase: evaluation 2020; 190 : 1680-90. of serological assays for diagnostics and exposure assessment. medRxiv 2020. doi: 10.1101/2020.04.23.20077156. 45. Whitaker B. Inside a Convalescent Plasma Therapy Program Treating Coronavirus Patients. Available from: https://www. 33. Li L, Zhang W, Hu Y, Tong X, Zheng S, Yang J, et al. Effect of cbsnews.com/news/coronavirus-antibodies-blood-plasma-therapy- convalescent plasma therapy on time to clinical improvement 60-minutes-2020-05-31/, accessed on October 18, 2020. in patients with severe and life-threatening COVID-19: A randomized clinical trial. JAMA 2020; 324 : 460-70. 46. Zhang B, Zhou X, Zhu C, Song Y, Feng F, Qiu Y, et al. Immune phenotyping based on the neutrophil-to-lymphocyte ratio and 34. Luchsinger LL, Ransegnola B, Jin D, Muecksch F, IgG level predicts disease severity and outcome for patients Weisblum Y, Bao W, et al. Serological assays estimate with COVID-19. Front Mol Biosci 2020; 7 : 157. highly variable SARS-CoV-2 neutralizing antibody activity in recovered COVID19 patients. J Clin Microbiol 2020; 58 : 47. Long QX, Tang XJ, Shi QL, Li Q, Deng HJ, Yuan J, et al. e02005-20. Clinical and immunological assessment of asymptomatic 35. Gharbharan A, Jordans CC, GeurtsvanKessel C, SARS-CoV-2 infections. Nat Med 2020; 26 : 1200-4. den Hollander JG, Karim F, Mollema FP, et al. Convalescent 48. Joyner MJ, Senefeld JW, Klassen SA, Mills JR, plasma for COVID-19. A randomized clinical trial. medRxiv Johnson PW, Theel ES, et al. Effect of convalescent 2020. doi: 10.1101/2020.07.01.20139857. plasma on mortality among hospitalized patients with 84 INDIAN J MED RES, January & February 2021

COVID-19: Initial three-month experience. medRxiv 2020. 58. Tetro JA. Is COVID-19 receiving ADE from other doi: 10.1101/2020.08.12.20169359. coronaviruses? Microbes Infect 2020; 22 : 72-3. 49. Agarwal A, Mukherjee A, Kumar G, Chatterjee P, Bhatnagar T, 59. Katzelnick LC, Gresh L, Halloran ME, Mercado JC, Kuan G, Malhotra P, et al. Convalescent plasma in the management of Gordon A, et al. Antibody-dependent enhancement of severe moderate COVID-19 in adults in India: open label phase II dengue disease in humans. Science 2017; 358 : 929-32. multicentre randomised controlled trial (PLACID Trial). BMJ 60. Shen C, Wang Z, Zhao F, Yang Y, Li J, Yuan J, et al. Treatment 2020; 371 : m3939. doi: 10.1136/bmj.m3939. of 5 critically ill patients with COVID-19 with convalescent 50. Ministry of Health and Family Welfare, plasma. JAMA 2020; 323 : 1582-9. Government of India. Drugs and Cosmetics Act 61. Zhang B, Liu S, Tan T, Huang W, Dong Y, Chen L, et al. 1940 and Rules 1945, Amended. Available from: Treatment with convalescent plasma for critically ill patients https://cdsco.gov.in/opencms/export/sites/CDSCO_WEB/ with severe acute respiratory syndrome coronavirus 2 Pdf-documents/acts_rules/2016DrugsandCosmeticsAct1940Rules1945. infection. Chest 2020; 158 : e9-13. pdf, accessed on October 18, 2020. 62. Ahn JY, Sohn Y, Lee SH, Cho Y, Hyun JH, Baek YJ, et al. Use 51. National Blood Transfusion Council. Guidelines for Blood Donor of convalescent plasma therapy in two COVID-19 patients selection and Blood Donor Referral. Available from: http://nbtc. with acute respiratory distress syndrome in Korea. J Korean naco.gov.in/assets/resources/policy/Letter-reg-%20guidelines-for- Med Sci 2020; 35 : e149. blood-donor-selection&referral-2017.pdf, accessed on October 18, 2020. 63. Ye M, Fu D, Ren Y, Wang F, Wang D, Zhang F, et al. Treatment with convalescent plasma for COVID-19 patients in Wuhan, 52. Working Party of Global Blood Safety, International China. J Med Virol 2020; 92 : 1890-1901. . Society of Blood Transfusion. Points to Consider in the Preparation and Transfusion of COVID-19 Convalescent 64. Zeng QL, Yu ZJ, Gou JJ, Li GM, Ma SH, Zhang GF, et al. Plasma in Low-and Middle-Income Countries. Available Effect of convalescent plasma therapy on viral shedding and from: http://isbtweb.org/fileadmin/user_upload/FINAL_ survival in patients with coronavirus disease 2019. J Infect Dis Points_to_consider_in_the_preparation_of_COVID_convale 2020; 222 : 38-43. scent_plasma_in_LMIC.pdf, accessed on May 9, 2020. 65. Rajendran K, Krishnasamy N, Rangarajan J, 53. Joint United Kingdom (UK) Blood Transfusion and Tissue Rathinam J, Natarajan M, Ramachandran A. Convalescent Transplantation Services Professional Advisory Committee plasma transfusion for the treatment of COVID-19: Systematic Guidelines for the Blood Transfusion Services 3.7: Volume of review. J Med Virol 2020; 92 : 1475-83. Donation. Available from: https://www.transfusionguidelines. 66. Liu STH, Lin HM, Baine I, Wajnberg A, Gumprecht JP, org/red-book/chapter-3-care-and-selection-of-whole-blood-and- Rahman F, et al. Convalescent plasma treatment of severe component-donors-including-donors-of-pre-deposit-autologous- COVID-19: A propensity score-matched control study. Nat blood/3-7-volume-of-donation, accessed on October 18, 2020. Med 2020; 26 : 1708-13. 54. National AIDS Control Organisation, Ministry of Health and 67. Perotti C, Baldanti F, Bruno R, Fante CD, Seminari E, Family Welfare, Government of India. Volume of plasma, Casari S, et al. Mortality reduction in 46 severe COVID-19 Plasmapheresis, Apheresis. Standards for Blood banks and patients treated with hyperimmune plasma. A proof of Blood Transfusion Services. Available from: http://nbtc.naco. concept single arm multicenter trial. Haematologica 2020; gov.in/assets/resources/sop/Standards_for_Blood_Banks_and_ 105 : 2834-40. Blood_Transfusion_Services.pdf, accessed on October 18, 2020. 68. Hartman W, Hess AS, Connor JP. Hospitalized COVID-19 patients treated with convalescent plasma in a mid-size city in the 55. Working Party of Global Blood Safety, International Midwest. medRxiv 2020. doi: 10.1101/2020.06.19.20135830. Society of Blood Transfusion. Points to Consider in the Preparation and Transfusion of COVID-19 Convalescent 69. Rasheed AM, Fatak DF, Hashim HA, Maulood MF, Kabah KK, Plasma. Available from: https://isbtweb.org/fileadmin/ Almusawi YA, et al. The therapeutic potential of convalescent user_upload/Points_to_consider_in_the_preparation_of_ plasma therapy on treating critically-ill COVID-19 patients COVID_convalescent_plasma_-_200331_ISBT_WP_GBS_ residing in respiratory care units in hospitals in Baghdad, Iraq. Final.pdf, accessed on May 9, 2020. Infez Med 2020; 28 : 357-66. 56. Joyner MJ, Wright RS, Fairweather D, Senefeld JW, 70. Salazar E, Christensen PA, Graviss EA, Nguyen DT, Castillo B, Bruno KA, Klassen SA, et al. Early safety indicators of Chen J, et al. Treatment of coronavirus disease 2019 patients COVID-19 convalescent plasma in 5000 patients. J Clin with convalescent plasma reveals a signal of significantly Invest 2020; 130 : 4791-7. decreased mortality. Am J Pathol 2020; 190 : 2290-303. 57. Joyner MJ, Bruno KA, Klassen SA, Kunze KL, Johnson PW, 71. Ibrahim D, Dulipsingh L, Zapatka L, Eadie R, Crowell R, Lesser ER, et al. Safety update: COVID-19 convalescent Williams K, et al. Factors associated with good patient outcomes plasma in 20,000 hospitalized patients. Mayo Clin Proc 2020; following convalescent plasma in COVID-19: A prospective 95 : 1888-97. phase II clinical trial. Infect Dis Ther 2020; 9 : 1-14. KHAIRE et al: CONVALESCENT PLASMA FOR COVID-19 IN INDIA 85

72. Libster R, Pérez MG, Wappner D, Coviello S, Bianchi A, Braem providers/component_3/index.html, accessed on October 18, V, et al. . Early high-titer plasma therapy to prevent severe 2020. COVID-19 in older adults. N Engl J Med 2021. doi: 10.1056/ 79. Sheridan C. Convalescent serum lines up as first-choice NEJMoa2033700. treatment for coronavirus. Nat Biotechnol 2020; 38 : 655-8. 73. Simonovich VA, Burgos Pratx LD, Scibona P, 80. Marwaha N. Voluntary blood donation in India: Achievements, Beruto MV, Vallone MG, Vázquez C, et al. A randomized expectations and challenges. Asian J Transfus Sci 2015; 9 : trial of convalescent plasma in COVID-19 severe pneumonia. S1-2. N Engl J Med 2020; NEJMoa2031304. 81. Ministry of Health and Family Welfare, Government of 74. Ray Y, Paul SR, Bandopadhyay P, D’Rozario R, Sarif J, India. Clinical Management Protocol: COVID-19. Available Lahiri A, et al. Clinical and immunological benefits of from: https://www.mohfw.gov.in/pdf/ClinicalManagement convalescent plasma therapy in severe COVID-19: insights ProtocolforCOVID19.pdf, accessed on October 18, 2020. from a single center open label randomised control trial. medRxiv 2020. doi: 10.1101/2020.11.25.20237883. 82. WHO Blood Regulators Network (2017) Position Paper on Use of Convalescent Plasma, Serum or Immune Globulin Concentrates 75. Expanded Access to Convalescent Plasma for the Treatment as an Element in Response to an Emerging Virus; 2020. of Patients with COVID-19. Available from: https://www. Available from: https://www.who.int/bloodproducts/brn/2017_ uscovidplasma.org/pdf/COVID-19%20Plasma%20EAP.pdf, BRN_PositionPaper_ConvalescentPlasma.pdf?ua=1, accessed accessed on October 18, 2020. on October 18, 2020. 76. The Exposure-Control Study. Available from: https://ccpp19. 83. Epstein J, Burnouf T. Points to consider in the preparation org/healthcare_providers/index.html, accessed on October 18, and transfusion of COVID-19 convalescent plasma. Vox Sang 2020. 2020; 115 : 485-7. 77. Casadevall A, Joyner MJ, Pirofski LA. SARS-CoV-2 viral 84. National Institutes of Health. Llama Antibody Engineered load and antibody responses: The case for convalescent to Block Coronavirus; 2020. Available from: https://www. plasma therapy. J Clin Invest 2020; 130 : 5112-4. nih.gov/news-events/nih-research-matters/llama-antibody- 78. National COVID-19 Convalescent Plasma Project: Clinical engineered-block-coronavirus, accessed on October 18, Trials; 2020. Available from: https://ccpp19.org/healthcare_ 2020

For correspondence: Dr Pankaj Malhotra, Department of Internal Medicine, Postgraduate Institute of Medical Education & Research, Chandigarh 160 012, India e-mail: [email protected] Quick Response Code: Review Article

Indian J Med Res 153, January & February 2021, pp 86-92 DOI: 10.4103/ijmr.IJMR_3669_20

Computed tomography chest in COVID-19: When & why?

Mandeep Garg1, Nidhi Prabhakar1, Ashu Seith Bhalla5, Aparna Irodi6, Inderpaul Sehgal2, Uma Debi1, Vikas Suri3, Ritesh Agarwal2, Laxmi Narayana Yaddanapudi4, Govardhan Dutt Puri4 & Manavjit Singh Sandhu1

Departments of 1Radiodiagnosis & Imaging, 2Pulmonary Medicine, 3Internal Medicine & 4Anaesthesia & Intensive Care, Postgraduate Institute of Medical Education & Research, Chandigarh, 5Department of Radiodiagnosis, All India Institute of Medical Sciences, New Delhi & 6Department of Radiology, Christian Medical College & Hospital, Vellore, Tamil Nadu, India

Received August 28, 2020

Computed tomography (CT) of the chest plays an important role in the diagnosis and management of coronavirus disease 2019 (COVID-19), but it should not be used indiscriminately. This review provides indications of CT chest in COVID-19 suspect, positive and recovered patients based on the current scientific evidence and our personal experience. CT chest is not indicated as a routine screening modality due to its poor sensitivity and specificity. However, it is useful in a small subset of COVID-19 suspects who test negative on reverse transcription-polymerase chain reaction (RT-PCR) with normal/ indeterminate chest X-ray (CXR) but have moderate-to-severe respiratory symptoms and high index of clinical suspicion. CT chest is not indicated in every RT-PCR–positive patient and should be done only in specific clinical scenarios, where it is expected to significantly contribute in the clinical management such as COVID-19 patients showing unexplained clinical deterioration and/or where other concurrent lung pathology or pulmonary thromboembolism needs exclusion. Serial CXR and point-of-care ultrasound are usually sufficient to evaluate the progression of COVID-19 pneumonia. CT chest is also indicated in COVID-19–positive patients with associated co-morbidities (age >65 yr, diabetes, hypertension, obesity, cardiovascular disease, chronic respiratory disease, immune-compromise, etc.) who, despite having mild symptoms and normal/indeterminate CXR, record oxygen saturation of <93 per cent at rest while breathing room air or de-saturate on six-minute walk test. Finally, CT chest plays a crucial role to rule out lung fibrosis in patients recovered from COVID-19 infection who present with hypoxia/impaired lung function on follow up. In conclusion, though CT chest is an indispensable diagnostic tool in COVID-19, it should be used judiciously and only when specifically indicated.

Key words Chest - comorbidities - COVID-19 - computed tomography scan - RT-PCR - thromboembolism

Introduction computed tomography (CT) of the chest plays an Coronavirus disease 2019 (COVID-19) is caused important role in the evaluation of COVID-19. There by severe acute respiratory syndrome coronavirus 2 have been more than 78 million cases of COVID-19 (SARS-CoV-2) that primarily affects the lungs, and reported worldwide and >10 million cases of

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 86 GARG et al: CT CHEST IN COVID-19 87

COVID-19 reported in India as on December 24, pneumonia, including influenza, H1N1, adenovirus 20201. Since there is no definite treatment available and rhinovirus10,13,14. An additional limitation is the for COVID-19, the effective control relies on early risk of infection from surface contamination and/or diagnosis and isolation/quarantine of the infected aerosolization, during the process of CT acquisition patients. However, the current reference standard of a COVID-19 patient. Although sanitization and test for confirming the diagnosis of SARS-CoV-2, decontamination of the CT imaging facility and i.e. reverse transcription-polymerase chain reaction appropriate air exchange can reduce the risk of (RT-PCR) on the nasal and pharyngeal swabs, only infection15, it is a time-consuming task and is required has a sensitivity of 32-80 per cent2-6. Furthermore, to be done after the acquisition of each suspect case. the newer rapid antigen and antibody tests have The healthcare workers engaged in CT suite are at an much lower sensitivity as compared to RT-PCR. increased risk for catching this infection and should The inability of these tests to definitively diagnose wear appropriate personal protective equipment as all cases of COVID-19 has potentially important per the standard recommendations and guidelines of ramifications pertaining to the spread of infection their local infection control committee. Conversely, and clinical management. In absence of a reliable CT imaging facility can also act as a source of single diagnostic test for COVID-19, the role of chest COVID-19 infection to the other patients coming for CT becomes pivotal in the diagnosis, evaluation CT examination. Because of these limitations of CT and management of COVID-19. However, there is imaging, all international radiology organizations and conflicting evidence regarding the use of CT chest chest societies have unanimously recommended that in COVID-192,3,7-10. Despite the consensus statements chest CT should not be used for routine screening in and guidelines issued by the WHO11, the Fleischner COVID-198,9,16. Society9 and various other international radiology Chest CT may be useful in a few COVID-19 associations and chest societies8, appropriate suspects who test negative on RT-PCR with normal/ usefulness of chest CT in COVID-19 remains indeterminate chest X-ray (CXR), despite having unclear. In addition, the multitude of different clinical moderate-to-severe respiratory symptoms9 and a high scenarios associated with COVID-19 can result index of suspicion for COVID-19. In this scenario, in partial or non-compliance with the suggested a typical CT pattern of COVID-19 with COVID-19 imaging recommendations. The COVID-19 Reporting and Data System (CO-RADS)17 Category pandemic mandates practical utilization guidelines 4/5 allows presumptive diagnosis of COVID-19 for chest CT that are understandable and applicable pneumonia, warranting immediate isolation of such internationally at all levels of clinical care. The patients. As COVID-19 patients are known to show current article addresses this issue and succinctly sudden clinical deterioration, close monitoring of defines the indications for CT chest in COVID-19, such patients is necessary until the confirmatory based on the current scientific evidence and our diagnosis is established. Various studies have personal experience with COVID-19 in the three shown that a few patients who initially tested RT- tertiary care medical institutes of India having fully PCR negative on one or more occasions despite dedicated COVID-19 hospital wings. having strong clinical suspicion of COVID-19 COVID-19: Routine screening and suspects subsequently were found to be COVID-19 positive on repeat RT-PCR tests2,3,18,19. CT chest in these The use of chest CT as a routine screening patients has shown the classical imaging findings modality in COVID-19 has many limitations and is of COVID-19 infection (CO-RADS 4/5) which not recommended. In this regard, 15-50 per cent of includes ground-glass opacities, consolidation, patients with COVID-19 will have a normal chest CT, septal/bronchovascular bundle thickening, crazy- particularly early in the course of the disease5,12. paving and halo/reversed halo sign (Fig. 1), while Consequently, similar to a false-negative RT-PCR, lymphadenopathy, centrilobular nodules and pleural a normal CT chest in patients with COVID-19 could effusion, though uncommon, have also been seen in potentially result in inappropriate isolation/quarantine a few patients14. recommendations. Moreover, chest CT abnormalities are not diagnostic of COVID-19 and can be In concordance with these studies, the role of indistinguishable from the manifestations of other viral CT chest is emphasized in those RT-PCR–negative 88 INDIAN J MED RES, January & February 2021

A B C

D E F

Fig. 1. Common computed tomography (CT) manifestations (indicated by arrows) of COVID-19 pneumonia in different patients: (A) ground- glass opacities, (B) consolidation, (C) crazy-paving, (D) sub-pleural linear opacities and parenchymal bands, (E) halo sign, (F) reverse halo sign.

A B RT-PCR–positive COVID-19 patients Chest CT is clinically useful in RT-PCR–positive patients, but it is not indicated in every positive patient and should be done only in specific clinical situations where it is expected to influence the treatment plan and further management of the patient. CT chest is needed in patients where clinical examination or radiographic Fig. 2. CT chest of a 45 yr old female who presented with fever findings are suspicious of other concurrent lung and moderate dyspnoea and history of contact with COVID-19 pathology (infectious, inflammatory or neoplastic), pneumonia patient. Two RT-PCR tests for COVID-19 virus done from oropharyngeal swab samples days on 5 and 7 of symptoms which may warrant a change in the treatment plan. For were negative. CT chest was done on the eighth day. (A and B) example, in tuberculosis (TB)-endemic countries like Sagittal and coronal CT sections in the lung window showed areas India, before starting the corticosteroids or immune of ground-glass opacities (arrow) in the right upper and middle lobes and left lower lobe. Computed tomography was reported COVID-19 modulators such as tocilizumab, it is important to Reporting and Data System Category 5 (CO-RADS 5); the patient be vigilant about the possibility of concurrent/latent was isolated and managed as COVID-19 pneumonia. Repeat RT-PCR pulmonary TB. CT chest in such situations plays test was positive for COVID-19 on the ninth day. a vital role in guiding the treatment plan (Fig. 3). However, it is always desirable to have the tissue/ patients who show significant (moderate-to-severe) microbial diagnosis of concurrent lung pathology as respiratory symptoms and carry a high index of CT scan alone in many instances may not be able to suspicion for COVID-19 (Fig. 2). To enhance the give the exact diagnosis. diagnostic accuracy of chest CT in such patients, CT interpretation should be done in conjunction with Further, CT chest is particularly useful in blood indices that are more likely to be found altered those COVID-19 patients who show a sudden in COVID-19 pneumonia, viz. lymphopenia, elevated and unexplained clinical deterioration or are neutrophil-lymphocyte ratio (NLR), serum D-dimer, unresponsive to treatment (Fig. 4). Some of lactate dehydrogenase (LDH) and inflammatory the patients of COVID-19 may also require CT markers such as C-reactive protein (CRP), pulmonary angiography in the appropriate clinical interleukin-6, serum-ferritin and fibrinogen5,20. setting (Fig. 5) as SARS-CoV-2 can result in the GARG et al: CT CHEST IN COVID-19 89

A B A B

Fig. 4. CT chest of a 70 yr old woman, RT-PCR positive for C D COVID-19, who presented with unexplained clinical deterioration. (A and B) Lung window (axial and coronal sections) showing bilateral, diffuse areas of ground-glass opacities and patchy consolidation, which demonstrate anteroposterior gradient and predominance in dependent regions of the lungs. CT and clinical features were consistent with acute respiratory distress syndrome. The patient expired the next day.

the patient management in COVID-19 pneumonia Fig. 3. A 60 yr old female, COVID-19 RT-PCR positive, was planned to start on tocilizumab in view of her rising inflammatory remains elusive, which is currently based on the markers and worsening hypoxia. (A) Chest X-ray revealed nodular clinical and laboratory parameters of the patient. opacities in both upper and mid zones with dense consolidation in Moreover, serial CT will also require extra workforce the right lower zone; findings were indeterminate for coronavirus disease pneumonia. (B-D) CT chest showed multiple random and to shift COVID-19 patients to the CT suite and will centrilobular nodules (white arrows) and cavitating lesions (black entail increased risk of infection to the healthcare arrows). These features were consistent with pulmonary tuberculosis workers of CT imaging facility. Serial CXR and point- (confirmed with sputum GeneXpert), so tocilizumab was withheld. of-care ultrasound usually suffice and remain useful diagnostic tools in most of the cases to look for disease formation of microthrombi in blood vessels and progression in COVID-19 pneumonia, and CT chest there is an increased prevalence of pulmonary in COVID-19–positive patients is indicated only in 21,22 thromboembolism in patients of COVID-19 . specific clinical scenarios that have already been Chest CT may also be considered in those described. COVID-19 patients who are at an increased risk for COVID-19–recovered patients disease progression (age >65 yr and with associated co-morbidities - diabetes, cardiovascular disease, CT chest plays a crucial role in the post-COVID-19 chronic respiratory disease, obesity, hypertension, phase wherein patients who have recovered from immune-compromised), have only mild symptoms COVID-19 infection present with persistent hypoxia/ and a normal/indeterminate CXR, but record arterial impaired lung function9. In these patients, a CT scan is useful in differentiating the sequel of COVID-19 oxygen saturation (SpO2) of <93 per cent at rest while breathing normal room air or have an abnormal six- infection (post-COVID-19 lung fibrosis) from other minute walk test (when there is an absolute decrease treatable causes (Fig. 6). of >3% in SpO after six-minute walk)23. In this subset 2 Sometimes, it may be difficult to differentiate post- of patients, chest CT plays a pivotal role in triaging COVID-19 lung fibrosis from other fibrotic interstitial the need for hospitalization and further management lung diseases, especially compensated lung fibrosis, as these patients are highly prone to COVID-19– which may have remained undiagnosed in the past. related life-threatening complications and increased The history of occupational exposure and availability mortality. of previous imaging (done before the COVID-19 Recently, the role of serial CT chest in COVID-19 pandemic) for comparison in such cases can be of pneumonia has been studied to identify the disease help as it will not only guide in reaching a quicker and progression by calculating CT involvement/severity correct diagnosis but will also help in chalking out the scores24-28. However, its utility in actually changing appropriate treatment plan. 90 INDIAN J MED RES, January & February 2021

The sequel of old healed pulmonary TB can be hilar lymph nodes and pleural thickening points another challenge while interpreting the CT images towards changes of sequel of pulmonary TB. In a in patients suspected of post-COVID-19 lung fibrosis. few instances, post-tubercular lung fibrosis may be However, the location of abnormalities can help in indistinguishable from post-COVID-19 fibrosis, and differentiating post-COVID-19 lung fibrosis from post- past history of TB and comparison with old imaging tubercular fibrosis. The tubercular fibrotic changes are (if available) can help in such cases. more commonly seen in the upper lobes (more so in The various indications for the use of CT chest in apical regions), while post-COVID-19 lung fibrosis COVID-19 are summarized in the Table. changes are more predominant in the lower lobes and in the peripheral and sub-pleural location29. In A B addition, the presence of small calcified mediastinal/

A B

Fig. 6. CT chest of a 55 yr old male patient who had COVID-19 pneumonia a few months back. Symptoms had resolved since then Fig. 5. A 40 yr old male patient with COVID-19 pneumonia except dyspnoea and hypoxia, which worsened over last few days. developed sudden onset of breathlessness. CT pulmonary RT-PCR test for COVID-19 done on the same day as computed angiography was done. (A) Axial section in the mediastinal window tomography was negative. (A and B) Axial CT sections in lung showing hypodense filling defects in the left pulmonary artery and window showed lung architectural distortion with atelectasis, its upper lobar branch, suggestive of pulmonary embolism (white parenchymal bands (thick arrow), coarse reticulation and irregular arrows). (B) Axial section in the lung window showing patchy interlobular septal thickening (thin white arrow) which was ground-glass opacities in the lower lobes (black arrows), findings predominant in the lower lobes. The patient gave no history of any consistent with COVID-19 pneumonia. occupational exposure or other fibrosing lung disease.

Table. Indications for computed tomography (CT) chest in COVID‑19: Screening/suspect/positive/recovered patients COVID‑19 screening CT chest for COVID‑19 routine screening is not indicated COVID‑19 suspecta Those who have significant (moderate‑to‑severe)b respiratory symptoms and a high index of suspicion for COVID‑19 but test negative on RT‑PCR and have normal/indeterminate CXR COVID‑19 positive Patients who show sudden and/or unexplained clinical deterioration Patients in whom clinical examination or radiographic findings are suspicious of other concurrent lung pathology, which may warrant a change in the treatment plan Patients with clinical suspicion of pulmonary thromboembolism will require CT pulmonary angiography Patients who are at an increased risk for disease progression (age >65 yr, associated comorbidities such as diabetes, cardiovascular disease, chronic respiratory disease, obesity, hypertension and c immune‑compromised), have mild symptoms with normal/indeterminate CXR, but record SpO2 of <93% at rest while breathing room air or de‑saturate on six‑minute walk test. CT is useful to triage such patients for need of hospitalization and further management COVID‑19 Patients who have recovered from COVID‑19 infection but on follow up show hypoxia/functional lung recovered impairment. CT chest is needed to differentiate the sequel of COVID‑19 infection (lung fibrosis) from other causes aDiagnostic accuracy of CT chest in these patients further improves when evaluated in conjunction with other laboratory parameters such as lymphopenia, elevated NLR, D‑dimer, CRP, LDH, serum‑ferritin and fibrinogen; bModerate‑to‑severe symptoms: moderate‑to‑ severe dyspnoea and presence of hypoxaemia; cMild symptoms: Fever, cough, sore throat, nasal congestion, malaise, headache, mild

or no dyspnoea. RT‑PCR, reverse transcription polymerase chain reaction; CXR, chest X‑ray; SpO2, arterial oxygen saturation; NLR, neutrophil‑lymphocyte ratio; LDH, lactate dehydrogenase; CRP, C‑reactive protein GARG et al: CT CHEST IN COVID-19 91

Conclusion Statements/Recommendations-for-Chest-Radiography-and-CT- for-Suspected-COVID19-Infection, accessed on July 22, 2020. With the continuous surge of COVID-19 cases 9. Rubin GD, Ryerson CJ, Haramati LB, Sverzellati N, Kanne JP, worldwide, it is imperative for the medical professionals Raoof S, et al. The role of chest imaging in patient management to have knowledge about the appropriate usefulness during the COVID-19 pandemic: A Multinational Consensus of CT chest in the diagnosis and management of Statement from the Fleischner Society. Radiology 2020; 296 : COVID-19. While routine CT screening for COVID-19 172-80. is not recommended, CT chest is an invaluable 10. Bai HX, Hsieh B, Xiong Z, Halsey K, Choi JW, Tran TML, diagnostic tool in COVID-19 suspects, confirmed and et al. Performance of radiologists in differentiating COVID-19 recovered patients in specific clinical scenarios where from viral pneumonia on chest CT. Radiology 2020; 296 : it is expected to contribute in the disease management E46-54. and its outcome. Thus, indiscriminate use of CT chest 11. World Health Organization. Use of chest imaging in should be discouraged. COVID-19: A rapid advice guide; June 11, 2020. Available from: https://apps.who.int/iris/handle/10665/332336, accessed Acknowledgment: Authors thank Dr Jeremy Erasmus on July 22, 2020. (University of Texas, MD Anderson Cancer Centre, USA), Dr 12. Bernheim A, Mei X, Huang M, Yang Y, Fayad ZA, Ashish Gupta (The Ottawa Hospital, Ontario, Canada) and Drs Zhang N, et al. Chest CT findings in coronavirus disease-19 Akshay Saxena, Ashish Bhalla and Pankaj Gupta (PGI, Chandigarh) (COVID-19): Relationship to duration of infection. Radiology 2020; 295 : 200463. for their invaluable inputs and opinion. 13. Garg M, Prabhakar N, Gulati A, Agarwal R, Dhooria S. Spectrum of imaging findings in pulmonary infections. Part 1: Financial support & sponsorship: None. Bacterial and viral. Pol J Radiol 2019; 84 : e205-13.

Conflicts of Interest: None. 14. Li Y, Xia L. Coronavirus disease 2019 (COVID-19): Role of chest CT in diagnosis and management. AJR Am J Roentgenol 2020; 214 : 1280-6. References 15. Kohli A. COVID 19 - Tips for getting back to work. Indian J 1. Worldometer. Coronavirus update (Live): 79,331,141 cases Radiol Imaging 2020; 30 : 105-10. and 1,743,079 deaths from COVID-19 virus pandemic. 16. Indian Radiological & Imaging Association. Guidelines Available from: https://www.worldometers.info/coronavirus/, on Imaging of COVID Patients June 2020 - Under Aegis of accessed on December 24, 2020. ICRI Chest Radiology Sub-Specialty Group. Available from: 2. Ai T, Yang Z, Hou H, Zhan C, Chen C, Lv W, et al. Correlation https://iria.org.in/guidelines-on-imaging-of-Covid-patients- of chest CT and RT-PCR testing for coronavirus disease 2019 version-june-2020, accessed on July 22, 2020. (COVID-19) in China: A report of 1014 cases. Radiology 17. Prokop M, Everdingen WV, Vellinga TVR, Ufford JQV, 2020; 296 : E32-40. Stöger L, Beenen L, et al. CO-RADS - A categorical CT 3. Fang Y, Zhang H, Xie J, Lin M, Ying L, Pang P, et al. assessment scheme for patients with suspected COVID-19: Sensitivity of chest CT for COVID-19: Comparison to RT- Definition and evaluation. Radiology 2020; 296 : E97-104. PCR. Radiology 2020; 296 : E115-7. 18. Hao W, Li M. Clinical diagnostic value of CT imaging in 4. Kim H, Hong H, Yoon SH. Diagnostic performance of CT COVID-19 with multiple negative RT-PCR testing. Travel and reverse transcriptase polymerase chain reaction for Med Infect Dis 2020; 34 : 101627. coronavirus disease 2019: A meta-analysis. Radiology 2020; 19. Feng H, Liu Y, Lv M, Zhong J. A case report of COVID-19 296 : E145-55. with false negative RT-PCR test: Necessity of chest CT. Jpn J 5. Wiersinga WJ, Rhodes A, Cheng AC, Peacock SJ, Prescott HC. Radiol 2020; 38 : 409-10. Pathophysiology, transmission, diagnosis, and treatment of 20. Garg S, Garg M, Prabhakar N, Malhotra P, Agarwal R. coronavirus disease 2019 (COVID-19): A review. JAMA Unraveling the mystery of COVID-19 cytokine storm: From 2020; 324 : 782-93. skin to organ systems. Dermatologic Ther 2020; e13859. 6. Yang W, Yan F. Patients with RT-PCR-confirmed COVID-19 21. Miesbach W, Makris M. COVID-19: Coagulopathy, risk of and normal chest CT. Radiology 2020; 295 : E3. thrombosis, and the rationale for anticoagulation. Clin Appl 7. Kohli A. Can imaging impact the coronavirus pandemic? Thromb Hemost 2020; 26 : 1076029620938149. Indian J Radiol Imaging 2020; 30 : 1-3. 22. Whyte MB, Kelly PA, Gonzalez E, Arya R, Roberts LN. 8. American College of Radiology. ACR recommendations Pulmonary embolism in hospitalised patients with COVID-19. for the use of chest radiography and computed tomography Thromb Res 2020; 195 : 95-9. (CT) for suspected COVID-19 infection. Available from: 23. Mantha S, Tripuraneni SL, Roizen MF, Fleisher LA. Proposed https://www.acr.org/Advocacy-and-Economics/ACR-Position- modifications in the 6-minute walk test for potential application 92 INDIAN J MED RES, January & February 2021

in patients with mild COVID-19: A Step to optimize triage for assessing the severity of patients with COVID-19. Korean guidelines. Anesth Analg 2020; 131 : 398-402. J Radiol 2020; 21 : 859-68. 24. Lyu P, Liu X, Zhang R, Shi L, Gao J. The performance of chest 27. Wu J, Wu X, Zeng W, Guo D, Fang Z, Chen L, CT in evaluating the clinical severity of COVID-19 pneumonia: et al. Chest CT findings in patients with coronavirus Identifying critical cases based on CT characteristics. Invest disease 2019 and its relationship with clinical features. Radiol 2020; 55 : 412-21. Invest Radiol 2020; 55 : 257-61. 28. Liu KC, Xu P, Lv WF, Qiu XH, Yao JL, Gu JF, et al. 25. Zhao W, Zhong Z, Xie X, Yu Q, Liu J. Relation between chest CT manifestations of coronavirus disease-2019: A CT findings and clinical conditions of coronavirus disease retrospective analysis of 73 cases by disease severity. (COVID-19) pneumonia: A multicenter study. AJR Am J Eur J Radiol 2020; 126 : 108941. Roentgenol 2020; 214 : 1072-7. 29. Kim HY, Song KS, Goo JM, Lee JS, Lee KS, Lim TH. Thoracic 26. Sun D, Li X, Guo D, Wu L, Chen T, Fang Z, et al. CT sequelae and complications of tuberculosis. Radiographics quantitative analysis and its relationship with clinical features 2001; 21 : 839-58.

For correspondence: Dr Mandeep Garg, Department of Radiodiagnosis & Imaging, Postgraduate Institute of Medical Education & Research, Chandigarh 160 012, India e-mail: [email protected] Quick Response Code: Systematic Review

Indian J Med Res 153, January & February 2021, pp 93-114 DOI: 10.4103/ijmr.IJMR_4431_20

Comparison of the immunogenicity & protective efficacy of various SARS-CoV-2 vaccine candidates in non-human primates

Labanya Mukhopadhyay1, Pragya D. Yadav2, Nivedita Gupta1, Sreelekshmy Mohandas2, Deepak Y. Patil2, Anita Shete-Aich2, Samiran Panda† & Balram Bhargava#

1Virology Unit, †Division of Epidemiology & Communicable Diseases, #Indian Council of Medical Research, New Delhi & 2Maximum Containment Laboratory, Indian Council of Medical Research-National Institute of Virology, Pune, Maharashtra, India

Received November 1, 2020

Background & objectives: The COVID-19 pandemic has emerged as a global public health crisis and research groups worldwide are engaged in developing vaccine candidates to curb its transmission, with a few vaccines having progressed to advanced stages of clinical trials. The aim of this systematic review was to compare immunogenicity and protective efficacy of various SARS-CoV-2 vaccine candidates tested in non-human primate (NHP) models. Methods: Literature on effect of SARS-CoV-2 vaccines in NHP models reported on PubMed and preprint platforms (medRxiv and bioRxiv) till October 22, 2020, was searched with the following terms: coronavirus vaccine, COVID-19 vaccine, SARS-CoV-2 vaccine, nonhuman primate, and rhesus macaque. Results: Our search yielded 19 studies, which reported immune response elicited by 18 vaccine candidates in NHP. All the vaccines induced detectable neutralizing antibody (NAb) titres in the serum of vaccinated animals, with some showing effective viral clearance from various organs. The vaccinated animals also showed nil to mild histopathological changes in their lungs compared to placebo groups in the trials that performed necropsy. Interpretation & conclusions: Our findings highlighted onset of quick immunogenicity and protective efficacy of mRNA-1273, followed by Ad26.CoV2.S, NVX-CoV2373, BNT162b2, RBD and BBV152 vaccine candidates in preclinical trials as compared to the others. NHP data also showed correlation with clinical trial data available for a few vaccines. Preclinical trials of COVID-19 vaccine candidates in NHPs yielded promising results, with some candidates faring better than others.

Key words COVID-19 - immune response - inactivated vaccine - neutralizing antibody - non-human primate - protein subunit vaccine - T-cell response - vaccine - viral clearance

COVID-19 has emerged as a global pandemic and are available for this novel disease. Development of caused significant morbidity and mortality all over the a safe and effective vaccine appears to be the most world. Currently, no effective therapeutics or vaccines promising tool to help develop immunity against

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 93 94 INDIAN J MED RES, January & February 2021 the infection and reduce disease transmission. As candidates with immunogenicity data demonstrating per the World Health Organization (WHO) report, high neutralizing antibody (NAb) titres and T-helper till October 29, 2020, 45 vaccine candidates were (Th1)-type cell polarization may be allowed to proceed under clinical trials and 156 candidates were in pre- to first-in-human trials without first completing post- clinical evaluation stage. These include whole virion- vaccination challenge studies in appropriate animal inactivated vaccines, recombinant vaccines, viral models. However, such studies are strongly advised in vector vaccines, RNA- and DNA-based vaccines and parallel to the initial trials10. Hence, there is an urgent sub-unit vaccines1. need to undertake NHP studies for COVID-19 vaccine candidates. In this systematic review information has Vaccine development is a complex and been compiled on various NHP studies conducted time-consuming process. However, to control the for COVID-19 vaccine candidates and performance pandemic, it is important to develop an effective 2 of various candidates and platforms. The review also vaccine candidate . Various approaches are being tried delineates the NHP species used, virus challenge doses, to fast track the development of safe and efficacious outcomes of the studies in terms of viral clearance, COVID-19 vaccines without compromising scientific B- and T-cell responses, etc. In addition, wherever quality and ethics. One of such approaches is the use available, results of the clinical trials have also been of well-established platforms, which have reduced included. the time taken to develop candidates and also helped in building trust since the beginning. DNA and Material & Methods RNA platforms are best suited for fast development, A review of relevant literature was carried out 2-5 followed by subunit protein vaccines . An important as per the Preferred Reporting Items for Systematic aspect of vaccine development is to assess the safety Reviews and Meta-Analyses (PRISMA) guidelines11. and protective efficacy of different candidates by The literature on SARS-CoV-2 vaccine studies in NHP conducting large animal challenge studies. Small models reported on PubMed and pre-print platforms animals such as rats, mice, rabbits and hamsters (medRxiv and bioRxiv) in 2020 was searched using are useful for making preliminary evaluation of appropriate Medical Subject Heading (MeSH) terms. safety, immunogenicity and dosing of the vaccine The searches were done using the following terms: candidates. Studies in large animals are more useful coronavirus vaccine, COVID-19 vaccine, SARS-CoV-2 in understanding comparative immune responses in vaccine, nonhuman primate and rhesus macaque 6 humans . So far, non-human primates (NHPs) are till October 22, 2020. Nineteen studies meeting the the best models for assessing the protective efficacy inclusion criteria were considered. These encompassed of vaccine candidates as they mimic many diseases 18 vaccine candidates which were included in this caused in humans. However, limited availability review. The PRISMA flowchart depicting study of approved primate facilities and cost are major selection is presented in the Figure. deterrents7. Rhesus macaques have been established as an effective animal model for SARS-CoV-2, All the articles were downloaded and read and their use in pre-clinical experiments is globally thoroughly by the authors. The data were compiled and recognized as an acceptable way to fast track vaccine reviewed to compare the degree of immunogenicity and development8,9. protective efficacy of the various vaccine candidates based on the following parameters: (i) viral clearance Till now, pre-clinical studies in NHPs have been from various organs and tissues of NHPs following successfully completed for a few COVID-19 vaccine challenge with live SARS-CoV-2; (ii) histopathology candidates. However, in view of the urgency to and immunohistochemistry (IHC) of the lung tissues introduce vaccines for COVID-19, parallel Phase I/II of NHPs from vaccinated and placebo groups; clinical trials and NHP studies are ongoing/planned and (iii) immune response induced by the vaccine, as for several vaccine candidates. Pre-clinical studies in evidenced by NAb and T-cell responses, measured by NHPs would be useful for all upcoming vaccines to specific cytokines. enable decision-making process for quick licensure. In the interest of time and public health emergency, Results the Central Drugs Standard Control Organization Our search yielded a total of 318 studies and (CDSCO) guidelines state that COVID-19 vaccine one record was added manually. Twelve articles MUKHOPADHYAY et al: PRE-CLINICAL EFFICACY OF COVID-19 VACCINE CANDIDATES 95

Figure. PRISMA (Preferred Reporting Items for Systematic Reviews and Meta-Analyses) flowchart depicting study design. were duplicated between the platforms and omitted. pharmaceutical or biological product companies to Vaccine studies related to other coronaviruses such commence mass-scale production. The Figure depicts as SARS-CoV and Middle East respiratory syndrome the methodology of study selection. coronavirus, as well as in vitro studies, were excluded from the analysis. Based on the above criteria, 269 Nineteen studies including 18 vaccine candidates studies were eliminated. Sixteen studies were excluded meeting the inclusion criteria were included in further because those were not carried out in NHP. this review. NHP species used in the respective Two studies were not considered because those were studies, site of experiment, details of vaccine neither on the WHO Draft Landscape of COVID-19 administration and doses, virus challenge study vaccine candidates nor were in collaboration with and NHP sacrifice are enumerated in Table I. 96 INDIAN J MED RES, January & February 2021

2 ‑ 8 2 ‑ 8 (°C) Contd... storage Proposed Not known temperature 7 Cynomolgus Day macaques: 25/36 Rhesus macaques: 7 DPI 7 DPI of animal sacrifice / 50 / /ml, 50 50 TCID 6.5 TCID TCID 6 6 1×10 10 10 ml, only intratracheally (volume not mentioned) intratracheally only (volume not mentioned) ml, intranasally (0.5 ml: 0.25ml and nostril) each intratracheally (1 ml) Live virus challenge dose 4 3 3 challenge dose (wk) Time until Time from the first

via i.m. route via Parameters via i.m. route via i.m. route 3 µg+adjuvant B/6 A/6 µg+adjuvant µg+adjuvant B at 0, 14 days i.m. doses 14 days apart Two administered Either 3 or 6 µg at 0, 7 and 14 days i.m. Three doses at intervals of seven days each administered i.m. route 2 or 4 8 µg of vaccine (0.5 ml) administered to Cynomolgus monkeys once a week for three weeks (4 doses) via i.m. route for safety profile 2 or 8 µg at 0 and 14 days administered to Rhesus macaques for viral challenge study Four or two doses given weekly and biweekly, to different respectively, NHPs Vaccine dosage and route Vaccine ICMR ‑ National Institute of Pune, Virology, India Institute of Animal Laboratory Science, Chinese Academy of Medical Sciences and Comparative Medicine Center, Beijing, China Institute of Animal Laboratory Science, Chinese Academy of Medical Sciences and Comparative Medicine Center, Beijing, China Site of animal experiment Various parameters of COVID ‑ 19 candidate vaccines included in the review Various I. Table 20 (4 groups, 5 in each group) 16 (4 groups, 4 in each group) Safety evaluation: 40 Cynomolgus monkeys (4 groups, 10 in each group) Challenge study: 10 Rhesus macaques (4 macaques each in 2 vaccinated group and 2 placebo) Number of NHPs and groups (including control/ placebo/sham) Species of NHP Rhesus macaques Rhesus macaques Cynomolgus macaques and Rhesus macaques 14 13 12 BBIBP ‑ CorV PiCoVacc Vaccine candidates Vaccine Inactivated vaccines BBV152 MUKHOPADHYAY et al: PRE-CLINICAL EFFICACY OF COVID-19 VACCINE CANDIDATES 97

−70 (°C) days, Contd... storage months for 24 h Proposed 2 ‑ 8 for 30 −20 for six Not known temperature Stable at RT Stable at RT

* 14/15 DPI At different time points: 200 EU group: 1 animal each on 3, 5, 7, 9 DPI 100 EU group: 1 animal each on 3, 7, 15 DPI 20 EU group: 1 animal each on 5, 9 and 15 DPI Adjuvant group: 1 animal each on 3, 5, 7, 9 and 15 DPI 7/8 DPI DPI of animal sacrifice

50 pfu, pfu) 6 5 CCID50 5 50% TCID 6 2×10 10 intranasally (1 ml: 0.5 each nostril) and intratracheally (3 ml) given to each monkey nasally intranasally (0.25 ml) and intratracheally (0.25 ml) (1.9×10 1.05×10 Live virus challenge dose 2 8 11 challenge dose (wk) Time until Time from the first

via i.m.

via i.m. route Parameters

3 groups: 4 macaques given 200 EU i.m. at days 0 and 14 3 macaques given 100 EU i.m. at days 0 and 14 3 macaques given 20 EU i.m. at days 0 and 14 doses two weeks Two apart administered route Either 10 µg or 100 at 0 and 28 days i.m. doses 28 days apart Two administered via i.m. route 30 or 100 μg on days 0 and 21 i.m. doses 21 days apart Two administered Vaccine dosage and route Vaccine

Institute of Medical Biology, Academy Chinese of Medical Sciences, Beijing, China BIOQUAL, INC., Maryland, USA New Iberia Research Center, University of Louisiana, Louisiana, USA And Southwest National Primate Research Center, San Antonio, USA Texas, Site of animal experiment 20 (10 in vaccinated group and 10 in control group) 24 (3 groups, 8 in each group) 18 (3 groups, 6 in each group) Number of NHPs and groups (including control/ placebo/sham) Species of NHP Rhesus macaques Rhesus macaques Rhesus macaques 15 18 19 BNT162b2 RNA vaccines RNA mRNA ‑ 1273 Vaccine candidates Vaccine Inactivated Vaccine Inactivated 98 INDIAN J MED RES, January & February 2021

2 ‑ 8 −20 (°C) Contd... mixing storage vaccine Standard Proposed one week one week Stable for at RT after at RT 25 (RT) for 25 (RT) constituents temperature refrigeration Not done Not done Not done Not mentioned 7 DPI DPI of animal sacrifice

50 / 50 TCID 5 TCID 5 Not done Not done Not done 1.0×10 4×10 intranasally (1 ml: 0.5 each nostril) and intratracheally (1 ml) ml, 4 ml intratracheally and 1 ml intranasally and 1 ml orally and 0.5 ml ocularly Live virus challenge dose 6 only) boost) 4 (prime 8 (prime Not done Not done Not done challenge dose (wk) Time until Time from the first

‑ 19,

via i.m. route via i.m. route via i.m. route

Parameters

viral particles 10 viral particles of Ad viral particles of 11 10 100 or 1000 μg on days 0 and 14 doses 14 days apart Two administered 15 or 45 135 μg on days 0 and 21 i.m. doses (500 μl each) Two 21 days apart administered via i.m. route 2 groups: Prime only: 250 μg single dose i.m. doses Two Prime boost: of 50 μg each at weeks 0 and 4 i.m. Single dose or two doses at four weeks interval administered 2.5×10 26 vector i.m. Single ‑ dose administered via i.m. route ChAdO×1 nCoV prime ‑ only (28 days before challenge) and prime ‑ boost regimens (56 and 28 days before challenge) administered via i.m. route Single dose or 2 doses at 28 days interval administered Vaccine dosage and route Vaccine BIOQUAL Inc., BIOQUAL Maryland, USA Academy of Military Medical Sciences, Beijing, China New Iberia Research Center, Louisiana, USA Washington National Primate Research Centre, Seattle, USA Washington, Rocky Mountain Laboratories, Hamilton, Montana, USA Site of animal experiment 32 (7 groups, 4 ‑ 6 in each group) and 20 sham 30 (10 each in two vaccinated groups and 10 in placebo group) 15 (4 monkeys in each of three vaccinated groups, 3 naïve macaques) 5 (3 in prime only and 2 in prime ‑ boost group) 18 (3 groups, 6 in each group) Number of NHPs and groups (including control/ placebo/sham) Rhesus macaques Species of NHP Cynomolgus macaques Cynomolgus macaques Pigtail macaque Rhesus macaques 26 ‑ 19 22 21 20 ChAdOx ‑ 1nCoV MRT5500 LION/ repRNA ‑ CoV2S Viral vector vaccines Viral Ad26.COV2.S Vaccine candidates Vaccine ARCoV MUKHOPADHYAY et al: PRE-CLINICAL EFFICACY OF COVID-19 VACCINE CANDIDATES 99

year (°C) Contd... (4 ‑ 25) storage months Stable at Proposed 2 ‑ 8 for six 24 h at RT temperature RT for >one RT Stable at RT Stable at RT Not mentioned 7 DPI 4 DPI DPI of animal sacrifice / 50 pfu 4 pfu TCID 4 7 1.1×10 2.6×10 1.04×10 intranasally (1 ml: 0.5 each nostril) and intratracheally (1 ml) intranasally and intratracheally (0.25 ml each) ml given intranasally and intratracheally and orally intravenously and ocularly (volumes not mentioned) Live virus challenge dose 6 17 15.5 challenge dose (wk) Time until Time from the first

via i.m. via i.d. route via i.m. route Parameters 3 mg GX ‑ 19 given i.m. at weeks 0, 3 and 5.5 Three doses three weeks apart administered route 1 mg at days 0 and 28 ID doses 28 days apart Two administered Three groups of Baboons: 1 μg/5 μg/25 μg NVX ‑ CoV2373 (with 50 μg Matrix ‑ M adjuvant) i.m. on days 0 and 21 One group of baboons: 2.5 μg NVX ‑ CoV2373 without adjuvant, i.m. on days 0 and 21 groups of Two macaques: 5 μg/25 μg NVX ‑ CoV2373 (with 50 μg Matrix ‑ M adjuvant) i.m. on days 0 and 21 One group of macaques: 2.5 μg NVX ‑ CoV2373 (with 25 μg Matrix ‑ M adjuvant) i.m. on days 0 and 21 doses 21 days apart Two administered Vaccine dosage and route Vaccine Korea National Primate Research Centre, Korea Research Institute of Bioscience and Biotechnology, Cheongju, Chungcheongbuk, Republic of Korea BIOQUAL Inc., BIOQUAL Maryland, USA Inc., BIOQUAL Maryland, USA Site of animal experiment

3 macaques previously not exposed to the virus used as controls in viral challenge study 10 (2 groups, 5 in each group) 3 vaccinated macaques and 10 (4 groups, 2 ‑ 3 in each group) baboons clearance Virus study in 16 Cynomolgus macaques (4 groups of 4 macaques each) Number of NHPs and groups (including control/ placebo/sham) Species of NHP Rhesus macaques Cynomolgus macaques Olive Baboon and Cynomolgus macaques 33,34 30 31 GX ‑ 19 Protein subunit vaccines NVX ‑ CoV2373 Vaccine candidates Vaccine DNA vaccines DNA INO ‑ 4800 100 INDIAN J MED RES, January & February 2021

‑ 2 ‑ 8 (°C) storage Proposed temperature Not done 5 DPI (2 from each group) and 7 DPI (4 from each group) Not done Not mentioned DPI of animal sacrifice

50 TCID 6 pfu/ml only 6 Not done 2.6×10 10 intranasally (40%) and intratracheally (60%) Not done intranasally (0.5 ml) Live virus challenge dose 5 4 Not done Not done challenge dose (wk) Time until Time from the first

9

via i.m. via i.m. ‑ S at

‑ S at week via i.m. route Parameters

pfu 9 2 groups: (with 0.25 30 μg S ‑ Trimer AS03 adjuvant) on ml days 0 and 21 given i.m. (with 1.5 30 μg S ‑ Trimer mg CpG 1018 + 0.75 alum adjuvant) on days 0 and 21 given i.m. doses 21 days apart Two administered 20 μg or 40 on days 0 and 7 i.m. doses seven days Two apart administered route 5×10 500 μg on days 1, 5 and 23 i.m. Three doses four days and 22 days from first dose. Route of administration not mentioned Sad23L ‑ nCoV 0 i.m., followed by 5×10 Two doses four weeks Two apart administered route pfu Ad49L ‑ nCoV week 4 i.m. Vaccine dosage and route Vaccine Kunming Institute of Chinese Zoology, Academy of Medical Sciences, Kunming, Yunnan, China Kunming National High ‑ level Biosafety primate Research Centre, Kunming, Yunnan, China Huangzheng Animal Laboratory Breeding Centre, Guangzhou, China Xieerxin Biotech, China Site of animal experiment 18 (6 in each group) 12 (7 vaccinated macaques in two dose groups, 2 macaques in placebo group and 3 in untreated group) 8 (5 vaccinated and 3 control macaques) 2 Number of NHPs and groups (including control/ placebo/sham) Species of NHP Rhesus macaques Rhesus macaques Rhesus macaques Cynomolgus macaques 37 ‑ S/ ‑ S 35 38 36 2 animals were also injected with RBD peptide. The data is not included in the table in view of inadequate number of macaques; TCID, tissue culture infective dose; EU, entropy dose; infective culture TCID, tissue of macaques; number of inadequate in view table the in included is not data The RBD peptide. with were also injected 2 animals RBD S1 ‑ Fc inoculation; i.m., intramuscular; NHPs, non ‑ human primates; i.m., intramuscular; ‑ inoculation; DPI, days post nanoparticles; unit; LION, lipid inorganic dose; pfu, plaque ‑ forming culture infective units; CCID, cell room temperature RT, Vaccine candidates Vaccine Sad23L ‑ nCoV Ad49L ‑ nCoV * S ‑ Trimer MUKHOPADHYAY et al: PRE-CLINICAL EFFICACY OF COVID-19 VACCINE CANDIDATES 101 Contd ... ‑ cell response ‑ ‑ Pre ‑ dominant T type ‑ ‑ Th1 ‑ biased response Th1 ‑ biased response Th1 biased Th1 biased ‑ Th1 ‑ biased response Low ‑ Th1/Th2 response ------Y Y Th response # ------↓ ↑ NS NS NS NS NS NS NS NS NS NS IL 5 Pro ‑ inflammatory * ------↓ ↑ NS NS NS NS NS NS NS NS NS NS IL 6 Th2 response ------x x N N N N NS NS NS IL 13 IL - - - - ↓ ↓ ↓ ↑ ↓ N N N N N N N NS NS NS NS NS NS NS NS IL 4 Anti-inflammatory ------↓ ↓ ↓ ↑ ↑ Y N N N N NS NS NS NS NS NS IL 2 ------↑ Y Y N N N N N ↑↑ ↑↑ NS NS NS NS NS IFN γ ------↓ ↓ ↓ ↑ ↑ Pro ‑ inflammatory Y N N N N NS NS NS NS NS NS TNFα Th1 response ------Anti ‑ inflammatory Vaccinated Groups of NHP Unvaccinated Vaccinated Unvaccinated Unvaccinated Vaccinated Vaccinated with 200 EU Vaccinated Vaccinated with 100 EU Vaccinated Vaccinated with 20 EU Vaccinated Control Vaccinated Unvaccinated Vaccinated Unvaccinated Vaccinated Unvaccinated Vaccinated Unvaccinated Vaccinated Unvaccinated Vaccinated Unvaccinated Vaccinated Unvaccinated Table II. Cellular immune response elicited by COVID ‑ 19 candidate vaccines included in the review Table Weeks 1, 3, 5 Weeks Time points Time post ‑ first dose of vaccination Day 1 till day 36 4 ‑ 5 weeks Days 3, 5, 7, 9, 15 Eight weeks Peak response at four weeks Three weeks Three weeks 2, 4, 6 weeks Four weeks 1, 3, 5, 7 DPI ‑ 19 PiCoVacc Vaccine Vaccine BBIBP ‑ CorV Inactivated vaccines BBV152 Inactivated Vaccine RNA vaccine RNA mRNA ‑ 1273 BNT162b2 ARCoV MRT 5500 MRT LION/repRNA ‑ CoV2S Viral vector Viral vaccine Ad26.COV2.S ChAdOx ‑ 1nCoV 102 INDIAN J MED RES, January & February 2021 ‑ cell response Pre ‑ dominant T type ‑ Th1 biased Th1 biased Better lymphocyte response in CpG ‑ 1018 + alum group Th1 biased ------Y X X Th response

------X X NS IL 5 Pro ‑ inflammatory ------X X NS IL 6 Th2 response cell response induced by RBD and S1 ‑ Fc were not cell response induced by ------X X NS IL 13 IL - - - ↓ ↓ X X ↓↓ NS IL 4 Anti-inflammatory - - ↑ ↑ ↓ ↑ X X NS IL 2 ↑ ↑ ↓ Y N X X ↑↑ NS IFN γ IL, interleukin TNF ‑ α, tumour necrosis factor-alpha, - - ↑ ↑ ↓ ↑ Pro ‑ inflammatory X X NS TNFα Th1 response 6 µg+adjuvant A. T A. Compared to the group 6 µg+adjuvant # ------X X Anti ‑ inflammatory (with adjuvant) (with (with adjuvant) (with Groups of NHP Vaccinated Unvaccinated Unvaccinated Vaccinated Vaccinated No adjuvant Vaccinated No adjuvant Vaccinated detected; N, Not ↑, increased as compared to placebo; ↓, decreased vaccinated; NS, not significant; DPI: days Y, Time points Time post ‑ first dose of vaccination Monitored till week 15 Weeks 5.5 and 8 Weeks Four weeks Five weeks, continued till sacrifice 2, 4, 5, 6, 8 weeks helper response; ‑ S/ T ‑ S Th, Compared to vaccinated groups, 3µg+adjuvant B and 6 µg+adjuvant A; Compared to vaccinated groups, 3µg+adjuvant B and 6 µg+adjuvant ‑ 14, 17 21, 24, 25,29, 30, 32 37 : Refs 11 Source available. nanoparticles; post ‑ infection; X, not studied; IFN, interferon; LION, lipid inorganic Vaccine Vaccine * DNA vaccine DNA INO ‑ 4800 GX ‑ 19 Protein subunit vaccine NVX ‑ CoV2373 Trimer S ‑ Trimer Sad23L ‑ nCoV Ad49L ‑ nCoV MUKHOPADHYAY et al: PRE-CLINICAL EFFICACY OF COVID-19 VACCINE CANDIDATES 103

Comparison of viral clearance, histopathology findings rose, with PiCoVacc-vaccinated animals showing and immune response of these candidate vaccines was peak NAb levels at three weeks. The antibody titres also done: were observed and detected till five weeks after administration of the first dose of BBV152, PiCoVacc Inactivated vaccines and BBIBP-CorV12-14. Data from the Inactivated Four inactivated vaccine candidates were Vaccine trial were not clear on the duration of considered in this review: BBV15212, PiCoVacc13, protection offered by the antibodies. Control BBIBP-CorV14 and Inactivated Vaccine15. animals showed nil/minimal NAb titres compared to 12-15 Viral clearance from various organs: Robust viral vaccinated animals in all the studies . clearance from upper respiratory tract (nasopharynx T-cell response: The inactivated vaccines did not elicit and oropharynx), lungs, bronchoalveolar lavage (BAL) an effective cellular immune response in vaccinated fluid, pharynx, trachea, tonsil, mediastinal and cervical NHPs; however, BBV152 produced T-helper cell lymph nodes and extrapulmonary organs such as response12. Table II depicts T-cell response and cytokine gastrointestinal tract (GIT), urinary bladder and skin profile of various vaccine candidates. was observed with 3 μg+adjuvant B and 6 μg+adjuvant B formulations of BBV152, with none of the vaccinated Progress to clinical trial: Except Inactivated Vaccine, animals showing sub-genomic RNA (sgRNA) by which is still in Phase I/IIa, the other three candidates seven-day post-infection (DPI). 6 μg+adjuvant A have entered Phase III clinical trials. Data from Phase II clinical trials of PiCoVacc and BBIBP-CorV formulation of BBV152 showed less efficacy than the 16,17 aforementioned formulations in viral clearance12. 6 μg are available in the public domain . dose group of PiCoVacc effectively cleared the virus PiCoVacc Phase II trial: A total of 600 participants from nasopharynx, GIT and lung, while the animals enrolled in the study were given either placebo or the vaccinated with 8 μg of BBIBP-CorV were unable to vaccine candidate (renamed CoronaVac in clinical completely clear the virus from the GIT, though it was trials) in doses of 3 or 6 µg two or four weeks apart16. successful in virus clearance from the oropharynx and (i) NAb response: Although higher NAb response lungs by seven DPI13,14. The lower dose groups of both was observed with the 6 µg group, the different these vaccines were less effective in viral clearance, vaccination schedules did not produce any significant but animals in the lower dose groups still fared better difference in NAb response in the respective dosage than the placebo groups. Inactivated Vaccine was groups. With the day 0,14 dosage schedule, NAb excluded from this analysis due to unavailability of the was detected first at 14 days. Response was higher number of vaccinated macaques at different time points with the 0,28 day dosage schedule16. in post-virus challenge study15. (ii) T-cell response: Cellular immune response data were Histopathology of lungs on necropsy: Nil-to-mild not available. focal histopathological changes were observed in lung BBIBP-CorV Phase I/II trial: Phase I trial enrolled 192 tissues of vaccinated animals compared to the placebo participants and they were inoculated with 2, 4 or 8 µg groups in all four trials12-15. The unvaccinated animals BBIBP-CorV four weeks apart. Phase II was carried showed evidence of pneumonia, which ranged from out in 448 participants who received 8 µg single dose moderate to severe. of BBIBP-CorV or two doses of 4 µg each on days Immune response in vaccinated animals 0,14/0,21 and 0,2817. (i) NAb response: Phase I trial yielded better response Neutralizing antibody (NAb) response: NAbs were in 18-59-yr-old participants, with 79-96 per cent measured using viral neutralization assays such as plaque reduction neutralization test (PRNT), seroconversion by two weeks and 100 per cent microneutralization test and live SARS-CoV-2 seroconversion by four weeks. Response was assays. NAbs first appeared in the serum of animals poorer in participants aged 60 yr and above. Phase injected with BBIBP-CorV and Inactivated Vaccine II participants had detectable NAb starting from 1 injected animals at one week, PiCoVacc-vaccinated to 2 wk after first dose, with better response seen in macaques at two weeks and BBV152-vaccinated the 4 µg dosage schedules on days 0,21 and 0,28. animals at three weeks following administration of (ii) T-cell response: Cellular immune response data were the first dose of the vaccine12-15. The levels gradually not available. 104 INDIAN J MED RES, January & February 2021

RNA vaccines serum panel used in the study18. No data on NAb titres in the control animals were available for BNT162b2, The five RNA vaccine candidates included were 18 19 20 21 ARCoV, LION/repRNA-CoV2S and MRT5500, mRNA-1273 , BNT162b2 , ARCoV , MRT5500 although LION/repRNA-CoV2S and low-dose and lipid inorganic nanoparticles (LION)/repRNA- group of ARCOV had NAb titres comparable with 22 CoV2S . convalescent human serum19-22. MRT5500 apparently Viral clearance from various organs: mRNA-1273 produced a dose-dependent response, but there was successfully cleared virus from tissues, as evidenced no significant difference in titres between vaccinated 21 by the absence of sgRNA in throat swab and BAL of groups . vaccinated macaques by 5-7 DPI and lung tissue of T-cell response: mRNA-1273, BNT162b2, ARCoV vaccinated animals at necropsy on 14/15 DPI. The and MRT5500 elicited Th1 skewed cellular immune 100 μg dose group showed better response than the responses, while T-cell response was not significant 10 μg group, and both fared better than the control for LION/repRNA-CoV2S vaccine. Details of T-cell group18. BNT162b2 showed the absence of sgRNA in response elicited by vaccine candidates are enumerated nasal swabs at three DPI and throat swabs and BAL in Table II. fluid at six DPI (throat swab of one vaccinated animal Progress to clinical trial: mRNA-1273 and BNT162b1 tested positive at 10 DPI)19. Virus challenge study was (which showed similar results to BNT162b2 in animal not conducted in the ARCoV, MRT5500 and LION/ trials) have progressed to Phase III clinical trials. repRNA-CoV2S vaccine trials20-22. Others are in Phase I/II or in pre-clinical stage. Data Histopathology of lungs on necropsy: Mild from published Phase I/II clinical trials of mRNA- inflammation was noted in the lung tissues of 1273 and BNT162b1 clinical trials are as follows: mRNA-1273-vaccinated animals on necropsy, while mRNA-1273 Phase I trial: Forty five participants were the control animals showed moderate-to-severe inoculated with two doses of 25/100 µg or 250 µg pneumonia18. Histopathological findings were not vaccine, four weeks apart23. available for BNT162b2 vaccine, while the other trials (i) NAb response: First detected at two weeks in 50 per did not conduct necropsy19. cent participants and gradually increased. Higher Immune response in vaccinated animals response was seen with higher dose groups. (ii) T-cell response: Cellular immune response data Neutralizing antibody response: Different virus for the 25 and 100 µg groups showed a Th1-biased neutralization methods such as Plaque Reduction and immune response. Neutralization Assay (PRNT), microneutralization assay, live virus neutralization assay, as well as BNT162b1 Phase I/II trial: Forty five participants pseudovirus neutralization assay were used to assess enrolled in the trial were given two doses of 10 µg/30 µg vaccine three weeks apart or a single shot of 100 µg NAb induced by RNA vaccines. NAbs were first 24 detected in the serum of MRT5500-injected macaques vaccine . at one week, mRNA-1273, ARCoV and LION/ (i) NAb response: First detected at three weeks and the repRNA-CoV2S–vaccinated animals at two weeks and titres gradually rose. BNT162b2-vaccinated animals at three weeks after (ii) T-cell response: Cellular immune response data were first vaccination. NAb titres peaked at six weeks with not available. mRNA-1273 and LION/repRNA-CoV2S vaccines and Viral vector vaccines were detected in the serum of vaccinated animals till 8 Ad26.COV2.S25 and ChAdOx1 nCoV-1926 were and 10 wk, respectively, from the first vaccine dose18-22 the two viral vector vaccines included in this review. while with the remaining three vaccines, peaks were observed at 4-5 wk (four weeks for ARCoV, five weeks Viral clearance from various organs: Ad26.COV2.S for MRT5500 and 4-5 wk for BNT162b2)19-21. NAb showed remarkable clearance of the virus from the response persisted up to eight weeks with BNT162b2 nose and BAL fluid starting from two DPI25. ChAdOx1 and six weeks with MRT5500. Control animals in the nCoV-19 showed less efficacy, with 50 and 16 per cent mRNA-1273 trial had poor NAb titres compared to vaccinated animals showing the presence of genomic vaccinated animals. Vaccinated macaques had NAb RNA (gRNA) in the nasal swabs and BAL fluid, titres 84 times higher than that of convalescent human respectively, on five DPI26. Although ChAdOx1 nCoV- MUKHOPADHYAY et al: PRE-CLINICAL EFFICACY OF COVID-19 VACCINE CANDIDATES 105

19 effectively cleared the virus from the trachea and (i) NAb response: All participants tested at four weeks tonsils on necropsy at seven DPI, it was less effective had detectable NAb. in doing so from the pharynx, mediastinal lymph node, (ii) T-cell response: Interferon (IFN)-γ was detected at tonsil, GIT and bladder26. seven days and peaked at 14 days. Histopathology of lungs on necropsy: Lung ChAdOx1 nCoV-19 Phase II/III trial: Data were available pathology was not studied for Ad26.COV2.S, while from 560 participants in low-dose (2.2×1010 virus particles) no vaccinated animal in the ChAdOx1 nCoV-19 and standard-dose (3.5-6.5×1010 virus particles) cohorts in vaccine trial showed evidence of pneumonia on single and double dose regimens (28 days apart)29. histopathology, which is in contrast with the control (i) NAb response: First detected at four weeks and group where two of the three animals developed viral peaked at six weeks after first dose. 25,26 interstitial pneumonia . (ii) T-cell response: IFN-γ peaked at 14 days after first dose. Immune response in vaccinated animals DNA vaccines Neutralizing antibody response: Live virus neutralization assay and pseudovirus neutralization This category included INO-480030 and GX-1931 assay were used to measure NAb response elicited by vaccines. both the vaccines. NAb response was induced within Viral clearance from various organs: INO-4800– two weeks of administration of the first dose, with NAb vaccinated animals did not demonstrate effective peak achieved at four weeks with Ad26.COV2.S and clearance of the virus from tissues, with sgRNA six weeks with ChAdOx1 nCoV-19. While in the Ad26. still detectable in the nasal swab and BAL fluid of COV2.S trial NAb titres were not measured beyond vaccinated animals at seven DPI. Findings were similar four weeks, NAbs induced by ChAdOx1 nCoV-19 to GX-19, which showed viral copies in the nasal and 25,26 were detectable till eight weeks . The response was throat swabs of all vaccinated animals till euthanasia higher with the prime-boost regimen of ChAdOx1 on four DPI30,31. nCoV-19, and animals vaccinated with these candidates had higher titres than control animals and convalescent Histopathology of lungs on necropsy: Lungs of GX- human serum. Ad26.COV2.S-vaccinated animals had 19–vaccinated animals showed mild changes compared higher NAb titres than control animals25,26. to the placebo group, which developed moderate-to- severe inflammation31. Necropsy studies were not T-cell response: Ad26.COV2.S induced Th1-biased carried out for INO-480030. response in vaccinated macaques, while ChAdOx1 nCoV-19 produced low Th1/Th2 immune response. Immune response in vaccinated animals T-cell responses elicited by these vaccines are described Neutralizing antibody response: The INO-4800 trial in Table II. employed pseudovirus neutralization assay, while Progress to clinical trial: Both candidates are currently the GX-19 trial employed PRNT assay for measuring under evaluation in Phase III clinical trials. Phase I NAb. Both vaccines induced NAb response in data from both vaccine trials and Phase II/III data from vaccinated macaques, with the first detection at ChAdOx1 nCoV-19 trial are discussed below. four weeks with INO-4800 and 5.5 wk with GX-19, starting from administration of the first dose of the Ad26.COV2.S (renamed JNJ-78436735) Phase I trial: vaccines. INO-4800 showed peak NAb response at Of the 796 participants enrolled, immunogenicity six weeks after the first dose, and the antibodies were results were available for 390 vaccine recipients. detectable for INO-4800 and GX-19 till weeks 12 and 5×1010 or 1×1011 virus particles were given as single 8, respectively, from the first vaccination30,31. INO- dose or two doses four weeks apart27. 4800–immunized animals had higher NAb titres than (i) NAb response: First testing carried out at four weeks placebo animals. showed 98 per cent participants had detectable NAb. T-cell response: GX-19 produced a Th1 cell response (ii) T-cell response: It was predominantly Th1 skewed. in vaccinated macaques, while INO-4800 induced only ChAdOx1 nCoV-19 Phase I/II trial: A total of 1077 IFN-γ which was detected in the serum of vaccinated participants were given either a single dose of 5×1010 animals but not control animals. Table II describes the virus particles or two doses four weeks apart28. cellular immune response elicited by these vaccines. 106 INDIAN J MED RES, January & February 2021

