Downloaded from orbit.dtu.dk on: Oct 09, 2021

Genomics-driven discovery, characterization, and engineering of fungal secondary metabolites

Wolff, Peter Betz

Publication date: 2020

Document Version Publisher's PDF, also known as Version of record

Link back to DTU Orbit

Citation (APA): Wolff, P. B. (2020). Genomics-driven discovery, characterization, and engineering of fungal secondary metabolites. Technical University of Denmark.

General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights.

 Users may download and print one copy of any publication from the public portal for the purpose of private study or research.  You may not further distribute the material or use it for any profit-making activity or commercial gain  You may freely distribute the URL identifying the publication in the public portal

If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.

GENOMICS-DRIVEN DISCOVERY, CHARACTERIZATION, AND ENGINEERING OF FUNGAL SECONDARY METABOLITES

Peter Betz Wolff

A thesis submitted for the degree of Doctor of Philosophy

February 2020 Genomics-driven discovery, characterization, and engineering of fungal secondary metabolites Peter Betz Wolff, 27th of February 2020

Address: Technical University of Denmark Department of Biotechnology and Biomedicine Sølftofts Plads, Building 223 2800 Kgs. Lyngby Denmark

Supervisors: Professor Uffe Hasbro Mortensen Professor Thomas Ostenfeld Larsen Preface

Preface

This Ph.D. thesis describes the results of my study initiated at the Technical University of Denmark (DTU) in September 2016 and finished in February 2020. The study was conducted at DTU Bioengineering, department of Biotechnology and Biomedicine under the supervi- sion of professor Uffe Hasbro Mortensen and Professor Thomas Ostenfeld Larsen. The Novo Nordisk foundation supported the work, grand NNF15OC0016610.

During my Ph.D. project, I have had the opportunity to learn new techniques for molecular engineering within fungal secondary metabolism, gain a broader knowledge for project management, and participate in inspiring conferences worldwide.

Kgs. Lyngby, February 2020

Peter Betz Wolff

Page i Contents

Contents

Preface i

Acknowledgements v

Summary vi

Sammenfatning ix

Publications xii

Conference contributions xiii

Abbreviations xiv

1 Project motivation and objective 1 Project motivation ...... 1 Project objective ...... 1 References ...... 3

2 Background 4 Biology and chemistry ...... 4 The fifth kingdom ...... 4 From genes to natural products ...... 5 The biosynthesis of natural products ...... 8 Pathways ...... 14 Tetracyclines ...... 18 Mode of action ...... 19 Structure activity relationship ...... 20 Bacteria resistance mechanisms ...... 22 Tools...... 23 Bioinformatics ...... 23 Quantitative real-time PCR ...... 23 Chemical analysis and dereplication ...... 24 Molecular networking for biosynthetic pathway elucidation ...... 24 References ...... 26

3 Fungal Synthetic Biology Tools to Facilitate Utilization of Secondary Metabo- lites: Discovery, Heterologous Production, and Biosynthesis of Biocombinato- rial Compounds 38 Abstract ...... 38 Introduction ...... 38

Page ii Contents

Discovery of secondary metabolite pathways in natural hosts ...... 39 CRISPR Cas9 in filamentous fungi ...... 40 Gene-expression cassettes ...... 41 Activation of silent BGCs in the native host ...... 43 Global regulation on and beyond chromatin level ...... 44 Linking fungal biosynthetic gene clusters to secondary metabolite products 46 Discovery and characterization using heterologous expression ...... 47 Fungal cell factories ...... 49 Optimization of fungal cell factories ...... 49 Expanding the chemical space via biocombinatorial synthetic biology ...... 51 Synthetic Pathways for Production of Natural and Non-natural Products . . 51 Synthetic Enzymes for Production of Non-Native Products ...... 54 Perspective ...... 56 References ...... 57

4 Acurin A, a novel hybrid compound, biosynthesized by individually translated PKS- and NRPS-encoding genes in Aspergillus aculeatus 69 Abstract ...... 69 Introduction ...... 70 Materials and Methods ...... 71 Results and Discussion ...... 76 Acurin A – a novel PK-NRP hybrid compound from Aspergillus aculeatus . 76 Identification of putative PKS and NRPS genes for the production of acurin 78 Separate PKS- and NRPS enzymes synthesize the acurin A core structure . 80 Uncoupled PKS and NRPS activity is conserved in a clade in section Nigri . 81 The acurin BGC contains genes encoding tailoring enzymes and a TF . . . 85 Gene deletions identify genes in the acr biosynthetic gene cluster ...... 87 Proposed biosynthesis of acurin A ...... 89 Conclusion ...... 91 Acknowledgements ...... 92 References ...... 92

5 Genetic Manipulation and Molecular Networking for Biosynthetic Pathway Characterization of Tetracycline-like Compounds in Aspergillus sydowii 97 Abstract ...... 97 Introduction ...... 97 Results ...... 98 Screening the genus Aspergillus for a potential tetracycline-likeBGC . . . . 98 Homologous expression of a putative pathway-specific transcription factor . 100 Targeted gene deletions for tetracycline-like BGC characterization . . . . . 102 Molecular networking as a tool for intermediate characterization ...... 103

Page iii Contents

Proposed biosynthetic pathway ...... 106 Discussion ...... 109 Screening the genus Aspergillus for potential tetracycline BGCs ...... 109 Overexpression of nstR leads to an unnatural behavior in A. sydowii .... 109 Targeted gene deletions verify neosartoricinB as the main BGC product . . 110 Molecular networking as a tool for biosynthetic pathway characterization . 110 Enzyme order in the pathway is defined by the environmental factors . . . . 110 Conclusion ...... 111 Acknowledgements ...... 112 Experimental ...... 112 References ...... 115

6 Expression Platform for Biocombinatorial Decoration of a Fungal-derived Tetra- cycline in Aspergillus niger 118 Abstract ...... 118 Introduction ...... 118 Results ...... 119 Homologous reconstitution of the ada pathway in A. niger ...... 119 Verification and analysis of tetracycline production in the platform strains . 122 AMA1-based expression of two tailoring-enzymes for further validation . . 122 Identifying tailoring enzyme-encoding genes for further expression . . . . . 124 Discussion ...... 126 Conclusion ...... 127 Acknowledgements ...... 127 Experimental section ...... 127 References ...... 129

7 Overall discussion, conclusion, and perspectives 131 References ...... 131

Appendix I (Chapter 4) 137

Appendix II (Chapter 5) 183

Appendix III (Chapter 6) 214

Page iv Acknowledgements

Acknowledgements

Firstly, I would like to express my gratitude to my supervisors Prof. Uffe Hasbro Mortensen and Prof. Thomas Ostenfeld Larsen, for the opportunity to be part of this research project. These last three and a half years have been an exciting, rewarding, and educational experience for me, and it would not have been possible without the invaluable guidance I received from both throughout this research. They have taught me the methodology needed to carry out my research and to present the results in the most precise way possible. Their motivation and vision for the project have deeply inspired me, and I feel incredibly grateful to have had the chance to work with them.

My former master supervisor Assoc. Prof. Jakob Blæsbjerg Hoof has given me valuable support and been a mentor for me throughout this project. I thank you for all the enjoyable scientific discussion we have had over the years, they have inspired me to do more.

I want to thank Karolina Subko for the fantastic cooperation on this project. You are a brilliant chemist with innovative ideas, an eye for details, and a great drive. I have enjoyed working together with you, and I have gained a lot more insights into the world of chemistry through our many talks. Thank you.

Working at the Technical University of Denmark (DTU) and especially in the Aspergillus laboratory at the section for synthetic biology, has been one of the best working experiences in my career. My co-workers and fellow Ph.D. candidates have always been helpful, and with a great sense of humor. I have particularly appreciated my productive discussions with Kresten Jon Korup Kromphardt and Jakob Kræmmer Haar Rendsvig, they have both contributed to improving my understanding of fungal science. Also, Zofia Dorota Jarczynska has been a great help in the laboratory with guidance and advice. And a special thanks to Andreas Møllerhøj Vestergaard for keeping us all entertained in his inexhaustible search for fungal monooxygenases.

Finally, to my caring, loving, and supportive wife, Naja: you have my deepest gratitude. You have been a guardian angel throughout these years, and the project would never have been finished if it wasn’t for you. Your loving care for our toddler daughter and baby son, in my absence, while writing, has been admirable and an inspiration to me. You have helped me in my darkest hour of frustration, listened, and always reassured me that I could do this. For that, I owe you everything.

Page v Summary

Summary

Filamentous fungi can produce many natural products (NPs) with both beneficial properties (e.g., bioactive pharmaceutical compounds), as well as harmful substances (e.g., mycotoxins). For the past decade, microbial whole-genome sequencing projects have identified a sizeable genetic potential for discovering yet more unknown natural products, which include complex derivatives of already-approved drugs. Filamentous fungi, here among the genus Aspergillus, has been a source for many drug discoveries, one example being the blockbusting phar- maceutical lovastatin produced by Aspergillus terreus. Other Aspergilli (e.g., A. fumigatus and A. flavus) can infect fruits, grains, and a range of other agriculture commodities with carcinogenic, neurotoxic, and immunosuppressing NPs (e.g., aflatoxin). It easy to imagine that some fungal strains can produce both valuable compounds in favorable amounts but, at the time, can produce harmful mycotoxins. One example being A. niger used for organic acid production, yet also proved in some industrial strains to produce mycotoxins such as fumonisins and ochratoxin A.

The present Ph.D. project aimed to investigate both a potential mycotoxin, previously identified in the fungus Aspergillus aculeatus, as well as examine the genus Aspergillus for biosynthetic gene clusters (BGCs) responsible for bioactive polyketide-derived tetracycline compounds. Tetracyclines have been used in the treatment of several diseases for more than half a century, including bacterial and fungal infections, inflammation, and even cancer. The scaffold of these compounds can relatively easily be chemically altered. A feature several pharmaceutical companies have, over the years, exploited by developing both natural, semi- synthetic, and synthetic derivatives into broadly used medications. The stepping-stone for all investigations in the project was to use and developed techniques for synthetic biology for pathway elucidation, activation of silent genes, and genetic engineering.

In chapter 3 (Review), the literature on synthetic biology developed for the expression of secondary metabolites in filamentous fungi is reviewed. This section highlights a wide range of molecular tools for genetic engineering, including expression systems, gene acti- vation, CRISPR/Cas9, and biocombinatorial approaches for the development of compound derivatives.

The research conducted in experimental case 1 (chapter 4) characterizes a BGC from Aspergillus aculeatus responsible for producing a potential mycotoxin, named acurin A. The novel hybrid compound, with an NRPS-PKS origin, highly resembles fusarin C, a known mycotoxin biosynthesized by several Fusarium spp. Using an Aspergillus aculea- tus nonhomologous end-joining (NHEJ)-deficient strain, we were able to efficiently delete multiple genes using homologous recombination (HR) gene-targeting strategy and propose a biosynthetic pathway. A notable observation from this investigation is an atypical BGC

Page vi Summary organization. Generally, hybrid compounds with similar 3-acyl 2-pyrrolinone scaffolds are biosynthesized by PKS-NRPS hybrid enzymes encoded from a single fused gene. However, in the BGC responsible for the biosynthesis of acurin A, these enzymes are encoded by separate genes. To fully appreciate the magnitude of this unique discovery, we further inves- tigated 475 different fungal species to clarify the inheritance and evolution of the BGC. Here we show that only a few species share similar BGC organizations and that, for Aspergillus, it is restricted to a small clade within the section Nigri. To our knowledge, acurin A is the first 3-acyl 2-pyrrolinone fungal compound to be reported as biosynthesized by individually translated PKS- and NRPS-encoding genes.

Concerning finding tetracycline-producing BGCs, we initially performed a bioinformat- ics pre-study to map out potential Aspergillus species with interesting loci that could produce a tetracycline or a tetracycline-like compound. The investigation was based on previously characterized PKS sequences obtained from known fungal tetracycline-producing BGCs (i.e., viridicatumtoxin B and TAN-1612 from Penicillium aethiopicum and Aspergillus niger, respectively), along with comparing the gene cluster organization. Several species indicated the presence of potential tetracycline BGCs. However, we noticed that it was challenging to differentiate between genuine tetracycline and tricyclic BGCs based on the bioinformatics available to us. To increase our knowledge of the small deviations that distinguish these BGCs, we decided to investigate a locus that borderlines the prediction between these com- pounds.

In experimental case 2 (chapter 5), we examined a BGC from Aspergillus sydowii with homology to the TAN-1612 BGC from A. niger, as well as homology to a BGC responsible for producing the tricyclic compound, neosartoricin, from Neosartorya fischeri. By overex- pressing a potential transcription factor encoding gene embedded in the A. sydowii BGC, we stimulated the strain to produce a range of compounds, which were undetectable in the wild type strain. Among these compounds, we found neosartoricin B, a pre-release tricyclic shunt compound, and a prenylated tetracycline in low concentrations. We also detected a tetracyclic compound with a C2-C18 five-membered ring formation, which could be a direct degradation product of the detected prenylated tetracycline. To confirm the origin of the compounds, we firstly deleted the core PKS encoding gene (JGI: 157033) to prove the link to the BGC. Surprisingly, all the above-mentioned compounds were abolished in the mutant strain, which let us conclude that the BGC was silent under standard laboratory conditions and that the BGC was involved in the biosynthesis of several natural products. To characterize this complex biosynthetic pathway encoded by the BGC, we optimized a method, based on the GNPS molecular networking tool, to cross-reference several mutant strains, which let us categorize all intermediate involved. This further allowed us to propose an extensive biosynthetic pathway with several branches supported by NMR verified structures. Moreover, we identified a putative enzymatic tetracycline degradation pathway and speculated on a

Page vii Summary potential gene candidate.

In experimental case 3 (chapter 6), we explored the opportunity of developing an expressing platform for biocombinatorial decoration of a basic tetracycline scaffold. The concept was based on the A. niger TAN-1612 core genes in order to express a demethylated version of the tetracycline. Two designs were pursued to obtain the desired compound. Firstly, we constructed an A. niger strain where the core genes (i.e., ada- A to -C) were expressed under the control of a single strong promoter with separation by the picornavirus self-cleaving sequence, P2A. The resulting strain yielded a new compound with a similar mass to the desired product, but with different retention-time when compared to standards in Mass spectrometry. Further analysis indicated a loss of translation concerning the last gene in the P2A construct, which perhaps resulted in misfolding of the fourth ring in the demethylated TAN-1612. Secondly, we designed a strategy with a transcription factor (TF) activating approach. By overexpressing the TF encoding gene adaR, and simultaneously eliminate the O-methyltransferase encoding gene adaD, we were able to establish a platform strain capable of producing acceptable amounts of the desired product. As a proof-of-concept for the platform’s ability to decorate the chemical scaffold, we expressed the prenyltransferase found in Aspergillus sydowii from experimental case 2. The resulting strain expressed a prenylated version of the demethylated TAN1612. In lack of time, we were not able to conduct any more transformations in the platform. However, in a bioinformatics analysis, we carefully selected fifteen genes from various species to be expressed later. The genes were selected based on either their known tetracycline-interacting functions (e.g., codon-optimized genes from tetracycline pathways in Streptomyces) or as potentially part of a putative BGCs predicted to produce tetracycline (e.g., from unexplored BGCs within the genus Aspergillus).

Page viii Sammenfatning

Sammenfatning

Filamentøse svampe kan producere mange naturprodukter med både gavnlige egenskaber (f.eks. Bioaktive farmaceutiske stoffer) såvel som skadelige stoffer (f.eks. Mykotoksiner). I det sidste årti har mikrobielle sekventeringsprojekter identificeret et betydeligt potentiale for opdagelsen af endnu flere ukendte naturprodukter, hvilket også inkluderer analoger af allerede godkendte lægemidler. Filamentøse svampe, her iblandt slægten Aspergillus, har været en kilde til mange lægemiddelopdagelser, hvor et eksempel er det potente lagemidle lovastatin produceret af Aspergillus terreus. Andre Aspergilli (f.eks. A. fumigatus og A. Flavus) kan derimod inficere frugter, korn og en række andre landbrugsvarer med kræft- fremkaldende, neurotoksiske og immunsvækkende NP’er (f.eks. Aflatoxin). Det er let at forestille sig, at nogle svampestammer både kan producere værdifulde stoffer i gunstige mængder, men samtidig også kan producere skadelige mykotoksiner. Et eksempel er A. niger brugt til produktionen af organiskesyrer, men som i nogle industrielle stammer har vist sig at producere mycotoksiner såsom fumisiner og ochratoxin A.