Progress to clinical trial: Both candidates are currently it took only one week with RBD, three weeks with in Phase I/IIa clinical trials with limited data available NVX-CoV2373 and one week with S1-Fc. The titres for INO-4800. gradually rose, with peaks at five weeks for S-Trimer and S1-Fc and 4-6 wk for Sad23L-nCoV-S/Ad49L-nCoV-S, INO-4800 Phase I trial: Phase I trial on 40 healthy and were detectable till five weeks with NVX- volunteers demonstrated immune response in 94 CoV2373 and RBD, six weeks with S-Trimer and 10 per cent of participants six weeks after two doses of wk with Sad23L-nCoV-S/Ad49L-nCoV-S33,35-38. NAb 32 INO-4800 . titres were higher in animals vaccinated with NVX- Protein subunit vaccines CoV2373, S-Trimer and RBD compared to placebo, while control data were not available for Sad23L- 33,34 35 36 NVX-CoV2373 , S-Trimer , RBD , Sad23L- nCoV-S/Ad49L-nCoV-S. NVX-CoV2373–vaccinated 37 38 nCoV-S/Ad49L-nCoV-S and S1-Fc were the protein animals had higher NAb titres than control animals, with vaccines included in the review. increasing titres on booster dose administration33,35-38. Viral clearance from various organs: NVX-CoV2373 Sad23L-nCoV-S/Ad49L-nCoV-S response was not demonstrated robust viral clearance in Cynomolgus enhanced after booster dose. macaques, with all vaccinated animals showing the T-cell response: NVX-CoV2373 and Sad23L- absence of sgRNA by four DPI. S-Trimer vaccinated nCoV-S/Ad49L-nCoV-S produced Th1-biased macaques (16-64 per cent of animals from AS03 and responses, and better lymphocyte response was seen CpG-1018/alum adjuvant groups) showed the presence with the CpG-1018+alum–vaccinated macaques in of gRNA in the nasal swabs, throat swabs, anal swabs S-Trimer study33,35,37, while no data were available for and trachea till seven DPI. There was complete RBD and S1-Fc36,38. The cellular immune responses clearance of the virus from lungs with S-Trimer, and produced by these candidate vaccines are described RBD (20 and 40 μg doses) showed absence of the in Table II. virus in the throat and anal swabs, with no detectable sgRNA (though gRNA was detected) by six DPI35,36. Progress to clinical trial: NVX-CoV2373 is being Neither gRNA nor sgRNA could be detected in the evaluated in Phase III clinical trials, with results of 39 lung tissues of RBD vaccinated animals in both groups Phase I/II trial already published . Others are in following virus challenge. Virus challenge study was Phase I or pre-clinical stage, with Sad23L-nCoV-S/ not performed for Sad23L-nCoV-S/Ad49L-nCoV-S Ad49L-nCoV-S not picked up for further trials. vaccine37. No data were available for viral clearance NVX-CoV2373 Phase I trial: A total of 131 participants from tissues and organs for S1-Fc38. were injected with placebo or 5 or 25 µg vaccine (renamed rSARS-CoV-2) with Matrix-M1 adjuvant Histopathology of lungs on necropsy: Lungs of control 39 animals showed evidence of pneumonia, while nil-to- three weeks apart . mild changes were observed in lung tissue of animals (i) NAb response: Detected at week three and peaked vaccinated with NVX-CoV2373, S-Trimer and RBD at week five, with higher response in 5 µg group. vaccines34-36. No data were available for Sad23L- (ii) T-cell response: Predominantly Th1-biased nCoV-S/Ad49L-nCoV-S candidate vaccine. Further, response. data were not available for histopathological findings The vaccines are ranked according to their efficacy of lung tissue in the S1-Fc trial37,38. in NHP models in Table III. Immune response in vaccinated animals Discussion Neutralizing antibody response: In NVX-CoV2373 Pre-clinical trials of vaccines and other biologicals vaccinated animals NAbs were measured using live are important before embarking on clinical trials, as these virus neutralization assay. S-Trimer and RBD trials may allow correct prediction of outcome in clinical trials. employed live virus as well as pseudovirus neutralization Rhesus macaques and Cynomolgus macaques are the assays. Sad23L-nCoV-S/Ad49L-nCoV-S trial used two monkey species most frequently used for pre-clinical surrogate viral neutralization assay and pseudovirus studies. There is genetic similarity between humans neutralization assays to measure NAb. Both S-Trimer and Rhesus macaques, including sharing of pathogen and Sad23L-nCoV-S/Ad49L-nCoV-S induced NAb genomes. It is also easy to handle rhesus monkeys, and response within two weeks of first vaccination, while therefore, they have been widely used in biomedical MUKHOPADHYAY et al: PRE-CLINICAL EFFICACY OF COVID-19 VACCINE CANDIDATES 107 till 7 DPI Contd ... week 5 Peak at Week 5 Week Week 8 Week 4 Week 5 Week 8 Week (week 5) Detected NAb response Week 1 Week Week 2 Week 2 Week 3 Week 3 Week 1 Week 3 Week First detected at as per the WHO) as per the within two weeks, (should be detected C. ‑ helper ‑ helper cell response macaques Not significant in Th1 ‑ biased response. T Additional cell response Th1 ‑ biased response Th1 ‑ biased response Th1 ‑ biased response Data not available T T cell response T mild Nil ‑ to mild histopathological changes in vaccinated group compared to placebo group Mild inflammation compared to placebo group Not studied Nil ‑ to mild changes in vaccinated animals compared to placebo group Data not available Nil ‑ to mild changes in vaccinated animals compared to placebo group Nil ‑ to mild histopathological changes in vaccinated group compared to placebo group Lung histopathology Complete clearance from throat and lungs incomplete in R. clearance from GIT macaques by 7 DPI Complete clearance from pulmonary and extra ‑ by 7 DPI organs Complete clearance from 2 DPI pulmonary organs, onwards Complete clearance from not pulmonary organs, detectable 2 DPI onwards Complete viral clearance starting from 3 DPI and lasting upto 10 DPI in pulmonary with 1 vaccinated organs, animal showing presence of virus in throat swab on 10 DPI levels Undetectable sgRNA and GIT in pulmonary organs starting from 2 DPI and lasting up to 6 DPI, thus depicting viral was, however, clearance. gRNA detectable in vaccinated animals Complete viral clearance from pulmonary and extra ‑ by 7 DPI organs Viral clearance Viral 2 1 2 2 2 2 2 or 4 WHO) Number of Table III. Ranking of COVID ‑ 19 vaccine candidates according to their efficacy in non human primates Table doses needed >2, as per the (should not be μg) (8

mRNA ‑ 1273 (100 μg) Ad26.COV2.S NVX ‑ CoV2373 (25 μg + 50 M ‑ 1) and (5 μg + 50 M ‑ 1) BNT162b2 RBD BBV152 (3μg + adjuvant B and 6 μg+adjuvant B) BBIBP ‑ CorV Vaccine candidate Vaccine 1 2 3 4 5 6 7 Rank 108 INDIAN J MED RES, January & February 2021 to till Not 7 DPI week 8 week 5 Peak at Peak at Week 4 Week 6 Week Week 8 Week 5 Week possible Week 10 Week Week 12 Week Week 10 Week (week 5) Detected Rising at comment NAb response 5.5 wk 2 ‑ 3 wk Week 2 Week Week 2 Week 4 Week Week 2 Week 2 Week 1 Week 2 Week 2 Week comment Not possible to First detected at as per the WHO) as per the within two weeks, (should be detected Not significant Data not available Better lymphocyte response in CpG ‑ 1018 + alum ‑ vaccinated group IFN ‑ γ raised in vaccinated animals Th1 ‑ biased response Not significant Low Th1/Th2 response Not significant Th1 ‑ biased response Th1 ‑ biased response Th1 ‑ biased response T cell response T Not done Not done Nil ‑ to mild changes in vaccinated animals compared to placebo group Not done Mild changes as compared to placebo group Nil ‑ to mild histopathological changes in vaccinated group compared to placebo group No pneumonia in vaccinated animals. Evidence of viral interstitial pneumonia in placebo group Nil ‑ to mild histopathological changes in vaccinated group compared to placebo group Not done Not done Not done Lung histopathology

Not done Not done Ineffective viral clearance, with 1 or more vaccinated animal showing presence of virus in by 7 DPI pulmonary organs in both vaccinated groups. no vaccinated animal However, had detectable virus in lung tissue on 7 DPI Ineffective viral clearance from by 7 DPI pulmonary organs Ineffective viral clearance from by 4 DPI pulmonary organs (necropsy) Not possible to comment Complete viral clearance from pulmonary and extra ‑ by 7 DPI organs Not done Not done Incomplete clearance from pulmonary and extra ‑ by 7 DPI organs Not done Viral clearance Viral 3 2 2 3 2 3 2 2 2 1 or 2 1 or 2 WHO) Number of doses needed >2, as per the (should not be ‑ S/ ‑ S ‑ 19 S1 ‑ Fc S ‑ Trimer INO ‑ 4800 GX ‑ 19 LION/ repRNA ‑ CoV2S Inactivated vaccine Ad49L ‑ nCoV ChAdOx ‑ 1nCoV (6 μg) PiCoVacc 5500 MRT Sad23L ‑ nCoV ARCoV Vaccine candidate Vaccine 17 13 14 15 16 18 8 9 10 11 12 Rank infection; R. macaques, Rhesus macaques; C. macaques, Cynomolgus macaques; IFN, interferon; LION, lipid inorganic nanoparticles; GIT, gastrointestinal nanoparticles; GIT, DPI: days post ‑ infection; R. macaques, Rhesus macaques; C. Cynomolgus IFN, interferon; LION, lipid inorganic tract; sgRNA, sub ‑ genomic RNA; Nab, neutralizing antibody ‑ 14, 17 21, 24, 25, 29, 30, 32 37 : Refs 11 Source MUKHOPADHYAY et al: PRE-CLINICAL EFFICACY OF COVID-19 VACCINE CANDIDATES 109 research. Cynomolgus monkeys bred exclusively for sgRNA to differentiate actively replicating virus from laboratory use are the most commonly used NHP models leftover inoculum45. in pre-clinical trials these days, despite the unavailability Thirteen vaccine candidates were tested for of extensive genomic data for this species, unlike Rhesus their efficacy in viral clearance from various tissues. monkeys40. To demonstrate this, the studies relied on detection While Muñoz-Fontela et al41 have commented on of gRNA and/or sgRNA from pulmonary and the lack of available data for choosing the best NHP extrapulmonary tissues of vaccinated and placebo model to study SARS-CoV-2, a recent pre-print study animals. As mentioned earlier, sgRNA detection is has shown that Rhesus and Cynomolgus monkeys are considered as evidence of active viral replication45,46. equally effective models for studying COVID-1942. The vaccinated animals fared better than the placebo The third primate species discussed here is the Baboon. groups, with 50-100 per cent animals showing They are excellent models for vaccine trials because of complete viral clearance within seven DPI in all 43 their phylogenetic similarity to humans . Most of the studies. Inactivated Vaccine was excluded from this vaccine candidates considered here were evaluated in analysis due to unavailability of data15. Rhesus macaques (Macaca mulatta) and Cynomolgus macaques (Macaca fascicularis), with part of the Of the inactivated vaccines, 3 μg+adjuvant B NVX-CoV2373 trial conducted in olive baboons and and 6 μg+adjuvant B regimens of BBV152 and 6 μg LION/repRNA-CoV2S tested in pigtail macaques. dose of PiCoVacc showed the best clearance of gRNA and sgRNA, and gRNA clearance, respectively12,13. Target product profile (TPP) of the WHO for Both these vaccines showed effective viral clearance COVID-19 vaccines advocates the administration of from the upper respiratory tract (nasopharynx and vaccine by any route as long as it is safe. The maximum oropharynx) and lungs (BAL fluid). Complete parenteral dose should not exceed 1 ml, and the regimen clearance of the virus from extrapulmonary tissues should consist of no more than two doses, with booster of vaccinated groups was seen with 3 μg+adjuvant B doses permitted for long-term effect44. Schedule of formulation of BBV152 whereas the 6 μg+adjuvant administration of various vaccines along with the doses B formulation showed impaired clearance. gRNA are provided in Table I. According to the WHO TPP, clearance from throat of NHP with 8 μg dose of vaccine-induced protection should last for a minimum of BBIBP-CorV was seen within seven DPI, with six months and the vaccine should clearly demonstrate impaired rectal clearance12-14. mRNA-1273 and its efficacy, ideally with about 50 per cent point estimate, BNT162b2 were the only RNA vaccine candidates with 70 per cent efficacy considered preferable. Endpoint to evaluate viral clearance (using sgRNA) and both may be assessed by presence of severe disease and/ 18,19 or virus shedding/transmission44. Based on the review showed comparable efficacy within seven DPI . In of available data of NHP studies, the performance of the viral vector vaccine group, Ad26.COV2.S was different vaccine candidates has been compared based more efficacious in clearing viral sgRNA from tissues on their compliance with the WHO TPP. within seven DPI than sgRNA and gRNA clearance by ChAdOx1 nCoV-1925,26, which also showed impaired Viral clearance from various organs and tissues of clearance of the virus from extrapulmonary organs. NHPs following challenge with live SARS-CoV-2 None of the DNA vaccines (INO-4800 and GX-19) Virus challenge study was conducted initally could successfully eliminate sgRNA or gRNA from with Inactivated Vaccine at two weeks after the tissues of vaccinated macaques within seven DPI30,31. first vaccination and last with GX-19 at 15.5 wk Among the protein subunit vaccines, RBD and NVX- post-vaccination15,31. Challenge studies were not carried CoV2373 both demonstrated better results in terms of out for ARCoV, MRT 5500, LION/repRNA-CoV2S, clearing sgRNA and gRNA at six DPI and sgRNA at Sad23L-nCoV-S/Ad49L-nCoV-S and S1-Fc vaccine seven DPI, respectively, than S-Trimer 34-36. However, candidates20-22,37,38. Route and dose of virus challenge viral gRNA was detectable in the throat and anal swabs are provided in Table I. The challenge doses used in and lung tissue of RBD vaccinated macaques till six different studies may be much higher than natural DPI. Further, sgRNA was not detected from these infective doses. Not only can this approach lead to samples, suggesting an absence of viral replication. erroneous estimation of NAb needed to stifle natural The viral load in vaccinated animals was lower than infection, but it may also necessitate the detection of the placebo groups in all the studies. 110 INDIAN J MED RES, January & February 2021

From the available data, it was inferred that higher with AS03 adjuvant containing S-Trimer– BBV152, PiCoVacc, mRNA-1273, BNT162b2, Ad26. vaccinated group as compared to CpG-1018/alum COV2.S, NVX-CoV2373 and RBD showed the most adjuvant. promising results in viral clearance from tissues and T-cell response organs of vaccinated macaques. The T-cell responses induced by the vaccine Histopathology and immunohistochemistry of lung candidates were measured using an array of Th1 and tissues of NHPs Th2 cytokines. These included Th1 cytokines such Ten vaccine candidates - BBV152, PiCoVacc, as TNF-α, IFN-γ and IL-2 and Th2 cytokines IL-4, BBIBP-CorV, Inactivated Vaccine, mRNA-1273, IL-5, IL-6 and IL-13, which were measured in varying ChAdOx1 nCoV-19, GX-19, NVX-CoV2373, degrees in different trials. S-Trimer and RBD - were compared for lung BBV152 was the only inactivated vaccine candidate pathology in vaccinated and placebo groups of to produce significant T-cell response in vaccinated non- animals. The vaccinated animals showed nil to mild human primates12. It induced T helper cell response. histopathological changes compared to the placebo Except LION/repRNA-CoV2S, the remaining RNA 12-15,18,26,31,34-36 groups in all the studies . IHC performed vaccines (mRNA-1273, BNT162b2, ARCoV and on lung tissues demonstrated no SARS-CoV-2 antigen MRT5500) produced a desirable Th1 skewed response 12 detection in the animals vaccinated with BBV152 . in vaccinated animals18-21. Unlike ChAdOx1 nCoV- Neutralizing antibody response 19, Ad26.COV2.S showed Th1-biased response in the viral vector vaccine category25,26. GX-19 also All the vaccine candidates elicited NAb response demonstrated a predominant Th1 response among the after the administration of first dose in NHP, which two DNA vaccines31. Of the protein subunit vaccines, was detected between 1 and 4 wk of vaccination and NVX-CoV2373 and Sad23L-nCoV-S/Ad49L-nCoV-S 12-15,18-22,25,26,30,31,33,35-38 lasted up to 5-12 wk . All the both induced Th1-dominant response33,37. studies reported significantly higher NAb titres in vaccinated groups compared to panels of human Eight candidates - mRNA-1273, Ad26.COV2.S, convalescent serum used in the respective trials, except BNT162b2, NVX-CoV2373, GX-19, ARCoV, MRT LION/repRNA-CoV2S, which showed no significant 5500 and Sad23L-nCoV-S/Ad49L-nCoV-S - induced difference in titres with convalescent human serum. a predominantly Th1-biased cellular immune response WHO TPP44 suggests that the vaccine candidate should in vaccinated animals; BBV152 and mRNA-1273 induce immune response, preferably within two weeks produced additional T helper cell response. INO-4800 of administration, and should provide protection for a induced detectable levels of IFN-γ (a Th1 cytokine) in minimum of six months. vaccinated animals, but the authors did not specify if the cellular immune response was predominantly of the BBIBP-CorV, RBD and MRT 5500 induced Th1 type30. Cytokine profile of NHPs was not available NAb response at week one post-vaccination14,21,36, for S-Trimer, though vaccinated animals showed followed by PiCoVacc, mRNA-1273, Ad26.COV2.S, increased lymphocyte frequency, which was higher ChAdOx1 nCoV-19, S-Trimer, ARCoV, S1-Fc, LION/ with the CpG-alum–adjuvant group. T-cell response repRNA-CoV2S and Sad23L-nCoV-S/Ad49L-nCoV-S induced by RBD and S1-Fc was not available. at two weeks13,18,20,22,25,26,35,37,38 and BBV152, BNT162b2, Inactivated Vaccine and NVX-CoV2373 at three A good COVID-19 vaccine candidate should result weeks12,15,19,33. NHPs injected with INO-4800 elicited in effective clearance of the virus from various tissues NAb response at four weeks of administration of the and organs, induce potent NAb response, and should first dose, while with GX-19, it was first detected at not elicit a Th2 skewed cellular immune response. The 5.5 wk after the first vaccination. All vaccine candidates last condition is of some urgency as vaccine-associated elicited persistent NAb response in vaccinated animals enhanced respiratory disease has been observed with some respiratory virus vaccines, which predominantly until they were euthanized. In the trials where live virus stimulate a Th2 response path47. challenge was not performed, NAbs mostly reached peak values at 5-7 wk and were detectable up to Ranking of the vaccines according to their wk 6-10. INO-4800 induced NAb that were detected performance in NHP models: It was observed that up to 12 wk post-vaccination. Antibody response was RNA vaccine, mRNA-1273, followed by viral vector MUKHOPADHYAY et al: PRE-CLINICAL EFFICACY OF COVID-19 VACCINE CANDIDATES 111 vaccine, Ad26.COV2.S, performed well, keeping and Ad26.COV2.S are the most promising candidates. in line with the TPP of WHO44. Both demonstrated NVX-CoV2373 and BNT162b2 are close behind them. robust viral clearance from various tissues and RBD and BBV152 are two other candidates to look induced effective NAb response, which was detectable out for. The data demonstrate that these six vaccines within two weeks of administration of the first dose are the most promising among the candidate vaccines of the vaccine18,25. These two vaccine candidates also analyzed. induced Th1 polarized cellular immune response in vaccinated macaques. mRNA-1273–vaccinated Human trial data available for some of these macaques also showed mild inflammation on lung candidates also showed results that corroborated histopathology compared to the placebo group, while NHP studies, with mRNA-1273, Ad26.COV2.S no such information was available for Ad26.COV2. and NVX-CoV2373 showing early NAb S–immunized animals. response (measured first at three weeks) and Th1 immune response23,27,39. BNT162b1 induced NAb Protein subunit vaccine, NVX-CoV2373 and response first detected at three weeks, with unavailability RNA vaccine, BNT162b2 both induced Th1 immune of cellular immunity data24. Besides these six vaccine response in vaccinated NHPs, but both elicited NAb candidates, clinical trial data are also available for response in vaccinated animals after three weeks other upcoming vaccines. ChAdOx1 nCoV-19 showed 19,33 of administration of the first dose which does better T-cell response in human trials compared to NHP not comply with the TPP of WHO. However, these studies28,29, and PiCoVacc (CoronaVac) and BBIBP- showed effective viral clearance from the respiratory CorV, which required three doses in NHP, generated tract, thereby making them valuable vaccine NAb with two doses in human trials16,17, thus complying candidates. NVX-CoV2373 vaccination led to mild with WHO guidelines. However, their T-cell response histopathological changes in the lungs following viral data were not available for comparison. challenge34, while histopathological data were not available for the BNT162b2 NHP trial. Apart from the efficacy demonstrated by these vaccines, a major factor that needs to be considered Protein subunit vaccine, RBD, led to NAb before large-scale rollout of these candidates for production within one week of the first dose, and the mass vaccination is storage temperature. While some vaccinated animals also showed effective clearance of candidates such as ARCoV and LION/repRNA- the virus from various organs following viral challenge, CoV2S are stable at room temperature for a week but there is no cellular immune response data available and INO-4800 at room temperature for a year, other for this candidate, and it is important to know the T-cell response to avoid vaccine-associated adverse effects. candidates such as BBV152, PiCoVacc, Ad26. COV2.S and ChAdOx1 nCoV-19 need refrigeration Among the inactivated vaccines, BBV152 at 2-8°C20,48-52. MRT5500 and BNT162b1 require performed better than the other candidates. BBV152 storage at −20°C and −70°C, respectively. Storage produced NAbs in vaccinated animals, which were temperature of mRNA-1273 has recently been first detectable three weeks after administration updated by the manufacturers to 2-8°C52. Vaccine of the first dose of the vaccine (not in line with manufacturers are still upgrading their formulations 44 the WHO guidelines) but it induced significant to enable storage at higher temperatures, which has to T-helper cell response. There was robust clearance be given special consideration in African and Asian of virus in vaccinated groups five DPI onwards, countries. demonstrating the strong protective efficacy of this 53 vaccine candidate12. Recently, Krammer published an article comparing the immune response and protective DNA vaccines did not perform as well as these efficacy of six COVID-19 vaccine candidates candidates; however, response was better with INO- 30,31 (PiCoVacc, mRNA-1273, Ad26.COV2.S, ChAdOx1n 4800 than GX-19 . CoV-19, BBIBP-CorV and NVX-CoV2373) in NHPs, After taking into account the immune responses which provided an insight into the effectiveness of generated by these candidate vaccines in NHPs, namely, various vaccine candidates. A systematic review of NAb response, T-cell response, and viral clearance, as candidate vaccines for SARS-CoV-2 by Dong et al54 well as the number of doses required to achieve the discussed the results of clinical trials, with a brief said response, it may be concluded that mRNA-1273 mention of results obtained in NHP models. Our 112 INDIAN J MED RES, January & February 2021 review compares and analyzes the immunogenicity 8. Yu P, Qi F, Xu Y, Li F, Liu P, Liu J, et al. Age-related rhesus and protective efficacy of 18 COVID-19 vaccine macaque models of COVID-19. Animal Model Exp Med 2020; candidates in NHPs and provides an elaborate 3 : 93-7. comparison of pre-clinical data obtained from the 9. European Medicines Agency. First regulatory workshop individual studies. on COVID-19 facilitates global collaboration on vaccine development; 2020. Available from: https://www.ema.europa.eu/ To conclude, COVID-19 vaccine studies en/news/first-regulatory-workshop-covid-19-facilitates-global- in NHPs yielded promising results, with some collaboration-vaccine-development, accessed on October 11, candidates faring better than the others. This review 2020. highlights the immunogenicity and protective 10. Central Drugs Standard Control Organization. Draft efficacy of various candidates who are frontrunners regulatory guidelines for development of vaccines with special consideration COVID-19 vaccine. New Delhi: Central Drugs in the vaccine race. Successful preclinical NHP Standard Control Organization, Directorate General of Health studies with these vaccine candidates demonstrating Services, Ministry of Health and Family Welfare, Government their immunogenicity and efficacy have boosted the of India; 2020. confidence of researchers across the world to fast 11. Moher D, Liberati A, Tetzlaff J, Altman DG; PRISMA track clinical trials and to produce a safe and effective Group. Preferred reporting items for systematic reviews and vaccine for SARS-CoV-2. However, it should be meta-analyses: The PRISMA statement. PLoS Med 2009; 6 : remembered that there are logistical challenges e1000097. that need to be addressed before commencing mass 12. Yadav P, Kumar S, Patil D, Mohandas S, Shete A, Bhati G, vaccination, and a suitable vaccine candidate has to et al. Remarkable immunogenicity and protective efficacy be chosen as per the infrastructure available in the of BBV152, an inactivated SARS-CoV-2 vaccine in Rhesus country. macaques. Available from: https://www.researchsquare.com/ article/rs-65715/v1, accessed on October 29, 2020. Financial support & sponsorship: None. 13. Gao Q, Bao L, Mao H, Wang L, Xu K, Yang M, et al. Development of an inactivated vaccine candidate for SARS- Conflicts of Interest: None. CoV-2. Science 2020; 369 : 77-81. References 14. Wang H, Zhang Y, Huang B, Deng W, Quan Y, Wang W, et al. Development of an inactivated vaccine candidate, BBIBP- 1. WHO COVID-19. Draft landscape of COVID-19 candidate corV, with potent protection against SARS-CoV-2. Cell 2020; vaccines. WHO; 2020. p. 3. Available from: https:// 182 : 713-21.e9. www.who.int/publications/m/item/draft-landscape-of-covid-19- candidate-vaccines, accessed on October 29, 2020. 15. Chen H, Xie Z, Long R, Fan S, Li H, He Z, et al. A valid protective immune response elicited in rhesus 2. Dinda AK, Tripathi SK, John B. Revisiting regulatory macaques by an inactivated vaccine is capable of framework in India for accelerated vaccine development in defending against SARS-CoV-2 infection. bioRxiv 2020. pandemics with an evidence-based fast-tracking strategy. doi: 10.1101/2020.08.04.235747. Indian J Med Res 2020; 152 : 156-63. 16. Zhang YJ, Zeng G, Pan HX, Li CG, Kan B, Hu YL, 3. Bregu M, Draper SJ, Hill AV, Greenwood BM. Accelerating et al. Immunogenicity and safety of a SARS-CoV-2 vaccine development and deployment: Report of a Royal inactivated vaccine in healthy 2 adults aged 18-59 Society Satellite Meeting. Philos Trans R Soc Lond B Biol Sci years: Report of the randomized, double-blind, and 3 2011; 366 : 2841-9. placebo-controlled phase 2 clinical trial. medRxiv 2020. 4. Randolph HE, Barreiro LB. Herd immunity: Understanding doi: 10.1101/2020.07.31.20161216. COVID-19. Immunity 2020; 52 : 737-41. 17. Xia S, Duan K, Zhang Y, Zhao D, Zhang H, Xie Z, et al. Effect 5. Adalja AA, Watson M, Cicero A, Inglesby T. Vaccine platforms: of an inactivated vaccine against SARS-CoV-2 on safety and State of the field and looming challenges; 2019. Available from: immunogenicity outcomes: Interim analysis of 2 randomized http://www.centerforhealthsecurity.org/our-work/pubs_archive/ clinical trials. JAMA 2020; 324 : 951-60. pubs-pdfs/2019/190423-OPP-platform-report.pdf, accessed on 18. Corbett KS, Flynn B, Foulds KE, Francica JR, October 12, 2020. Boyoglu-Barnum S, Werner AP, et al. Evaluation of the 6. Gerdts V, Wilson HL, Meurens F, van Drunen Littel-van den mRNA-1273 vaccine against SARS-CoV-2 in nonhuman Hurk S, Wilson D, et al. Large animal models for vaccine primates. N Engl J Med 2020; 383 : 1544-55. development and testing. ILAR J 2015; 56 : 53-62. 19. Vogel AB, Kanevsky I, Che Y, Swanson KA, 7. Herati RS, Wherry EJ. What is the predictive value of animal Muik A, Vormehr M, et al. A prefusion SARS-CoV-2 models for vaccine efficacy in humans? Consideration of spike RNA vaccine is highly immunogenic and prevents strategies to improve the value of animal models. Cold Spring lung infection in non-human primates. bioRxiv 2020. doi: Harb Perspect Biol 2018; 10 : 31583-4. 10.1101/2020.09.08.280818. MUKHOPADHYAY et al: PRE-CLINICAL EFFICACY OF COVID-19 VACCINE CANDIDATES 113

20. Zhang NN, Li XF, Deng YQ, Zhao H, Huang YJ, Yang G, details/2020/INOVIO-Announces-Positive-Interim-Phase-1-Data- et al. A thermostable mRNA vaccine against COVID-19. Cell For-INO-4800-Vaccine-for-COVID-19/default.aspx, accessed on 2020; 182 : 1271-83.e16. November 28, 2020. 21. Kalnin KV, Plitnik T, Kishko M, Zhang J, Zhang D, 33. Tian JH, Patel N, Haupt R, Zhou H, Weston S, Hammond H, Anosova NG, et al. Immunogenicity of novel mRNA et al. SARS-CoV-2 spike glycoprotein vaccine candidate NVX- COVID-19 vaccine MRT5500 in mice and non-human CoV2373 elicits immunogenicity in baboons and protection in primates. bioRxiv 2020. doi: 10.1101/2020.10.14.337535. mice. bioRxiv 2020. doi: 10.1101/2020.06.29.178509. 22. Erasmus JH, Khandhar AP, O’Connor MA, Walls AC, 34. Guebre-Xabier M, Patel N, Tian J-H, Zhou B, Maciejewski S, Hemann EA, Murapa P, et al. An Alphavirus-derived Lam K, et al. NVX-CoV2373 vaccine protects cynomolgus replicon RNA vaccine induces SARS-CoV-2 neutralizing macaque upper and lower airways 3 against SARS-CoV-2 antibody and T cell responses in mice and nonhuman primates. challenge. bioRxiv 2020. doi: 10.1101/2020.08.18.256578. Sci Transl Med 2020; 12 : 9396. 35. Liang JG, Su D, Song T-Z, Zeng Y, Huang W, Wu J, et al. 23. Jackson LA, Anderson EJ, Rouphael NG, Roberts PC, S-Trimer, a COVID-19 subunit vaccine candidate, induces Makhene M, Coler RN, et al. An mRNA vaccine against protective immunity in nonhuman primates. bioRxiv 2020. SARS-CoV-2-Preliminary report. N Engl J Med 2020; 383 : doi: 10.1101/2020.09.24.311027. 1920-31. 36. Yang J, Wang W, Chen Z, Lu S, Yang F, Bi Z, et al. A vaccine 24. Mulligan MJ, Lyke KE, Kitchin N, Absalon J, Gurtman A, targeting the RBD of the S protein of SARS-CoV-2 induces Lockhart S, et al. Phase I/II study of COVID-19 RNA protective immunity. Nature 2020; 586 : 572-7. vaccine BNT162b1 in adults. Nature 2020; 586 : 589-93. 37. Luo S, Zhang P, Liu B, Yang C, Liang C, Zhang L, et al. Prime- 25. Mercado NB, Zahn R, Wegmann F, Loos C, Chandrashekar A, boost vaccination of mice and Rhesus macaques with two Yu J, et al. Single-shot Ad26 vaccine protects against SARS- novel 1 adenovirus vectored COVID-19 vaccine candidates 2. CoV-2 in Rhesus macaques. Nature 2020; 586 : 583-8. bioRxiv 2020. doi: 10.1101/2020.09.28.311480. 26. van Doremalen N, Lambe T, Spencer A, Belij-Rammerstorfer S, 38. Ren W, Sun H, Gao GF, Chen J, Sun S, Zhao R, et al. Purushotham JN, Port JR, et al. ChAdOx1 nCoV-19 vaccination Recombinant SARS-CoV-2 spike S1-fc fusion protein induced prevents SARS-CoV-2 pneumonia in rhesus macaques. high levels of neutralizing responses in nonhuman primates. bioRxiv 2020. doi: 10.1101/2020.05.13.093195. Vaccine 2020; 38 : 5653-8. 27. Sadoff J, Le Gars M, Shukarev G, Heerwegh D, Truyers C, 39. Keech C, Albert G, Cho I, Robertson A, Reed P, Neal S, et al. Marit de Groot A, et al. Safety and immunogenicity of the Phase 1–2 Trial of a SARS-CoV-2 recombinant spike protein Ad26.COV2.S COVID-19 vaccine candidate: interim results nanoparticle vaccine. N Engl J Med 2020; 383 : 2320-32. of a phase 1/2a, double-blind, randomized, placebo-controlled 40. Cauvin AJ, Peters C, Brennan F. Advantages and Limitations trial. medRxiv 2020. doi: 10.1101/2020.09.23.20199604. of Commonly Used Nonhuman Primate Species in Research 28. Folegatti PM, Ewer KJ, Aley PK, Angus B, Becker S, and Development of Biopharmaceuticals. The Nonhuman Belij-Rammerstorfer S, et al. Safety and immunogenicity Primate in Nonclinical Drug Development and Safety of the ChAdOx1 nCoV-19 vaccine against SARS-CoV-2: A Assessment. Elsevier Inc.; 2015. p. 379-95. preliminary report of a phase 1/2, single-blind, randomised 41. Muñoz-Fontela C, Dowling WE, Funnell SGP, Gsell PS, controlled trial. Lancet 2020; 396 : 467-78. Riveros-Balta AX, Albrecht RA, et al. Animal models for 29. Ramasamy MN, Minassian AM, Ewer KJ, Flaxman AL, COVID-19. Nature 2020; 586 : 509-15. Folegatti PM, Owens DR, et al. Safety and immunogenicity 42. Boszormenyi KP, Stammes MA, Fagrouch ZC, of ChAdOx1 nCoV-19 vaccine administered in a prime-boost Kiemenyi-Kayere G, Niphuis H, Mortier D, et al. Comparison regimen in young and old adults (COV002): A single-blind, of SARS-CoV-2 infection in two non-human primate randomised, controlled, phase 2/3 trial. Lancet 2020. species: Rhesus and Cynomolgus macaques. bioRxiv 2020. doi: 10.1016/S0140-6736(20)32466-1. doi: 10.1101/2020.11.05.369413. 30. Patel A, Walters J, Reuschel EL, Schultheis K, Parzych E, Gary EN, et al. Intradermal-delivered DNA 43. Murthy KK, Salas MT, Carey KD, Patterson JL. Baboon as a vaccine provides anamnestic protection in a rhesus nonhuman primate model for vaccine studies. Vaccine 2006; macaque SARS-CoV-2 challenge model. bioRxiv 2020. 24 : 4622-4. doi: 10.1101/2020.07.28.225649. 44. WHO COVID-19. WHO target product profiles for COVID-19 31. Seo YB, Suh YS, Ryu JI, Jang H, Oh H, Koo BS, et al. Soluble vaccines. Geneva: WHO; 2020. spike DNA vaccine provides long-term protective immunity 45. Khoury DS, Wheatley AK, Ramuta MD, Reynaldi A, against SAR-CoV-2 in mice and nonhuman primates. bioRxiv Cromer D, Subbarao K, et al. Measuring immunity to SARS- 2020. doi: 10.1101/2020.10.09.334136. CoV-2 infection: Comparing assays and animal models. Nat 32. INOVIO Pharmaceuticals. INOVIO announces positive interim Rev Immunol 2020; 20 : 727-38. phase 1 data for INO-4800 vaccine for COVID-19; 2020. p. 1-6. 46. Wölfel R, Corman VM, Guggemos W, Seilmaier M, Available from: http://ir.inovio.com/news-releases/news-releases- Zange S, Müller MA, et al. Virological assessment of 114 INDIAN J MED RES, January & February 2021

hospitalized patients with COVID-2019. Nature 2020; 581 : https://www.scmp.com/news/china/science/article/3110314/ 465-9. coronavirus-vaccine-developed-china-induces-quick-immune, 47. National Institutes of Health. Experimental COVID-19 accessed on November 28, 2020. vaccine protects upper and lower airways in nonhuman 51. FiercePharma. Pfizer’s COVID-19 vaccine looks impressive, primates. Available from: https://www.nih.gov/news- but Sanofi, J&J and Novavax shots eye a logistics edge. events/news-releases/experimental-covid-19-vaccine-protects- Available from: https://www.fiercepharma.com/pharma/despite upper-lower-airways-nonhuman-primates, accessed on -pfizer-s-high-efficacy-expectations-other-covid-vaccines- October 27, 2020. may-have-a-logistics-edge, accessed on November 28, 2020. 48. Jeong-Yeo L. Can Korea handle COVID-19 vaccines? 52. Genetic Engineering and Biotechnology News. The cold Available from: http://www.koreaherald.com/view. truth about COVID-19 vaccines. Available from: https://www. php?ud=20201118000885, accessed on November 28, 2020. genengnews.com/news/the-cold-truth-about-covid-19-vaccines/, 49. Black S. Replicating RNA COVID-19 vaccine shows robust accessed on November 28, 2020. responses in early testing. The Science Advisory Board; 2020. Available from: https://www.scienceboard.net/index. 53. Krammer F. SARS-CoV-2 Vaccines in development. Nature aspx?sec=sup&sub=can&pag=dis&ItemID=1053, accessed 2020; 586 : 516-27. on November 28, 2020. 54. Dong Y, Dai T, Wei Y, Zhang L, Zheng M, Zhou F, et al. A 50. South China Morning Post. Coronavirus vaccine developed systematic review of SARS-CoV-2 vaccine candidates. Signal in China induces quick immune response. Available from: Transduct Target Ther 2020; 5 : 237.

For correspondence: Dr Nivedita Gupta, Virology Unit, Division of Epidemiology & Communicable Diseases, Indian Council of Medical Research, Ansari Nagar, New Delhi 110 029, India e-mail: [email protected] Indian J Med Res 153, January & February 2021, pp 115-125 Quick Response Code: DOI: 10.4103/ijmr.IJMR_2311_20

Demographic & clinical profile of patients with COVID-19 at a tertiary care hospital in north India

Shiv Lal Soni1, Kamal Kajal1, L.N. Yaddanapudi1, Pankaj Malhotra2, Goverdhan Dutt Puri1, Ashish Bhalla2, Mini P. Singh3, Inderpaul Singh Sehgal4, Vipin Koushal9, Neelam Varma5, Manisha Biswal6, P.V.M. Lakshmi7, Sadhna Sharma8, Vikas Suri2, Z. Deepy8, Sant Ram8, Jaivinder Yadav10, Navin Pandey9, Prashant Sharma11, Nabhajit Malik11, Kapil Goyal3, Aseem Mehra12, Swapnajeet Sahoo12, Ritin Mohindra2, Jijo Francis1, Mudit Bhargava2, Karan Singla1, Preena Babu1, Amiy Verma1, Niranjan Shiwaji Khaire2 & R.R. Guru9

Departments of 1Anaesthesia & Intensive Care, 2Internal Medicine, 3Virology, 4Pulmonary Medicine, 5Pathology, 6Medical Microbiology, 7Community Medicine & School of Public Health, 8Biochemistry, 9Hospital Administration, 10Pediatrics, 11Hematology & 12Psychiatry, Postgraduate Institute of Medical Education & Research, Chandigarh, India

Received June 1, 2020

Background & objectives: The COVID-19 pandemic emerged as a major public health emergency affecting the healthcare services all over the world. It is essential to analyze the epidemiological and clinical characteristics of patients with COVID-19 in different parts of our country. This study highlights clinical experience in managing patients with COVID-19 at a tertiary care centre in northern India. Methods: Clinical characteristics and outcomes of consecutive adults patients admitted to a tertiary care hospital at Chandigarh, India, from April 1 to May 25, 2020 were studied. The diagnosis of SARS-CoV-2 infection was confirmed by real-time reverse transcriptase polymerase chain reaction (RT-PCR) on throat and/or nasopharyngeal swabs. All patients were managed according to the institute’s consensus protocol and in accordance with Indian Council of Medical Research guidelines. Results: During the study period, 114 patients with SARS-CoV-2 infection were admitted. The history of contact with COVID-19-affected individuals was available in 75 (65.8%) patients. The median age of the patients was 33.5 yr (13-79 yr), and there were 66 (58%) males. Of the total enrolled patients, 48 (42%) were symptomatic. The common presenting complaints were fever (37, 77%), cough (26, 54%)

and shortness of breath (10, 20.8%). Nineteen (17%) patients had hypoxia (SpO2<94%) at presentation and 36 (31%) had tachypnoea (RR >24). Thirty four (29.8%) patients had an accompanying comorbid illness. Age more than 60 yr and presence of diabetes and hypertension were significantly associated with severe COVID-19 disease. Admission to the intensive care unit (ICU) was needed in 18 patients (52%), with three (2.6%) patients requiring assisted ventilation. Mortality of 2.6 per cent (3 patients) was observed. Interpretation & conclusions: Majority of the patients with COVID-19 infection presenting to our hospital were young and asymptomatic. Fever was noted only in three-fourth of the patients and respiratory symptoms in half of them. Patients with comorbidities were more vulnerable to complications. Triaged classification of patients and protocol-based treatment resulted in good outcomes and low case fatality.

Key words Acute respiratory distress syndrome - comorbidities - COVID-19 - hypoxia - India - pandemic - pneumonia

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 115 116 INDIAN J MED RES, January & February 2021

The World Health Organization (WHO) reported Case definitions and classification: A standard protocol more than 43 million confirmed cases of SARS-CoV-2 which included case definitions for categorization of infection and more than one million deaths globally1, SARS-CoV-2 infection, detailed management plan, with India contributing to >600,000 confirmed patients baseline and follow up investigations and treatment and >100,000 deaths until October 29, 20202. The first according to clinical severity was devised by a group patient in India was reported from Kerala3, and gradually of experts from various specialities of the PGIMER. COVID-19 has engulfed the entire country. Patients with This consensus treatment algorithm was developed SARS-CoV-2 infection may have mild-to-asymptomatic after reviewing the guidelines of various international illness, but some rapidly progress to acute respiratory societies and revised national clinical management distress syndrome (ARDS), multi-organ dysfunction guidelines for COVID-19 by the MoHFW, Government 11 syndrome (MODS) and death4. of India, dated March 31, 2020 . Symptomatic patients were categorized to have mild, moderate or severe It is pertinent to identify the clinical and disease. Patients with uncomplicated upper respiratory demographic characteristics of patients considering tract infection or non-specific symptoms such as fever, the novelty and substantial heterogeneity of the illness cough, sore throat, nasal congestion, malaise and across the world, particularly in countries like China headache were classified to have mild disease. Patients and India5-9. This study describes the demographic with radiologically proven pneumonia but without characteristics, comorbid conditions, baseline the signs of severe pneumonia were categorized as laboratory findings, clinical course and outcomes moderate disease. Severe pneumonia included a patient among COVID-19 patients admitted at a dedicated with fever, plus one of the following: respiratory rate

COVID hospital in north India. >30 breaths/min, severe respiratory distress and SpO2 <90% on room air. Standard criteria for defining, Material & Methods ARDS and MODS were used12,13. Critically ill patients Study population and settings: The study was included those who had severe pneumonia, shock and conducted at the Nehru Hospital Extension Block, organ dysfunction syndrome at admission or during a dedicated COVID hospital at the Postgraduate hospital stay. Institute of Medical Education & Research (PGIMER), Chandigarh, India, from April 1 to May 25, 2020. All stable patients irrespective of symptoms were Individuals with influenza-like illness who fulfilled treated in isolation rooms, while those with critical the ICMR screening criteria (dated May 18, 2020)10 illness were admitted in the intensive care unit (ICU). and asymptomatic close contacts of COVID-19- Standard organ-specific supportive care was provided positive patients were screened10. Consecutive adult when clinically indicated. patients (>12 yr) who tested positive on real-time Specimen collection, laboratory test and discharge reverse transcriptase polymerase chain reaction policy: Throat and/or nasopharyngeal specimens (RT-PCR) assay for SARS-CoV-2 on a throat and/or were obtained using standard techniques. The a nasopharyngeal swab were admitted and included nasopharyngeal samples were tested using the in the study. Pregnant women and children were National Institute of Virology (NIV), Pune-developed excluded. The study was approved by the Institutional kits as per the ICMR recommendations14. The kit was Ethics Committee. a two-step kit wherein the E gene was used for the screening test. All those specimens came out to be Data collection: A written informed consent was taken positive by screening test were confirmed by a second in person from patients by the treating team while a reaction targeting the ORF and RdRP genes as per the telephonic consent was obtained from the quarantined NIV protocol15. The ICMR guidelines were followed immediate family members in case the patient was to discharge the patients from the hospital16,17. Initially, unable to consent himself/herself. Demographic till May 8, 2020, all the admitted patients were details, medical history including comorbidities, discharged only after two consecutive nasopharyngeal history of exposure to COVID-19 and vital parameters swabs (done after 14th day of stay) tested negative were recorded at admission to the hospital. Baseline on RT-PCR. After May 8, 2020, with a change in the laboratory parameters, treatment details and clinical national guidelines, asymptomatic and mild patients outcomes were also collected. were discharged after 10 days of symptom onset SONI et al: CLINICAL PROFILE OF COVID-19 PATIENTS 117 and being afebrile for three consecutive days. The Table I. Baseline characteristics and clinical outcomes of discharge guidelines for severe pneumonia were also COVID‑19 patients (n=114) revised and mandated oxygen-free period of three Parameters Values days and a negative RT-PCR result as against the two Age (yr) samples previously16,17. Mean±SD 35.9±14.7 Statistical analysis: Statistical analysis was carried Range 13‑79 out using Statistical Package for the Social Sciences Median 33.5 (SPSS Inc., Chicago, IL, USA, version 23.0 for IQR (%) 24.2‑46.7 Windows) and Microsoft Excel 2016. All quantitative 12‑45 85 (74.5) data such as age, weight, haemodynamic parameters and laboratory values were estimated using measures 45‑59 20 (17.5) of central location (mean). Qualitative or categorical >60 9 (7.8) variables were described as proportions. Normality Gender (%) of quantitative data was checked by Kolmogorov- Male 66 (57.8) Smirnov tests of normality. For normally distributed Female 48 (42.1) data, means were compared using independent t test. Comorbidities** (%) Mann-Whitney U-test was applied for statistical None 80 (70.1) analysis of skewed continuous variables and ordered Cardiovascular (IHD) 2 (1.7) categorical variables. Univariate and multivariate logistic regression analyses were performed to HTN 19 (16.6) analyse the effect of comorbidities (age >60 yr, COPD 2 (1.7) diabetes mellitus and hypertension) on the severity of Diabetes mellitus 17 (14.9) COVID-19. Mortality as an outcome measure could Thyroid 6 (5.2) not be used as its number was low. CKD 3 (2.6) CLD 1 (0.8) Results Obesity 1 (0.8) Demographics and baseline clinical characteristics: CVA 1 (0.8) During the study period, 114 patients were diagnosed Multiple comorbidity# 10 (8.7) to have COVID-19 and were included in the study. The Temperature >38°C, n (%) 37 (77.1) baseline demographic and clinical characteristics of Per cent oxygen saturation room air, n (%) these patients are summarized in Table I. The median <94 19 (16.6) age of the patients was found to be 33.5 yr (IQR: 24.2-46.7, range: 13-79 yr) and 66 (57.8%) were male. >94 95 (83.3) Of the total patients, 66 (57.8 %) were asymptomatic Respiratory rate (breaths/min), n (%) and 48 (42.1%) were symptomatic at admission. Two <24 78 (68.42) patients developed symptoms during hospitalization. >24 36 (31.6) Among the symptomatic patients (n=50), mild, HR, n (%) moderate and severe illness was seen in 22, 10 and <100/min 96 (84.2) 18 patients, respectively. The common presenting >100/min 18 (15.8) complaints were fever in 37 (77.1%) followed by cough Blood pressure, n (%) in 26 (54.2%) patients. Twenty eight patients (58.3%) were noted to have multiple (more >2) symptoms. SBP <90 and DBP <60 mmHg 2 (1.8) At triage, 19 (16.6%) patients were hypoxic with Admission to the ICU 18 (15.7) Treatment (%) oxygen saturation (SpO2) <94 per cent on room air, 36 (31.6%) patients had tachypnoea while two patients Oxygen supplementation (1.7%) had hypotension (systolic arterial pressure Non‑rebreathing mask 19 (16.6) <60 mmHg). Two patients (1.7%) required non- Mechanical ventilation invasive ventilation, while three (2.6%) were Non‑invasive 2 (1.7) mechanically ventilated. Renal replacement therapy Invasive 3 ( (2.7) was instituted in four (3.5%) patients. Three of these had an underlying chronic kidney disease and were Contd... 118 INDIAN J MED RES, January & February 2021

Parameters Values (CRP), while 14 (16%) had a serum ferritin level Dialysis (renal replacement therapy) 4 (3.5) above the normal range. Determination of cardiac injury was assessed with troponin T (Trop T) levels in Specific drugs 51 patients, but only five (9.8%) patients had the values Antibiotic treatment 9 (7.9) above the normal range. Similarly, of the 54 patients Antifungal treatment 2 (1.8) tested, eight (14.8%) had values of pro-BNP higher Anti‑tubercular 2 (1.8) than the normal range at admission (Table II). Immuvac (Sepsivac) 20 (17.5) Tocilizumab (IL‑6 inhibitor) 2 (1.8) Clinical characteristics of patients with comorbid HCQ 37 (32.5) illness: Thirty four (29.8%) patients had associated Anticoagulation comorbid condition of varying severity. These included hypertension in 19 (16.6%), diabetes in 17 (14.9%) Prophylactic (enoxaparin) 17 (14.9) and chronic renal disease in three (2.6%) patients. Ten Therapeutic (enoxaparin) 11 (9.6) patients (8.7%) had multiple comorbidities (Table I). Clinical outcome (%) Significantly higher levels of inflammatory biomarkers Undergoing treatment 3 (2.6) at admission [CRP, ferritin and lactate dehydrogenase Discharge* 108 (94.7) (LDH)] among patients with an underlying comorbidity as Mortality 3 (2.6) compared to those without a comorbidity (P<0.05) were Data expressed in number (n), and percentage (%); #Multiple observed. In addition, these patients also demonstrated comorbidity: >1 comorbidity; *Discharge as per the ICMR significantly higher levels of high D-Dimers as well guidelines15,16; **Comorbidities listed here are defined as as cardiac biomarkers (Trop T, pro-BNP) (P=0.05) medical diagnoses, included in medical history by ICD‑10 (Table III). On univariate analysis, age >60 yr and coding. SD, standard deviation; IQR, interquartile range; presence of hypertension and diabetes mellitus were IHD, ischaemic heart disease; HTN, hypertension; COPD, chronic obstructive pulmonary disease; CKD, chronic kidney significantly associated with severe COVID-19 but disease; CLD, chronic liver disease; CVA, cerebrovascular failed to achieve significance on multivariate analysis accident; HCQ, hydroxychloroquine; ICMR, Indian Council (Table IV). This could be attributed to the small sample of Medical Research; ICD, International Classification of size, which was evident from the wide confidence Diseases; IL, interleukin; ICU, intensive care unit; SBP, intervals (CIs). systolic blood pressure; DBP, diastolic blood pressure; HR, heart rate Comparison of clinical and laboratory characteristics of asymptomatic and symptomatic patients: on maintenance dialysis regimen before the current Asymptomatic patients were younger with a mean illness, whereas one patient developed new-onset age of 29.90±12.91 yr while the mean age of acute kidney injury (Kidney Disease Improving patients with severe COVID-19 was 55.9±12.91 yr Global Outcomes stage 3). (Table V). Comorbidities including hypertension and diabetes were observed more frequently in patients Baseline laboratory characteristics of patients: At who were symptomatic as compared to those who admission, leucocyte counts had increased in 17 patients were asymptomatic (14/50 vs. 5/59). Inflammatory parameters (LDH, CRP and serum ferritin) were (15%) and were below the normal range in five (4.5%) significantly increased in the symptomatic group patients. Twenty one (19%) patients had lymphocyte compared to asymptomatic group. Maximal increase count below the normal range. High neutrophil- in the above inflammatory parameters was observed in to-lymphocyte ratio (NLR) (≥3.5) was observed patients with severe SARS-CoV-2 infection. in 41 (37%) patients. Fourteen (13%) patients had thrombocytopaenia (<0.15 million), and 38 (34%) had Clinical characteristics of critically ill patients: anaemia (haemoglobin <12 g/dl) at baseline A variable Eighteen (15.7%) patients were critically ill at degree of liver dysfunction with an increase in aspartate admission and required intensive care services. Elderly aminotransferase (25%)/alanine aminotransferase patients (age >60 yr), presence of comorbidities such (32%)/alkaline phosphatase (29%) was observed. Nine as hypertension and diabetes, increased serum levels (12%) patients had high serum procalcitonin. Thirty of inflammatory biomarkers (CRP, ferritin and LDH) seven (41%) patients had high C-reactive protein and renal dysfunction/high creatinine at admission SONI et al: CLINICAL PROFILE OF COVID-19 PATIENTS 119

Table II. Baseline laboratory parameters of COVID‑19 patients Parameter Median (IQR) n Normal range Haemoglobin (g/dl), median (IQR) 12.7 (11.6‑13.9) 110 11‑16 Decreased (<12 g/dl) 38 (34) WBC count (×109/l) 7.6 (6.2‑9.6) 110 4000‑11000 Increased, n (%) 17 (15) Decreased, n (%) 5 (4.5) DLC 110 Neutrophils (%) 58 (48‑70) Lymphocytes (%) 30 (21‑35.5) Lymphocyte count 1500 (1000‑2500) 110 1100‑3200 Increased, n (%) 4 (4) Decreased, n (%) 21 (19) NLR 2.35 (1.48‑5.7) 110 <3.5 Increased, n (%) 41 (37) Platelets (×109/l) 305 (224‑486) 110 150‑450 Increased, n (%) 33 (30) Decreased, n (%) 14 (13) APTT (s) 30.9 (27‑34) 95 <35 Increased, n (%) 18 (18) PT (s) 14.3 (13.5‑15.2) 95 <15 Increased, n (%) 25 (26) D‑Dimer# (normal standardized value) 0.94 (0.5‑1.9) 88 <1 Increased, n (%) 36 (40.9) Fibrinogen (g/l) 3.53 (2.9‑4.5) 79 <4 Increased, n (%) 28 (35) Serum sodium (mEq/l) 141 (139‑142) 95 135‑145 Increased, n (%) 2 (2) Decreased, n (%) 8 (8) Serum potassium (mEq/l) 4.3 (4.1‑4.6) 91 3.5‑5.5 Increased, n (%) 5 (5) Decreased, n (%) 3 (3) Chloride (mEq/l) 100 (98‑103) 50 95‑105 Decreased, n (%) 4 (8) Total protein (g/dl) 7.6 (7.1‑7.8) 95 >6.5 Decreased, n (%) 5 (5) Albumin (g/dl) 4.4 (4‑4.6) 93 >3.5 Decreased, n (%) 8 (8.6) AST (U/l) 27.7 (20‑40.2) 92 <40 Increased, n (%) 23 (25) ALT (U/l) 29 (18‑49.2) 92 <40 Increased, n (%) 30 (32) ALP (U/l) 102 (82‑125) 92 <120 Increased, n (%) 27 (29) Contd... 120 INDIAN J MED RES, January & February 2021

Parameter Median (IQR) n Normal range Total bilirubin (mg/dl) 0.5 (0.4‑0.7) 94 <1.1 Increased, n (%) 4 (4.2) LDH (U/l) 223.5 (192.5‑266.5) 58 <333 Increased, n (%) 4 (6.8) Urea (mg/dl) 24.4 (20‑28.7) 95 <50 Increased, n (%) 5 (5.2) Serum creatinine (mg/dl) 0.7 (0.6‑0.9) 95 <1.2 Increased, n (%) 4 (4.2) Lipid profile ‑ TG (mg/dl) 112.5 (82.2‑155.7) 58 <150 Increased, n (%) 16 (27) Procalcitonin (ng/ml) 0.03 (0.0‑0.1) 70 <0.15 Increased, n (%) 9 (12) CRP (mg/dl) 2.1 (0.8‑5.4) 90 <3 Increased, n (%) 37 (41) Serum ferritin (ng/ml) 90 (40.5‑200.5) 83 30‑300 Increased, n (%) 14 (16) Decreased, n (%) 16 (19) Pro‑BNP (pg/ml) 11.4 (5‑38.7) 54 <125 Increased, n (%) 8 (14.8) Trop T (pg/ml) 6.1 (5.4‑8.2) 51 <100 Increased, n (%) 5 (9.8) CK‑MB (U/l) 44.9 (38.0‑100.3) 6 <25 Increased, n (%) 6 (5.26)

HBA1c (%) 6.4 (5.5‑8.4) 15 Increased, n (%) 7 (46.6) #Normalized D‑Dimer value (1 indicate 240 ng/ml); Data expressed as median and IQR. DLC, differentiate leucocyte count; NLR, neutrophil-lymphocyte ratio; PT, prothrombin time; APTT, activated partial thromboplastin time; CRP, C‑reactive protein; AST, aspartate aminotransferase; ALT, alanine aminotransferase; ALP, alkaline phosphatase; LDH, lactate dehydrogenase;

TG, triglyceride; Pro‑BNP, pro‑brain natriuretic peptide; Trop T, troponin T; CK‑MB, creatinine kinase‑MB; HbA1c, haemoglobin A1c; IQR, interquartile range; WBC, white blood count were significantly higher among critically ill patients. Discussion (P<0.05) (Table VI). High D-dimers and fibrinogen SARS-CoV-2 is one of the most virulent levels were also observed among these patients. pathogens causing severe acute respiratory illness Treatment and clinical outcome: Fifty nine (51.75%) along with MERS and swine flu in humans. Initial patients were given specific therapies for COVID-19. Thirty case studies from China demonstrated COVID-19 to seven patients (32.4%) received hydroxychloroquine be a respiratory illness with a spectrum ranging from (HCQ), 20 (17.54%) received a study drug Immuvac mild illness (81%), severe respiratory distress (14%) (Sepsivac-Mw vaccine)18 and two patients (1.75%) and critical illness in five per cent with a case fatality 5 received tocilizumab (interleukin-6 inhibitor). By the end rate of around 2.4 per cent . Considerable disparities in of May 25, 108 (94.7%) patients were discharged, three demographic and clinical patterns have been observed were still undergoing treatment and three (2.6%) patients between countries across different continents. This had died. All the three patients who succumbed to the prospective study demonstrated the clinical profile and illness had diabetes mellitus, while two patients also had outcomes of initial COVID-19 patients from northern chronic kidney disease. India. These patients were well categorized according SONI et al: CLINICAL PROFILE OF COVID-19 PATIENTS 121

Table III. Clinical characteristics based on the burden of comorbid illness Parameter Without comorbidities (n=80) With comorbidities (n=34) P Median Range Median Range Age (yr) (%) 30 13‑59 50 22‑29 12‑44τ 71 (88.7) 14 (41.1) 45‑59τ 9 (11.25) 11 (32.3) >60τ 0 9 (26.4) Gender (%) Maleτ 50 (62.5) 16 (47) Femaleτ 30 (37.5) 18 (52.9) RR (/min) 20 16‑24 20 16‑26

SpO2 (%), room air 98 93‑100 97 90‑100 Temperature (°C) 37 36.7‑38.4 37 37‑39 SBP (mmHg) 120 100‑160 129 88‑206 DBP (mmHg) 80 64‑104 78 60‑100 NLR 1.9 0.6‑22.5 2.3 0.7‑47.5 Fibrinogen (g/l) 3.3 1.5‑8.0 4.5 1.2‑7.9 Ferritin (ng/ml) 86 8.1‑1522 138.5 11.3‑2000 0.047 CRP (mg/dl) 1.3 0.1‑162 5.0 0.1‑252 <0.001 Normalized D‑Dimer# 0.7 0.0‑83 1.0 0.1‑25 0.021 LDH (U/l) 227 159‑359 208 150‑603 0.626 Pro‑BNP (pg/ml) 5.1 3.0‑138.5 40 4.1‑105330 0.002 Trop T (pg/ml) 5.8 3.8‑317 8.24 3.5‑49.7 0.014 Procalcitonin (ng/ml) 0.0 0.0‑0.4 0.0 0.0‑7.0 0.211 Urea (mg/dl) 24 14‑39 24.950 14‑263 0.176 Creatinine (mg/dl) 0.7 0.4‑1.2 0.7 0.2‑12 0.334 # τ Normalized D‑Dimer value (1 indicate 240 ng/ml); Expressed in number and percentage. RR, respiratory rate; SPO2, oxygen saturation; HB, haemoglobin; TLC, total leucocyte count to severity and managed using standard protocols for the hospital stay. Varied laboratory abnormalities investigations and treatment. were observed, with four each (16.7%) developing 9 Patients in our study were younger (median age lymphopaenia (<0.8×10 cells/l) and leucopenia at – 33 yr) compared to those in China (median age – admission. These observations reiterate the fact that 56 yr)19, New York (median age – 63 yr)20 or Italy asymptomatic patients need to be followed closely as (median age – 63 yr)21. Although similar age pattern some of them may progress to severe disease. Another (mean age of 40.3 yr) was observed in a study done observation was an increased incidence of severe by Gupta et al22 at another tertiary care hospital from COVID-19 disease manifestations in patients with northern India, but their sample size was limited. underlying chronic diseases (hypertension 16.6% and diabetes 14.9%). Similar findings have been reported Fifty eight per cent of the patients in our study from various studies across the world4,5,7. were asymptomatic at admission; all of them were followed closely, and only two out of 66 patients Various biomarkers have been shown to predict became subsequently symptomatic during the hospital severe COVID-19 disease. This observation is confirmed stay. We found abnormalities in laboratory parameters in a meta-analysis of 21 studies (3,377 patients) by in 25 per cent of our asymptomatic patients. In a study Henry et al24. An increased white blood count, decreased by Hu et al23 from China, five of the 24 asymptomatic lymphocyte/platelet count, high interleukin-6 and high COVID-19 patients developed symptoms during serum ferritin levels were strong discriminators for severe 122 INDIAN J MED RES, January & February 2021

Table IV. Univariate and multivariate logistic regression analyses with ‘hypoxia at admission’ and ‘critical illness’ being the outcome variables with age >60 yr and presence of hypertension and diabetes mellitus as predictor categorical variables Outcome variable Predictor variable Univariate analysis Multivariate analysis Odds ratio/95% CI P Odds ratio/95% CI P Critical illness at Age >60 yr 13.07 (2.55‑66.84) 0.002 3.82 (0.53‑27.13) 0.18 admission Hypertension 12.15 (3.44‑42.94) 0.001 4.51 (0.80‑25.35) 0.87 Diabetes 10.37 (2.91‑37.11) 0.001 3.02 (0.52‑17.3) 0.21 Hypoxia at Age >60 yr 1.12 (0.12‑10.01) 0.920 1.07 (0.94‑12.23) 0.95 admission Hypertension 1.88 (0.45‑7.82) 0.385 0.41 (0.06‑2.7) 0.36 Diabetes 1.23 (0.242‑6.26) 0.803 1.47 (0.17‑12.51) 0.72

Table V. Clinical laboratory parameters of symptomatic and asymptomatic COVID‑19 patients Variable Asymptomatic Symptomatic (n=50) P* (n=64) Mild (n=22) Moderate (n=10) Severe (n=18) Sex (male/female) 38/26 11/9 6/4 11/9 0.60a Age (yr), mean±SD 29.90±12.91 32.33±13.69 37.08±14.12 55.9±12.37 <0.01b Age, (>60 yr) 1 1 1 6 <0.01a Hypertension (absent/present) 59/5 20/2 6/4 10/8 <0.01a Diabetes (absent/present) 60/4 19/3 7/3 11/7 <0.01a NLR, median (IQR) 1.90 (1.15) 1.79 (1.08) 1.43 (0.92) 5.57 (25.5) <0.01c CRP (mg/dl), median (IQR) 1.02 (2.07) 1.97 (4.62) 3.6 (28.23) 34.6 (167.40) <0.01c Serum ferritin (ng/ml), median (IQR) 56.6 (100.60) 63.10 (153.83) 113.55 (342.98) 425.0 (381) <0.01c D Dimer# (normal standardized value <1) 0.70 (0.83) NA NA 2.8 ‑ LDH (U/l) (<333) 205 (80.5) 225 (50) 214 (117.5) 374 (304.5) 0.06c #Normalized D‑Dimer value (1 indicates 240 ng/ml); aFisher’s‑exact test; bOne‑way ANOVA, cKruskal‑Wallis test disease24. We also observed nearly same results with high was despite 35 per cent of patients having increased baseline levels of CRP, ferritin and LDH and an NLR D dimer levels at admission. As per our institutional ratio of ≥3.5 along with hypoalbuminaemia and deranged protocol, early institution of heparin therapy based on baseline creatinine, indicating severe COVID-19-related D-dimers levels was strictly followed. This intervention illness. might have made a difference in preventing any thrombotic episodes in any of our patients. Tang et al27 The frequency of COVID-19-related myocardial also observed beneficial effects of early initiation of injury among hospitalized patients varied from 7 to 28 low molecular weight heparin among the 449 severe per cent25. At admission, 9.8 per cent of our patients COVID-19 patients with markedly elevated D-dimers had an elevated Trop T level, while pro-BNP was with a significantly improved 28 day overall survival higher than the normal range in 14.8 per cent of the (P=0.017 and P=0.029, respectively) among the users patients. Two of our patients had acute myocardial versus non-users. insults during the hospital stay. COVID-19 is considered a hypercoagulable state, leading to venous Two severely hypoxaemic patients with exuberant thromboembolism in patients with severe disease26. inflammatory response received tocilizumab. This Routine radiological screening for venous thrombosis was followed by a significant improvement in their was not performed. A compression ultrasound was done P/F ratio, radiological features and reduction in the only if peripheral venous thrombosis was clinically inflammatory biomarkers in each of these two patients. suspected (n=3), however, none of these patients had This drug has shown promise if given early in the any evidence of venous thrombosis at imaging. This course of the disease. Sciascia et al28 used tocilizumab SONI et al: CLINICAL PROFILE OF COVID-19 PATIENTS 123

Table VI. Difference in baseline clinical characteristics between critically ill and clinically stable patients Parameter Critically ill patients (n=18) Clinically stable patients (n=96) P Median Range Median Range Age (%) 55.9 29‑79 31 13‑65 12‑44τ 5 (27.7) 80 (83.3) 45‑59τ 7 (38.8) 13 (13.5) >60τ 6 (33.3) 3 (3.1) Gender (%) Maleτ 11 (61.1) 55 (57.2) Femaleτ 7 (38.8) 41 (42.7) Hypertension (%) 8/18 (44.4) 11/96 (11.45) <0.001 Diabetes (%) 7/18 (38.8) 10/96 (10.4) <0.001 RR (/min) 22 16‑26 20 16‑24

SpO2 (%) room air 96 79‑97 98 94‑100 Temperature (°C) 37 37‑39 37 36.7‑39 SBP (mmHg) 129 88‑160 120 100‑206 DBP (mmHg) 79 60‑100 80 64‑104 Hb (g/dl) 12.4 5.8‑16 13 8‑17.8 TLC (×106/l) 7300 4000‑19,800 6650 3100‑15,400 Neutrophil (%) 78 53‑96 56 31‑80 Lymphocyte (%) 14 2‑29 30 9‑60 Absolute lymphocyte count (×106/l) 936 256‑2128 1883 816‑7200 Increased (%) 0 7 (7.3) Decreased (%) 9 (50) 6 (6) Platelets (×106/l) 180 54‑518 163 68‑690 Increased (%) 1 (5.5) 3 (3.1) Decreased (%) 3 (16.6) 35 (36) NLR 5.5 1.8‑47.5 1.8 0.6‑8.8 Fibrinogen (g/l) 4.6 1.2‑8.0 3.5 1.5‑116 Increased (%) 8 (44.4) 20 (21) Ferritin (ng/ml) 425 81‑2000 75.25 8.1‑1522 Increased (%) 8 (44.4) 6 (7) CRP (mg/dl) 34.6 3.7‑252 1.6 0.1‑162 <0.001 Normalized D-Dimer# 2.8 0.1‑25 0.8 0.02‑83 LDH (U/l) 374 265‑603 216 150‑359 0.004 Total protein (g/dl) 7.10 5.3‑7.9 7.600 5.4‑6.9 0.16 Albumin (g/dl) 3.500 2.7‑4.3 4.500 2.8‑5.3 <0.001 Pro‑BNP (pg/ml) 2881 11.2‑105330 8.5 3‑734 0.02 Trop T (pg/ml) 579 145‑4975 6.00 3.5‑317 <0.001 Procalcitonin (ng/ml) 0.09 0.02‑7.0 0.02 0.2‑0.8 <0.001 Urea (mg/dl) 36 16‑263 24 14‑39 Serum creatinine (mg/dl) 1.2 0.5‑12 0.7 0.2‑1.2 0.001 #Normalized D‑Dimer value (1 indicates 240 ng/ml); τExpressed in number and percentage 124 INDIAN J MED RES, January & February 2021 in 63 patients with severe COVID-19. They observed Conflicts of Interest: None. significant improvement in the levels of ferritin, CRP,