Den nærværende ph.d. projekt havde til formål at undersøge både et potentielt mycotoxin, tidligere identificeret i svampen Aspergillus aculeatus, samt undersøge slægten Aspergillus for biosyntetiske genkluster, der potentielt kunne være ansvarlige for produktionen af bioak- tive tetracyklinske forbindelser. Tetracykliner er blevet anvendt til behandling af flere syg- domme i mere end 50 år, hvilket inkludere bakterie- og svampeinfektioner, generel inflama- tion og endda kræft. Grund strukturen af disse forbindelser kan relativt let ændres kemisk. En egenskab som flere farmaceutiske virksomheder har udnyttet gennem årene til at udvikle både naturlige, halv-syntetiske og syntetiske derivater til anvendt medicin. Hovedformålet for alle del-projekter i den her Ph.D. afhanling var at anvende og udvikle teknikker til brug af syntetisk biologi til opklaring af pathways, aktivering af gener og gen-manipulering.

I kapitel 3 (Review) gennemgås litteratur om syntetisk biologi udviklet til ekspression af sekundære metabolitter i filamentøse svampe. Dette afsnit fremhæver en bred række af molekylære værktøjer til genteknologi, herunder ekspressionssystemer, genaktivering, CRISPR/Cas9 og biokombinatoriske tilgange til udvikling af sammensatte derivater

Forskningen, der er udført i kapitel 4, karakteriserer et genkluster fra Aspergillus aculeatus, der er ansvarlig for at producere et potentielt mycotoxin, kaldet acurin A. Hybridforbindelsen (NRPS-PKS) ligner meget fusarin C, hvilket er et kendt mycotoxin fundet i flere Fusarium spp. Ved brug af en Aspergillus aculeatus nonhomologous end-joining (NHEJ) mangelfuld stamme var vi i stand til effektivt at slette flere gener ved hjælp af homolog rekombination (HR) i en genetisk målretning strategi. Fra disse data kunne vi fremsætte potentiel biosyn- tetisk pathway. En bemærkelsesværdig observation fra denne undersøgelse er en atypisk genkluster organisation. Generelt er hybridforbindelser med lignende 3-acyl 2-pyrrolinon

Page ix Sammenfatning grund structurer biosynteseret af PKS-NRPS-hybrid enzymer kodet fra et enkelt gen. I genklusteret ansvarlig for biosyntesen af acurin A, kodes disse enzymer fra to forskellige gener. For bedre at forstå denne unikke opdagelse foretog vi yderligere en undersøgelse med 475 forskellige svampearter for at tydeliggøre arv og udvikling af genklusteret. Resultaterne viser, at kun få arter har lignende gen-organisation, og at det for Aspergillus er begrænset til få species indenfor afsnittet Nigri. Så vidt vi ved, er acurin A den første 3-acyl 2-pyrrolinon forbindelse fra filamentøse svampe, der rapporteres som biosyntetiseret af individuelt over- satte PKS- og NRPS-kodende gener.

Hvad angår at finde tetracyklinproducerende genkluster, så udførte vi en forudgående bioinformatiks undersøgelse for at kortlægge potentiale Aspergillus species med interes- sante loci, der kunne producere tetracyklin eller en tetracyklin-lignende forbindelse. Un- dersøgelsen var baseret på tidligere-karakteriserede PKS-sekvenser fra kendte svampe- tetracyklinproducerende genkluster (dvs. viridicatumtoxin B og TAN-1612 fra henholdsvis Penicillium aethiopicum og Aspergillus niger). Flere arter indikerede tilstedeværelsen af potentielle tetracyclin-genkluster. Vi bemærkede dog, at det var udfordrende at skelne mellem ægte tetracyklin og tricykliske genkluster baseret på bioinformatik alene. For at øge vores viden om de små afvigelser, der adskiller disse genkluster, besluttede vi at undersøge et locus, der ved hjælp af bioinformatik var forudsagt til at producere enten tetracycline eller neosartoricin.

I kapitel 5 undersøgte vi et genkluster fra Aspergillus sydowii med homologi til TAN- 1612 klusteret fra A. niger, samt med homologi med et genkluster ansvarlig for produktionen af den tricykliske forbindelse, neosartoricin, fra Neosartorya fischeri. Ved at overudtrykke en potentiel transkriptionsfaktor stimulerede vi stammen til at producere en række forbindelser, som ikke kunne påvises i vildtypestammen. Blandt disse forbindelser fandt vi neosartoricin B, en tricyklisk shuntforbindelse, og et prenyleret tetracyklin i lave koncentrationer. Vi opdagede også en tetracyklinsk forbindelse med en C2-C18-femleddet ringdannelse, som kunne være et direkte nedbrydningsprodukt af det detekterede prenylerede tetracyklin. For at bekræfte forbindelsenes oprindelse, slettede vi først det PKS-kodende gen (JGI: 157033). Overraskende blev alle de ovennævnte forbindelser elimineret fra mutant stammen. Fra det kunne vi konkludere, at genklusteret ikke er udtrykt under normale laboratoriebetingelser, og at klusteret er involveret i biosyntesen af adskillige naturprodukter. For at karakterisere denne komplekse biosyntetiske pathway fuldest optimerede vi en metode, der er baseret på GNPS-molekylære netværks program, til at krydsehenvise forbindelserne fra diverse mutant stammer. Med det kunne vi kategorisere alle involverede mellemprodukter, hvilket yderligere gav os mulighed for at foreslå en omfattende biosyntetisk vej med flere grene understøttet af NMR-verificerede strukturer. Derudover identificerede vi en formodet enzy- matisk tetracyklin-nedbrydningsmekanisme og foreslår en potentiel genkandidat.

Page x Sammenfatning

I kapitel 6 udforsker vi muligheden for at udvikle en platform til biokombinatorisk dekoration af et grundlæggende tetracyklin. Konceptet blev baseret på A. niger TAN-1612 klusterets kernegener til at udtrykke et demethyleret tetracyklin sammenlignet med TAN-1612. To design blev forfulgt for at opnå den ønskede forbindelse. I den første version konstruerede vi en A. niger stamme, hvor kernegenerne (dvs. adaA til -C) blev udtrykt under kontrol af en enkelt stærk promotor med adskillelse med picornavirus selvspaltende konsekvens, P2A. Den resulterende stamme producerede en ny forbindelse med en lignende masse som det ønskede produkt, men med anden retentionstid sammenlignet med standarder inden- for Massspektrometry. Yderligere analyse indikerede et tab af translation vedrørende det sidste gen i P2A-konstruktionen, hvilket resulterede i forkert foldning af den fjerde ring i det demethylerede TAN-1612. For det andet design ændrede vi strategien til en transkrip- tionsfaktor (TF) aktiverende tilgang. Ved at overudtrykke det TF-kodende gene adaR og samtidig eliminere det O-methyltransferase-kodende gen adaD, var vi i stand til at etablere en platformstamme, der er i stand til at producere acceptable mængder af det ønskede produkt. Som et bevis for konceptet og platformens evne til at dekorere grund strukturen udtrykte vi en prenyltransferase, vi tidligere identificerede i Aspergillus sydowii (kapitel 5). Den resulterende stamme udtrykte en prenyleretversion af det demethylerede TAN1612. I mangel på tid var vi ikke i stand til at udføre flere transformationer i platformen. I en bioinformatisk analyse valgte vi dog omhyggeligt femten gener fra forskellige arter, der skal udtrykkes senere. Genene blev valgt baseret på enten kendte tetracyclin-interaktive funktioner (for eksempel kodon-optimerede gener fra tetracyklin-biosynteser i arterne Streptomyces), eller gener fra Aspergillus species genkluster som var forudsagt til at producere tetracyklin.

Page xi Publications

Publications

Submitted papers Acurin A, a novel hybrid compound, biosynthesized by individ- ually translated PKS- and NRPS-encoding genes in Aspergillus aculeatus Peter B. Wolff, Maria L. Nielsen, Jason C. Slot, Lasse N. Andersen, Lene M. Petersen, Thomas Isbrandt, Dorte K. Holm, Uffe H. Mortensen, Christina S. Nødvig, Thomas O. Larsen, Jakob B. Hoof.

Resubmitted to Fungal Genetics and Biology.

Fungal Synthetic Biology Tools to Facilitate Utilization of Sec- ondary Metabolites: Discovery, Heterologous Production, and Biosyn- thesis of Biocombinatorial Compounds Peter B. Wolff, Jakob Blæsbjerg Hoof, Tomas Strucko, Uffe Hasbro Mortensen.

In preparation for re-submission to Natural Product Reports (NPR)

Manuscripts in preparation Genetic Manipulation and Molecular Networking for Biosynthetic Pathway Characterization of Tetracycline-like Compounds in As- pergillus sydowii Peter B. Wolff, Karolina Subko, Sebastian Theobald, Jakob B. Hoof, Jens C. Frisvad, Char- lotte H. Gotfredsen, Mikael R. Andersen, Uffe H. Mortensen, and Thomas O. Larsen

Expression Platform for Biocombinatorial Decoration of a Fungal- derived Tetracycline in Aspergillus niger Peter B. Wolff, Karolina Subko, Benjamin S. Bejder, Jakob B. Hoof, Thomas O. Larsen, and Uffe H. Mortensen.

Page xii Conference contributions

Conference contributions Biosynthesis of acurin A and B, two novel isomeric fusarin C-like compounds from Aspergillus aculeatus Peter P. Wolff, Maria L. Nielsen, Lene M. Petersen, Lasse N. Andersen, Thomas Isbrandt, Dorte K. Holm, Uffe H. Mortensen, Christina S. Nødvig, Thomas O. Larsen, Jakob B. Hoof. Poster presentation, Directing Biosynthesis V, March 2017, Warwick, United Kingdom.

Biosynthesis of acurin A and B, two novel isomeric fusarin C-like compounds from Aspergillus aculeatus Peter P. Wolff, Maria L. Nielsen, Lene M. Petersen, Lasse N. Andersen, Thomas Isbrandt, Dorte K. Holm, Uffe H. Mortensen, Christina S. Nødvig, Thomas O. Larsen, Jakob B. Hoof. Poster presentation, 14th European Conference on Fungal Genetics, February 2018, Haifa, Israel.

Discovery and activation of a tetracycline-like producing gene clus- ter in Aspergillus sydowii Peter B. Wolff, Karolina Subko, Sebastian Theobald, Jakob B. Hoof, Jens C. Frisvad, Char- lotte H. Gotfredsen, Mikael R. Andersen, Uffe H. Mortensen, and Thomas O. Larsen. Poster presentation, 30th Fungal Genetics Conference, March 2019, Pacific Grove, USA.

Expression Platform for Biocombinatorial Decoration of a Fungal- derived Tetracycline in Aspergillus niger Peter B. Wolff, Karolina Subko, Benjamin S. Bejder, Jakob B. Hoof, Thomas O. Larsen, and Uffe H. Mortensen. Poster presentation, 16th Copenhagen Bioscience Conference - discovering natural products, May 2019, Favrholm Campus, Hillerød, Denmark

Page xiii Abbreviations

Abbreviations

A Adenylation ACP Acyl-Carrier Protein acyl-CoA Acyl-coenzyme A AT Acyltransferase BGC Biosynthetic Gene Cluster BLAST Basic Local Alignment Search Tool C Condensation CLC Claisen-like cyclase CRISPR Clustered Regularly Interspaced Short Palindromic Repeats DH Dehydratase DMAPP Dimethylallyl pyrophosphate DNA Deoxyribonucleic Acid E Epimerase ER Enoylreductase FMO FAD-dependent monooxygenase GNPS Global Natural Product Social Molecular Networking HR Homologous Recombination IPP Isopentenyl pyrophosphate KR Ketoreductase KS Ketosynthase LPS Lipopolysaccharid M Methylation Mb Mega base pair MβL Metallo-beta-lactamase MM Minimal Media MRSA Methicillin-resistant Staphylococcus aureus MS Mass Spetrometry MT Methyltransferase NHEJ Non-Homology-End-Joining NP Natural Product NRP Non-ribosomal Peptide NR-PKS Nonreducing PKS OE Overexpression OSMAC One-Strain-MAny-Compounds PCP Peptidyl carrier protein PgpdA Promoter gpdA PKS-NRPS Polyketide Synthase Nonribosomal Peptide Synthetase

Page xiv Abbreviations

PTA Prenyltransferase pyrG1 Orotidine 5’-phosphate decarboxylase R Reductase RIPPs Ribosomally synthesized and post-translationally modified peptides RNA ribonucleic acid RT-qPCR Real-Time quantitative Polymerase Chain Reaction SAHA Suberoylanilide hydroxamic acid SAM S-adenosylmethionine SAT Starter unit ACP SM Secondary Metabolite T Thiolation TC Tetracycline TE Thioesterase TF Transcription factor TtrpC Terminator trpC UV/Vis Ultraviolet/Visual light WT Wild Type YES Yeast Extract Sucrose

Page xv 1. Project motivation and objective

1 Project motivation and objective

Project motivation

Fungal secondary metabolites have an enormous impact on human health, both as beneficial natural products formulated into useful pharmaceuticals (e.g., for battling infectious diseases), but also as contaminating mycotoxins destroying essential crops and commodities worldwide [1]. Large whole-genome sequencing projects have estimated a noteworthy potential of undiscovered natural products in the tremendous number of fungal species investigated so far [2]. With the genomics information available today, it is possible to both identify potential hazards represented by mycotoxin-producing biosynthetic gene clusters (BGCs) (e.g., previously unidentified in industrial applied production strains), and search for novel derivatives of vital bioactive compounds for the development of new drugs. A better under- standing of the genetic machinery behind both classes of compounds could aid in creating safer production strains, as well as develop platform strains for the production of advanced compound derivatives. Fungal polyketide-derived compounds, here among tetracyclines, exhibit potent bioactivities, which makes fungal genome mining an attractive reservoir in the search for derivatives of these privileged scaffolds [3]. Tetracyclines can be applied as highly effective broad-spectrum antibiotics against both Gram-positive and -negative bacteria. However, as a result of clinical misuse and extreme overspending in the agriculture section, among others, the world is now experiencing an antibiotic bacterial resistance crisis [4]. More often do physicians encounter patients infected with so-called "superbugs," which now requires much more powerful methods to battle these once-treatable infections [5]. From these perspectives, one can easily imagine that among the unexplored fungal strains, some could have the ability to produce a novel tetracycline vital to public health, or that combining tailoring-enzyme activities from experimental verified tetracycline pathways can result in novel structures unseen in nature. On the other hand, many fungal species of interest to the industry could produce undiscovered mycotoxins. Identifying and elucidating the pathways of these hazardous compounds could contribute raise more awareness of the risks involved, as well as aid in solving the problem.

Project objective

The overall objective of the work presented in the present thesis was to use and develop synthetic biology tools to investigate both the genetics behind a potentially dangerous my- cotoxin identified in the industrial strain Aspergillus aculeatus and at the same explore the genus Aspergillus for the potential of valuable drug candidates. In perspective of the latter, the project focused on the polyketide-derived tetracycline-class since only a few fungal- derived tetracyclines are characterized, and filamentous fungi are known for having a range of compound derivatives founded on comprehensive tailoring-enzyme activities.

Page 1 1. Project motivation and objective

The specific aims are addressed in the separate cases, as follows:

Review (Chapter 3): Provides an overview covering literature on synthetic biology, bio- combinatorial approaches for the development of bioactive derivatives in filamentous fungi, as well as optimization of fungal cell factories. Many of the techniques described here are used throughout the project

Experimental case 1 (Chapter 4): After the identification of a polyketide non-ribosomal peptide hybrid compound in Aspergillus aculeatus, highly resembling the mycotoxin fusarin C from various Fusarium sp., we aimed to locate the BGC and elucidate the biosynthetic pathway. The study revealed an atypical gene cluster composition with separated PKS- and NRPS- encoding genes responsible for the production of the hybrid compound. To fully understand the genetics of the BGC, we further investigated the inheritance and evolution among several fungal species.

Experimental case 2 (Chapter 5): Identifying a specific compound structure based solely on genomics data can be complicated. In order to better assist in the identification of po- tential tetracycline-producing BGCs, we aimed to elucidate a BGC expected to produce a tetracycline-like compound fully. The investigation in this chapter describes how a small silent BGC from A. sydowii can be activated, and how to combine molecular networking data from several mutant strains to achieve strong evidence for a pathway with more than one branching point.

Experimental case 3 (Chapter 6): Here, we describe the development of a platform in A. niger for biocombinatorial biosynthesis of novel tetracycline derivatives. By modifying functional groups of a relevant tetracycline scaffold, through heterologous expression of tailoring-enzyme encoding genes from close-related pathways, the goal was to increase the portfolio for fungal tetracyclines. We aimed to identify the relevant genes for heterologous expression in the genus Aspergillus through the available applications for BGC recognition (e.g., fungal antiSMASH) together with a further validation based on the experience gained from the previous study (experimental case 2).

Page 2 1. Project motivation and objective

References

[1] V. Meyer, M. R. Andersen, A. A. Brakhage, G. H. Braus, M. X. Caddick, T. C. Cairns, R. P. de Vries, T. Haarmann, K. Hansen, C. Hertz-Fowler, S. Krappmann, U. H. Mortensen, M. A. Peñalva, A. F. J. Ram, and R. M. Head, “Current challenges of research on filamentous fungi in relation to human welfare and a sustainable bio-economy: A white paper”, eng, Fungal Biology and Biotechnology, vol. 3, no. 1, pp. 6, 6, 2016, ISSN: 20543085. DOI: 10.1186/s40694-016-0024-8. [2] H. Nordberg, M. Cantor, S. Dusheyko, S. Hua, A. Poliakov, I. Shabalov, T. Smirnova, I. V. Grigoriev, and I. Dubchak, “The genome portal of the Department of Energy Joint Genome Institute: 2014 updates”, 2014. DOI: 10.1093/nar/gkt1069. [On- line]. Available: http://genome.jgi.doe.. [3] I. Chopra and M. Roberts, “Tetracycline Antibiotics: Mode of Action, Applications, Molecular Biology, and Epidemiology of Bacterial Resistance”, Microbiology and Molecular Biology Reviews, vol. 65, no. 2, pp. 232–260, 2001, ISSN: 1092-2172. DOI: 10.1128/mmbr.65.2.232-260.2001. [Online]. Available: http://mmbr. asm.org/. [4] T. H. Grossman, “Tetracycline antibiotics and resistance”, Cold Spring Harbor Perspectives in Medicine, vol. 6, no. 4, Apr. 2016, ISSN: 21571422. DOI: 10.1101/ cshperspect.a025387. [5] G. D. Wright, “Resisting resistance: New chemical strategies for battling superbugs”, eng, Chemistry and Biology, vol. 7, no. 6, R127–R132, R127–R132, 2000, ISSN: 18791301, 10745521. DOI: 10.1016/s1074-5521(00)00126-5.

Page 3 2. Background

2 Background

Biology and chemistry

The fifth kingdom

The kingdom of fungi or the fifth kingdom in the tree of life consists of a vast amount of eukaryotic species divided into several phyla, classes, orders, families, and genera, see figure 1. In 2017 it was estimated that only 3% to 8% of an expected 2.2 to 3.8 million fungal species had been cataloged and named [1]. Many of the known fungal species have had an beneficial impact on human life and the enormous amount of expected species to come offers even more potential for future valuable discoveries. The known part of the fungal kingdom is highly diverse and covers all from eatable mushrooms to deadly human pathogens. They are nearly found in any corner of the earth, and even space is no exception with species of filamentous fungi being isolated from the International Space Station (ISS) [2].

The subdivision for the fungal kingdom is required based on the enormous diversity within the kingdom. Many fungi are known as decomposers, because they get their energy by breaking down dead plant material, which makes them incredibly important for the ecosys- tem. Others are parasites and pray on animals and human. Some are recognizable by their large fruiting bodies, and others grows in the form of multi-cellular filaments (e.g., mould). The filamentous fungi are likewise subdivided, and further into the taxonomy of the fungal kingdom appears a family called Trichocomaceae. Within this family are fungal genera like Penicillium, Talaromyces, and Aspergillus. The most famous filamentous fungus is probably Penicillium notatum due to the discovery of penicillin in this fungus in 1928 by Alexander Fleming [3]. However, the genus of Aspergillus contains numerous industrial relevant strains, as well as laboratory organisms, and moreover contains an immense amount of unexplored species. For the scope of the present Ph.D. thesis, the focus will be on the genus Aspergillus.

Figure 1 - The super taxonomic classes for Aspergillus. The Aspergillus genus holds more than 300 species divided into several sections and subgenera based on phylogenetic studies. The genus includes food spoilers, human pathogens, industrial work strains, and model strains for, e.g., cell biology research [4].

A common feature for Aspergilli is their ability to reproduce asexually with the formation of conidia, also known as conidiospores. Some species can also undergo sexual reproduction, just as parasexual reproduction additional has been proved in some species [5] . The asexual haploid conidia formation happens through a vegetative growth phase with the development

Page 4 2. Background of a conidiophore stalk. In the case of Aspergillus nidulans can each stalk harbor more than 10.000 conidia, with each spore/conidia having the capacity of colonize new media and develop new conidia within 10h when the right conditions are in place [6]. The massive amounts of conidia produced per colony fitly add to the fact that Aspergilli are among the most abundant fungi in the world. In this regard, Aspergilli impact human life in almost every aspect, from food, feed, and agriculture, as well as being the cause of deadly diseases.

The Aspergillus genus, with all its species, has a huge potential to produce a widespread of chemical diverse secondary metabolites (SMs). SMs are small organic molecules associated with a comprehensive variety of biological activities, many of human interest and concern, such as mycotoxins. SMs are not required for growth but contribute to valuable benefits in the competition against other organisms in their environment. Moreover, secondary metabolites are also thought to be involved in virulence, mineral uptake, and communication between fungi [7].

In the agriculture section, millions of dollars are each year spent on evasive actions to avoid contamination by mycotoxins, of which the carcinogenic aflatoxin is a significant concern [8]. The species Aspergillus fumigatus and Aspergillus flavus continue to invade im- munosuppressed patients and cause the life-threatening condition known as Aspergillosis [9]. In a more fruitful aspect, Aspergillus oryzae and Aspergillus sojae are used for fermentation of soybeans, rice, grains, and potatoes for the production of various products like soy sauce, bean paste (miso), as well as other traditional Japanese commodities including the alcoholic beverage sake [10]. From a biotechnological point of view, the production of citric acid in Aspergillus niger, initiated over 100 years ago by James Currie, stands out as an example of how superior filamentous fungi can be for the production of useful compounds [11]. The pharmaceutical company Pfizer established the process in 1923; in 2019, it was considered the world’s largest pharmaceutical company [12].

The most important discovery regarding a pharmaceutical compound isolated from an Aspergillus is mevinolin, also known as lovastatin produced by Aspergillus terreus. The compound is a potent antagonistic inhibitor of 3-hydroxy-3-methylglutaryl-coenzyme A reductase and can, therefore, decrease the cholesterol levels in hypercholesterolemia patients [13]. Lovastatin was discovered in 1979 and commercially sold since 1987. Statins are estimated to be the largest selling class of drugs, with cumulative sales of over 150 billion dollars [14], [15]. Countless SMs have been isolated from Aspergilli through the last 50 years, and discoveries continue. Moreover, several fungal DNA sequencing projects in Aspergilli are showing genetic evidence for silent and still undiscovered SM biosynthetic genes clusters (BGCs) [16].

Page 5 2. Background

From genes to natural products

Aspergillus nidulans has played an essential part in genetic research and serves as an ex- perimental model for a large number of other Aspergillus species due to their relatively similar genomes [17]–[19]. Scientific research papers on cell biology and gene regulation using Aspergillus nidulans dates back to more than 50 years [20], [21], and the organism has undoubtedly contributed significantly to a better understanding of the fundamental concepts of genetics.

Aspergillus nidulans has a modest genome size (approximately 31 Mb [22] ), which is relatively easy to modify. The genome consists of eight well-categorized chromosomes in sizes from 2.8 Mb to 4.4 Mb harboring roughly 11.000 to 12.000 genes. In a recent study investigating inter- and intraspecies variation of the Aspergillus section Nigri, it was found that the average number of genes per species in that specific section was about 11.900 [23]. In perspective, the whole-genome sequenced strains of A. flavus, A. nidulans, A. oryzae, and A. niger, holds on average, 60 genes predicted to encode SM synthases or synthetases [24]–[26].

In 2005, the Broad Institute of MIT and Havard released the first genome sequence of Aspergillus nidulans with annotation of predicted genes using a combination of various available gene models [27]. Since then, the development of better and faster bioinformatics tools has improved the process of analyzing genomes and categorize genes by predicted functions. An increasing number of Aspergillus species have following been whole-genome sequenced under different projects with the ambition of completing the entire genus. More than 300 species of Aspergilli are currently known [4], and over 100 whole-genome se- quences are publicly available through "The genome portal of the Department of Energy Joint Genome Institute [28]. The many whole-genome sequences have led to a more extensive understanding of the Aspergillus genus. E.g., the evolution of the genus has been studied through comparative genomics providing new insights into the accurate identification of species boundaries [29].

A distinct feature among many microorganisms, including filamentous fungi such as As- pergilli, is the physical clustering of genes related to the same SM biosynthetic pathway. These Biosynthetic Gene Clusters (BGCs) contains two or more genes, commonly with one gene encoding an enzyme for the formation of the core structure of the SM and addition- ally genes encoding enzymes for chemical decoration or modification [30], [31]. Besides the apparent genes encoding enzymes catalyzing product formation, additional genes for regulation, transportation, and self-resistance are often included in the BGC [31], [32]. The chemical diversity and dynamics of secondary metabolism between Aspergilli in the section Nigri have been studied by analyzing the genomes for SM BGCs, and subsequently dividing them into chemical families based on the predicted outcome. It was shown that each species,

Page 6 2. Background on average, hold 8.75 unique SM clusters, regardless of the close phylogenetic distance of the section [23]. Numerous studies on Aspergilli SM BGCs prove that the potential for discovering novel compounds through using bioinformatics and a synthetic molecular approach exceeds by far the classical approach (i.e., crude extract screening of wild type strains using UV detection and MS) [33], see figure 2. In that context, filamentous fungi including the Aspergillus species holds prominent potential as a reservoir for SM genome mining, and several accessible online tools have been developed for that purpose. E.g., the web-based Secondary Metabolite Unique Regions Finder (SMURF) [34] and antiSMASH fungal version [35] can predict SM BGCs and compare them to familiar BGCs for a more straightforward evaluation.

Figure 2 - The classical approach vs. the bioinformatics approach. 1 The classical approach combines the cultivation of wild-type fungal strains with external activators (e.g., media variation, bacterial co-cultivation, or chemical modifiers). Genes and BGCs are activated on a global level without direct knowledge of the SM output. Screening of crude extract can expose novel compounds, and a putative biosynthesis can be predicted through structural elucidation. BGCs can then be predicted and confirmed through e.g., gene deletion. 2 The bioinformatics approach takes advantage of whole-genome sequences in combination with gene recognizing algorithms in silico. Potential SM BGCs can be identified through alignment to validated genes responsible for the production of known SMs. Genetic strain modification can directly interact with the target BGC for the production of a specific SM. 3 The synthetic molecular toolbox can be applied in both approaches. For most parts are the molecular tools applied at the end of the classical approach and vise versa in the bioinformatics approach.

A more in-depth analysis of a SM BGC can reveal different kinds of information on the predicted SM compound. The core gene structure for a specific pathway can be analyzed, and the general domain architecture of the related protein/enzyme can be uncovered, and hence, a compound class can be proposed [36]. As with all living organisms, the fungal kingdom follows the central dogma for molecular biology, and with that, DNA is transcribed

Page 7 2. Background into mRNA and further translated to protein, forming the necessary enzymes for natural product biosynthesis. Without going into details of alternative splicing, the domains of a core protein can be interpreted directly from the nucleotide sequence of a pathway gene. In addition to the online tools described above, several tools for domain search are likewise available, and several databases with immediate BLAST options can predict a compound class through a comparison of validated genes linked to known proteins. Adjacent to the core genes are often genes encoding tailoring enzymes. These can further be analyzed for familiar domains and functions; hence, their role in the biosynthesis of a given SM can be elucidated at a theoretical level. However, to prove a predicted gene function and the specific role of an enzyme can commonly only be solved through molecular research. Linking a compound to a specific BGC has been achieved through gene deletions, heterologous expression of entire or partly pathways in suitable hosts, or by overexpression of regulatory elements embedded in the BGC [16]. The latter can be necessary as many BGCs are not expressed under standard laboratory conditions, for more information on BGC activation, please see chapter X). Another approach to stimulate gene activation is the OSMAC approach, (i.e., One Strain MAny Compounds). Here, different strategies are applied to force the strain to produce SMs under various scenarios, e.g., co-cultivation, altering cultivation parameters, and addition of enzyme inhibitors [37].

The biosynthesis of natural products

The Aspergilli SM BGCs are responsible for the formation of different classes of compounds sorted by the nature of the core enzyme(s) encoded by genes in the cluster. Secondary metabolism acquires molecular starter units originating from the primary metabolism, and based on these building blocks, the classes can be defined; Polyketides (PK), in most cases in fungi, utilize acetyl-CoA as the starter unit and use malonyl-CoA as the extender units for building backbone structures. Nonribosomal peptides (NRP) are derived from amino acids, both proteinogenic and non-proteinogenic. In terms of terpenes, the starter units are isopen- tenyl pyrophosphate (IPP) or dimethylallyl pyrophosphate (DMAPP) [38]. All these starter units originate from the primary metabolism as e.g., carbohydrates, generally as glucose, and go through conventional primary metabolic pathways before entering the secondary metabolism. The glycolysis provides the most substantial volume of building materials for SM biosynthesis since the key intermediate pyruvate can be converted to acetyl-CoA. Acetyl-CoA can then either directly be utilized by polyketide synthases (PKSs) or further go through the mevalonate pathway to form IPP [39]. Many amino acids are also derived from pyruvate, both directly (e.g., alanine, leucine, or valine) or through the citric cycle via the connection of acetyl-CoA. Others, the aromatic amino acids, are generated in the shikimate pathway with pre-steps via the pentose phosphate pathway or glycolysis (i.e., through phosphoenolpyruvate)[40].

SMs can derive from a single starter unit class, as with PKs, NRPs, or terpenes, but classes

Page 8 2. Background can also be of a mixed biosynthetic origin (e.g., PKS-NRPS hybrids, meroterpenoids, and indole alkaloids); for an illustration of the relationship between starter units and compound classes, please see figure 3.

Figure 3 - Compound classes based on the starter unit origin. The illustration, from outside in, depictures examples of different classes of secondary metabolites based on the synthases/synthetases responsible for assembling them. In the case of polyketide synthases (PKS) and terpene synthases (TPSs) or terpene cyclases (TCs) are the most common starter units and extender units included (i.e., acetyl CoA, malonyl CoA, and isopentenyl pyrophosphate (IPP), dimethylallyl pyrophosphate (DMAPP), respectively). The outer ring represents the core enzymes responsible for the biosynthesis of the natural product. Hybrid classes share boundaries with their respective synthases or synthetases, except for indole-alkaloids (arrows are drawn to bypass RiPPs and phenolics, two groups based on amino acids alone). The second ring from the outside represents the most common starter units used as the substrate for the core enzymes. * symbolizes deamination of the aromatic amino acids L-phenylalanine and L-tyrosine originating from the shikimic acid pathway. The ring second to the center represents an intermediate in the pathway for the starter unit. The center of the illustration assigns glucose as a possible precursor for all the above.

Terpene cyclases in Aspergilli are by far surpassed by the number of both NRPSs and PKSs found in the genus [23]. However, natural products derived from these cyclases show a noticeable degree of structural diversity with many of pharmacological interest [41]. More-

Page 9 2. Background over, a common characteristic of terpenes is their ability to function as fragrances, flavoring agents, and preservatives [42]. In comparison, other biosynthetic classes have a much larger repertoire of synthases/syntheases represented in the fungal genomes [23]. However, the relative low selection of terpene synthases available are still able to generate a considerable amount of bioactive compounds with human interest for a widespread use [43].