D-dimer, and serial PaO2/FiO2 after tocilizumab use. References They also observed that tocilizumab, when given 1. World Health Organization. WHO Coronavirus Disease within six days of admission, was associated with an (COVID-19) Dashboard. Available from: https://covid19. increased likelihood of survival [hazard ratio (HR): who.int/, accessed on October 29, 2020. 2.2 95% CI: 1.3-6.7, P<0.05)28. Steroids, especially 2. Ministry of Health and Family Welfare, Government of dexamethasone, are now a mainstay in the treatment India. Available from: https://www.mohfw.gov.in, accessed on of COVID-19 management after the results of the October 29, 2020. RECOVERY trial have been published29. Better 3. Andrews MA, Areekal B, Rajesh KR, Krishnan J, Suryakala R, Krishnan B, et al. First confirmed case of outcomes as compared to usual care were observed COVID-19 infection in India: A case report. Indian J Med when dexamethasone was initiated in those patients Res 2020; 151 : 490-2. requiring invasive mechanical ventilation (29.3 vs. 4. Huang C, Wang Y, Li X, Ren L, Zhao J, Hu Y, et al. Clinical 41.4%) and among those receiving oxygen without features of patients infected with 2019 novel coronavirus in invasive mechanical ventilation (23.3 vs. 26.2%). No Wuhan, China. Lancet 2020; 395 : 497-506. benefit was observed in the use of steroids in patients 5. Wu Z, McGoogan JM. Characteristics of and important with COVID-19 infection who were not hypoxic at lessons from the coronavirus disease 2019 (COVID-19) admission29. We did not routinely use corticosteroids outbreak in China: Summary of a report of 72 314 cases from the Chinese Center for Disease Control and Prevention. in critically ill patients as part of our treatment JAMA 2020; 323 : 1239-42. protocol. 6. Guan WJ, Ni ZY, Hu Y, Liang WH, Ou CQ, He JX, et al. The case fatality rate in our study was 2.6 per cent. Clinical characteristics of coronavirus disease 2019 in China. All the three patients had diabetes mellitus, whereas N Engl J Med 2020; 382 : 1708-20. two patients also had chronic kidney disease and were 7. Liang WH, Guan WJ, Li CC, Li YM, Liang HR, Zhao Y, et al. Clinical characteristics and outcomes of hospitalized patients on maintenance haemodialysis. They had missed with COVID-19 treated in Hubei (epicentre) and outside multiple dialysis sessions before being admitted at the Hubei (non-epicentre): A nationwide analysis of China. Eur hospital with COVID-19. Respir J 2020; 55 : 2000562. 8. Goyal P, Choi JJ, Pinheiro LC, Schenck EJ, Chen R, Jabri A, To conclude, though symptomatic SARS-CoV-2 et al. Clinical characteristics of COVID-19 in New York city. infection was encountered in 43 per cent patients, N Engl J Med 2020; 382 : 2372-4. severe illness was seen in 15.7 per cent patients only. 9. Bhandari S, Bhargava A, Sharma S, Keshwani P, Sharma R, Fever was noted only in three-fourth of the patients Banerjee S. clinical profile of COVID-19 infected patients and respiratory symptoms in nearly half of them. admitted in a tertiary care hospital in north India. J Assoc High inflammatory parameters, NLR ratio of ≥3.5, Physicians India 2020; 68 : 13-7. hypalbuminaemia and deranged creatinine predicted 10. Indian Council of Medical Research. Strategy for COVlD-19 severe COVID-19 illness. Older patients with diabetes testing in lndia (Version 5, dated 18/05/2020). Available from: https://www.mohfw.gov.in/pdf/Revised testing guidelines.pdf, and hypertension were significantly associated with accessed on May 18, 2020. severe disease on univariate analysis. The management 11. Directorate General of Health Services (EMR Division), team consisting of physicians from different specialities Ministry of Health & Family Welfare, Government of and triaged classification of patients and protocol-based India. Revised guidelines on clinical management of management algorithms resulted in good outcomes and COVID-19. Available from: https://www.mohfw.gov. in/ low case fatality. pdf/RevisedNational Clinical Management Guideline for COVID1931032020.pdf, accessed on March 31, 2020. Acknowledgment: Authors acknowledge the COVID-19 12. ARDS Definition Task Force, Ranieri VM, Rubenfeld GD, Management Team consisting of faculty from the departments Thompson BT, Ferguson ND, Caldwell E, et al. Acute respiratory of Anaesthesia & Intensive Care, Internal Medicine, Pulmonary distress syndrome: The Berlin definition. JAMA 2012; 307 : Medicine, Microbiology, Virology, Biochemistry, Haematology, 2526-33. Radiodiagnosis, Paediatrics and Hospital Administration who 13. Marshall JC, Cook DJ, Christou NV, Bernard GR, Sprung CL, helped in setting up of a dedicated facility for COVID-19-positive Sibbald WJ. Multiple organ dysfunction score: A reliable patients, and their management protocol. Authors thank all patients descriptor of a complex clinical outcome. Crit Care Med who gave their consent for participation in this study. 1995; 23 : 1638-52. 14. Choudhary ML, Vipat V, Jadhav S, Basu A, Cherian S, Financial support & sponsorship: None. Abraham P, et al. Development of in vitro transcribed RNA SONI et al: CLINICAL PROFILE OF COVID-19 PATIENTS 125

as positive control for laboratory diagnosis of SARS-CoV-2 in 22. Gupta N, Agrawal S, Ish P, Mishra S, Gaind R, India. Indian J Med Res 2020; 151 : 251-4. Usha G, et al. Clinical and epidemiologic profile of the initial 15. ICMR-National Institute of Virology (ICMR-NIV), Pune. COVID-19 patients at a tertiary care centre in India. Monaldi Standard Operating Procedure For Detection of 2019 novel Arch Chest Dis 2020; 90 : 193-6 coronavirus (2019-nCoV) in suspected human cases by rRT- 23. Hu Z, Song C, Xu C, Jin G, Chen Y, Xu X, et al. Clinical PCR: First Line Screening assay. Document No.: SP.01. characteristics of 24 asymptomatic infections with COVID-19 16. Discharge Policy of nCoV Case. Available from: https://www. screened among close contacts in Nanjing, China. Sci China mohfw.gov.in/pdf/Corona%20Discharge-Policy.pdf, accessed Life Sci 2020; 63 : 706-11. on March 17, 2020. 24. Henry BM, de Oliveira MHS, Benoit S, Plebani M, 17. Directorate General of Health Services (EMR Division), Lippi G. Hematologic, biochemical and immune biomarker Ministry of Health & Family Welfare, Government of India. abnormalities associated with severe illness and mortality in Guidance document on appropriate management of suspect/ coronavirus disease 2019 (COVID-19): A meta-analysis. Clin confirmed cases of COVID-19. Available from: https://www. Chem Lab Med 2020; 58 : 1021-8. mohfw.gov.in/pdf/FinalGuidanceon Mangaement of Covid 25. Shi S, Qin M, Shen B, Cai Y, Liu T, Yang F, et al. Association casesversion2.pdf, accessed on May 8, 2020. of cardiac injury with mortality in hospitalized patients with 18. Sehgal IS, Bhalla A, Puri GD, Yaddanapudi LN, COVID-19 in Wuhan, China. JAMA Cardiol 2020; 5 : 802-10. Singh M, Malhotra P, et al. Safety of an immunomodulator 26. Klok FA, Kruip M, van der Meer NJ, Arbous MS, Gommers D, Mycobacterium w in COVID-19. Lung India Kant KM, et al. Incidence of thrombotic complications in 2020; 37 : 279-81. critically ill ICU patients with COVID-19. Thromb Res 2020; 19. Zhou F, Yu T, Du R, Fan G, Liu Y, Liu Z, et al. Clinical 191 : 145-7. course and risk factors for mortality of adult inpatients with COVID-19 in Wuhan, China: A retrospective cohort study. 27. Tang N, Bai H, Chen X, Gong J, Li D, Sun Z. Anticoagulant Lancet 2020; 395 : 1054-62. treatment is associated with decreased mortality in severe coronavirus disease 2019 patients with coagulopathy. 20. Richardson S, Hirsch JS, Narasimhan M, Crawford JM, J Thromb Haemost 2020; 18 : 1094-9. McGinn T, Davidson KW, et al. Presenting characteristics, comorbidities, and outcomes among 5700 patients hospitalized 28. Sciascia S, Aprà F, Baffa A, Baldovino S, Boaro D, Boero with COVID-19 in the New York city area. JAMA 2020; R, et al. Pilot prospective open, single-arm multicentre 323 : 2052-9. study on off-label use of tocilizumab in patients with severe COVID-19. Clin Exp Rheumatol 2020; 38 : 529-32. 21. Grasselli G, Zangrillo A, Zanella A, Antonelli M, Cabrini L, Castelli A, et al. Baseline characteristics and outcomes 29. RECOVERY Collaborative Group, Horby P, Lim WS, of 1591 patients infected with SARS-CoV-2 admitted to Emberson JR, Mafham M, Bell JL, et al. Dexamethasone in ICUs of the Lombardy Region, Italy. JAMA 2020; 323 : hospitalized patients with COVID-19 - Preliminary report. 1574-81. N Engl J Med 2020. doi.10.1056/NEJMoa2021436

For correspondence: Dr Vikas Suri, Department of Internal Medicine, Postgraduate Institute of Medical Education & Research, Sector 12, Chandigarh 160 012, India e-mail: [email protected] Indian J Med Res 153, January & February 2021, pp 126-131 Quick Response Code: DOI: 10.4103/ijmr.IJMR_3305_20

Rapid chromatographic immunoassay-based evaluation of COVID-19: A cross-sectional, diagnostic test accuracy study & its implications for COVID-19 management in India

Ankesh Gupta1, Surbhi Khurana8, Rojaleen Das2, Deepankar Srigyan2, Amit Singh7, Ankit Mittal1, Parul Singh8, Manish Soneja1, Arvind Kumar1, Akhil Kant Singh3, Kapil Dev Soni9, Suneeta Meena4, Richa Aggarwal9, Neha Sharad8, Anivita Aggarwal1, Harshith Kadnur1, Netto George1, Komal Singh1, Devashish Desai1, Praveen Trilangi1, Adil Rashid Khan1, Vandana V. Kiro8, Shivdas Naik1, Bharthi Arunan1, Shivam Goel1, Diksha Patidar1, Amit Lathwal10, Lalit Dar2, Anjan Trikha3, Ravindra Mohan Pandey5, Rajesh Malhotra11, Randeep Guleria6, Purva Mathur8 & Naveet Wig1

Departments of 1Medicine, 2Microbiology, 3Anaesthesiology, Pain Medicine & Critical Care, 4Laboratory Medicine, 5Biostatistics & 6Pulmonology & Sleep Disorder, 7Centralized Core Research Facility, All India Institute of Medical Sciences, Departments of 8Laboratory Medicine, 9Critical & Intensive Care, 10Hospital Administration & 11Orthopedics, JPNA Trauma Centre, All India Institute of Medical Sciences, New Delhi, India

Received August 2, 2020

Background & objectives: Coronavirus disease 2019 (COVID-19) has so far affected over 41 million people globally. The limited supply of real-time reverse transcription-polymerase chain reaction (rRT-PCR) kits and reagents has made meeting the rising demand for increased testing incompetent, worldwide. A highly sensitive and specific antigen-based rapid diagnostic test (RDT) is the need of the hour. The objective of this study was to evaluate the performance of a rapid chromatographic immunoassay-based test (index test) compared with a clinical reference standard (rRT-PCR). Methods: A cross-sectional, single-blinded study was conducted at a tertiary care teaching hospital in north India. Paired samples were taken for RDT and rRT-PCR (reference standard) from consecutive participants screened for COVID-19 to calculate the sensitivity and specificity of the RDT. Further subgroup analysis was done based on the duration of illness and cycle threshold values. Cohen’s kappa coefficient was used to measure the level of agreement between the two tests. Results: Of the 330 participants, 77 were rRT-PCR positive for SARS-CoV-2. Sixty four of these patients also tested positive for SARS-CoV-2 by RDT. The overall sensitivity and specificity were 81.8 and 99.6 per cent, respectively. The sensitivity of RDT was higher (85.9%) in participants with a duration of illness ≤5 days. Interpretation & conclusions: With an excellent specificity and moderate sensitivity, this RDT may be used to rule in COVID-19 in patients with a duration of illness ≤5 days. Large-scale testing based on this RDT across the country would result in quick detection, isolation and treatment of COVID-19 patients.

Key words Antigen test - COVID-19 - point-of-care test - SARS-CoV-2

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 126 GUPTA et al: EVALUATION OF COVID-19 RAPID ANTIGEN TEST IN INDIA 127

In December 2019, a new coronavirus disease in north India, following STARD 2015 guidelines for emerged in Wuhan, China, and rapidly spread reporting diagnostic accuracy studies6 to evaluate the throughout the world. Now formally called coronavirus performance of a rapid chromatographic immunoassay- disease 2019 (COVID-19), the causative virus has based test (index test) compared with a clinical been named severe acute respiratory syndrome reference standard (rRT-PCR). coronavirus 2 (SARS-CoV-2)1. For diagnosis, the Patient recruitment and clinical specimens: Patients SARS-CoV-2 genomic RNA is detected from upper eligible for inclusion were consecutive adults (>18 yr) and lower respiratory specimens2. The growing with suspected COVID-19 infection, based on the COVID-19 pandemic has led to a global crisis and Indian Council of Medical Research (ICMR) strategy crunch of laboratory-based molecular testing capacity for COVID-19 testing7. The following two types of and reagents3. This is especially true for developing patients were included: (i) patients symptomatic for countries, with a scarcity of health-resources. India COVID-19; and (ii) asymptomatic/pre-symptomatic currently has over 7.7 million cases of confirmed contacts of laboratory-confirmed cases between 5 and COVID-19 and the disease is rapidly spreading to 10 days of exposure. smaller towns and villages4. The real-time reverse transcription-polymerase chain reaction (rRT-PCR) The study was conducted at the ‘COVID-19 received emergency use authorization (EUA) by the screening and testing outpatient department (OPD)’ Centers for Disease Control and Prevention (CDC) for at the 3000-bedded All India Institute of Medical the qualitative detection of SARS-CoV-2 nucleic acid 5 Sciences (AIIMS), New Delhi, India, between from the respiratory specimens . The rRT-PCR testing May 31, 2020 and July 24, 2020. Almost 50 per cent requires a sophisticated Biosafety level (BSL)-2/BSL- beds have been allocated to COVID-19 care in the 3 laboratory setup and trained technicians to run the test face of an increasing number of cases. All patients and interpret results. The rRT-PCR takes a minimum were evaluated in a consecutive manner at the of 8-10 h from the collection of swab to reporting of Medicine out-patients department (OPD). Nasal and results, which can further increase in resource-limited throat swabs were collected for rRT-PCR using nylon and high-burden settings. In small towns and cities, flocked swabs, and both the swabs were placed molecular diagnostic laboratories are non-existent together in a 2 ml VTM tube for rRT-PCR; parallelly, and the reagents/viral transport medium (VTM) and NP samples were collected for the rapid diagnostic test resources are difficult to procure. Therefore, the need (RDT). The rapid chromatographic immunoassay test of the hour is to rapidly detect and isolate positive was performed immediately in all the patients as per cases to contain the disease spread, to quickly triage the manufacturer’s instructions. A parallel sampling patients with severe acute respiratory illness (SARI) was done for rRT-PCR, and the sequence for specimen in emergency departments (EDs) and to ramp up collection was random for both the samples. The testing facilities. Many diagnostic test manufacturers samples for rRT-PCR were kept in an icebox at 4°C are developing/have developed rapid diagnostic kits the laboratory. All suspected patients were advised to and devices to facilitate point-of-care testing. These self-isolate themselves till the reporting of rRT-PCR sample kits are based on either antibody detection from results. Because rRT-PCR has the highest sensitivity blood/plasma/serum or the detection of SARS-CoV-2 for detection of SARS-CoV-2-specific gene targets, antigens from respiratory samples. with the limit of detection (LOD) being as low as However, there is very limited data on the 0.91-3.1 copies/ml for different gene targets, it is performance and potential diagnostic utility of a considered a reference standard8. rapid chromatographic immunoassay-based test for The study was approved by the AIIMS Ethics SARS-CoV-2 in suspected patients. Here, we report the Committee (IEC/537/5/2020) and informed consent evaluation of a rapid chromatographic immunoassay- was obtained from each patient. based test for the qualitative detection of a specific antigen to SARS-CoV-2 in the nasopharyngeal (NP) rRT-PCR: This reference test was done on nasal and swab for diagnosis of COVID-19 in India. throat swabs collected in VTM and transported at 4-8°C as per the guidelines of the ICMR9. Total nucleic acid Material & Methods was extracted from the samples, using the MagMAX A single-blinded, cross-sectional, single-centre Viral Isolation Kit (Thermo Fisher Scientific, USA). study was conducted in a tertiary care, referral hospital A commercial rRT-PCR kit (BGI Genomics Co. Ltd., 128 INDIAN J MED RES, January & February 2021

China, which has EUA from the US FDA and approval overall and various levels of pre-test probabilities (i.e. from the ICMR), was used to detect the SARS-CoV-2 duration of illness ≤ 5 days, >5 days and asymptomatic). ORF 1ab region of the genome, in an AriaMx real-time The rapid diagnostic test was also evaluated for PCR instrument (Agilent, USA). The test also detects the subgroups considering the viral load and days the human housekeeping gene β-actin as a control for since infection. Agreement between RDT diagnosis confirming the adequacy of the sample, RNA extraction of COVID-19 and rRT-PCR was evaluated using and rRT-PCR. The result was interpreted as positive or Cohen’s kappa calculation (κ < 0.40, poor agreement; negative as per the manufacturer’s instructions. The 0.40 ≤ κ < 0.60, moderate agreement; 0.60≤ κ <0.80, LOD of the kit was 100 copies/ml. good agreement and κ ≥ 0.80, excellent agreement). For each of the summary measures, a 95 per cent Rapid antigen detection test: The Standard Q rapid confidence interval (CI) was also computed. Stata 14.0 antigen detection test (SD Biosensor, Inc., Gurugram) statistical software (StataCorp LLC, TX, USA) was was evaluated in this study. The test was conducted used for data analysis. on an NP swab specimen. The RDT kit consisted of a sterile swab, viral extraction tubes with buffer, tube Results nozzles and a COVID-19 antigen test device. A total of 990 swabs (one nasal and one throat swab for rRT-PCR and one NP swab for RDT) were Collection of specimens and antigen extraction: The collected from 330 participants during the study test was conducted on an NP swab, and samples were period. The median age of the study participants taken from both sides of the nasopharynx using a swab was 34.1±12.6 yr (231 males and 99 females, with provided with the kit to maximize the viral load in the a sex ratio of 0.42). According to rRT-PCR results sample. Before collecting samples, the patients were (Table I), 77 were positive for SARS-CoV-2 RNA, asked for a nose blow to remove excessive secretion. with a mean cycle threshold (Ct) value of 21.4±5.0 A sterile swab was inserted into the nasal cavity of (mean±SD, range: 10-35.4). Sixty four (83.1%) the patient at an angle of 90° in a 50°-70° extended participants who tested positive in rRT-PCR, neck position to swab the surface of the posterior presented with symptoms suggestive of COVID-19, nasopharynx. The swab was kept in the nasopharynx for 5-10 sec to properly absorb secretions and gently Table I. Baseline characteristics of the study participants removed while rotating it. The swab was inserted into (n=330) the tube containing the extraction buffer provided Demography with the kit and stirred into the buffer 5-6 times before Age, yr (mean±SD) 34.1±12.6 squeezing and discarded. A nozzle was placed tightly onto this extraction buffer tube. Three drops of the Sex extracted specimen were put onto the specimen well of Male 231 (70.0) the test device and was set aside. Female 99 (30.0) Ratio (female/male) 0.42 Interpretation of results: The test results were read after 15-30 minutes. The test device develops red Symptomatic 204 (61.8) bands at two positions: ‘C’ control line and ‘T’ test Asymptomatic 126 (38.1) line - SARS-CoV-2 antigen. If red bands appeared at Duration of illness (n=179) the ‘C’ and ‘T’ positions, the test was interpreted as ≤5 days 192 (58.1) positive. All red bands, including the faint ones, were >5 days 12 (3.6) taken as positive results. If the red band appeared at Clinical features only the ‘C’ position, it was interpreted as a negative Fever 104 (31.5) result. The test was considered invalid if no red band Cough 84 (25.4) appeared at the ‘C’ position and was repeated. Sore throat 78 (23.6) Statistical analysis: Data were recorded on a pre- Fatigue/malaise 39 (11.8) designed proforma. Diagnostic characteristics such Headache 11 (3.3) as sensitivity and specificity of the test with rRT-PCR Runny nose 11 (3.3) as reference were calculated. Positive and negative predictive values of the test were also computed for both Values shown as n (%) GUPTA et al: EVALUATION OF COVID-19 RAPID ANTIGEN TEST IN INDIA 129 while 15.5 per cent (13/77) of the participants were 21.1+4.8 (mean+SD, range: 10-35.4) and that of false- asymptomatic. The median duration of illness at the negative RDT samples was 25.8±5.0 (mean±SD, range: time of testing among symptomatic patients was one 15-34.1, P=0.0017). The sensitivity in participants day (range: 1-10). The most commonly presented with a duration of illness ≤ 5 days was 85.9 per cent symptoms among the screened participants were [95% CI: 74.2-93.7]. fever (31.5%) followed by cough (25.4%), fatigue/ Discussion malaise (11.8%), headache (3.3%) and runny nose (3.3%), and 57 participants presented with the In the present study, the RDT was found to have complaint of a sore throat but only two of them an acceptable sensitivity of 81.8 per cent and a high (3.5%) had COVID-19. specificity of 99.6 per cent. The analytical performance of RDT depends on the mixing of NP swab with The rapid chromatographic immunoassay based buffer and the viral load in the sample, but the clinical RDT was positive in 64 (19.3%) and negative in 266 performance of the test may be variable which depends (80.6%) participants. Overall, among the positive test on the technique of sample collection and the duration results (Table II), the rapid antigen test detected 63 true of illness of patients. Hence, the sensitivity will be positives (19.0%) and gave one false-positive result, average in asymptomatic patients because it is difficult with respect to the reference standard. Among negative to analyze the pre-test probability in asymptomatic test results, 252 (76.3%) were true negatives and 14 patients. (4.2%) were false negatives. The overall sensitivity and specificity of the test were 81.8 and 99.6 per cent, Recently, Porte et al10 reported the evaluation of respectively, and the test accuracy was 95.4 per cent. similar fluorescence immunochromatographic SARS- The disease prevalence in the tested participants was CoV-2 rapid antigen test (Bioeasy Biotechnology Co., 23.3 per cent with a kappa coefficient of 0.86 and China) using universal transport medium with NP and an agreement of 95 per cent between both the tests. oropharyngeal swabs in 127 suspected COVID-19 The likelihood ratio (LR) for positive test results was cases. The overall sensitivity and specificity were 93 207.0, and 0.18 for negative test results. The positive and 100 per cent, respectively, but a pre-print study predictive value of the test was 98.4 per cent, and the by the manufacturer of the kit reported an overall negative predictive value was 94.7 per cent. The mean sensitivity of 68 per cent and specificity of 100 per cent Ct value of truly positive RDT-positive samples was in NP swabs11.

Table II. Diagnostic characteristics of rapid diagnostic test with reference to rRT‑PCR: Overall and subgroup analysis Diagnostic Overall Subgroups characteristics Duration of illness Duration of illness Asymptomatic ≤5 days (n=191) >5 days (n=12) (n=127) TP 63 49 5 9 TN 252 134 5 113 FP 1 0 0 1 FN 14 8 2 4 Ct values (mean±SD) 21.4±5.0 (10‑35.4) 21.1±4.8 (10‑35.4) 25.1±4.8 (15.1‑30.4) 20.7±5.0 (16.9‑34.1) (minimum‑maximum) Sensitivity % (95% CI) 81.8 (71.3‑89.6) 85.9 (74.2‑93.7) 71.4 (29.0‑96.3) 69.2 (38.5‑90.9) Specificity % (95% CI) 99.6 (97.8‑99.9) 100 (97.2‑100) 100 (47.8‑100) 99.1 (95.2‑99.9) PPV % (95% CI) 98.4 (88.8‑99.7) 100 100 90.0 (55.2‑98.4) NPV % (95% CI) 94.7 (91.8‑96.6) 94.3 (89.7‑96.9) 71.4 (43.6‑89.0) 96.0 (92.5‑98.4) Accuracy % (95% CI) 95.4 (92.6‑97.4) 95.8 (91.8‑98.2) 83.3 (51.6‑97.9) 96.0 (91.0‑98.7) LR+ (95% CI) 207.0 (29.1‑1468.0) CNC CNC 78.9 (10.5‑574.3) LR− (95% CI) 0.18 (0.11‑0.29) 0.14 (0.07‑0.27) 0.28 (0.08‑0.92) 0.31 (0.14‑0.70) CI, confidence interval; Ct, cycle threshold; PPV, positive predictive value; NPP, negative predictive value; LR, likelihood ratio; CNC, could not be calculated (due to zero FP RDT result); RDT, rapid diagnostic test; TP, true positive; TN, true negative; FP, false positive; FN, false negative 130 INDIAN J MED RES, January & February 2021

The RDT in the present study showed a high positive LR of 207.0. This indicates a 207-fold increase in the odds of having infection with SARS-CoV-2 in participants with positive RDT results. Similarly, the negative LR for the RDT was 0.18, which means that the odds of having SARS-CoV-2 infection had decreased by 5.5-fold after a negative RDT result. However, to understand the utility of RDT, case-based estimation of pre-test probability is essential which depends on SARS-CoV-2 prevalence in the population, history of contact with the positive case and signs and symptoms in suspects (Fig. 1). The post- test probability calculated with the help of LR and pre- test probabilities, which turn out to be 98 per cent for a positive test and 5 per cent for a negative test result, Fig. 1. A plot of the post-test probability against the pre-test would mean that 98 per cent times SARS-CoV-2 is probability of having COVID-19. The green and orange ribbons present if the RDT is tested positive. In 5 per cent of cases, represent the 95% confidence interval around these values. The vertical line indicates the pre-test probability or prevalence of SARS-CoV-2 is present if RDT is tested negative. The COVID-19 (23.3%). Where this vertical line cuts the green and application of LR in clinical settings requires an estimate orange lines, those points give the probabilities that if the result of of pre-test probability, which is often subjective, and the the rapid diagnostic test is negative, then COVID-19 is absent, and estimation of pre-test probability must be individualized if the result is positive, the disease is present. and tailored to the suspect’s symptoms. This is not easy 30 to estimate in asymptomatic cases. Therefore, this test True positive RDT False negative RDT 3.7% may not be good for surveillance purposes. This test can 25 14.8% perform as well as RT-PCR in high-prevalence areas with high pre-test probability. Moderate sensitivity of the 20 RDT leads to false-negative results, which must be taken into consideration while making diagnostic algorithms 15 (Fig. 2). 10 The advantages of RDT such as yielding rapid 41.6% results, being at a reasonable price and being safe due to 5 20.0% viral inactivation and the fact that this does not require Number of rRT-PCR positive test results 75.0% 80.0% 96.3% 85.7% 61.5% sophisticated laboratory set-up or technical expertise 0 25.0% Ct value 10-15 15.1-20 20.1-25 25.1-30 30.1-35.4 make it an ideal test to be rolled out in high-prevalence False negative RDT 11453 community settings. Based on these findings, this True positive RDT 426248 1 test has been adopted in the diagnostic algorithms for Fig. 2. A plot comparing cycle threshold (Ct) values of true-positive Indian hospitals and an advisory has been issued by and false-negative cases and rRT-PCR-positive test results. The 12 X-axis represents Ct values and the Y-axis represents the number the ICMR in this regard . However, because negative of rRT-PCR-positive test results. The data table below the X-axis results cannot rule out SARS-CoV-2 infection, all shows true-positive and false-negative rapid diagnostic test results. negative tests should be covered by rRT-PCR. In India, and other populous developing nations This study had several limitations. First, because facing a surge of cases, the rapid nature of this test participants were recruited from a screening OPD, they has two main advantages: a positive patient can be were either asymptomatic/pre-symptomatic or mildly immediately sent to a dedicated COVID-19 centre, symptomatic. The testing was not done in moderate- which otherwise may be delayed by 2-3 days. Second, to-severe cases; therefore, it needs to be evaluated in the cramped EDs of many hospitals, while suspected in this category of COVID-19 suspects. Second, the patients are kept in a holding area until the PCR sensitivity of RDT was 81.8 per cent compared to reports arrive, there is a high likelihood of COVID- a standard reference (rRT-PCR), but the standard 19-negative SARI patients contracting COVID-19 due reference itself had limited sensitivity in the initial to cross-transmission. A rapid test may prevent that test up to 83-89 per cent compared to the initial chest eventuality. computed tomography. Thus, RDT can miss up to GUPTA et al: EVALUATION OF COVID-19 RAPID ANTIGEN TEST IN INDIA 131

25-30 per cent of COVID-19 cases13,14. Third, a positive 2. Wang W, Xu Y, Gao R, Lu R, Han K, Wu G, et al. Detection of RDT is not 100 per cent specific to SARS-CoV-2, as it SARS-CoV-2 in different types of clinical specimens. JAMA 2020; 323 : 1843-4. shows cross-reactivity with SARS-CoV based on the 3. World Health Organization. Advice on the use of point- analytical performance of the test provided by the kit of-care immunodiagnostic tests for COVID-19: Scientific manufacturer, but not evaluated further in the clinical brief, 8 April 2020. Available from: https://apps.who.int/iris/ setup15. handle/10665/331713, accessed on October 22, 2020. 4. Government of India. India Fights Corona COVID-19. Our study had several strengths also. First, Available from: https://www.mygov.in/covid-19/, accessed on because the study was single blinded, those who July 14, 2020. collected swabs were unaware of the participant’s 5. Centers for Disease Control and Prevention. CDC 2019-novel clinical symptoms and rRT-PCR test report. Second, coronavirus (2019- nCoV) real-time RT-PCR diagnostic panel. Atlanta: CDC; 2020. the NP swabs for RDT and nasal and throat swabs for rRT-PCR were collected simultaneously and randomly 6. Cohen JF, Korevaar DA, Altman DG, Bruns DE, Gatsonis CA, Hooft L, et al. STARD 2015 guidelines for reporting diagnostic in some participants, and there was no time lag between accuracy studies: explanation and elaboration. BMJ Open the index and reference standard tests. Third, all 2016; 6 : e012799. participants underwent index and reference standard 7. Indian Council of Medical Research. Strategy for COVID-19 tests, so all positive and negative results were verified. testing in India (Version 5, dated 18/05/2020). Available Fourth, the test performance was also evaluated in from: https://www.icmr.gov.in/pdf/covid/strategy/Testing_ Strategy_v5_18052020.pdf, accessed on July 14, 2020. asymptomatic contacts. 8. Corman VM, Landt O, Kaiser M, Molenkamp R, Meijer A, In conclusion, the rapid antigen test showed an Chu DK, et al. Detection of 2019 novel coronavirus (2019- nCoV) by real-time RT-PCR. Eurosurveillance 2020; 25 : excellent specificity to ‘rule-in’ COVID-19 patients 2000045. within the first five days of illness and had a moderate 9. ICMR- National Institute of Virology, Pune. Specimen sensitivity. Therefore, patients showing positive result collection, packaging and transport guidelines for testing need to immediately triaged and those with negative 2019-Novel Coronavirus (2019-nCoV) (Version 1.0, dated tests should be reconfirmed by an rRT-PCR. 29/01/2020). Available from: https://www.mohfw.gov.in/ pdf/5Sample%20collection_packaging%20%202019-nCoV. Acknowledgment: Authors thank Drs Thomas R Fanshawe, pdf, accessed October 22, 2020. University of Oxford, Michael Power, Sara Graziadio, Newcastle 10. Porte L, Legarraga P, Vollrath V, Aguilera X, Munita JM, upon Tyne Hospitals Foundation Trust, Newcastle upon Tyne, Araos R, et al. Evaluation of a novel antigen-based rapid detection test for the diagnosis of SARS-CoV-2 in respiratory José M Ordóñez-Mena, Nuffield Department of Primary Care samples. Int J Infect Dis 2020; 99 : 328-33. Health Sciences, University of Oxford, John Simpson, Joy Allen, 11. Diao B, Wen K, Chen J, Liu Y, Yuan Z, Han C, et al. Diagnosis Newcastle University, Newcastle upon Tyne, UK, and British of Acute Respiratory Syndrome Coronavirus 2 Infection by Medical Journal Evidence-Based Medicine for providing ‘Clinical Detection of Nucleocapsid Protein. medRxiv 2020. doi: Accuracy and Utility’ toolkit, for better visualization of pre- and 10.1101/2020.03.07.20032524 post-test probability figures. 12. Indian Council of Medical Research. Advisory on use of rapid antigen detection test for COVID-19. Available from: Financial support & sponsorship: This study was https://www.icmr.gov.in/pdf/covid/strategy/Advisory_ for_rapid_antigen_test14062020.pdf, accessed on July 14, financially supported by the Indian Council of Medical Research, 2020. New Delhi (for the Regional Virus Research and Diagnostic 13. Kim H, Hong H, Yoon SH. Diagnostic performance of CT Laboratory at the All India Institute of Medical Sciences, and reverse transcriptase polymerase chain reaction for New Delhi). coronavirus disease 2019: A meta-analysis. Radiology 2020; 296 : E145-55. Conflicts of Interest: None. 14. Long C, Xu H, Shen Q, Zhang X, Fan B, Wang C, et al. Diagnosis of the coronavirus disease (COVID-19): rRT-PCR or CT? Eur J Radiol 2020; 126 : 108961. References 15. Standard Q COVID-19 Ag kit package insert and performance 1. World Health Organization. Coronavirus disease 2019: characteristics. Available from: http://sdbiosensor.com/ Events as they happen. Available from: https://www.who. xe/?module=file&act=procFileDownload&file_srl=18227& int/emergencies/diseases/novel-coronavirus-2019/events-as- sid=34288e1ee19dcfe4303c44f79b8ffcfe&modu le_srl=513, they-happen, accessed on June 29, 2020. accessed on July 14, 2020. For correspondence: Dr Purva Mathur, Department of Laboratory Medicine, JPNA Trauma Center, All India Institute of Medical Sciences, New Delhi 110 029, India e-mail: [email protected] Indian J Med Res 153, January & February 2021, pp 132-143 Quick Response Code: DOI: 10.4103/ijmr.IJMR_1132_20

Drug repurposing for identification of potential inhibitors against SARS-CoV-2 spike receptor-binding domain: An in silico approach

Santosh Kumar Behera1, Namita Mahapatra1, Chandra Sekhar Tripathy1 & Sanghamitra Pati2

1Health Informatics Centre, 2ICMR-Regional Medical Research Centre, Bhubaneswar, Odisha, India

Received April 10, 2020

Background & objectives: The world is currently under the threat of coronavirus disease 2019 (COVID-19) infection, caused by SARS-CoV-2. The objective of the present investigation was to repurpose the drugs with potential antiviral activity against receptor-binding domain (RBD) of SARS-CoV-2 spike (S) protein among 56 commercially available drugs. Therefore, an integrative computational approach, using molecular docking, quantum chemical calculation and molecular dynamics, was performed to unzip the effective drug-target interactions between RBD and 56 commercially available drugs. Methods: The present in silico approach was based on information of drugs and experimentally derived crystal structure of RBD of SARS-CoV-2 S protein. Molecular docking analysis was performed for RBD against all 56 reported drugs using AutoDock 4.2 tool to screen the drugs with better potential antiviral activity which were further analysed by other computational tools for repurposing potential drug or drugs for COVID-19 therapeutics. Results: Drugs such as chalcone, grazoprevir, enzaplatovir, dolutegravir, daclatasvir, tideglusib, presatovir, remdesivir and simeprevir were predicted to be potentially effective antiviral drugs against RBD and could have good COVID-19 therapeutic efficacy. Simeprevir displayed the highest binding affinity and reactivity against RBD with the values of −8.52 kcal/mol (binding energy) and 9.254 kcal/mol (band energy gap) among all the 56 drugs under investigation. Interpretation & conclusions: In the current investigation, simeprevir was identified as the potential antiviral drug based on the in silico findings in comparison to remdesivir, favipiravir and other 53 drugs. Further, laboratory and clinical investigations are needed to be carried out which will aid in the development of quick therapeutics designed for COVID-19.

Key words Angiotensin-converting enzyme 2 - COVID-19 - in silico - receptor-binding domain - SARS-CoV-2 - simeprevir

SARS-CoV-2 belongs to one of the largest RNA are encoded by spike (S), envelope (E), membrane (M) virus genomes, ranging in size from 27 to 32 kb. and nucleocapsid (N) genes1. Among all the structural The viral genome of SARS-CoV-2 contains non- proteins, CoV spike (S) glycoprotein has been reported structural protein genes with open-reading frame to play the most crucial role in viral attachment, (ORF) 1a, ORF1b and four key structural proteins that fusion and entry and also used as a key target for the

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 132 BEHERA et al: DRUG REPURPOSING FOR POTENTIAL INHIBITORS AGAINST RDB 133 production of antibodies, vaccines and entry inhibitors. repurposable drug for the treatment of COVID-19, S glycoprotein is considered as the most important which was also shown to synergize remdesivir in potential therapeutic target which is recognized by suppressing the replication of SARS-CoV-210. the cellular receptor and primed by the host cellular Understanding the importance of RBD for protease2. S1 and S2 are the two subunits of S protein; COVID-19 therapeutics, limitations of vaccine the S1 facilitates the entry of virus into the host cells development at a short interval, research by its binding to the host receptor through its receptor- controversies and prioritizing the urgent need of binding domain (RBD), whereas S2 subunit facilitates COVID-19 therapeutics, we performed an integrative the fusion of the viral and host membranes. The RBD in computational approach to inhibit the RBD of S SARS-CoV-2 S protein was reported to be the gateway protein from SARS-CoV-2 using 56 drugs which were of infection that bound robustly to human angiotensin- commercially available and used for therapeutics of converting enzyme 2 (ACE2) receptor3. various diseases. In this approach, an attempt was made The SARS-CoV-2 genome-specific vaccines to repurpose the drugs with potential antiviral activity and their therapeutic antibodies are currently being against COVID-19 which could inhibit the RBD of S tested. Alternatively, drug repurposing approaches of protein and ultimately prevent its entry into the human the existing therapeutic agents were carried out for cells through ACE2 receptor. clinical studies of COVID-19 therapeutics. Drugs Material & Methods such as remdesivir, favipiravir, hydroxychloroquine, ivermectin and lopinavir/ritonavir were repurposed for Sequence, structure and domain architecture analysis: the treatment of COVID-19, based on their previous The sequence, structure and functional information clinical history for potential therapeutics of other virus of RBD of S protein of SARS-CoV-2 were retrieved infections and pathologies4. These clinical therapies from National Center for Biotechnology Information can be divided into two categories depending on their (NCBI), GenBank with accession number MN908947. target: first, acting directly against SARS-CoV-2 either The spike (S) protein consisted of 1273 amino acids by inhibiting pivotal viral enzymes/proteins responsible (aa), of which 229 were aa codes for RBD protein of for the replication of genomes or by preventing the SARS-CoV-2 that directly interacted with human ACE2. entry of viruses into human cells; second, boosting The RBD lies within the S1 region of a coronavirus S the innate response by modulating the human immune protein that triggers host-cell receptor binding activity11. system, this plays a key role against viruses, or by The experimental structure of RBD with Protein Data inhibiting the inflammatory processes that cause lung Bank (PDB) ID: 6M0J was retrieved from Research injury. Collaboratory for Structural Bioinformatics (RCSB), PDB with a resolution of 2.45 Å. The co-crystallized Based on the drug targets, clinical trials have been human ACE2 was removed using BIOVIA Discovery done on several classes of drugs including favipiravir Studio 4.5 Visualizer (BIOVIA, San Diego, CA, USA). and remdesivir (RNA polymerase inhibitors), lopinavir/ ritonavir (protease inhibitors), chloroquine along with Retrieval of drugs: The information of 56 commercially its hydroxyl derivative (aminoquinolines), xiyanping available drugs that are mostly prescribed for viral injection and corticosteroids (anti-inflammatory agents) diseases, was retrieved from various sources6,12-14. and ACE2 inhibitors5 . In addition to the clinical benefits The three-dimensional (3D) structure of all these of aminoquinolines, protease inhibitors and RNA 56 drugs was retrieved from the NCBI PubChem polymerase inhibitors over COVID-19 therapeutics, database in Structure Data Format, which was later there have been a few controversial findings reported 6,7 converted to PDB format using online web server from various research findings . namely Simplified Molecular Input Line Entry System Remdesivir was reported to inhibit SARS- as per the requirement of AutoDock 4.2 docking tool CoV-2 which could be a prospective treatment of (http://autodock.scripps.edu/). SARS-CoV-2, responsible for COVID-198. It was permitted to enter the clinical trials immediately Prediction of binding site: The key interacting residues under COVID-19 emergency conditions, on the basis were analyzed from the experimental structure of of its safety and antiviral activities9. In an in vitro RBD-ACE2 complex (PDB ID: 6M0J) and available investigation, a hepatitis C virus protease inhibitor, literature, which were identified as active site residues namely simeprevir, was found to be a favourable that take part in the binding site formation. 134 INDIAN J MED RES, January & February 2021

Molecular docking using AutoDock 4.2 tool: Molecular tolerance was used for energy of minimization as docking studies were carried out using experimental required for releasing the conflicting interactions. In the structure of RBD S protein against all the 56 drugs primary phase, constant number of particles, volume using AutoDock 4.2 tool. To allocate Kollman charges and temperature (NVT) ensemble was carried for for the protein and Gasteiger partial charges for all temperature equilibration by restraining the positions of the inhibitors, ADT v.1.5 was used. The grid with backbone atoms for 1000 picoseconds (psec) followed dimension space and parameters were as follows: by the secondary phase where pressure equilibration x-centring: -37.872, y-centring: 28.878 and z-centring: was used in constant number of particles, pressure and 2.979, were chosen to allow full-extended conformation temperature (NPT) ensemble for 1000 psec. A run of of the ligand. Based on the binding energy values, 30 nanoseconds (nsec) MD time period was set for both ligand efficiency, intermolecular hydrogen (H)-bonds Apo and Holo states using periodic boundary conditions and other hydrophobic and electrostatic interactions, with constant temperature. Visual MD (VMD 1.9.1) the best resulting docked complexes were identified was used to analyze the resultant trajectories which are and processed for further computational analysis. inbuilt in GROMACS. The root mean square deviation The existence of intermolecular interactions between (RMSD), root mean square fluctuation (RMSF), radius RBD–drug complexes was depicted through LigPlot+ of gyration (Rg), total energy and solvent accessible (https://www.ebi.ac.uk/thornton-srv/software/LigPlus/). surface area (SASA) were analyzed using gmx_rmsd, gmx_rmsf, gmx_gyrate, gmx_tenergy and gmx_sasa. Quantum chemical calculation using density functional All 2D plots were graphed using GRaphing, Advanced, theory (DFT): A density functional theory (DFT)- Computation and Exploration 5.1.23 version (https:// based study using the highest occupied molecular www.its.hku.hk/services/research/hpc/software/grace) orbital (HOMO) and lowest unoccupied molecular for data analysis of MD simulations. orbital (LUMO) energy was carried out to investigate the reactivity and efficiency of potential drugs with Principal component analysis (PCA): To recognize antiviral activity against RBD by concerning the Becke, the coordinated movements in Apo and Holo states 3-parameter, LeeYang-Parr (B3LYP) correlation of RBD, principal component analysis (PCA) was function of DFT15. The energy calculations were made performed through essential dynamics (ED) process using ORCA Program version 4.016. The electronic using gmx_covera and gmx_aneig tools as per the energy, frontier HOMOs, LUMOs, gap energy and protocol within the software package of GROMACS. After diagonalizing and calculating the covariance dipole moment were calculated for the potential drugs. matrix representing the molecules’ concerted motion, The DFT was calculated using the following equation: a set of eigenvectors and eigenvalues were obtained. 3 E O minn{ Vrnuclei ()()nrdr Fn[(r )]} Results Annotation of binding site of RBD of spike protein: The literature survey and crystal structure analysis of Where, Vnuclei+n r }n ≡ trial density and F ≡ universal functional. RBD–ACE2 complex denoted the residues Lys417, Gly446, Tyr449, Tyr453, Leu455, Ile472, Phe486, Molecular dynamics (MD) simulations: GROMOS96 Asn487, Tyr489, Gln493, Gly 496, Thr500, Asn501, 43A1 force field in the GROMACS version 5.1.4 Gly502 and Tyr505 of RBD, which interact with molecular dynamics (MD) simulation package was used human ACE2 during cell entry, thus annotated as active to analyze the Apo (protein only) and Holo (protein- site residues that take part in binding site formation17. ligand) states to understand the dynamic behaviour, binding mode and specificity of RBD inhibitors. RBD- Molecular docking: The binding free energies simeprevir complex, which represented the highest of all the 56 (RDB-drug complexes) interactions binding affinity from our docking analysis, was further are summarized in Table I. The docking results processed for MD simulations to explore its inhibitor reflected different binding free energies for different specificity, dynamic behaviour and mode of binding drug-target complexes, ranging from −0.23 to −8.52 activity. The ‘pdb2gmx’ programme of GROMACS kcal/mol. RBD-chloroquine phosphate docking complex package was used for the generation of topology represented the least binding energy, whereas RBD- file. The steepest descent method with a 1000 kJ/mol simeprevir complex represented the highest binding BEHERA et al: DRUG REPURPOSING FOR POTENTIAL INHIBITORS AGAINST RDB 135 Contd... 2.511 3.088 2.727 2.810 3.074 2.827 2.782 2.862 2.822 1.887 2.619 2.179 1.843 2.463 1.943 3.343 2.701 2.692 2.714 2.688 3.214 2.350 2.736 2.549 2.209 2.093 2.102 of H ‑ bonds (Å) Average distance Average ‑ 2 spike (S) protein GLY496 GLY496 GLY496 TYR453 THR500 TYR449 THR500 GLU406 ARG403 ARG403 ARG403 SR494, TYR505 GLN493, SER494 GLN493, SER494 SER494, GLN498 GLY502, TYR453 GLY502, GLY496, TYR505 GLY496, TYR449, GLN498 ARG403, GLU406 GLN493, TYR553, H ‑ bond forming residues GLN493, SER494, GLY502 TYR449, GLN493, SER494 CYS488, PHE490, GLN493 TYR449, TYR453, GLY496 GLN498, THR500, ASN501 TYR449, GLN498, GLY496 GLN493, GLY496, GLN498 GLN493, GLY496, YTR453, GLN493, GLU406 GLY496, GLN498, ASN501, GLY496, ASN487, GLU484, GLY485, ASN487, GLU484, GLY485, TYR449, GLN498, TYR449, ‑ binding domain of SARS CoV 4 1 1 4 1 5 3 1 4 1 1 2 8 2 3 2 1 1 4 5 2 1 3 5 4 2 6 H ‑ bonds Number of (μm) 8.42 21.8 78.6 10.21 10.27 18.41 20.98 41.28 44.68 49.62 48.37 65.57 55.18 76.12 99.15 170.4 116.51 564.68 101.27 101.16 138.29 158.04 154.31 180.12 178.07 230.54 186.84 Inhibition constant −0.2 −0.11 −0.11 −0.16 −0.24 −0.28 −0.19 −0.12 −0.21 −0.12 −0.37 −0.07 −0.14 −0.29 −0.18 −0.29 −0.18 −0.26 −0.34 −0.18 −0.12 −0.35 −0.24 −0.28 −0.13 −0.24 −0.18 Ligand efficiency −5.6 −5.2 −5.11 −8.52 −6.81 −6.81 −6.92 −6.46 −6.36 −6.38 −5.98 −5.93 −5.87 −5.89 −5.71 −5.81 −5.62 −5.45 −5.46 −5.45 −5.37 −5.26 −5.19 −5.12 −5.14 −4.96 −5.09 (kcal/mol) Binding energy Binding energy Drug Simeprevir Enzaplatovir Tideglusib Presatovir Grazoprevir Dolutegravir Daclatasvir Chalcone Cyclosporine A Cyclosporine Montelukast Interferon ‑ alpha Elvitegravir Entecavir Raltegravir Efavirenz Saquinavir Etravirine Ebselen Danoprevir Deoxyrhapontin Indinavir Tdzd ‑ 8 Abacavir Carmofur Nelfinavir Shikonin Bortezomib Table I. Molecular docking scores of 56 commercially available drugs participating in hydrogen bonding with receptor Table PubChem Compound ID 24873435 58406357 11313622 58029842 44603531 54726191 25154714 637760 5284373 5281040 72193873 5277135 135398508 54671008 64139 441243 193962 3194 11285588 5316606 5362440 4124851 441300 2577 64143 479503 387447 136 INDIAN J MED RES, January & February 2021 Contd... 3.395 2.626 2.181 2.607 2.632 2.907 2.699 2.916 3.535 2.364 2.659 2.243 2.613 1.920 2.465 2.067 2.138 2.797 2.400 3.075 2.390 2.177 2.817 2.884 of H ‑ bonds (Å) Average distance Average SER494 ASN501 TYR453 TYR505 TYR453 ASN501 GLN493 GLN493 ARG403 GLN493, SER494 GLY496, TYR505 GLY496, GLN498, ASN501 GLY496, GLU406 GLY496, GLN498, TYR453 ARG403, TYR453 TYR453, GLN493, H ‑ bond forming residues SER494, GLN493, TYR453 TYR449, GLN493, SER494 GLN498, THR500, ASN501 GLY496, GLN498, TYR505 GLY496, TYR449, GLY496, GLN498 TYR449, GLY496, ARG403, ASN501, TYR505 ARG403, GLY496, TYR453 ARG403, GLY496, ARG403, GLN493, ASN501 GLU484, TYR489, PHE490, TYR449, GLY496, TYR553, TYR449, GLY496, ASN501, TYR449, GLY496, ASN501, TYR449, GLY496, ARG403, TYR449, GLY496, ARG403, TYR449, GLY496, 3 5 1 5 5 4 8 1 4 4 1 2 4 4 2 1 2 2 4 3 1 3 5 6 H ‑ bonds Number of (μm) 3.1 3.2 1.94 1.39 1.34 1.07 2.76 3.14 3.87 6.71 6.46 427.1 678.1 234.88 277.08 273.36 333.77 290.89 371.48 425.74 572.51 668.95 725.12 819.77 Inhibition constant −0.2 −0.3 −0.11 −0.12 −0.13 −0.16 −0.27 −0.21 −0.12 −0.39 −0.15 −0.18 −0.21 −0.14 −0.26 −0.37 −0.08 −0.08 −0.07 −0.15 −0.21 −0.07 −0.17 −0.15 Ligand efficiency −4.6 −4.6 −3.7 −3.9 −3.4 −4.95 −4.85 −4.86 −4.74 −4.82 −4.68 −4.42 −4.32 −4.33 −4.28 −3.92 −4.05 −4.21 −3.49 −3.42 −3.42 −3.29 −2.97 −2.99 (kcal/mol) Binding energy Binding energy Drug Tipranavir Boceprevir Lomibuvir Maribavir Acyclovir Remdesivir (Investigational drug: drug already in use) Ribavirin Chloroquine (Investigational drug: drug already in use) Darunavir Favipiravir (Investigational drug: drug already in use) Arbidol (Investigational drug: drug already in use) Cinanserin Penciclovir Polydatin Lamivudine Px ‑ 12 Carfilzomib Lopinavir (Investigational drug: drug already in use) Atazanavir Hydroxy chloroquine (Investigational drug: drug already in use) Disulfiram Asunaprevir Ganciclovir Trifluridine PubChem Compound ID 54682461 10324367 24798764 471161 135398513 121304016 37542 2719 213039 492405 131411 5475158 135398748 5281718 60825 219104 11556711 92727 148192 3652 3117 16076883 135398740 6256 BEHERA et al: DRUG REPURPOSING FOR POTENTIAL INHIBITORS AGAINST RDB 137

affinity among the 56 drugs under investigation. The drugs remdesivir and favipiravir represented the binding energy −4.68 and −4.32 kcal/mol which were lower than simeprevir. To identify the potential drugs with better 2.662 2.807 3.181 2.180 2.057 antiviral activity for SARS-CoV-2 therapeutics, a cut- of H ‑ bonds (Å) Average distance Average off binding energy with a range from −5.98 to −8.52 kcal/mol was considered for further computational analysis. The selected range provided eight drugs consisting of chalcone, grazoprevir, enzaplatovir, dolutegravir, daclatasvir, tideglusib, presatovir and simeprevir. The drugs bortezomib, entecavir, ribavirin and trifluridine were considered due to the highest GLN493 number of conventional H-bond interactions with LYS458, GLU471 LYS458, GLN498, ASN501 TYR453, GLN493 RBD. Remdesivir was also considered under priority

H ‑ bond forming residues research area for COVID-19 therapeutics. Similarly, GLY496, ASN501, GLN493 GLY496, the drug favipiravir was considered for further analysis based on its applications for COVID-19 therapeutics. 1 2 3 2 5 Hydrogen bond analysis and inter-atomic H ‑ bonds

Number of distance calculation: The study showed that all docked complexes exhibited variable numbers of intermolecular H-bonding patterns. The docking

(μm) analysis depicted eight H-bonds (average of ~2.179 16.9 13.06 52.57 94.32 and ~2.699 Å) in RBD complex with entecavir and 675.48

Inhibition ribavirin, which were the highest number among all the constant complexes (Fig. 1A and B). Remdesivir and favipiravir represented four H-bonds (average of ~2.907 and ~2.659 Å) (Fig. 1C and D). H-bond network of −0.05 −0.04 −0.05 −0.04 −0.05

Ligand RBD-simeprevir complex resulted in four number of efficiency H-bonds in spite of highest binding affinity among all drugs. The H-bond network was between Lys417, Gln493 and Ser494 of RBD and simeprevir with an average distance of ~2.810 Å (Fig. 2A). The −1.4 −2.57 −1.75 −2.42 −0.23 residues Tyr453, Leu455 and Lys417 were involved (kcal/mol) in hydrophobic interactions. The post-MD docking Binding energy Binding energy studies of RBD-simeprevir complex represented a binding affinity of −8.74 kcal/mol. The H-bond network was between Gly496 and Ser494 of RBD and simeprevir with an average distance of ~3.12 Å.

Quantum chemical calculation: Owing to the importance of quantum computation, quantum chemistry was employed to study the frontier molecular descriptors such as HOMO and LUMO, gap energy Drug Azithromycin Ritonavir (Investigational drug: drug already in use) Telaprevir Fosamprenavir Chloroquine phosphate and dipole moment for all the 14 shortlisted drugs that were predicted with better potential activity against RBD of S protein in SARS-CoV-2 (Table II). The effective reactivity for all the 14 drugs, which showed

band energy gap (ΔE), i.e. the difference between ELUMO and E , ranged from 9.254 to 13.126 kcal/mol. PubChem Compound ID 447043 392622 3010818 131536 64927 HOMO Simeprevir displayed greatest reactivity against RBD 138 INDIAN J MED RES, January & February 2021

A B

C D

Fig. 1. Intermolecular hydrogen bonding, electrostatic and hydrophobic interactions formed between (A) RBD-entecavir complex, (B) RBD- ribavirin complex, (C) RBD-remdesivir complex, (D) RBD-favipiravir complex. The images are drawn by LigPlot+ tool. RBD, receptor- binding domain. BEHERA et al: DRUG REPURPOSING FOR POTENTIAL INHIBITORS AGAINST RDB 139

A B

Fig. 2. (A) Intermolecular hydrogen bonding, electrostatic and hydrophobic contacts formed between RBD-simeprevir complex drawn by and LigPlot+ tool. (B) LUMO and HOMO plots of simeprevir which exhibited higher reactivity against RBD. The positive electron density is indicated by red colour while blue colour indicates negative electron density. HOMO, highest occupied molecular orbital; LUMO, lowest unoccupied molecular orbital.

Table II. Electronic energy, Energy in atomic unit of highest occupied molecular orbital (HOMO), lowest unoccupied molecular orbital (LUMO), gap energy and dipole moment of screened drugs

PubChem Drug name Electronic ELUMO EHOMO GAPEnergy Dipole Moment Compound ID energy (eV) (kcal/mol) (kcal/mol) (ΔE) (kcal/mol) (Debye) 37542 Ribavirin −59709.776 2.749 −10.377 13.126 6.74289 6256 Trifluridine −78658.337 1.971 −10.384 12.355 7.65268 135398508 Entecavir −69756.220 3.179 −8.282 11.461 11.04225 58406357 Enzaplatovir −106784.442 2.502 −8.712 11.214 1.32310 121304016 Remdesivir (investigational −211558.873 2.972 −8.100 11.072 11.35974 drug: drug already in use) 492405 Favipiravir (investigational −32705.803 1.346 −9.385 10.731 5.84279 drug: drug already in use) 54726191 Dolutegravir −119111.197 1.640 −8.971 10.611 7.00435 387447 Bortezomib −103013.589 1.610 −8.525 10.135 9.27791 637760 Chalcone −42552.894 1.362 −8.672 10.034 3.48279 44603531 Grazoprevir −300982.758 1.466 −8.414 9.88 6.97561 25154714 Daclatasvir −256640.071 1.678 −8.186 9.864 7.18234 11313622 Tideglusib −94283.082 1.596 −8.090 9.686 2.53781 58029842 Presatovir −184960.093 2.174 −7.114 9.288 4.29299 24873435 Simeprevir −297899.418 1.436 −7.818 9.254 5.44166 140 INDIAN J MED RES, January & February 2021

A B

C D

E

Fig. 3. Conformational stability of RBD (Apo and Holo states) from SARS-CoV-2 spike protein throughout 30 nanoseconds (nsec) time period of MD simulations. (A) Backbone-RMSD of RBD. (B) Cα-RMSF profile of RBD. (C) Radius of gyration (Rg) profile of RBD. (D) Total energy of RBD and RBD-simeprevir complex (Apo and Holo state) during 30 nsec MD simulations. (E) Solvent accessible surface (SASA) analysis of RBD-simeprevir complex during 30 nsec MD simulations. The Apo and Holo are displayed by black and red lines, respectively. RMSD, root mean square deviation; RMSF, root mean square fluctuation; MD, molecular dynamics. among all the screened drugs based on its lowest band a stable RMSD with a value ranging from ~0.23 to energy gap, which was calculated to be 9.254 kcal/mol ~0.22 nm from 25 to 30 nsec. This means that the drug (Fig. 2B). Taking together the results of molecular simeprevir can help stabilize the protein by changing docking and DFT analysis, the drug simeprevir was the conformation. The result of RMSD was further further postulated for MD simulation along with RBD. validated through fluctuation of residues using RMSF. The mobility of different residues was observed in Trajectory analysis of MD simulations: The MD RBD through RMSF plots (Fig. 3B). In Apo state, it simulation of the Apo and Holo (RBD-simeprevir was observed that the amino acid residues between complex) states of RBD was carried out to evaluate 370-379 and 430-435 exhibited greater deviations in the dynamics and stability of RBD protein, RMSD, their Cα atoms in comparison to other regions. Around Cα-RMSF, Rg, total energy and SASA from the 10 residues (475-485) displayed greater deviations in trajectories resulted from MD simulations using Holo state of RBD as compared to its Apo state. This GROMACS tools. The RMSD depiction for backbone plot signifies that binding of simeprevir decreases the residues was developed and plotted against a time mobility of residues in Holo state than in Apo state. scale of 30 nsec to access the dynamic stability of Rg was calculated to analyze the overall compactness RBD. The backbone RMSD (Holo) was observed for both the states. Gyration radius versus time graphs with a stable deviation after 20 nsec of simulation were plotted to check the compactness (Fig. 3C). (Fig. 3A) when compared to its Apo state. The Apo The Apo state’s Rg ranged from ~1.84 to ~1.85 nm, state depicted a significant deviation from 0 to 30 whereas the Holo Rg ranged from ~1.82 to ~1.79 nm, nsec (0.1-0.25 nm) compared to the Holo state, with which represented higher Rg value in Apo state than BEHERA et al: DRUG REPURPOSING FOR POTENTIAL INHIBITORS AGAINST RDB 141

A B

C

D

Fig. 4. (A) Deviation of H-bonds contributed in interaction during 30 nsec simulation in RBD-simeprevir complex. (B) Post-MD simulations intermolecular hydrogen bonding, electrostatic and hydrophobic contacts formed between RBD-simeprevir complex drawn by Diglot+ tool. (C) The cloud represents the projection of trajectories eigenvectors (EV1 and EV2) (Black: Apo; Red: Holo). (D) Projection of the motion of the Apo and Holo states of RBD in phase space along the first two principal eigenvectors (EV1 and EV2). in Holo state. The energy plot depicted the decreased H-bond analysis: The intermolecular hydrogen bonds mobility of residues in Holo state compared to Apo of the RBD-simeprevir complex were tracked using state, which was confirmed form RMSF plot (Fig. 3D). the gmx_hbond tool of GROMACS (Fig. 4A). The The hydrophobic interactions mediate the exposure simulation of Holo state represented an inconsistent of amino acids to certain solvent. The frequency number of intermolecular hydrogen bonds throughout of these interactions with the solvent and the core the simulation time period. It represented four H-bonds protein residues is directly proportional to the exposed (with an average atomic distance of ~1.67 nm). The surface area. The sketch of SASA (Fig. 3E) showed a number of H-bonds was directly proportional to the reduction in the accessible solvent surface in the Holo stability of the drug-target complex over the entire state of RBD relative to its Apo state. SASA’s findings simulation time period. During simulations, a few showed the alteration of hydrophilic and hydrophobic crucial H-bonds such as Gln493 and Lys417 were interaction areas resulted by the binding of simeprevir broken, but later novel H-bonds, van der Waals and to RBD, which could potentially prevent the host-viral hydrophobic contacts were compensated (Fig. 4B). interactions and ultimately making binding surface In spite of certain novel interactions with residues unavailable for the virus with human counterparts. Leu452, Phe 456, Tyr489, Leu492 and Tyr505, it did Throughout the simulation time, the SASA graphs of not compensate with residue Ser494 (H-bond). This the Holo state represented SASA with ~91 to ~110 nm2, reflects its potentiality against the targeted protein as which was lower than the Apo state with a value of Ser494 which is one of the crucial residues in boosting ~115 to ~ 120 nm2 (Fig. 3E). the ACE2 binding18. 142 INDIAN J MED RES, January & February 2021

Principal component analysis (PCA): The movement based on the information of drugs and experimentally of the RBD Apo and Holo states in phase space was derived crystal structure of RBD. The findings of this captured by the trajectory projections from PC1 and in silico investigation could be a supporting evidence PC2 (Fig. 4C), which were well aligned with RMSF for in vivo and in vitro studies needed to be carried out (Fig. 3B). The trace values shown for Apo and Holo to confirm the efficacy and antiviral drug potency of were 13.65 and 12.31 nm2 for RBD. The lower Holo simeprevir against RBD SARS-CoV-2 S protein. state trace values confirmed the overall decrease in RBD flexibility relative to its Apo state. The motion Acknowledgment: Authors thank Prof. (Dr) Balram Bhargava, direction was shown by the vectorial representation Secretary, Department of Health Research, Ministry of Health and of the solitary components. The majority of internal Family Welfare Government of India, and Director-General, Indian movements are shown by the initial vectors, while Council of Medical Research, New Delhi, for his support. EV1 and EV2 represent a large number of overall Financial support & sponsorship: None. movements. Following the plotting of eigenvalues against eigenvectors, steep curves of eigenvalues Conflicts of Interest: None. (Fig. 4D) were obtained. References 1. Wu F, Zhao S, Yu B, Chen YM, Wang W, Song ZG. A new Discussion coronavirus associated with human respiratory disease in Attempts for the development of vaccines and China. Nature 2020; 579 : 265-9. direct-acting potential antiviral drugs are being carried 2. Hoffmann M, Kleine-Weber H, Schroeder S, Krüger N, out for effective treatment of COVID-19 therapeutics. Herrler T, Erichsen S, et al. SARS-CoV-2 cell entry depends on ACE2 and TMPRSS2 and is blocked by a clinically proven Existing reports from various research findings protease inhibitor. Cell 2020; 181 : 271-80. have suggested that drugs such as chloroquine, 3. Tai W, He L, Zhang X, Pu J, Voronin D, Jiang S, et al. hydroxychloroquine, arbidol, remdesivir, favipiravir, Characterization of the receptor-binding domain (RBD) of azithromycin and nelfinavir have shown efficacy and 2019 novel coronavirus: implication for development of RBD safety for COVID-19 treatment12-14. Pharmaceutical protein as a viral attachment inhibitor and vaccine. Cell Mol and medicinal experts, however, raised the queries on Immunol 2020; 17 : 613-20. their efficacy because both these drugs were originally 4. Tu YF, Chien CS, Yarmishyn AA, Lin Y, Luo Y, Lin YT, et al. designed to treat other diseases. This depicted their A review of SARS-CoV-2 and the ongoing clinical trials. Int J Mol Sci 2020; 21 : 2657. implementation through drug-repurposing. Considering 5. Sisay M. Available evidence and ongoing clinical trials of the pros and cons of the COVID-19 investigational remdesivir: Could it be a promising therapeutic option for drugs, the current investigation was based on in COVID-19? Front Pharmacol 2020; 11 : 791. silico screening of 56 commercially available drugs 6. Gautret P, Lagier JC, Parola P, Hoang VT, Meddeb L, against RBD, through a computational approach to Mailhe M, et al. Hydroxychloroquine and azithromycin as find out potential candidates for COVID-19 therapy. a treatment of COVID-19: Results of an open-label non- This investigation revealed chloroquine phosphate randomized clinical trial. Int J Antimicrob Agents 2020; 56 : and simeprevir to have the least and highest antiviral 105949. activity based on their binding energy. RBD-simeprevir 7. Chen Z, Hu J, Zhang Z, Jiang S, Han S, Yan D, et al. Efficacy of hydroxychloroquine in patients with COVID-19: complex, which was approached for MD simulation Results of a randomized clinical trial. medRxiv 2020. predicted higher fluctuation pattern in a few residues of doi: 10.1101/2020.03.22.20040758. RBD, which might be due to their direct interaction with 8. Wang M, Cao R, Zhang L, Yang X, Liu J, Xu M, et al. 1 human ACE2 as reported by Wu et al . The integrative Remdesivir and chloroquine effectively inhibit the recently computational approach of docking, quantum chemical emerged novel coronavirus (2019-nCoV) in vitro. Cell Res calculation and MDS was used, which was able to 2020; 30 : 269-71. detect the linkage between residual movements in 9. Agostini ML, Andres EL, Sims AC, Graham RL, RBD and its way of interactions with these drugs. The Sheahan TP, Lu X, et al. Coronavirus susceptibility to the antiviral remdesivir (GS-5734) is mediated by the viral capability of simeprevir for COVID-19 therapeutics polymerase and the proofreading exoribonuclease. mBio was eventually hypothesized by the Apo and Holo state 2018; 9 : e00221-18. trajectories. The overall findings obtained from various 10. Lo HS, Hui KPY, Lai H, Khan KS, Kaur S, Li Z, et al. Simeprevir computational tools affirmed the pivotal role of the 14 suppresses SARS-CoV-2 replication and synergizes with drugs. This investigation was an in silico approach remdesivir. bioRxiv 2020. doi: 10.1101/2020.05.26.116020. BEHERA et al: DRUG REPURPOSING FOR POTENTIAL INHIBITORS AGAINST RDB 143

11. Wrapp D, Wang N, Corbett KS, Goldsmith JA, Hsieh CL, and binding free energy calculation. bioRxiv 2020. doi: Abiona O, et al. Cryo-EM structure of the 2019-nCoV spike 10.1101/2020.01.27.921627. in the prefusion conformation. Science 2020; 367 : 1260-3. 15. Gill PM, Johnson BG, Pople JA, Frisch MJ. The performance 12. Dong L, Hu S, Gao J. Discovering drugs to treat coronavirus of the Becke-Lee-Yang-Parr (B-LYP) density functional disease 2019 (COVID-19). Drug Discov Ther 2020; 14 : 58-60. theory with various basis sets. Chem Phys Lett 1992; 197 : 499-505. 13. Beck BR, Shin B, Choi Y, Park S, Kang K. Predicting commercially available antiviral drugs that may act on the 16. Neese F. The ORCA program system. WIREs Comput Mol Sci novel coronavirus (SARS-CoV-2) through a drug-target 2012; 2 : 73-8. interaction deep learning model. Comput Struct Biotechnol J 17. Lan J, Ge J, Yu J, Shan S, Zhou H, Fan S, et al. Structure of 2020; 18 : 784-90. the SARS-CoV-2 spike receptor-binding domain bound to the 14. Xu Z, Peng C, Shi Y, Zhu Z, Mu K, Wang X, et al. ACE2 receptor. Nature 2020; 581 : 215-20. Nelfinavir was predicted to be a potential inhibitor of 18. Satarker S, Nampoothiri M. Structural proteins in severe acute 2019-nCoV main protease by an integrative approach respiratory syndrome coronavirus-2. Arch Med Res 2020; 51 : combining homology modelling, molecular docking 482-91.