Terpenes are grouped based on the number of C5 units (IPP or DMAPP) that are used to biosynthesize the individual type of terpene; C10 monoterpenes, C15 sesquiterpenes, C20 diterpenes, C25 sesterterpenes, and C30 teriterpenes etc. The biosynthesis happens in a head-to-tail or tail-to-tail manner to form the various structures, see figur 4 [44].

Figure 4 - Biosynthesis of terpenes. IPP or DMAPP are often described in a "head" or "tail" fashion, whereas "head" represents the end of the molecule closest to the β-carbon. Here illustrated the "head-to-tail" and the "tail-to-tail" assembly. Moreover, the "head-to-head" assembly is also an option (not shown).

Terpenes can also function as decorative chemical groups to other compound classes, e.g., PKs and NRPs. The enzymes facilitating prenylation are named prenyltransferases and have the capability to attach one or more isoprene units to other chemical backbones such as aromatic polyketides [45]. PK/terpene hybrid compounds or meroterpenes are a profoundly compelling group of SMs combining both PKs and terpenes (e.g., fumagillin, a potent antibi- otic used in human medicine and apiculture, see figure 3) [46].

Shikimic pathway derived compounds are only known from plants and microorganisms. Here key C6C3 -precursors are obtained through the phenylpropanoid pathway with the elimination of ammonia in the aromatic amino acids L-phenylalanine and L-tyrosine, re- sulting in cinnamic acid and 4-coumaric acid, respectively. In plants are these precursors used for the formation of several SMs (e.g., lignin monomers, flavonoids, and stilbenes) [47][dewickbook]. The deamination step in the phenylpropanoid pathway is catalyzed by phenylalanine ammonia-lyase (PAL), an enzyme also found in multiple Aspergillus species [48].

Ribosomally synthesized and post-translationally modified peptides (RiPPs) or ribosomal natural products are compounds derived from the protein synthesis based on a structural gene. Newly synthesized peptides, typically 20–110 residues in length, can be recognized

Page 10 2. Background by the post-translational modification enzymes to assist in the formation of the end product [49]. RiPPs in Aspergillus is a relatively newly discovered class, with only a few compounds reported [50], [51]. However, bioinformatics research indicates a much higher potential [52].

Nonribosomal peptide synthetases (NRPSs) in the Aspergillus genus are structurally or- ganized in domains grouped as single modules. Each module can recognize and attach a particular amino acid to a growing peptide chain. The domain organization in a minimal module includes adenylation (A), thiolation (T) or peptidyl carrier protein (PCP), and con- densation (C) domains [53]. The amount of modules in the synthetase governs the elongation of the NRP. A C-terminal thioesterase (TE) domain administers the release of the synthesized peptide. Besides the use of a large variety of amino acids to contribute to the chemical diversity of NRPs, biosynthesis can additionally link in a linear or cyclic order. From here, the NRPs can undergo modifications by tailoring enzymes encoded in the BGC. The A domain controls the selection of a specific amino acid, which then is transferred to the following catalytic domains by a 4’-phosphopantetheine cofactor prosthetic group attached to the PCP domain through a conserved serine residue. The C domain is responsible for the peptide-bond formation between each amino acid, or in case of hybrid systems, the link between the chemical structures (e.g., the attachment of homoserine to the PK part in fusarin C [54]. Additional optional domains can appear in NRPS; epimerase (E) domains can convert L- to D- amino acids, methylation (M) domains can N-methylate residues, and oxidation domains can oxidize individual residues during elongation.

Numerous NRPs have been isolated from fungi. In general, many of which have been formulated into valuable pharmaceuticals. Penicillin G from Penicillium chrysogenum uses a three-module NRPS to form the tripeptide intermediate of the three-enzymatic step pathway [55], see figure 5. In Tolypocladium niveum, an NRPS catalyzes biosynthesis of the impor- tant immunosuppressive drug cyclosporin used in organ transplants, among others [56]. In Aspergillus nidulans, several NRPSs and hybrid systems of NRPs have been identified, e.g., siderophores and aspyridone [57]–[59].

Figure 5 - Domain structure of an NRPS. The penicillin G NRPS consists of three modules responsible for the fusion of three amino acids. Each module contains an adenylation (A) domain for selecting a specific substrate and a condensation (C) domain for the peptide-bond formation. The C-terminal of the synthetase holds a thioesterase (TE) domain that controls the release of the SM intermediate.

Page 11 2. Background

Polyketides synthases (PKS) are evolved from fatty acid synthases (FAS) but differ in essential vital points. Both use the same approach for elongation through a repetitive de- carboxylative Claisen thioester condensation. However, PKSs can produce various chain lengths, have a broader selection of biosynthetic building blocks, but most significantly can have an optional reductive step after each elongation [60]. PKSs can be non-, partially-, or highly reducing (i.e., NR, PR, or HR respectively), wheres FASs usually are fully reduced. PKs are quite distinguished in chemical structure and have a wide range of bioactivities, and the class is even considered to be the most important of SMs [61]. PKs can be released from the enzyme in both linear and aromatic form, the latter can use aldol condensation for internal ring formation often performed by a product template (PT) domain. In some cases when needed, the ring formation is accompanied by keto-enol tautomerization to conjugate the chemical structure [47]. For more on the aromatic PK ring formation, please see below in "Pathways - TAN-1612, figure 8".

The structural composition of PKSs is highly diversified and can be classified into three cate- gories; PKS type I, II, and III. In summary, the PKS type I is represented by two subgroups, the modular type I and the iterative type I. The modular type I is mainly found in bacteria and is by its name a multifunctional enzyme divided into modules responsible for each elongation step with optional reduction. The iterative type I is predominantly found in fungi and is likewise a multifunctional enzyme. However, the domains are not divided into modules but are reused throughout the entire biosynthesis. In contrast to the modular type I PKS, the structural organization of the domains in the iterative type I PKS makes it hard to predict the chain length and the degree of reduction of a given PK. The type II PKS is also considered as an iterative enzyme, but, is a complex composed of smaller individually functional enzymes. These enzyme complexes are only found in bacteria. The type III PKSs are organized as homodimers with a domain structure for iterative elongation. They are initially found in plants, but bacteria and fungi are also included with several newly discoveries in Aspergilli [60], [62], [63].

The scope of the present Ph.D. thesis is the investigation of the biosynthesis of tetracy- clines in the genus Aspergillus. In this connection, the further focus will be on the fungal iterative type I PKS found to be responsible for the synthesis of the tetracycline backbone structure in fungi.

The domain structure of fungal iterative PKSs are encoded from single genes, usually embedded in a BGC. However, to be fully functional, the enzymes require a phosphopanteth- eine (PPT) prosthetic group bound to a conserved serine in the acyl carrier protein (ACP) domain. In Aspergillus nidulans, it has been shown that a single phosphopantheteinyl trans- ferase (PPTase) is responsible for the attachment of PPT to several PKSs and that deletion of the specific PPTase encoding gene results in the abolishment of numerous PK compounds

Page 12 2. Background

[64]. The ACP domain is part of the carrier system between active sites of the growing chain. In the initiation of the PK synthesis, the enzyme is primed with acetyl CoA in the β-ketosynthase domain (KS), or starter acyl transferase (SAT) domain in NR-PKSs [65]. Malonyl CoA is loaded into the acyl-transferase (AT) domain and carried to the KS domain. Here a Claisen condensation reaction catalyzes the elongation driven by a decarboxylation [66].

In the reducing iterative PKSs, the optional domains of ketoreductase (KR), dehydratase (DH), and enoyl reductase (ER) can reduce the ketone group to a hydroxyl group, an enoyl group, or an alkyl group respectively. Other optional domains can be available depending on the reductive nature of the enzyme; NR-PKSs can hold product template (PT) domains capable of cyclization to form complex ring structures [67], methyltransferase (MT) domains can also be embedded in the protein responsible for C-methylation of the backbone by utilizing S-adenosylmethionine (SAM) as seen in fusarin C produced by several Fusarium sp. [54], [68].

Once the PK chain length is reached and additionally biosynthetic steps have been achieved, the product is released through a chain-release domain. Most iterative PKSs possesses a C-terminal Claisen-like cyclase (CLC) or thioesterase (TE) domain that initiates the product release. Some PKSs mediate product release by a reductase (R) domain, and some PKSs lack a release mechanism entirely. In these cases, biosynthetic tailoring enzymes typically assist in the release of the product [66]. For a schematic of an iterative PKS, see figure 6.

Page 13 2. Background

Figure 6 - A proposed structure for a fungal iPKS. The illustration depictures a proposed structure of an iterative PKS type 1. From top: Minimal domains necessary for the selection of starter/extender units and further release of the elongated polyketide (PK). Middle: The ACP domain with the attached phosphopantheteinyl (PPT) prosthetic arm accountable for the transfer of the elongating PK between domains. Bottom: Optional domains for reduction and methylation. The product template domain for ring formation is not shown. Surrounding the iPKS is examples of known fungal polyketides. (Inspiration [65])

Pathways

Tailoring enzymes play an essential role in chemical diversity and hence, impact the bioactiv- ity magnitude of pharmaceutical compound candidates and the degree of the damaging effect of mycotoxins, and so forth. Together with the core synthases/synthetases, they provide the framework for the biosynthetic pathways necessary for the majority of natural products. An increasing number of bioinformatics studies are progressively identifying SM BGCs in numerous fungal species and with that, predicting more putative tailoring-enzyme encoding genes. These gene predictions are helpful tools in the elucidation of pathways and for the identification of potential derivatives of established compound classes with more. A better understanding of the SM biosynthetic pathways and the connection to the genomic informa- tion can link compounds to their respective BGCs, which opens up for further possibilities, e.g., full elucidation of crucial natural product pathways, compound elimination for safer pro- duction strains, as well as for combinatorial engineering purposes. The following describes three crucial SM pathways based on their enzymatic steps.

Penicillin G is a well-known antibiotic isolated first in Penicillium notatum. However, later also discovered in Penicillium chrysogenum and the model organism Aspergillus nidulans. The pathway has been elucidated in both organisms and has revealed an NRPS based pathway with three enzymatic steps. In A. nidulans is the first step, the backbone biosynthesis of a tripeptide intermediate using three amino acids (i.e., L-α-aminoadipic acid, L-cysteine,

Page 14 2. Background and L-valine), carried out by the core NRP synthetase (AcvA) through an ATP consuming reaction. An internal thioesterase activity part of the NRPS releases the intermediate from the enzyme. Second, a synthase called isopenicillin N (IpnA) is responsible for the formation of the characteristic beta-lactam ring via an oxidative step. The intermediate isopenicillin N has shown antibiotic activity and can function as precursors for penicillin derivatives [47]. The third and last step is the conversion to penicillin G. This is accomplished with the AatA enzyme that poses two catalytic functions, a ligase, and an acyltransferase. The enzyme cleaves the L-α-aminoadipic acid side chain of isopenicillin N and replaces it with a phenylacetic acid. Hence, the reaction needs phenylacetic acid in an active form as a substrate. The genes encoding AcvA, IpnA, and AatA are all clustered together in the genome [58], [69]. For an illustration of the pathway step by step, please see figures 5 and 7.

Figure 7 - Penicillin G pathway post-release from the NRPS (AcvA). The β-lactam ring formation resulting in isopenicillin N is based on the oxidation of the NRPS released product. The final penicillin G is obtained through an exchange of the L-α-aminoadipic acid side chain with phenylacetic acid.

TAN-1612 belongs to the chemical class of tetracyclines. An iterative type 1 PKS biosynthe- sizes the polyketide core structure. The compound is found and investigated in Aspergillus niger, and the BGC (ada) has been described to contain a total of five genes. Besides the core-structure PKS encoding gene (adaA), the cluster also includes genes encoding a Metallo- β-lactamase (adaB), a Flavin-dependent monooxygenase (adaC), an O-methyl transferase

(adaD), and a pathway-specific Zn2Cys6 family transcription factor (adaR). The PKS belongs to group V of non-reducing PKSs, which is characterized by the lack of a release domain. This task is commonly carried out by tailoring enzyme activity. In the case of TAN-1612, the assignment of compound release falls to the Metallo-β-lactamase (AdaB), which contains a TE/CLC domain. The domain structure for the NRPKS holds; a SAT domain for selection of starter units (i.e., acetyl CoA), a KS domain responsible for the elongation of the polyketide chain using malonyl CoA, an AT domain assisting in the transfer of the extender units, a prod- uct template domain completing the folding of three out of the four characteristic rings found in tetracyclines, and an ACP domain part of the carrier system. The Metallo-β-lactamase (AdaB) folds the fourths ring during the release of the intermediate. However, before the fold of the last ring is possible, the Flavin-dependent monooxygenase (AdaC) most establish a C2-hydroxylation that may be essential for the Claisen cyclization. After the release of the tetracycline intermediate, the O-methyltransferase (AdaD) methylates the hydroxyl group on

Page 15 2. Background

C9 using S-adenosylmethionine (SAM) as a donor to complete the biosynthesis of TAN-1612 [70], see figure 8.

Figure 8 - TAN-1612 biosynthesis. Purple: The iterative NRPKS type 1 (AdaA) utilizes a single acetyl CoA and nine malonyl Coa extender units for the elongation towards the decaketide (C20) backbone. Green: The PT domain assists in the intermolecular aldol condensation. Step 1, the first C6-C11 ring formation, is initiated by alkaline deprotonation of an α-hydrogen on C6, resulting in a carbanion. Step 2, the carbanion attacks the carbonyl group on C11 following a rearrangement of the electrons to the oxygen. Step 3, single bond formation is established between C6-C11, and regeneration of the hydroxide catalyst using water. Step 4-6, the hydroxide can grab the remaining α-hydrogen on C6, creating a new carbanion while simultaneously expelling water. The double bond formation is established in the regeneration of the hydroxide. Blue: Keto-enol tautomerization conjugates the polyketide ring formation. Step 7-9, the enolization is assisted in an acidic step to generate a double bond. Step 10, the PT domain is responsible for the ring formation, and conjugation of ring D and C (C4-C13). Ring B (C2-C15) is assumed to undergo formation spontaneously. Step 11-12, the flavin-dependent monooxygenase (AdaC) adds a hydroxyl group to C2 before the release and cyclization of ring A (C1-C17) performed by the metallo-β-lactamase (AdaB). The last step is conducted by the O-methyltransferase (AdaD) to yield TAN-1612. [47], [70]

Page 16 2. Background

Fusarin C is a mycotoxin of PKS-NRPS hybrid origin produced by several Fusarium species. The main enzyme is a PKS fused with a single modular NRPS. The PKS domain structure includes KS, AT, DH, KR, ACP, and a C-methyltransferase, but lacks a release domain at the end of the PKS part. Fungal PKS-NRPSs often lack an intact enoyl reductase (ER) domain, and most, therefore, rely on a trans-acting ER to mediate full β-keto processing [71]. The NRPS part of the hybrid holds C, A, T, and R domains, with the A domain responsible for selecting homoserine as a substrate. The proposed biosynthesis is likely to start with an acetyl CoA starter unit followed by six elongation steps using malonyl CoA as extender units. The C-methyltransferase domain is responsible for four C-methylations during the biosynthesis of the PK part, which uses SAM as the methyl group donor. The PK intermediate is then transferred to the NRPS condensation domain via the linkage of the ACP domain before it is fused with homoserine. The release of the compound from the enzyme complex is next thought to go through a cyclization using the reduction domain of the NRPS part. The resulting compound, named pre-fusarin C, is following subjected to an epoxidation, oxidation of a methyl group before further O-methylation, and a hydroxylation, see figure 9 for more details. Several of the enzymes in the pathway are yet to be identified before a full elucidation of the biosynthesis of fusarin C can be reported [54], [72].

Figure 9 - Fusarin C biosynthesis. The PKS/NRPS-encoding gene fus1 is responsible for the core enzyme able to synthesize and fuse the polyketide to the homoserine residue. While several enzymatic steps in the following pathway are unclear, intermediates have been identified in deletion strains of fus2, fus8, and fus9. Fus2 is required for the formation of the pyrrolidone ring and might be involved in further oxidation and epoxidation. Fus8 oxidizes C20 to form the carboxylic acid group, which is O-methylated by Fus9 [72].