For correspondence: Dr Sanghamitra Pati, ICMR-Regional Medical Research Centre, Nalco Square, Chandrasekharpur, Bhubaneswar 751 023, Odisha, India e-mail: [email protected] Indian J Med Res 153, January & February 2021, pp 144-150 Quick Response Code: DOI: 10.4103/ijmr.IJMR_2363_20

Performance evaluation of Truenat™ Beta CoV & Truenat™ SARS-CoV-2 point-of-care assays for coronavirus disease 2019

Shantala Gowdara Basawarajappa1, Ambica Rangaiah1, Shashiraja Padukone1, Pragya D. Yadav2, Nivedita Gupta3 & Sathyanarayan Muthur Shankar1

1Department of Microbiology, Bangalore Medical College & Research Institute, Bengaluru, Karnataka, 2Maximum Containment Laboratory, ICMR-National Institute of Virology, Pune, Maharashtra & 3Division of Epidemiology & Communicable Diseases, Indian Council of Medical Research, New Delhi, India

Received June 3, 2020

Background & objectives: The rapid diagnosis of coronavirus disease 2019 (COVID-19) is a significant step towards the containment of the virus. The surge of COVID-19 cases in India and across the globe necessitates a rapid and sensitive molecular assay. Rapid point-of-care (PoC) assays (Truenat Beta CoV and Truenat SARS-CoV-2 assays) for the diagnosis of COVID-19 have been developed which are expected to shorten the turnaround time of reporting of results and also can be used for field investigations of COVID-19. The objectives of the study were to validate the performance of Truenat Beta CoV and Truenat SARS-CoV-2 PoC assays for the detection of SARS-CoV-2 infected cases with reference to analytical sensitivity, precision/inter-machine variation, clinical sensitivity and clinical specificity. Methods: The rapid PoC screening and confirmatory assays were prospectively validated at the State Level Virus Research and Diagnostic Laboratory at Bangalore Medical College and Research Institute, Bengaluru, under technical supervision by the Indian Council of Medical Research-National Institute of Virology (ICMR-NIV), Pune. Real-time reverse transcription-polymerase chain reaction (rRT-PCR) was considered as the reference standard against which the rapid assays were validated for all samples tested based on analytical sensitivity, precision/inter-machine variation, clinical sensitivity and clinical specificity. Results: Truenat Beta CoV and Truenat SARS-CoV-2 assays showed concordant results when compared with the reference standard rRT-PCR. These PoC assays exhibited 100 per cent sensitivity, specificity, positive predictive value and negative predictive value. Interpretation & conclusions: Truenat Beta CoV and Truenat SARS-CoV-2 assays showed concordance with the reference standard assay and may be recommended for screening and confirmation of SARS-CoV-2 in the field settings.

Key words COVID-19 - point-of-care test - rRT-PCR - SARS-CoV-2 - Truenat Beta CoV - Truenat SARS-CoV-2

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 144 o

BASAWARAJAPPA et al: PERFORMANCE EVALUATION OF TRUENAT SARS-CoV-2 POC ASSAYS 145

Coronavirus disease 2019 (COVID-19) pandemic diagnostic assays for the detection of SARS-CoV-2 has resulted in 37,601,548 confirmed cases, with over with respect to analytical sensitivity, precision/inter- 1,077,799 deaths globally, as of October 13, 20201. machine variation, clinical sensitivity and clinical In the backdrop of a surge in cases of COVID-19 in specificity. The results were compared with reference India and 216 affected countries across the globe, the standard rRT-PCR. rapid diagnosis of cases is considered as a significant Material & Methods tool towards the containment of cases. Currently, real-time reverse transcription-polymerase chain The present study was undertaken during the reaction (rRT-PCR) has been globally accepted as the months of April and May 2020 at the State Level reference standard for the detection of SARS-CoV-2 VRDL, Bangalore Medical College and Research which is being performed in COVID-19 testing centers Institute (BMCRI), Bengaluru, India5,6. Known identified by the Indian Council of Medical Research SARS-CoV-2 positive and negative nasopharyngeal (ICMR) across the country using approved protocols (NP)/oropharyngeal (OP) archived samples in viral and kits2,3. The ICMR has harnessed the potential of a transport medium (VTM), blood, and NP/OP samples network of Virus Research and Diagnostic Laboratories collected from suspected cases of SARS-CoV-2 were (VRDLs) present across the nation to address the issue included in the study. Samples from other respiratory of SARS-CoV-2 diagnosis4. infections like bacterial pneumonia and tuberculosis Timely diagnosis, effective treatment and future were excluded. NP and OP swabs in VTM from prevention are crucial to the management of COVID-19 patients with H1N1 and severe acute respiratory cases. The current race to develop cost-effective point- illness (SARI) and blood samples from SARS-CoV-2 of-care (PoC) test kits and efficient laboratory techniques positive and negative cases were used for validating for confirmation of SARS-CoV-2 infection has fueled a the Truenat screening (Beta CoV) and confirmatory new frontier of diagnostic innovation. Benefits of PoC (SARS-CoV-2) assays. Institutional Ethics Committee tests include case confirmation in field settings, guidance approval (Vide No: BMCRI/PS/02/2020-21 dated in early public health interventions like contact tracing, 18.04.2020) was taken before undertaking the isolation of case and prophylaxis, apart from on-spot study. A total of 75 samples, including 30 confirmed case confirmation of SARS-CoV-2, which is expected SARS-CoV-2 positives, 45 confirmed SARS-CoV-2 to improve case management. On these lines, rapid negatives and six blood samples (3 each from Truenat PoC assays for the diagnosis of COVID-19 have SARS-CoV-2 positive and negative cases) were used. been developed by Molbio Diagnostics Private Limited, Evaluation of analytical sensitivity of the test: Aliquot India, which are expected to shorten the turnaround of one VTM sample with low Ct values for envelope time of reporting of results and also can be used for field protein (E) gene and RNA-dependent RNA polymerase investigations of COVID-19. Truenat platforms are light (RdRp-2) was used for extraction by Trueprep Auto and portable indigenous chip-based rRT-PCR designed (as per manufacturer’s protocol) and also by manual RNA for rapid diagnosis of infectious diseases, including extraction kit (QiAmp viral RNA extraction kit - mini COVID-19. The processing of clinical specimens from prep, Qiagen, Germany). Ribonuclease P (RNase P), RNA extraction to amplification can be achieved in a human constitutive gene, was used as an internal <60 min. Availability of ready-made master mix prep control for all the assays. RNA extracted from the and negating the need of clean biosafety cabinet, samples was diluted 10-fold from 10−1 (dilution 1) to minimal training for field testing are additional benefits. 10−6 (dilution 6). Six dilutions (1:10) were made from Truelab workstation Real-Time micro PCR system both Trueprep elute and Qiagen elute. These were is achieved through a combination of lightweight, run in parallel in TaqMan rRT-PCR using ICMR-NIV portable, mains/battery operated Truelab Real-Time protocol, considered as the reference standard and micro PCR analyzers, TruePrep AUTO universal Truenat assays5,6 (Fig. 1). cartridge-based SamplePrep device, room temperature stable Truenat microPCR chips and TruePrep AUTO For E gene, strong positive: low Ct value: 20±1.5 SamplePrep tests. (13 samples); medium positive: medium Ct value: The present study was undertaken to validate the 29±1.5 (10 Samples); weak positive: high Ct value: performance of Truenat Beta CoV (screening assay) 32±1.5 (7 Samples) (used for validation of Truenat and Truenat SARS-CoV-2 (confirmation assay) PoC Beta CoV assay in this study). 146 INDIAN J MED RES, January & February 2021

Fig. 1. Flowchart showing evaluation of analytical sensitivity of the test. NP/OP nasopharyngeal/oropharyngeal swab; VTM, viral transport medium; rRT-PCR, real-time reverse transcription-polymerase chain reaction.

For RdRp-2, strong positive: low Ct value: Cross-reactivity testing: Cross-reactivity was 27.5±2.5 (11 samples); medium positive: medium Ct evaluated by testing 15 RNA samples from clinical value: 32.5±2.5 (14 samples); weak positive: high specimens, previously tested for H1N1 (5 positive, Ct value: 37.5±2.5 (5 samples). Both dilution series 10 negative). To check cross-reactivity with SARI, were run on Truenat SARS-CoV-2 chips as well as 30 samples from confirmed SARI patients were used SARS-CoV-2 rRT-PCR systems in parallel. Log-linear for the detection of the E gene and RdRp-2. curves were plotted to determine the linearity of assays. In vitro transcribed (IVT) RNA dilutions: Serial Evaluation of blood samples: RNA extracted from dilutions of in vitro transcribed (IVT) RNA received six blood samples (3 SARS-CoV-2 positive and from ICMR-NIV were done and compared on Truenat 3 SARS-CoV-2 negative) using Trueprep Auto were Beta CoV, Truenat SARS-CoV-2 and rRT-PCR. Ct run on Truenat SARS-CoV-2 assay. RNAs extracted values of these dilutions in assays performed by all the by the manual method were processed using reference methods were noted7. standard rRT-PCR protocol and the Ct values recorded were compared with that of Truenat assays. Evaluation of repeatability of the test (precision)/inter- machine variations: Repeatability of the PCR test is Results essential to ensure assay reproducibility and reliability. Reference standard assay rRT-PCR detected up to Three clinical elutes representing high, medium and dilution 10−5 (D5) from the undiluted sample, with valid low Ct values [Sample IDs: R1 (Ct: 30.24), R2 (Ct: Ct values. Truenat Beta CoV/SARS-CoV-2 detected E 24.19), R3 (Ct: 20.97) for E gene detection by Truenat gene and RdRp-2 targets up to dilution 106 (D6) with Beta CoV; R4 (Ct: 26.71), R5 (Ct: 20.75), R6 (Ct: 14.5) valid Ct value (Table II). for RdRp-2 detection by Truenat SARS-CoV-2] were run on all four Truenat PCR devices under evaluation Linearity of assay (Trueprep Auto extract): Using for precision/inter-machine variations. the dilution series from Trueprep Auto elutes run on Truenat Beta CoV and SARS-CoV-2, the log-linear Clinical sensitivity and specificity: Clinical sensitivity curve was plotted to check the linearity of Ct values was tested by running confirmed positives samples of (Figs 2 and 3). The slope of the line was −3.289 (R2 SARS-CoV-2 (n=30), representing high, medium, and value: 0.9944 for Truenat Beta CoV; 0.9901 for Truenat low Ct values of RdRp-2 for testing and comparison SARS-CoV-2). The assay was observed to be linear with both the systems (Table I). To evaluate clinical over the range of dilutions tested, and PCR efficiency specificity, known positive NP/OP samples of H1N1, was found to be 99.57 per cent (Figs 2 and 3). SARI, blood samples from SARS-CoV-2 positive and negative cases, as well as confirmed COVID-19 Serially diluted IVT RNA assayed for E gene, negatives were used. and RdRp-2 targets showed better sensitivity with o

BASAWARAJAPPA et al: PERFORMANCE EVALUATION OF TRUENAT SARS-CoV-2 POC ASSAYS 147

Table I. Comparison of Ct values of 30 confirmed SARS-CoV-2 positive samples on Truenat and real‑time PCR platforms Sample Truenat Beta CoV (Ct) Truenat SARS‑CoV‑2 (Ct) rRT-PCR SARS‑CoV‑2 (Ct) RNase P E gene RNase P RdRp‑2 RNase P E gene RdRp‑2 1 26.29 23.6 26.14 26.71 31.36 29.04 36.29 2 22.43 22 22.75 18 27.88 24.12 30 3 27 33.33 27.25 31.6 34.24 26 34 4 20.75 18.5 21.2 16.75 27.92 19.45 26.89 5 23.33 24 23.5 24 29.6 30.81 35 6 24.8 20.5 25.17 18.3 32.23 25.23 31.07 7 20.33 15 20.5 13 27.76 19.11 26.15 8 23.33 22 24.33 21 33.09 28.95 34.53 9 23.14 23.33 23.86 21.63 27.56 24.5 31 10 21.8 25.33 22.29 22.4 27.42 27.8 24.7 11 25 18.4 25.75 18.17 29.99 23.03 29.85 12 25 21.11 25.25 19.71 29.8 24.07 31.53 13 26.2 17.4 26.5 16.6 32.23 24.18 30 14 22.17 21.6 22.5 20.43 29.48 27.23 33 15 21.5 20.5 22.29 19 30.51 24.42 32.28 16 22 16 22.4 14.5 30.45 19.49 27.85 17 27.8 21 29.5 20.29 33.54 25.16 31.55 18 23 22.75 23 22 28.23 26.19 32.47 19 26 12.8 25 11.4 33.66 21.05 32.38 20 26.33 22.14 26.5 21.14 32.62 26.09 35.45 21 25.2 22.8 32 18.71 26.2 22.35 28.17 22 24.14 15.17 24.83 14.17 31.14 19.28 25.82 23 24.17 25 24.13 20.43 26.2 20.97 26.36 24 22.43 21.83 22 20.75 26.09 30.88 27.88 25 23.29 27.17 23.6 25.8 28.34 31.92 32.68 26 27.2 26.38 26.4 24.8 31.88 29.52 35.5 27 24.6 21.14 24.5 19.25 30.84 22.88 31.31 28 25 31.4 26 30.1 30.77 36.86 38.56 29 20.6 30 21 27.8 27.19 33.16 39.36 30 24.33 29.6 24 28 31.19 31.66 34.28

Table II. Analytical sensitivity of Truenat point‑of‑care (PoC) assays compared to reference rRT-PCR method values Dilutions Truenat Beta CoV Truenat SARS‑CoV‑2 SARS‑CoV 2 rRT-PCR E gene RNase P RdRp‑2 RNase P E gene RdRp‑2 RNase P Neat 15 20.33 13 20.5 19.29 24.49 26.45 D1 16.33 23.75 16.17 24.43 22.05 26.87 29.63 D2 20.6 28.11 18.5 27.86 25.78 30.28 33.01 D3 24 31.6 22.25 30.75 29.22 33.76 35.55 (‑ve) D4 27.2 33.29 25 33.6 32.4 36.87 (‑ve) 38.6 (‑ve) D5 30.29 ND 28.8 ND 36.25 40.52 (‑ve) 39.8 (‑ve) D6 33.33 ND 32 ND 38.3 ND ND ND, not detected 148 INDIAN J MED RES, January & February 2021

35 Table III. Analytical sensitivity of Truenat PoC assays using 30 in vitro transcribed (IVT) RNA 25 e 20 Dilutions Truenat SARS‑CoV‑2 rRT-PCR 15 (copies) (Ct values) (Ct values)

Ct valu R² = 0.9944 10 RdRp‑2 RdRp‑2 5 10−5 (107) 17.0 25.65 0 0 1234567 10−6 (106) 19.67 30.63 Log dilution 10−7 (105) 23.5 34.08 Fig. 2. Linearity and PCR efficiency on Truenat Beta CoV. Y-axis −8 4 indicates Ct values, and X-axis is arbitrary log numbers indicating 10 (10 ) 26.5 39.72 dilutions. 10−9 (103) 29.83 ND 10−10 (102) 32.18 ND 35 ND, Not Detected 30 25 20 Table IV. Precision of Truenat SARS‑CoV‑2 assay 15 Ct valu e R² = 0.9901 Equipment ID Truenat SARS CoV‑2 RdRp‑2 (Ct) 10 ID:383 ID:1263 ID:885 5 TLDU0401 26.71 20.75 14.67 0 01234567 TLDU1308 26.14 21 14.5 Log dilution TLDU1306 26.2 21.17 15 Fig. 3. Linearity and PCR efficiency on Truenat SARS-CoV-2. Y-axis TLQU0001 26.14 20.75 14.5 indicates Ct values, and X-axis is arbitrary log numbers indicating dilutions. Mean 26.30 20.92 14.67 Standard deviation 0.28 0.21 0.24 Truenat Beta CoV and Truenat SARS-CoV-2 assays in Per cent CV 1.1 1.0 1.6 comparison to rRT-PCR. Valid Ct values were detected TLDU, Truelab™ Duo Real Time Quantitative micro PCR by Truenat assays in log IVT dilutions higher than that Analyzer; TLQU,Truelab™ Quattro Real Time Quantitative of rRT-PCR, and these assays had a limit of detection micro PCR Analyzer; ID, sample identification number; (LOD) of 102 copies/µl (D6) for these targets, indicating CV, coefficient of variation higher sensitivity as compared to rRT-PCR assay, which had a LOD of 103 (1000) copies/µl (Table III). Table V. Calculation of diagnostic performance Precision/inter-machine variations: The results of Truenat Beta CoV and SARS‑CoV‑2 rRT-PCR (n=75) Truenat assays were found to be reproducible with a Truenat SARS‑CoV‑2 Positive Negative Total coefficient of variation in Ct values significantly <10 (n=75) per cent, across samples. All positive samples were Positive 30 (TP) 0 (FP) 30 detected by both screening (Truenat Beta CoV, E gene) Negative 0 (FN) 45 (TN) 45 and confirmatory (Truenat SARS-CoV-2, RdRp-2) Total 30 45 75 assays. These results were 100 per cent concordant with rRT-PCR results as represented in Table IV. TP, true positive; TN, true negative; FP, false positive; FN, false negative, PPV, positive predictive value; NPV, negative predictive value. Sensitivity=TP/TP+FN; Specificity=TN/ Specificity, cross-reactivity and diagnostic performance: TN+FP; PPV=TP/TP+FP; NPV=TN/TN+FN; Sensitivity: 100 The PoC assays did not show cross-reactivity with per cent; Specificity: 100 per cent; PPV: 100 per cent; NPV: 100 known positive and negative samples of SARS-CoV-2 per cent; Clinical sensitivity: 100 per cent; Clinical specificity: (n=75) used for evaluation and exhibited 100 per cent 100 per cent; Overall concordance: 100 per cent concordance with rRT-PCR results (Table V). Internal control RNase P was amplified in all samples with no confirmed SARS-CoV-2 positives and 45 confirmed amplification of E gene and RdRp-2 gene targets. For SARS-CoV-2 negatives) were tested on the four Truenat performance evaluation of Truenat Beta CoV and platforms under evaluation. A comparison of results SARS-CoV-2 assays, a total of 75 samples (30 from rRT-PCR and Truenat SARS-CoV-2 was done o

BASAWARAJAPPA et al: PERFORMANCE EVALUATION OF TRUENAT SARS-CoV-2 POC ASSAYS 149 using a 2×2 matrix. Clinical sensitivity, clinical values were determined to be 100 per cent. These PoC specificity and overall concordance were determined to assays are expected to be of value in the field settings as be 100 per cent (Table V). these require minimal laboratory setup, workforce, and skill to perform the same. In turn, this would reduce Discussion the burden on testing sites performing RT-PCR and Conventionally, the preferred targets of coronavirus shorten the turnaround time of reporting of results. The RT-PCR assays included the conserved and/or extraction of RNA using Trueprep takes 20 min and abundantly expressed genes such as the structural S each of the assays requires 45 minutes. This is quicker and N genes and the nonstructural RdRp and replicase as compared to rRT-PCR, which takes around 4-6 h open reading frame (ORF) 1a/b genes. The reference for the entire process. Owing to the urgent requirement standard rRT-PCR for SARS-CoV-2 employs E gene of PoC assays validation for use in field settings, the for screening and RdRp, as well as ORF for confirmation present evaluation was done with a limited sample size, of cases. Molecular assays on PoC platforms have which was a limitation of the present study. Studies the added advantage of higher applicability in field with a larger sample size performed in field settings settings for rapid screening and confirmation of are required to further validate the tests. However, SARS-CoV-2 cases without compromising the the present study can be considered as a preliminary diagnostic parameters8-14. Truenat Beta CoV and finding which needs to be tested independently in the Truenat SARS-CoV-2 are indigenous chip-based field for further validation of results with large samples rRT-PCR assays for semi-quantification of SARS-CoV-2. using the method of blinding to further strengthen the E gene is employed for screening by Truenat Beta hypothesis. CoV assay and RdRp-2 for confirmation by Truenat Truenat Beta CoV and Truenat SARS-CoV-2 SARS-CoV-2 assay. PoC assays, targeting E and RdRp-2 genes may The present study was done to evaluate the be recommended for screening and confirmation, performance of Truenat PoC assays for screening and respectively, of suspected cases of COVID-19. These confirmation of SARS-CoV-2. The results indicated assays would be of value in rapid confirmation of that the Truenat Beta CoV and SARS-CoV-2 assays COVID-19 cases in field settings. were highly sensitive and specific for the detection of Acknowledgment: Authors acknowledge Dr Varsha A. Potdar, SARS-CoV-2 RNA. The Truenat PoC assays were also Influenza Group, ICMR-NIV, Pune, for providing IVT RNA for evaluated for performance based on the parameters use and technical assistance provided by Ms. Asha Munegowda, of analytical sensitivity, precision/inter-machine- Research Assistant, State Level Virus Research and Diagnostic variations, clinical sensitivity and specificity. Cross- Laboratory (VRDL), Bangalore Medical College and Research reactivity with other respiratory viruses like H1N1 was Institute (BMCRI), Bengaluru. also evaluated. The results of precision and inter-machine variation Financial support & sponsorship: Authors acknowledge for Truenat screening and confirmatory assays were the funding received from the Department of Health Research reproducible with per cent co-efficient of variation (DHR) and ICMR for the establishment of State Level VRDL at in Ct values being <10 per cent. The PoC tests under BMCRI, where the present study was undertaken. evaluation showed concordant results with a reference standard assay for cross-reactivity, and when elutes Conflicts of Interest: None. from blood samples of SARS-CoV-2 positive and negative cases were run in duplicates for both targets. References SARS-CoV-2 positive samples categorized into three 1. World Health Organization. WHO Coronavirus Disease categories of the low, medium and high Ct values were (COVID-19) Dashboard. Available from: https://covid19. run in parallel on the Truenat platform and reference who.int/, accessed on October 13, 2020. standard assay. The results were found to be 100 2. Chan JF, Yip CC, To KK, Tang TH, Wong SC, Leung KH, et al. Improved molecular diagnosis of COVID-19 by the novel, per cent concordant and LOD was 100 copies. highly sensitive and specific COVID-19-RdRp/Hel real-time Diagnostic performance of the PoC tests in terms of reverse transcription-PCR assay validated in vitro and with sensitivity, specificity, positive and negative predictive clinical specimens. J Clin Microbiol 2020; 58 : e00310-20. 150 INDIAN J MED RES, January & February 2021

3. Broedersa S, Huberb I, Grohmannc L, Berbend G, 9. Chan JF, Kok KH, Zhu Z, Chu H, To KK, Yuan S, Tavernierse I, Mazzaraf M, et al. Guidelines for validation of et al. Genomic characterization of the 2019 novel human- qualitative real-time PCR methods. Trends Food Sci Technol pathogenic coronavirus isolated from a patient with atypical 2014; 37 : 115-26. pneumonia after visiting Wuhan. Emerg Microbes Infect 4. Gupta N, Potdar V, Praharaj I, Giri S, Sapkal G, Yadav P, 2020; 9 : 221-36. et al. Laboratory preparedness for SARS-CoV-2 testing in 10. Lu R, Zhao X, Li J, Niu P, Yang B, Wu H, et al. Genomic India: Harnessing a network of virus research; diagnostic characterisation and epidemiology of 2019 novel coronavirus: laboratories. Indian J Med Res 2020; 151 : 216-25. Implications for virus origins and receptor binding. Lancet 5. ICMR-National Institute of Virology. Standard Operating 2020; 395 : 565-74. Procedure for Detection of 2019 novel coronavirus (2019- nCoV) in suspected human cases by rRT-PCR: First Line 11. Chen L, Liu W, Zhang Q, Xu K, Ye G, Wu W, et al. RNA based Screening assay. Pune: ICMR-National Institute of Virology; mNGS approach identifies a novel human coronavirus from 2020. p. 1-7. two individual pneumonia cases in 2019 Wuhan outbreak. 6. ICMR-National Institute of Virology. Standard operating Emerg Microbes Infect 2020; 9 : 313-9. procedure for detection of 2019 novel coronavirus (2019- 12. Corman VM, Landt O, Kaiser M, Molenkamp R, Meijer A, nCoV) in suspected human cases by rRT-PCR: Confirmation Chu DK, et al. Detection of 2019 novel coronavirus (2019- Assay. Pune: ICMR-National Institute of Virology; nCoV) by real-time RT-PCR. Euro Surveill 2020; 25 : 2020. p. 1-7. 2000045. 7. Choudhary ML, Vipat V, Jadhav S, Basu A, Cherian S, 13. Chu DKW, Pan Y, Cheng SMS, Hui KPY, Krishnan P, Liu Y, Abraham P, et al. Development of in vitro transcribed RNA et al. Molecular diagnosis of a novel coronavirus (2019-nCoV) as positive control for laboratory diagnosis of SARS-CoV-2 in India. Indian J Med Res 2020; 151 : 251-4. causing an outbreak of pneumonia. Clin Chem 2020; 66 : 549-55. 8. Chan JF, Yuan S, Kok KH, To KK, Chu H, Yang J, et al. A familial cluster of pneumonia associated with the 14. World Health Organization. Laboratory testing for coronavirus 2019 novel coronavirus indicating person-to-person disease (COVID-19) in suspected human cases: Interim transmission: A study of a family cluster. Lancet 2020; 395 guidance, 19 March 2020. Available from: https://apps.who. : 514-23. int/iris/handle/10665/331501, accessed on June 1, 2020.

For correspondence: Dr Sathyanarayan Muthur Shankar, Department of Microbiology, Bangalore Medical College & Research Institute, KR Road, Fort, Bengaluru 560 002, Karnataka, India e-mail: [email protected] Indian J Med Res 153, January & February 2021, pp 151-158 Quick Response Code: DOI: 10.4103/ijmr.IJMR_3665_20

Chloroquine nasal drops in asymptomatic & mild COVID-19: An exploratory randomized clinical trial

Alok Thakar1, Smriti Panda1, Pirabu Sakthivel1, Megha Brijwal2, Shivram Dhakad2, Avinash Choudekar2, Anupam Kanodia1, Sushma Bhatnagar3, Anant Mohan4, Subir K. Maulik5 & Lalit Dar2

Departments of 1Otorhinolaryngology & Head & Neck Surgery, 2Microbiology, 3Oncoanesthesia, 4Pulmonary Medicine & Sleep Disorders & 5Pharmacology, All India Institute of Medical Sciences, New Delhi, India

Received August 28, 2020

Background & objectives: Chloroquine (CQN) administered as nasal drops has the potential to achieve much greater local tissue levels than with oral/systemic administration. This trial was undertaken to study the efficacy and safety profile of topical nasal administration of CQN drops in reducing viral load and preventing clinical progression in early COVID-19 infection. Methods: This randomized clinical trial was done with a sample size of 60. Reverse transcription- polymerase chain reaction (RT-PCR) confirmed asymptomatic patients or those with mild COVID-19 illness [National Early Warning Score (NEWS) ≤4] were included. Patients were randomized in a 1:1 manner. Control arm (standard supportive treatment, n=30) was compared with intervention arm (n=30) of standard treatment plus CQN eye drops (0.03%) repurposed as nasal drops administered six times daily (0.5 ml/dose) for 10 days. Outcome measures were adverse events and adherence; clinical progression and outcomes were measured by NEWS; sequential RT-PCR cycle threshold (Ct) values were also noted on days 0, 3, 7 and 10. Results: Nasal CQN was associated with local irritation in seven and non-compliance in one of 30 patients. Eleven patients were excluded due to enrolment error (2 – recovered; 9 – false-positive referral), and 49 patients were analyzed as per modified intention-to-treat analysis. Clinical recovery was noted as similar with 100 per cent asymptomatic by day seven in both arms. Virological outcomes also indicated similarly improving Ct values in both arms, and similar proportion of patients transitioning to non-infectivity by day 10 (controls - 19/25; nasal CQN - 15/24). Nine false-positive patients with enrolment error and day 0 RT-PCR negative were initially uninfected but had continuing COVID-19 exposure and treatment as per randomization. Patients receiving nasal CQN (n=5) demonstrated stable Ct values from day 0 to 10, while patients with no nasal CQN (n=4) demonstrated significant dip in Ct value indicating to infection (Ct<35) and infectivity (Ct<33). Interpretation & conclusions: The present study suggests to the potential of topical nasal CQN in the prevention of COVID-19 infection if administered before the infection is established. No significant differences in clinical or virological outcome were however, demonstrated in patients with mildbut established illness.

Key words Chloroquine - COVID-19 - nasal drops - National Early Warning Score - prophylaxis - SARS CoV-2

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 151 152 INDIAN J MED RES, January & February 2021

Chloroquine (CQN) and hydroxychloroquine Participants: Patients were assessed for recruitment (HCQ) have been demonstrated to have antiviral activity when referred for admission with a COVID-19 against the coronaviruses and novel coronavirus 2 RT-PCR test reported positive from a panel of (SARS-CoV-2) in cell culture and in animal studies1-5. government-approved laboratories. Study recruitment An initial report from China not supported by data was restricted to asymptomatic or mildly symptomatic suggested the apparent efficacy of CQN in humans adults [National Early Warning Score (NEWS) ≤4]16. with COVID-19 infection6, and an observational data Exclusion criteria included recent intake of from France noted that HCQ along with azithromycin led to a rapid progression to cure and to progressive oral CQN or HCQ or any other specific treatment, decline in viral RNA load as measured by reverse hypersensitivity to CQN/HCQ, cardiovascular transcription-polymerase chain reaction (RT-PCR) comorbidities and pregnant or lactating ladies. cycle threshold (Ct) values7,8. Enthusiasm towards CQN Randomization and masking: Patients were randomized and HCQ has however, since waned. A subsequent in a 1:1 manner as per a computerized generated non-randomized open-label observational study with sequence. The microbiological team was blinded to the the same drug combination did not demonstrate similar randomization allocation and also to clinical status. efficacy9. Attempts to improve response rates by increasing drug dosages have been disappointing and Intervention: The control arm received standard limited by significant toxicity and mortality10.11, and symptomatic supportive care. The intervention arm the RECOVERY and SOLIDARITY trials examining received all treatments and observations as for the various treatments in severe COVID-19 have not been control arm plus additional nasal instillation of able to demonstrate its efficacy11,12. 0.03 per cent CQN eye drops (Uv Lubi Unims 0.03% Drops, Manufactured by FDC Ltd, Mumbai). Six doses The antiviral action of CQN is mainly mediated by of 0.5 ml each were instilled daily for 10 days. The restricting viral entry into the cell2,3. This mechanism of dosage was determined as per the past literature of action predicates to greater efficacy if used in the early usage as eye drops17,18. stage of the infection13,14, or as prophylaxis15, rather than in severe infection. An option yet unexplored is The drops were self-administered by patients. A the use of CQN as a topical treatment. Topical CQN video demonstration educated patients on the method eye drops are available in India at a concentration of of drop instillation (head-hanging method). Doses 0.03 per cent for the treatment of dry eye and have were instilled at three hourly intervals in the day (0600- regulatory approval. The present study was therefore, 2100 h) with a nine hour break at night. Alternate undertaken to explore the safety and efficacy of CQN nostrils were used for alternate doses. eye drops repurposed as nasal drops in reducing viral Outcomes: Primary outcomes were assessed for drug load and preventing clinical progression of disease in tolerance, clinical and virological metrics. Toxicity early COVID-19 infection. assessment was carried out by direct verbal questioning Material & Methods and subsequent investigations as required. General well-being was assessed daily along with the evaluation This was an exploratory, randomized controlled of the breath-holding time and documentation of the trial comparing topical administration of CQN drops NEWS on days 0, 3, 7 and 10. in the nose with standard symptomatic management in patients with asymptomatic/mild COVID-19. Nasal swabs were taken on days 0, 3, 7 and 10 and The study received institutional biosafety clearance tested by real-time RT-PCR targeting the ORF1ab gene and ethical approval (IEC-250/17.04.2020) and was (BGI Genomics Co. Ltd., China) on Agilent AriaMx registered with the Clinical Trial Registry of India real-time PCR system. A reference internal control (CTRI/2020/04/024729). This study was conducted at with human beta actin was simultaneously assessed to a designated COVID-19 treatment facility (NCI-Jhajjar check for sample adequacy and extraction efficiency. Campus) at the All India Institute of Medical Sciences Estimation of viral load was done by Ct value. RT-PCR (AIIMS), New Delhi. Study recruitment was from tests were undertaken in composite batches, with all April 23 to May 6, 2020. Informed written consent was four tests of a particular patient tested in single batch so obtained from all participants. as to enable charting of sequential trends in Ct values. THAKAR et al: NASAL CHLOROQUINE DROPS FOR MILD COVID-19 153

Ct assessment was taken as a surrogate marker Table II lists the symptoms, indication for testing for semi-quantitative assessment with lower values and subsequent days 3, 7, 10 clinical and virological indicative of a higher copy number of the target status for this day 0 RT-PCR-negative group (n=11). RNA. A Ct<35 was taken as positive and Ct<33 Two of the 11 patients had been symptomatic for >10 taken as positive and infective19. For samples with no days and were judged to be in the recovery phase detected fluorescence (undetected), the Ct value was of their illness. For the other nine patients, it was approximated to 38 for statistical analysis. judged that the initial pre-study test undertaken by the referring institution was a false-positive test. These 11 Sample size calculation: The exploratory trial design patients with day 0-negative RT-PCR were adjudged did not mandate sample size calculation for efficacy. as enrolment errors and excluded from further This being a new off-label intervention, ethical clearance was granted for 60 patients. Further, as analysis of the a priori objective (topical CQN in mild per results available for oral HCQ from the French COVID-19). The modified intention-to-treat analysis experience at the time of trial initiation7,8, the expected was therefore, restricted to 49 patients. RT-PCR-negative rates on day seven for the control Clinical & virological outcomes: Clinical outcomes and nasal CQN groups were assumed at 25 and 60 in the modified intention-to-treat patients were noted per cent and on day 10 at 67 and 95 per cent, as uniformly good (Table I). No significant difference respectively. Accounting for alpha and beta errors was noted in the day 0 Ct values of the asymptomatic at 0.05 and 0.2, the sample size calculations further and symptomatic patients. Sequential Ct values plotted corroborated that this sample size would be appropriate. from days 0 to 10 indicated towards a general trend of improving Ct values (decreasing viral load) in both Statistical analysis: Baseline categorical and continuous arms. Figure 2 compares the means of the Ct values variables were compared between the groups using on days 0, 3, 7 and 10 in the two arms indicating to Fisher’s exact test and unpaired t test/Wilcoxon rank- no differences, but a trend favouring the control arm sum test, respectively. The means of Ct values on days (day 10, P=0.06). 0, 3, 7 and 10 were compared between the groups over a period using generalized estimating equations. A depiction of the results in categorical RT-PCR The proportions on RT-PCR positive/negative and negative/positive but non-infective/positive and infective/non-infective on days 7 and 10 were assessed infective terms is presented in Figure 3. In terms of by the odds ratio (OR) and the Chi-square test. All the infectivity (Ct<33), no significant difference was statistical analysis was carried out using STATA 15.0 identified in the two groups on day seven or day 10. (StataCorp LP, Texas, USA). In terms of the positive/negative binary, a similar trend was noted in both groups till day seven; however, on Results day 10, a significantly greater number of negative Figure 1 shows the CONSORT diagram of the results were noted in controls (18/25) than in the nasal trial. The baseline characteristics of the two groups CQN group (10/24) [OR 3.6, 95% confidence interval are summarized in Table I. No serious adverse events 1.09-11.85, P=0.032]. were reported. The nasal CQN arm had seven of 30 RT-PCR-negative, high-risk exposure group: The nine patients reporting minor local irritation from the drops, false-positive patients constituted a unique subgroup and one of these also reported additional nausea. One which was negative at day 0 but at high risk of patient missed the drops for one day (day 5). One other continuing exposure by nature of being in a COVID- patient was altogether non-compliant and did not take designated isolation facility. Patients received treatment the drops after the first dose. and observations as per the allocated randomization The day 0 test sample tested negative (Ct>35) in 11 arm. Figure 4 illustrates the temporal trends in the of 60 patients. Since all virological assessments were Ct values. In the four patients not using nasal CQN, undertaken in composite batches, with all four tests of Ct values dipped significantly to indicate to definite a particular patient undertaken as a single batch, these RT-PCR positivity (Ct<35) and also to infectivity tests were only available after day 10 and completion (Ct<33) in three of four. The patients using nasal CQN, of all treatments. in contrast, showed stable Ct levels. 154 INDIAN J MED RES, January & February 2021

Enrolment Assessed for eligibility (n=359)

Excluded (n=299) ¨ Not meeting inclusion criteria (n=265) ¨ Part of other trials (n=34)

Randomized (n=60)

Allocation Allocated to control arm (n=30) Allocated to nasal CQN arm (n=30) ¨Received allocated intervention (n=30) ¨Received allocated intervention (n=30)

Follow up Lost to follow up (n=0) Lost to follow up (n=0) Discontinued intervention (n=0) Discontinued intervention (n=1)

Analysis ¨Intention-to-treat analysis (n=30) ¨Intention-to-treat analysis (n=30) ¨Modified intention-to-treat analysis (n=25) ¨Modified intention-to-treat analysis (n=24) (n=5 Inclusion error; Day0 confirmatory (n=6 Inclusion error; Day0 confirmatory RT-PCR negative) RT-PCR negative)

Fig. 1. Trial CONSORT diagram. CQN, chloroquine; RT-PCR, reverse transcription-polymerase chain reaction.

Nasal CQN (n=24) Control (n=25) evaluating a new route of administration, a few leads 40 P=0.06 were obtained. Intranasal CQN (0.03%) was noted as P=0.94 safe and well tolerated. The clinical outcomes were 35 uniformly good in the subset of patients with mild/ =0.63 P asymptomatic infection. The good clinical outcomes in the control group indicated that a large sample size 30 P=0.95 would be required to demonstrate the effect of any intervention in mild COVID-19 on the basis of clinical 25 outcomes alone. The present trial did not show any in vivo antiviral efficacy of intranasal CQN drops in

Cycle threshold (Ct) mean patients with mild but established illness. Recent trials 20 on systemic HCQ in COVID-19 have relied on mortality as the outcome measure9-12. Mortality as an outcome 15 measure may be influenced by both the efficacy of 03710 treatment and its toxicity. The outcome measure in this Day study was the sequential RT-PCR Ct values of every Fig. 2. Means of Ct values in control and nasal chloroquine groups individual patient from days 0 to 10. Post hoc analysis on days 0, 3, 7 and 10. Ct, cycle threshold. exploring the role of intranasal CQN in pre-exposure prophylaxis demonstrated Ct values turning positive Discussion for COVID-19 infection with dips below the threshold Despite the small sample size of the study of positivity (Ct<35) and infectivity (Ct<33) in three considered as appropriate for an exploratory study of four patients not receiving nasal CQN. In contrast, THAKAR et al: NASAL CHLOROQUINE DROPS FOR MILD COVID-19 155

Table I. Clinical and demographic characteristics of patients Clinical and demographic features Intention‑to‑treat group (n=60) Post‑exclusion for enrolment error modified intention‑to‑treat group (n=49)* Control Nasal CQN Control Nasal CQN (n=30) (n=30) (n=25) (n=24) Age (yr), mean±SD 34.2±9.4 35.6±11.3 34.4±9.4 35.41±11.7 Range 18‑58 18‑58 18‑58 18‑58 Sex Male 21 26 17 21 Female 6 4 5 3 Transgender 3 0 3 0 Comorbidities 1 0 1 0 Smoking/oral tobacco Yes 6 3 5 3 Quit 1 0 1 0 Never 23 27 19 21 BCG vaccination 30 28 25 22 Contact history Known 21 20 18 16 Unknown 9 10 7 8 Symptoms at presentation Asymptomatic 23 24 20 18 Symptomatic 7 6 5 6 Days since symptomatic (n=13) 5.6 5 3.4 5 Median (range) 3 (2‑12) 3 (1‑10) 3 (2‑5) 3 (1‑10) Breath holding time at presentation (sec), mean±SD 28.5±0.5 29.1±0.44 28.6±2.8 29.2±2.6 NEWS at presentation 0 28 28 24 22 1 2 1 1 1 2 0 1 0 1 NEWS progression 01 1 0 0 0 02 0 0 0 0 12 0 0 0 0 23 0 0 0 0 *Modified intention‑to‑treat group‑ excluding patients with day 0 RT‑PCR negative for COVID‑19 (n=11). CQN, chloroquine; SD, standard deviation; BCG, bacille Calmette‑Guerin; RT‑PCR, reverse transcription‑polymerase chain reaction; NEWS, National Early Warning Score patients receiving nasal CQN maintained non-infected with continuing high-risk exposure and additionally status. No valid conclusion can be drawn because of had treatment as per randomization. This has afforded small sample size. Since the false-positive tests and an opportunity to assess the impact of nasal CQN on a consequent enrolment errors were only identified post hoc basis in a small number of uninfected patients after completion of all observations, all such patients wherein ethical issues may otherwise restrict such a continued to be resident in the COVID care facility randomized intervention. 156 INDIAN J MED RES, January & February 2021

Table II. Details of patients excluded as day 0 RT‑PCR negative (n=11) Patient Arm Symptoms Indication for NEWS Ct number testing Day Day 0 3 7 10 0 3 7 10 5 Nasal CQN Nil Contact tracing 0 0 0 0 UD UD UD UD 8 Control Fever, sore throat ×12 days Symptomatic 1 1 0 0 UD 35.2 UD UD 11 Control Nil Contact tracing 0 0 0 0 37.3 UD 32.8 37.4 16 Nasal CQN Nil Contact tracing 0 0 0 0 UD 35.9 34 UD 19 Control Chest discomfort, fever Symptomatic, 0 0 0 1 36.2 36.6 37.2 UD ×10 days Healthcare worker 21 Nasal CQN Nil Contact tracing 0 0 0 0 35 UD UD UD 22 Nasal CQN Nil Contact tracing 0 0 0 0 40 UD UD 34.8 23 Control Nil Contact tracing 0 0 0 0 35.7 35.1 32.6 30.4 31 Nasal CQN Nil Contact tracing 0 0 0 0 37.6 35.1 UD UD 58* Nasal CQN Nil Contact tracing 0 0 0 0 UD UD 37 34.5 59 Control Nil Contact tracing 0 0 0 0 36.7 25.8 UD 34.9 *Poor compliance‑did not use the drug after first dose instillation. Ct, cycle threshold; UD, undetected

Control (n=25) Control Infective Ct<33 Positive non-infective 33≤Ct<35 Negative Ct≥35 P11 P23 P58 P59 25 42 20 40 15 38 10 36 Ct=35 5 34 Number of patients 0 32 03710 Ct values Day 30 28 Nasal CQN (n=24) 26 Infective Ct <33 Positive non-infective 33≤Ct<35 Negative Ct≥35 24 25 0246810

20 Day

15 Nasal CQN 10 P5 P16 P21 P22 P31 5 42 Number of patients 0 40 03710 Day 38 36 Ct=35 Fig. 3. Bar chart showing the distribution of infective (Ct<33), positive but non-infective (33≤Ct<35) and negative (Ct≥35) test 34 results from days 0 to 10 in the two groups. 32 Ct values 30 28 Emerging recent data in severe COVID-19 26 with systemic CQN have also not demonstrated any 24 9-12 0246810 improvement in mortality . Our literature review Day identified four systematic reviews and meta-analysis Fig. 4. Temporal trends of Ct values in the non-infected but high-risk focussing on the role of CQ/HCQ in the treatment exposure group (n=9). P, patient. of COVID-19. None of the studies could provide high-quality evidence in favour of a therapeutic benefit was only noted if CQN was administered before of CQ/HCQ in COVID-19 (Table III)20-23. The in vitro the inoculation of the HCoV-OC43 virus. In vitro data and animal studies of Keyaerts et al2 previously administration of CQN to the culture medium even indicated that the activity of CQN on SARS-CoV two hours after the viral inoculation was noted as THAKAR et al: NASAL CHLOROQUINE DROPS FOR MILD COVID-19 157

Table III. Some selected systematic reviews and meta‑analysis of chloroquine/hydroxychloroquine in the treatment of COVID‑19 Study Number of studies (n) Pooled RR (95% CI) Toxicity RR (95% CI) Comments Elavarasi et al20 Observational ‑ 12 Mortality: −0.98 (0.66‑1.46) ECG changes/ Quality of evidence was RCT ‑ 3 (CQ/HCQ: Time to fever resolution: arrhythmias: 1.96 found to be low Control: 5713:4966) −0.54 days (−1.19‑0.11) (1.46‑2.06) HCQ/CQ did not improve Clinical deterioration: 0.90 clinical outcomes (0.47‑1.71) Zang et al21 RCT ‑ 3 Conversion to negative Not available No robust evidence to Observational ‑ 4 RT‑PCR: 1.11 (0.77‑1.59) support the role of CQ/HCQ (n=851) Rate of exacerbated in treatment of COVID‑19 pneumonia: 0.44 (0.20‑0.94) Death: 1.92 (1.26‑2.93) Wang et al22 42 studies Death: 1.08 (0.81‑1.44) Not available Significant benefit of HCQ/ Severe cases: 1.05 CQ in the treatment of (0.61‑1.81) COVID‑19 could not be demonstrated Yang et al23 9 studies (n=4122) Increased mortality in CQ/ No effect on QT Faster virological clearance HCQ: 2.34 (1.63‑3.36) prolongation with HCQ and azithromycin Viral clearance: 27.18 combination, but increased (1.29‑574.32) mortality risk HCQ, hydroxychloroquine; RR, relative risk; CI, confidence interval; RCT, randomized controlled trial ineffective2. The data from this pre-clinical study efficacy was demonstrated in patients with established provide an explanation for the clinical disappointment infection. Favourable virus load trends were however, with CQN/HCQ in established infection but indicate noted when administered pre-infection but the findings to its potential when used in the setting of prophylaxis were limited due to small sample. Further studies with before infection. a large sample size should be done to reach to a valid Observational data from South Korea in a long- conclusion. term healthcare facility with oral CQN administered Acknowledgment: Authors acknowledge Drs Sanjay Gupta, 6-106 h following low-risk exposure to COVID-19 Dhananjay Tiwary, Kalaivani Mani and Biswajeet Sahoo for their have suggested to complete effectiveness in support in conducting this clinical trial. preventing infection as assessed by RT-PCR on 24 day 14 . A randomized study assessing post- Financial support & sponsorship: AIIMS Research Grant exposure prophylaxis in high- and moderate-risk (Grant No. F.8-A-COVID-11/2020/RS) supported the study. exposure, however, noted of no efficacy in limiting symptomatic infection25. Recent case-control data Conflicts of Interest: None. from India indicated that pre-exposure prophylactic HCQ administered weekly for >four weeks provided References protection from COVID-19 infection in exposed 1. Keyaerts E, Vijgen L, Maes P, Neyts J, Van Ranst M. In vitro 15 healthcare workers . Another large interventional inhibition of severe acute respiratory syndrome coronavirus study is currently testing pre-exposure prophylaxis in by chloroquine. Biochem Biophys Res Commun 2004; 323 : exposed healthcare workers26. 264-8. 2. Keyaerts E, Li S, Vijgen L, Rysman E, Verbeeck J, The present study was limited by its small sample Van Ranst M, et al. Antiviral activity of chloroquine against size, thus reducing its power to draw definitive human coronavirus OC43 infection in newborn mice. conclusions. The bioavailability and absorption of the Antimicrob Agents Chemother 2009; 53 : 3416-21. drug in the tissues was not tested, though previous 3. Wang M, Cao R, Zhang L, Yang X, Liu J, Xu M, et al. Remdesivir experience from the ophthalmology literature indicated and chloroquine effectively inhibit the recently emerged novel to its local efficacy (and presumed absorption)17,18. coronavirus (2019-nCoV) in vitro. Cell Res 2020; 30 : 269-71. 4. Yao X, Ye F, Zhang M, Cui C, Huang B, Niu P, et al. In vitro This exploratory trial showed the safety profile of antiviral activity and projection of optimized dosing design 0.03 per cent nasal CQN. No significant evidence of of hydroxychloroquine for the treatment of severe acute 158 INDIAN J MED RES, January & February 2021

respiratory syndrome coronavirus 2 (SARS-CoV-2). Clin 15. Chatterjee P, Anand T, Singh KJ, Rasaily R, Singh R, Das S, Infect Dis 2020; 71 : 732-9. et al. Healthcare workers & SARS-CoV-2 infection in India: 5. Savarino A, Di Trani L, Donatelli I, Cauda R, Cassone A. A case-control investigation in the time of COVID-19. Indian New insights into the antiviral effects of chloroquine. Lancet J Med Res 2020; 151 : 459-67. Infect Dis 2006; 6 : 67-9. 16. Royal College of Physicians. National Early Warning 6. Gao J, Tian Z, Yang X. Breakthrough: Chloroquine Score (NEWS) 2. Available from: https://www.rcplondon. phosphate has shown apparent efficacy in treatment of ac.uk/projects/outputs/national-early-warning-score-news-2, COVID-19 associated pneumonia in clinical studies. accessed on June 14, 2020. Biosci Trends 2020; 14 : 72-3. 17. Titiyal JS, Kaur M, Falera R, Bharghava A, Sah R, Sen S, 7. Gautret P, Lagier JC, Parola P, Hoang VT, Meddeb L, et al. Efficacy and safety of topical chloroquine in mild to Mailhe M, et al. Hydroxychloroquine and azithromycin as moderate dry eye disease. Curr Eye Res 2019; 44 : 1306- a treatment of COVID-19: Results of an open-label non- 12. randomized clinical trial. Int J Antimicrob Agents 2020; 56 : 18. Bhavsar AS, Bhavsar SG, Jain SM. Evaluation of the effects 105949. of chloroquine phosphate eye drops in patients with dry eye 8. Million M, Lagier JC, Gautret P, Colson P, Fournier PE, syndrome. Int J Biomed Adv Res 2011; 2 : 198-214. Amrane S, et al. Early treatment of COVID-19 patients 19. La Scola B, Le Bideau M, Andreani J, Hoang VT, Grimaldier C, with hydroxychloroquine and azithromycin: A retrospective Colson P, et al. Viral RNA load as determined by cell culture analysis of 1061 cases in Marseille, France. Travel Med Infect as a management tool for discharge of SARS-CoV-2 patients Dis 2020; 35 : 101738. from infectious disease wards. Eur J Clin Microbiol Infect Dis 9. Rosenberg ES, Dufort EM, Udo T, Wilberschied LA, 2020; 39 : 1059-61. Kumar J, Tesoriero J, et al. Association of treatment with 20. Elavarasi A, Prasad M, Seth T, Sahoo RK, Madan K, Nischal N, hydroxychloroquine or azithromycin with in-hospital et al. Chloroquine and hydroxychloroquine for the treatment mortality in patients with COVID-19 in new york state. JAMA of COVID-19: A systematic review and meta-analysis. J Gen 2020; 323 : 2493-502. Intern Med 2020; 35 : 3308-14. 10. Borba MG, Val FF, Sampaio VS, Alexandre MA, Melo GC, 21. Zang Y, Han X, He M, Shi J, Li Y. Hydroxychloroquine use Brito M, et al. Effect of high vs. low doses of chloroquine and progression or prognosis of COVID-19: A systematic diphosphate as adjunctive therapy for patients hospitalized review and meta-analysis. Naunyn Schmiedebergs Arch with severe acute respiratory syndrome coronavirus 2 (SARS- Pharmacol 2020; 1-8. CoV-2) infection: A randomized clinical trial. JAMA Netw Open 2020; 3 : e208857. 22. Wang M, Wu T, Zuo Z, You Y, Yang X, Pan L, et al. Evaluation of current medical approaches for COVID-19: A systematic 11. RECOVERY Trial. No clinical benefit from use of review and meta-analysis. BMJ Support Palliat Care 2020; hydroxychloroquine in hospitalised patients with bmjspcare-2020-002554. COVID-19. Available from: https://www.recoverytrial.net/ news/statement-from-the-chief-investigators-of-the-rand 23. Yang TH, Chou CY, Yang YF, Chien CS, Yarmishyn AA, omised-evaluation-of-covid-19-therapy-recovery-trial-on- Yang TY, et al. Systematic review and meta-analysis of the hydroxychloroquine-5-june-2020-no-clinical-benefit-from- effectiveness and safety of hydroxychloroquine in treating use-of-hydroxychloroquine-in-hospitalised-patients-with- COVID-19 Patients. J Chin Med Assoc 2020. doi: 10.1097/ covid-19, accessed on June 26, 2020. JCMA.0000000000000425. 12. Solidarity Clinical Trial for COVID-19 Treatments. Available 24. Lee SH, Son H, Peck KR. Can post-exposure prophylaxis for from: https://www.who.int/emergencies/diseases/novel- COVID-19 be considered as an outbreak response strategy in coronavirus-2019/global-research-on-novel-coronavirus- long-term care hospitals? Int J Antimicrob Agents 2020; 55 : 2019-ncov/solidarity-clinical-trial-for-covid-19-treatments, 105988. accessed on June 26, 2020. 25. Boulware DR, Pullen MF, Bangdiwala AS, Pastick KA, 13. Del Rio C, Malani P. Translating science on COVID-19 to Lofgren SM, Okafor EC, et al. A randomized trial of improve clinical care and support the public health response. hydroxychloroquine as postexposure prophylaxis for JAMA 2020; 323 : 2464-5. COVID-19. N Engl J Med 2020; 383 : 517-25. 14. Risch HA. Early outpatient treatment of symptomatic, high- 26. ClinicalTrials.gov. Healthcare Worker Exposure Response and risk COVID-19 patients that should be ramped up immediately Outcomes of Hydroxychloroquine (HERO-HCQ). Available as key to the pandemic crisis. Am J Epidemiol 2020; 189 : from: https://clinicaltrials.gov/ct2/show/NCT04334148, accessed 1218-26. on June 23, 2020.

For correspondence: Dr Alok Thakar, Department of Otorhinolaryngology & Head & Neck Surgery, All India Institute of Medical Sciences, New Delhi 110 029, India e-mail: [email protected] Indian J Med Res 153, January & February 2021, pp 159-165 Quick Response Code: DOI: 10.4103/ijmr.IJMR_3541_20

SARS-CoV-2 detection in sewage samples: Standardization of method & preliminary observations

Deepa Kailash Sharma1, Uma Prajwal Nalavade1, Kamlesh Kalgutkar1, Nivedita Gupta2 & Jagadish Mohanrao Deshpande1

1ICMR-National Institute of Virology, Mumbai Unit, Mumbai, Maharashtra & 2Division of Epidemiology & Communicable Diseases, Indian Council of Medical Research, New Delhi, India

Received August 18, 2020

Background & objectives: Since its first recognition in Wuhan, China, in December 2019, the SARS-CoV-2 has spread rapidly across the world. Though SARS-CoV-2 spreads mainly via the droplets of respiratory secretions, it was also detected in stool samples of patients, indicating active infection of the gastrointestinal tract. Presence of SARS-CoV-2 RNA in sewage samples was reported in February 2020, raising the possibility of using environmental water surveillance to monitor SARS-CoV-2 activity in infected areas. The aim of this study was to standardize the methodology for detection of SARS-CoV-2 from sewage and explore the feasibility of establishing supplementary surveillance for COVID-19. Methods: Sewage specimens were collected from six sites in Mumbai, India, using the grab sample method and processed using polyethylene glycol (PEG)-dextran phase separation method for virus concentration. Real-time reverse transcription-polymerase chain reaction (RT-PCR) assay was used to detect the presence of SARS-CoV-2 RNA. Results: A total of 20 sewage samples collected from six different wards in Mumbai city, before the spread of SARS-CoV-2 infections and during May 11-22, 2020, were processed using the phase separation method. The WHO two-phase PEG-dextran method was modified during standardization. SARS-CoV-2 was found to concentrate in the middle phase only. All samples collected before March 16, 2020 were SARS-CoV-2 negative. Viral RNA was detected in sewage samples collected during the ongoing COVID-19 pandemic in all the six wards. Interpretation & conclusions: PEG-dextran phase separation method was effectively used to concentrate SARS-CoV-2 from domestic waste waters to detection levels. It would be feasible to initiate sewage surveillance for SARS-CoV-2 to generate data about the viral transmission in various epidemiologic settings.

Key words COVID-19 - RT-PCR - SARS-CoV-2 - sewage - two-phase separation

The World Health Organization (WHO) declared The virus spread quickly across countries due to its COVID-19 a global pandemic on March 11, 20201. respiratory route of spread and also the presence

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 159 160 INDIAN J MED RES, January & February 2021 of susceptible population globally2. The unique (polyethylene glycol 6000) (Sigma, USA) and 35 ml feature of SARS-CoV-2 infection is the prolonged of 5 M NaCl (Sigma, USA) were added sequentially shedding of virus in stools, with viral load being high with constant mixing. The mixture was stirred for one in stool samples3. While the major focus remains on hour at 4°C before setting up phase separation. The containment zones, it is critical to ensure adequate sample was transferred to a one litre separating funnel surveillance in apparently low-transmission zones to and allowed to stand at 4°C for 16 h for partitioning monitor the disease trends. Such surveillance includes of the virus into one of the phases5-7. After phase serological assays to understand the seroprevalence separation, the lower, middle/inter and upper phases of infection and in turn the disease transmission were collected individually for SARS-CoV-2 detection dynamics. However, because prolonged shedding by real-time reverse transcription-polymerase chain of SARS-CoV-2 RNA has been reported in stool reaction (RT-PCR)8. samples of both symptomatic and asymptomatic infected individuals3, sewage surveillance seems to be RNA extraction and real-time RT-PCR: Viral RNA was a useful tool for monitoring the trend of COVID-19 extracted from the clarified sewage sample and the three disease in high- as well as low-transmission zones. phases using QIAamp Viral RNA Mini Kit (QIAGEN, Sewage surveillance has been used successfully as a Germany) according to the manufacturer’s instructions. tool to monitor the shedding of SARS-CoV-2 in stool Presence of SARS-CoV-2 was inferred by detecting samples in The Netherlands4. Presence of live virus envelope (E) and RNA-dependent RNA polymerase in stool and the subsequent implications on faeco- (RdRp) genes amplification using LabGun COVID-19 oral transmission are still debated. Here, we describe real-time RT-PCR kit (LabGenomics, The Republic of Korea) as per the manufacturer’s instructions. The the methodology standardized at the ICMR-National kit manufacturer set a cut-off cycle threshold (Ct) for Institute of Virology, Mumbai Unit, Mumbai, India, scoring a clinical sample positive for SARS-CoV-2 for sewage surveillance for COVID-19. It was further as Ct ≤40. The following reaction conditions were planned to explore the feasibility of establishing used: 50°C for 30 min, 45 cycles of 95°C for 15 min, sewage surveillance for COVID-19. 95°C for 15 sec and 60°C for one minute in a 7500 Material & Methods real-time PCR system (Applied Biosystems, USA). The RNA extracted from the clarified sewage sample Sewage samples were collected from a total of six and the lower, middle and upper phases was tested for sites in Mumbai, India. One of the sites was a sewage SARS-CoV-2 RNA. Samples showing sigmoid curves pumping station and the remaining sites were large of increasing fluorescence intensity in both the gene open drains. Samples collected before the COVID-19 segments were considered positive for the virus. pandemic were available from each site. Fresh sewage samples were collected between May 11-22, 2020. One Results litre grab sample of sewage was collected by lowering a bucket in the flowing sewage water. The sample The six sewage collection sites were chosen for was transferred to a glass bottle containing 100 ml detecting SARS-CoV-2 because of the presence of chloroform and a stirrer bar. The bottle contents were large slum-like areas housing low socio-economic mixed well at the site. Samples were collected between groups and substantial migrant populations. 1000 and 1130 h. The samples were transported to the These same sites were being used for poliovirus testing laboratory on wet ice within two hours. Personal environmental surveillance (ES). The Wadala pumping protection equipment including face shield were used station (Ward F/N) was the only site where piped for protection. Materials used for sample collection sewage was collected. Table I presents the date of the were autoclave sterilized in the laboratory. first COVID-19 case and the increasing intensity of the pandemic in each ward. The first COVID-19 case in Sample processing for viral concentration: The sewage Mumbai was reported on March 11, 2020. The selected samples with chloroform were mixed thoroughly using wards experienced COVID-19 cases in the mid-March, a magnetic stirrer for 30 min at 4oC. The samples and the case numbers increased from <20 in the early were centrifuged at 3000 × g for 20 min at 4°C and April to more than 1000 by the mid-May 2020. At least supernatant was collected. To 500 ml clarified sewage one sewage sample collected before the COVID-19 sample, 39.5 ml of 22 per cent (w/w) dextran T40 outbreak and two samples during the COVID-19 (Sigma, USA), 287 ml of 29 per cent (w/w) PEG6000 pandemic were used in the study. SHARMA et al: SARS-CoV-2 DETECTION IN SEWAGE SAMPLES 161

Table I. Confirmed COVID-19 cases in BMC wards where sewage samples were collected during May 11-22, 2020 Sewage site BMC ward Population COVID-19 cases as of date Date of the first case in March 2020 April 4 May 22

Wadala F north 551079 20 5 1534 Dharavi G north 627744 30 4 1969 Kurla L 928813 22 6 1450 Shivaji Nagar M east 840461 Not available 17 1140 Malad P north 983421 22 18 534 Kanjur S 773365 15 11 1373 (May 26)

As shown in Figure 1, PEG-dextran in water was separated in three phases, partitioning molecules as per their characteristics. If SARS-CoV-2 partitioned into lower or middle phase, it would get concentrated, enabling detection by PCR. The volume of middle phase varied from 2.2 to 4.5 ml (mean=2.7 ml) which was approximately 200-fold concentration if the virus partitioned into this phase and 7 to 10 ml (mean=8.3 ml) for the lower phase with a concentration factor of approximately 60-fold. In SARS-CoV-2 spiked sewage concentrates, no inhibitory effects of PEG/dextran T40 were observed (data not shown). Real-time RT-PCR amplification curves of SARS-CoV-2 E and RdRp genes are presented in Figure 2. Figure 2A and B show completely flat Fig. 1. Separating funnel showing three phases of PEG6000- curves for all the four RNA extracts (clarified dextranT40-sewage sample mixture after 16 h at 4°C. The lower, middle and upper phases were collected individually sewage and that in lower, middle and upper phases) for RNA extraction. of a sewage sample collected in February 2020; figure 2C and D show the amplification curves of The final results of the 20 samples collected a sample collected in May 2020. RNA extracted from the six sites before and during the COVID-19 from the middle phase gave the lowest Ct values of pandemic period are shown in Table III. None of the amplification for both the genes. The Ct values of sewage samples (from any site) collected before March middle phase RNA extracts were 3-9 points lower 20, 2020 showed amplification of E and RdRp genes than the corresponding clarified sewage samples, of SARS-CoV-2 RNA. In the absence of COVID-19 confirming that SARS-CoV-2 partitioned only cases, the sewage concentrates (lower/middle phases) to the middle phase (Table II). Sewage samples did not show any false-positive amplification in E and with middle phase Ct values lower by 3 or more RdRp genes real-time RT-PCR. All sewage samples points were considered positive for SARS-CoV-2. collected in May 2020 (except one sample from Kurla) Amplification curves (Ct >39) in the other phases were positive for SARS-CoV-2 (Ct values <36 for both could be due to a minor fraction of the viral particles E and RdRp genes for RNA extracted from the middle or viral RNA that did not partition to the middle phase. phase). Amplification curves with Ct >39 were observed in the RNA extracted directly from the sewage samples Although it may be tempting to argue that the late collected in May 2020 when the number of COVID-19 amplification (Ct >39) could be SARS-CoV-2 RNA cases was increasing rapidly. Improved (lower) Ct specific, but we suggest that a viral concentration step values after concentration in the middle phase provided be included and improvement of Ct value by about 3 evidence of the presence of the virus. points be used for the interpretation of positive results 162 INDIAN J MED RES, January & February 2021

A B

C D

Fig. 2. Results of E and RdRp genes real-time RT-PCR of RNA extracted from clarified sewage and the three phases after phase separation. (A and B) SW-3713 (February 3, 2020); (C and D) SW-3737 (May 12, 2020). PC, positive control; CS, clarified sewage; L, lower phase; U, upper phase; M, middle phase. SARS-CoV-2 concentrated in to the middle phase. No amplification seen in SW-3713, the pre-COVID-19 sample. until substantial additional data become available The GPLN-validated PEG-dextran two-phase from several different SARS-CoV-2-infected and separation method to concentrate poliovirus from non-infected regions. sewage recommends collection of the entire lower Discussion and interphase sample and treat it with chloroform to inactivate microbial contamination to render it A global emergency of pandemic was declared compatible for virus isolation in cell cultures7. We, by the WHO on March 11, 2020 after the detection of therefore, decided to employ the same two-phase 1 SARS-CoV-2 in Wuhan, China, in December 2019 . separation methodology to concentrate and detect The virus was found to be transmitting via respiratory SARS-CoV-2 in sewage samples. route. However, SARS-CoV-2 RNA was also found to be excreted in human faeces9. This suggested that Risk analysis showed that SARS-CoV-2, an the virus could be detected from sewage water. ES enveloped virus, is inactivated by household bleach, for poliovirus detection has played a critical role detergents/soaps and lipid solvents11. Sewage samples in the eradication of wild poliovirus globally. The were collected in chloroform-containing bottles to WHO-Global Polio Laboratory Network (GPLN) has inactivate the virus to further mitigate the risk and to established supplemental surveillance for polioviruses allow sample handling in BSL-2 (Biosafety level 2) by testing sewage samples in several countries10. In laboratories. This became the first modification of the India, ES was first initiated in Mumbai city in 2001 WHO two-phase protocol. In our initial experiments by ICMR-National Institute of Virology, Mumbai with spiked sewage samples, SARS-CoV-2 could not Unit (formerly known as ICMR-Enterovirus Research be effectively concentrated in the lower phase (lower Centre). and middle layers collected together) collected as per SHARMA et al: SARS-CoV-2 DETECTION IN SEWAGE SAMPLES 163

Table II. Results of real-time RT-PCR tests on RNA extracted from phase separation of sewage samples for SARS-CoV-2 detection Sample_ID Site SARS-CoV-2 real time RT-PCR result Ct values for gene E Ct values for gene RdRp Clarified Lower Middle Upper Clarified Lower Middle Upper sewage phase phase phase sewage phase phase phase SW-3713 Dharavi UD UD UD UD UD UD UD UD SW-3731 UD UD UD UD UD UD UD UD SW-3737 38.64 39.4 33.02 UD 39.21 39.77 32.72 UD SW-3741 39.4 37.72 33.15 UD 38.13 37.57 32.36 UD SW-3714 Wadala UD UD UD UD UD UD UD UD SW-3732 UD UD UD UD UD UD UD UD SW-3738 38.74 37.64 33.58 40.86 38.59 37.5 33.25 UD SW-3742 36.35 37.61 31.92 40.95 35.67 37.19 30.96 UD SW-3730 Shivaji Nagar UD UD UD UD UD UD UD UD SW-3740 40.14 43.54 34.53 UD 40.18 41.38 38.76 UD SW-3744 40.17 UD 36.27 UD 39.72 41.54 35.79 UD SW-3734 Kurla UD UD UD UD UD UD UD UD SW-3739 40.6 41.07 41.94 UD 40.56 40.66 39.3 UD SW-3743 40.52 41.52 35.37 41.94 38.28 UD 35.98 UD SW-3729 Kanjur UD UD UD UD UD UD UD UD SW-3745 40.17 37.13 33.24 UD 39.32 38.1 33.5 UD SW-3747 39.34 35.69 35.52 UD 35 34.1 32.85 37.42 SW-3733 Malad UD UD UD UD UD UD UD UD SW-3746 37.33 39.28 33.11 41.84 38.95 41.53 33.64 42.19 SW-3748 37.13 35.65 33.56 40.07 39.83 34.11 30.46 35.25 UD, undetected, no amplification

Table III. Results of SARS-CoV-2 detection in sewage samples collected from six wards in Mumbai before and during the COVID-19 pandemic Site Pre-COVID-19 period During COVID-19 period Date of Result Date of Result Date of Result Date of Result collection collection in collection in collection in March 2020 May 2020 May 2020 Dharavi February 3, 2020 Negative 16 Negative 12 Positive 14 Positive Wadala February 3, 2020 Negative 16 Negative 12 Positive 14 Positive Shivaji X X 11 Negative 13 Positive 15 Positive Nagar Kurla X X 18 Negative 13 Positive 15 Positive Kanjur X X 11 Negative 16 Positive 22 Positive Malad X X 18 Negative 16 Positive 22 Positive X, samples not available for testing 164 INDIAN J MED RES, January & February 2021 the WHO protocol7. The three layers of upper, middle SARS-CoV-2-infected populations and confirmation and lower were collected separately and tested for of COVID-19-free zones. SARS-CoV-2. The virus was found to be concentrated To conclude, SARS-CoV-2 was detected in only in the middle phase. This was the second and sewage samples collected from six different sites in major modification of the WHO two-phase separation Mumbai during the ongoing pandemic of COVID-19. method introduced during standardization. PEG6000-dextran T40 phase separation method was PEG precipitation and PEG-dextran phase adopted to concentrate SARS-CoV-2 from sewage separation methods are widely used for concentrating samples. The virus was found to partition and viruses5-7. Pre-COVID-19 samples were collected for concentrate specifically at the middle phase. RNA poliovirus ES in our laboratory. Sample collection extracted from the middle phase was suitable for was done during May 11-22, 2020 specifically for SARS-CoV-2 detection by real-time RT-PCR. standardization of the method for detecting SARS- Acknowledgment: Authors acknowledge Prof. (Dr) Balram CoV-2 in sewage samples. Bhargava, Secretary, Department of Health Research, Ministry of None of the pre-COVID-19 sewage samples Health and Family Welfare Government of India, and Director- showed amplification in any of the fractions (phase) General, Indian Council of Medical Research (ICMR), New Delhi; tested, indicating that false amplification did not happen. Dr Raman Ganagakhedkar, National Chair, ICMR, New Delhi, All the samples collected in May 2020 were positive and Prof (Dr) Priya Abraham, Director ICMR-National Institute of for SARS-CoV-2. Thus, the feasibility of using PEG- Virology, Pune, for encouragement, guidance and support. Authors dextran phase separation method for ES of COVID-19 also thank Dr Shailesh D. Pawar, Officer-in-Charge, ICMR- was established. The method may be further simplified National Institute of Virology, Mumbai Unit, for his kind support. by substituting gravity filtration for the centrifugation step and phase separation at ambient temperature. Financial support & sponsorship: This study was Other viral concentration methods may be compared to financially supported by ICMR intramural grant. identify the most suitable one for long-term use. Conflicts of Interest: None. Angiotensin-converting enzyme 2 (ACE2) was identified as the cellular receptor of SARS- References CoV-212,13. ACE2 is expressed on the cells of several 1. Cucinotta D, Vanelli M. WHO declares COVID-19 a different organs including lungs, kidneys and pandemic. Acta Biomed 2020; 91 : 157-60. intestine. About 107 SARS-CoV-2 RNA copies/g 2. Zheng J. SARS-CoV-2: An emerging coronavirus that causes of faeces may be excreted by symptomatic patients a global threat. Int J Biol Sci 2020; 16 : 1678-85. during the first week of the disease9,14. SARS-CoV-2 3. Amirian ES. Potential fecal transmission of SARS-CoV-2: Current evidence and implications for public health. Int J in sewage was first detected in The Netherlands Infect Dis 2020; 95 : 363-70. 4 within weeks after the reports of COVID-19 cases . 4. Medema G, Heijnen L, Elsinga G, Italiaander R, Brouwer Viral concentration was achieved by ultra-filtration A. Presence of SARS-CoV-2 in Sewage. medRxiv 2020. technique. Sewage samples were found to be negative doi: 10.1101/2020.03.29.20045880. for SARS-CoV-2 in the area where the prevalence 5. Deshpande JM, Shetty SJ, Siddiqui ZA. Environmental surveillance system to track wild poliovirus transmission. of COVID-19 was 2.9 cases/100,000 population, Appl Environ Microbiol 2003; 69 : 2919-27. with partial positivity at 3.5 cases/100,000 and 6. Hovi T, Shulman LM, van der Avoort H, Deshpande J, high positivity when the prevalence reached 12.9 Roivainen M, De Gourville EM, et al. Role of environmental cases/100,000 population4. poliovirus surveillance in global polio eradication and beyond. Epidemiol Infect 2012; 140 : 1-3. SARS-CoV-2 detection in waste waters could be 7. World Health Organization. Guidelines for environmental used to understand the epidemiology of COVID-19. surveillance of poliovirus circulation. WHO/V&B/03.03. Available For example, (i) decreasing concentration or absence from: http://polioeradication.org/wp-content/uploads/2016/07/ of virus at previously SARS-CoV-2-positive sewage WHO_V-B_03.03_eng.pdf, accessed on March 1, 2020. sampling sites may indicate successful implementation 8. Wang D, Hu B, Hu C, Zhu F, Liu X, Zhang J, Wang B, et al. Clinical characteristics of 138 hospitalized patients with 2019 of COVID-19 control strategies, and (ii) it may novel coronavirus-infected pneumonia in Wuhan, China. provide evidence of the presence or absence of JAMA 2020; 323 : 1061-69. SHARMA et al: SARS-CoV-2 DETECTION IN SEWAGE SAMPLES 165

9. Zhang N, Gong Y, Meng F, Shi Y, Wang J, Mao P, 12. Zhou P, Yang P, Wang XG, Hu B, Zheng L, Zheng W, et al. A et al. Comparative study on virus shedding patterns in pneumonia outbreak with a new coronavirus of probable bat nasopharyngeal and fecal specimens of COVID-19 patients. origin. Nature 2020; 579 : 270-3. Sci China Life Sci 2020; 1-3. 13. Zhu N, Zhang D, Wang W, Li X, Yang B, Song J, et al. A novel 10. Asghar H, Diop OM, Weldegebriel G, Malik F, coronavirus from patients with pneumonia in China, 2019. Shetty S, El Bassioni L, et al. Environmental surveillance N Engl J Med 2020; 382 : 727-33. for polioviruses in the Global Polio Eradication Initiative. J Infect Dis 2014; 210 (Suppl 1) : S294-303. 14. Woelfel R, Corman M, Guggemos W, Seilmaier M, 11. World Health Organization. Annex G, use of disinfectants: Zange S, Mueller MA, et al. Clinical presentation and Alcohol and bleach. Infection prevention and control of virological assessment of hospitalized cases of coronavirus epidemic- and pandemic-prone acute respiratory infections in disease 2019 in a travel-associated transmission cluster. health care. Geneva: WHO; 2014. medRxiv 2020. doi: 10.1101/2020.03.05.20030502.

For correspondence: Dr Deepa Kailash Sharma, ICMR-National Institute of Virology, Mumbai Unit, Haffkine Institute Compound, AD Marg, Parel, Mumbai 400 012, Maharashtra, India e-mail: [email protected] Indian J Med Res 153, January & February 2021, pp 166-174 Quick Response Code: DOI: 10.4103/ijmr.IJMR_3418_20

Phylogenetic classification of the whole-genome sequences of SARS-CoV-2 from India & evolutionary trends

Varsha Potdar1, Veena Vipat1, Ashwini Ramdasi$, Santosh Jadhav2, Jayashri Pawar-Patil$, Atul Walimbe2, Sucheta S. Patil2, Manohar L. Choudhury1, Jayanthi Shastri3, Sachee Agrawal3, Shailesh Pawar4, Kavita Lole5, Priya Abraham$, Sarah Cherian2,* & ICMR-NIV NIC Team#

1Influenza Group, 2Bioinformatics & Data Management Group, 5Hepatitis Group, $ICMR-National Institute of Virology, Pune, 4ICMR-National Institute of Virology, Mumbai Unit, 3Department of Microbiology, Topiwala National Medical College & B.Y.L. Nair Charitable Hospital, Mumbai, Maharashtra, India

Received August 10, 2020

Background & objectives: Several phylogenetic classification systems have been devised to trace the viral lineages of the severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2). However, inconsistency in the nomenclature limits uniformity in its epidemiological understanding. This study provides an integration of existing classifications and describes evolutionary trends of the SARS-CoV-2 strains circulating in India. Methods: The whole genomes of 330 SARS-CoV-2 samples were sequenced using next-generation sequencing (NGS). Phylogenetic and sequence analysis of a total of 3014 Indian SARS-CoV-2 sequences from 20 different States/Union Territories (January to September 2020) from the Global Initiative on Sharing All Influenza Data (GISAID) database was performed to observe the clustering of Nextstrain and Phylogenetic Assignment of Named Global Outbreak LINeages (Pangolin) lineages with the GISAID clades. The identification of mutational sites under selection pressure was performed using Mixed Effects Model of Evolution and Single-Likelihood Ancestor Counting methods available in the Datamonkey server. Results: Temporal data of the Indian SARS-CoV-2 genomes revealed that except for Uttarakhand, West Bengal and Haryana that showed the circulation of GISAID clade O even after July 2020, the rest of the States showed a complete switch to GR/GH clades. Pangolin lineages B.1.1.8 and B.1.113 identified within GR and GH clades, respectively, were noted to be indigenous evolutions. Sites identified to be under positive selection pressure within these clades were found to occur majorly in the non-structural proteins coded by ORF1a and ORF1b. Interpretation & conclusions: This study interpreted the geographical and temporal dominance of SARS- CoV-2 strains in India over a period of nine months based on the GISAID classification. An integration of the GISAID, Nextstrain and Pangolin classifications is also provided. The emergence of new lineages B.1.1.8 and B.1.113 was indicative of host-specific evolution of the SARS-CoV-2 strains in India. The hotspot mutations such as those driven by positive selection need to be further characterized.

Key words Clades - COVID-19- nucleotide substitution - India - SARS-CoV-2 - selection pressure - whole genomes

#National Influenza Centre Team:S. Bhardwaj, R. Ghuge, S. Jadhav, V. Malik, N. Srivastava, B. Nimhas, H. Kengle, A. Awhale, P. Malsane, S. Bhorekar, V. Autade, M. Shinde, U. Saha, A. Jagtap, P. Shinde, K. Patel, Y.B. Karthick, D. Saini, A. Varma, S. Salve, P. Newase, A. More

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 166 POTDAR et al: INDIAN SARS-CoV-2 WHOLE GENOME CLASSIFICATION 167

Genome sequence analyses of severe acute samples from different States that were referred to the respiratory syndrome coronavirus 2 (SARS-CoV-2) NIV and hence the approval for the study was obtained strains aid in understanding of patterns and from the Institutional Ethics Committee. determinants of the global spread of the pandemic RNA isolation, RT-PCR of clinical samples and next- strain causing coronavirus disease 2019 (COVID-19)1. generation sequencing (NGS): Throat and nasal swab The phylogenetic analysis of the genome sequences samples of suspected cases fulfilling the case definition showed that within a short span from the emergence for SARS-CoV-2 were referred by the hospital of the SARS-CoV-2 virus, the genetic diversity 2,3 authorities and COVID collection centers of State expanded . This resulted in the delineation of the Health Services, Maharashtra, India, to ICMR-NIV, viral strains into clades, lineages and sub-lineages. Pune, for diagnosis of SARS-CoV-2 during the period The Global Initiative on Sharing All Influenza Data 4 from March 9 to September 28, 2020. The detection (GISAID) database (https://www.gisaid.org/) in its of the SARS-CoV-2 was done by using the NIV earliest classification divided SARS-CoV-2 into two reverse transcription-polymerase chain reaction kit as major lineages/clades ‘L’ and ‘S’ based on a mutation per the protocols described earlier8. Positive clinical L84S in the ORF8 protein. Further, for the purpose samples were selected for whole-genome sequencing of consistent reporting based on marker mutations, it representing the geographical districts and disease identified three major clades denoted as G, V and O or severity. an unclassified group. These clades evolved from ‘L’. Further, the clade G was split into sub-clades GH and In brief, 280 μl of each sample in duplicate 5 GR . The GISAID clades are presently augmented with was used for RNA extraction by Qiagen viral more detailed lineages assigned by the Phylogenetic RNA extraction protocol. The extracted RNA was Assignment of Named Global Outbreak LINeages quantified using Qubit® Fluorometer (Invitrogen; (Pangolin tool (https://virological.org/t/pangolin- Thermo Fisher Scientific, Inc., Waltham, MA, USA). web-application-release/482)6. On the other hand, A concentration of 10 ng of RNA was used for Nextstrain7 classified the SARS-CoV-2 initially into cDNA synthesis using the SuperScript™ VILO™ about nine clades referred to as A1a, A2, A2a, A3, A6, cDNA Synthesis Kit (Invitrogen, Carlsbad, CA, B, B1, B2 and B4. These are indicated in the form of USA). Further, two-pool RNA panel libraries were ancestral nodes as 19A, 19B, 20A, 20B and 20C. prepared manually using the Ion AmpliSeq™ Library Thus, it can be noted that several phylogenetic Kit Plus as per the manufacturer’s instructions classification systems based on different approaches (Invitrogen, Carlsbad, CA, USA). The amplified have been devised to trace the viral lineages of the amplicons were partially digested with FuPa reagent SARS-CoV-2 across the globe. Inconsistency in the and were ligated with adaptors with Switch Solution nomenclature systems limits the uniformity in its and DNA Ligase. Purified libraries were quantified epidemiological understanding. In this study, we using the Qubit™ fluorometer or the Agilent™ 2100 describe the genetic lineages of the strains circulating Bioanalyzer™ instrument and diluted to 100 pM. The in India as retrieved from GISAID and provide Ion Chef System was used for template preparation. integration for the SARS-CoV-2 classification systems Purified template beads were submitted to meta- developed by GISAID, Nextstrain and Pangolin. This transcriptome next-generation sequencing (NGS) in study also adds to the whole-genome sequences of the Ion S5 platform (Thermo Fisher Scientific) using an Ion 540™ chip and the Ion Total RNA-Seq kit v2.0, SARS-CoV-2, majorly referred samples from different as per the manufacturer’s protocol (Thermo Fisher districts of Maharashtra during the period from March Scientific). 9 to October 14, 2020. To further understand if adaptive evolution of the clades is being observed in the Indian The Ion AmpliSeq SARS-CoV-2 Research Panel context, selection pressure studies were undertaken. containing target region information was downloaded from Ion AmpliSeq designer (https://ampliseq.com/ Material & Methods login/login.action) and utilized for analysis. Sequence This study was conducted at the National Influenza data were processed using the Torrent Suite Software Centre, ICMR-National Institute of Virology (NIV), (TSS) v5.10.1 (Thermo Fisher Scientific, USA). Pune, India. The genomic analysis was based on Coverage analysis plugins were utilized to generate 168 INDIAN J MED RES, January & February 2021 coverage analysis report for each of the samples. diversification by employing a mixed-effects maximum Reference-based reads gathering and assembly likelihood approach and Single-Likelihood Ancestor were performed for all the samples using Iterative Counting16 that uses a combination of maximum Refinement Meta-Assembler (IRMA)9 developed by likelihood and counting approaches to infer the non- the Centers for Disease Control, USA incorporated synonymous and synonymous rates of substitution for within the TSS. each site. Phylogenetic analysis and classification: The whole- genome sequences from India available in GISAID The overall pipeline of work undertaken in this as of October 14, 2020 with information of the study is depicted in Figure 1. sampling location (State information) (n=3014) were Results used as a starting dataset for this study. The selected sequences were aligned using MAFFT v.7.45010, and The whole-genome sequencing for 330 strains phylogenetic analysis was undertaken using MEGA from Maharashtra (n=328) and Karnataka (n=2) was v.611 based on the neighbour-joining approach with undertaken as a part of this study. The details of the the composite likelihood as the substitution model. study samples and the sequences obtained including Further, the classification of the Indian sequences into the per cent of reads mapped, total reads and the the Nextstrain assigned new clades and the Pangolin per cent of genome coverage recovered are provided in nomenclature for clades/sub-clades was done using Supplementary Table I. the respective tools directly. However, the GISAID Phylogenetic analysis (Supplementary Fig. 1) nomenclature was assigned by the phylogeny and revealed that the genomes from different parts of India mutations noted. (n=3014) could be classified under seven clades, viz. S, V, G, GR, GH, L and O, identified by the GISAID Identification of synonymous/non-synonymous on the basis of the marker mutations as shown in substitutions in dominant Pangolin lineages in Table I. The genetic make-up of the Indian sequences India: The nucleotide substitutions were identified revealed that overall, the proportion of strains in clade by comparing the alignment of all the Indian SARS- G (including GH and GR) were found to be highest CoV-2 genomes against the reference human SARS- (74.98%) followed by strains in O (unclassified CoV-2 genome from Wuhan (NC_045512.2) using category) (21.53%) (Fig. 2A and Supplementary NUCmer version 3.112. The resulting list of nucleotide Table II). Within the G clade, the highest proportion variations was translated into synonymous and non- was noted in the GR clade. Fig. 2B represents the synonymous amino acid changes using a previously equivalence between the GISAID nomenclature and developed R script13 and the updated list of gene features from NCBI RefSeq SARS-CoV-2 genome the Pangolin lineages for the Indian SARS-CoV-2 annotation (https://www.ncbi.nlm.nih.gov/sars-cov-2/). sequences. As per the Pangolin nomenclature, majority The substitutions which were present in more than 75 per cent of the sequences of only one lineage with a minimum of 10 representing genomes were considered as the substitutions characterizing the specific lineage.

Selection pressure analysis: Selection pressure analysis was performed using the Datamonkey adaptive evolution server14. The sequences were separated into different datasets based on the GISAID clades. For each clade, if the number of sequences was >500, then redundant (100% identical) sequences were removed. Further, if still the number of sequences exceeded 500, then random selection of 500 sequences was done. Stop codons were replaced by gaps. The individual codon sites under diversifying selection pressure were identified by employing two methods: Mixed Effects Model of Evolution15 method which detects episodic Fig. 1. Workflow for SARS-CoV-2 data analysis. POTDAR et al: INDIAN SARS-CoV-2 WHOLE GENOME CLASSIFICATION 169

Table I. Establishing an equivalence between the Global Initiative on Sharing All Influenza Data (GISAID), Nextstrain and Phylogenetic Assignment of Named Global Outbreak LINeages (Pangolin) nomenclature systems with respect to the genome sequence data from India (n=3014) GISAID clades Nextstrain Dominant Pangolin lineages Major marker mutations G 20A B.1, B.1.80 S: D614G GR 20B B.1.1.32, B.1.1, B.1.1.8 S: D614G + N: G204R GH 20C B.1.113, B.1.36 S: D614G + nsp3:Q57H V 19A B.2.1 nsp6:L37F + nsp3:G251V L (Ref. seq. WIV04) 19A B ‑ S 19B A ORF8:L84S O 19A B.6, B.4 ORF1a: L3606F

A B

Fig. 2. Sunburst diagrams coloured according to Global Initiative on Sharing All Influenza Data (GISAID) clades showing relationship between GISAID and Phylogenetic Assignment of Named Global Outbreak LINeages (Pangolin) annotations on the inner and outer circles, respectively for the Indian SARS-CoV-2 genomes (n=3014). (A) The proportionate chart showing dominant Pangolin corresponding to each of the GISAID clades (The count for individual clades/lineages is shown in Supplementary Table II). (B) The schematic representation of association between the GISAID clades and the Pangolin lineages. of the Indian sequences belonged to sub-lineages On the basis of the new nomenclature by Nextstrain B.1.1.32, B.6, B.1, B.1.1, B.1.113 and B.1.1.8 (Fig. 2, as per the ancestral nodes, majority of the sequences Supplementary Fig. 1 and Supplementary Table II). fell into the cluster having ancestral nodes as 20A and 20B and others fell into clusters with nodes as 19A, Other than the major globally circulating clades 19B and 20C (Supplementary Table II). The Nextstrain that possessed the marker mutations as shown in clade assignment was retrieved as on 14 October 2020. Table I, mutations specific to the dominant Indian Extrapolating to the Nextstrain old nomenclature for Pangolin lineages were identified (Table II). As per classification, it could be seen that the Indian strains the Pangolin lineage summaries (https://cov-lineages. could be classified into clades A2a, A1a, A3, B, B4 and org/lineages.html), some of the lineages most likely O (Supplementary Table III). to have evolved in India are B.1.113 (n=372), B.1.1.8 The State-wise distribution of the SARS-CoV-2 (n=193), A.7 (n=23) and A.9 (n=6). Among these, the genomes classified as per the different GISAID clades is major lineage B.1.1.8 was found to possess unique shown in Fig. 3. A comparison of these genetic variants mutations nsp3:S1285F and ORF3a:L46F, while in the Indian States wherein sufficient sequence data B.1.113 possessed S194L in the N protein (Table II). were available (Supplementary Table IV) was done. 170 INDIAN J MED RES, January & February 2021

Table II. Synonymous and non‑synonymous substitutions characterizing the dominant Phylogenetic Assignment of Named Global Outbreak LINeages (Pangolin) in India Pangolin Synonymous substitution Non‑synonymous substitutions Untranslated lineage Nucleotide Gene (amino‑acid Nucleotide Gene (amino‑acid change) nucleotide variation change) variation change B.1.113 C22444T S (D294D) C28854T N (S194L) ‑ B.1.1.32 C313T NSP1 (L16L) C5700A nsp3 (A994D)/ORF1ab (A1812D) ‑ B.1.1.8 G4354A NSP3 (E545E)/ C6573T nsp3 (S1285F)/ORF1ab (S2103F) ‑ ORF1ab (E1363E) C25528T ORF3a (L46F) B.1.80 C3634T NSP3 (N305N)/ ‑ ORF1ab (N1123N) C15324T NSP12b (N619N) B.4 T28688C N (A138A) C884T nsp2 (R27C)/ORF1ab (R207C) 3’UTR G1397A nsp2 (V198I)/ORF1ab (V378I) (G29742T) G8653T nsp4 (M33I)/ORF1ab (M2796I) G11083T nsp6 (L37F)/ORF1ab (L3606F) B.6 C13730T nsp12b (A88V) ‑ C28311T N (P13L) C6312A nsp3 (T1198K)/ORF1ab (T2016K) G11083T nsp6 (L37F)/ORF1ab (L3606F)

GH predominated; while in Haryana, O and GH were predominant. Clade S majorly circulated in Odisha along with GR, G, O and GH, and Maharashtra was also noted to have several clades in circulation including GR, G, O and S. State-wise temporal data (March to August 2020) are shown in Fig. 4 and Supplementary Table V. Several clades were noted to be circulating in many of the States between March and May. Beyond this, a switch to majorly GR/GH was observed. The temporal distribution in Maharashtra was analyzed based on the sequences generated as a part of this study. The clades during March were majorly O, S and G. The proportion of strains of clade O was noted to decrease gradually, and a replacement to GR strains was noted consistently Fig. 3. State-wise distribution of total number of SARS-CoV-2 during May to September. sequences deposited from India to Global Initiative on Sharing All Influenza Data (GISAID) from January to September 2020. The In addition, as the information of the outcome colours on the graph denote the GISAID clades. of the infection in terms of fatality was available for Maharashtra (n=41 of 328 sequences, Supplementary For States where a single clade was predominant, Table I), the proportion of fatal cases were estimated it was noted that clade O predominated in Delhi and in the clade G (including GR as none of the sequences Tamil Nadu while G predominated in West Bengal belonged to GH clade). It was observed that 14.38 per and Madhya Pradesh. Both clades GH and G were cent (41 of 285) of cases which possessed the D614G predominant in Gujarat. Clades GR and O predominated mutation resulted in fatal outcomes, while the rest of in Telangana; in Karnataka and Uttarakhand, GR and the cases that possessed the mutation were mild. POTDAR et al: INDIAN SARS-CoV-2 WHOLE GENOME CLASSIFICATION 171

Fig. 4. Temporal distribution of SARS-CoV-2 sequences from different States of India. The number of SARS-CoV-2 sequences belonging to distinct GISAID clades is represented as a percentage plot of the clades for each month.

Nextstrain inference (Supplementary Fig. 2) the other hand, Nextstrain is based on a maximum of the most likely transmission events (https:// likelihood approach as implemented in TreeTime19. nextstrain.org/ncov/asia?c=clade_membership&f_ Considering temporal dating of ancestral nodes and country=India&f_region=Asia) revealed that the discrete trait geographic reconstruction based on the dominant clade B.6 (GISAID O) that emerged SARS-CoV-2 sequences, Nextstrain identified five from 19A was introduced into India from China, nodes that were labelled as 19A, 19B, 20A, 20B and Europe, South-East Asia and Middle-East while 20C. B.1 (G) and B.1.36 (GH) that emerged from 20A had their origins from Europe, Middle-East and Based on the equivalence between the GISAID Africa. The B.1.1 (GR) clade that emerged from clade nomenclature, the new Nextstrain clades and 20B was introduced from the Europe, Middle-East the Pangolin sub-lineages, initially, Nextstrain clade and Far-East. Selection pressure analysis revealed names were ad hoc letter number combinations that that site nsp3:994A/D was identified to be under were never intended to be a permanent naming system. positive selection pressure in both clades G and At least ten clades (B, B1, B2, B4, A3, A6, A7, A1a, GR, nsp6:37 L/F and nsp12:323 L/P in both G and A2 and A2a) based on specific marker mutations were GH and nsp16:298N/L/I in GR and GH (Table III). identified. The marker mutations specific to these clades are shown in Supplementary Table III. The Discussion clades A1a, A3, A6 and A7 emerged from the node A dynamic nomenclature for SARS-CoV-2 labelled 19A, while clades B, B1, B2 and B4 emerged proposed by Rambaut et al5 initially identified two from the node 19B. The strains belonging to clade lineages (A and B) at the root of the phylogeny based A2 correlated to strains having ancestral nodes 20A, on the sharing of two nucleotides at positions 8782 while the A2a strains could be traced back to nodes in ORF1ab and 28144 in ORF817,18. Subsequently, 20A, 20B and 20C. Thus, the old Nextstrain clade descendent lineages were assigned a numerical value nomenclature was found to be undefined and did provided; these satisfied certain criteria of nucleotide not reflect on the time scale of evolution. We further substitutions within and between lineages. Several analyzed the predominance of the strains in different lineages and sub-lineages were thus identified. On Indian States based on the Pangolin and GISAID clade 172 INDIAN J MED RES, January & February 2021

Table III. Selection pressure analysis based on the GISAID) circulating in India are the B.1.1.32/GR, whole‑genome sequences using the methods Mixed Effects B.6/O, B.1/G, B.1.1/GR, B.1.113/GH and B.1.1.8/ Model of Evolution and Single‑Likelihood Ancestor Counting, GR. Thus, as also observed in other studies21,22, available in the Datamonkey server the G clade (including GR and GH) is seen to have Clade Gene Site Variable amino P P established itself in India as well as the world over13,23 acid residues MEME SLAC (Supplementary Fig. 3). Temporal data of the Indian G nsp3 994 A/D 0.01 0.042 SARS-CoV-2 genomes revealed that except for nsp6 37 L/F 0.01 0.036 Uttarakhand, West Bengal and Haryana that showed the circulation of O clade even after July, other States nsp12 323 L/P 0.01 0.008 showed a complete switch to GR/GH. The dominant GR nsp3 994 D/A 0.01 0.05 clades were noted to have emerged from nodes 19A, nsp3 1103 P/L/S 0.02 0.085 20A, 20B and 20C. The same Nextstrain clades/ nsp4 380 A/V 0.05 0.088 Pangolin lineages were found to occur in multiple nsp7 54 S/L/P 0.07 0.066 GISAID clades. Hence, the GISAID nomenclature nsp16 298 N/L/I 0 0.037 system that is specifically based on amino acid ORF3a 46 L/F 0.01 0.06 substitutions can be considered more robust than the GH nsp6 37 L/F 0.02 0.04 other two nomenclatures. nsp12 323 L/P 0.03 0.059 The State-wise distribution of the prevalence of nsp14 372 T/I 0.03 0.062 the different clades was observed. Within clade GR, nsp16 298 N/L/H/I 0 0.062 a sub-group (Pangolin B.1.1.32 lineage) showed the S ‑ ‑ ‑ ‑ ‑ combinations of strains from Maharashtra interspersed with strains from Telangana. Another sub-group (B.1.1) O nsp3 1197 S/R/K 0 0.021 showed strains mainly from Telangana along with strains nsp3 1198 K/T 0.07 0.022 from Karnataka, Odisha and Tamil Nadu. The lineage nsp3 1768 V/G 0 0.004 B.1.1.8 which was identified as an indigenous lineage nsp6 37 F/L 0.02 0.009 of India could most likely be attributed to evolution Sites were identified as showing evidence of positive selection within Telangana. On the other hand, within the clade as per the statistical significance level (P<0.1) by both G, groups with mixing of strains from Gujarat, Madhya the methods. MEME, Mixed Effects Model of Evolution; Pradesh, West Bengal, Odisha, Karnataka or Gujarat, SLAC, Single‑Likelihood Ancestor Counting Karnataka and Maharashtra were evident. These may be associated with the inter-State movements of nomenclatures (Supplementary Table IV) in association migrant workers, tourists, students and professionals with their emergence times as per the Nextstrain new before or following the lock down imposed in the clades classification nomenclature. country. Another indigenous lineage (B.1.113), a major component of the clade GH, was noted to have emerged The earliest Indian cases2,3 of SARS-CoV-2 were in Gujarat. Within clade O, two prominent sub-groups based on laboratory confirmation of suspected cases of 20 were noted. In one of these sub-groups (Pangolin B.6 persons with international travel history . Since March lineage), Delhi strains were noted to be interspersed with 2020, the reported cases saw an increase in different strains from several States all over the country including States of the country. Genome sequencing efforts in Odisha, Maharashtra, Karnataka, Telangana, Madhya India resulted in generation of whole-genome sequence Pradesh, Andhra Pradesh, Haryana, Uttar Pradesh, Bihar, data representing 20 different States/Union Territories Tamil Nadu, West Bengal, Telangana and Rajasthan. (UTs). Good representation was noted from the States The other sub-group (B.4) involved mainly Karnataka, of Telangana, Gujarat, Maharashtra, Delhi, Karnataka, Maharashtra, Ladakh, Telangana and Gujarat. The O Odisha, West Bengal, Uttarakhand, Uttar Pradesh and clade was prevalent across several States in the country Haryana (Supplementary Table IV and Fig. 2). In the in March and April, suggesting their expansion due to other 16 States/UTs, though cases of SARS-CoV-2 introductions before the lockdown on March 19, 2020 were reported, no genome data were deposited. (Fig. 4). The genetic make-up of the Indian sequences It was noted that the sites putatively identified to revealed that the predominant clades (Pangolin/ be under positive selection pressure within the GISAID POTDAR et al: INDIAN SARS-CoV-2 WHOLE GENOME CLASSIFICATION 173 clades were found to occur majorly in the non-structural Financial support & sponsorship: None. proteins coded by ORF1a and ORF1b. A few of the sites were found to be common to clades G/GH/GR. This Conflicts of Interest: None. was a reflection of the evolution within the dominant clade G. It remains to be observed whether these and the References other sites would be future hotspots of evolution. Such 1. WHO Coronavirus Disease (COVID-19) Dashboard. Available sites need to be further characterized to understand if from: https://covid19.who.int, accessed on February 4, 2021. the virus is adapting further towards enhanced human 2. Yadav PD, Potdar VA, Choudhary ML, Nyayanit DA, Agrawal transmissions24-27. The clade G/GH/GR strains possess M, Jadhav SM, et al. Full-genome sequences of the first two the mutation D614G in the spike protein S. It has been SARS-CoV-2 viruses from India. Indian J Med Res 2020; 151 : 200-9. demonstrated that this mutation increases infectivity, resulting in potentially more transmissible SARS- 3. Potdar V, Cherian SS, Deshpande GR, Ullas PT, Yadav PD, 28-30 Choudhary ML, et al. Genomic analysis of SARS-CoV-2 CoV-2 . Insight into the associated mechanism was strains among Indians returning from Italy, Iran & China, & obtained from cryo-EM studies of the SARS-CoV-2 Italian tourists in India. Indian J Med Res 2020; 151 : 255-60. S protein trimer which revealed that D614G shifted the 4. Elbe S, Buckland‐Merrett G. Data, disease and diplomacy: S conformation toward an ACE2 binding-competent GISAID’s innovative contribution to global health. Glob state28. Further, considering that a lower proportion Chall 2017; 1 : 33-46. of the clade G cases resulted in fatality, if could be 5. Alm E, Broberg EK, Connor T, Hodcroft EB, Komissarov AB, difficult to attribute the outcome of infection solely to Maurer-Stroh S, et al. Geographical and temporal distribution of SARS-CoV-2 clades in the WHO European Region, the D614G marker mutation. It is necessary to focus January to June 2020. Euro Surveill 2020; 25 : 2001410. on the viral genomic variations arising from rapid local 6. Rambaut A, Holmes EC, O’Toole Á, Hill V, McCrone JT, expansions of the GISAID or Pangolin lineages. Ruis C, et al. A dynamic nomenclature proposal for SARS- CoV-2 lineages to assist genomic epidemiology. Nat Microbiol In summary, this study revealed the genetic 2020; 5 : 1403-7. variants circulating in India during the period from 7. Hadfield J, Megill C, Bell SM, Huddleston J, Potter B, March to September 2020. The increased prevalence Callender C, et al. Nextstrain: Real-time tracking of pathogen of the GH and GR clades from May 2020 onwards was evolution. Bioinformatics 2018; 34 : 4121-3. noted to parallel the global trend. The observation of 8. Choudhary ML, Vipat V, Jadhav S, Basu A, Cherian S, emergence of new lineages B.1.1.8 and B.1.113 was Abraham P, et al. Development of in vitro transcribed RNA indicative of host-specific evolution of the SARS- as positive control for laboratory diagnosis of SARS-CoV-2 in CoV-2 strains within GR and GH clades, respectively, India. Indian J Med Res 2020; 151 : 251-4. in India. To conclude on the robustness of the existing 9. Shepard SS, Meno S, Bahl J, Wilson MM, Barnes J, Neuhaus E. Viral deep sequencing needs an adaptive approach: IRMA, the classification nomenclatures, there would be need to Iterative Refinement Meta-Assembler. BMC Genomics 2016; continue observing the global evolutionary trends and 17 : 708. delineation of the strains. The study had limitations due 10. Katoh K, Misawa K, Kuma K, Miyata T. MAFFT: A novel to the non-availability or less sequence data at uniform method for rapid multiple sequence alignment based on fast time intervals from many parts of the country and also Fourier transform. Nucleic Acids Res 2002; 30 : 3059-66. the lack of clinical information. This would benefit in 11. Tamura K, Stecher G, Peterson D, Filipski A, Kumar S. exploring the establishment of the clades, molecular MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 2013; 30 : 2725-9. clock, transmissions within the country and further evidence of indigenous evolution. It may also help 12. Delcher AL, Phillippy A, Carlton J, Salzberg SL. Fast algorithms for large-scale genome alignment and comparison. infer the potential association of SARS-CoV-2 lineages Nucleic Acids Res 2002; 30 : 2478-83. and mortality, as well as identify possible ethnic and 13. Mercatelli D, Giorgi FM. Geographic and genomic genetic correlations. distribution of SARS-CoV-2 mutations. Front Microbiol 2020; 11 : 1800. Acknowledgment: Authors acknowledge the support of 14. Weaver S, Shank SD, Spielman SJ, Li M, Muse SV, Thermo Fisher Scientific India field applications specialist (FAS), Kosakovsky Pond SL. Datamonkey 2.0: A modern web Laboratory, Bioinformatics and Technical Sales Specialist (TSS) application for characterizing selective and other evolutionary team. The authors acknowledge Dr G.B. Shantala, Bangalore processes. Mol Biol Evol 2018; 35 : 773-7. Medical College Research Institute, Bengaluru, Karnataka, for 15. Murrell B, Wertheim JO, Moola S, Weighill T, Scheffler K, sharing clinical samples. Kosakovsky Pond SL. Detecting individual sites subject 174 INDIAN J MED RES, January & February 2021

to episodic diversifying selection. PLoS Genet 2012; 8 : strains circulating worldwide implicates heterogeneity. Sci e1002764. Rep 2020; 10 : 14004. 16. Kosakovsky Pond SL, Frost SD. Not so different after all: A 24. Callaway E. Making sense of coronavirus mutations. Nature comparison of methods for detecting amino acid sites under 2020; 585 : 174-7. selection. Mol Biol Evol 2005; 22 : 1208-22. 25. Hodcroft EB, Zuber M, Nadeau S, Crawford KH, Bloom JD, 17. Tang X, Wu C, Li X, Song Y, Yao X, Wu X, et al. On the origin Veesler D, et al. Emergence and spread of a SARS-CoV-2 and continuing evolution of SARS-CoV-2. Natl Sci Rev 2020; variant through Europe in the summer of 2020. Medrxiv 2020; 7 : 1012-23. doi: 10.1101/2020.10.25.20219063. 18. Khailany RA, Safdar M, Ozaslan M. Genomic characterization 26. Sardar R, Satish D, Birla S, Gupta D. Comparative analyses of a novel SARS-CoV-2. Gene Rep 2020; 19 : 100682. of SAR-CoV2 genomes from different geographical locations and other coronavirus family genomes reveals unique features 19. Sagulenko P, Puller V, Neher RA. TreeTime: Maximum- potentially consequential to host-virus interaction and likelihood phylodynamic analysis. Virus Evol 2018; 4 : pathogenesis. bioRxiv 2020; doi:10.1101/2020.03.21.001586. vex042. 27. Lo Presti A, Rezza G, Stefanelli P. Selective pressure on 20. Ministry of Health and Family Welfare, Government of SARS-CoV-2 protein coding genes and glycosylation site India. COVID-19. Available from: https://www.mohfw.gov.in/, prediction. Heliyon 2020; 6 : e05001. accessed on February 4, 2021. 28. Zhang L, Jackson CB, Mou H, Ojha A, Rangarajan ES, 21. Kumar P, Pandey R, Sharma P, Dhar MS, Vivekanand A, Izard T, et al. The D614G mutation in the SARS-CoV-2 spike Uppili B, et al. Integrated genomic view of SARS-CoV-2 in protein reduces S1 shedding and increases infectivity. bioRxiv India. Wellcome Open Res 2020; 5 : 184. 2020; doi: 10.1101/2020.06.12.148726. 29. Yurkovetskiy L, Wang X, Pascal KE, Tomkins-Tinch C, 22. Singh H, Singh J, Khubaib M, Jamal S, Sheikh JA, Nyalile TP, Wang Y, et al. Structural and functional analysis Kohli S, et al. Mapping the genomic landscape & diversity of of the D614G SARS-CoV-2 spike protein variant. Cell 2020; COVID-19 based on >3950 clinical isolates of SARS-CoV-2: 183 : 739-51. Likely origin & transmission dynamics of isolates sequenced in India. Indian J Med Res 2020; 151 : 474-8. 30. Starr TN, Greaney AJ, Hilton SK, Ellis D, Crawford KH, Dingens AS, et al. Deep mutational scanning of SARS-CoV-2 23. Islam MR, Hoque MN, Rahman MS, Alam AS, Akther M, receptor binding domain reveals constraints on folding and Puspo JA, et al. Genome-wide analysis of SARS-CoV-2 virus ACE2 binding. Cell 2020; 182 : 1295-310.e20.

For correspondence: Dr Sarah Cherian, Scientist F, ICMR-National Institute of Virology, 20-A Dr Ambedkar Road, Pune 411 001, Maharashtra, India e-mail: [email protected] Indian J Med Res 153, January & February 2021, pp 175-181 Quick Response Code: DOI: 10.4103/ijmr.IJMR_4051_20

Modelling the spread of SARS-CoV-2 pandemic - Impact of lockdowns & interventions

Manindra Agrawal1, Madhuri Kanitkar3 & M. Vidyasagar2

1Department of Computer Science & Engineering, Indian Institute of Technology Kanpur, Kanpur, Uttar Pradesh, 2Department of Artificial Intelligence, Indian Institute of Technology Hyderabad, Hyderabad, Telangana & 3Deputy Chief Integrated Defence Staff (Medical), HQ Integrated Defense Staff, Ministry of Defence, Government of India, New Delhi, India

Received September 28, 2020

Background & objectives: To handle the current COVID-19 pandemic in India, multiple strategies have been applied and implemented to slow down the virus transmission. These included clinical management of active cases, rapid development of treatment strategies, vaccines computational modelling and statistical tools to name a few. This article presents a mathematical model for a time series prediction and analyzes the impact of the lockdown. Methods: Several existing mathematical models were not able to account for asymptomatic patients, with limited testing capability at onset and no data on serosurveillance. In this study, a new model was used which was developed on lines of susceptible-asymptomatic-infected-recovered (SAIR) to assess the impact of the lockdown and make predictions on its future course. Four parameters were used, namely β, γ, η and ε. β measures the likelihood of the susceptible person getting infected, and γ denotes recovery

rate of patients. The ratio β/γ is denoted by R0 (basic reproduction number). Results: The disease spread was reduced due to initial lockdown. An increase in γ reflects healthcare and hospital services, medications and protocols put in place. In Delhi, the predictions from the model were corroborated with July and September serosurveys, which showed antibodies in 23.5 and 33 per cent population, respectively. Interpretation & conclusions: The SAIR model has helped understand the disease better. If the model is correct, we may have reached herd immunity with about 380 million people already infected. However, personal protective measures remain crucial. If there was no lockdown, the number of active infections would have peaked at close to 14.7 million, resulted in more than 2.6 million deaths, and the peak would have arrived by June 2020. The number of deaths with the current trends may be less than 0.2 million.

Key words Asymptomatic cases - India - lockdown - modelling - resources

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 175 176 INDIAN J MED RES, January & February 2021

COVID-19 pandemic has affected India as much the current COVID-19 pandemic, a large fraction of as it has the rest of the world and the updated data for population showed little or no symptoms. The standard India are available in the public domain1-3. India, in mathematical models could not explain the role of spite of being the second most populated country in asymptomatic cases in unfolding of the pandemics. the world with less than ideal healthcare infrastructure, A new susceptible-asymptomatic-infected-recovered has been fortunate to have had a fairly low (SAIR) model: Based on an in-depth analysis, a case-fatality rate until now4,5. The role of various mathematical model was proposed, which built on an measures to reduce transmission is now better earlier model27,28. Before this, another mathematical defined6-10. The exact reasons for the outcome in India model provided estimates of the inventories of vital are possibly multidimensional, but the various steps equipment required to cope with the pandemic29. implemented by the Policy makers to slow down This model developed on lines of susceptible- transmission of the virus have also been important11-13. asymptomatic-infected-recovered (SAIR) was used to Besides aiding in flattening the curve, these have given assess the magnitude of the impact of the lockdown the scientific community an opportunity to better on the disease burden. In addition, predictions on the understand the vector host environment dynamics14,15. future course of the pandemic were also made. These actions have also provided time for the existing healthcare organizations to plan, activate and reallocate The standard model for pandemic dynamics called resources to help prepare for the surge. There was an SIR classifies the population in three categories: urgent need to be ready to cater to a large number of susceptible (S), infected (I) and removed (R). A patients over a short period of time. The time gained subcategory of removed is deceased (D). To differentiate through various government policies has also helped between asymptomatic and symptomatic patients, a nurture individual innovators and industry partnerships new category of asymptomatic (A) was introduced with to achieve self-sufficiency in resources, such as the the population in category I of SIR model divided into personal protective equipment, sanitizers and hospital A (asymptomatic patients) and I (symptomatic patients). beds16, at a time when the world grappled with the Further, it has been assumed that whether a person is crises17,18. We have presented a mathematical model for categorized in A or I upon infection solely depends on a time series prediction and to analyze the impact of a the physiology of the person (immunity level, genetic lockdown in the country. disposition, comorbidities, etc.). This splits category

Material & Methods S into two: SA (asymptomatic upon getting infected) and S (infection and manifesting disease upon getting A consultative committee was constituted by the I infected). Department of Science and Technology under the Ministry of Science and Technology, Government Parameter estimation was based on four parameters of India, to develop a supermodel consisting of in this model, namely β, γ, η and ε. In brief, β measures mathematical predictions as related to the COVID-19 the likelihood that contacts between a susceptible pandemic in India19. During the deliberations of person on the one hand, and an asymptomatic or the committee, there were extensive discussions an infected person on the other hand, leads to the and literature review of the evolving pandemic susceptible person getting infected. The parameter and experience from other countries20-24. Several γ corresponds to the rate at which asymptomatic or mathematical models submitted to the committee, for infected patients recover. The parameter η measures the spread of a pandemic were analyzed in detail and the rate at which infected patients die (the presumption the gaps identified, namely the inability of the standard is that all asymptomatic patients recover). Finally, susceptible-infected-recovered (SIR)/susceptible-exposed- the parameter ε measures the ratio between infected infected-recovered (SEIR) models to account for symptomatic and asymptomatic patient populations. asymptomatic patients, which were a novel feature Results of COVID-1921. There is a paucity of data on the behaviour of the virus among Indian population14,15,23. The ratio β/γ is known as the basic reproduction

Limited testing capability in India at the time of onset ratio and is denoted by R0. If R0 <1, then the pandemic of the pandemic25,26, non-availability of standardized does not take off because it means that asymptomatic/ tests for serosurveillance27 and non-availability of infected patients recover faster than they can infect the data on asymptomatic cases were other limitations. In susceptible population. However, if R0 >1, then the AGRAWAL et al: MODELLING COVID-19 & IMPACT OF INTERVENTIONS 177 number of infections increases at first before decreasing dI to a steady state value. Therefore, to make predictions =+βγSIH ()AI− dt using the model, it is essential to form reliable estimates dR of these parameters based on the available data. A = γ A dt For data, the model used three daily time series dR reported: active infections, cumulative recovered and I = γ I cumulative deaths1. We took these three as the daily values dt of I, R and D, respectively. This may not be exactly true dD I = ηI since many asymptomatic patients are also reported and dt some deaths are not reported. Four parameters were used in this model, namely β, γ, η, ε and these four parameters Susceptible (S) is the uninfected fraction of change with time. The parameter β is a function of population. It is divided in two: SH and SL fractions interactions between people and so, lockdowns directly that transition to I and A, respectively, on infection. impact it by reducing it. The parameters γ denotes Asymptomatic (A) is the fraction of population who is recovery rate and η the deaths which depend on the infected but goes undetected. Infected (I) is the fraction medical care available. Improvements in medical care of population who is infected and detected. Removed increases γ and reduces η. Parameter ε is the ratio of (R) is the fraction of population who had infection infected with disease and asymptomatic cases. but no longer infected (either through recovery or by demise). It is also divided in two: I and A transition to In principle, the parameter ε should not change as RI and RA, respectively. The denominator dt is over a the ratio of infected and asymptomatic remains constant continuous timeframe. in the model. However, its measurement is not exact for two reasons. First, initially, the infection is limited Pandemic progression in India: The estimated to a small section of population in the region under parameters for the five phases are depicted in Table I. study, and it takes time for it to spread to the entire The mathematical model and predictions are further region. Since we do not know the exact size of initial depicted in Figure 1, which depicts that the actual data infected population, we get a significant underestimate suggest a peak on September 17, 2020. The model of ε initially as we use total population of the region overestimates the actual growth by around 1.5 per cent to compute it. The measured value slowly increases to and the peak arrives four days later. Cumulative deaths eventually stabilize once the entire region is covered are predicted to be around 0.2 million. The β and γ - this makes ε also dependent on lockdown. Second, values for the last phase imply R0 value around 1.39, measured values of active infections and cumulative and the herd immunity for this value of R0 at around removed (recovered plus deceased) also include parts 28 per cent of population in A, I and R categories. This of A and R , respectively. Hence, actual values of I and translates to around 3.9 million population infected A or with antibodies at the peak. On September 17, the RI are smaller than calculated by parameter estimation. This causes the value of ε to be overestimated. numbers in I and RI categories were around 5.2 million. Adjustments can be made to get a better estimate of Using the 1/ε value (=67) of phase 6, the model ε by estimating how the infection is spreading in the predicts total population with infection or antibodies to region and recording the fraction of asymptomatic be around 3.5 million. cases in reported positive ones. The details of these equations and calculations as Table I. Predicted parameters for phases of the pandemic in India developed by the authors and part of the mandate for the Committee are as follows: Pandemic phase 1/ε 1/β γ η 1 475,400 4.6 0.020 0.005

dSL 2 20,850 7.4 0.030 0.003 =−βSIL ()+ A dt 3 1108 9.9 0.048 0.002 4 773 6.8 0.065 0.002 dSH =−βSIH ()+ A dt 5 151 8.2 0.076 0.002 dA 6 67 8.2 0.087 0.001 =+βγSIL ()AA− dt 178 INDIAN J MED RES, January & February 2021 n 1.2 Model projection Actual data 16 No lockdown May 1 lockdown 14 1 April 1 lockdown Actual lockdown 12 0.8 tic infections 10 llion) ma 0.6 mi to 8 (in mp 0.4 6 sy 0.2 4 scenarios (in million) 2 Active 0

1.3.20 20.4.20 9.6.20 29.7.2017.9.20 6.11.20 26.12.20 14.2.21 Projected active symptomatic 0 Time (in days) infections for alternative lockdow 1.3.20 20.4.20 9.6.20 29.7.20 17.9.20 6.11.20 26.12.20 14.2.21 Fig. 1. Progression of the pandemic in India. Source: Ref. 1 for Time (in days) actual data. Fig. 3. Effects of timing of lockdown on the number of active cases.

40 No lockdown May 1 lockdown Model projection Actual data e 35 3.5 April 1 lockdown Actual lockdown 30 3 25 20 2.5 15 2 (in thousand) 10 1.5 5 0 1 Active symptomatic infections 1.3.20 20.4.20 9.6.20 29.7.20 17.9.20 6.11.20 26.12.20 14.2.21 0.5 Time (in days)

lockdown scenarios (in million) 0 Fig. 2. Progression of the infection in Delhi. Source: Ref. 1 for Projected mortalities for alternativ 1.3.20 20.4.20 9.6.20 29.7.20 17.9.20 6.11.20 26.12.20 14.2.21 actual data. Time (in days) Fig. 4. Impact of timing of lockdown on mortality. Analysis of disease progression in Delhi: The estimated 30 parameters for the phases 1-6 for Delhi are depicted in 23.5 per cent of population , and RI at the start of survey Table II. For Delhi, first phase starts from April 1, as was around 55000. The model predicts R (=1/ɛ×RI) to data were available in the open domain only from March be around 5.4 million (1/ɛ=104 for phase 3 assuming and a window of 14 days is required for calculations by the population of Delhi to be around 20 million. This is the model. The Delhi plot of projections are of special close to 27.5 per cent of population which is 4 per cent interest since the data from two serosurveys can be higher than actual data. September serosurvey showed 31 used to validate the calculations made by this model. antibodies in 33 per cent of population and RI at the The mathematical model and predictions are further start of the survey was around 0.16 million. The model depicted in Figure 2, which depicts that the projected predicts R (=1/ɛ×RI) to be around 6.5 million (1/ɛ= 41 trajectory follows the actual line closely, except for phase 5). This amounts to 33.7 per cent which is that the second wave starts about a week early, first 0.76 per cent higher than actual data. As evident by the calculations in this model, there was a good association peak is about 20 per cent higher, and second is about between the predicted numbers and the actual data 10 per cent higher. Cumulative deaths are to be obtained in the serosurvey. around 6500. July serosurvey showed antibodies in The effect of lockdown and the spread in active Table II. Predicted parameters for phases of the pandemic in infections and hypothetical effects of timing of Delhi lockdown are depicted in Figure 3. It revealed that if Pandemic phase 1/ε 1/β γ η there was no lockdown, the number of active infections 1 1356 7.1 0.032 0.001 would have peaked at 14+ million and the peak would 2 243 7.5 0.034 0.003 have arrived by mid-May. This would have resulted 3 104 5.6 0.102 0.003 in overwhelming our hospitals. The impact of delay 4 80 5.7 0.116 0.002 in lockdown is starkly reflected in projected mortality and the same is depicted in Figure 4. If there was no 5 41 4 0.110 0.001 lockdown, it would have resulted in more than two 6 36 4.2 0.133 0.001 million deaths. The number of deaths with current trends is projected to be less than 0.2 million. AGRAWAL et al: MODELLING COVID-19 & IMPACT OF INTERVENTIONS 179

Discussion and increasing cases. γ increased significantly from phase 2 to 3 reflecting the major improvements The presence of asymptomatic patients, who can in medical care in June. Decreasing η reflected infect the susceptible population when they come improvements in medical care provided, thus in contact with, changes the dynamics of disease21. Among the total population who test positive, only reducing mortality. the symptomatic and sick patients (which is a small The pandemic progression actual data showed fraction), require major medical intervention. Thus, a peak on September 1730. Our model predicted a the estimates for medical inventory, including oxygen, slightly higher peak (by ~1.5%) four days later. ventilators and intensive care unit beds, needs to be Cumulative deaths are predicted to be slightly less planned based on projections of this number and not the than 0.2 million. The β and γ values for phase 6 imply total infected persons. At the same time, asymptomatic R0 value around 1.39 and the herd immunity for this patients need to be advised isolation so that they do not value of R0 is at around 28 per cent of population in spread the infection. In the present model, time period A, I and R categories. This translates to around 3.85 of the disease progression in the country was divided million population with infection or with antibodies in six phases. These were obtained by identifying the at peak. On September 17, the numbers in I and RI dates on which the value of ε increased significantly: categories were around 5.2 million. Using the 1/ε phase 1: period up to April 5; phase 2: period from April value (=67) of phase 6, the model predicts total 5 to 30; phase 3: period from May 1 to June 15; phase population with either infection or antibodies to be 4: period from June 16 to July 15; phase 5: period from around 350 million. If the model is correct and there July 16 to August 15; and phase 6: period from August is no significant increase in R0 value, we perhaps 15 to date. have reached herd immunity. However, to ensure

These phases correspond to different levels of that R0 stays small, it is important to continue the use lockdown introduced in the country with some delay. of personal protective measures such as mask, hand For each of these phases, parameters were estimated hygiene and physical distancing. for India as a whole and specifically for the city of The mathematical model used in this study Delhi (due to lack of early data, for Delhi, the phases was developed to analyze the spread of the disease began from April 1 and there were slight changes in under three different hypothetical scenarios, namely phase boundaries). no lockdown, lockdown starting April 1, 2020 The progression of the pandemic in India revealed and lockdown starting May 1, 2020. To simulate that there was a significant reduction in β due to initial the trajectories, the assumptions made are that no lockdown. It was more or less stabilized despite lockdown on March 26 allows migrants and others relaxations in lockdown. This possibly reflects the to travel back home. Due to this, a small number of protective measures being ensured by the susceptible infected people reach many parts of the country. population all over the country such as use of mask We incorporated this by reducing the value of 1/ε, and social distancing. An increase in γ was observed the parameter that captures reach of the disease to following initial lockdown. This reflects healthcare different regions, to phase 3 value (1108) on April 5 and hospital services, medications and protocols instead of phase 2 value (20,850). There appeared a put in place. η remained stationary in the first three sharp reduction; however, even with strict lockdown, phases and then started reducing. This possibly reflects this reduction happened within a month. Hence, it improved medical interventions and increasing number is reasonable to assume that with no lockdown and of asymptomatic patients being diagnosed and counted significant travel all over, the reduction would have towards total cases. happened much faster. The progression of the disease in Delhi revealed For no lockdown, the value of 1/ε continues that the value of 1/ɛ dropped and more so from phase to reduce sharply, the value of 1/β remains as in 1 to 3. This suggested that the virus did not initially phase 1 and γ and η improve slowly. Lockdown from spread over the entire population uniformly. The April 1 changes the value of 1/β to phase 2 value. value of β increased significantly from phase 2 to 3 However, the value of γ improves slowly. This is and again from phase 4 to 5. This reflected relaxation because, with rapid spread of infection, hospitals of lockdown leading to increased human interactions start getting overwhelmed (as would be evident 180 INDIAN J MED RES, January & February 2021 from plots below) and so are unable to ramp up and toll of COVID-19 in the United States. bioRxiv 2020. put in place a proper setup. Lockdown from May 1 doi: 10.1101/2020.04.15.20066431. reduces values of 1/ε further and values of 1/β; γ and 6. Block P, Hoffman M, Raabe IJ, Dowd JB, Rahal C, Kashyap R, η improve but slowly. et al. Social network-based distancing strategies to flatten the COVID-19 curve in a post-lockdown world. Nat Hum Behav If there was no lockdown, the number of active 2020; 4 : 588-96. infections would have peaked at 14+ million and the 7. Leng T, White C, Hilton J, Kucharski A, Pellis L, Stage H, peak would have arrived by mid-May. This would have et al. The effectiveness of social bubbles as part of a Covid-19 resulted in overwhelming our hospitals and widespread lockdown exit strategy, a modelling study. Wellcome Open panic. There was little qualitative difference between Res 2020; 5 : 213. two lockdown timings of April 1 and May 1, 2020. 8. Mitze T, Kosfeld R, Rode J, Wälde K. Face masks considerably reduce COVID-19 cases in Germany. medRxiv 2020. These would have resulted in a peak between 0 and doi: 10.1101/2020.06.21.20128181. 5 million active infections by mid-June. If there was 9. Balachandar S, Zaleski S, Soldati A, Ahmadi G, no lockdown, it would have resulted in more than Bourouiba L. Host-to-host airborne transmission as a 2 million deaths. The two lockdowns (April 1 and May multiphase flow problem for science-based social distance 1, 2020) would have resulted in between 0.5-1 million guidelines. Int J Multiphas Flow 2020; 132 : 103439. deaths. The number of deaths with current trends is 10. Cheng VC, Wong SC, Chan VW, So SY, Chen JH, Yip CC, projected to be less than 0.2 million. et al. Air and environmental sampling for SARS-CoV-2 around hospitalized patients with coronavirus disease 2019 The major limitation of our model was the non- (COVID-19). Infect Control Hosp Epidemiol 2020; 1-8. availability of accurate data. While our modelling 11. Advisory Manual on Use of Homemade Protective Cover for efforts have tried to match the available data, the Face & Mouth. Available from: https://www.mohfw.gov.in/ utility of our projections is limited by the accuracy and pdf/Advisory&ManualonuseofHomemadeProtectiveCover reliability of the available data. Hence, more accurate forFace&Mouth.pdf, accessed on September 20, 2020. and reliable input data to the model would result in 12. Indian Council of Medical Research. How India ramped up more reliable projections. COVID testing capacity. Available from: https://main.icmr. nic.in/sites/default/files/press_realease_files/ICMR_Press_ In conclusions the new model is useful to Release_India_testing_story_20052020.pdf, accessed on calculate the possible disease burden in a realistic September 25, 2020. manner and may help plan for the resources. The 13. Current Rules and Guidelines. Available from: https:// impact of lockdown and interventions undertaken in covidindia.org/current-rules-and-regulations, accessed on September 25, 2020. a timely manner has been highlighted. The continuing 14. Chakraborty T, Ghosh I. Real-time forecasts and risk importance of interventions such as use of mask, hand assessment of novel coronavirus (COVID-19) cases: A data- hygiene and physical distance is reinforced. driven analysis. Chaos Solitons Fractals 2020; 135 : 109850. Financial support & sponsorship: None. 15. Mahajan P, Kaushal J. Epidemic trend of COVID-19 transmission in India during lockdown-1 phase. J Community Health 2020; 1-10. Conflicts of Interest: None. 16. National Portal of India. Building Atmanirbhar Bharat and Overcoming COVID-19. Available from: https://www.india. References gov.in/spotlight/building-atmanirbhar-bharat-overcoming- 1. COVID Data. Available from: https://covid19india.org/open- covid-19, accessed on September 25, 2020. data/, accessed on October 16, 2020. 17. Guan D, Wang D, Hallegatte S, Davis SJ, Huo J, Li S, et al. 2. Ministry of Health & Family Welfare, Government of India. Global supply-chain effects of COVID-19 control measures. Available from: https://www.mohfw.gov.in, accessed on Nat Hum Behav 2020; 4 : 577-87. September 25, 2020. 18. Bateman IJ, Dannenberg A, Elliott R, Finus M, 3. Worldometer. World/Counties/India. Available from: https:// Koundouri P, Millock K, et al. Perspectives on the Economics www.worldometers.info/coronavirus/country/india/, accessed of the Environment in the Shadow of Coronavirus. Environ on September 26, 2020. Resour Econ (Dordr) 2020; 1-71. 4. Changotra R, Rajput H, Rajput P, Gautam S, Arora AS. 19. Department of Science and Technology. DST initiates Largest democracy in the world crippled by COVID-19: COVID-19 India National Supermodel for monitoring Current perspective and experience from India. Environ Dev infection transmission & aid decision-making by policymakers. Sustain 2020; 1-19. Available from: https://dst.gov.in/dst-initiates-covid-19-india- 5. Weinberger DM, Cohen T, Crawford FW, Mostashari national-supermodel-monitoring-infection-transmission-aid- F, Olson D, Pitzer VE, et al. Estimating the early death decision, accessed on September 24, 2020. AGRAWAL et al: MODELLING COVID-19 & IMPACT OF INTERVENTIONS 181

20. Britton T, Ball F, Trapman P. A mathematical model reveals indias-poor-testing-rate-may-have-masked-coronavirus- the influence of population heterogeneity on herd immunity to cases, accessed on September 25, 2020. SARS-CoV-2. Science 2020; 369 : 846-9. 26. Swaminathan A, Subramanian SV. Reflections on designing 21. Lee S, Kim T, Lee E, Lee C, Kim H, Rhee H, et al. Clinical population surveys for COVID-19 infection and prevalence. course and molecular viral shedding among asymptomatic Geroscience 2020. doi: 10.1007/s11357-020-00253-6. and symptomatic patients with SARS-CoV-2 infection in a 27. Asnumali S, Kaushal S, Kumar A, Prakash M, Vidyasagar M. community treatment center in the Republic of Korea. JAMA Modelling a pandemic with asymptomatic patients, impact of Intern Med 2020. doi: 10.1001/jamainternmed.2020.3862. lockdown and herd immunity, with applications to COVID-19. Annu Rev Control 2020. doi: https://doi.org/10.1016/j. 22. Gomes MGM, Corder RM, King JG, Langwig KE, arcontrol.2020.10.003. Souto-Maior C, Carneiro J, et al. Individual variation in susceptibility or exposure to SARS-CoV-2 28. Robinson M, Stilianakis NI. A model for the emergence of lowers the herd immunity threshold. medRxiv 2020. drug resistance in the presence of asymptomatic infections. doi: 10.1101/2020.04.27.20081893. Math Biosci 2013; 243 : 163-77. 29. COVID 19 Medical Inventory. Available from: https:// 23. McAloon C, Collins Á, Hunt K, Barber A, Byrne AW, Butler F, covid19medinventory.in, accessed on September 24, 2020. et al. Incubation period of COVID-19: A rapid systematic review and meta-analysis of observational research. BMJ 30. Sero-prevalence study conducted by National Center for Disease Open 2020; 10 : e039652. Control NCDC, MoHFW, in Delhi, June 2020. Available from: https://pib.gov.in/PressReleasePage.aspx?PRID=1640137, 24. Rogers TN, Rogers CR, VanSant-Webb E, Gu LY, Yan B, accessed on September 26, 2020. Qeadan F. Racial disparities in COVID-19 mortality among essential workers in the United States. World Med Health 31. 33% Delhiites have developed COVID-19 antibodies: Latest Policy 2020. doi: 10.1002/wmh3.358. sero survey of 17,000 Samples. Available from: https://www. india.com/news/india/33-delhiites-might-have-coronavirus- 25. India’s Poor testing rate may have masked coronavirus cases. antibodies-latest-sero-survey-of-17k-samples-4143871, Available from: https://www.aljazeera.com/news/2020/03/18/ accessed on September 26, 2020.

For correspondence: Dr Madhuri Kanitkar, Deputy Chief Integrated Defence Staff (Medical), HQ Integrated Defense Staff, Ministry of Defence, Government of India, New Delhi 110 011, India e-mail: [email protected] Indian J Med Res 153, January & February 2021, pp 182-189 Quick Response Code: DOI: 10.4103/ijmr.IJMR_2855_20

Correspondence

Prediction of potential small interfering RNA molecules for silencing of the spike gene of SARS-CoV-2

Sir, 6000 different S gene sequences of SARS- A novel SARS-CoV-2 causing the global CoV-2 from different regions of the world coronavirus disease 2019 pandemic has affected most were retrieved from the NCBI GenBank countries and territories around the world with a death database as on May 25, 2020. The S gene of toll of more than one million cases. As of November SARS-CoV-2 lies in the region from 21563 to 25384 19, 2020, a total of 56,674,523 cases have been nt.Using multiple sequence alignment, the reported for SARS-CoV-21. The entry mechanism of conserved regions within the S gene sequences SARS-CoV-2 involves the binding of spike (S) were identified using the MEGA-X software5. protein to the angiotensin-converting enzyme 2 The conserved regions shorter than 30 nt were not (ACE-2) receptor of host cell through the receptor- incorporated for the study. The target sequences binding domain (RBD)2. The ectodomain of the S for siRNA binding were identified using the protein consists of S1 and S2 subunits. The S1 subunit predictions from three different online siRNA contains the RBD, and is involved in recognition and designing servers: Block-iT RNAi designer6, binding, whereas the S2 subunit is associated with OligoWalk siRNA designer server6 and siDirect the fusion mechanism3. 2.0 web server7. Block-iT RNAi designer (Thermo Fisher Scientific, USA) is an online The race for finding a potential antiviral agent siRNA design server requiring the user to mainly and development of a protective vaccine against specify the minimum and maximum guanine- SARS-CoV-2 is still on. The RNA interference cytosine (GC) content. The server OligoWalk (RNAi)-based strategies can be a promising treatment generates siRNAs through the calculation of the option to combat SARS-CoV-24. RNAi is an thermodynamic free energy of hybridization and evolutionary mechanism of gene regulation induced the use of support-vector machines (SVMs)8. The by small interfering RNA (siRNA) along with a server siDirect 2.0 generates efficient siRNAs by specific endonuclease. Synthetic siRNAs are 19-23 nt minimizing off-target effects through calculation long RNAs, containing a complementary sequence to of thermodynamic stabilities of the seed-target a target region on the genome sequence that can block duplex which is formed between the nucleotides the protein translation by hybridizing to the target. positioned at 2-8 from the 5’ end of the siRNA Targeting the S gene for designing siRNAs would be guide strand and its target mRNA7. The selection effective since siRNA against this gene would inhibit of lower thermodynamic stability defined by its translation, reduce the protein availability for the melting temperature (Tm) (benchmark Tm formation of functional infectious virions and, as a <21.5°C) is followed by the elimination of result, reduce the host cell infectivity. However, it unrelated transcripts with nearly perfect match. A is important that the design of the siRNAs should be sequence with lower GC content is more preferred restricted to the highly conserved regions in the S as a siRNA target because of its lesser probability gene, to ensure that these will be effective against all to form secondary structures with strong bonds9. strains of SARS-CoV-2. Hence, in all the three servers, the range for GC In this study conducted at ICMR-National content of the target sequences was selected to be Institute of Virology, Pune, India, a total of 30 to 55 per cent.