Page 17 2. Background

Tetracyclines

The main focus of the present Ph.D. thesis is a genomics-driven discovery and following pathway characterization of polyketide-derived compounds from the genus Aspergillus. The focus fall on the aromatic compounds, tetracyclines, based on their interesting bioactivities and diversities. However, tetracyclines are not a new class of compounds; they have been known for more than 70 years and belong to a group of natural products discovered in the so- called "Golden Age" of antibiotics spanning from the 1940s to 1960s [73]. Tetracycline was first introduced to the market in 1948 after Benjamin M. Duggar isolated an organism from a soil sample, Streptomyces aureofaciens, with the ability to produce chlortetracycline[74]. The compound is still in use today and sold under the name Aureomycin. Soon after the discovery of chlortetracycline came oxytetracycline, a molecule isolated from Streptomyces rimosus only deviating by the absence of a C7 chlorine atom and an additional C5 hydroxyl group, see figure 10. Together with a dechlorinated version of chlortetracycline, namely tetracycline, these compounds became known as the first generation of tetracyclines. In the second generation, semi-synthetic compounds emerged based on the first generation scaffold, especially oxytetracycline. In this group are essential therapeutics, such as doxycycline and minocycline, both commonly used for the treatment of bacterial infected acne[75]. The third generation is referred to as the synthetic tetracyclines with chemical modification added to the scaffold of minocycline. The group includes the vital compound tigecycline introduced in 2006 and used against Gram-positive antibiotic-resistant bacteria, including methicillin-resistant Staphylococcus aureus (MRSA)[76]. When it comes to the discovery of antibiotics, in general, is the number of novel compounds with antibacterial properties originating from the bacterial genus Streptomyces dominant. Despite the fact that penicillin was the first antibiotic on the market and isolated from Penicillium species, only a few tetracyclines derived from filamentous fungi are known today[45], see figure 10 for examples of different generations of tetracycline including fungal derived.

The need for effective antibiotics to treat severe bacterial infections is vital to modern medical care, and due to an increasing number of resistant bacteria identified, is the development of more potent compounds, ideally with different resistance patterns, a necessity. Roughly 42 new antibiotics were in clinical development worldwide as of June 2018, and of these were five tetracyclines[77]. Based on the current pipeline, and with an estimated low success rate of approximately 12 percent for an antibiotic to go from Phase I to market, only one new tetracycline can be expected to be commercialized. Another barrier to the development of new and efficient antibiotics is the cost, estimated at around e700 million to e1.1 billion, which makes it difficult for pharmaceutical companies to earn a profit, particularly if some antibiotics are kept as reserves[78]. From a tetracycline point of view, the future seems bright as alternative uses emerge in literature, e.g., doxycycline and minocycline have shown anti-apoptotic effects leading to potential protection against Huntington’s disease, traumatic brain injury, and Parkinson’s disease[79]. Also, reactive oxygen species (ROS) scavenging

Page 18 2. Background

Figure 10 - Examples of early and present developed tetracyclines. 1st generation tetracyclines are the naturally derived, mostly from the genus Streptomyces. 2nd generation tetracyclines are the semi-synthetic, many with oxytetracycline as the precursor. 3rd generation tetracyclines are synthetic; the precursor is often minocycline. The latest FDA approved tetracycline is tigecycline used in clinical treatment against MRSA. have been reported for tetracyclines in preclinical porcine studies, potentially aiding in the recovery of coronary artery disease[80]. Tetracycline’s importance and influence will likely continue as a low-cost broad-spectrum antibiotic as well as segments in other medical areas as these therapeutics exceed several bioactivities.

Mode of action

To be effective with an antibiotic, the targeting effect on the invading bacteria most be specific in a way that can circumvent the cells of the patient. Examples include disruption of cell mem- brane functions specific to bacteria, inhibition of cell-wall synthesis, inhibition of DNA/RNA synthesis or metabolism of folic acid[81]. The mode of action for tetracycline falls within the group of inhibitors of bacterial protein synthesis, which also includes erythromycin, chloramphinical, streptomycin, and gentamycin. Bacterial protein synthesis requires similar machinery for protein translation as eukaryotes, but the key to the specificity of tetracyclines and similar antibiotics is found in the structural differences of the ribosomes between the two domains. As eukaryotic ribosomes contain 40S and 60S subunits, prokaryotes have 30S and 50S subunits[82]. Tetracyclines are effective in binding to the bacterial 30S subunit near its acceptor site for transfer-RNA, thereby blocking the availability of the amino acids needed for elongation of the peptide[83], see figure 11. This leads to a disruption of the cellular processes in the bacteria, while the eukaryotic host is unaffected concerning protein synthesis.

Page 19 2. Background

Figure 11 - Tetracyclines’ primary antibacterial mode of action. The bacterial ribosome (70S) includes the 30S and 50S subunits with acceptor site (A), peptidyl site (P), and exit site (E). By binding near the A-site, tetracyclines block the peptide chain for further elongation. As a result, protein synthesis is disrupted and the bacteria can no longer maintain its cellular functions. Since tetracyclines only interrupt protein elongation, the effect is bacteriostatic.

Tetracycline’s alternative bioactivities can be explained by the fact that the scaffold is highly modifiable, and each position in the molecule affects the binding in various biological processes.

Structure activity relationship

Tetracyclines can be altered in almost any way and in nearly any position in the scaffold, which paves the way for a large number of structural combinations. The molecular features, i.e., functional groups, added, can drastically alter the potency and the mode of action. Knowledge of a structure-activity relationship (SAR) enables the evaluation of novel natural products in both toxicity and bioactivity profiling[84]. During the last half-century, intensive investigation of the SAR of tetracyclines was carried out based on the many derivatives generated, both bioactive and -inactive[85]. This has made it possible to map the scaffold for high-value positions as well as to identify the added chemical groups’ importance. The scaffold of the molecule can be divided into four rings (i.e., A, B, C, and D) with substitution positions from one to twelve, including six additional sub positions (i.e., 4a, 5a, 6a, 10a, 11a, 12a); see figure 12. Each position can be altered with a suitable functional group, but concerning specific activities, some positions are more conserved. The dimethylamino group in position 4, together with a distinct keto-enol system in positions 11, 12, and 12a, is a preserved motif for antibacterial activity towards the ribosomal 30S subunit[86]. Replacing the carboxamide in position 2 has likewise produced analogs with lower antibacterial activity, plausibly due to the position 2 motif of the tetracycline molecule is required for transportation inside bacteria[87]. Together with preserved chemical groups in positions 1-3, the hydrophilic part of the molecule (see Figure 12, blue shade) can create charged interactions with the ribosome in an area near the acceptor site for amino activated tRNA and thus block protein

Page 20 2. Background synthesis[88]. Altering the functional groups at different positions in ring B, C, and D has resulted in tetracyclines with better endurance against bacterial resistance; many of these are in clinical use today[89].

Figure 12 - Structure-activity relationship for tetracyclines. Top: The basic scaffold of tetracyclines (red) with position numbers (1-12a). Various double bonds in the rings A-B-C can occur depending on the nature of the added side groups. Green shade represents the position for the dimethyl amide group, which is found to be essential for antibacterial bioactivity. Blue shade represents both the ribosomal contact surface and the highly chelating area of the molecule. Oxidation levels of the chemical groups can vary depending on the different compounds. Bottom: Names, pharmacophores, and primary bioactivity listed for seven tetracycline derivatives. The red part of the functional group represents the binding on the tetracycline scaffold.

Tetracyclines are active chelating agents for a wide range of cations, which can, in some cases, function as an atypical bacterial limiting factor in reducing the concentrations of free metal ions needed for pathogens to invade[90], [91]. In particular, the hydrophilic part of the molecule can bind metal ions; this ability can also decrease the absorption of the molecule in the gastrointestinal tract. Altering the chelation ability can, therefore, change the absorption pattern. In respect to the above, taking tetracycline together with metalliferous foods is not recommended[92].

Page 21 2. Background

Some tetracyclines are used as antitumor agents, benefiting from the ability to chelate metals[93]. Doxycycline and other tetracyclines have shown to inhibit the activity of sev- eral matrix metalloproteinases, which have proved to be essential mediators of metastasis formation in bones[94]. Anthracycline antibiotics (e.g., doxorubicin and daunorubicin, see figure 12) are used in treatment against both solid tumors and leukemia. Both compounds differ among others from traditional tetracycline in position one with an additional 4-amino- 6-methoxy-2-methyltetrahydro-2H-pyran-3-ol, please refer to figure 12 under doxorubicin R1 group for details.

Bacteria resistance mechanisms

Developing antibiotic resistance in microbes is a natural event in response to environmental exposure to toxic compounds. Metagenomic analyses of ancient (i.e., 30,000 years) DNA from Beringian permafrost sediments have identified a wide range of genes that encode resistance to β-lactam, tetracycline, and glycopeptide antibiotics. This, by far, predates the selective pressure applied by the use of clinical antibiotics and, therefore, cannot be the reason for the evolution of resistant microbes[95]. However, excess spending and misuse of antibiotics in humans and animals, in general, have resulted in an unnatural and constant high selective pressure on pathogenic bacteria, thereby accelerating the developing process of bacterial resistance. In 1950 tetracycline was introduced in clinical treatment, and nine years later, the first tetracycline resistance bacteria, Shigella, was reported[96]. This tendency has continued for general all antibiotics. The primary mechanisms responsible for tetracycline resistance involve efflux proteins for pumping out intracellular accumulated tetracycline, ribosomal protection proteins, and enzymatic degradation.

The efflux system for pumping out tetracycline depends on the nature of the bacteria. For gram-positive bacteria, having no outer membranes, primarily the major facilitator super- family (MFS) proteins are used for transporting the drug out of the cell. For gram-negative bacteria, the procedure requires a larger multi-component efflux transporter for the diffusion over both membranes in a single step, or a 2-step single-component pump system penetrating first the inner membrane and subsequently the outer membrane[97]. However, more than 30 different tetracycline-specific efflux pumps have been described in bacteria. Regulation of the efflux protein-encoding genes in gram-negative bacteria is controlled by the presence of a repressor protein, that dissociates from the DNA operator region when encountering and binding tetracycline. The regulation in gram-positive bacteria is much less known [89].

The ribosomal protection proteins (RPPs) are cytoplasmic GTPases with structural sim- ilarity to elongation factors EF-Tu and EF-G, two proteins involved in the binding of aminoacyl-tRNA to the bacterial ribosome and assisting in protein translation[86], [89]. The RPPs can catalyze tetracycline release from the bacterial ribosome by competing with

Page 22 2. Background

EF-G for an overlapping binding site. By directly interfering with the locking interaction of the tetracycline, the RPP actively removes the tetracycline and subsequent function as an elongation factor resistant to tetracycline[98]. TetO and TetM are two well-studied RPPs representing a group with a wide range of tetracycline resistance. In bacterial resistance endurance, RPPs have been shown to be much more effective than in bacteria with efflux pump systems[86].

Enzymatic degradation of tetracyclines is the least studied of the tetracycline resistance mechanisms, with only a few enzymes characterized. First isolated from Bacteroides fragilis, the tetX gene encodes an enzyme able to decrease tetracycline concentrations in E. coli when heterologously expressed. For their degradation behavior, the TetX enzyme and similar proteins identified in different species have received the class annotation destructases. The primary mechanism resembles flavoprotein hydroxylases (FMO) capable of attacking and oxidizing the tetracycline Scaffold’s A or B-ring and thus modifying the structure into an inactive form[99].

Tools

The following section provides a more comprehensive description of some of the methods and tools applied in the project. For a much more detailed description of the molecular tools and engineering approaches in Aspergillus, e.g., gene-expression systems, CRISPR- Cas9 technology, and NHEJ deficient strain construction, please see chapter 3 "Engineering filamentous fungi for the production of secondary metabolites."

Bioinformatics

Substantial progress in bioinformatics and more specific genomics has been achieved over the past decade as better algorithms have become available, and computational power has increased substantially. In the fungal community, leading projects for whole-genome sequencing filamentous fungi have made a large number of fungal genomes available, which has further led to a more genomics-driven approach for the search and discovery of SMs [23], [100]. Specific genes of interest may be identified by BLAST [101] with protein sequences from homologs or DNA sequences from known BGCs working as "bait." After locating a potential SM synthase/synthetase encoding gene, antiSMASH (e.g., fungal version) can be applied for cluster recognition and identifying the presence of tailoring enzyme encoding genes [35]. In the case of searching for potential tetracycline producing BGCs, specific genes needed to be present in the candidate BGCs. A gene encoding an NR PKS type I group V lacking a release domain, as well as genes encoding a flavin-depended monooxygenase and a Metallo-β-lactamase. The presence of the core genes can further be visualized using a comparable tool, such as EasyFig [102], a program able to align multiple annotated sequences.

Page 23 2. Background

Quantitative real-time PCR

Quantitative real-time PCR (RT-qPCR) can be applied in the process of validating BGCs. The procedure measures gene expression based on gene-specific mRNA available in a given sample. The signals between two samples of interest are normalized to a minimum of two housekeeping genes, assumed to be stably expressed under all conditions. In this way, a relative change in expression in specific genes between the two samples can be assumed to be an effect of the difference in treatment [103]. Further, to avoid any interference from genomic DNA, primers can be designed to span an intron, in this way, only correct spliced mRNA is measured [104].

Chemical analysis and dereplication

Fungal samples can be chemical analyzed for the presence of SMs using an Ultra-High- Performance Liquid Chromatography (UHPLC) linked to a Diode Array Detection (DAD) and High-Resolution tandem Mass Spectrometry (MS/HRMS). Compounds can be effective separated regarding polarity, analyzed based on light absorption patterns and m/z values, see figure 13. Crude extracts obtained from filamentous fungi often contain a large number of SMs, some even with the same elemental composition [25], [105]. Thus, the identification of a natural product without authentic standards can be cumbersome. Dereplication, using UHPLC-DAD-HRMS together with a database search for the comparison with previously elucidated structures, is critical in identifying novel compounds [106]. Since NMR-based structural elucidation can be time-consuming and costly, proper dereplication strategies are crucial for novel compound research [105]. To further assist in the distinguishing of novel compounds from already known compounds, a tandem mass spectrometry (MS/MS) analysis can be applied. The technique allows for the MS to supply the SMs with fragmentation energies, which then split into fragment ions. These MS/MS derived ion-patterns can then be used for further database comparison and identification[107].

The DAD is essential in the detection of tetracyclines. The structural composition of the tetracycline scaffold creates a distinct footprint. The system of conjugated double bonds or chromophores results in a well-defined absorption pattern around 400 nm [108], which results in the emission of light in the yellow spectrum. It is notably the conjugated pi-system in the D-ring that adds to the characteristic of the absorption pattern [109].

Molecular networking for biosynthetic pathway elucidation

The development of a new MS/MS networking approaches has made it possible to align chromatographically separated, however biosynthetically related, compounds pairwise [111]. Based on the presence of similar fragments, structurally related compounds can be clustered. Thus, several compounds belonging to the same pathway can be linked together in a network. This is referred to as global natural products of social molecular networking (GNPS) and

Page 24 2. Background

Figure 13 - UHPLC-DAD-HRMS. From left, the ultra-high-performance liquid chromatography consists of a solvent-system that controls the polarity of the mobile phase (pumps/mixer) . The sample is injected and mixed in the sample loop and carried with the mobile phase to the liquid chromatography column containing the stationary phase. Here are the natural products separated based on polarity as they pass through an apolar environment, typically a C-18 column. The separated metabolites enter the flow cell of the diode array detector and are exposed to both ultraviolet- and visible light. Metabolites absorb the light energy following their chromophore systems before the light passes through and are scattered by the grating and detected. The sample exits the DAD flow cell and enters the electrospray ionization source (ESI), which applies a high-voltage current creating aerosol. The sampling cone sorts and directs the aerosols before entering the ion optics, which adjust the ion stream to support a stable trajectory. The ions continue to the quadrupole, a system with four linear rods with applied opposite charges. Thus, an adjustable oscillating field is created in the quadrupole controlled by the charge applied. The stability of ions passing through the quadrupole is dependent on the mass to charge ratio. Ions with too low or too high mass to charge ratio become unstable, which allows only the user-selected ions to pass. Next, the ions pass-through the hexapole, an installment able to apply fragmentation energy. In the last part of the system, the ions enter the time-of-flight analyzer (TOF) were the same amount of energy is applied to each ion. The ions are then sent to the reflector and redirected to the detector. The time of flight from the push to the detector is measured and dependent on the mass to charge ratio [110]. functions both in regards to compounds belonging to known and novel biosynthetic pathways [112]. The approach was initially developed for peptide-like NPs. However, the GNPS organization has combined more than 70 million MS spectra from over a hundred laboratories making it possible to perform online dereplication [113].

Page 25 2. Background

References

[1] D. L. Hawksworth and R. Lücking, “Fungal Diversity Revisited: 2.2 to 3.8 Million Species”, The Fungal Kingdom, pp. 79–95, 2017. DOI: 10.1128/microbiolspec. funk-0052-2016. [Online]. Available: www.indexfungorum.org. [2] J. Romsdahl, A. Blachowicz, A. J. Chiang, N. Singh, J. E. Stajich, M. Kalkum, K. Venkateswaran, and C. C. C. Wang, “ Characterization of Aspergillus niger Isolated from the International Space Station ”, MSystems, vol. 3, no. 5, 2018. DOI: 10.1128/msystems.00112-18. [3] A. Fleming, “On the antibacterial action of cultures of a Penicillium, with special reference to their use in the isolation of B. influenzæ.”, Thr British journal of experimental pathology, vol. 10, pp. 226–236, 1929. [4] R. A. Samson, C. M. Visagie, J. Houbraken, S. B. Hong, V. Hubka, C. H. Klaassen, G. Perrone, K. A. Seifert, A. Susca, J. B. Tanney, J. Varga, S. Kocsubé, G. Szigeti, T. Yaguchi, and J. C. Frisvad, “Phylogeny, identification and nomenclature of the genus Aspergillus”, Studies in Mycology, vol. 78, no. 1, pp. 141–173, 2014, ISSN: 01660616. DOI: 10.1016/j.simyco.2014.07.004. [Online]. Available: http: //dx.doi.org/10.1016/j.simyco.2014.07.004.. [5] L. Casselton and M. Zolan, “The art and design of genetic screens: Filamentous fungi”, Nature Reviews Genetics, vol. 3, no. 9, pp. 683–697, 2002, ISSN: 14710056. DOI: 10.1038/nrg889. [Online]. Available: http://www.riceblast.org. [6] P. Krijgsheld, R. Bleichrodt, G. J. van Veluw, F. Wang, W. H. Müller, J. Dijksterhuis, and H. A. Wösten, “Development in aspergillus”, Studies in Mycology, vol. 74, pp. 1–29, 2013, ISSN: 01660616. DOI: 10.3114/sim0006. [7] E. M. Fox and B. J. Howlett, “Secondary metabolism: regulation and role in fungal biology”, Current Opinion in Microbiology, vol. 11, no. 6, pp. 481–487, 2008, ISSN: 13695274. DOI: 10 . 1016 / j . mib . 2008 . 10 . 007. [Online]. Available: www.sciencedirect.com. [8] U. P. Sarma, P. J. Bhetaria, P. Devi, and A. Varma, “Aflatoxins: Implications on Health”, Indian Journal of Clinical Biochemistry, vol. 32, no. 2, pp. 124–133, 2017, ISSN: 09740422. DOI: 10.1007/s12291-017-0649-2. [Online]. Available: www. efsa.europa.eu. [9] M. P. Cheng, J. L. Orejas, E. Arbona-Haddad, T. D. Bold, I. H. Solomon, K. Chen, A. Pandit, A. E. Kusztos, K. C. Cummins, A. Liakos, F. M. Marty, S. Koo, and S. P. Hammond, “Use of triazoles for the treatment of invasive aspergillosis: a three-year cohort analysis.”, Mycoses, 2019, ISSN: 1439-0507. DOI: 10.1111/myc.13013. [Online]. Available: http://www.ncbi.nlm.nih.gov/pubmed/31587405.

Page 26 2. Background

[10] W. Shurtleff and A. Aoyagi, History of koji - grains and / or soybeans enrobed with a mold culture ( 300 BCE to 2012 ): Extensively annotated bibliography and sourcebook. 2012, pp. 1–660, ISBN: 9781928914457. [Online]. Available: www . soyinfocenter.com. [11] T. C. Cairns, C. Nai, and V. Meyer, “How a fungus shapes biotechnology: 100 years of Aspergillus niger research”, Fungal Biology and Biotechnology, vol. 5, no. 1, p. 13, 2018. DOI: 10.1186/s40694-018-0054-5. [Online]. Available: https: //doi.org/10.1186/s40694-018-0054-5. [12] M. Christal, “Pharmaceutical Executive”, Tech. Rep. Vol. 39, No. 6, p. 13, June, 2019. [13] J. Barrios-González and R. U. Miranda, “Biotechnological production and applica- tions of statins”, Applied Microbiology and Biotechnology, vol. 85, no. 4, pp. 869– 883, 2010, ISSN: 01757598. DOI: 10.1007/s00253-009-2239-6. [14] A. Endo, “A historical perspective on the discovery of statins”, Proceedings of the Japan Academy Series B: Physical and Biological Sciences, vol. 86, no. 5, pp. 484– 493, 2010, ISSN: 03862208. DOI: 10.2183/pjab.86.484. [15] J. P. Ioannidis, More than a billion people taking statins? Potential implications of the new cardiovascular guidelines, 2014. DOI: 10.1001/jama.2013.284657. [16] N. P. Keller, “Fungal secondary metabolism: regulation, function and drug discov- ery”, Nature Reviews Microbiology, vol. 17, no. 3, pp. 167–180, Mar. 2019, ISSN: 17401534. DOI: 10 . 1038 / s41579 - 018 - 0121 - 1. [Online]. Available: http : //www.nature.com/articles/s41579-018-0121-1. [17] G. Pontecorvo, J. A. Roper, L. M. Chemmons, K. D. Macdonald, and A. W. Bufton, “The Genetics of Aspergillus nidulans”, Advances in Genetics, vol. 5, no. C, pp. 141– 238, 1953, ISSN: 00652660. DOI: 10.1016/S0065-2660(08)60408-3. [18] W. E. Timberlake and M. A. Marshall, “Genetic regulation of development in Aspergillus nidulans”, Tech. Rep. 6, 1988, pp. 162–169. DOI: 10.1016/0168- 9525(88)90022-4. [19] T. Nayak, E. Szewczyk, C. E. Oakley, A. Osmani, L. Ukil, S. L. Murray, M. J. Hynes, S. A. Osmani, and B. R. Oakley, “A versatile and efficient gene-targeting system for Aspergillus nidulans”, Genetics, vol. 172, no. 3, pp. 1557–1566, 2006, ISSN: 00166731. DOI: 10.1534/genetics.105.052563. [Online]. Available: www.broad.mit.edu/annotation/. [20] C. G. Elliott, “The cytology of Aspergillus nidulans”, Genetical Research, vol. 1, no. 3, pp. 462–476, 1960, ISSN: 14695073. DOI: 10.1017/S0016672300000434. [Online]. Available: https://doi.org/10.1017/S0016672300000434.

Page 27 2. Background

[21] M. J. Hynes and J. A. J. Pateman, “The genetic analysis of regulation of amidase synthesis in Aspergillus nidulans - I. Mutants able to utilize acrylamide”, Tech. Rep. 2, 1970, pp. 97–106. DOI: 10.1007/BF02430516. [22] H. Brody and J. Carbon, “Electrophoretic karyotype of Aspergillus nidulans (chro- mosome separation/karyotype/pulsed-field gel electrophoresis/fllamentous fungi)”, Tech. Rep., 1989, pp. 6260–6263. [23] T. C. Vesth, J. L. Nybo, S. Theobald, and et al., “Investigation of inter- and in- traspecies variation through genome sequencing of Aspergillus section Nigri”, Na- ture Genetics, vol. 50, no. 12, pp. 1688–1695, 2018, ISSN: 15461718. DOI: 10.1038/ s41588-018-0246-1. [24] T. E. Cleveland, J. Yu, N. Fedorova, D. Bhatnagar, G. A. Payne, W. C. Nierman, and J. W. Bennett, “Potential of Aspergillus flavus genomics for applications in biotechnology”, Trends in Biotechnology, vol. 27, no. 3, pp. 151–157, 2009, ISSN: 01677799. DOI: 10.1016/j.tibtech.2008.11.008. [Online]. Available: http: //compbio.dfci.harvard.edu/tgi]. [25] M. L. Nielsen, J. B. Nielsen, C. Rank, M. L. Klejnstrup, D. K. Holm, K. H. Brogaard, B. G. Hansen, J. C. Frisvad, T. O. Larsen, and U. H. Mortensen, “A genome-wide polyketide synthase deletion library uncovers novel genetic links to polyketides and meroterpenoids in Aspergillus nidulans”, FEMS Microbiology Letters, vol. 321, no. 2, pp. 157–166, 2011, ISSN: 03781097. DOI: 10.1111/j.1574-6968.2011.02327.x. [Online]. Available: https://academic.oup.com/femsle/article-abstract/ 321/2/157/626983. [26] J. F. Sanchez, A. D. Somoza, N. P. Keller, and C. C. Wang, Advances in Aspergillus secondary metabolite research in the post-genomic era, Mar. 2012. DOI: 10.1039/ c2np00084a. [27] J. E. Galagan, S. E. Calvo, C. Cuomo, and et al., “Sequencing of Aspergillus nidu- lans and comparative analysis with A. fumigatus and A. oryzae”, Nature, vol. 438, no. 7071, pp. 1105–1115, 2005, ISSN: 14764687. DOI: 10.1038/nature04341. [Online]. Available: www.broad.mit.edu/wga/. [28] JGI-Genome-Portal, “Https://mycocosm.jgi.doe.gov/aspergillus/aspergillus.info.html”, Aspergillus genus, vol. 14.10.2017, 2019. [29] A. Rokas, G. Payne, N. D. Fedorova, S. E. Baker, M. Machida, J. Yu, D. R. Geor- gianna, R. A. Dean, D. Bhatnagar, T. E. Cleveland, J. R. Wortman, R. Maiti, V. Joardar, P. Amedeo, D. W. Denning, and W. C. Nierman, “What can comparative genomics tell us about species concepts in the genus Aspergillus?”, Studies in Mycol- ogy, vol. 59, pp. 11–17, 2007, ISSN: 01660616. DOI: 10.3114/sim.2007.59.02. [Online]. Available: www.studiesinmycology.org.

Page 28 2. Background

[30] J.-H. Yu and N. Keller, “Regulation of Secondary Metabolism in Filamentous Fungi”, Annual Review of Phytopathology, vol. 43, no. 1, pp. 437–458, 2005, ISSN: 0066- 4286. DOI: 10.1146/annurev.phyto.43.040204.140214. [Online]. Available: www.annualreviews.org. [31] D. Hoffmeister and N. P. Keller, Natural products of filamentous fungi: Enzymes, genes, and their regulation, 2007. DOI: 10.1039/b603084j. [32] N. P. Keller, G. Turner, and J. W. Bennett, “Fungal secondary metabolism - From biochemistry to genomics”, Nature Reviews Microbiology, vol. 3, no. 12, pp. 937– 947, 2005, ISSN: 17401526. DOI: 10.1038/nrmicro1286. [Online]. Available: www.nature.com/reviews/micro. [33] B. Baral, A. Akhgari, and M. Metsä-Ketelä, “Activation of microbial secondary metabolic pathways: Avenues and challenges”, Synthetic and Systems Biotechnology, vol. 3, no. 3, pp. 163–178, 2018, ISSN: 2405805X. DOI: 10.1016/j.synbio.2018. 09.001. [Online]. Available: http://www.keaipublishing.com/synbio. [34] N. Khaldi, F. T. Seifuddin, G. Turner, D. Haft, W. C. Nierman, K. H. Wolfe, and N. D. Fedorova, “SMURF: Genomic mapping of fungal secondary metabolite clusters”, Fungal Genetics and Biology, vol. 47, no. 9, pp. 736–741, Sep. 2010, ISSN: 10871845. DOI: 10.1016/j.fgb.2010.06.003. [35] K. Blin, S. Shaw, K. Steinke, R. Villebro, N. Ziemert, S. Y. Lee, M. H. Medema, and T. Weber, “antiSMASH 5.0: updates to the secondary metabolite genome min- ing pipeline”, Nucleic Acids Research, vol. 47, no. W1, W81–W87, 2019, ISSN: 0305-1048. DOI: 10.1093/nar/gkz310. [Online]. Available: https://docs. antismash.. [36] K. Throckmorton, P. Wiemann, and N. P. Keller, Evolution of chemical diversity in a group of non-reduced polyketide gene clusters: Using phylogenetics to inform the search for novel fungal natural products, 9. Toxins, 2015, vol. 7, pp. 3572–3607, ISBN: 1608262979. DOI: 10.3390/toxins7093572. [37] H. Wei, Z. Lin, D. Li, Q. Gu, and T. Zhu, “Osmac (one strain many compounds) approach in the research of microbial metabolites–a review”, chi, Wei Sheng Wu Xue Bao = Acta Microbiologica Sinica, vol. 50, no. 6, pp. 701–709, 2010, ISSN: 00016209. [38] P. K. Ajikumar, K. Tyo, S. Carlsen, O. Mucha, T. H. Phon, and G. Stephanopoulos, “Terpenoids: Opportunities for biosynthesis of natural product drugs using engineered microorganisms”, Molecular Pharmaceutics, vol. 5, no. 2, pp. 167–190, 2008, ISSN: 15438384. DOI: 10.1021/mp700151b. [Online]. Available: https://pubs.acs. org/sharingguidelines. [39] H. M. Miziorko, Enzymes of the mevalonate pathway of isoprenoid biosynthesis, Jan. 2011. DOI: 10.1016/j.abb.2010.09.028.

Page 29 2. Background

[40] J. Berg, J. Tymoczko, and L. Stryer, “Amino Acids Are Made from Intermediates of the Citric Acid Cycle and Other Major Pathways”, Biochemistry, pp. 1–17, 2002. [41] R. Ebel, “Terpenes from Marine-Derived Fungi”, Mar. Drugs, vol. 8, pp. 2340– 2368, 2010, ISSN: 1660-3397. DOI: 10.3390/md8082340. [Online]. Available: www.mdpi.com/journal/marinedrugs.

[42] R. S. Jackson, “NO SIRVE - Wine Science”, Wine Science, pp. 347–426, 2014. DOI: 10.1016/B978-0-12-381468-5.00006-3. [Online]. Available: http://www. sciencedirect.com/science/article/pii/B9780123814685000063. [43] M. B. Quin, C. M. Flynn, and C. Schmidt-Dannert, “Traversing the fungal ter- penome”, Natural Product Reports, vol. 31, no. 10, pp. 1449–1473, 2014, ISSN: 14604752. DOI: 10.1039/c4np00075g. [44] E. Oldfield and F. Y. Lin, “Terpene biosynthesis: Modularity rules”, Angewandte Chemie - International Edition, vol. 51, no. 5, pp. 1124–1137, 2012, ISSN: 14337851. DOI: 10.1002/anie.201103110. [45] Y. H. Chooi, R. Cacho, and Y. Tang, “Identification of the Viridicatumtoxin and Griseofulvin Gene Clusters from Penicillium aethiopicum”, Chemistry and Biology, vol. 17, no. 5, pp. 483–494, 2010, ISSN: 10745521. DOI: 10.1016/j.chembiol. 2010.03.015. [46] J. P. Van Den Heever, T. S. Thompson, J. M. Curtis, A. Ibrahim, and S. F. Pernal, “Fumagillin: An overview of recent scientific advances and their significance for apiculture”, Journal of Agricultural and Food Chemistry, vol. 62, no. 13, pp. 2728– 2737, 2014, ISSN: 15205118. DOI: 10 . 1021 / jf4055374. [Online]. Available: https://pubs.acs.org/sharingguidelines. [47] P. M. Dewick, Medicinal Natural Products: A Biosynthetic Approach: Third Edition. 2009, pp. 1–539, ISBN: 9780470741689. DOI: 10.1002/9780470742761. [48] M. W. Hyun, Y. H. Yun, J. Y. Kim, and S. H. Kim, “Fungal and plant phenylalanine ammonia-lyase”, Mycobiology, vol. 39, no. 4, pp. 257–265, 2011, ISSN: 12298093. DOI: 10.5941/MYCO.2011.39.4.257. [Online]. Available: http://dx.doi.org/ 10.5941/MYCO.2011.39.4.257. [49] P. G. Arnison, M. J. Bibb, G. Bierbaum, and et al., “Ribosomally synthesized and post- translationally modified peptide natural products: Overview and recommendations for a universal nomenclature”, Natural Product Reports, vol. 30, no. 1, pp. 108–160, 2013, ISSN: 14604752. DOI: 10.1039/c2np20085f. [50] M. Umemura, N. Nagano, H. Koike, J. Kawano, T. Ishii, Y. Miyamura, M. Kikuchi, K. Tamano, J. Yu, K. Shin-ya, and M. Machida, “Characterization of the biosynthetic gene cluster for the ribosomally synthesized cyclic peptide ustiloxin B in Aspergillus flavus”, Fungal Genetics and Biology, vol. 68, pp. 23–30, 2014, ISSN: 10960937. DOI: 10.1016/j.fgb.2014.04.011.