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 182 PANDA et al: siRNA MOLECULES FOR SARS-CoV-2 183

The predicted sequences of the siRNAs were RNAs of the selected regions were evaluated by further screened for effectiveness by determining i-Score designer14,15 which evaluates nine different their secondary structure. The secondary siRNA designing scores (Ui-Tei, Amarzguioui, structure of the selected siRNAs was generated Hsieh, Takasaki, s-Biopredsi, i-Score, Reynolds, using the MaxExpect10 programme in the RNA Katoh and DSIR). Further monitoring of the target structure webserver (https://rna.urmc.rochester.edu/ sequences of the final shortlisted siRNAs was RNAstructureWeb/Servers/MaxExpect/MaxExpect html done by analyzing the mutation information from Maxexpect). The MaxExpect server generates a the 2019nCoVR database16 (https://bigd.big.ac.cn/ specified group of secondary structures from the ncov/?lang=en). given RNA sequence, each structure in the group Multiple sequence alignment of the S gene containing base pairs which have the highest sequences (n=6000) identified five different possible chance of being accurate. The gamma conserved regions (nucleotide positions: 23,312- parameter value was kept as one to maintain a good balance in providing the weight on pairing and 23,370; 23,474-23,535; 24,260-24,324; 24,575- non-pairing bases during the secondary structure 24,619 and 24,242-24,347) which were considered prediction, while the standard temperature of 37°C for predicting the siRNA target regions. The three was selected10. different siRNA prediction servers proposed a total of 78 different target sequences (Fig. 1). No Next, the RNA-RNA interaction of the target common target regions were predicted by either of site and siRNA was analyzed using the server the servers. Further, the selection of more effective 11 DuplexFold which is based on folding the two siRNAs was done based on the free energy of folding given RNA sequences into their lowest hybrid values obtained from the predicted secondary free energy conformation. Default settings were structures through MaxExpect. siRNAs with free considered for optimal specifications for the energy of folding greater than zero indicate more maximum permitted per cent energy difference, efficient binding as it will be less prone to form a maximum number of output structures, window secondary structure17. A higher value of free energy size, maximum loop size and temperature. Finally, of folding indicates lower folding probability and 12 an online siRNA validation server (siRNAPred) more efficient binding17. All the predicted siRNAs (http://crdd.osdd.net/raghava/sirnapred/algo.html) with a free energy of folding greater than 1.5 were was used to validate the efficacy of the predicted selected (n=60). Further shortlisting of the siRNAs siRNA. The siRNAPred incorporates hybrid SVM- was done based on the free energy of binding of based methods for predicting the actual efficacy of the antisense RNA towards the target sequence both 21-mer and 19-mer siRNAs with high accuracy. obtained from DuplexFold. Lower free energy of The ENDMEMO online server (http://www. binding value signifies higher siRNA potency, endmemo.com/bio/gc.php) was used to determine as it will have efficient binding capability and the GC percentage of the predicted siRNAs. The better ability to inhibit the target sequence17. The determination of the entire equilibrium melting siRNAs with lower free energy of binding were profile of the designed siRNAs is an important thus selected and considered for further validation criterion for evaluation of its inhibition potency. of siRNA efficacy using siRNA validation server. The DINAMelt web server13 was used to determine The cut-off value of −30 was considered for further the heat capacity plot and concentration plot for shortlisting of the siRNAs (n=21)17. Finally, based the designed siRNAs. The detailed heat capacity on the result of the validation server, siRNAPred at plot helps to determine the contribution of each a cut-off value of 0.717, four different siRNA target species to the ensemble heat capacity (Cp). The regions were identified (Fig. 2) between 23339 and concentration plot-Tm (Conc.) indicates the 24317 nt positions of the S gene sequences (Table). temperature at which the concentration of double- The siRNA_1, siRNA_2 and siRNA_4 have a stranded siRNA molecules becomes one-half validation score of more than 0.9, indicating higher of its maximum value. The parameters such as inhibition efficacy12. Within the spike protein, the temperature range and initial concentrations were nucleotide region 225, 17-23, 185 nt is translated kept at default value based on the standard described into the RBD, and hence, the target binding by Markham and Zuker13. The best antisense regions of the selected siRNAs are located outside 184 INDIAN J MED RES, January & February 2021

Fig. 1. Flow chart for prediction of potential small interfering RNAs (siRNAs) against SARS-CoV-2 spike gene. The successive siRNAs screened and shortlisted by different servers is denoted by the values of ‘N’ in the bracket. Different parameters selected for the various softwares are indicated in the rectangular boxes towards the right. PANDA et al: siRNA MOLECULES FOR SARS-CoV-2 185

A

Energy: 1.6Energy: 1.9 Energy: 1.6Energy: 1.9 B

Energy: -31.5 Energy: -32.1 Energy: -34.1 Energy: -33.2

siRNA_1 siRNA_2 siRNA_3 siRNA_4

Fig. 2. (A) Secondary structure prediction and free energy of folding of the predicted siRNAs. (B) Lowest free energy structure upon binding of the predicted siRNAs with the target sequences. the RBD. The proposed siRNA_2, siRNA_3 and Tm (Conc.) value between 79.5 and 82.2, whereas Tm siRNA_4 comprise 21-mer sequences, whereas the (Cp) value ranged from 79.7 to 83.5 (Table). Values siRNA_1 is a 19 mer. All the four identified siRNAs greater than 75 indicate higher effectiveness17,19. The of the target sequence were located in the S2 graphical representation of the Tm values is shown domain; three (siRNA_2, siRNA_3 and siRNA_4) in Figures 3 and 4. In the i-Score designer server, in the region that is translated into the heptad the selected siRNAs were scored using different repeat 1 (HR1), which plays a critical role in viral algorithms and the score-based ranks according to entry18. The siRNA_2, siRNA_3 and siRNA_4 i-Score, s-Biopredsi and DSIR indicate the probability were noted to be predicted from the siDirect 2.0 of being the best siRNA20. All the four shortlisted servers, while the siRNA_1 was predicted from siRNAs in this study showed rank one by all the above Block-iT RNAi designer. The GC content of the three scores. The 2019nCoVR database is maintained siRNA molecule is an important parameter for its by the China National Center for Bioinformation functionality. The predicted siRNAs in this study and provides information regarding the sequence 16 were found to possess GC content in the range of 33 variability . No such information of mutations of the to 42 per cent (Table). The Tm (Cp) and Tm (Conc.) target sequences was indicated by the server, indicating values were calculated using the DINAMelt web the suitability of the designed siRNAs. server which defines the entire equilibrium melting In a recent study by Chowdhury et al17, eight profile of the siRNAs. All the four siRNAs had a potential siRNAs were designed for SARS-CoV-2 186 INDIAN J MED RES, January & February 2021

using computational methods based on conserved

Tm sequences in the nucleocapsid phosphoprotein 79.7 83.5 81.6 81.7 (Cp) genes and the surface spike glycoprotein gene derived from a smaller sequence dataset of 139 strains. Among the siRNAs predicted in the S gene, two siRNA target regions were located Tm 79.5 82.2 80.7 80.2 within the RBD region, whereas one target region

(concentration) was located within the fusion peptide region. The other siRNA sequences predicted against the S gene were targeted towards the S2 domain in % 35 33 38 42 GC no specific functional region17. Another study by Chen et al21 also identified nine different siRNA

‑ 2 target sequences for SARS-CoV-2 using a single reference sequence and computational approaches. score 0.935 0.964 0.781 0.917 The designed siRNAs were mainly located in Validation Validation Orf1ab, Orf1b, S gene, Orf3a, M gene and N gene. The target sequences for the S gene (n=1) were located within the S1 domain in no specific 22 −33.2 −32.1 −34.1 −31.5 functional region. A study by Shi et al reported of binding

Free energy Free energy three different siRNAs against the earlier SARS- CoV-1 structural proteins (E, M and N) that reduced 80 per cent of the target gene expression. A total of 35 patent applications have been 1.9 1.9 1.6 1.6 disclosed by Chemical Abstracts Service (CAS)

of folding 23 Free energy Free energy for designed siRNAs against SARS-CoV-1 . Most of the siRNAs were targeted towards the

structural protein nucleotide sequences such as

S, E, N and M genes23. CAS disclosed the siRNA target region information from patent application US20050004063, which was located within the nucleotide region 23165-23186 nt of the S gene, which was also translated into the RBD region23. The exact nucleotide information of the target regions is not available for the other four patent applications disclosed by CAS, which also target the S gene. However, as there is a considerable difference between the genomes24 and specifically the S gene sequences of SARS-CoV-1 and SARS- Details of the best predicted small interfering RNAs (siRNAs) against SARS ‑ CoV Table. CoV-2, it is less likely that siRNAs designed for SARS-CoV-1 would be effective for SARS- Antisense ‑ UCAUAGAGAACAUUCUGUGUA Sense ‑ CACAGAAUGUUCUCUAUGAGA Antisense ‑ AAACCUAUAAGCCAUUUGCAU Sense ‑ GCAAAUGGCUUAUAGGUUUAA Antisense ‑ AGAACAUUCUGUGUAACUCCA Sense ‑ GAGUUACACAGAAUGUUCUCU siRNA sequences siRNA Sense ‑ GGUGGUGUCAGUGUUAUAA Antisense ‑ UUAUAACACUGACACCACC CoV-223. The four siRNAs designed in our study are based on the conserved regions identified nt nt nt nt from 6000 different SARS-CoV-2 sequences and considering the prediction from multiple 24311 24289 ‑ 24311 Target region Target 24295 ‑ 24317 24260 ‑ 24282 23339 ‑ 23357 prediction servers. This enabled a larger initial dataset for screening of potential siRNAs to increase the probability of designing highly functional siRNAs against the SARS-CoV-2. cytosine; Tm, melting temperature GC, guanine ‑ cytosine; siRNA_3 siRNA_4 Serial number siRNA_2 siRNA_1 Even though the regions targeted by these PANDA et al: siRNA MOLECULES FOR SARS-CoV-2 187

A B

C D

Fig. 3. Equilibrium melting profile of the hybridized siRNAs in terms of concentration plot (Conc.). Concentration plots of siRNAs_1-4 are represented in (A-D), respectively. X-axis represents temperature in degree Celsius and Y-axis represents the mole fraction of each species of the siRNA strands. The red and green lines indicate the concentrations of the unfolded single strands (Au- A strand unfolded; Bu- B strand unfolded), and the blue and magenta lines show the folded single strands (Af- A strand folded; Bf- B strand folded). The yellow and cyan curves correspond to the two homodimers (AA & BB) and the black curve to the heterodimer (AB). siRNAs were noted to be devoid of mutations SARS-CoV-2-mediated infection, the ciliated cells based on the large initial global dataset and the of lungs are the primary site for viral entry26. Several 2019nCoVR database, continuous monitoring of potential therapies against the SARS-CoV-2 are the variability in the target regions is mandated. currently under experimental and developmental Three of the siRNAs predicted in this study were stages. The predicted siRNAs, having met the targeted towards the HR1 nucleotide region, criteria of standard siRNA molecules, may therefore, while the other target sequence was not found to be attempted as an alternative therapeutic/antiviral be located in a specific functional region. Heptad approach against SARS-CoV-2. repeats are common in both SARS-CoV-1 and SARS- siRNA-based strategy for use against CoV-2, though the nucleotide sequence and the SARS-CoV-2 has to overcome many challenges translation pattern are different in both the viruses. The such as high susceptibility to degradation, off- target siRNA sequences are unique in SARS-CoV-2, target gene silencing and activation of immune which indicates the novelty from previously designed response. Further, the proper delivery of a targeted siRNAs for SARS-CoV-122,23. The RNAi technology molecule into the host cell can provide better results has the potential to combat viral pathogens as these are towards reduction of viral copy number through highly specific towards the target sequence and are also the mechanism of gene silencing. A recent study27 flexible for targeting multiple strains of the virus25. In presented in vivo data in a mice model, in which 188 INDIAN J MED RES, January & February 2021

A B

C D

Fig. 4. Equilibrium melting profile of the hybridized siRNAs in terms of heat capacity (Cp) plot. Heat capacity plots of siRNAs_1-4 are represented in (A-D), respectively. X-axis represents temperature in degree Celsius and Y-axis represents the heat capacity which is calculated by numerical differentiation of the ensemble free energy. aerosolized delivery of siRNA via pressurized syringe Conflicts of Interest: None. to the selected organ was found to be effective for respiratory infections. Hence, the siRNAs predicted Kingshuk Panda1, Kalichamy Alagarasu1, in this study would further need to be validated by Sarah S. Cherian2,*, # & Deepti Parashar1,# in vitro studies, and later in vivo approaches can also 1Chikungunya-Dengue Group & 2Bioinformatics be considered. Group, ICMR-National Institute of Virology, Pune 411 001, Maharashtra, India In conclusion, the present study predicted *For correspondence: four potential siRNAs based on the evaluation of [email protected] predictions from three different siRNA prediction servers and additional validation from other in Received July 2, 2020 silico tools to ensure that the predicted siRNAs #Equal contribution would have the ability to interact efficiently with the target sequence with minimal non-specific binding. References The predicted siRNAs may be useful in developing RNAi-based therapeutics against SARS-CoV-2 if 1. Coronavirus. Available from: www.worldometers.info/ found effective by in vitro and in vivo studies. coronavirus/, accessed on November 19, 2020. 2. Shang J, Wan Y, Luo C, Ye G, Geng Q, Auerbach A, et al. Cell Acknowledgment: Authors acknowledge Shri Santosh Jadhav entry mechanisms of SARS-CoV-2. Proc Natl Acad Sci USA for inputs to the gene sequence data set. 2020; 117 : 11727-34. PANDA et al: siRNA MOLECULES FOR SARS-CoV-2 189

3. Walls AC, Park YJ, Tortorici MA, Wall A, McGuire AT, influenza A virus. Bioinformatics 2011; 27 : 3364-70. Veesler D. Structure, function, and antigenicity of the SARS- 16. Zhao WM, Song SH, Chen ML, Zou D, Ma LN, Ma YK, et al. CoV-2 spike glycoprotein. Cell 2020; 181 : 281-92.e6. The 2019 novel coronavirus resource. Yi Chuan 2020; 42 : 4. Uludağ H, Parent K, Aliabadi HM, Haddadi A. Prospects for RNAi 212-21. therapy of COVID-19. Front Bioeng Biotechnol 2020; 8 : 916. 17. Chowdhury UF, Sharif Shohan MU, Hoque KI, Beg MA, 5. Kumar S, Stecher G, Li M, Knyaz C, Tamura K. MEGA X: Moni MA, Sharif Siam MK. A computational approach Molecular evolutionary genetics analysis across computing to design potential siRNA molecules as a prospective platforms. Mol Biol Evol 2018; 35 : 1547-9. tool for silencing nucleocapsid phosphoprotein and 6. Villegas-Rosales PM, Méndez-Tenorio A, Ortega-Soto E, surface glycoprotein gene of SARS-CoV-2. bioRxiv 2020. Barrón BL. Bioinformatics prediction of siRNAs as potential doi: 10.1101/2020.04.10.036335. antiviral agents against dengue viruses. Bioinformation 2012; 18. Xia S, Zhu Y, Liu M, Lan Q, Xu W, Wu Y, et al. Fusion 8 : 519-22. mechanism of 2019-nCoV and fusion inhibitors targeting HR1 7. Naito Y, Yoshimura J, Morishita S, Ui-Tei K. siDirect 2.0: domain in spike protein. Cell Mol Immunol 2020; 17 : 765-7. updated software for designing functional siRNA with 19. Nur SM, Hasan MA, Amin MA, Hossain M, Sharmin T. reduced seed-dependent off-target effect. BMC Bioinformatics Design of potential RNAi (miRNA and siRNA) molecules for 2009; 10 : 1-8. middle east respiratory syndrome coronavirus (MERS-CoV) 8. Lu ZJ, Mathews DH. OligoWalk: An online siRNA design gene silencing by computational method. Interdiscip Sci 2015; tool utilizing hybridization thermodynamics. Nucleic Acids 7 : 257-65. Res 2008; 36 : W104-8. 20. Reynolds A, Leake D, Boese Q, Scaringe S, Marshall WS, 9. Liu Y, Chang Y, Zhang C, Wei Q, Chen J, Chen H, et al. Khvorova A. Rational siRNA design for RNA interference. Influence of mRNA features on siRNA interference efficacy. Nat Biotechnol 2004; 22 : 326-30. J Bioinformatics Comput Biol 2013; 11 : 1341004. 21. Chen W, Feng P, Liu K, Wu M, Lin H. Computational 10. Bellaousov S, Reuter JS, Seetin MG, Mathews DH. RNA identification of small interfering RNA targets in SARS- structure: Web servers for RNA secondary structure prediction CoV-2. Virol Sin 2020; 35 : 359-61. and analysis. Nucleic Acids Res 2013; 41 : W471-4. 22. Shi Y, Yang DH, Xiong J, Jia J, Huang B, Jin YX. Inhibition 11. Reuter JS, Mathews DH. RNA structure: software for of genes expression of SARS coronavirus by synthetic small RNA secondary structure prediction and analysis. BMC interfering RNAs. Cell Res 2005; 15 : 193-200. Bioinformatics 2010; 11 : 129. 23. Liu C, Zhou Q, Li Y, Garner LV, Watkins SP, Carter LJ, et al. 12. Kumar M, Lata S, Raghava GPS. siRNApred: SVM based Research and development on therapeutic agents and vaccines method for predicting efficacy value of siRNA. Proceedings for COVID-19 and related human coronavirus diseases. ACS of the OSCADD-2009: International Conference on Open Cent Sci 2020; 6 : 315-31. Source for Computer Aided Drug Discovery; 2009 Mar 22- 26. Chandigarh: IMTECH; 2009. 24. Chan JF, Kok KH, Zhu Z, Chu H, To KK, Yuan S, et al. Genomic characterization of the 2019 novel human- 13. Markham NR, Zuker M. DINAMelt web server for nucleic pathogenic coronavirus isolated from a patient with atypical acid melting prediction. Nucleic Acids Res 2005; 33 : pneumonia after visiting Wuhan. Emerg Microbes Infect W577-81. 2020; 9 : 221-36. 14. Ichihara M, Murakumo Y, Masuda A, Matsuura T, Asai N, 25. Qureshi A, Tantray VG, Kirmani AR, Ahangar AG. A review on Jijiwa M, et al. Thermodynamic instability of siRNA duplex current status of antiviral siRNA. Rev Med Virol 2018; 28 : e1976. is a prerequisite for dependable prediction of siRNA activities. Nucleic Acids Res 2007; 35 : e123. 26. Ghosh S, Firdous SM, Nath A. siRNA could be a potential therapy for COVID-19. EXCLI J 2020; 19 : 528-31. 15. El Hefnawi M, Hassan N, Kamar M, Siam R, Remoli AL, El-Azab I, et al. The design of optimal therapeutic small 27. Hodgson J. The pandemic pipeline. Nat Biotech 2020; 38 : interfering RNA molecules targeting diverse strains of 523-32. Indian J Med Res 153, January & February 2021, pp 190-195 Quick Response Code: DOI: 10.4103/ijmr.IJMR_2711_20

Correspondence

SARS-CoV-2 & influenza A virus co-infection in an elderly patient with pneumonia

Sir, The cyclic threshold (Ct) value for the influenza A A novel coronavirus causing respiratory illness H1N1 was 37. He was started on oral oseltamivir was first confirmed in India on February 29, 2020 and kept in hospital isolation. Considering the from Kerala State and within a couple of months, current COVID-19 pandemic and the patient’s acute cases were reported from all over the country1. This respiratory syndrome, he was also tested for the virus transmitted through respiratory tract was named SARS-CoV-2 infection. OP/NP swabs were again severe acute respiratory syndrome coronavirus-2 collected and tested for RT-PCR for SARS-CoV-2 (SARS-CoV-2)2. The transmission mode and clinical virus7, which were found positive with Ct value of presentation are similar to that of influenza A viral 26 for the E (envelop) gene (screening) and 27 and infection, and both these viruses are prevalent all 31 for RdRp (RNA-dependent RNA polymerase) over the country2-4. In South East Asian region, and ORF (open reading frame) genes (confirmatory), India has reported the highest number of COVID-19 respectively. 5 cases where influenza A is also prevalent . Here we The patient was admitted to the medical intensive report a case of co-infection with SARS-CoV-2 and care unit (ICU), and started on injection ceftriaxone influenza A H1N1 virus in an elderly patient from (500 mg i.v. BD) and injection azithromycin (500 mg Bengaluru, India. OD) for bilateral consolidation. He was also given A 65 yr old male admitted to the Pulmonology tablet hydroxychloroquine (HCQ) (400 mg BD), tablet ward in Vikram Hospital, a tertiary care hospital in vitamin C (500 mg three times a day) and tablet zinc Bengaluru city, during the second week of April 2020, 50 mg one tablet a day. Further, the patient was started had clinical presentation of breathlessness along with on supplemental oxygen via a nasal cannula at a rate productive cough and no fever. He had no travel of 6 l/min. His arterial blood gas parameters at room history or contact with any positive SARS-CoV-2- air showed severe hypoxia with 50 per cent of partial infected case in the last one month. He had comorbid pressure of oxygen and 84 per cent of saturation. After conditions including chronic obesity, obstructive the initial treatment, he was stabilized and the same pulmonary disease, type II diabetes mellitus, chronic treatment was continued. kidney disease, hypertension and hypothyroidism On day 2 of ICU admission, his oxygen saturation as the underlying conditions. On examination, started dropping and the flow increased to 10 l/min. his respiratory rate was 30 cycles/min and oxygen Then, a high-flow nasal cannula (HFNC) system was saturation was <90 per cent in ambient air. White started at 60 per cent which improved his oxygen blood cell count was normal with lower lymphocyte saturation to 96 per cent. The respiratory status count of 8 per cent (40-75%). Blood urea nitrogen was satisfactory and stable while on HFNC, with [39 mg/dl (9-20 mg/dl)] and serum creatinine [2.13 maintaining oxygen saturation above 92 per cent. mg/dl (0.66-1.25 mg/dl)] were elevated. Chest X-ray The possibility and scope for endotracheal intubation revealed bilateral extensive patchy consolidation. His and mechanical ventilation was considered, and a oropharyngeal and nasopharyngeal (OP/NP) swabs close watch was kept on his vital parameters. After a were tested by reverse transcription-polymerase stable clinical course for 4-5 h, the patient continued chain reaction (RT-PCR) for influenza A H1N1 to desaturate and developed acute hypoxaemic haemagglutinin gene6 and found to be positive. respiratory failure, warranting endotracheal intubation

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 190 MUNIVENKATAPPA et al: SARS-CoV-2 & INFLUENZA A H1N1 CO-INFECTION 191

Figure. Phylogenetic tree for the SARS-CoV-2 sequences from India along with the retrieved sequence: A maximum likelihood phylogenetic tree based on the HKY model is generated using the MEGA software (https://www.megasoftware.net/). A bootstrap replication of 1000 cycles was performed to assess the statistical robustness of the tree generated. Different clades are marked using colours on branches, and the SARS-CoV-2 sequence retrieved in the study is marked in red. The scale bar represents the branch lengths measured in the number of substitutions per site. 192 INDIAN J MED RES, January & February 2021 Contd... Not mentioned Outcome Transferred Discharged P3 ‑ Discharged after 48 h Discharged Discharged

30 mg twice a ® ‑ ritonavir 400/100 mg Tamiflu ‑ Ventilated day for five days HCQ Treatment Oral oseltamivir ICU ‑ Endotracheal intubation Oral oseltamivir P1, P2 ‑ Mechanical ventilation Lopinavir ICU ‑ Non invasive ventilation ICU Oral twice a day, oral HCQ 200 mg twice a day, twice a day (in haemodialysis patients, 100 mg twice a day) and oral oseltamivir 150 mg twice a day (in haemodialysis patients, 30 mg every 48 h). Subcutaneous interferon β ‑ 1b 8 MU was added every 48 h in P2 Oral oseltamivir (75 mg twice per day for five days) and lopinavir/ritonavir (400/100 mg twice per day for 14 days) Intravenous methylprednisolone (40 mg twice daily for five days with tapered discontinuation) HCQ, azithromycin, oseltamivir

co ‑ infection case reports

A Radiological findings CT scan report ‑ Mass, CT ground ‑ glass consolidation in the right inferior lobe of the lungs scan report ‑ Ground CT glass opacity adjacent to pleura Chest X ‑ rays Bilateral reticular shadow Chest X ‑ rays P2 Bilateral infiltrate scan report ‑ CT Bilateral peripheral ground ‑ glass opacities Chest X ‑ ray Right lower lobe infiltrate CT scan report ‑ CT Bilateral peripheral ground ‑ glass opacities ‑ 2 and influenza Abnormal laboratory parameters Leucopenia and lymphopenia Elevated liver enzymes P1 ‑ Elevated Ferritin, CRP. D ‑ dimer P2 ‑ Elevated LDH, CRP, D ‑ dimer P3 ‑ Elevated LDH, CRP, D ‑ dimer Lymphopenia, fibrinogen CRP, elevated ‑ P2 ‑ Ferritin elevated

Comorbid conditions None Dyslipidaemia, hypothyroidism All patients had hypertension P1 ‑ End stage renal disease (on dialysis) 2 Type P2 ‑ diabetes mellitus Overweight, history of myocardial infarction Hypertension, diabetes, chronic kidney disease Stage 3, congestive heart failure, coronary artery disease P2 ‑ Diabetes mellitus Literature of SARS ‑ CoV Table.

Age 69, male 56, male 78, female 66, female (yr/gender) P2 ‑ 51, male 53, male (P1) 78, male (P2) 56, male (P3) P1 ‑ 49, female Number of cases One One Three One One Two

16 15 18 17 13 19 Istanbul, Turkey, March ‑ May, 2020 Country and month/year China, Wuhan, January 2020 Tokyo, Japan, Tokyo, February 2020 Barcelona, Spain, 2020 Rome, Italy, March 2020 USA, Kentucky, 2020 MUNIVENKATAPPA et al: SARS-CoV-2 & INFLUENZA A H1N1 CO-INFECTION 193

and mechanical ventilation. The patient developed acute respiratory distress syndrome (ARDS). On mechanical ventilation, he was placed in P1 and P2 expired Outcome Discharged pressure-controlled ventilation mode and ARDSnet 8

protocol was followed. However, the patient continued ® to remain hypoxaemic and blood pressure continued to drop, requiring inotropes. After six hours on mechanical ventilation, the patient’s clinical condition deteriorated and died due to cardiac arrest on the early hours of day 3 of ICU admission. The OP/NP swabs were sent to the ICMR- National Institute of Virology (ICMR-NIV), Pune, for retrieving the complete genome of the viruses. (lopinavir/ritonavir) Treatment ICU HCQ and Kaletra Combination Oral oseltamivir Glucocorticoid therapy P2 ‑ Non invasive ventilation The study was approved by the Institutional Ethics Committee. The sequencing was performed using the steps, as mentioned previously9. De novo assembly was performed which led to 56 contiguous segments (contigs) with a minimum size of 500 nucleotides. A single contig of 29,813 nucleotide bases was retrieved and identified as SARS-CoV-2 using Basic Local Alignment Search Tool (BLAST) (https://blast.ncbi.nlm.nih.gov/Blast.cgi#) search. Radiological findings CT scan report ‑ CT Bilateral peripheral ground ‑ glass opacities CT scan report ‑ CT Pulmonary lesions BLAST analysis revealed that none of the contigs

matched for the influenza A virus. The maximum likelihood tree (Figure) was generated for the SARS-CoV-2 sequence retrieved in this study, with the other Indian SARS-CoV-2 sequences Abnormal laboratory parameters P1 and P2 ‑ Lymphopenia P1 and P2 ‑ Lymphopenia in elevated CRP P1, P2 and P3 downloaded from the Global Initiative on Sharing All Influenza Data (GISAID)10 using the Hasegawa- Kishono-Yano (HKY) model11. It was observed that the sequence, grouped with the unclassified SARS-CoV-2 sequences. As per the GISAID classification, the sequence laid within the GISAID unclassified ‘O’ clade. Comorbid conditions P1 ‑ Chronic lung disease P2 ‑ Hypertension

Elderly patients with multiple comorbid conditions including chronic lung diseases with dual viral infection may manifest with worsening ARDS. The clinical management for the patient in this study gender) Age (yr/ P2 ‑ 50, male P2 ‑ 75, male P1 ‑ 47, female P1 ‑ 78, female P3 ‑ 49, female included mechanical ventilation along with different drug administration (HCQ, ceftriaxone/azithromycin combination), but his clinical condition could not be improved. Even on ventilation, his oxygen saturation Number of cases Three Two and blood pressure continued to decline, finally leading to death. Similar case scenario was observed for another two elderly cases from Iran, demonstrating overwhelming ARDS and death12.

20 12 SARS-CoV-2 and influenza A virus co-infection Country and ` reactive protein; CT, computed tomography; ICU, intensive care unit; HCQ, hydroxychloroquine; LDH, lactate dehydrogenase C ‑ reactive protein; CT, CRP, Wuhan, China, Wuhan, September, 2020 month/year Bojnurd, Iran, March ‑ April, 2020 manifests common clinical features such as fever, sore throat, cough, rhinitis, headache and body pain though 194 INDIAN J MED RES, January & February 2021 the presentation period is different for both viruses Ashok Munivenkatappa1,*, Pragya D. Yadav4, from the time of infection3,13. Infection from both of K. Swetha2, Manjunatha Jayaswamy1, the viruses can progress to ARDS, however ARDS Dimpal A. Nyayanit4, Rima Rakeshkumar Sahay4 is more common and mortality is 3-4 per cent with & T. J. Basavaraj3 SARS-CoV-2, whereas ARDS is less common 1ICMR-National Institute of Virology, Field Unit, and mortality is <1 per cent with influenza A viral Bangalore, 2Department of Pulmonology, Vikram infection13,14. Hospital Pvt. Ltd., 3Department of Pulmonary Medicine, Bangalore Medical College & Reports of SARS-CoV-2 and influenza A Research Institute, Bengaluru 560 002, Karnataka co-infection have been reported from China, Japan, & 4Maximum Containment Laboratory, Turkey, Iran, Spain, the USA and Italy15-20. Infected ICMR-National Institute of Virology, individuals had an age ranging from 47 to 78 yr, Pune 411 021, Maharashtra, India with majority of them being males. The presenting *For correspondence: symptoms were fever, cough, rhinitis, headache [email protected] and body pain. Majority of the patients also had comorbid conditions such as obesity, hypertension, Received June 24, 2020 chronic kidney disease, chronic lung disease, diabetes mellitus and chronic heart diseases. Elevated References C-reactive protein, serum ferritin, D-dimer, liver enzymes and lymphopenia were abnormally observed 1. Yadav PD, Potdar VA, Choudhary ML, Nyayanit DA, laboratory parameters. Common radiological Agrawal M, Jadhav SM, et al. Full-genome sequences of the first two SARS-CoV-2 viruses from India. Indian J Med Res findings were bilateral pulmonary peripheral ground- 2020 ; 151 : 200-9. glass opacities12,16-19. Ventilator support was required for the majority of patients. Considering influenza 2. Wu Y, Ho W, Huang Y, Jin DY, Li S, Liu SL, et al. SARS-CoV-2 is an appropriate name for the new coronavirus. A viral infection, oral oseltamivir was used for Lancet 2020; 395 : 949-50. the treatment of all patients. For SARS-CoV-2 3. Jiang C, Yao X, Zhao Y, Wu J, Huang P, Pan C, et al. infection, experimental off-label drugs such as HCQ, Comparative review of respiratory diseases caused by glucocorticoid and lopinavir/ritonavir combination coronaviruses and influenza A viruses during epidemic season. were given to some patients. The outcome among Microbes Infect 2020; 22 : 236-44. majority of the co-infected patients was found to 4. Kulkarni SV, Narain JP, Gupta S, Dhariwal AC, Singh SK, be satisfactory, and they were discharged from the Macintyre CR. Influenza A (H1N1) in India: Changing hospital, except for two patients from Iran who epidemiology and its implications. Natl Med J India 2019; expired15-20 (Table). 32 : 107-8. 5. World Health Organization. WHO Coronavirus Disease The current study describes an elderly patients with (COVID-19) Dashboard. Available from: https://covid19. SARS-CoV-2 and influenza A H1N1 co-infection with who.int/?gclid=Cj0KCQjwhb36BRCfARIsAKcXh6EC0NC4N various comorbid conditions, clinically deteriorated by 1g3rs9-T0Tn3fvY3uMMv2WEgBxwAuUkLvOBsoXcgVikkb4a waning ARDS. This study indicates the need for prompt Ar44EALw_wcB, accessed on September 2, 2020. identification of the co-infection cases especially during 6. World Health Organization. CDC protocol of real time RT- this pandemic and flu season. Larger studies need to be PCR for influenza A (H1N1). Available from: https://www.who. undertaken to generate data evidence from different int/csr/resources/publications/swineflu/CDCRealtimeRTPCR_ regions of the country to establish aetiological diagnosis SwineH1Assay-2009_20090430.pdf?ua=1, accessed on June for co-infection. 10, 2020. 7. Gupta N, Potdar V, Praharaj I, Giri S, Sapkal G, Yadav P, Financial support & sponsorship: Financial support was et al. Laboratory preparedness for SARS-CoV-2 testing in provided by the Department of Health Research to ICMR-NIV, India: Harnessing a network of Virus Research & Diagnostic Pune. Laboratories. Indian J Med Res 2020; 151 : 216-25. 8. Grasso S, Stripoli T, De Michele M, Bruno F, Moschetta M, Conflicts of Interest: None. Angelelli G, et al. ARDSnet ventilatory protocol and alveolar MUNIVENKATAPPA et al: SARS-CoV-2 & INFLUENZA A H1N1 CO-INFECTION 195

hyperinflation: Role of positive end-expiratory pressure. Am J 15. Zheng X, Wang H, Su Z, Li W, Yang D, Deng F, et al. Respir Crit Care Med 2007; 176 : 761-7. Co-infection of SARS-CoV-2 and Influenza virus in Early 9. Yadav PD, Nyayanit DA, Shete AM, Jain S, Majumdar TP, Stage of the COVID-19 Epidemic in Wuhan, China. J Infect Chaubal GY, et al. Complete genome sequencing of Kaisodi 2020; 81 : e128-9. virus isolated from ticks in India belonging to Phlebovirus 16. Azekawa S, Namkoong H, Mitamura K, Kawaoka Y, Saito F. Co‐ genus, family Phenuiviridae. Ticks Tick Borne Dis 2019; infection with SARS‐CoV‐2 and influenza A virus. IDCases 10 : 23-33. 2020; 20 : E00775. 10. Shu Y, McCauley J. GISAID: Global initiative on sharing all 17. Cuadrado-Payán E, Montagud-Marrahi E, Torres-Elorza M, influenza data - from vision to reality. Euro Surveill 2017; Bodro M, Blasco M, Poch E, et al. SARS-CoV-2 and influenza 22 : 30494. virus co-infection. Lancet 2020; 395 : e84. 11. Hasegawa M, Kishino H, Yano T. Dating of the human-ape splitting by a molecular clock of mitochondrial DNA. J Mol 18. D’Abramo A, Lepore L, Palazzolo C, Barreca F, Evol 1985; 22 : 160-74. Liuzzi G, Lalle E, et al. Acute respiratory distress syndrome due to SARS-CoV-2 and Influenza A co-infection in an 12. Hashemi SA, Safamanesh S, Ghafouri M, Taghavi MR, Italian patient: Mini-review of the literature. Int J Infect Mohajeri Zadeh Heydari MS, Abad HN, et al. Co‐infection Dis 2020; 97 : 236-9. with COVID‐19 and Influenza A virus in two died patients with acute respiratory syndrome, Bojnurd, Iran. J Med Virol 19. Ozaras R, Cirpin R, Duran A, Duman H, Arslan O, 2020; 92 : 2319-21. Bakcan Y, et al. Influenza and COVID-19 coinfection: 13. Konala VM, Adapa S, Gayam V, Naramala S, Report of six cases and review of the literature. J Med Duggubati SR, Kammari CB, et al. Co-infection with influenza Virol 2020; 92 : 2657-65. A and COVID-19. Eur J Case Rep Intern Med 2020; 7 : 001656. 20. Ding Q, Lu P, Fan Y, Xia Y, Liu M. The clinical characteristics 14. Fang Z, Zhang Y, Hang C, Ai J, Li S, Zhang W. Comparisons of pneumonia patients coinfected with 2019 novel of viral shedding time of SARS-CoV-2 of different samples in coronavirus and influenza virus in Wuhan, China. J Med Virol ICU and non-ICU patients. J Infect 2020; 81 : 147-78. 2020; 92 : 1549-55. Indian J Med Res 153, January & February 2021, pp 196-198 Quick Response Code: DOI: 10.4103/ijmr.IJMR_2789_20

Correspondence

Inactivation of SARS-CoV-2 by gamma irradiation

Sir, maximum irradiation dose of 15,000 rad (0.15 kGy), The coronavirus disease 2019 (COVID-19) a dose not expected to inactivate the virus. There pandemic caused by severe acute respiratory syndrome is no information available on gamma inactivation coronavirus 2 (SARS-CoV-2) is the most impactful of SARS-CoV-2. Considering the need to develop pandemic of the 21st century affecting millions of non-infectious diagnostic reagents for use in serological persons within a short span of time1. Several protective assays, the present study was carried out to evaluate the and control measures have been implemented to control inactivation of SARS-CoV-2 using gamma irradiation. the rapid spread of the disease. However, universal The study was conducted at the Indian Council mask usage, social distancing and maintaining hand of Medical Research-National Institute of Virology and surface hygiene seem to be the most useful methods (ICMR-NIV), Pune, India, and approved by the to contain the transmission of the virus2. Institutional Biosafety Committee. SARS-CoV-2 The World Health Organization (WHO) has clinical virus isolate (passage-2) obtained from recommended and approved SARS-CoV-2-specific the throat/nasal swab of a COVID-19 patient was real-time reverse transcriptase-polymerase chain used in all the experiments8. The SARS-CoV-2 reaction (RT-PCR) as the optimal method for the was freshly propagated in Vero CCL-81 cells using diagnosis of COVID-193. Serological assays are Eagle’s minimum essential medium (MEM, GIBCO, also being utilized in monitoring and surveillance Thermo Fisher Scientific, USA) supplemented with activities to determine the new case frequency during two per cent fetal bovine serum (HiMedia, Mumbai), outbreaks and the true infection rate of the disease. penicillin (100 U/ml) and streptomycin (100 mg/ml)8. The development of such serological assays requires On the 4th day post-infection, cells were observed for the production of authentic SARS-CoV-2 virus stock cytopathic effects. The supernatant of the infected for antigen preparation. Considering the high risk Vero CCL-81 cells was harvested after a single freeze- associated with SARS-CoV-2 infection, the WHO has thaw cycle. After centrifugation, the clear supernatant advised that the propagation of the virus be conducted was aliquoted in a 1.5-ml/tube and stored at −80°C until within the Biosafety level-3 (BSL-3) laboratories. further use. This virus stock was titrated in duplicate To protect laboratory personnel from SARS-CoV-2 using the median tissue culture infectious dose 8 infection, the developed serological assay reagents (TCID50) assay in a 96-well plate . Subsequently, the should be non-infectious and therefore, safe to be used virus titre was calculated using the Reed and Muench in resource-limited settings. Hence, it is necessary to method9. The SARS-CoV-2-infected cells produced a 6.5 inactivate the virus so that it can be handled within the titre of 10 TCID50/ml. BSL-2 laboratory for developing serological assays. Duplicate vials of each gamma irradiation Gamma irradiation is a commonly employed experimental set and virus control vials were prepared method for inactivation of viruses. The method from the virus stock. All the cryovials were sealed using inactivates virus mainly by cross-linking of genomic a Parafilm, packed in a biohazard bag and thoroughly material or radiolytic cleavage4,5, resulting in the loss surface disinfected. The experimental sets of the cryovials of infectivity of viruses without affecting the structural were sent out from the containment laboratory to a integrity of the antigenic proteins6. Darnell et al7 BSL-2 laboratory for gamma irradiation. Non-irradiated studied the gamma inactivation of SARS-CoV at a virus control vials were stored at −80˚C until further use.

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 196 JAIN et al: SARS-CoV-2 INACTIVATION USING GAMMA IRRADIATION 197

A gamma chamber (GC-5000) with a cobalt-60 A dose of 5 kGy failed to completely inactivate the 1 source [Board of Radiation and Isotope Technology SARS-CoV-2 with a remaining titre of 10 TCID50 (BRIT), India] was used for gamma irradiation observed. experiments. Annually, the gamma dosimetry of Another experiment was carried out in duplicate GC-5000 is established by the authorities of BRIT, with gamma irradiation doses of 1, 2, 3, 4, 5, 6, 7, 8, 9 Mumbai, at ICMR-NIV, Pune. Uncertainty in the and 10 kGy to determine the dose-response kinetics for absorbed dose was determined using a dosimeter inactivation of SARS-CoV-2. The results of this study during GC-5000 calibration. This process validated the revealed the complete inactivation of SARS-CoV-2 at actual gamma radiation dose imparted to the specimens doses of 6 kGy and above. The non-irradiated virus in GC-5000. Virus stock vials for gamma irradiation control specimens of both the experiments did not show experiments were thawed in an ice bucket. The vials any reduction in the original virus titre with a standard were placed in the biohazard bag containing ice error of ± 0.5 log ×103 TCID /ml (Fig. 1). The D flakes. The sample bucket was taken out of the sample 10 50 10 value is the ability of gamma radiation to reduce an chamber by turning the slide locking arrangement exposed microbial population 90 per cent (one log ) of the removable half door. The biohazard bag with 10 under standard conditions of time, temperature and the specimens was then loaded in the bucket and the dose. The D values were calculated using the inverse bucket was again fixed in the sample chamber. After 10 of the slopes of the regression lines (1/slope) of gamma closing the sample chamber, the system was operated irradiation dose against log virus titre using Microsoft on auto mode. The gamma-irradiated specimens were Office Excel 2007 (Microsoft Corp., Redmond, removed after the completion of each irradiation dose WA, USA). The D was found to be 1.09 kGy. This of 1, 5, 10, 15 and 25 kGy. Two vials of each irradiated 10 corresponds to a 0.92 log reduction in titre per kGy specimen were tested in duplicates using the TCID 10 50 (Fig. 2). assay to determine the inactivation of the irradiated virus specimens. Feldman et al6 reported inactivation of another betacoronavirus, SARS-CoV, with gamma irradiation The TCID assay of the irradiated specimens 50 dose of 10 kGy. The present study demonstrated the (preliminary study) demonstrated that SARS-CoV-2 inactivation of SARS-CoV-2 by gamma irradiation at was inactivated by gamma irradiation at the 10 kGy doses expected to inactivate viruses. Understanding dose (data not shown). This confirmed the complete of the gamma inactivation dose and optimization inactivation of SARS-CoV-2 at this dose. All the of gamma inactivation procedure for SARS-CoV-2 gamma doses above 10 kGy (15, 20 and 25 kGy) should help in developing non-infectious and safe were also found to inactivate the virus completely. viral stocks for use in preparing diagnostic reagents. The data generated from this study can also be utilized Gamma-irradiated Non-irradiated 500 6 450 log (n) Linear [log (n)]

/ml) 400 y = -0.9154x + 5.3061 50 5 R² = 0.9685 350 /ml] 50 TCID 3 300 4 ×10

10 250 g 3 200 150 2

Virus titre (lo 100

Virus titre [log (n) TCID 1 50

0 0 0123456 0123456 Radiation dose in kGy Gamma irradiation dose in kGy Fig. 1. Effect of gamma radiation on the infectivity of SARS-CoV-2. Fig. 2. Plot used for calculating the gamma radiation dose required

TCID50, median tissue culture infectious dose. to reduce infectivity of SARS-CoV-2 by 90% (D10 value) in kGy. 198 INDIAN J MED RES, January & February 2021 further for the gamma inactivation of quality control emergencies/diseases/novel-coronavirus-2019, accessed on panels of diagnostic kits and clinical specimens of April 10, 2020. SARS-CoV-2. 2. Mondal C, Adak D, Majumder A, Bairagi N. Mitigating the transmission of infection and death due to SARS-CoV-2 Acknowledgment: Authors acknowledge the support and through non-pharmaceutical interventions and repurposing guidance of Dr Priya Abraham, Director, ICMR-NIV, Pune, and drugs. ISA Trans 2020. doi: 10.1016/j.isatra.2020.09.015. Servshri Mayur Mohite and Yogendra Gondane for the technical assistance. 3. World Health Organization. Laboratory testing for coronavirus disease (COVID-19) in suspected human cases. Available Financial support & sponsorship: Financial support was from: https://apps.who.int/iris/rest/bitstreams/1272454/retrieve, provided by the ICMR-NIV, Pune. accessed on April 10, 2020. Conflicts of Interest: None. 4. Sullivan R, Fassolitis AC, Larkin EP, Read RB Jr., Peeler JT. Inactivation of thirty viruses by gamma radiation. Rajlaxmi Jain, Prasad Sarkale, Appl Microbiol 1971; 22 : 61-5. Deepak Mali, Anita M. Shete, Deepak Y. Patil, 5. Elliott LH, McCormick JB, Johnson KM. Inactivation of Triparna Majumdar, Annasaheb Suryawanshi, Lassa, Marburg, and Ebola viruses by gamma irradiation. Savita Patil, Sreelekshmy Mohandas & J Clin Microbiol 1982; 16 : 704-8. Pragya D. Yadav* 6. Feldmann F, Shupert WL, Haddock E, Twardoski B, Maximum Containment Laboratory, Feldmann H. Gamma irradiation as an effective method for ICMR-National Institute of Virology, inactivation of emerging viral pathogens. Am J Trop Med Hyg 2019; 100 : 1275-7. Pune 411 021, Maharashtra, India *For correspondence: 7. Darnell ME, Subbarao K, Feinstone SM, Taylor DR. [email protected] Inactivation of the coronavirus that induces severe acute respiratory syndrome, SARS-CoV. J Virol Methods 2004; Received June 29, 2020 121 : 85-91. 8. Sarkale P, Patil S, Yadav PD, Nyayanit DA, Sapkal G, Baradkar S, et al. First isolation of SARS-CoV-2 from clinical References samples in India. Indian J Med Res 2020; 151 : 244-50. 1. World Health Organization. Coronavirus disease (COVID-19) 9. Reed LJ, Muench H. A simple method of estimating fifty per outbreak situation. Available from: https://www.who.int/ cent endpoints. Am J Hyg 1938; 27 : 493-7. Indian J Med Res 153, January & February 2021, pp 199-200 Quick Response Code: DOI: 10.4103/ijmr.IJMR_3883_20

Correspondence

Impact of the COVID-19 pandemic on clinical ophthalmology

Sir, which can be based on torchlight examination or slit- There are numerous reports of several lamp examination. Patients who are in need of urgent ophthalmologists getting infected by COVID-19 and attention should be examined first and those who need also of mortality among ophthalmologists, despite routine examination can be tele-consulted or may be being fully gowned with a protective suit and N95 given a review date later. Fundus imaging has proven respirator1. We read with interest the review article by beneficial even while triaging the retina patients. While Gupta et al2 and were impressed by their point of view. managing the outpatient department, the authors have However, we have a few important observations and correctly enlisted all the precautions2. We would like to suggestions to make which may be beneficial for the add a few important points such as limited number of readers to get more insight from the ophthalmologist patients should be permitted inside the hospital on an point of view. appointment basis, alternate chair-sitting arrangement Considering the proximity of encounter, the benefits for social distancing, separate conjunctivitis ophthalmologists are at highest risk while doing slit- cubicle for red eye or conjunctivitis patients and an lamp examination, direct and indirect ophthalmoscopy isolated cubical area with doctors wearing full personal and gonioscopy. The viral transmission through these protective equipment for examination of patients with a instruments can be prevented by regular cleaning with history of COVID-19 infection. Topical eye drops can an alcohol-based sanitizer after each examination. be made available in the form of pre-assembled kits for Moreover, these can be covered with a cling wrap on a emergency conditions such as conjunctivitis, trauma, daily basis. The authors have listed the ocular finding corneal ulcers, hordeolum internum and externum and in COVID-19 patients holistically2. Recently many acute dacryocystitis. reports of retinal involvement in COVID-19 patients For the operation theatre (OT) management have come forward. The manifestations vary from protocol, the patients should wash their hands and retinal haemorrhage, cotton wool spots, central retinal face before entering the OT. If COVID-19 testing 3 artery occlusion and hyper-reflective lesions at the is not possible during emergency, a chest X-ray level of ganglion cell and inner plexiform layers, more should be done mandatorily. Complete haemogram prominently at the papillomacular bundle documented to rule out thrombocytopenia and electrocardiogram 4 on optical coherence tomography scan . are must before any surgical intervention. Oxygen The authors have highlighted the screening saturation levels should be monitored using a pulse protocol at the hospital entrance2. We would like to oximeter during surgery in the OT. All surgeries add a few points here. The order should follow like should be done on a day-care basis. Syringing should hand washing, three-ply mask application, thermal be avoided, and this can be replaced by fluorescein screening, relevant COVID-19 history and application dye disappearance test6. Betadine application should of hand sanitizer before entering the clinic. Social be mandatory as it is shown to reduce the flora in distancing needs to be observed at each step5. The the cul-de-sac7. Saline jetting should be avoided to authors have segregated patients based on triaging. We prevent aerosol dissemination. Viscoelastic spread would like to add that triage should be done while taking over the cornea also helps in reducing the aerosol history from the patient and also while examination generation. Only one attender should be permitted

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 199 200 INDIAN J MED RES, January & February 2021 with patients, and all comorbidities should be ruled lacrimal surgery during the COVID-19 pandemic. Indian J out. For surgery, the quickest and the safest procedure Ophthalmol 2020; 68 : 974-80. should be followed. 7. Edington M, Ramaesh K, Lockington D. Virucidal benefits of povidone-iodine use on the ocular surface: A review. BMJ Financial support & sponsorship: None. Open Ophthalmol 2020; 5 : e000509.

Conflicts of Interest: None. DOI: 10.4103/0971-5916.307214 1,* 2 Bharat Gurnani & Kirandeep Kaur Quick Response Code: Departments of 1Cornea & Refractive Services & 2Pediatric Ophthalmology & Squint Service, Aravind Eye Hospital & Postgraduate Institute of Ophthalmology, Puducherry 605 007, India *For correspondence: [email protected] Received September 14, 2020 Authors’ response We appreciate the authors Gurnani and Kaur1 for References their constructive comments. This review was written at a time when many clinical findings were not known. 1. Li JO, Lam DS, Chen Y, Ting DS. Novel coronavirus disease We have also started tele-ophthalmology services at our 2019 (COVID-19): The importance of recognising possible institute and have separate cubicles for the examination early ocular manifestation and using protective eyewear. Br J Ophthalmol 2020; 104 : 297-8. of patients with conjunctivitis or those whose Aarogya Setu app shows red/high risk of infection. Once again, 2. Gupta PC, Kumar MP, Ram J. COVID-19 pandemic from an ophthalmology point of view. Indian J Med Res 2020; 151 : we thank the authors for the time and effort they put in 411-8. bringing out many important points which are relevant 3. Acharya S, Diamond M, Anwar S, Glaser A, Tyagi P. Unique in the COVID era.

case of central retinal artery occlusion secondary to COVID-19 1 2 disease. IDCases 2020; 21 : e00867. Parul Chawla Gupta , Praveen Kumar M & Jagat Ram1,* 4. Marinho PM, Marcos AA, Romano AC, Nascimento H, 1 2 Belfort R Jr. Retinal findings in patients with COVID-19. Departments of Ophthalmology & Pharmacology, Lancet 2020; 395 : 1610. Postgraduate Institute of Medical Education & 5. Sharma N, Sachdev MS. All India ophthalmological society: Research, Chandigarh 160 012, India * Stance on COVID-19 pandemic. Indian J Ophthalmol 2020; For correspondence: 68 : 1239-42. [email protected] 6. Ali MJ, Hegde R, Nair AG, Bajaj MS, Betharia SM, References Bhattacharjee K, et al. All India Ophthalmological Society - Oculoplastics Association of India consensus 1. Gurnani B, Kaur K. Impact of the COVID-19 pandemic on statement on preferred practices in oculoplasty and clinical ophthalmology. Indian J Med Res 2020; 152. Indian J Med Res 153, January & February 2021, pp 201-206 Quick Response Code: DOI: 10.4103/ijmr.IJMR_4525_20

Correspondence

Modelling the spread of SARS-CoV-2 pandemic - Is this even close to a supermodel?

Sir, dA =SL (I +A)- A (3) I read with interest the article on modelling the dt spread of SARS-CoV-2 pandemic published recently1. dI (4) =S(I +A)- I I am writing to convey my concerns with the model dt H proposed in this article. In view of my concerns about dR the model, I also cannot agree with the quantitative A =Aγ (5) inferences of the model, which has been widely dt mentioned as a ‘supermodel’ from India. dR I =Iγ (6) The authors must be aware of the earlier models dt proposed for modelling coronavirus disease 2019 dD (7) (COVID-19), where the presence of asymptomatic =Iη infected have been explicitly considered. Therefore, dt the inclusion of the A component per se, in the proposed model is not new. Further, the extensive My objections and concerns are listed below: changes in parameters done in this study, without 1. There are a few standard ways of framing proper mathematical analysis or biological reasoning, epidemiological compartment models. The different is risky in terms of prediction and evaluation of types of compartmental models [SIR (susceptible- goodness-of-fit, unless the parameters and initial infected-recovered), SEIR (susceptible-exposed- condition dependence of the model, with respect to its infected-recovered), SIRS (susceptible-infected- robustness, are investigated. Such modelling exercises recovered-susceptible)] are structurally and are often tantamount to back-fitting of the data to the mathematically different from each other. The model. Further, the data used in this study are also of interactions among the compartments (based on heterogeneous nature [subject to error due to under- the disease biology) are such that it is not possible reporting, high variability in testing across the country to simply add the compartments (and the evolution and mixing of data with different sensitivities (reverse transcription-polymerase chain reaction and rapid equations) and reduce it to another type. Hence, an antigen testing), etc.], and therefore, reliability is also SEIR model is structurally different from an SIR or highly variable. SIRS models. Thus one should not be able to reduce a properly framed SAIR (susceptible-asymptomatic- My primary concerns are with the framing of the infected-recovered) model to an SIR model, because model, whose equations are reproduced below: of the underlying interaction structure of the dS compartments (through parameters and interaction L =-β S(I+A) (1) dt L terms). This SAIR model used by Agrawal et al1 is just the opposite. There is no difference in A and I dSH (2) =-β S(H I+A) equations. This means that one can keep dividing dt the susceptible and infected compartments into as

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 201 202 INDIAN J MED RES, January & February 2021

many compartments as one wants - may be pre- of the person (immunity level, genetic disposition, symptomatic, asymptomatic with no symptoms, comorbidities, etc.)”1. Till date, none of these with low symptoms, with headache, showing long individual traits has been shown to determine if COVID-19 symptoms, etc. and then add them to say the infected individual will be A or I. Furthermore, that it essentially is a SIR model (https://www.iith. asymptomatic has not been defined clearly, even ac.in/~m_vidyasagar/arXiv/Super-Model.pdf). This though the inclusion of asymptomatics (A) is is not epidemiological compartment modelling, and what makes this model ‘new’. It is to be noted certainly not developing a new SAIR model. This that an asymptomatic is one without symptoms, model can easily be reduced to two parallel SIR but the presence or absence of symptoms depends

(SL-A-RA and SH-I-RI) models. So it is an improperly on what symptoms one is looking for. Existence framed model. of pre-symptomatic individuals, with no or very 2. Equations (1) and (2) are structurally the same. If little symptoms, is known (who never inform

SH (0)=0.499 (say), SL (0)=0.500, and I=0.001, then and therefore, not tested), who finally may or both the subgroups of S evolve exactly in the same may not convert to a fully symptomatic case manner, and essentially follow the same trajectory. (I). An important factor that has been ignored is Since these are simply population fractions, age because the epidemiology of SARS-CoV-2 the equations with subdivisions make no sense. infection and its outcome has been shown to be Similarly, it is not understood how, with the same age-dependent2,3. For including individual traits parameters (beta, gamma), the A and I evolution and their effect on infection spread, the agent-based equations (Equations (3) and (4)) are different. As models are more appropriate, and there have been 4 mentioned above, for the same SL(0) and SH(0), the a few around . trajectory of equations (1) and (2) are the same, and 5. The most confusing parameter is epsilon, which so are equations (3) and (4). Then mathematically, has been used extensively for data-fitting. The there is no difference in these two variables. What definition of epsilon varies in the different versions is the advantage in having separate compartments of the model. The expanded model (in Supermodel.

then? What kind of SAIR model is this? Thus, these pdf) defines it as: epsilon=SH(0)/S(0). Which equations are both unrealistic and mathematically means that epsilon depends on the initial value ill-framed. for equation (2). Therefore, its change with time 3. Of the two variables, A and I, A is not easily in a particular region (with a particular population measurable, and so total I+A is not known. It may be size) in different phases (which are contiguous possible to consider a fraction of A (asymptomatic in time) does not arise. However, in this paper and/or pre-symptomatic), be converted to I, depending “the parameter ε measures the ratio between on how the viral load increases in the body (about infected symptomatic and asymptomatic patient which not much is known). This leads to interaction populations”1. That means, ε=I/A. In this case, between the A and I compartments, which can the parameter epsilon should change with time. then lead to a SAIR model different from a simple But the authors write, “In principle, the parameter SIR model. Similar objections can be raised for ε should not change as the ratio of infected and equations (5) and (6). Given the rapidly evolving asymptomatic remains constant in the model”1. behaviour of SARS-CoV-2 (including changes in There are evolution equations for both A and I, and the types and mutations in the genome sequences in there is no conservation of numbers of (I+A) with India) and the increasing experimental literature on time. So why is the parameter ε expected to remain reinfection and/or relapse cases, it will be pertinent constant in the model? The only reason for changing to consider a SIRS (or variations thereof) model epsilon, with no apparent scientific basis in the same as part of the so-called Supermodel for the future population, seems to fit the data. If this parameter is relevance. incorporated in the model equations, then one can 4. From the available biological information, dividing track it mathematically. With no existing references

the susceptible population to SL and SH is or a technical way to track epsilon, the results are inappropriate. The reason given is “the physiology difficult to justify. SINHA: SUPERMODEL FOR SARS-CoV-2 203

6. Identification of the phases of the epidemic is variables may exhibit different final trajectories another contentious issue. The authors have stated based on the basin boundaries of the fixed points that “these were obtained by identifying the dates and with chaotic dynamics. It is not clear (and not on which the value of ε increased significantly”1. mentioned) whether this property is true with the Sometimes it is 25 days, 45 days, etc. In view proposed model. Therefore, how can one distinguish of what is stated in para 5 above, these seem between two variables that have the same evolution unreasonable and have been possibly done for back- equations and parameters? fitting the data. The role of migration, if included, 12. The concerns about the parameters estimation should change both S, A and I at a particular time methods are not being detailed. It is an important point, and not S alone. issue, as different methods have different pros/ The following points are my additional concerns cons, and these can be manipulated easily to fit and related queries/suggestions: anything. One expects some references on parameter 7. Let us consider that gamma is the rate of exiting the estimation methods used in the study. In any case, compartments A and I. Then gamma for I includes later data5 have already shown that the model both recovery and death, and the same parameter is predictions are not correct. only for the recovery rate for A. In such a case how 13. During an epidemic/pandemic, since it is rare to obtain is eta an independent parameter? Should not the data that are complete, it is standard to account for propensity of death from I individuals only be a fixed under-reporting in data. The present study essentially fraction of gamma? assumes that the data set under analysis is ideal, i.e. 8. Given the above, and with no explicit sink term reported cases and number of cases are the same. In (-eta*I) included in equation 4, the evolution India (and other countries), a comparison of serology equation for D is not correct. What is the source of D and case data shows that most seropositive individuals in equation 7 if (-eta* I) is absent in equation 4? But were never reported as cases6,7. Hence, by failing to then, if the mortality term is included in equation (4) account for under-reporting, the model parameters for correcting it, then is the conservation expression and results from the model are likely to be biased. The i.e. S +S +A+I+R +R =1 valid? L H A I authors should include these critical considerations, 9. An important problem with this model and its and also study the robustness of the model. treatment for data fitting is in the calculation of Given that there are many models in the literature the R0 (basic reproductive rate), which is simply considered to be beta/gamma. With the given now, we expected a reasonably good, biologically values of beta and gamma in Table 1, the paper relevant, and mathematically correct model from the national committee. yields erratic values of R0 at different phases. Since population size and sizes of S sub-compartments at Financial support & sponsorship: None. t=0 are considered to be very important (through the parameter epsilon), it is imperative that the authors Conflicts of Interest: The views expressed in this letter are consider the values of ‘effective reproduction personal and do not represent that of the affiliated organization.

number (Reff )’, and not R0, at different phases. In Somdatta Sinha addition, R0=beta/gamma is true only for the simple SIR model. For other type of compartment models, Adjunct Professor, Department of Biological it will be different. The authors need to check the Sciences, Indian Institute of Science Education & relevant papers regarding this. Research, Kolkata 741 246, West Bengal, India 10. The absence of any wire (transition) diagram of *For correspondence: the compartment conversions, that clearly depict [email protected] interactions among the compartments in an Received November 21, 2020 epidemiological model, is baffling. It is the first step to visualize any disease progression kinetics in a model population References 11. It is known to those from non-linear dynamics, that 1. Agrawal M, Kanitkar M, Vidyasagar M. Modelling the small variations in the initial condition of model spread of SARS-CoV-2 pandemic - Impact of lockdowns 204 INDIAN J MED RES, January & February 2021

& interventions. Indian J Med Res 2020. doi: 10.4103/ijmr. constituting the committee and appointing the members IJMR_4051_20. to develop the model, and not coined by the authors. 2. Laxminarayan R, Wahl B, Dudala SR, Gopal K, Mohan BC, (ii) The statement that the authors must be aware of the Neelima S, et al. Epidemiology and transmission dynamics earlier models proposed for modelling COVID-19, of COVID-19 in two Indian states. Science 2020; 370 : 691-7. where presence of asymptomatic infected have been explicitly considered and therefore, not new 3. Ferguson NM, Laydon D, Nedjati-Gilani G, Imai N, Ainslie K, Baguelin M, et al. Impact of non-pharmaceutical interventions is acknowledged by the authors. In fact, reference 1 (NPIs) to reduce COVID-19 mortality and healthcare demand. 28 of our paper is about the pioneering paper by London: Imperial College London; 2020. Robinson and Stilianakis3 where the SAIR model 4. Silva PCL, Batista PVC, Lima HS, Alves MA, Guimarães FG, is proposed. Silva RCP. COVID-ABS: An agent-based model of COVID-19 (iii) Dr Sinha also suggests that the datasets used for epidemic to simulate health and economic effects of social the model are of heterogenous nature and therefore distancing interventions. Chaos Solitons Fractals 2020; 139 reliability is highly variable2. This statement would : 110088. apply to every country and to every modelling 5. COVID INDIA. Available from: https://www.covid19india. org/, accessed on November 20, 2020. exercise however, the inherent unreliability of pandemic data need not be an excuse to avoid 6. Murhekar MV, Bhatnagar T, Selvaraju S, Rade K, Saravanakumar V, Vivian Thangaraj JW, et al. Prevalence undertaking the exercise of developing a model all of SARS-CoV-2 infection in India: Findings from the together. national serosurvey, May-June 2020. Indian J Med Res (iv) The specific objections and questions enumerated 2020; 152 : 48-60. para wise in the letter are addressed below: 7. Doi A, Iwata K, Kuroda H, Hasuike T, Nasu S, 1. It is stated that the model can easily be reduced Kanda A, et al. Seroprevalence of novel coronavirus to two parallel SIR (S_L-A-R_A and S_H-I-R disease (COVID-19) in Kobe, Japan. medRxiv 2020. I) models2. We are aware of this shortcoming doi: 10.1101/2020.04.26.20079822. and have developed a method for calibrating the Robinson and Tsilianakis SAIR model to DOI: 10.4103/0971-5916.307699 real data (the first ones to do so). However, the delta parameter in that model is overly sensitive Quick Response Code: to data, and thus the traditional SAIR model does not lend itself to making accurate future projections. Moreover, the model proposed by us gave an accurate projection for >90 days since the time it was published. We might add that to the best of our knowledge, we are not aware of any other Indian model for this pandemic with similar accuracy. We are Authors’ response developing yet another model that does not At the outset, the authors1 would like to thank suffer from the shortcoming pointed out by Dr Sinha for her suggestions and critical review of Dr Sinha, and yet seems capable of producing our paper2. The detailed analytical justification of the accurate predictions. We propose to report the model was not included in the paper as its intent was same soon. In contrast to the delta parameter of to highlight some of the predictions of the model. Most the SAIR model, the epsilon parameter in the of the critical comments are possibly due to inadequate proposed model can be estimated in a robust clarification by the authors, regarding the rationale of model. There is always scope for fine tuning certain assumptions made while developing the model. and improving the process of modelling. The authors provide the following clarifications for 2. It is pointed out that equations (1) and (2) some of the observations made in the letter: are structurally the same. If S_H (0)=0.499 (i) The phrase ‘supermodel from India’ was used by the (say), S_L (0)=0.500, and I=0.001, then both Department of Science and Technology (DST) when the subgroups of S evolve exactly in the AUTHORS’ RESPONSE 205

same manner, and essentially follow the same trajectory. This is essentially the same comment as explained at para 1 above, it will be better addressed in the proposed subsequent model under process. 3. It is mentioned that given the rapidly evolving behaviour of SARS-CoV-2 (including changes in the types and mutations in the genome sequences in India) and the increasing experimental literature on reinfection and/or relapse cases, it will be pertinent to consider a Figure. Flowchart for population in the SAIR model. S, susceptible;

SIRS (or variations thereof) model as part of SA susceptible and asymptomatic; A, asymptomatic; I, infected; 2 SI, susceptible and infected; RA, recovered among asymptomatic; the so-called Supermodel for future relevance . R , recovered among infected. We have been following the rapidly evolving I behaviour of SARS-CoV-2 closely4,5. There are a more elaborate formula involving the spectral no noteworthy mutations so far as per experts (more than 99% commonality in the coding radius of the next generation matrix. This is regions of the virus). If the need arises, we will well-studied in mathematical epidemiology. include a relapse from R back to S in our model. However, with the simplifying assumptions 4. The comment that asymptomatic has not been made, the R_0 reduces to beta/gamma. We do defined clearly, even though inclusion of not see any benefit in using the effective R. asymptomatic (A) is what makes this model 10. We agree that a wire diagram should have been ‘new’ has already been answered above. We included. The same is being added as a Figure have not claimed that the inclusion of A is new. here. 5. The number ε is the ratio S_I(0)/S(0). Therefore 11. This observation mentions a few phenomena in S_I(0)/S_A(0)=ε /(1 – ε) which is approximately non-linear analysis, and adds that it is unclear equal to ε. There is no error, nor is there any whether this property is true with the proposed benefit of unnecessarily complicated formulae model. We would like to point out that one of that can be easily simplified. The author states the authors has been working on non-linear that the only reason for changing epsilon, dynamics for many decades now. The situation with no apparent scientific basis in the same that Dr Sinha has hypothesized does not occur population, seems to fit the data. This comment with any of the various classes of SEIR, SAIR, is not understood since the idea of changing any or other models, including the one proposed model parameter or equation is to fit and explain by us. There are no basin boundaries nor is the data logically. In addition, we do explain the there chaotic behaviour. The set of equilibria is method of estimating epsilon. globally attractive. This is further exemplified 6. It is explained in the paper that the epidemiological at Theorems 6, 7, and 8 of reference 271 in our parameters change with time, mainly due to 6 changes in the contact parameter beta. Thus, article . when the previous estimates no longer match 12. Comments at points 2 and 13 are simply ground-level data, a new phase is initiated opinions and do not call for any response from based on changing in interactions and hence us. the duration of phases cannot be the same. (v) We believe that our model is biologically relevant 7. The eta parameter captures deaths and does not and mathematically correct. So long as our model interfere with the gamma parameter. continues to fit not only past but also future data or 8. Answered at para 7 already. a better model can be developed, we feel our model 9. For multi-compartmental models, the simple explains the pandemic in a simple and replicable beta/gamma formula for R_0 can be replaced by way. 206 INDIAN J MED RES, January & February 2021

Manindra Agrawal1, Madhuri Kanitkar3,* 2. Sinha S. Modelling the spread of SARS-CoV-2 pandemic & M. Vidyasagar2 - Is this even close to a supermodel? Indian J Med Res 2020; 52. 1Department of Computer Science & Engineering, Indian Institute of Technology Kanpur, 3. Robinson M, Stilianakis NI. A model for the emergence of drug resistance in the presence of asymptomatic infections. 2 Kanpur 208 016, Uttar Pradesh, Department Math Biosci 2013; 243 : 163-77. of Artificial Intelligence, Indian Institute of 4. Ortiz-Prado E, Simbaña-Rivera K, Gómez-Barreno L, Technology Hyderabad, Hyderabad 502 285, Rubio-Neira M, Guaman LP, Kyriakidis NC, et al. Clinical, Telangana & 3Deputy Chief Integrated Defence molecular, and epidemiological characterization of the SARS- Staff (Medical), HQ Integrated Defence Staff, CoV-2 virus and the coronavirus Disease 2019 (COVID-19), a comprehensive literature review. Diagn Microbiol Infect Dis Ministry of Defence, Government of India, 2020; 98 : 115094. New Delhi 110 010, India 5. Ghaebi M, Osali A, Valizadeh H, Roshangar L, Ahmadi M. [email protected] Vaccine development and therapeutic design for 2019-nCoV/ References SARS-CoV-2: Challenges and chances. J Cell Physiol 2020; 235 : 9098-109. 1. Agrawal M, Kanitkar M, Vidyasagar M. Modelling the 6. Asnumali S, Kaushal S, Kumar A, Prakash M, Vidyasagar M. spread of SARS-CoV-2 pandemic - Impact of lockdowns & Modelling a pandemic with asymptomatic patients, impact of interventions. Indian J Med Res 2020. doi: 10.4103/ijmr. lockdown and herd immunity, with applications to COVID-19. IJMR_4051_20. Annu Rev Control 2020; 50 : 432-47. Section: Policy, Programme & Practice

Indian J Med Res 153, January & February 2021, pp 207-213 Quick Response Code: DOI: 10.4103/ijmr.IJMR_3911_20

Policy

Seroprevalence of antibodies to SARS-CoV-2 in healthcare workers & implications of infection control practice in India

Ritu Gupta1, Tanima Dwivedi1, Smeeta Gajendra1, Biswajeet Sahoo1, Sanjeev Kumar Gupta1, H. Vikas2, Angel Rajan Singh2, Anant Mohan4, Sushma Bhatnagar3, Sheetal Singh2, Laxmitej Wundavalli2 & Randeep Guleria4,†

1Laboratory Oncology Unit, Departments of 2Hospital Administration, 3Onco-Anaesthesia & Palliative Medicine & 4Pulmonary, Critical Care & Sleep Medicine, †All India Institute of Medical Sciences, New Delhi, India

Received September 16, 2020

Background & objectives: Healthcare workers (HCWs) are considered to be at a high risk of contracting COVID-19 infection. Besides, control of nosocomial infections transmitted from HCWs to the patients is also a cause of concern. This study was undertaken to investigate the seroprevalence of antibodies against the SARS-CoV-2 virus among the hospital staff of a tertiary care health facility in north India. Methods: The HCWs were tested for SARS-CoV-2 serology (IgG+IgM) using chemiluminescence immunoassay between June 22 and July 24, 2020. Venous blood (2 ml) was collected and tested for SARS-CoV-2 IgG and IgM antibodies. Results: Of the 3739 HCWs tested, 487 (13%) were positive for total SARS-CoV-2 antibodies. The highest seroprevalence was observed in administrative staff (19.6%) and least in physicians (5.4%). The staff who used public (20%) and hospital transportation (16.9%) showed higher seroprevalence compared to staff using personal transportation (12.4%). No difference was observed between HCWs posted in COVID versus non-COVID areas. All seropositive symptomatic HCWs in our study (53.6%) had mild symptoms, and the remaining 46.4 per cent were asymptomatic. The antibody positivity rate progressively increased from 7.0 per cent in the first week to 18.6 per cent in the fourth week during the study. Interpretation & conclusions: The presence of antibodies to SARS-CoV-2 in a significant number of asymptomatic HCWs, association with the use of public transport, relatively lower seroprevalence compared with the non-HCWs and rising trend during the period of the study highlight the need for serosurveillance, creating awareness for infection control practices including social distancing and study of infection dynamics in the community for effective control of an infectious pandemic.