Page 30 2. Background

[51] W. Ding, W. Q. Liu, Y. Jia, Y. Li, W. A. Van Der Donk, and Q. Zhang, “Biosynthetic investigation of phomopsins reveals a widespread pathway for ribosomal natural products in Ascomycetes”, Proceedings of the National Academy of Sciences of the United States of America, vol. 113, no. 13, pp. 3521–3526, 2016, ISSN: 10916490. DOI: 10.1073/pnas.1522907113. [Online]. Available: www.pnas.org/cgi/doi/ 10.1073/pnas.1522907113. [52] S. Luo and S. H. Dong, Recent advances in the discovery and biosynthetic study of eukaryotic RIPP natural products, Apr. 2019. DOI: 10.3390/molecules24081541. [53] B. R. Miller and A. M. Gulick, “Structural biology of nonribosomal peptide syn- thetases”, Methods in Molecular Biology, vol. 1401, pp. 3–29, 2016, ISSN: 10643745. DOI: 10.1007/978-1-4939-3375-4_1. [54] Z. Song, R. J. Cox, C. M. Lazarus, and T. J. Simpson, “Fusarin C biosynthesis in Fusarium moniliforme and Fusarium venenatum”, ChemBioChem, vol. 5, no. 9, pp. 1196–1203, Sep. 2004, ISSN: 14394227. DOI: 10.1002/cbic.200400138. [Online]. Available: http://doi.wiley.com/10.1002/cbic.200400138. [55] S. W. Queener, “Molecular biology of penicillin and cephalosporin biosynthesis”, Tech. Rep. 6, 1990, pp. 943–948. DOI: 10.1128/AAC.34.6.943. [56] G. Weber, K. Schörgendorfer, E. Schneider-Scherzer, and E. Leitner, “The peptide synthetase catalyzing cyclosporine production in Tolypocladium niveum is encoded by a giant 45.8-kilobase open reading frame”, Tech. Rep. 2, 1994, pp. 120–125. DOI: 10.1007/BF00313798. [57] H. von Döhren, “A survey of nonribosomal peptide synthetase (NRPS) genes in Aspergillus nidulans.”, Fungal genetics and biology : FG & B, vol. 46 Suppl 1, 2009, ISSN: 10960937. DOI: 10.1016/j.fgb.2008.08.008. [Online]. Available: http://www.binf.gmu.edu/. [58] A. Herr and R. Fischer, “Improvement of Aspergillus nidulans penicillin produc- tion by targeting AcvA to peroxisomes”, Metabolic Engineering, vol. 25, pp. 131– 139, Sep. 2014, ISSN: 10967184. DOI: 10.1016/j.ymben.2014.07.002. [On- line]. Available: https://www.sciencedirect.com/science/article/pii/ S1096717614000937. [59] S. Bergmann, J. Schümann, K. Scherlach, C. Lange, A. A. Brakhage, and C. Her- tweck, “Genomics-driven discovery of PKS-NRPS hybrid metabolites from As- pergillus nidulans”, Nature Chemical Biology, vol. 3, no. 4, pp. 213–217, 2007, ISSN: 15524469. DOI: 10.1038/nchembio869. [60] C. Hertweck, “The biosynthetic logic of polyketide diversity”, Angewandte Chemie - International Edition, vol. 48, no. 26, pp. 4688–4716, 2009, ISSN: 14337851. DOI: 10.1002/anie.200806121. [Online]. Available: http://www.ncbi.nlm.nih. gov/pubmed/19514004.

Page 31 2. Background

[61] R. J. Cox, “Polyketides, proteins and genes in fungi: Programmed nano-machines begin to reveal their secrets”, Organic and Biomolecular Chemistry, vol. 5, no. 13, pp. 2010–2026, 2007, ISSN: 14770520. DOI: 10.1039/b704420h. [Online]. Available: www.rsc.org/obc. [62] M. Hashimoto, T. Nonaka, and I. Fujii, “Fungal type III polyketide synthases”, Natural Product Reports, vol. 31, no. 10, pp. 1306–1317, 2014, ISSN: 14604752. DOI: 10.1039/c4np00096j. [Online]. Available: www.rsc.org/npr. [63] W. Xu, K. Qiao, and Y. Tang, “Structural analysis of protein-protein interactions in type i polyketide synthases”, Critical Reviews in Biochemistry and Molecular Biology, vol. 48, no. 2, pp. 98–122, 2013, ISSN: 10409238. DOI: 10.3109/10409238. 2012.745476. [64] O. Márquez-Fernández, Á. Trigos, J. L. Ramos-Balderas, G. Viniegra-González, H. B. Deising, and J. Aguirre, “Phosphopantetheinyl transferase CfwA/NpgA is required for Aspergillus nidulans secondary metabolism and asexual development”, Eukaryotic Cell, vol. 6, no. 4, pp. 710–720, 2007, ISSN: 15359778. DOI: 10.1128/ EC.00362-06. [65] D. A. Herbst, C. A. Townsend, and T. Maier, “The architectures of iterative type I PKS and FAS”, Natural Product Reports, vol. 35, no. 10, pp. 1046–1069, 2018, ISSN: 14604752. DOI: 10.1039/c8np00039e.

[66] L. Du and L. Lou, PKS and NRPS release mechanisms, 2010. DOI: 10.1039/ b912037h. [67] J. M. Crawford, P. M. Thomas, J. R. Scheerer, A. L. Vagstad, N. L. Kelleher, and C. A. Townsend, “Deconstruction of iterative multidomain polyketide synthase function”, Science, vol. 320, no. 5873, pp. 243–246, 2008, ISSN: 00368075. DOI: 10.1126/science.1154711. [68] M. L. Klejnstrup, R. J. Frandsen, D. K. Holm, M. T. Nielsen, U. H. Mortensen, T. O. Larsen, and J. B. Nielsen, “Genetics of polyketide metabolism in Aspergillus nidu- lans”, Metabolites, vol. 2, no. 1, pp. 100–133, 2012, ISSN: 22181989. DOI: 10.3390/ metabo2010100. [Online]. Available: www.mdpi.com/journal/metabolites/. [69] L. Gidijala, J. A. Kiel, R. A. Bovenberg, I. J. Van Der Klei, and M. A. D. Berg, “Biosynthesis of active pharmaceuticals: β-lactam biosynthesis in filamentous fungi”, Biotechnology and Genetic Engineering Reviews, vol. 27, no. 1, pp. 1–32, 2010, ISSN: 20465556. DOI: 10.1080/02648725.2010.10648143. [Online]. Available: https: / / www . tandfonline . com / action / journalInformation ? journalCode = tbgr20.

Page 32 2. Background

[70] Y. Li, Y. H. Chooi, Y. Sheng, J. S. Valentine, and Y. Tang, “Comparative characteri- zation of fungal anthracenone and naphthacenedione biosynthetic pathways reveals an α-hydroxylation-dependent claisen-like cyclization catalyzed by a dimanganese thioesterase”, Journal of the American Chemical Society, vol. 133, no. 39, pp. 15 773– 15 785, 2011, ISSN: 00027863. DOI: 10.1021/ja206906d. arXiv: NIHMS150003. [Online]. Available: http://pubs.acs.org.proxy.findit.dtu.dk/doi/pdf/ 10.1021/ja206906d. [71] D. Boettger and C. Hertweck, “Molecular Diversity Sculpted by Fungal PKS-NRPS Hybrids”, ChemBioChem, vol. 14, no. 1, pp. 28–42, 2013, ISSN: 14394227. DOI: 10.1002/cbic.201200624. [72] E. M. Niehaus, K. Kleigrewe, P. Wiemann, L. Studt, C. M. Sieber, L. R. Connolly, M. Freitag, U. Güldener, B. Tudzynski, and H. U. Humpf, “Genetic manipulation of the fusarium fujikuroi fusarin gene cluster yields insight into the complex regulation and fusarin biosynthetic pathway”, Chemistry and Biology, vol. 20, no. 8, pp. 1055–1066, 2013. DOI: 10.1016/j.chembiol.2013.07.004. [73] B. R. da Cunha, L. P. Fonseca, and C. R. Calado, “Antibiotic discovery: Where have we come from, where do we go?”, Antibiotics, vol. 8, no. 2, 2019, ISSN: 20796382. DOI: 10.3390/antibiotics8020045. [Online]. Available: www.mdpi. com/journal/antibiotics. [74] M. L. Nelson and S. B. Levy, “The history of the tetracyclines”, Annals of the New York Academy of Sciences, vol. 1241, no. 1, pp. 17–32, 2011, ISSN: 17496632. DOI: 10.1111/j.1749-6632.2011.06354.x. [75] J. S. Strauss, D. P. Krowchuk, J. J. Leyden, A. W. Lucky, A. R. Shalita, E. C. Siegfried, D. M. Thiboutot, A. S. Van Voorhees, K. A. Beutner, C. K. Sieck, and R. Bhushan, “Guidelines of care for acne vulgaris management”, Journal of the American Academy of Dermatology, vol. 56, no. 4, pp. 651–663, Apr. 2007, ISSN: 01909622. DOI: 10.1016/j.jaad.2006.08.048. [76] P. Koomanachai, J. L. Crandon, M. A. Banevicius, L. Peng, and D. P. Nicolau, “Phar- macodynamic profile of tigecycline against methicillin-resistant Staphylococcus au- reus in an experimental pneumonia model”, Antimicrobial Agents and Chemotherapy, vol. 53, no. 12, pp. 5060–5063, 2009, ISSN: 00664804. DOI: 10.1128/AAC.00985- 09. [Online]. Available: http://aac.asm.org/. [77] The Pew Charitable Trusts, “Antibiotics Currently in Clinical Development”, Tech. Rep. September, 2018, pp. 1–7. [Online]. Available: http://www.pewtrusts.org/ en/multimedia/data-visualizations/2014/antibiotics-currently-in- clinical-development.

Page 33 2. Background

[78] M. J. Renwick, V. Simpkin, and E. Mossialos, “Targeting innovation in antibiotic drug discovery and development”, Targeting innovation in antibiotic drug discovery and development: The need for a One Health – One Europe – One World Framework, 2016. [79] M. O. Griffin, E. Fricovsky, G. Ceballos, and F. Villarreal, “Tetracyclines: A pleitropic family of compounds with promising therapeutic properties. Review of the literature”, American Journal of Physiology - Cell Physiology, vol. 299, no. 3, pp. 539–548, 2010, ISSN: 03636143. DOI: 10.1152/ajpcell.00047.2010. [Online]. Available: www.ajpcell.org. [80] M. F. Swartz, J. M. Halter, G. W. Fink, L. Pavone, A. Zaitsev, H. M. Lee, J. M. Steinberg, C. J. Lutz, T. Sorsa, L. A. Gatto, S. Landas, C. Hare, and G. F. Nie- man, “Chemically modified tetracycline improves contractility in porcine coronary ischemia/reperfusion injury”, Journal of Cardiac Surgery, vol. 21, no. 3, pp. 254– 260, May 2006, ISSN: 08860440. DOI: 10.1111/j.1540-8191.2006.00226.x. [Online]. Available: http://doi.wiley.com/10.1111/j.1540-8191.2006. 00226.x. [81] S. E. Rossiter, M. H. Fletcher, and W. M. Wuest, “Natural Products as Platforms to Overcome Antibiotic Resistance”, Chemical Reviews, vol. 117, no. 19, pp. 12 415– 12 474, 2017, ISSN: 15206890. DOI: 10.1021/acs.chemrev.7b00283. [82] Y. Xie, A. V. Dix, and Y. Tor, “Antibiotic selectivity for prokaryotic vs. eukaryotic decoding sites”, Chemical Communications, vol. 46, no. 30, pp. 5542–5544, 2010, ISSN: 13597345. DOI: 10.1039/c0cc00423e. [83] W. Diirckheimer, “Tetracyclines: Chemistry, Biochemistry, and Structure-Activity Relations”, Angewandte Chemie (International ed. in English), vol. 11, no. 10, pp. 861–874, 1972. [84] R. L. Grant, A. B. Combs, and D. Acosta, “Experimental Models for the Investigation of Toxicological Mechanisms”, Tech. Rep., 2010, pp. 203–224. DOI: 10.1016/B978- 0-08-046884-6.00110-X. [85] D. Fuoco, “Classification framework and chemical biology of Tetracycline-structure- based drugs”, Antibiotics, vol. 1, no. 1, pp. 1–13, 2012, ISSN: 20796382. DOI: 10.3390/antibiotics1010001. arXiv: arXiv:1111.2769. [Online]. Available: http://www.mdpi.com/2079-6382/1/1/1/. [86] I. Chopra and M. Roberts, “Tetracycline Antibiotics: Mode of Action, Applications, Molecular Biology, and Epidemiology of Bacterial Resistance”, Microbiology and Molecular Biology Reviews, vol. 65, no. 2, pp. 232–260, 2001, ISSN: 1092-2172. DOI: 10.1128/mmbr.65.2.232-260.2001. [Online]. Available: http://mmbr. asm.org/.

Page 34 2. Background

[87] I. CHOPRA, “Transport of tetracyclines into escherichia-coli requires a carbox- amide group at the c2 position of the molecule”, eng, Journal of Antimicrobial Chemotherapy, vol. 18, no. 6, pp. 661–666, 1986, ISSN: 14602091, 03057453. [88] D. E. Brodersen, W. M. Clemons, A. P. Carter, R. J. Morgan-Warren, B. T. Wim- berly, and V. Ramakrishnan, “The structural basis for the action of the antibiotics tetracycline, pactamycin, and hygromycin B, on the 30S ribosomal subunit”, Tech. Rep. 7, 2000, pp. 1143–1154. DOI: 10.1016/S0092-8674(00)00216-6. [89] T. H. Grossman, “Tetracycline antibiotics and resistance”, Cold Spring Harbor Perspectives in Medicine, vol. 6, no. 4, Apr. 2016, ISSN: 21571422. DOI: 10.1101/ cshperspect.a025387. [90] A. H. Caswell and J. D. Hutchison, “Selectivity of cation chelation to tetracyclines: Evidence for special conformation of calcium chelate”, Tech. Rep. 3, 1971, pp. 625– 630. DOI: 10.1016/0006-291X(71)90660-7. [91] D. Grenier, M. P. Huot, and D. Mayrand, “Iron-chelating activity of tetracyclines and its impact on the susceptibility of Actinobacillus actinomycetemcomitans to these antibiotics”, Tech. Rep. 3, 2000, pp. 763–766. DOI: 10.1128/AAC.44.3.763- 766.2000. [Online]. Available: http://aac.asm.org/. [92] D. G. Waller, A. G. Renwick, and K. Hillier, “Medical pharmacology and therapeu- tics”, und, 2001. [93] P. P. Silva, W. Guerra, J. N. Silveira, A. M. D. C. Ferreira, T. Bortolotto, F. L. Fischer, H. Terenzi, A. Neves, and E. C. Pereira-Maia, “Two new ternary complexes of copper(II) with tetracycline or doxycycline and 1,10-phenanthroline and their potential as antitumoral: Cytotoxicity and DNA cleavage”, Inorganic Chemistry, vol. 50, no. 14, pp. 6414–6424, 2011, ISSN: 00201669. DOI: 10.1021/ic101791r. [Online]. Available: https://pubs.acs.org/sharingguidelines. [94] Z. Saikali and G. Singh, Doxycycline and other tetracyclines in the treatment of bone metastasis, 2003. DOI: 10.1097/00001813-200311000-00001. [95] V. M. Dcosta, C. E. King, L. Kalan, M. Morar, W. W. Sung, C. Schwarz, D. Froese, G. Zazula, F. Calmels, R. Debruyne, G. B. Golding, H. N. Poinar, and G. D. Wright, “Antibiotic resistance is ancient”, Nature, vol. 477, no. 7365, pp. 457–461, 2011, ISSN: 00280836. DOI: 10.1038/nature10388. [96] C. L. Ventola, “The Antibiotic Resistance Crisis Part 1: Causes and Threats. Phar- macy and Therapeutics.”, Tech. Rep. 4, 2015, pp. 277–283. [Online]. Available: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4378521/. [97] Yılmaz and G. Özcengiz, Antibiotics: Pharmacokinetics, toxicity, resistance and multidrug efflux pumps, Jun. 2017. DOI: 10.1016/j.bcp.2016.10.005.