Key words Healthcare workers - high risk - immunoassay - pandemic - SARS-CoV-2 - seroprevalence

India has a high burden of coronavirus disease 2019 declared the COVID-19 outbreak a global pandemic2. (COVID-19), a novel disease caused by SARS-CoV-21. In less than five months, it had spread to all States and In March 2020, the World Health Organization (WHO) Union Territories in India and posed a challenge for

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 207 208 INDIAN J MED RES, January & February 2021 the healthcare system worldwide. The virus spreads reporting guidelines were followed for this study5. from person to person, among those in close contacts, The approval of Institutional Ethical Committee was by respiratory droplets. Healthcare workers (HCWs) obtained before initiating the study and a waiver for are both at a high risk of infection in healthcare informed consent was obtained as it was a voluntary system and can be a source of nosocomial infection in screening and participants filled a questionnaire before transmitting disease to the patients. Early and timely submitting their samples. screening of HCWs enables rapid identification and A total SARS-CoV-2 antibody (both IgG and isolation of potential source of transmission and can 3 IgM) chemiluminescence immunoassay (CLIA) was reduce risk of disease spread to the wider community . used (ADVIA Centaur COV2T assay, Siemens AG, Diagnosis of SARS-CoV-2 is based on the detection of Munich, Germany). After filling up the questionnaire, viral RNA using real-time reverse transcription PCR 2 ml of venous blood was collected in a serum (RT-PCR) in the nasopharyngeal and/or oropharyngeal separator tube under aseptic conditions and processed swabs and depends on collecting the proper respiratory in ADVIA Centaur XPT (Siemens AG, Munich, tract specimen at the right time from the right anatomic Germany) at Robotic Core Clinical Laboratory, 4 site . The serological assays that detect antibodies National Cancer Institute (NCI)-Jhajjar, AIIMS, as per produced by individuals as a result of exposure to the manufacturer’s protocol and institutional infection the virus are relatively quicker, simpler and cheaper control guidelines. This COV2T assay detects the than the molecular method but do not have adequate antibody to spike protein receptor binding domain sensitivity in the initial phase of the disease. Serological (S1RBD) on the surface of the SARS-CoV-2 virus, tests, however, may supplement the diagnosis in which binds the virus to the target cells by a distinct suspected symptomatic but RT-PCR-negative patients human receptor (ACE2) found in the lung, heart, multiple and in identification of prior exposure to SARS-CoV-2. organs and blood vessels. The principle of this assay These also help establish the extent of community is antigen sandwich binding immunoassay in which transmission of COVID-19, especially through the antibodies from patient samples bind to the preformed undocumented, asymptomatic cases. complex of streptavidin-coated microparticles and The present study was aimed to investigate the binotinylated SARS-CoV-2 recombined antigens. This seroprevalence of antibodies against SARS-CoV-2 complex initiates the chemiluminescence reaction, among hospital staff of the All India Institute of which is measured as relative light units (RLUs). Medical Sciences (AIIMS), New Delhi, India, and to A direct correlation exists between the amount of evaluate the demographic and clinical correlates. SARS-CoV-2 antibodies present in the sample and the amount of RLUs measured by the analyzer. The Material & Methods results are expressed in index value and reported This prospective, cross-sectional study was as reactive (≥1 index; positive for SARS-CoV-2 carried out at the AIIMS, New Delhi, and its affiliated antibodies) or non-reactive (<1 index; negative for centres, from June 22 to July 24, 2020. All the HCWs SARS-CoV-2 antibodies). including physicians, administrative staff, nursing Before starting the test, precision studies (intra- and staff, technical staff and paramedical staff including inter-assay) and accuracy checks were done, and the hospital attendants, sanitary workers and security results were within acceptable limit (data not shown). personnel and research staff were invited to participate The specificity and sensitivity of the ADVIA Centaur on a voluntary basis. An online questionnaire was COV2T assay were also analyzed in the laboratory. created to collect the demographic characteristics, For this, serum samples collected from symptomatic job descriptions, exposure to COVID-19, any related patients (RT-PCR positive) within the first week, symptoms, prior comorbidities, details of previous i.e. 0-7 days (n=20), 7-14 days (n=20) and >14 days COVID-19 RT-PCR tests done and prophylactic use (n=20) were evaluated. Serum samples collected from of hydroxychloroquine sulphate (HCQS). All the the individuals before November 2019 and stored in participants were asked to fill the questionnaire before the hospital repository were evaluated as negative peripheral blood collection. HCWs with the presence controls. Internal validation of the assay using negative of related symptoms and/or positive RT-PCR test controls showed 100 per cent specificity. Sensitivity were not excluded. The Strengthening the Reporting was 20 per cent in RT-PCR-positive samples collected of Observational Studies in Epidemiology (STROBE)

Survey taken between June 22 and July 24, 2020 n=4548

Samples received between June 22 and July 24, 2020 n=3820

Total HCW evaluated Known RT-PCR positive n=3739 n=193

Serology positive Serology negative n=171 (88.6%) n=22 (11.4%)

RT-PCR negative RT-PCR not done n=765 n=2781

Serology positive Serology negative Serology positive Serology negative n=47 (6.1%) n=718 (93.9%) n=269 n=2512

Serology positives in RT-PCR negatives/not done n=316/3538 (8.9%) Figure. Flowchart showing serosurveillance in healthcare workers. 210 INDIAN J MED RES, January & February 2021

[196/1260 (16%)] compared with non-exposed HCWs Correlation of SARS-CoV-2 antibody-positive [291/2479 (12%); OR: 1.385; CI: 1.139-1.684; P=0.001] status with mode of transport used by HCWs: The (Table). seroprevalence was 20 per cent (47/235) in those who used public transport followed by 16.9 per cent Correlation of SARS-CoV-2 antibody-positive status (114/676) who used hospital transport, 12.4 per cent with residential area of the HCWs and general (247/1986) in those who commuted by their own community status: The seroprevalence was highest in vehicle, 11.2 per cent (61/544) in those who travelled HCWs from Faridabad (9/55; 16.4%) followed by those for work on foot and six per cent (18/298) in those from Noida (9/59; 15.3%), Delhi (429/2951; 14.5%), who did not declare their mode of transport. The Ghaziabad (11/83; 13.3%), Sonipat (2/30; 6.7%) and seroprevalence was significantly higher in HCWs who Gurugram (6/31; 4.6%). The majority of the HCWs used public or hospital transport as compared with in this study were residents of Delhi (2951/3739; other modes of commute (P<0.05). 78.9%) and had higher odds of antibody positivity (OR: 1.476; CI: 1.034-2.105; P=0.03) compared with Correlation of SARS-CoV-2 antibody-positive status the rest of the HCWs. with comorbidities, symptoms and hydroxychloroquine sulphate (HCQS) prophylaxis: The information was The seroprevalence progressively increased from collected on the comorbid conditions of HCWs such 7.0 per cent in the first week of the survey to 13.2 as hypertension, diabetes mellitus, thyroid disorder, per cent in the second, 16.0 per cent in the third and heart disease, renal diseases, liver disease, connective 18.6 per cent in the fourth week of the survey. The HCWs tissue disease, malignancy and asthma/COPD. Of all at our institute who were residing in Delhi, showed a the study participants, 25.5 per cent (n=952) had one positivity rate of 16.6 per cent during the intervening or more than one comorbid conditions (Table). The two-week period of the study, i.e. week 2 and 3. presence of comorbidities as a group was not associated

Table. Comparison of demographic, exposure and clinical characteristics in the SARS‑CoV‑2 antibody‑positive healthcare workers (HCWs) (n=3739) Characteristics SARS‑CoV‑2 Ab positive OR 95% 95% P Total number (n=487; 13%), n (%) CI‑Low CI‑High (n=3739), n (%) Male 309/2220 (13.9) 1.218 1.000 1.484 0.050 2220 (59.4) Female 178/1519 (11.7) ‑ ‑ ‑ ‑ 1519 (40.6) Age (yr) 18‑35 272/2073 (13.1) 1.008 0.860 1.183 0.917 2073 (55.4) >35 215/1666 (12.9) ‑ ‑ ‑ ‑ 1666 (44.6) On active COVID duty 110/943 (11.7) 0.840 0.670 1.053 0.131 943 (25.2) Not on active COVID duty 377/2796 (13.5) ‑ ‑ ‑ ‑ 2796 (74.8) Breach in PPE* 38/300 (12.7) 0.962 0.663 1.396 0.838 300/1773 (16.9) No breach in PPE* 193/1473 (13.1) ‑ ‑ ‑ ‑ 1473/1773 (83.1) Contact with COVID‑positive individuals 196/1260 (15.6) 1.385 1.139 1.684 0.001 1260 (33.7) No contact with COVID‑positive individuals 291/2479 (11.7) ‑ ‑ ‑ ‑ 2479 (66.3) HCQS prophylaxis 99/769 (12.9) 0.983 0.776 1.245 0.884 769 (20.6) No HCQS prophylaxis 388/2970 (13.1) ‑ ‑ ‑ ‑ 2970 (79.4) Presence of a comorbidity 114/952 (12) 0.880 0.704 1.101 0.265 952 (25.5) No comorbidity 373/2787 (13.4) ‑ ‑ ‑ ‑ 2787 (74.5) Symptomatic 267/1460 (18.3) 2.095 1.728 2.538 <0.001 1460 (39) Asymptomatic 220/2279 (9.7) ‑ ‑ ‑ ‑ 2279 (61) *Voluntary disclosure on breach in PPE was given by 1773 HCWs. SARS‑CoV-2, severe acute respiratory syndrome coronavirus 2; OR, odds ratio; CI, confidence interval; COVID, coronavirus disease; PPE, personal protective equipment; HCQS, hydroxychloroquine sulphate GUPTA et al: SEROPREVALENCE OF SARS-CoV-2 ANTIBODIES IN HCWS IN INDIA 211 with higher SARS-CoV-2 antibody positivity rate as shown by NCDC serosurveillance during the (12 vs. 13.4%). study period. The lower seropositivity of COVID-19 infection amongst HCWs compared with community The majority (2279; 61%) of HCWs enrolled could be attributed to better training and awareness for in this study were asymptomatic. The antibody infection control in HCWs, effective implementation positivity rate was higher in symptomatic HCWs of infection control practices at workplace in terms of (18.3%; 267/1460) compared with asymptomatic adequate use of PPE, availability of rapid diagnostic HCWs (9.7%; 220/2279; P<0.001). The most tests for disease identification and timely screening common symptoms experienced by seropositive coupled with contact tracing and quarantine. HCWs were fever (176/487; 36.1%), cough (115/487; 23.6%), sore throat (100/487; 20.5%), body ache Seropositivity in the current study was highest (94/487; 19.3%), nasal discharge (36/487; 7.4%), in administrative staff (19.6%), low in nurses (9.8%) diarrhoea (21/487; 4.3%), nausea (17/487; 3.5%) and and least in physicians (5.4%) and was perhaps due abdominal pain (16/487; 3.3%). None of the seropositive to better awareness to infection control practices in HCWs developed serious symptoms warranting an medical cadres. Posting in COVID-19-designated admission to intensive care unit (ICU). wards and/or ICU was not associated with increased antibody positivity in HCWs and even self-assessment A total of 769 (20.6%) HCWs received HCQS of breach of PPE while working in COVID-19- prophylaxis and 99 (12.9%) were positive for designated areas was not associated with higher antibodies, which is comparable with the prevalence of seropositivity, suggesting that the isolation protocols SARS-CoV-2 antibodies in those not receiving HCQS and PPE were sufficient to prevent high levels of prophylaxis (388; 13%) (Table). nosocomial transmission to HCWs. Studies on HCWs Discussion from other parts of the world have not reported an increase in seroprevalence in HCWs posted in HCWs are frontline personnel responsible for COVID-19 areas, except Iversen et al9 who reported the clinical management of suspected or confirmed higher seroprevalence in HCWs posted in COVID-19 COVID-19 patients. They are at a higher risk for wards and ICU, but this could be due to the fact that acquiring disease and, if infected, pose a threat to exposure to COVID-19 patients outside hospital fellow HCWs, to vulnerable patients and to the working was not accounted for in their study. A higher community. Therefore, regular screening of HCWs for seroprevalence was observed in those HCWs who SARS-CoV-2 infection is necessary to identify reported contact with a confirmed COVID-19 patient asymptomatic cases and exposure trends and to outside the duty hours, either in community, family formulate hospital policy to curb infection in the or at workplace. In contrast, a study from North- hospital setting. West England (Salford Royal NHS Foundation Trust) Seroprevalence of SARS-CoV-2 antibodies in reported antibody positivity in six per cent of HCWs HCWs in our study was 13 per cent which was higher and all the seropositive HCWs were directly involved than that reported in studies from Italy [0.7% (15/2057)]6, in patient care10. Germany [1.6% (5/316) by Korth et al7 and 2.7% by 8 9 Social gatherings and closed environments Schmidt et al ], Denmark [4·04% (1163/ 28792)] , augment spread of SARS-CoV-2, and the present North-West England [6% (17/281)]10, Belgium [6.4% study has shown a higher seroprevalence in HCWs (197/4125)]11, Sweden [6.6% (577/8679)]12, and Spain commuting via public transport and hospital transport [5.9% by Martin et al13 and 9.3% (54/578) by Garcia- for HCWs. As social distancing is the key factor for Basteiro et al14]; similar to the studies from Egypt preventing disease spread, it can be concluded that (12.2%)15 and Italy (14.4% by Sotgiu et al16) and lower travelling by public transport can increase risk of than that reported from the UK (18%)17 and the USA SARS-CoV-2 infection transmission and thus supports (36%)18. Comparison of serosurveillance data between the public policy of curtailed public transport during an HCWs and National Centre for Disease Control infectious pandemic. (NCDC) showed significantly higher seroprevalence in the community than in HCWs at our institute19. Higher The clinical symptoms of COVID-19 range from seroprevalence in HCWs in our study could be due to severe respiratory distress to minimal or no symptoms. higher seroprevalence (23.6%) in general community The majority of HCWs presented with mild symptoms 212 INDIAN J MED RES, January & February 2021 with fever being the most common of all symptoms as the community which could be attributed to better described in other studies20,21. Two studies (Iversen et al9 awareness and effective preventive measures. The and Steensels et al11) reported anosmia and loss of taste rising trend of seroprevalence with time reflected as frequent symptoms in seropositive HCWs. The data an increase in spread of the SARS-CoV-2 in on anosmia and loss of taste were not collected in community and progressively increased duration of the present study. Around 45 per cent of HCWs with exposure as the pandemic advanced. The exposure antibodies against SARS-CoV-2 in our study were to COVID-19-positive individuals and closed asymptomatic. Disease transmission through these environments emerged as significant risk factors and asymptomatic HCWs might become a risk factor for need attention while drafting policy for infection patients, colleagues and community. Therefore, timely control. identification of these asymptomatic carriers would be Acknowledgment: Authors acknowledge all the HCWs for important so that they can be isolated from family and their participation. colleagues to avoid cross-infection. Cases associated with connective tissue diseases Financial support & sponsorship: Authors acknowledge (CTDs) have been shown to be associated with increased M/S Siemens Healthineers for providing the SARS-CoV-2 total risk of SARS-CoV-2 infection, and this has been antibody assay kits as part of ‘Corporate Social Responsibility’ attributed to a general impairment of immune system programme. The funders had no role in the design, execution or intrinsic to the autoimmune disease and iatrogenic interpretation of the study. effect due to the use of immunosuppressive drugs22. Conflicts of Interest: None. Clarke et al23 reported a high seroprevalence (36.2%) of SARS-CoV-2 antibodies in patients receiving in-centre References haemodialysis. Thus, specific sub-populations with altered immune functions seem to incur a higher risk 1. Sahoo H, Mandal C, Mishra S, Banerjee S. Burden of COVID-19 pandemic in India: Perspectives from heath infrastructure. of acquiring the SARS-CoV-2 infection. However, in medRxiv 2020. doi: 10.1101/2020.05.26.20113456. our study, the number of HCWs with CTD and/or renal 2. World Health Organization. WHO Director-General’s opening disease was only a few (n=3 each). remarks at the media briefing on COVID-19 - 11 March 2020. Available from: https://www.who.int/director-general/ The major strengths of the study included a speeches/detail/who-director-general-s-opening-remarks-at- CLIA-based laboratory monitored test with high the-media-briefing-on-covid-19---11-march-2020, accessed sensitivity and specificity, unbiased reporting of data on March 12, 2020. as all the participants filled up the questionnaire before 3. Indian Council of Medical Research. Newer Additional testing and absence of selection bias as HCWs with Strategies for COVID-19 Testing. Available from: https:// www.icmr.gov.in/pdf/covid/strategy/New_ presence of symptoms, prior exposures or testing additional_Advisory_23062020_3.pdf, accessed on June for SARS-CoV-2 or posting in COVID-19 areas 24, 2020. were not excluded from the study. Despite being a 4. Zou L, Ruan F, Huang M, Liang L, Huang H, Hong Z, et al. single institution with a common infection control SARS-CoV-2 viral load in upper respiratory specimens of policy, the study included participants working at infected patients. N Engl J Med 2020; 382 : 1177-9. multiple centres of the same institution, three of which 5. Vandenbroucke JP, von Elm E, Altman DG, Gøtzsche PC, Mulrow CD, Pocock SJ, et al. Strengthening the Reporting are physically distinct campus locations. An added of Observational Studies in Epidemiology (STROBE): strength of study was comparison of seroprevalence Explanation and elaboration. PLoS Med 2007; 4 : e297. in HCWs with serosurveillance data of the community 6. Lahner E, Dilaghi E, Prestigiacomo C, Alessio G, Marcellini L, carried out during the study duration. The limitations Simmaco M, et al. Prevalence of SARS-CoV-2 infection in of this study included lack of concomitant RT-PCR health workers (HWs) and diagnostic test performance: The testing, cross-sectional nature of the study with no experience of a teaching hospital in Central Italy. Int J Environ Res Public Health 2020; 17 : 4417. serial testing to check for seroconversion which might 7. Korth J, Wilde B, Dolff S, Anastasiou OE, Krawczyk A, have been missed if testing was early or in cases with Jahn M, et al. SARS-CoV-2-specific antibody detection delayed antibody response and assessment of duration in healthcare workers in Germany with direct contact to of antibody positivity in seropositive HCWs. COVID-19 patients. J Clin Virol 2020; 128 : 104437. 8. Schmidt SB, Grüter L, Boltzmann M, Rollnik JD. Prevalence In conclusion, seroprevalence of SARS-CoV-2 of serum IgG antibodies against SARS-CoV-2 among clinic antibodies in HCWs was lower in HCWs than in staff. PLoS One 2020; 15 : e0235417. GUPTA et al: SEROPREVALENCE OF SARS-CoV-2 ANTIBODIES IN HCWS IN INDIA 213

9. Iversen K, Bundgaard H, Hasselbalch RB, Kristensen JH, workers of an Italian COVID-19 forefront hospital. BMC Nielsen PB, Pries-Heje M, et al. Risk of COVID-19 in health- Pulm Med 2020; 20 : 203. care workers in Denmark: An observational cohort study. 17. Pallett SJC, Rayment M, Patel A, Fitzgerald-Smith SAM, Lancet Infect Dis 2020; 20 : 1401-8. Denny SJ, Charani E, et al. Point-of-care serological assays 10. Poulikakos D, Sinha S, Kalra PA. SARS-CoV-2 antibody for delayed SARS-CoV-2 case identification among health- screening in healthcare workers in a tertiary centre in North care workers in the UK: A prospective multicentre cohort West England. J Clin Virol 2020; 129 : 104545. study. Lancet Respir Med 2020; 8 : 885-94. 11. Steensels D, Oris E, Coninx L, Nuyens D, Delforge ML, 18. Mansour M, Leven E, Muellers K, Stone K, Mendu DR, Vermeersch P, et al. Hospital-wide SARS-CoV-2 antibody Wajnberg A. Prevalence of SARS-CoV-2 antibodies screening in 3056 staff in a tertiary center in Belgium. JAMA among healthcare workers at a tertiary academic hospital in 2020; 324 : 195-7. New York City. J Gen Intern Med 2020; 35 :2485-6. 12. Lidström AK, Sund F, Albinsson B, Lindbäck J, Westman G. 19. Ministry of Health and Family Welfare, Government of Work at inpatient care units is associated with an increased India. Sero-prevalence study conducted by National Center risk of SARS-CoV-2 infection; a cross-sectional study of for Disease Control NCDC, MoHFW, in Delhi, June 2020. 8679 healthcare workers in Sweden. Ups J Med Sci 2020; Available from: https://pib.gov.in/PressReleasePage.aspx? 125 : 305-10. PRID=1640137, accessed on November 16, 2020. 13. Martín V, Fernández-Villa T, Lamuedra Gil de Gomez M, 20. Hunter E, Price DA, Murphy E, van der Loeff IS, Baker KF, Mencía-Ares O, Rivero Rodríguez A, Reguero Celada S, et al. Lendrem D, et al. First experience of COVID-19 screening Prevalence of SARS-CoV-2 infection in general practitioners of health-care workers in England. Lancet 2020; 395 : e77-8. and nurses in primary care and nursing homes in the healthcare 21. Lai X, Wang M, Qin C, Tan L, Ran L, Chen D, et al. area of León and associated factors. Semergen 2020; 46 (Suppl Coronavirus disease 2019 (COVID-2019) infection among 1) : 35-9. health care workers and implications for prevention measures 14. Garcia-Basteiro AL, Moncunill G, Tortajada M, Vidal M, in a tertiary hospital in Wuhan, China. JAMA Netw Open Guinovart C, Jiménez A, et al. Seroprevalence of antibodies 2020; 3 : e209666. against SARS-CoV-2 among health care workers in a large 22. Favalli EG, Agape E, Caporali R. Incidence and clinical Spanish reference hospital. Nat Commun 2020; 11 : 3500. course of COVID-19 in patients with connective tissue 15. Kassem AM, Talaat H, Shawky S, Fouad R, Amer K, diseases: A descriptive observational analysis. J Rheumatol Elnagdy T, et al. SARS-CoV-2 infection among healthcare 2020; 47 : 1296. workers of a gastroenterological service in a tertiary care 23. Clarke C, Prendecki M, Dhutia A, Ali MA, Sajjad H, facility. Arab J Gastroenterol 2020; 21 : 151-5. Shivakumar O, et al. High prevalence of asymptomatic 16. Sotgiu G, Barassi A, Miozzo M, Saderi L, Piana A, Orfeo N, COVID-19 infection in hemodialysis patients detected using et al. SARS-CoV-2 specific serological pattern in healthcare serologic screening. J Am Soc Nephrol 2020; 31 : 1969-75.

For correspondence: Dr Randeep Guleria, Director, All India Institute of Medical Sciences, New Delhi 110 029, India e-mail: [email protected] Indian J Med Res 153, January & February 2021, pp 214-218 Quick Response Code: DOI: 10.4103/ijmr.IJMR_2598_20

Programme Perspective COVID-19 & HIV/AIDS pandemics: Parallels & lessons

In March 2020, the World Health Organization remains to be seen whether this novel virus would (WHO) characterized severe acute respiratory ultimately disappear like SARS and MERS or will syndrome coronavirus 2 or SARS-CoV-2 which become endemic like HIV or H1N1. This also means caused COVID-19 as a global pandemic1. Currently, that we have to live with COVID-19 in the foreseeable there is neither cure nor a vaccine proven to prevent future and get used to the ‘new normal’. In terms of COVID-19. Many features of this pandemic are in preventive practices, we have to persist with physical fact the reminiscent of early responses to AIDS, first distancing, wearing of masks and hand hygiene. reported in the USA in 1981 - caused by HIV, leading HIV continues to be a major global public health to a high mortality and presenting a major challenge to issue, having infected 75 million people and claimed the society. almost 33 million lives since the beginning of the Incidentally, both AIDS and COVID-19 are caused pandemic2. Over the years, we know a great deal about by RNA viruses, originating from animals. HIV is a its transmission, prevention strategies and treatment retrovirus and SARS-CoV-2 belongs to the family of and care aspects, resulting in remarkable success in Coronaviruses. The latter is known to predominantly curbing its transmission and in managing cases. infect the respiratory and enteric systems, with Risk communication and community engagement are clinical presentation ranging from asymptomatic/ key to prevention mild symptoms to severe illness and mortality. While COVID-19 is transmitted through droplets, Both the pandemics were characterized by rapidity aerosols especially indoors, and by contaminated of response. The advances in science and technology surfaces/fomites, HIV through exchange of body helped identify and characterize the viruses. This led fluids including blood, semen, vaginal fluid etc. Both to the rapid development of diagnostic tests and of do not respect national boundaries, and have highly drugs at a phenomenally fast pace for HIV compared variable incubation period and communicability. While with other diseases such as tuberculosis. Availability of COVID-19 is highly contagious and has a shorter antiretroviral drugs brought about a transformational incubation period of 2-14 days, it has spread across change in HIV management, turning it from a ‘death the globe within a few weeks of the first case, AIDS sentence’ to a chronic manageable condition. Similarly, which has much longer incubation period took nearly research on vaccine and drug development for 10 years to do so. COVID-19 is now moving at an unprecedented rapid pace. Here we attempt to highlight some of the parallels between responses to these two viruses and to observe In the absence of a vaccine to suppress what lessons can be learnt. It is important, however, SARS-CoV-2, many countries have resorted to to note that the knowledge of COVID-19 continues to lockdowns, either nationwide or partially. The main rapidly evolve globally and in India. idea behind the lockdown (a drastic form of physical distancing) was to prevent the sudden and sharp Origin and ultimate destiny of the novel viruses increase in cases that would otherwise overwhelm the While the origin of SARS-CoV-2 remains unclear existing health system capacity and to buy time so that and is currently under investigation, the rapid person- health system can be better prepared for the surge in to-person transmission has led to the virus engulfing case counts. While the lockdowns helped us curtail the the globe within a short period of a few months. It spread of the coronavirus, it had a severe disruptive

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 214 DAWA & NARAIN: COVID-19 & AIDS PANDEMIC 215 effect on social life and economy. In addition, the Taiwan and South Korea have proactively and rapidly pandemic has contributed to a life of fear, mental stress responded to COVID-19 and contained the epidemic and anxiety3. with sufficient testing and robust contact tracing12. Transmission of SARS-CoV-2 and HIV has a In HIV, testing had the following three specific strong link with human behaviour. Like HIV/AIDS, purposes: (1) diagnosis of infection in an individual, bringing about behavioural change is crucial for using ELISA with Western blot as confirmatory COVID-19 prevention and in breaking the chain of test (testing was accompanied by a pre- and post- transmission and ultimately in determining the course test counselling); (2) prevention by screening of the of the pandemic4. While education, information donated blood and finally for (3) surveillance purposes and communication have been the bedrock of HIV to better understand the prevalence, distribution and prevention, providing credible information and trends of HIV infection13. In COVID-19, the cases are messages can clarify misconceptions and help people classified as confirmed if a person receives a positive take informed decisions to protect themselves from reverse transcription-polymerase chain reaction COVID-19. Civil society organizations in China have (RT-PCR) test result. RT-PCR remains the gold taken the responsibility of educating the community standard of frontline diagnostic testing for the novel about their role in preventing the virus from spreading SARS-CoV-2. This method requires nasal and throat and urging to comply with the national guidelines5. swabs which are used to detect the current infection status of an individual. Some States such as Delhi Several systematic reviews and meta-analyses have begun using rapid antigen detection test which have demonstrated the effectiveness of evidence- is a rapid test to detect the virus in a sample from based, interpersonal communication in preventing HIV the respiratory tract of a person. It is a quicker and transmission6-8. Such a public health action requires cheaper test giving result within less than half an hour. trust and confidence of the people to ensure that they Because it has a low sensitivity (meaning that the test participate fully, for example, in contact tracing and gives many false-negative results), the negative test quarantine measures. results have to be sequentially tested by RT-PCR. On Social networks and opinion leaders can play a the other hand, an antibody test is not a diagnostic test vital role under the larger ambit of risk communication but is used for surveillance purposes to measure past and community engagement because of their influence infection by the identification of antibodies present in a in community9. In the case of COVID-19, popular blood sample after 1-3 wk of acquiring the infection. It opinion leaders can help support government efforts by is helpful in understanding the extent of disease spread guiding, educating and encouraging their communities within a community. to adopt safer behavioural norms and raise voice against Strategic information, research and evidence-based stigma and discrimination against those infected with policymaking COVID-19 including healthcare workers. Strategic information: Surveillance was identified Today, the epidemic of misinformation - often by HIV programmes as an important priority, triggered by social media - poses a major barrier to and considerable investments were made in data accessing healthcare and disclosing health status, thus collection, analysis and use of data for policy and weakening the ability to protect oneself. To address strategy development14. These include HIV and AIDS these issues in the context of HIV, policy frameworks case reporting, HIV sentinel surveillance in defined were backed by legal instruments to protect the rights sub-populations and integrated biochemical and of infected individuals10. To mitigate the adverse effect behavioural surveillance on an ongoing basis to detect of COVID-19 on healthcare workers, the Government trends in disease incidence and prevalence over time. of India has amended Epidemic Disease Act 1897, making the act of violence against medical staff a For COVID-19 also, robust country-specific cognizable and a non-bailable offence11. disease/infection surveillance data are critically important to monitor trends and mount an evidence- Optimizing testing for early diagnosis based proactive action. Prompt outbreak investigations Preventing COVID-19 infection involves can help not only identify local transmission in a identifying infected individuals and isolating them so community, but limit wider transmission through that they no longer can transmit infection to others. isolation of cases and a strong system for contact 216 INDIAN J MED RES, January & February 2021 tracing. A detailed analysis of real-time data in each On March 18, 2020, the WHO announced an country can help identify populations at risk and international clinical trial called SOLIDARITY trial to vulnerable groups at greater risk of severe disease and evaluate the effectiveness of four different drugs or drug poor health outcomes. In the situation of community combinations for efficacy against COVID-19. The drugs transmission, the geographical spread, disease trends, included were remdesivir, lopinavir-ritonavir with or virus hotspots and virological features need to be without interferon and hydroxychloroquine. However, monitored15. Interim results from the SOLIDARITY Therapeutics Trial, indicate that remdesivir, hydroxychloroquine, Vaccine and drug development research: The issue lopinavir/ritonavir and interferon regimens appeared of HIV vaccine development was complicated as the to have little or no effect on 28-day mortality or the virus attacked the very cells in the immune system in-hospital course of COVID-19 among hospitalized that we tried to boost by means of a vaccine. The three patients23. decades of research and infrastructure put in place is helping scientists to accelerate the development One remarkable aspect is that the pandemic has of next-generation vaccine platforms as they seek to catalyzed the unusual level of communication and produce a viable COVID-19 vaccine in record time16. collaboration among scientists across the world along with the growing financial investments and sharing of According to the WHO, as of November 12, 2020 data, enabling research to move forwards faster than there are 48 COVID-19 candidate vaccines in clinical any time in the past. The availability of gene sequence evaluation of which 11 are in Phase III trials including data of COVID-19 virus is case in point. It has enabled Covaxine from Bharat Biotech from India17. In addition, scientists around the world to quickly work on vaccine from India another vaccine from Zydus Cadila is in Phase development 1 and 2 trials, and a third vaccine from AstraZeneca/ Oxford University has been approved to move to Phase Need for a whole-of-society approach, with health at 3 trial, which is undertaken by the Serum Institute of the centre India18. The Serum Institute also has a contract with Because both COVID-19 and HIV/AIDS uniquely AstraZeneca/Oxford University and a few other affect every sector of the society and pose a grave developers for mass production of vaccines. Alongside threat to economic development, they require an research, discussions are already underway as to how to intersectoral or ‘the whole-of-society’ approach. HIV ensure that, if and when ready, the vaccine can become was perhaps the first programme to actively engage accessible to all who need it. The National Expert Group with non-governmental organizations, civil societies, on vaccine administration has begun discussions with the private sectors and other stakeholders. Campaigns by leading vaccine developers and manufacturers regarding AIDS activist groups were instrumental in accelerating their production capacity and plans on pricing19. FDA approval for licensing of life-saving antiretroviral At global level, the WHO is leading a COVAX drugs and in ensuring that effective treatment was global vaccine programme in partnership with the made available to all those who needed it the most. Global Alliance for Vaccines and Immunization To combat the COVID-19 pandemic, all sectors (GAVI) vaccine alliance, and the Coalition for must play their role in a collective and coordinated Epidemic Preparedness Innovations (CEPI) which is manner. The government has the fundamental designed to guarantee rapid, fair and equitable access responsibility to plan, coordinate, mobilize and to COVID-19 vaccine for every country in the world20. facilitate various COVID-19 prevention, treatment, In the area of treatment, a recent study has identified care and support activities. It must further strengthen 21 drugs to be effective in blocking the replication of the the epidemiological surveillance, laboratory capacity, SARS-CoV-2 virus21. Referred to as repurposed drugs research and human resources at all levels of health or drugs approved for other diseases are now under services. While broad-based consultation with the investigation for their effectiveness against COVID-19. experts and communities was an important component Clofamazine - an antileprosy drug for which safety in the fight against HIV, it appeared missing in many data are already available - has been used in India for countries. The initial global response to HIV was decades. The WHO has recently recommended systemic coordinated by the WHO’s Global Programme on AIDS, corticosteroid therapy (e.g. dexamethasone) for patients and subsequently from 1995 onwards by UNAIDS24. with severe and critical COVID-1922. Contrary to HIV, the response to COVID-19 has been DAWA & NARAIN: COVID-19 & AIDS PANDEMIC 217 uncoordinated and fragmented, with different countries community engagement as a part of the whole-of- doing their own activities. society approach. A strong and robust health system is most critical especially the human resources. This For Indian pharmaceutical industries, the and the primacy of ramping up research and innovation COVID-19 pandemic came as an opportunity to play with focus on the development of new drugs, vaccines a crucial role in scaling up the manufacturing of and diagnostics can help formulate and implement COVID-19 vaccines and drugs. For years, the generic appropriate public health policy and action to combat manufacturers of India have played a stellar role in this unprecedented public health challenge confronting making effective yet affordable vaccines and drugs the human society. available to the world. The India’s manufacturers also need to maintain the global position by Conflicts of Interest: None. strengthening capabilities and becoming self-reliant in Natasha Dawa1,* & Jai Prakash Narain2 producing lifesaving medicines, by producing active 1 2 pharmaceutical ingredients (API). In this context, India Public Health Specialist & Former Director, has to depend on imports of over 95 per cent of API Communicable Diseases, World Health Organization for paracetamol and azithromycin from China25. To Regional Office for South-East Asia, New Delhi 110 002, India overcome this overdependence on a foreign country and * to build self-reliance on raw materials, Indian pharma For correspondence: industries need to build up domestic manufacturing of [email protected] API and for this to happen, the government needs to Received June 18, 2020 grant infrastructure status to API industries and push innovation by providing incentives and streamlining approval process. References 1. World Health Organization. COVID-19 can be characterized HIV programmes during the 1990s helped as pandemic. Available from: https://www.who.int/dg/ strengthen health system capacities in the area of speeches/detail/who-director-general-s-opening-remarks-at- blood safety, laboratory diagnosis and engagement the-media-briefing-on-covid-19---11-march-2020, accessed of community-level organizations in public health. on March 20, 2020. Similarly, COVID-19 is an opportunity to seize 2. Joint United Nations Programme on HIV/AIDS (UNAIDS). and convert this crisis as a turning point towards Global HIV & AIDS statistics - 2020 fact sheet. Available from: establishing a strong, robust and responsive health https://www.unaids.org/en/resources/fact-sheet, accessed on system in the country. July 29, 2020. 3. Narain JP. Covid-19 and Chronic Noncommunicable Diseases: Finally, considerable international cooperation and profiling a deadly combination. Int J NCDs 2020; 5 : 25-8. co-ordination has been forged especially for COVID-19 vaccine development. An example of international 4. Anderson RM, Heesterbeek H, Klinkenberg D, Hollingsworth TD. How will country-based mitigation measures influence cooperation and global alliance is global health actors the course of the COVID-19 epidemic? Lancet 2020; 395 : such as the Bill and Melinda Gates Foundation, 931-4. Coalition for Epidemic Preparedness Innovations. 5. Zhang S, Wang Z, Chang R, Wang H, Chen X, Xiaoyue Y, GAVI, Global Fund, WHO, private sector partners and et al. COVID-19 containment: China provides important other stakeholders have come together to accelerate the lessons for global response. Front Med 2020; 14 : 215-9. development, production and equitable global access 6. Cooper B, Toskin I, Kulier R, Allen T, Hawkes S. Brief to new COVID-19 essential health technologies. sexuality communication - A behavioural intervention to In conclusion, we would like to re-assert some of advance sexually transmitted infection/HIV prevention: A systematic review. BJOG: An Int J Obstet Gynaecol 2014; the key lessons from the HIV/AIDS pandemic which 121 : 92-103. can be helpful in planning and implementing our 7. Toskin I, Cooper B, Troussier T, Klugman B, response to the COVID-19 pandemic. These include Kulier R, Chandra-Mouli V, et al. WHO guideline for brief the fundamental importance of a well-coordinated sexuality-related communication: Implications for STI/HIV intersectoral response with health sector playing policy and practice. Reprod Health Matters 2015; 23 : 177-84. a central role; a need for comprehensive strategy 8. Eaton LA, Huedo-Medina TB, Kalichman SC, including prevention and clinical management and Pellowski JA, Popat AR, Sagherian MJ, et al. Systematic importance of communication, building trust and review and meta-analysis of single-session behavioral 218 INDIAN J MED RES, January & February 2021

interventions to prevent sexually transmitted infections: vaccines, accessed on November 18, 2020. Implications for bundling multiple STI/HIV prevention 18. Hindustan Times. Two out of five Covid-19 vaccines in Phase 3 packages. Am J Public Health 2012; 102 : e34. trial stage: Govt. Available from: https://www.hindustantimes. 9. Abara W, Coleman JD, Fairchild A, Gaddist B, White J. A com/india-news/2-out-5-covid-vaccines-in-phase-3-trial-sta faith-based community partnership to address HIV/AIDS in ge-govt/story-b92Y1SDNgvQcWwVdAhlvoO.html, accessed the southern United States: Implementation, challenges, and on November 20, 2020. lessons learned. J Relig Health 2015; 54 : 122-33. 19. Press Information Bureau, Government of India. Latest Press 10. Joint United Nations Programme on HIV/AIDS (UNAIDS). Releases. Available from: https://pib.gov.in/Press Release National Composite Policy Index Reports-Countries. Available framePage.aspx?PRID=1646506, accessed on August 17, from: https://www.unaids.org/en/dataanalysis/knowyourresponse/ 2020. ncpi/2010countries, accessed on July 28, 2020. 20. World Health Organization. 172 countries and multiple 11. The Hindu. Coronavirus | Attacks on health workers to attract candidate vaccines engaged in COVID-19 vaccine Global up to 7 years in prison. Available from: https://www.thehindu. Access Facility. Available from: https://www.who.int/news/ com/news/national/coronavirus-attacks-on-health-workers- item/24-08-2020-172-countries-and-multiple-candidate-vacc to-attract-up-to-7-years-in-prison/article31404910.ece, ines-engaged-in-covid-19-vaccine-global-access-facility, accessed on April 23, 2020. accessed on November 18, 2020. 12. Steinbrook R. MD editorial contact tracing, testing, and 21. Sanford Burnham Prebys Medical Discovery Institute. Multiple control of COVID-19–learning from Taiwan. JAMA Intern drugs improve the activity of remdesivir, a current standard- Med 2020; 180 : 1163-4. of-care treatment for COVID-19. Available from: https:// www.sciencedaily.com/releases/2020/07/200724104221.htm, 13. The Joint United Nations Programme on HIV/AIDS accessed on September 9, 2020. (UNAIDS). HIV testing methods UNAIDS. Available from:https://www.unaids.org/sites/default/files/media_asset/ 22. World Health Organization. Corticosteroids for COVID-19: testmtu_en_0.pdf, accessed on November 18, 2020. Lliving guidance, 2 September 2020. Available from: https://apps.who.int/iris/handle/10665/334125, accessed on 14. World Health Organization. Monitoring health for the SDGs. September 9, 2020. Geneva, Switzerland: World Health Statistics, WHO; 2016. 23. World Health Organization. “Solidarity” clinical trial for 15. World Health Organization. COVID-19 strategic preparedness COVID-19 treatments. Available from: https://www.who.int/ and response plan. Operational Planning Guidelines to emergencies/diseases/novel-coronavirus-2019/global-rese Support Country Preparedness and Response Draft as of 12 arch-on-novel-coronavirus-2019-ncov/solidarity-clinical- February, 2020. Available from: https://www.who.int/docs/ trial-for-covid-19-treatments, accessed on October 15, 2020. default-source/coronaviruse/covid-19-sprp-unct-guidelines. 24. Joint United Nations Programme on HIV/AIDS. UNAIDS: pdf, accessed on August 24, 2020. The first 10 years, 1996-2006. Available from: https://data. 16. Riel DV, Wit ED. Next-generation vaccine platforms for unaids.org/pub/report/2008/jc1579_first_10_years_en.pdf, COVID-19 Consensus among experts is that only an effective accessed on November 18, 2020. COVID-19 vaccine will end the pandemic. Nat Mater 2020; 25. Economic Times. Govt should grant infrastructure status to 19 : 810-20. API industry: IPA President Satish Reddy. Available from: 17. World Health Organization. Draft landscape of COVID19 https://health.economictimes.indiatimes.com/news/industry/ candidate vaccines. Available from: https://www.who.int/ govt-should-grant-infrastructure-status-to-api-industry-ipa- publications/m/item/draft-landscape-of-covid-19-candidate- president-satish-reddy/77196178, accessed on July 28, 2020. Indian J Med Res 153, January & February 2021, pp 219-226 Quick Response Code: DOI: 10.4103/ijmr.IJMR_2294_20

Programme

Safety of hydroxychloroquine in healthcare workers for COVID-19 prophylaxis

Atiya R. Faruqui1, Denis Xavier1, Sandhya K. Kamat3, Sujith J. Chandy4, Bikash Medhi5, Raakhi K. Tripathi3, Yashashri C. Shetty3, John Michael Raj2, Sandeep Kaushal6, S. Balakrishnan8, Shubham Atal8, Santanu K. Tripathi9, Dinesh K. Badyal7, Harihar Dikshit11, Sukalyan Saha Roy11, Niyati Trivedi12, Suparna Chatterjee10, Chetna Desai13, C.D. Tripathi14, Nirmala N. Rege3, Pooja Gupta15, R. Raveendran18, Rajni Kaul16 & Nilima A. Kshirsagar17

Departments of 1Pharmacology & 2Biostatistics, St. John’s Medical College, Bengaluru, Karnataka, Departments of 3Pharmacology & Therapeutics, Seth Gordhandas Sunderdas Medical College & King Edwards Medical Hospital, Mumbai, Maharashtra, 4Department of Pharmacology & Clinical Pharmacology, Christian Medical College, Vellore, Tamil Nadu, 5Department of Pharmacology, Postgraduate Institute of Medical Education & Research, Chandigarh, 6Department of Pharmacology, Dayanand Medical College & Hospital, Ludhiana, 7Department of Pharmacology, Christian Medical College, Ludhiana, Punjab, 8Department of Pharmacology, All India Institute of Medical Sciences, Bhopal, Madhya Pradesh, 9Department of Clinical & Experimental Pharmacology, School of Tropical Medicine, 10Department of Pharmacology, Institute of Postgraduate Medical Education & Research, Kolkata, West Bengal, 11Department of Pharmacology, Indira Gandhi Institute of Medical Science, Patna, Bihar, 12Department of Pharmacology, Medical College Baroda, Vadodara, 13Department of Pharmacology, B.J. Medical College, Ahmedabad, Gujarat, Department of Pharmacology, 14Vardhman Mahavir Medical College & Safdarjung Hospital, 15All India Institute of Medical Sciences, 16Division of Basic Medical Sciences, 17National Chair Clinical Pharmacology, Indian Council for Medical Research, New Delhi & 18Department of Pharmacology, Jawaharlal Institute of Postgraduate Education & Research, Puducherry, India Received May 30, 2020

Background & objectives: Hydroxychloroquine (HCQ), reported to inhibit severe acute respiratory syndrome coronavirus 2 (SARS-CoV-2) replication in in vitro studies, has been recommended for prophylaxis of COVID-19 in healthcare workers (HCWs). The objective of this study was to assess short-term adverse events (AEs) of HCQ in HCWs. Methods: This cross-sectional study among consenting HCWs taking prophylaxis and working in hospitals with COVID-19 patients used online forms to collect details of HCWs, comorbidities, prophylactic drugs used and AEs after the first dose of HCQ. Verification of dose and AEs was done by personal contact. Multivariate logistic regression analysis was done to determine the effect of age, gender and dose of HCQ on AE. Results: Of the 1303 HCWs included, 98.4 per cent (n=1282) took HCQ and 66 per cent (n=861) took 800 mg as first day’s dose. Among the 19.9 per cent (n=259) reporting AEs, 1.5 per cent (n=20) took treatment for AE, none were hospitalized and three discontinued HCQ. Gastrointestinal AEs were the most common (172, 13.2%), with less in older [odds ratio (OR) 0.56, 95% confidence interval (CI) 0.35- 220 INDIAN J MED RES, January & February 2021

0.89], with more in females (OR 2.46, 95% CI 1.78-3.38) and in those taking a total dose of 800 mg on day one compared to a lower dose. Hypoglycaemia (1.1%, n=14), cardiovascular events (0.7%, n=9) and other AEs were minimal. Interpretation & conclusions: HCQ prophylaxis first dose was well tolerated among HCWs as evidenced by a low discontinuation. For adverse effects, a small number required treatment, and none required hospitalization. The study had limitations of convenience sampling and lack of laboratory and electrocardiography confirmation of AEs.

Key words Adverse events - chloroquine - coronavirus - COVID-19 - healthcare workers - hydroxychloroquine - prophylaxis - rational

Chloroquine (CQ) and hydroxychloroquine College (SJMC), Bengaluru, India, which was one of (HCQ) have been shown to inhibit the replication of the coordinating centres, managing data and statistical SARS-CoV-2 in vitro and are recommended/being analyses. The study was conducted during the months investigated for prophylactic use. Both these drugs of April and May 2020. have been commonly used in malaria, rheumatoid Participants consisted of all consenting HCWs arthritis (RA) and other immune-mediated diseases (doctors, nurses and ancillary staff such as technicians, for over five decades1. Patients on these drugs have reported various early adverse events (AEs) such laboratory staff, ward attendants, aides, ambulance as abdominal pain, decreased appetite, diarrhoea, drivers and security staff) working in RUMCs or nausea, vomiting, prolonged QT interval, ventricular neighbouring institutions (henceforth called others) at arrhythmia, hypoglycaemia and hypersensitivity. On risk of exposure to COVID-19–suspect or confirmed long-term use, retinopathy and haematologic events patients, taking HCQ prophylaxis for COVID-19. have been reported1. There were no exclusion criteria. The evidence on HCQ/CQ use in patients with A convenience sampling method was followed as COVID-19 has been considered futile2,3, and a it was not known as to how many HCWs had started randomized trial of HCQ as post-exposure prophylaxis taking HCQ. Administrative approval and Ethics for COVID-19 reported that HCQ did not prevent Committee approval for conducting the study were illness when used as post-exposure prophylaxis within obtained by each centre. Eligible participants were four days after exposure4. Yet, to date, there are limited approached by the RUMC investigator teams. reports from clinical studies on the use of HCQ or CQ A questionnaire was developed for data prophylaxis in COVID-19. A systematic review of 31 collection which included questions on medicines ongoing interventional studies of HCQ prophylaxis in used for prophylaxis; total dose of medicines taken those at high risk of exposures reported wide variation on day one; whether prior ECG was taken; presence in the dose used (400-1400 mg) and duration (3- of co-morbidities and exposure to COVID-19 5 24 wk) . The Oxford University Group is currently patients. Participant information sheet and informed undertaking a large global trial called COPCOV, consent form were part of the form. The link to the evaluating potential for CQ/HCQ to be taken as pre- questionnaire form was sent by e-mail or instant 6,7 exposure prophylaxis and safety of these drugs . messaging application to all eligible personnel. After We undertook an observational study to evaluate the participants ticked their consent, they were allowed the safety of HCQ for COVID-19 prophylaxis among to fill data on the questionnaire form online. For HCWs HCWs in India to report short-term AEs after its first- with challenge in filling the online form, a printed day dosing. copy was provided which was then transcribed to the online form. To verify total dose on day one of HCQ Material & Methods (if other than 800 mg) and reports of AEs by personally This cross-sectional, observational study was contacting the participants, their contact details were carried out by the Indian Council of Medical Research shared by the coordinating centre with RUMCs and (ICMR) Rational Use of Medicine Centres (RUMCs), others, after confidentiality and data privacy agreement at department of Pharmacology, St. John’s Medical were signed by them. FARUQUI et al: HYDROXYCHLOROQUINE SAFETY FOR COVID-19 PROPHYLAXIS 221

Statistical analysis: Data were extracted into MS Excel Table I. Frequency, types and management of adverse events for verification as well as sending queries to sites. reported Clean data were extracted into STATA (StataCorp. Characteristic n=1303, n (%) 2019. Stata Statistical Software: Release 16. College Any one or more adverse effects 259 (19.9) Station, TX: StataCorp LLC.) for statistical analysis. Number of adverse effects Age was categorized into three groups as less than 0 1044 (80.1) and equal to 30, 31-45 and more than 45 yr. Association 1 166 (12.7) of AEs by age, gender and HCQ dose was determined 2 72 (5.5) by univariate logistic regression with a P<0.05 set for significance and multivariate logistic regression ≥3 21 (1.6) analysis reporting the odds ratio (OR) and its 95 per Type of adverse events cent confidence intervals (CIs). Nausea 114 (8.7) Vomiting 18 (1.4) Results Abdominal pain 91 (7.0) Between April 2, and May 13, 2020, 1303 Hypoglycaemia 14 (1.1) participants taking HCQ and other medications for Hypersensitivity 12 (0.9) COVID-19 prophylaxis were recruited. The mean age of the participants was 35 yr; 42 per cent (n=547) Photosensitivity 7 (0.5) were less than or equal to 30 yr, 36.5 per cent (n=476) Cardiovascular effects 9 (0.7) were 31-45 yr and 21.5 per cent (n=280) over 45 yr; Others 115 (8.8) males comprised 56.2 per cent; doctors 43.5 per cent Any treatment taken 20 (1.5) (n=567), ancillary staff 32.5 per cent (n=424) and Hospitalization 0 nurses 23.9 per cent (n=312). A low proportion of participants had comorbidities such as diabetes (4.3%, n=56), hypertension (6.3%, n=82), cardiovascular (CV) disease (0.6%, n=8) and recurrent respiratory (GI) events, hypoglycaemia and CV events. Rest of the disease (1.5%, n=19). A total of 208 (16%) participants AEs were grouped as other. reported exposure to COVID-19 suspect and 10.5 per cent (n=137) reported exposure to confirmed patients. Among the AEs, 13.2 per cent (n=172) were GI system related such as nausea (8.7%, n=114), Medicines taken for prophylaxis: Participants abdominal pain (7%, n=91) and vomiting (1.4%, took one drug, either HCQ (98.4%, n=1282) or n=18). Symptoms suggestive of hypoglycaemia were CQ (0.5%, n=5 ). A few (<1%) reported taking reported by 1.1 per cent (n=14) of participants as they other drugs [HCQ+azithromycin 11 (0.8%) and experienced hunger or fatigue that was relieved with HCQ+ivermectin 2 (0.2%); 1021 (78.4%) of the food or chocolate. It was not confirmed with blood participants got their medication from the hospital. glucose testing. Those with diabetes did not report The most common total dose of HCQ taken on day significantly higher rate of hypoglycaemia compared one was 800 mg (66.1%, n=861), 28.1 per cent to those without diabetes (3.5 vs. 1%, P=0.064). (n=366) reported taking 400 mg and 4.6 per cent Participants reported experiencing CV AEs (0.7%, (n=60) reported taking 200 mg. n=9), symptoms of palpitation and tightness of the chest. No ECG was taken. Adverse events and discontinuation of prophylaxis: AEs reported and their management are presented in Adverse events by age: AEs related to the GI system Table I. 19.9 per cent (n=259) reported one AE and 1.5 were reported differently across age groups. Older per cent (n=20 ) reported taking treatment for the AE. individuals (>45 yr) reported less GI symptoms None were serious enough to require hospitalization. as compared to the younger individuals (≤ 30 yr) Three participants discontinued prophylactic treatment (OR 0.56, 95% CI 0.35-0.89). Hypoglycaemia was due to AE (palpitation and gastritis in one; migraine reported more in older individuals (>45 yr) compared flare-up in another and gastritis, headache, body ache to younger ones, but this was not significant (OR and sleeplessness in the third). The focus was on AEs 2.78, 95% CI 0.87-8.84). The other specified AEs, that were commonly reported and those likely to be namely hypersensitivity and photosensitivity, were not serious and affecting compliance, e.g. gastrointestinal significantly different in the three age groups (Table II). 222 INDIAN J MED RES, January & February 2021

Table II. Univariate analysis of adverse events by age, gender and dose of hydroxychloroquine on day one Adverse events Risk factor Adverse events OR 95% CI P Present, n (%) Absent, n (%) Lower Upper Any gastrointestinal Age (yr) symptoms ≤30 82 (14.99) 465 (85.01) Reference 31‑45 65 (13.66) 411 (86.34) 0.90 0.63 1.27 0.544 >45 25 (8.93) 255 (91.07) 0.56 0.35 0.89 0.015 Gender Male 67 (9.15) 665 (90.85) Reference Female 105 (18.39) 466 (81.61) 2.24 1.61 3.11 <0.001 Dose of HCQ# (mg) ≤400 42 (9.9) 384 (90.1) Reference 800 127 (14.8) 734 (85.2) 1.58 1.09 2.29 0.015 Hypoglycaemia Age (yr) ≤30 5 (0.91) 542 (99.09) Reference 31‑45 2 (0.42) 474 (99.58) 0.46 0.89 2.37 0.351 >45 7 (2.5) 273 (97.50) 2.78 0.87 8.84 0.083 Gender Male 3 (0.41) 729 (99.59) Reference Female 11 (1.93) 560 (98.07) 4.77 1.33 17.19 0.017 Dose of HCQ# (mg) ≤400 5 (1.2) 421 (98.8) Reference 800 9 (1) 852 (99) 0.89 0.30 2.67 0.835 Hypersensitivity Age (yr) ≤30 5 (0.91) 542 (99.09) Reference 31‑45 6 (1.26) 470 (98.74) 1.38 0.42 4.56 0.594 >45 1 (0.36) 279 (99.64) 0.39 0.05 3.34 0.389 Gender Male 2 (0.27) 730 (99.73) Reference Female 10 (1.75) 561 (98.25) 6.51 1.42 29.81 0.016 Dose of HCQ# (mg) ≤400 5 (1.2) 421 (98.8) Reference 800 7 (0.8) 854 (99.2) 0.69 0.22 2.19 0.529 Photosensitivity Age (yr) ≤30 2 (0.37) 545 (99.63) Reference 31‑45 5 (1.05) 471 (98.95) 2.89 0.56 14.98 0.206 >45 0 280 (100) 1.0 ‑ ‑ ‑ Gender Male 4 (0.55) 728 (99.45) Reference Female 3 (0.53) 568 (99.47) 0.96 0.21 4.31 0.959 Dose of HCQ# (mg) ≤400 1 (0.2) 425 (99.8) Reference 800 6 (0.7) 855 (99.3) 2.98 0.36 24.85 0.312 Contd... FARUQUI et al: HYDROXYCHLOROQUINE SAFETY FOR COVID-19 PROPHYLAXIS 223

Adverse events Risk factor Adverse events OR 95% CI P Present, n (%) Absent, n (%) Lower Upper Cardiovascular effects Age (yr) ≤30 3 (0.55) 544 (99.45) Reference 31‑45 2 (0.42) 474 (99.58) 0.77 0.13 4.60 0.770 >45 4 (1.43) 276 (98.57) 2.63 0.58 11.82 0.208 Gender Male 2 (0.27) 730 (99.73) Reference Female 7 (1.23) 564 (98.77) 4.53 0.94 21.89 0.060 Dose of HCQ# (mg) ≤400 2 (0.5) 424 (99.5) Reference 800 7 (0.8) 854 (99.2) 1.74 0.36 8.40 0.492 Any specified* adverse events Age (yr) ≤30 89 (16.3) 458 (83.7) Reference 31‑45 71 (14.9) 405 (85.1) 0.90 0.64 1.27 0.552 >45 32 (11.4) 248 (88.6) 0.66 0.43 1.02 0.064 Gender Male 72 (9.8) 660 (90.2) Reference Female 120 (21) 451 (79) 2.44 1.78 3.34 <0.001 Dose of HCQ# (mg) ≤400 50 (11.7) 376 (88.3) Reference 800 139 (16.1) 722 (83.9) 1.45 1.02 2.05 0.036 *Any gastrointestinal symptoms (nausea, vomiting, abdominal pain), hypoglycaemia, hypersensitivity, photosensitivity and cardiovascular effects; #Dose of HCQ available for only 1287 patients. HCQ, hydroxychloroquine; OR, odds ratio; CI, confidence interval

Adverse events by gender: In the univariate analysis, AEs (OR 1.45, 95% CI 1.02-2.05) (Table II). In the compared to males, females reported over twice the multivariate analysis, only GI AEs was significantly number of GI symptoms (OR 2.24, 95% CI 1.61- higher in the group taking total dose of 800 mg (OR 3.11). Similarly, compared to males, females reported 1.56, 95% CI 1.07-2.26) (Table III). significantly more hypoglycaemia (OR 4.77, 95% CI 1.33-17.19) and hypersensitivity (OR 6.51, 95% Discussion CI 1.42-29.81). Other AEs such as photosensitivity and CV AEs were not different by gender. Overall, In this cross-sectional study among HCWs in occurrence of any of the specified AEs was higher in hospitals with COVID-19 patients, the population females than in males (OR 2.44, 95% CI 1.78-3.34) was predominantly young with a mean age of 35 yr. (Table II). Chronic comorbidities such as diabetes, hypertension or any CV disease were low (9.2%), as expected in this In the multivariate logistic regression analysis, GI type of population distribution. AEs were more in females (OR 2.19, 95% CI 1.57- Overall, 20 per cent reported one AE and the most 3.08) and in the younger age group compared to those common was related to the GI system (13.2%), more in the older groups but was not significant. Female in the younger age group, among females, and in those gender was an independent predictor for specified AEs getting total dose of 800 mg of HCQ on day one. Some (OR 2.46, 95% CI 1.78-3.38) (Table III). patients needed treatment (1.5%) for AEs, but none of Adverse events by dose of HCQ: Participants who them were serious enough to require hospitalization. took a total dose on day one of 800 mg of HCQ For indications such as lupus nephritis, RA, systemic compared to lower doses did not report increased lupus erythematosus (SLE) and others, HCQ has been rates of AEs such as hypoglycaemia, hypersensitivity, reported to cause GI AEs such as nausea, vomiting, photosensitivity or CV AEs but reported higher GI cramps or diarrhoea on the first few days of treatment. 224 INDIAN J MED RES, January & February 2021

Table III. Multivariate analysis of adverse events by age, gender and dose of hydroxychloroquine on day one Adverse events Risk factor OR 95% CI P Lower Upper Any gastrointestinal Age (yr) ≤30 Reference 31‑45 1.01 0.70 1.44 0.976 >45 0.62 0.38 1.00 0.051 Gender Male Reference Female 2.19 1.57 3.08 <0.001 Dose (mg) ≤400 Reference 800 1.56 1.07 2.26 0.021 Any specified* adverse Gender events Male Reference Female 2.46 1.78 3.38 <0.001 Dose ≤400 Reference 800 1.41 1.00 2.01 0.053 *Any gastrointestinal symptoms (nausea, vomiting, abdominal pain), hypoglycaemia, hypersensitivity, photosensitivity and cardiovascular effects

Most events are self-limiting, dose dependent and It is known that HCQ causes QTc prolongation occur with a loading dose of 800 mg8. and risk is exacerbated by the use of other QTc prolonging medications. There are studies with A small number of participants (1.1%) CQ in healthy volunteers, but most studies with reported the possibility of hypoglycaemia based on 10,11 symptoms such as weakness, fatigue, hunger and HCQ are limited to case reports of chronic use . The risk of CV events has also been addressed in feeling better after taking sugar, food or chocolate. 12 The symptoms were not severe or serious enough a meta-analysis . The use of HCQ in patients with to discontinue HCQ. Hypoglycaemia is reported in lupus nephritis, RA and SLE was associated with diabetic patients with short-term use of HCQ9. In significant protection against occurrence of CV our study, participants with diabetes did not report disease in patients with rheumatic disorder (OR 12 significantly higher rates of symptoms suggestive of 0.041, 95% CI 0.26-0.69) . hypoglycaemia compared to those without diabetes Dermatologic AEs involving skin, hair or nails (3.5 vs. 1.0%, P = 0.064). have been reported in the literature though the majority CV AEs such as palpitation and chest tightness occurred after treating auto-immune conditions with were reported in 0.7 per cent. None were severe cumulative dosages. While photosensitivity is a less or serious to discontinue treatment. ECG was commonly seen reaction with HCQ, it is reported at not taken. Among our participants, 0.6 per cent a lower mean cumulative dose of 150 g as compared reported known CV disease and 6.3 per cent had to more commonly seen drug rash, seen with nearly hypertension. Baseline ECG was done by 12 per three times the dose (mean dose of 530 gm)13. In our cent. A combination of HCQ and azithromycin was study, 12 (0.9%) and four (0.5%) participants reported taken by 0.8 per cent. However, the patients taking hypersensitivity and photosensitivity, respectively. azithromycin (0.84%) did not have a history of CV None were severe enough to discontinue HCQ. disease nor did they report any CV events. Those Furthermore, those taking a total dose of 800 mg with CV disease or hypertension did not report compared to 400 mg on day one did not report higher higher incidence of CV AE. rates of AEs such as hypoglycaemia, CV events, FARUQUI et al: HYDROXYCHLOROQUINE SAFETY FOR COVID-19 PROPHYLAXIS 225 photosensitivity or hypersensitivity, except for higher with a grant from the ICMR. No additional financial support was rates of GI symptoms (nausea, vomiting or abdominal provided to the centres. pain) (OR 1.58, 95% CI 1.09-2.29). Conflicts of Interest: None. There is considerable experience with the use of HCQ for different indications. Dosage for References HCQ varies as per the treatment indication; for uncomplicated malaria, it is 800 mg followed by 1. Rainsford KD, Parke AL, Clifford-Rashotte M, Kean WF. Therapy and pharmacological properties of 400 mg at 6, 24 and 48 h (total dose 2000 mg); for hydroxychloroquine and chloroquine in treatment of SLE, it is 200-400 mg single or divided dose daily; systemic lupus erythematosus, rheumatoid arthritis and for RA, it is 400-600 mg and the usual maintenance related diseases. Inflammopharmacology 2015; 23 : dose is 200-400 mg14. 231-69. 2. RECOVERY Collaborative Group, Horby P, Mafham M, The study had some limitations. The participants Linsell L, Bell JL, Staplin N, et al. Effect of hydroxychloroquine did not represent all HCWs taking prophylaxis for in hospitalized patients with COVID-19. N Engl J Med 2020; COVID-19, since convenience sampling was the 383 : 2030-40. method used. However, the ICMR RUMCs are 3. Chivese T, Musa OA, Hindy G, Wattary N, Badran S, located in different regions of country and include Soliman NH, et al. A meta-review of systematic reviews both government and private institutions. All HCWs and an updated meta-analysis on the efficacy of chloroquine and hydroxychloroquine in treating COVID19 infection. including doctors, nurses and ancillary staff were medRxiv 2020. doi: 10.1101/2020.07.28.20164012. approached to participate in the study, thus attempting 4. Boulware DR, Pullen MF, Bangdiwala AS, Pastick KA, to include a broad representation. Another limitation Lofgren SM, Okafor EC, et al. A randomized trial of was that participants filled the form by recalling hydroxychloroquine as postexposure prophylaxis for symptoms. Since the form was filled during a short COVID-19. N Engl J Med 2020; 383 : 517-25. time span. The description of AEs was not asked to 5. Bienvenu AL, Marty AM, Jones MK, Picot S. Systematic the participant. Hypoglycaemia and CV AEs were review of registered trials of hydroxychloroquine prophylaxis not investigated with blood sugar estimation or ECG. for COVID-19 health-care workers at the first third of 2020. Participants were contacted telephonically after they One Health 2020; 10 : 100141. filled the forms to verify the reported AEs. Some AEs 6. Chloroquine/Hydroxychloroquine Prevention of Coronavirus Disease (COVID-19) in the Healthcare Setting (COPCOV). such as headache and sleeplessness were grouped as Available from: https://clinicaltrials.gov/ct2/show/ others. NCT04303507, accessed on September 21, 2020. In this study, among HCWs working in hospitals 7. Llewelyn M, Schilling W. Down, but not out: with COVID-19 patients, it was found that majority Hydroxychloroquine could still have a role against COVID-19. J Pharm Health Serv Res 2020; 305. doi: 10.1211/ of the participants took HCQ for prophylaxis of PJ.2020.20208233. COVID-19. Overall rates of AE reported by these 8. Furst DE, Lindsley H, Baethge B, Botstein GR, Caldwell J, HCWs were low; none were serious; were mainly Dietz F, et al. Dose-loading with hydroxychloroquine improves related to the GI system; were seen more commonly in the rate of response in early, active rheumatoid arthritis: A the younger population and among females. randomized, double-blind six-week trial with eighteen-week extension. Arthritis Rheum 1999; 42 : 357-65. Acknowledgment: Authors acknowledge Prof. (Dr) Balram 9. Plaquenil®. Hydroxychloroquine Sulfate, USP. Available Bhargava, Secretary, Department of Health Research, Ministry of from: https://www.accessdata.fda.gov/drugsatfda_docs/label/ Health and Family Welfare Government of India, and Director- 2017/009768s037s045s047lbl.pdf, accessed on May 27, General, Indian Council of Medical Research (ICMR), New Delhi, 2020. for his support. Dr Vijay Kumar, Head of BMS Division; TAG 10. O’Laughlin JP, Mehta PH, Wong BC. Life threatening members – Dr V.P. Kamboj (Chairperson), Drs Y.K. Gupta and severe QTc prolongation in patient with systemic lupus erythematosus due to hydroxychloroquine. Case Rep Cardiol Subir Maullick for their valuable suggestions and guidance and Ms 2016; 2016 : 4626279. Priyanka Tadkase, Ms Aishwarya Bhoir for secretarial assistance. 11. Morgan ND, Patel SV, Dvorkina O. Suspected hydroxychloroquine-associated QT-interval prolongation in a Financial support & sponsorship: This study was patient with systemic lupus erythematosus. J Clin Rheumatol conducted by ICMR RUMCs which have been established in 2019 2013; 19 : 286-8. 226 INDIAN J MED RES, January & February 2021

12. Liu D, Li X, Zhang Y, Kwong JS, Li L, Zhang Y, et al. A systematic review. J Am Acad Dermatol 2020; 83 : Chloroquine and hydroxychloroquine are associated with 563-78. reduced cardiovascular risk: A systematic review and meta- 14. Gautret P, Lagier JC, Parola P, Hoang VT, Meddeb L, analysis. Drug Des Devel Ther 2018; 12 : 1685-95. Mailhe M, et al. Hydroxychloroquine and azithromycin as a 13. Sharma AN, Mesinkovska NA, Paravar T. Characterizing treatment of COVID-19: Results of an open-label non-randomized the adverse dermatologic effects of hydroxychloroquine: clinical trial. Int J Antimicrob Agents 2020; 56 : 105949.

For correspondence: Dr Nilima A. Kshirsagar, Emeritus Scientist, ICMR-National Institute for Research in Reproductive Health, Jehangir Merwanji Street Road, Parel, Mumbai 400 012, Maharashtra, India. e-mail: [email protected] Indian J Med Res 153, January & February 2021, pp 227-232 Quick Response Code: DOI: 10.4103/ijmr.IJMR_2333_20

Programme

Feasibility, efficiency & effectiveness of pooled sample testing strategy (pooled NAAT) for molecular testing of COVID-19

Shantanu Prakash1, Om Prakash1, Hricha Mishra1, Danish N. Khan1, Suruchi Shukla1, Ajay Pandey1, Kiran Rade2, Nivedita Gupta3, M.L.B. Bhatt† & Amita Jain1

Department of 1Microbiology, †King George’s Medical University, Lucknow, Uttar Pradesh, 2Consultant, WHO Country Office for India 3& Division of Epidemiology & Communicable Diseases, Indian Council of Medical Research, New Delhi, India

Received June 2, 2020

Background & objectives: During the current COVID-19 pandemic, a large number of clinical samples were tested by real-time PCR. Pooling the clinical samples before testing can be a good cost-saving and rapid alternative for screening large populations. The aim of this study was to compare the performance characteristics, feasibility and effectiveness of pooling nasal swab and throat swab samples for screening and diagnosis of SARS-CoV-2. Methods: The pool testing was applied on a set of samples coming from low COVID-19 positivity areas. A total of 2410 samples were tested in pools of five samples each. A total of five pools of five samples each were generated and tested for E gene. Results: Of the total of 482 pools (2410 samples) 24 pools flagged positive. Later on pool de-convolution, a total of 26 samples were detected as positive for COVID-19, leading to positivity of about one per cent in the test population. For the diagnosis of individual samples, the pooling strategies resulted in cost savings of 75 per cent (5 samples per pool). Interpretation & conclusions: It was observed that testing samples for COVID-19 by reverse transcription (RT)- PCR after pooling could be a cost-effective method which would save both in manpower and cost especially for resource-poor countries and at a time when test kits were short in supply.

Key words COVID-19 - cost-effective testing - diagnostics - pool testing - reverse transcription-polymerase chain reaction - sensitive - specific

In a pandemic situation there is a need to test a be cost-effective for testing each individual. Many large number of samples for virus detection. It is not a of the testing centres lack automation hence require possibility to expand laboratory capacity exponentially. large number of trained manpower. Pooling samples Moreover, in low- and middle-income countries can be an efficient way to screen for the nucleic acids detection using real-time PCR technologies may not of viruses, bacteria or parasites1,2. A pooled testing

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 227 228 INDIAN J MED RES, January & February 2021 algorithm involves the PCR screening of a specimen surveillance purpose. Since this was for diagnosing pool comprising multiple individual patient specimens, positive cases, it was considered that no positive followed by individual testing (pool de-convolution) case should be missed because of dilution effect. only if a pool flags positive3. As all individual samples For pooling with de-convolution, a maximum of in a negative pool are regarded as negative it results in 10 sample pooling was found appropriate based substantial cost savings when large number of pools on the biological plausibility (of retaining same test negative. characteristic from 25-30 µl into the pooled sample of 250 µl) based on criteria for Dorfman procedure4 This study was planned to demonstrate the for adequacy of individual samples characteristics feasibility of sample pooling for PCR screening for and use of micro-pipette for subsequent testing COVID-19 and to assess the efficiency and effectiveness retaining test accuracy2,5. However, for the present of sample pooling in COVID-19 testing using reverse study, it was decided to pool only five samples/ test, transcription (RT)-PCR. so that no positive case was missed. Material & Methods Biological plausibility and experimental feasibility The study was conducted in the virology assessment: Considering sample quantity of 250 µl laboratory, department of Microbiology, King required for PCR testing, it was decided to pool five George’s Medical University, Lucknow, India, during samples so that 50 µl sample could be taken from each March 25 and April 10, 2020 on COVID-19 nasal for the pool. The stored COVID-19 positive samples swab and throat swab (NS/TS) samples. The study with different cyclic threshold (Ct) value range were protocol was approved by the Institutional Ethics taken from the repository stored at -80°C. All the Committee. To determine the analytical sensitivity of samples had a unique identification number and were the pooled and non-pooled samples different panels of recorded in such a manner that individuals could not clinical samples were used. be identified, directly or through identifiers. A total of Statistical feasibility (pool size estimation): 50 µl each of one positive sample and four negatives Statistically probabilities of optimized batch sizes (b) samples were mixed in a single tube. were worked out considering dynamic conditions of rapidly increasing numbers for two types of pooling Throat swab/nasal swab (TS/NS) pool constitution (repeated pooling and one-time pooling) based on total expected samples (N) and frequency of positive Pool one: Five pools of five sample each containing samples (in the absence of population prevalence (p)2. four negative and one positive specimen which was One-time pooling was considered due to simplicity tested positive (Ct >15-20). as shown in Table I. Statistically optimized batch size Pool two: Five pools of five sample each containing 2-4 was 64 (max) . Theoretically, this was acceptable four negative and one positive specimen which was for monitoring of positivity among pools when tested positive (Ct >20-25). large scale screening was intended, especially for Pool three: Five pools of five sample each containing Table I. Statistical feasibility of samples in one‑time pooling four negative and one positive specimen which was tested positive (Ct >25-30). Range of P Range of ratios Optimal Fraction of positive sample of tests Pool four: Five pools of five sample each containing samples batch size needed four negative and one positive specimen which was 0.0430-35). 0.00810 per cent we could with 50 μl of nuclease-free double distilled water and save 30 per cent tests by pooling the samples. Overall, stored at -80 °C until further use. the efficiency in terms of the number of tests was increased by 300 per cent in almost all sets. After Real time PCR and interpretation of results: TaqMan adjusting for time, workforce and logistics required for real-time PCR for testing the presence of SARS-CoV-2 sample pooling and de-convolution, the efficiency of was used as per the WHO protocol using SuperScriptIII sample pooling was retained. Platinum One-Step quantitative RT-PCR (Invitrogen, Carlsbad, USA) master mix8. All the samples went A total of 26 samples (2 pools tested COVID-19 through testing protocol consisting of first-line screening positive for 2 samples each) were tested positive out which included E gene (for coronavirus) and RnaseP of the 24 pools flagged as positive. Of the 24 flagged (human housekeeping control/internal control) gene. If pools, 26 samples were positive for COVID-19 the sample was positive for the E gene then confirmatory RNA as two pools contained more than one positive assay was carried out for ORF and RdRp gene targets. COVID-19 samples. The comparative analysis of the The real-time PCR sensitivity, in terms of 95% hit rate cost difference in samples tested individually and in was about 5.2 RNA copies/reaction (at 95% hit rate; pools of five showed that the pool testing reduced the 95% confidence interval: 3.7-9.6 RNA copies/reaction requirement of the reagents to 1/4th saving up to 75 could be detected)9. per cent of the cost involved in testing. Pooled sample testing and testing showed 100 per cent sensitivity Applicability, advantages, and disadvantages of (Table IV). pooled and non-pooled sample testing: An analysis In this study, it was observed that testing samples was conducted to understand the applicability, for COVID-19 by RT-PCR after pooling might be a advantages and disadvantages of pooled testing in cost-effective method which would save both in terms screening for COVID-19. The analysis was conducted of workforce and cost. The strategic pooling of NS/TS in terms of the difference of sensitivity among both samples will help in bulk increase of testing capacity the methods and the cost saved in testing samples in and cost reduction of RT-PCR testing during the pools10. COVID-19 pandemic. The method retained accuracy 230 INDIAN J MED RES, January & February 2021

Table II. Comparison of cyclic threshold values of E gene by individual and pool testing Average Ct of positive sample when Average Ct of positive sample when Difference tested individually (250 µl sample) tested in pool of five (250 µl sample) in Ct Pool 1: Sample Ct range (15‑20) 14.89 14.45 0.44 14.04 14.48 0.44 13.47 14.21 0.74 20.49 21.52 1.03 17.97 19.03 1.06 Pool 2: Sample Ct range (20‑25) 21.11 20.48 0.63 24.42 25.52 1.1 24.53 23.79 0.74 22.39 23.61 1.22 25.12 25.29 0.17 Pool 3: Sample Ct range (25‑30) 26.12 25.89 0.23 27.44 28.34 0.9 28.76 29.45 0.69 26.47 27.17 0.7 30.92 32.11 1.19 Pool 4: Sample Ct range (30‑35) 33.47 34.51 1.04 32.29 33.12 0.83 34.94 36.12 1.18 33.25 34.21 0.96 35.49 36.68 1.19 Pool 5: Negative samples ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND ND, not detected; Ct, cyclic threshold of the test. The sensitivity of conventional individual the total of 482 pools (2410 samples), 24 pools were sample testing was retained. flagged. A total of 26 samples were detected as positive for COVID-19, leading to a positivity of approximately The pool testing was applied on the set of cases one per cent among the study population. coming from low COVID-19 positivity areas. Only one set of the pool (set 6) containing 24 pools showed Acknowledgment: Authors acknowledge the staff of virology high flagging rate (12/24 flagged). This was due to the laboratory, Department of Microbiology, King George’s Medical emergence of a new hot spot in one of the districts. Of University, Lucknow, for their support. PRAKASH et al: SAMPLE POOLING OF COVID-19 SAMPLES 231

Table III. Results of pooled testing and the number of flagged pools Pool Number of Number Flagged De‑convolution Total number of PCR tests if 5 Proportion sets pools tested of samples positive tests pooling (with de‑convolution of tests in set tested in pool pools of positive pools) saved (%) Set 1 13 65 0 0 13 80 Set 2 31 155 2 10 41 74 Set 3 12 60 0 0 12 80 Set 4 3 15 0 0 3 80 Set 5 8 40 0 0 8 80 Set 6* 24 120 12 60 84 30 Set 7 24 120 1 5 29 76 Set 8 16 80 0 0 16 80 Set 9 30 150 1 5 35 77 Set 10 6 30 0 0 6 80 Set 11 14 70 1 5 19 73 Set 12 31 155 1 5 36 77 Set 13 17 85 0 0 17 80 Set 14 9 45 0 0 9 80 Set 15 48 240 0 0 48 80 Set 16 43 215 1 5 48 78 Set 17 4 20 0 0 4 80 Set 18 22 110 0 0 22 80 Set 19 34 170 1 5 39 77 Set 20 46 230 4 20 66 71 Set 21 47 235 0 0 47 80 Total 482 2410 24 120 602 75 *Emergence of new hot spot

Table IV. Comparison of expenses done if samples are tested individually versus in pools of five Parameter Samples tested individually Samples in pools of 5 Individual samples or pools tested (n) 2410 482 Positive pools (n) - 24 Samples found positive 26 24 Sensitivity of pooled testing (%) NA (reference value) 100 Total cost in % Actual cost (X) 24.86 of X Total cost savings (%) Actual saving (Y) 75.23 of Y NA, not available

Financial support & sponsorship: The financial support References received from the Indian Council of Medical Research (ICMR), 1. Van TT, Miller J, Warshauer DM, Reisdorf E, Jernigan D, rd New Delhi Grant 83 ECM IIA/P9 is acknowledged. Humes R, et al. Pooling nasopharyngeal/throat swab specimens to increase testing capacity for influenza viruses by PCR. Conflicts of Interest: None. J Clin Microbiol 2012; 50 : 891-6. 232 INDIAN J MED RES, January & February 2021

2. Federer W. Pooling and other designs for analysing laboratory 7. Indian Council of Medical Research. Advisory on feasibility samples more efficiently. Statistician 1994; 43 : 413-22. of using pooled samples for molecular testing of COVID-19. 3. Jarvis L, Becker J, Tender A, Cleland A, Queiros L, Available from: https://www.icmr.gov.in/pdf/covid/strategy/ Aquiar A, et al. Evaluation of the Roche cobas s 201 system Advisory_on_feasibility_of_sample_pooling.pdf, accessed on and cobasTaqScreen multiplex test for blood screening: A May 22, 2020. European multicenter study. Transfusion 2008; 48 : 1853-61. 8. World Health Organization. Coronavirus disease 4. Dorfman R. The detection of defective members of large (COVID-2019) situation reports. Available from: https:// populations. Ann Math Stat 1943; 14 : 436-40 www.who.int/emergencies/diseases/novelcoronavirus- 5. Shani-Narkiss H, Gilday OD, Yayon N, Landau ID. 2019/situation-reports, accessed on February 29, 2020. Efficient and practical sample pooling for high-throughput PCR diagnosis of COVID-19, Center for Brain Sciences, 9. Corman VM, Landt O, Kaiser M, Molenkamp R, Meijer A, Hebrew University of Jerusalem. medRxiv 2020. doi: Chu DK, et al. Detection of 2019 novel coronavirus (2019- 10.1101/2020.04.06.20052159. nCoV) by real-time RT-PCR. Euro Surveill 2020; 25 : 6. ICMR-National Institute of Virology (ICMR-NIV), Pune. 2000045. Standard Operating Procedure For Detection of 2019 10. Shipitsyna E, Shalepo K, Savicheva A, Unemo M, novel coronavirus (2019-nCoV) in suspected human cases by rRT-PCR: First Line Screening assay. Available from: Domeika M. Pooling samples: The key to sensitive, specific https://www.icmr.gov.in/pdf/covid/labs/1_SOP_for_First_ and cost-effective genetic diagnosis of Chlamydia trachomatis Line_Screening_Assay_for_2019_nCoV.pdf, accessed on in low-resource countries. Acta Dermato-Venerologica May 22, 2020. 2007; 877 : 140-3.

For correspondence: Dr Amita Jain, Department of Microbiology, King George’s Medical University, Lucknow 226 003, Uttar Pradesh, India e-mail: [email protected] Indian J Med Res 153, January & February 2021, pp 233-237 Quick Response Code: DOI: 10.4103/ijmr.IJMR_4486_20

Practice Perspective Face mask - An essential armour in the fight of India against COVID-19

Face masks, in the last year or so, have covered a in the West, initial hesitation from some of the space in public discussion and political debate, which government officials to implement mask mandates is larger than ever before. To use or not to use and what was associated with a relatively rapid spread of SARS- is an appropriate situation to use face masks constitute CoV-211,12. A study in the United States noted that if some of these discourses. This renewed focus on face face masks were nationally mandated for employees masks has come about with the advent of COVID-19. on March 14, 2020, perhaps 19,000-47,000 lives Respiratory infections occur through the transmission could have been saved by the end of May13. A study in of microorganism-containing droplets (>5-10 µm) and Canada estimated a reduction of 25 per cent in weekly aerosols (≤5 µm) exhaled from infected individuals COVID-19 cases with mask mandates, and a study in during breathing, speaking, coughing and sneezing, the Germany suggested a 40 per cent reduction in daily risk of which can be reduced by wearing face mask1. growth rate of COVID-19 cases with masks14,15. The use of face masks at the community level In India, early advisories related to travel for disease prevention can be traced back to the time restrictions following the first detection of COVID-19 of the Manchurian plague (1910-1911)2. During this on January 30, 2020, measures such as screening at epidemic, the team working on the containment of the international airports for travellers coming from the disease, suspected airborne transmission of this abroad, flight restrictions, as well as national lockdown pneumonic plague and encouraged people to wear since March 24, prevented the COVID-19 numbers gauze masks in addition to quarantining the patients2. from rising rapidly. Subsequently, the use of face A few years later, during the 1918 influenza pandemic, masks was encouraged in public. Worth noting against inappropriately popularized as Spanish flu, the use of this background is the national serological survey multilayered gauge masks was touted as a prevention (second round) conducted by the Indian Council of tool in Western countries. Unfortunately, the subpar Medical Research across several States, finding only quality and to some extent public reluctance towards seven per cent of the adult population with antibodies using masks were responsible for its poor impact3,4. against COVID-19 by mid-September 202016, while a Almost a century later, with new discoveries and similar survey in May-June 2020 identified 0.7 per cent advancements in knowledge of infectious diseases, seroprevalence17. This indicated that a large proportion face masks became the first line of defence against of the population was yet unexposed and susceptible severe acute respiratory syndrome (SARS), Middle to the virus. A preliminary analysis of data generated East respiratory syndrome (MERS) and now the by the third round of the national serological survey, COVID-19 outbreak caused by the novel coronavirus completed in early-January 2021, further indicates that SARS-CoV-21,5,6. the infection has so far not spread beyond one-fourth of the population and therefore we are far from herd In the early days of the COVID-19 pandemic, there immunity at this stage (unpublished data). were many unknowns about the transmission mode of the virus. Despite this, the East Asian countries In response to the aforementioned evidence, and such as Hong Kong, Taiwan and South Korea swiftly in order to keep COVID-19 numbers in check in the enhanced wearing of face masks in public places7-9. festive and winter season, the Government of India This behaviour stems from their previous encounters launched a Jan Andolan campaign to provide targeted with the epidemics of coronaviruses10. Contrastingly, nudges via posters and billboards at public places or

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 233 234 INDIAN J MED RES, January & February 2021 public service announcements on media platforms. facilities. Vaporized hydrogen peroxide is a relatively The purpose is to prompt the population towards reliable and efficient method for decontamination ‘COVID-19 appropriate behaviour’18. Promoting mask in resource constraint settings, but there are other use behaviour is one of the key components of this methods also available such as dry heat pasteurization, public health response. ultraviolet irradiation and moist heat29-31. Further, a relevant point to consider is that the increased use of Wearing a mask is not an alternative to physical disposable masks during the COVID-19 pandemic distancing and hand hygiene, but it is most valuable is leading to environmental challenges due to in scenarios where physical distancing is challenging. irresponsible dumping32. Face masks limit the spread of infectious respiratory droplets into the environment. There are three types Poor air quality has been linked with increased of face masks available in the market: (i) COVID-19 risk of COVID-19 cases. Under stable atmospheric - cloth masks, (ii) medical masks, and (iii) respirator conditions, particulate matters agglomerate with SARS- masks (N95 and N99). The World Health Organization CoV-2 increasing its permanence and contagiousness (WHO) recommends cloth masks for general public in the environment as it travels longer distances33. A use, and medical or respirator masks for people at few preliminary studies have reported that people high risk of COVID-19, those with COVID-19 and with long-term exposure to air pollution are at risk healthcare workers19. for higher severity and mortality from COVID-1934-37. This is worrisome in the Indian context. The India Cloth masks block the exhalation of coarse State-Level Disease Burden Initiative has reported particles and limit the spread of the smaller particles20,21. high ambient pollution levels across India, with the The filtration efficacy of multilayered cloth masks is annual mean particulate matter <2.5 μm in size levels 50-70 per cent for respiratory aerosol particles22,23. more than three times the recommended limit of Effectiveness of cloth mask depends on various factors 40 μg/m3 in several States in north India (Figure)38. Cloth such as fabric material, number of layers and the fit or medical masks are not adequate to protect against air of the mask. A multilayered cloth mask with at least pollution; neither do these provide protection against three layers and a high thread count is preferred24. edge-seal leakage39. N95 or N99 respirator masks are Cotton blend or other hybrid materials, such as cotton more effective for protection against air pollution40, silk or cotton chiffon, are recommended as these have and the associated higher risk of COVID-19. Caution is higher filtration than pure cotton25,26. The outer layer however, necessary to ensure the quality of face masks of the mask should be of highly hydrophobic material, if these have to serve their intended purpose well. such as polyester or cotton-polyester blend, to repel the droplets from the environment. The middle layer It is important to ensure the appropriate use of face should also be hydrophobic preferably of non-woven mask for it to be effective. A recent survey noted that polypropylene fabric, but the inner layer should be only 44 per cent of Indians were wearing it properly hydrophilic to absorb the droplets coming out of the in compliance with the guidelines. Discomfort and mouth and nose27. Medical masks cover the mouth and difficulty in breathing were the commonly reported nose with a three-layered non-woven material. Medical barriers against the use of face mask41. There are ways masks without gap can filter 99 per cent particles larger to improve the comfort of the wearer and mechanisms than 0.3 µm and 75 per cent particles smaller than to avoid breathing difficulty, which could be shared 0.3 µm26. N95 and N99 respirator masks are relatively with the public more broadly using appropriate mass more effective in filtration than the cloth and medical communication strategies42. A face mask of adequate masks. N95 masks without gap can filter 99.9 per cent quality can be used while exercising in places with particles larger than 0.3 µm and 85 per cent particles risk of transmission of respiratory organisms, without smaller than 0.3 µm26. any drop in oxygen saturation of the blood43. It is also important to note that mask use is not recommended Strategies to extend the use and reuse of masks in children under two years, in individuals with depend upon the mask type. Cloth masks are to be disabilities such as cerebral palsy and in those not able washed daily or immediately after use with soap and to remove the mask without assistance44. warm water6,28. Medical masks are generally single use, whereas respirator masks can be cautiously reused after In conclusion, it is important to appreciate that reprocessing during a critical shortage in healthcare diligent face mask use is a crucial component of the set PANDA et al: FACE MASK AGAINST COVID-19 IN INDIA 235

Figure. Annual mean ambient particulate matter <2.5 μm in size concentration levels in the States of India, 2019. Source: Adapted in part from Ref. 38 in accordance with the Creative Commons License (https://s100.copyright.com/ AppDispatchServlet?publisherName=ELS&contentID=S2542519620302989&orderBeanReset=true&orderSource=Phoenix). of public health interventions, components of which difficult. A local train or a public bus commuting with together build multiple layers of barriers between daily office-goers within and between cities on a typical individuals infected with SARS-CoV-2 and those who day in India is the case in consideration here. In situations are susceptible. Widespread use of face masks coupled of mass religious gatherings such Kumbh mela or Haj with hand hygiene and physical distancing has been transit stations, wearing face masks would be very found to increase the odds of SARS-CoV-2 transmission useful, but this could be challenging to implement so control. However, self-reported face mask use has been other preventive measures such as vaccination should reported to have increased in some parts of the world also be emphasized in these situations. In addition, face separate from government mandates, indicating that masks also reduce the transmission of other respiratory supplemental public health interventions are needed infections such as influenza and tuberculosis. However, to maximize this behavioural change45. In addition to using them is the key. Masks on faces could serve limiting the spread of infectious respiratory droplets as reminders for others, especially in the current into the environment, face masks are affordable, easy environment when people are experiencing prevention to use and practical where physical distancing appears fatigue. People wearing masks thus could not only 236 INDIAN J MED RES, January & February 2021 help in generating peer pressure but also serving as 8. Penn M. How some Asian countries beat back COVID-19. the agents for social change. It would therefore be Available from: https://globalhealth.duke.edu/news/how- ideal if every person living in India attempts to wear some-asian-countries-beat-back-covid-19, accessed on a proper face mask diligently in public places for now. November 4, 2020. Face masks are here to stay for some time, as even 9. Jennings R. How cultural differences help Asian countries beat with the recent introduction of COVID-19 vaccines, COVID-19, while US struggles. Available from: https://www. voanews.com/covid-19-pandemic/how-cultural-differences-help- the development of vaccine-induced herd immunity asian-countries-beat-covid-19-while-us-struggles, accessed on is going to take some time. Finally, it is important to November 4, 2020. recognize that although vaccinated individuals would 10. Mills M, Rahal C, Akimova E. Face masks and coverings for have less risk of getting symptomatic SARS-CoV-2 the general public. The Royal Society and British Academy; disease, they may still be able to spread the virus to 2020. Available from: https://royalsociety.org/-/media/ others and should therefore use face mask. policy/projects/set-c/set-c-facemasks.pdf?la=en-GB&hash= A22A87CB28F7D6AD9BD93BBCBFC2BB24, accessed on None. Conflicts of Interest: November 4, 2020. Samiran Panda1,#, Harkiran Kaur3, Lalit 11. Cheung H. Coronavirus: Why attitudes to masks have changed 3,† 2,* around the world. BBC News; 13 July, 2020. Available from: Dandona & Balram Bhargava https://www.bbc.com/news/world-53394525, accessed on 1 ICMR-National AIDS Research Institute, November 4, 2020. # Pune 411 026, Maharashtra, Division of 12. Leffler CT, Ing E, Lykins JD, Hogan MC, McKeown CA, Epidemiology and Communicable Diseases, Grzybowski A. Association of country-wide coronavirus † Indian Council of Medical Research (ICMR), mortality with demographics, testing, lockdowns, and public New Delhi 110 029, 2Department of Health wearing of masks. Am J Trop Med Hyg 2020; 103 : 2400-11. Research (ICMR), Ministry of Health & Family 13. Chernozhukov V, Kasahara H, Schrimpf P. Causal impact of Welfare, New Delhi 110 001 & 3Public Health masks, policies, behavior on early COVID-19 pandemic in the Foundation of India, New Delhi 110 017, India U.S. J Econom 2021; 220 : 23-62. * For correspondence: 14. Karaivanov A, Lu SE, Shigeoka H, Chen C, [email protected] Pamplona S. Face masks, public policies and slowing the spread of COVID-19: Evidence from Canada. medRxiv 2020. Received November 19, 2020 doi: 10.1101/2020.09.24.20201178. 15. Mitze T, Kosfeld R, Rode J, Wälde K. Face masks considerably References reduce COVID-19 cases in Germany: A synthetic control method approach. Bonn (Germany): Institute of Labor 1. Prather KA, Wang CC, Schooley RT. Reducing transmission Economics; 2020. Available from: http://ftp.iza.org/dp13319. of SARS-CoV-2. Science 2020; 368 : 1422-4. pdf, accessed on December 5, 2020. 2. Kool JL, Weinstein RA. Risk of person-to-person transmission 16. Murhekar MV, Bhatnagar T, Selvaraju S, Kumar VS, of pneumonic plague. Clin Infect Dis 2005; 40 : 1166-72. Saravanakumar V, Vivian Thangaraj JW, Shah N, et al. SARS- 3. Kellogg WH, Macmillan G. An experimental study of the CoV-2 antibody seroprevalence in India, August-September, efficacy of gauze face masks. Am J Public Health (N Y) 1920; 2020: Findings from the second nationwide household 10 : 34-42. serosurvey. Lancet Glob Health 2021. doi: 10.1016/S2214- 4. Vaughan WT. Influenza: An epidemiologic study. Available 109X(20)30544-1. from: http://hdl.handle.net/2027/nnc2.ark:/13960/t6qz30017, 17. Murhekar MV, Bhatnagar T, Selvaraju S, Rade K, accessed on December 5, 2020. Saravanakumar V, Vivian Thangaraj JW, et al. Prevalence 5. Cunha CB, Opal SM. Middle East respiratory syndrome of SARS-CoV-2 infection in India: Findings from the (MERS). Virulence 2014; 5 : 650-4. national serosurvey, May-June 2020. Indian J Med Res 2020; 152 : 48-60. 6. World Health Organization. Coronavirus disease (COVID-19): Masks. Available from: https://www.who.int/news-room/q- 18. Press Information Bureau. Hon’ble Prime Minister to launch a-detail/coronavirus-disease-covid-19-masks, accessed on Jan Andolan for COVID-19 appropriate behaviour. Available November 2, 2020. from: http://Pib.gov.in/Pressreleaseshare.aspx?PRID=1662449, 7. Cheng VC, Wong SC, Chuang VW, So SY, Chen JH, Sridhar S, accessed on November 4, 2020. et al. The role of community-wide wearing of face mask for 19. World Health Organization. Mask use in the context of control of coronavirus disease 2019 (COVID-19) epidemic COVID-19: Interim guidance, 1 December, 2020. Geneva: due to SARS-CoV-2. J Infect 2020; 81 : 107-14. WHO; 2020. PANDA et al: FACE MASK AGAINST COVID-19 IN INDIA 237

20. Bandiera L, Pavar G, Pisetta G, Otomo S, Mangano E, 33. Tung NT, Cheng PC, Chi KH, Hsiao TC, Jones T, BéruBé K, Seckl JR, et al. Face coverings and respiratory tract droplet et al. Particulate matter and SARS-CoV-2: A possible model dispersion. R Soc Open Sci 2020; 7 : 201663. of COVID-19 transmission. Sci Total Environ 2021; 750 : 21. Bahl P, Bhattacharjee S, de Silva C, Chughtai AA, Doolan C, 141532. MacIntyre CR. Face coverings and mask to minimise droplet 34. Comunian S, Dongo D, Milani C, Palestini P. Air Pollution dispersion and aerosolisation: A video case study. Thorax and COVID-19: The Role of Particulate Matter in the Spread 2020; 75 : 1024-5. and Increase of COVID-19’s Morbidity and Mortality. Int J 22. Lindsley WG, Blachere FM, Law BF, Beezhold DH, Noti JD. Environ Res Public Health 2020; 17 : 4487. Efficacy of face masks, neck gaiters and face shields for reducing 35. Coker ES, Cavalli L, Fabrizi E, Guastella G, Lippo E, the expulsion of simulated cough-generated aerosols. Aerosol Parisi ML, et al. The effects of air pollution on COVID-19 Sci Technol 2021. doi: 10.1080/02786826.2020.1862409. related mortality in Northern Italy. Environ Resour Econ 23. Ueki H, Furusawa Y, Iwatsuki-Horimoto K, Imai M, Kabata H, (Dordr) 2020; 76 : 611-34. Nishimura H, et al. Effectiveness of face masks in preventing 36. Wu X, Nethery RC, Sabath BM, Braun D, Dominici F. airborne transmission of SARS-CoV-2. mSphere 2020; 5 : Exposure to air pollution and COVID-19 mortality in the e00637-20. United States: A nationwide cross-sectional study. medRxiv 24. Zangmeister CD, Radney JG, Vicenzi EP, Weaver JL. 2020. doi: 10.1101/2020.04.05.20054502. Filtration efficiencies of nanoscale aerosol by cloth mask 37. Yao Y, Pan J, Liu Z, Meng X, Wang W, Kan H, et al. Temporal materials used to slow the spread of SARS-CoV-2. ACS Nano association between particulate matter pollution and case 2020; 14 : 9188-200. fatality rate of COVID-19 in Wuhan. Environ Res 2020; 189 : 25. Aydin O, Emon B, Cheng S, Hong L, Chamorro LP, Saif MTA. 109941. Performance of fabrics for home-made masks against the 38. India State-Level Disease Burden Initiative Air Pollution spread of COVID-19 through droplets: A quantitative Collaborators. Health and economic impact of air pollution in mechanistic study. Extreme Mech Lett 2020; 40 : 100924. the states of India: The Global Burden of Disease Study 2019. 26. Konda A, Prakash A, Moss GA, Schmoldt M, Grant GD, Lancet Planet Health 2021; 5 : e25-38. Guha S. Aerosol filtration efficiency of common fabrics used 39. Cherrie JW, Apsley A, Cowie H, Steinle S, Mueller W, in respiratory cloth masks. ACS Nano 2020; 14 : 6339-47. Lin C, et al. Effectiveness of face masks used to protect Beijing 27. Rawal A. Multi-layered masks to combat COVID-19. Indian J residents against particulate air pollution. Occup Environ Med Med Res 2020; 152 : 9-11. 2018; 75 : 446-52. 28. MacIntyre CR, Dung TC, Chughtai AA, Seale H, 40. Shakya KM, Noyes A, Kallin R, Peltier RE. Evaluating the Rahman B. Contamination and washing of cloth masks and efficacy of cloth facemasks in reducing particulate matter risk of infection among hospital health workers in Vietnam: A exposure. J Expo Sci Environ Epidemiol 2017; 27 : 352-7. post hoc analysis of a randomised controlled trial. BMJ Open 41. The Hindu. Only 44% wear mask correctly, shows survey; 15 2020; 10 : e042045. September, 2020. Available from: https://www.thehindu.com/ 29. World Health Organization. Rational use of personal news/national/karnataka/only-44-wear-mask-correctly-shows- protective equipment for COVID-19 and considerations survey/article32614925.ece, accessed on December 5, 2020. during severe shortages; 2020. Available from: https:// 42. Harvard Health. Coping with face mask discomfort. Available apps.who.int/iris/bitstream/handle/10665/338033/WHO- from: https://www.health.harvard.edu/staying-healthy/coping- 2019-nCoV-IPC_PPE_use-2020.4-eng.pdf, accessed on with-face-mask-discomfort, accessed on December 5, 2020. December 24, 2020. 43. Chan NC, Li K, Hirsh J. Peripheral oxygen saturation in 30. Mackenzie D. Reuse of N95 Masks. Engineering (Beijing) older persons wearing nonmedical face masks in community 2020; 6 : 593-6. settings. JAMA 2020; 324 : 2323-4. 31. Saini V, Sikri K, Batra SD, Kalra P, Gautam K. Development 44. Centers for Disease Control and Prevention. Coronavirus of a highly effective low-cost vaporized hydrogen peroxide- disease 2019 (COVID-19). Available from: https://www. based method for disinfection of personal protective cdc.gov/coronavirus/2019-ncov/prevent-getting-sick/cloth- equipment for their selective reuse during pandemics. face-cover-guidance.html, accessed on December 18, 2020. Gut Pathog 2020; 12 : 29. 45. Rader B, White LF, Burns MR, Chen J, Brilliant J, Cohen J, 32. Sangkham S. Face mask and medical waste disposal during et al. Mask-wearing and control of SARS-CoV-2 transmission the novel COVID-19 pandemic in Asia. Case Stud Chem in the USA: A cross-sectional study. Lancet Digit Health Environ Eng 2020; 2 : 100052. 2021; S2589-7500(20)30293-4. Indian J Med Res 153, January & February 2021, pp 238-214 Quick Response Code: DOI: 10.4103/ijmr.IJMR_2960_20 Practice Perspective Focussing on ‘mental hygiene’ along with ‘hand hygiene’ in the times of COVID-19

As the COVID-19 outbreak has affected most enables it (the organism) to adjust itself efficiently countries globally, there are guidelines established by and continuously to its changing environments. It various national and international agencies to prevent does not limit to promoting positive mental health the further spread of COVID-19. It has been seen that but also identifying and preventing factors which media and public health often focus on the biological/ may be detrimental to mental health and restoring physical ramifications such as hand hygiene while impaired functions5. Various principles of mental ignoring the psychological impact. There is evidence hygiene have been described6. One of the first tenets that during and immediately after such outbreaks, of mental hygiene described was to be born healthy. many individuals directly or indirectly affected by the Though it has been conventionally described in the illness show increased symptoms of psychological context of preventing the occurrence of psychiatric nature, such as anxiety and depression1. A recent report illness in predisposed children, such as children born has shown that the prevalence of psychiatric symptoms to individuals with mental illness, it may well be is on the rise during this pandemic as well, with rates extrapolated in the current scenario. For example, of depressive and anxiety symptoms in the general women in reproductive age groups, during the time population being >15 and 25 per cent, respectively2. of this pandemic, should be actively educated about Measures including maintaining a daily routine with contraception, stress related to planning pregnancies exercise/meditation, following healthy eating, limiting during COVID-19, the risk associated with frequent alcohol use and avoiding negative newsfeed, have often visits to the hospital for antenatal check-ups/delivery been suggested to prevent the occurrence or recurrence and not being able to get regular check-ups because of of psychiatric illness3. These are important but not be the risk of contracting COVID-19. However, clinicians sufficient for the preservation of mental health. In the should be aware of staying empathetic about those who Indian context, some issues may be more pertinent, still plan to get pregnant, without inducing excessive like containing COVID-19 in the presence of poverty fear. and unemployment. For example, saving a daily wage Another important principle of mental hygiene is earner from contracting COVID-19 by employing maintaining the physical welfare of the individuals in measures such as lockdown, may eventually turn out to all stages of development. Hence, efforts can be made be more stressful due to the lack of income. An aspiring to provide food at the doorstep to families below the student’s examinations may be delayed, and individuals poverty line and screening for infections or signs of graduating from different courses may have difficulty malnutrition in children. Efforts in this regard have being recruited for jobs due to lack of jobs/recruitment been made by the central government, various State procedures. In addition, it has often been observed governments as well as different non-governmental that individuals infected with COVID-19, particularly organizations7,8. The third principle is the provision of a healthcare and frontline workers, have borne the brunt satisfying home environment. This would include both of stigma due to the same4. Thus, it becomes important psychological environment, that is good interpersonal to focus on the concept of mental hygiene as a part of relations, and physical environment, that is sanitation. preventive psychiatry to face the uncertainties which This can also be dealt with by repeated information, are likely to persist as the new normal. education and communication activities conducted in Mental hygiene has been defined as the promotion a locality or through mass media. A way of ensuring and preservation of that condition of the organism which the spread of such information is broadcasting such

© 2021 Indian Journal of Medical Research, published by Wolters Kluwer - Medknow for Director-General, Indian Council of Medical Research 238 SEN et al: MENTAL HYGIENE WITH HAND HYGIENE DURING COVID-19 239 advertisements on radio or television through all activity, is yet another principle of mental hygiene, channels at the same time so that more people would which may be applicable in the times of COVID-19. get covered. While planning a vacation may be a common The pandemic brings certain risks to children such constructive escape mechanism, it may not be feasible as school closure, increased risk of domestic abuse in the current scenario. Other mechanisms could be and worsening of symptoms of known psychiatric inculcating new hobbies, social work, books, sleep, disorders9. Some principles of mental hygiene are etc. One should be aware of not using maladaptive particularly described in the context of children, as they escape mechanisms such as alcohol use. In addition to are in the stage of cognitive and emotional development constructive escape, the emphasis has been made on the and are more vulnerable. The fourth principle of mental principle of emotional regulation. It must be understood hygiene is inculcating adaptive habits in children. This that emotions are not easily controlled, but individuals can be done by setting up their routine and learning must be encouraged to control the physical expression by modelling. It has also been emphasized that home of emotions. It is imperative that all workplaces and isolation/lockdown/school closure has led children to educational institutions should appoint a counsellor/ spend quality time with their parents and thus have psychologist/psychiatrist for regular monitoring, got the opportunity to focus on their creativity10. The training, psychoeducation and management. fifth principle governs the development of a sense of Some of the efforts made by the government security, self-confidence and the ability to develop with regard to mental hygiene deserve a mention: for affectionate relationships among children. Parents must example, the instructional videos and documents on utilize the free time to develop fruitful communication mental health and COVID-19 released by the Ministry with their children. Children can be introduced to the of Health and Family Welfare13. In addition, mandatory concept of spirituality and religion, as it is a known screening for psychiatric symptoms among patients protective factor against psychiatric illnesses11. diagnosed with COVID-19, their family members Another challenge the pandemic brings is that it or those in the quarantine may be an important step. also affects the level of health anxiety in individuals. While those who get admitted may fill a checklist An increase in health anxiety may result in the for screening common psychological symptoms such increased interpretation of normal bodily sensations as feeling restless, having panic attacks, low mood as illness and increased attendance of hospitals, or and pessimistic ideations, along with a screening of paradoxically avoiding visits to hospitals with the fear various other medical comorbidities, those who are of contracting an infection. Healthcare workers, who screened positive may be consulted by a psychiatrist are at a higher risk of exposure, may also fall victim to (in-person or tele-consultation) during admission or such symptoms12. Certain principles of mental hygiene after recovery, based on the seriousness of symptoms. adopt the example of various defence mechanisms, Another way for screening individuals quarantined at for example, to avoid defence mechanisms such as home or other isolation facilities, may be with the help rationalization and projection. Health workers may of apps specifically made for COVID-19 tracking such be specifically prone to rationalize or project being as Aarogya Setu, via daily/weekly/monthly pop-ups, infected or being in quarantine because they may or reminders. The integration of chatbots may also be believe that patient hides his/her symptoms from helpful in situations where the mental health service them. There should be regular education and training gap is further going to expand. The media should be of healthcare workers on the precautions they must encouraged to present hopeful stories proportionate take during their duty and take responsibility for their to their occurrence instead of sensationalizing and own safety. Another defence mechanism that has been terrifying the audience by unfortunate incidents. encouraged and described as part of the principles of While it is important to appreciate the efforts by mental hygiene, is sublimation. Hence, if one desires the frontline workers, it is important to encourage to avoid wearing a mask for a long time, he/she and train the general population to follow mental should consider staying at home as much as possible hygiene in order to make them self-sufficient, which and working online. This will fulfil his/her desire in a will eventually lessen the burden on the mental health socially acceptable manner. workers whose resources can be diverted to the care Constructive escape, which means taking a break of those affected with COVID-19. The issues of from their profession, or care for some other satisfying stigma related to infectious illnesses are longstanding. 240 INDIAN J MED RES, January & February 2021

Reinforcement of correct information with allaying 4. Taylor S, Landry CA, Rachor GS, Paluszek MM, of the associated myths through repeated measures Asmundson GJ. Fear and avoidance of healthcare workers: of creating awareness among the lay public should An important, under-recognized form of stigmatization during the COVID-19 pandemic. J Anxiety Disord 2020; 75 : 102289. be carried out. The concept of mental hygiene, which was introduced historically during the World War, is 5. Abbot ES. What is mental hygiene? A definition and an outline. Am J Psychiatry 1924; 81 : 261-84. forgotten, and must be revived to fight the war against COVID-19 with a newer perspective and integrating 6. Stevenson G. Mental Hygiene Principles. Can Med Assoc J the techniques of preventive psychiatry, thus enabling 1945; 53 : 115-9. every individual from the general population to be the 7. Delhi COVID-19 lockdown: Ration may soon be delivered at warrior. doorstep. Available from: https://timesofindia.indiatimes.com/ city/delhi/ration-may-soon-be-delivered-at-doorstep/articleshow/ Conflicts of Interest: None. 74921008.cms, accessed on April 2, 2020. 8. How are the children receiving their mid-day meals amid Mahadev Singh Sen, Nishtha Chawla & COVID-19 pandemic? Available from: https://swachhindia. Rajesh Sagar* ndtv.com/how-are-the-children-in-india-receiving-their-mid- Department of Psychiatry, All India Institute of day-meals-amid-the-covid-19-pandemic-47940/, accessed on November 18, 2020. Medical Sciences, New Delhi 110 029, India *For correspondence: 9. Green P. Risks to children and young people during COVID-19 pandemic. BMJ 2020; 369 : m1669. [email protected] 10. Chawla N, Sharma P, Sagar R. Psychological impact of Received July 9, 2020 COVID-19 on children and adolescents: Is there a silver lining? Indian J Pediatr 2020; 14 : 1. References 11. Asmundson GJ, Taylor S. How health anxiety influences responses to viral outbreaks like COVID-19: What all 1. Tucci V, Moukaddam N, Meadows J, Shah S, Galwankar SC, decision-makers, health authorities, and health care professionals Kapur GB. The forgotten plague: psychiatric manifestations need to know. J Anxiety Disord 2020; 71 : 102211. of Ebola, zika, and emerging infectious diseases. J Glob Infect 12. Verghese A. Spirituality and mental health. Indian J Psych Dis 2017; 9 : 151. 2008; 50 : 233-7. 2. Rajkumar RP. COVID-19 and mental health: A review of the 13. Ministry of Health and Family Welfare, Government existing literature. Asian J Psychiatry 2020; 52 : 102066. of India. Minding our minds during the COVID-19. 3. Inter-Agency Standing Committee. IASC guidelines on mental Available from: https://www.mohfw.gov.in/pdf/ health and psychosocial support in emergency settings. MindingourmindsduringCoronaeditedat.pdf, accessed on Geneva, Switzerland: IASC; 2006. August 27, 2020. The Indian Journal of Medical Research Guidelines for Contributors

SCOPE The Indian Journal of Medical Research (IJMR) is a biomedical journal with international circulation. It publishes original communications of biomedical research that advance or illuminate medical science or that educate the journal readers. It is issued monthly, in two volumes per year. Manuscripts dealing with clinical aspects will be considered for publication, provided they contain results of original investigations. Articles need to be of general interest - e.g., they cross the boundaries of specialities or are of sufficient novelty and importance that the journal’s readers, whatever be their speciality, should be made aware of the findings. Research papers reporting original research, review articles (both narrative and evidence based), research correspondence, letter to editor will be considered. View points and Perspectives are also considered. Papers of routine nature which are merely records of interesting cases, as also those dealing with modifications of routine methodology are not encouraged. Further, serialization of articles by the same author(s) into various parts (1,2,3, etc.) is strongly discouraged. In such cases the authors are advised to submit independent papers with self-sufficient titles and text. The IJMR strongly discourages duplication/reduplication of data already published in other journals (even when certain cosmetic changes/additions are made). If and when duplication is detected after publishing in IJMR, the journal will be forced to ‘retract’ such articles. Articles based on work carried out in private nursing homes and other non-recognized hospitals/research institutes will be discouraged.

THE EDITORIAL PROCESS All manuscripts submitted to the IJMR and considered suitable for processing are subject to peer review process. Authors need to certify in the covering letter that this manuscript has not been submitted to any other journal simultaneously. All manuscripts are screened initially at the editorial office for suitability for consideration for publication. Those found suitable are sent to 2-3 technical reviewers and one statistical expert based on the need. The journal follows the double blind peer review process. After peer review process, manuscripts considered suitable for publication are suitably edited before publication. The processes of submission of manuscript, peer review, communication of final decision and sending proofs are done through online system.

TYPE OF MANUSCRIPTS 1. Original Research Articles The approximate length of article should not be more than 2500 words (excluding Abstract and References). Original research articles should include a structured abstract (of 250 words maximum) under four subheadings: (i) Background & objectives, (ii) Methods, (iii) Results, and (iv) Interpretation & conclusions, followed by 5-8 key words arranged alphabetically. The main article should include the sections in following order: Introduction, Material & Methods, Results, Discussion, Acknowledgment (if any), Conflicts of Interest and References. The permission from Ethics Committee/ Institutional Review Board (IRB) is mandatory for all studies on human subjects and animals and this should be mentioned in the Material & Methods section. Registration of clinical trials is mandatory and registration number/CTR number should be mentioned.

vii 2. Reviews Narrative review articles written by scientist(s)/ expert(s) working in the particular area and who has/have published quality original research, will be considered. The article could be about 15-20 typed pages with not more than 100 references (recent & relevant) and an unstructured abstract of about 250 words. Tables and Figures could be included as per requirement. Copyright permission should be obtained from the copyright holder in advance, if a published Table/Figure is reproduced in part or whole.

3. Systematic Reviews (Including Meta-analysis) The articles under this section will be critical appraisal of different studies on important topics of clinical/public health significance to obtain an unbiased quantitative estimate of the overall effect of an intervention or variable for a defined outcome. The focus could be on cause, diagnosis, prognosis, therapy, prevention, etc. These would be thoroughly researched articles giving comprehensive and balanced perspective. There should be a structured abstract. Systematic reviews could be about 2500-3000 words with minimum number of Tables/Figures. These will be published subject to peer review.

4. Perspectives/Personal View/View point These are primarily opinion pieces written by senior scientists, public health experts and policy makers. Such papers will be generally written by a single author. No anonymous articles will be published. These should be about 1000- 1500 words and should contain references. Except for commissioned pieces, all submissions will be published subject to peer review.

5. Student IJMR Aimed to encourage and promote the participation of students in medical research, this new section is started exclusively for medical undergraduate students. This section would also include reports of important scientific developments that will impact patient care, public health and/or career advancement. This section may also carry Abstracts of research done by students as part of ICMR’s Short Term Studentship, DST’s Kishore Vaigyanik Protsahan Yojana, etc. The length of the papers should not be more than 1000 words. All the content in this section will be published subject to peer review. 6. Short Paper/ Research Correspondence/ Short Note Original research manuscripts containing well defined study design and sample size but limited parameters analysed may be submitted as Short Papers. These would be about 2000 words and contain a structured abstract with a combined Results & Discussion section. A research correspondence would be either a preliminary/pilot study or a post-implicative report with no abstract. Submissions with preliminary investigative data with limited methodology and sample size but having important clinical implications may be submitted as a Short Note containing a 200 words unstructured abstract. Both Correspondence and Short Note would be of around 1000-1500 words containing either a Table and/or a Figure. 7. Clinical Images Rare and educative cases may be presented under this section. A maximum of two authors are allowed per clinical image submission of whom, one should be a faculty associated with the case. A concise write up without reference or running title, of around 125-150 words may be submitted, containing details of the place (department/institute) and period (month/year) of patient presentation, diagnosis, treatment and follow up (along with the duration of follow up). Authors need to obtain the patient consent form (available on our official website) before the publication and have the form properly archived. The consent forms are not to be uploaded with the cover letter but can be sent through email to editorial office when asked for. If the patient is in paediatric age group or deceased, the form may be signed by a family member or a close relative. Clear and well resolved images (up to 3-4 or as panels; JPEG/ TIFF format with at least 300 dpi resolution) and up to two videos not exceeding 1MB may be submitted with the write up.

viii SUBMISSION OF MANUSCRIPT The IJMR does not charge for submission and processing of the manuscript. All manuscripts submitted for publication to the IJMR should include the following: (1) First page file; (2) Article file; (3) Tables & Figures; (4) A scanned copy of ethical clearance certificate; (5) Undertaking by authors & copyright transfer agreement. Details are given below. 1. FIRST PAGE FILE This should include a Covering letter, Title page and Author’s contribution in a single file.  The covering letter should explain why the paper should be published in the IJMR, rather than a specialty journal. One of the authors should be identified as the corresponding author of the paper, who would be responsible for the contents of the paper as for communication with the Editorial office. Author should declare that the article was not published or under consideration, in part or whole, simultaneously in any other journal or proceedings.  Title page should include (i) name(s) of author(s); (ii) highest degree; (iii) name(s) of the Department(s); (iv) designations (academic position) of authors in the department; (v) complete postal addresses, mobile number and e-mail id of all authors; (vi) name of corresponding author with all above mentioned details. Title page also should include: (i) Type of manuscript: original article/ review/ correspondence/ perspective/ view point/ clinical image/ letter to editor/ student IJMR; (ii) Title; (iii) Short title; (iv) Number of Tables; (v) Number of Figures; (vi) Source of financial support in the form of grants; (vii) Registration number in case of Clinical Trials; (viii) STS number in case of Student IJMR.  Specific author’s contribution should be given at the end in the Title page. 2. ARTICLE FILE Manuscripts must be submitted online through the website: www.journalonweb.com/ijmr. First time users will have to register at this site. Registration is free but mandatory. Registered authors can keep track of their articles after logging into the site using their user name and password. Manuscripts should be concise and neatly typed. Pages should be numbered consecutively and the contents arranged in the following order: Title: Title of the article should be short, continuous (broken or hyphenated titles are not acceptable) and yet sufficiently descriptive and informative so as to be useful in indexing and information retrieval.

A short running title not exceeding 6-7 words must also be provided. Abstract & Key words: All manuscripts should (except reviews) have a structured abstract (of about 250 words) with subheadings of Background & objectives, Methods, Results, and Interpretation & conclusions. Abstract should be brief and indicate the scope and significant results of the paper. It should only highlight the principal findings and conclusions so that it can be used by abstracting services without modification. Conclusions and recommendations not found in the text of the articles should not be inserted in the Abstract.

A set of suitable key words (6-8 in number) arranged alphabetically should also be provided. Introduction: Introduction should be brief and state precisely the scope of the paper. Review of the literature should be restricted to reasons for undertaking the present study and provide only the most essential background. The objective of the study should be written clearly with adequate justification at the end of this section.

ix Material & Methods: The nomenclature, the source of material and equipment used, with the manufacturers details in parenthesis, should be clearly mentioned. The procedures adopted should be explicitly stated to enable other workers to reproduce the results, if necessary. New methods may be described in sufficient detail indicating their limitations. Established methods can be just mentioned with authentic references and significant deviations, if any given, with reasons for adopting them. While reporting experiments on human subjects and animals, it should be clearly mentioned that procedures followed are in accordance with the ethical standards laid down by the national bodies or organizations of the particular country. For example, for research carried out in India on human subjects, the ICMR’s Ethical guidelines for biomedical research on human participants (2006) should be adhered to. Similarly, for experiments on laboratory animals the ICMR’s guidelines: Use of animals in scientific research (May 2006)/INSA’s guidelines for care and use of animals in scientific research (2000) or guidelines of the Committee for the Purpose of Control and Supervision of Experiments on Animals (CPCSEA) should be followed. Adequate information should be provided on the care and use of laboratory animals, source of animals, strain, age, sex, housing and nutrition, etc. Whenever needed, appropriate certification should be provided at the time of submission of the manuscripts. The drugs and chemicals used should be precisely identified, including generic name(s), dosage(s) and route(s) of administration. Study design: Selection of the observational or experimental participants (patients or laboratory animals, including controls, whether randomly or consecutively) and basis of sample size calculation should be mentioned clearly, including eligibility and exclusion criteria and a description of the source population. Contributors may consult the following Guidelines for specific study designs:

Sr. No. Type of study Source 1 Randomized controlled trials (RCTs) CONSORT- http://www.consort-statement.org 2 Systematic reviews & meta-analysis PRISMA guidelines- http://www.prisma-statement.org 3 Observational studies in epidemiology STROBE - http://www.strobe-statement.org/ 4 Meta-analysis of observational studies in MOOSE - http://statswrite.eu/pdf/MOOSE%20Statement. epidemiology pdf 5 Studies on diagnostic accuracy STARD - http://www.stard-statement.org * For any other type of study contributors may consult ICMJE website (www.icmje.org)

Period (with month and year) and place of the study should be clearly stated. Studies based on clinical trials: All clinical trials should be registered in a Primary Clinical Trial Registry and the Registration number be given under Material & Methods. Articles presenting with results of randomized clinical trials should provide information on all major study elements, including the protocol, assignment of interventions (methods of randomization, concealment of allocation to treatment groups), and the method of masking (blinding), based on the CONSORT Statement (http://www. consort-statement.org/). It should be clearly stated that study protocol was approved by the institutional/local ethics committee and written consent obtained from the participants. The statistical analysis done and statistical significance of the findings when appropriate, should be mentioned. Unless absolutely necessary for a clear understanding of the article, detailed description of statistical treatment may be avoided. Articles based heavily on statistical considerations, however, need to give details particularly when new or uncommon methods are employed. For standard and routine statistical methods employed, authors need to give only authentic references. Results: Only such data as are essential for understanding the discussion and main conclusions emerging from the study should be included. The data should be arranged in unified and coherent sequence so that the report develops clearly and logically. Data presented in Tables and Figures should not be repeated in the text. Only important observations need to be emphasized or summarized. The same data should not be presented both in tabular and graphic forms. Interpretation of the data should be taken up only under the Discussion and not under Results. x Discussion: The discussion should deal with the interpretation of results without repeating information already presented under Results. It should relate new findings to the known ones and include logical deductions. It should also mention any weaknesses/limitations/lacunae of the study. The conclusions can be linked with the goals of the study but unqualified statements and conclusions not completely supported by the data should be avoided. Claiming of priority on work that is ongoing should also be avoided. All hypotheses should, if warranted, clearly be identified as such; recommendations may be included as part of the Discussion, only when considered absolutely necessary and relevant. This section should preferably end with a concluding remark. Acknowledgment: Acknowledgment should be brief and made for specific scientific/technical assistance and financial support only and not for providing routine departmental facilities and encouragement or for help in the preparation of the manuscripts (including typing or secretarial assistance). Conflicts of Interest: A conflict of interest exists if authors or their institutions have financial or personal relationships with other people or organizations that could inappropriately influence (bias) their actions. A conflict can be actual or potential, and full disclosure to the Editor is absolute requirement. All submissions must include disclosure of all relationships that could be viewed as presenting a potential conflict of interest. All authors must disclose any financial and personal relationships with other people or organizations that could inappropriately influence (bias) their work. If there are no conflicts of interest, authors should state so. References: The total number of References should normally be restricted to a maximum of 30 for Original Research Articles. References to literature cited should be numbered consecutively and placed at the end of the manuscript. In the text they should be indicated above the line (superior). As far as possible mentioning names of author(s) under references should be avoided in text. Articles in Journals: The titles of the journals should be abbreviated according to the style used by the PubMed. 1. Standard journal article List the first six authors followed by et al. Halpern SD, Ubel PA, Caplan AL. Solid-organ transplantation in HIV-infected patients. N Engl J Med 2002; 347 : 284-7. More than six authors: Rose ME, Huerbin MB, Melick J, Marion DW, Palmer AM, Schiding JK, et al. Regulation of interstitial excitatory amino acid concentrations after cortical contusion injury. Brain Res 2002; 935 : 40-6. 2. Organization as author Diabetes Prevention Program Research Group. Hypertension, insulin, and proinsulin in participants with impaired glucose tolerance. Hypertension 2002; 40 : 679-86. 3. Both personal authors and an organization as author Vallancien G, Emberton M, Harving N, van Moorselaar RJ; Alf-One Study Group. Sexual dysfunction in 1,274 European men suffering from lower urinary tract symptoms. J Urol 2003; 169 : 2257-61.

xi 4. No author given 21st century heart solution may have a sting in the tail. BMJ 2002; 325 : 184. 5. Article not in English Ellingsen AE, Wilhelmsen I. [Sykdomsangst blant medisin- og jusstudenter]. Tidsskr Nor Laegeforen 2002; 122 : 785-7. 6. Volume with supplement Geraud G, Spierings EL, Keywood C. Tolerability and safety of frovatriptan with short- and long-term use for treatment of migraine and in comparison with sumatriptan. Headache 2002; 42 (Suppl 2) : S93-9. 7. Issue with supplement Glauser TA. Integrating clinical trial data into clinical practice. Neurology 2002; 58 (12 Suppl 7) : S6-12. 8. Volume with part Abend SM, Kulish N. The psychoanalytic method from an epistemological viewpoint. Int J Psychoanal 2002; 83 (Pt 2) : 491-5. 9. Issue with part Ahrar K, Madoff DC, Gupta S, Wallace MJ, Price RE, Wright KC. Development of a large animal model for lung tumors. J Vasc Interv Radiol 2002; 13 (9 Pt 1) : 923-8. 10. Issue with no volume Banit DM, Kaufer H, Hartford JM. Intraoperative frozen section analysis in revision total joint arthroplasty. Clin Orthop 2002; (401) : 230-8. 11. No volume or issue Outreach: bringing HIV-positive individuals into care. HRSA Careaction 2002 Jun : 1-6. 12. Pagination in roman numerals Chadwick R, Schuklenk U. The politics of ethical consensus finding. Bioethics 2002; 16 : iii-v. 13. Type of article indicated as needed Tor M, Turker H. International approaches to the prescription of long-term oxygen therapy [letter]. Eur Respir J 2002; 20 : 242. Lofwall MR, Strain EC, Brooner RK, Kindbom KA, Bigelow GE. Characteristics of older methadone maintenance (MM) patients [abstract]. Drug Alcohol Depend 2002; 66 (Suppl 1) : S105. 14. Electronic journal article Bhagwat NM, Joshi AS, Rao G, Varthakavi PK. Uncontrolled hyperglycaemia: A reversible cause of hemichorea- hemiballismus. BMJ Case Rep 2013; 2013. pii : bcr2013010229. 15. Article republished with corrections Mansharamani M, Chilton BS. The reproductive importance of P-type ATPases. Mol Cell Endocrinol 2002;188(1- 2):22-5. Corrected and republished from: Mol Cell Endocrinol 2001; 183 : 123-6.

xii 16. Article with published erratum Malinowski JM, Bolesta S. Rosiglitazone in the treatment of type 2 diabetes mellitus: a critical review. Clin Ther 2000; 22 : 1151-68; discussion 1149-50. Erratum in: Clin Ther 2001;23 : 309. 17. Article published electronically ahead of the print version Yu WM, Hawley TS, Hawley RG, Qu CK. Immortalization of yolk sac-derived precursor cells. Blood 2002 Nov 15; 100 : 3828-31. Epub 2002 Jul 5. Books and Other Monographs 18. Personal author(s) Murray PR, Rosenthal KS, Kobayashi GS, Pfaller MA. Medical microbiology. 4th ed. St. Louis: Mosby; 2002. 19. Editor(s), compiler(s) as author Gilstrap LC 3rd, Cunningham FG, VanDorsten JP, editors. Operative obstetrics. 2nd ed. New York: McGraw-Hill; 2002. 20. Author(s) and editor(s) Breedlove GK, Schorfheide AM. Adolescent pregnancy. 2nd ed. Wieczorek RR, editor. White Plains (NY): March of Dimes Education Services; 2001. 21. Organization(s) as author Royal Adelaide Hospital; University of Adelaide, Department of Clinical Nursing. Compendium of nursing research and practice development, 1999-2000. Adelaide (Australia): Adelaide University; 2001. 22. Chapter in a book Meltzer PS, Kallioniemi A, Trent JM. Chromosome alterations in human solid tumors. In: Vogelstein B, Kinzler KW, editors. The genetic basis of human cancer. New York: McGraw-Hill; 2002. p. 93-113. 23. Conference proceedings Harnden P, Joffe JK, Jones WG, editors. Germ cell tumours V. Proceedings of the 5th Germ Cell Tumour Conference; 2001 Sep 13-15; Leeds, UK. New York: Springer; 2002. 24. Conference paper Christensen S, Oppacher F. An analysis of Koza’s computational effort statistic for genetic programming. In: Foster JA, Lutton E, Miller J, Ryan C, Tettamanzi AG, editors. Genetic programming. EuroGP 2002: Proceedings of the 5th European Conference on Genetic Programming; 2002 Apr 3-5; Kinsdale, Ireland. Berlin: Springer; 2002. p. 182-91. 25. Abstract in journal or supplement Passmore JA, Williams B. Role of vaginal microbiota in genital inflammation and enhancing HIV acquisition in women. In: 21st International AIDS Conference (AIDS 2016); 2016 July 18-22; Durban, South Africa. Durban: International AIDS Society; 2016. (Abstract No. TUSS0604). 26. Scientific or technical report Issued by funding/sponsoring agency: Yen GG (Oklahoma State University, School of Electrical and Computer Engineering, Stillwater, OK). Health

xiii monitoring on vibration signatures. Final report. Arlington (VA): Air Force Office of Scientific Research (US), Air Force Research Laboratory; 2002 Feb. Report No.: AFRLSRBLTR020123. Contract No.: F496209810049. Issued by performing agency: Russell ML, Goth-Goldstein R, Apte MG, Fisk WJ. Method for measuring the size distribution of airborne Rhinovirus. Berkeley (CA): Lawrence Berkeley National Laboratory, Environmental Energy Technologies Division; 2002 Jan. Report No.: LBNL49574. Contract No.: DEAC0376SF00098. Sponsored by the Department of Energy. 27. Dissertation Borkowski MM. Infant sleep and feeding: a telephone survey of Hispanic Americans [dissertation]. Mount Pleasant (MI): Central Michigan University; 2002. 28. Patent Pagedas AC, inventor; Ancel Surgical R&D Inc., assignee. Flexible endoscopic grasping and cutting device and positioning tool assembly. United States patent US 20020103498. 2002 Aug 1. Other Published Material 29. Newspaper article Tynan T. Medical improvements lower homicide rate: study sees drop in assault rate. The Washington Post. 2002 Aug 12;Sect. A:2 (col. 4). Available from: https://www.washingtonpost.com/archive/politics/2002/08/12/medical- improvements-lower-homicide-rate/7067e6d2-02f9-4900-bfbf-d647c748a1cf/?utm_term=.5ac4bf94e2b3, accessed on November 5, 2017. 30. Audiovisual material Chason KW, Sallustio S. Hospital preparedness for bioterrorism [videocassette]. Secaucus (NJ): Network for Continuing Medical Education; 2002. 31. Legal Material Public law: Veterans Hearing Loss Compensation Act of 2002, Pub. L. No. 107-9, 115 Stat. 11 (May 24, 2001). Unenacted bill: Healthy Children Learn Act, S. 1012, 107th Cong., 1st Sess. (2001). Code of Federal Regulations: Cardiopulmonary Bypass Intracardiac Suction Control, 21 C.F.R. Sect. 870.4430 (2002). Hearing: Arsenic in Drinking Water: An Update on the Science, Benefits and Cost: Hearing Before the Subcomm. on Environment, Technology and Standards of the House Comm. on Science, 107th Cong., 1st Sess. (Oct. 4, 2001). 32. Map Pratt B, Flick P, Vynne C, cartographers. Biodiversity hotspots [map]. Washington: Conservation International; 2000. 33. Dictionary and similar references Dorland’s illustrated medical dictionary. 29th ed. Philadelphia: W.B. Saunders; 2000. p. 675. Unpublished Material 34. Unpublished observations/data can be given within the text as ‘(unpublished observations/data)’. Personal communications can be cited within the text in parentheses as (personal communication, name of the person and place).

xiv Electronic Material 35. Journal article on the Internet Abood S. Quality improvement initiative in nursing homes: the ANA acts in an advisory role. Am J Nurs [serial on the Internet]. 2002 Jun. Available from: http://www.nursingworld.org/AJN/2002/june/Wawatch.htm, accessed on August 12, 2002. 36. Monograph on the Internet Foley KM, Gelband H, editors. Improving palliative care for cancer [monograph on the Internet]. Washington: National Academy Press; 2001. Available from: http://www.nap.edu/books/0309074029/html/, accessed on July 9, 2002. 37. Homepage/Web site Cancer-Pain.org [homepage on the Internet]. New York: Association of Cancer Online Resources, Inc.; c2000-01 [updated 2002 May 16]. Available from: http://www.cancer-pain.org/, accessed on July 9, 2002. 38. Part of a homepage/Web site American Medical Association [homepage on the Internet]. Chicago: The Association; c1995-2002 [updated 2001 Aug 23]. AMA Office of Group Practice Liaison; [about 2 screens]. Available from: http://www.ama-assn.org/ama/ pub/category/1736.html, accessed on August 12, 2002. 39. Database on the Internet Open database: Who’s Certified [database on the Internet]. Evanston (IL): The American Board of Medical Specialists. c2000. Available from: http://www.abms.org/newsearch.asp, accessed on March 8, 2001. Closed database: Jablonski S. Online Multiple Congential Anomaly/Mental Retardation (MCA/MR) Syndromes [database on the Internet]. Bethesda (MD): National Library of Medicine (US). c1999 [updated 2001 Nov 20]. Available from: http://www.nlm.nih.gov/mesh/jablonski/syndrome_title.html, accessed on December 8, 2017. 40. Part of a database on the Internet MeSH Browser [database on the Internet]. Bethesda (MD): National Library of Medicine (US); 2002 - [cited 2003 Jun 10]. Meta-analysis; unique ID: D015201; [about 3 p.]. Available from: http://www.nlm.nih.gov/mesh/MBrowser. html Files updated weekly. 3. TABLES & FIGURES Tables (and graphs in MS Word format) should be included in main Article file in MS Word file format. Tables should numbered consecutively with Roman numerals (I, II, III, etc). They should bear brief title and column headings should also be short. Units of measurement should be abbreviated and placed below the headings. Statistical measurement variations such as SD and SE should be identified. Inclusion of structural formule in Tables should be avoided. Abbreviations used be given in the footnote. Figures should be submitted in JPEG or TIFF format (size not more than 1 MB), numbered consecutively in Arabic numerals with appropriate Title and explanation of symbols in the legends for illustrations. Within a multi-panel figure, different parts should be labelled as A, B, C,...etc. on top left corner. Photomicrographs should have internal scale markers regarding details of magnification to facilitate reduction in size in final print. Symbols, arrows and letters used in the photomicrographs should be legible and in contrast with the background.

xv Graphs in JPEG/TIFF format can be uploaded as Figures. All published material should be acknowledged and copyright material should be submitted along with the written permission of the copyright holder. Enzyme Nomenclature For enzymes, only the trivial names recommended by the IUPAC-IUB Commission should be used. At its first citation in the text of the paper its code number and systematic name should be indicated. Abbreviations Only standard abbreviations are to be used. The abbreviations should conform to the International System of Units (SI), throughout the text, Tables and Figures. Generic names of the drugs should be used. If proprietary brands are used in research brand name, name of manufacturer and country should be given in parentheses after the generic name at the first place of use. 4. ETHICAL CLEARANCE CERTIFICATE All studies conducted on patients / volunteers/ Human biological material/animals should submit a scanned copy of Ethical Clearance Certificate. 5. UNDERTAKING BY AUTHOR(S) & COPYRIGHT TRANSFER AGREEMENT Downloadable form It is necessary that all the authors give an undertaking (in the format specified by the journal) indicating their consent to be co-authors in the sequence indicated on the title page. Each author should give his or her names as well as the address and appointment current at the time the work was done, plus a current address for correspondence including telephone and fax numbers and email address. A senior author may sign the Undertaking by Authors for a junior author who has left the institution and whose whereabouts are not known and take the responsibility. A paper with corporate (collective) authorship must specify the key persons responsible for the article; others contributing to the work should be recognized separately. Author(s) will be asked to sign a transfer of copyright agreement, which recognizes the common interest that both journal and author(s) have in the protection of copyright. It will also allow us to tackle copyright infringements ourselves without having to go back to authors each time. PROOFS Authors of accepted articles are supplied of printer’s proofs online on their Author centre and will also receive email alerts when proofs are available. Corrections on the page proofs should be restricted to printer’s errors only and no substantial additions/deletions should be made. No change in the names of the authors (by way of additions and deletions) is permissible at the proof stage. If there are valid reasons for such a change, after acceptance of a paper, the permission of the Editor-in-Chief must be sought.

xvi Standard abbreviations to be used in IJMR The abbreviations should be used in the text, tables and illustrations without a full stop.

Molar (mole/litre) M* counts per minute cpm milli molar (m mole/litre) mM Curie Ci Micromolar (mole/litre) µM rad rad mole (quantity of substance) mol Roentgen R normal N gravity g metre m ortho o centimetre cm meta m square centimetre cm2 para p millimetre mm intramuscular im micrometre µm intraperitoneal ip nanometre nm intravenous iv picometre pm subcutaneous sc mg/ 100 ml mg/dl oral po

Angstrom Å lethal dose-50 LD50 litre 1 Ampere A millilitre ml milli Ampere mA microlitre µl Watt W gram g anti meridiem (before noon) am milligram mg post meridiem (after noon) pm kilogram kg volume vol hour(s) h volume ratio vol/vol minute(s) min (volume per volume) second(s) sec weight wt week(s) wk weight per volume wt/vol year(s) yr weight ratio wt/wt Probability (weight per weight) (statistical significance) P

*Should not be used as an abbrevation for mole

xvii Undertaking by Authors

We, the undersigned, give an undertaking to the following effect with regard to our article entitled “ “______

______submitted for publication in the Indian Journal of Medical Research :- 1. The article mentioned above has not been published or submitted to or accepted for publication in any form, in any other journal. 2. We also vouchsafe that the authorship of this article will not be contested by anyone whose name(s) is/are not listed by us here. 3. I/We declare that I/We contributed significantly towards the research study i.e., (a) conception, design and/or analysis and interpretation of data and to (b) drafting the article or revising it critically for important intellectual content and on (c) final approval of the version to be published. 4. I/We hereby acknowledge IJMRs conflict of interest policy requirement to scrupulously avoid direct and indirect conflicts of interest and, accordingly, hereby agree to promptly inform the editor or editor’s designee of any business, commercial, or other proprietary support, relationships, or interests that I/We may have which relate directly or indirectly to the subject of the work. 5. I/We also agree to the authorship of the article in the following sequence:-

Authors’ Names (in sequence) Signature of Authors 1. ______2. ______3. ______4. ______5. ______6. ______7. ______8. ______

Important (i). All the authors are required to sign independently in this form in the sequence given above. In case an author has left the institution/country and whose whereabouts are not known, the senior author may sign on his/her behalf taking the responsibility. (ii). No addition/deletion/ or any change in the sequence of the authorship will be permissible at a later stage, without valid reasons and permission of the Editor-in-Chief. (iii). If the authorship is contested at any stage, the article will be either returned or will not be processed for publication till the issue is solved.

xviii Copyright Transfer Agreement Form

This document must be signed by all authors and submitted with the manuscript.

COPYRIGHT TRANSFER AGREEMENT

The Indian Journal of Medical Research (IJMR) is published monthly by the Indian Council of Medical Research, V. Ramalingaswami Bhawan, Ansari Nagar, New Delhi-110029 (India).

The IJMR and Authors hereby agree as follows: In consideration of IJMR reviewing and editing the following described work for first publication on an exclusive basis:

Title of manuscript: ______

______

The undersigned author(s) hereby assigns, conveys, and otherwise transfers all rights, title, interest, and copyright ownership of said work for publication. Work includes the material submitted for publication and any other related material submitted to IJMR. In the event that IJMR does not publish said work, the author(s) will be so notified and all rights assigned hereunder will revert to the author(s). The assignment of rights to IJMR includes but is not expressly limited to rights to edit, publish, reproduce, distribute copies, include in indexes or search databases in print, electronic, or other media, whether or not in use at the time of execution of this agreement, and claim copyright in said work throughout the world for the full duration of the copyright and any renewals or extensions thereof. IJMR shall own the work, including (1) copyright; (2) the right to grant permission to republish the article in whole or in part, with or without fee; (3) the right to produce preprints or reprints and translate into languages other than English for sale or free distribution; and (4) the right to republish the work in a collection of articles in any other mechanical or electronic format. The article will be published under the terms of the latest Creative Commons Attribution-NonCommercial- ShareAlike License, unless the journal notifies the author otherwise in writing. The author(s) hereby represents and warrants that they are sole author(s) of the work, that all authors have participated in and agree with the content and conclusions of the work, that the work is original, and does not infringe upon any copyright, propriety, or personal right of any third party, and that no part of it nor any work based on substantially similar data has been submitted to another publication. Authors’ Names (in sequence) Signature of Authors 1. ______2. ______3. ______4. ______5. ______6. ______7. ______8. ______

xix Online Manuscript Submission Check List

1. Covering letter and Title page should be submitted as single file in First page file.

2. Manuscript with Abstract & Key words should be submitted as Article file.

3. Tables and graphs (in MS Word format) should be included in the main Article file.

4. Figures, videos and graphs (if in JPEG/TIFF formats) should be submitted in Images section

5. Scanned images of Undertaking and Copyright Transfer Agreement Form duly signed by all authors should be submitted as single file (sequence of authors should be maintained as per title page).

6. Scanned image of Ethical Clearance certificate should be submitted.

xx Indian J Med Res 153, January & February 2021, pp 1-240

FORM IV

Statement about ownership and other particulars of the Indian Journal of Medical Research under Rule 8 of the Registration of Newspapers (Central), Rules, 1956.

nd 1. Place of Publication : A-202, 2 Floor, The Qube, C.T.S. No.1498A/2 Village Marol, Andheri (East), Mumbai 400 059, India 2. Periodicity of Publication : Monthly

3. Printer’s Name : Smt. A. Wason

Nationality : Indian

Address : Administrative Officer Indian Council of Medical Research Ansari Nagar, New Delhi 110 029

4. Publisher’s Name : Smt. A. Wason

Nationality : Indian

Address : Administrative Officer Indian Council of Medical Research Ansari Nagar, New Delhi 110 029

5. Editor-in-Chief ’s Name : Dr Anju Sharma

Nationality : Indian

Address : Indian Council of Medical Research Ansari Nagar, New Delhi 110 029

6. Name and Address of Owner : Indian Council of Medical Research Ansari Nagar, New Delhi 110 029

I, A. Wason, hereby declare that the particulars given above are true to the best of my knowledge and belief.

Dated: February 1, 2021 (Sd) A. Wason (on behalf of ICMR)�� Signature of Publisher

Indian Journal of Medical Research published by Wolters Kluwer (India) Private Ltd on behalf of Director-General, Indian Council of Medical Research, New Delhi Ø Full text online at www.ijmr.org.in Ø Submit online : http://www.journalonweb.com/ijmr India & COVID-19 (Part-IV)

R.N.I. Regd. No. 2223/57