Page 35 2. Background

[98] S. R. Connell, D. M. Tracz, K. H. Nierhaus, and D. E. Taylor, “Ribosomal Protection Proteins and Their Mechanism of Tetracycline Resistance”, Antimicrobial Agents and Chemotherapy, vol. 47, no. 12, pp. 3675–3681, 2003, ISSN: 00664804. DOI: 10.1128/AAC.47.12.3675-3681.2003. [Online]. Available: http://aac.asm. org/. [99] J. L. Markley and T. A. Wencewicz, “Tetracycline-inactivating enzymes”, Frontiers in Microbiology, vol. 9, no. MAY, p. 1058, 2018, ISSN: 1664302X. DOI: 10.3389/ fmicb.2018.01058. [Online]. Available: www.frontiersin.org. [100] H. Nordberg, M. Cantor, S. Dusheyko, S. Hua, A. Poliakov, I. Shabalov, T. Smirnova, I. V. Grigoriev, and I. Dubchak, “The genome portal of the Department of Energy Joint Genome Institute: 2014 updates”, 2014. DOI: 10.1093/nar/gkt1069. [On- line]. Available: http://genome.jgi.doe.. [101] S. ALTSCHUL, W. GISH, W. MILLER, E. MYERS, and D. LIPMAN, “Basic local alignment search tool”, eng, Journal of Molecular Biology, vol. 215, no. 3, pp. 403– 410, 1990, ISSN: 10898638, 00222836. DOI: 10.1016/S0022-2836(05)80360-2. [102] M. J. Sullivan, N. K. Petty, and S. A. Beatson, “Easyfig: A genome comparison visualizer”, Bioinformatics, vol. 27, no. 7, pp. 1009–1010, 2011, ISSN: 13674803. DOI: 10.1093/bioinformatics/btr039. [103] J. Huggett, K. Dheda, S. Bustin, and A. Zumla, “Real-time RT-PCR normalisation; strategies and considerations”, Genes and Immunity, vol. 6, no. 4, pp. 279–284, 2005, ISSN: 14664879. DOI: 10.1038/sj.gene.6364190. [Online]. Available: www.nature.com/gene. [104] S. Bustin and J. Huggett, “qPCR primer design revisited”, Biomolecular Detection and Quantification, vol. 14, pp. 19–28, 2017, ISSN: 22147535. DOI: 10.1016/j. bdq.2017.11.001. [Online]. Available: https://doi.org/10.1016/j.bdq. 2017.11.001. [105] T. El-Elimat, M. Figueroa, B. M. Ehrmann, N. B. Cech, C. J. Pearce, and N. H. Oberlies, “High-resolution MS, MS/MS, and UV database of fungal secondary metabolites as a dereplication protocol for bioactive natural products”, Journal of Natural Products, vol. 76, no. 9, pp. 1709–1716, Sep. 2013, ISSN: 01633864. DOI: 10.1021/np4004307. [Online]. Available: https://pubs.acs.org/doi/10. 1021/np4004307. [106] K. F. Nielsen and T. O. Larsen, “The importance of mass spectrometric dereplication in fungal secondary metabolite analysis”, Frontiers in Microbiology, vol. 6, no. FEB, 2015, ISSN: 1664302X. DOI: 10.3389/fmicb.2015.00071. [Online]. Available: www.frontiersin.org.

Page 36 2. Background

[107] S. Kildgaard, M. Mansson, I. Dosen, A. Klitgaard, J. C. Frisvad, T. O. Larsen, and K. F. Nielsen, “Accurate dereplication of bioactive secondary metabolites from marine-derived fungi by UHPLC-DAD-QTOFMS and a MS/HRMS library”, Ma- rine Drugs, vol. 12, no. 6, pp. 3681–3705, 2014, ISSN: 16603397. DOI: 10.3390/ md12063681. [Online]. Available: www.mdpi.com/journal/marinedrugsArticle. [108] I. Nilsson Ehle, T. T. Yoshikawa, M. C. Schotz, and L. B. Guze, “Quantitation of antibiotics using high pressure liquid chromatography: tetracycline”, Tech. Rep. 5, 1976, pp. 754–760. DOI: 10.1128/AAC.9.5.754. [Online]. Available: http: //aac.asm.org/. [109] J. Ma, Y. Sun, and F. Yu, “Efficient removal of tetracycline with KOH-activated grapheme from aqueous solution”, Royal Society Open Science, vol. 4, no. 11, 2017, ISSN: 20545703. DOI: 10.1098/rsos.170731. [Online]. Available: http: //dx.doi.org/10.1098. [110] J. Sherma, High performance liquid chromatography in phytochemical analysis, eng. CRC Press, Taylor & Francis, 2011, XX, 975 S. (unknown), ISBN: 042914539x, 1420092618, 142009260x, 1282902512, 9786612902512, 9781420092608. [111] J. Watrous, P. Roach, T. Alexandrov, B. S. Heath, J. Y. Yang, R. D. Kersten, M. Van Der Voort, K. Pogliano, H. Gross, J. M. Raaijmakers, B. S. Moore, J. Laskin, N. Bandeira, and P. C. Dorrestein, “Mass spectral molecular networking of living microbial colonies”, Proceedings of the National Academy of Sciences of the United States of America, vol. 109, no. 26, Jun. 2012, ISSN: 00278424. DOI: 10.1073/ pnas.1203689109. [112] J. Y. Yang, L. M. Sanchez, C. M. Rath, X. Liu, P. D. Boudreau, N. Bruns, E. Glukhov, A. Wodtke, R. De Felicio, A. Fenner, W. R. Wong, R. G. Linington, L. Zhang, H. M. Debonsi, W. H. Gerwick, and P. C. Dorrestein, “Molecular networking as a dereplication strategy”, Journal of Natural Products, vol. 76, no. 9, pp. 1686–1699, 2013, ISSN: 01633864. DOI: 10.1021/np400413s. [Online]. Available: https: //pubs.acs.org/sharingguidelines. [113] H. Mohimani, A. Gurevich, A. Shlemov, A. Mikheenko, A. Korobeynikov, L. Cao, E. Shcherbin, L. F. Nothias, P. C. Dorrestein, and P. A. Pevzner, “Dereplication of microbial metabolites through database search of mass spectra”, Nature Communica- tions, vol. 9, no. 1, 2018, ISSN: 20411723. DOI: 10.1038/s41467-018-06082-8. [Online]. Available: www.nature.com/naturecommunications.

Page 37 3. Fungal Synthetic Biology Tools

Fungal Synthetic Biology Tools to Facilitate Utilization of Secondary Metabolites: Discovery, Heterologous Production, and Biosynthesis of Biocombinatorial Compounds.

Peter Betz Wolff, Jakob Blæsbjerg Hoof, Tomas Strucko, Uffe Hasbro Mortensen

Section for Eukaryotic Biotechnology, DTU Bioengineering, Institute for Biotechnology and Biomedicine, Technical University of Denmark, Kongens Lyngby, Denmark.

ABSTRACT

The discovery of secondary metabolites in filamentous fungi and the investigation of the underlying production machinery has been enhanced due to the advancements in synthetic molecular tools available for filamentous fungi. Better gene-expression systems and the introduction of CRISPR technology have participated in streamlining the process for easier activation and elucidation of novel biosynthetic pathways. Moreover, numerous genome sequencing projects and gene-prediction tools that have become publicly available, particularly within the last decade, have revealed more biosynthetic gene clusters for secondary metabolism than first anticipated. Further, combinatorial biosynthetic approaches across species and even kingdoms can help widen the chemical space for filamentous fungi, bring forth novel compounds, and optimize natural product pathways and provide higher yields. In this review, we will discuss essential molecular synthetic tools for engineering filamentous fungi for the discovery and production of secondary metabolites, both expressed in the native host and heterologous expressed, as well as combinatorial approaches for semi- and synthetic compounds. We will also reflect on some of the efforts made for optimizing fungal cell factories for higher yields and less cross chemistry potentially interfering with intermediates and downstream processes.

INTRODUCTION

Filamentous fungi are exceedingly active producers of natural products (NPs) with a significant impact on human society. Notably, the pharmaceutical lovastatin found in Aspergillus terreus has improved the lives of many patients with high blood cholesterol (1). On the other hand, the carcinogen aflatoxins produced by molds like Aspergillus fumigatus and Aspergillus flavus impose an enormous health concern when contaminating food, feed, and agricultural commodities (2). Filamentous fungi have throughout its kingdom a massive potential for providing novel drug candidates in demand for new pharmaceuticals and other beneficial compounds. However, fungal secondary metabolites (SMs) still constitute only a fraction of the chemical space that is of potential human interest. Organisms from other kingdoms, e.g., plants, also a rich source of SMs similar to

Page 38 3. Fungal Synthetic Biology Tools

fungi, provide a more significant number of NPs. But, many of these compounds are not easy to produce in large amounts typically due to the growth physiology, conditions of the organism, or because the compound of interest is produced in tiny amounts (3). Filamentous fungi can function as outstanding cell factories for the production of these hard-to-come-by NPs. Further, by combining biosynthetic mechanisms and redesigning fungal pathways through the engineering of biological principles with new insights to genomics, the novel drug discovery process can be enhanced, and yields higher. Many fungal sequencing projects have already demonstrated that fungi serve as a vast reservoir of yet to be discovered enzymes and SMs, which may improve human life in the future. It is, therefore, easy to imagine that new and developed tools, synthetic approaches, and biocombinatorial pathways can contribute to enhancing fungal applications in the industry, as well as the health and agricultural sections. The introduction of synthetic fungal biology has accelerated SM discovery and exploitation significantly. For example, the newly introduced CRISPR system has revolutionized genetic engineering and made it possible to work directly in a diverse array of sequenced fungal species for easy SM gene discovery and pathway elucidation. Moreover, the fungal toolbox for efficient heterologous gene expression is continually evolving and contributes as an essential complementary technology to forward understanding SM genetics and biochemistry. Importantly, the heterologous gene expression toolbox is instrumental in the development of future SM cell factories based on well-characterized industrially relevant host species. Similarly, this toolbox is also a requirement towards expanding the fungal chemical space by providing the platform of technology for the construction of tailor-made biosynthetic pathways to produce non-natural compounds.

DISCOVERY OF SECONDARY METABOLITE PATHWAYS IN NATURAL HOSTS

Genetically accessible fungal strains are essential for the discovery of silent pathways and subsequent elucidation. However, genetic engineering is for most filamentous fungi complicated by the fact that non-homologous end-joining (NHEJ), rather than homologous recombination (HR), is the preferred fungal pathway for chromosomal DNA integration (4,5). Some methods have been developed to enhance integration by HR, including the use of bipartite markers to select for HR proficient protoplast since only transformants that reconstitute a full functional marker by recombination are favored in selection (6,7). Another more active line of the strategy is the permanent or transient elimination of genes that are essential for NHEJ. Deleting the genes homologous to human KU70 and KU80 in Neurospora crassa resulted in homologous integration events in 100% of transformants, compared to 10 to 30% for a wild-type recipient. Similar results were observed in A. nidulans (8), and both studies show the improved efficiency of HR by deleting the KU genes. The CRISPR technology has/can considerably reinforce the success rate for correct

Page 39 3. Fungal Synthetic Biology Tools

integration, as well as disruption. Establishing systems and methods for correct and rapid gene editing is critical for further engineering in filamentous fungi.

CRISPR Cas9 in filamentous fungi

Recently, the famous CRISPR/Cas system has been introduced in fungi allowing speedy and accurate genetic engineering. The popularity of the system has been instantaneous, and the fungal CRISPR toolbox is rapidly expanding. The system is showing to be highly compatible with a wide range of species from a different genus, including Aspergillus, Trichoderma, Penicillium, and Alternaria (9–13). The Cas enzymes applied are riboprotein nucleases that are guided to the target sequence by the protospacer component of the guide RNA (gRNA), which gets embedded in the protein structure. In order to be efficiently cleaved, a target sequence needs to be complementary to the protospacer and contain a PAM sequence, e.g., NGG for Cas9, see Figure 1A. The Cas specificity is accessible to re- program since the protospacer complementary sequence of the gRNA can be easily changed. Repair of the Cas induced DNA double-strand breaks can be used for genetic engineering typically by serving a DNA substrate for repair. This repair template can be double-stranded DNA and contain a new gene to be expressed or no gene to introduce a gene deletion, and even simple oligonucleotides can be used as repair templates allowing the introduction of small specific mutations (14). Importantly, CRISPR/Cas is exceptionally efficient, and modifications can be introduced at the site of the break without the need for an accompanying selectable marker for integration. Even multiplexing is possible by expressing several gRNAs at once. Three different principles have achieved the delivery of the Cas protein component and the gRNA. Firstly, Cas-gRNA complexes may be assembled in vitro and then transformed into the fungus (13); secondly, a strain containing a cas9 gene copy in its genome can be transformed with gRNA species allowing the Cas-gRNA complex to be assembled in vivo (15); and thirdly, genes encoding Cas and gRNA can be transformed into the fungus allowing for in vivo Cas-gRNA assembly. To minimize the possibility of off-target effects, it may be desirable to minimize the Cas-gRNA reaction time and for that reason experiments that are based on gRNA and cas gene expression often harbor either the gRNA gene or both the gRNA and the cas gene on a AMA1-based plasmids, figure 1B, that can easily be lost in the absence of selection (13). To deliver gRNAs in vivo, systems based on both Pol II and Pol III promoters as well as systems that liberate gRNAs from more abundant transcripts via ribozymes or via the cellular tRNA processing machinery are available (13). To increase the repertoire, two different Cas enzymes, Cas9 and Cpf1, with different PAM sequences, 5'-NGG-3' and 5'-TTTN-3', respectively, have so far been introduced for fungi to broaden the repertoire of sequences that can be engineered by CRISPR (16).

Page 40 3. Fungal Synthetic Biology Tools

Figure 1 – CRISPR Cas9 system for filamentous fungi. A. Illustration of the Cas9 nuclease guide- RNA complex targeting a sequence-specific site for a double-stranded break in the genomic DNA 5' of the PAM. B. AMA1 based expression cassette for both gRNA and Cas9 expression simultaneously. The construct can harbor several different markers depending on the desired selection.

Gene-expression cassettes

Gene-expression cassettes are essential components in the discovery and engineering of fungal biosynthetic pathways to produce NPs. The many assembly methods available for constructing a variety of expression cassettes are thoroughly described in the 2019 Moore review (17). In this section of the review, we will, therefore, focus on what we find essential for the engineering of filamentous fungi. Establishing a straightforward procedure for construction and assembly of gene- expression cassettes can be both timesaving and cost-efficient. One practical and useful approach is to organize libraries of synthetic bio-blocks with different functionalities and develop systems that allow them to be easily fused to functional units, see Figure 2A. Here we define bio-blocks as "functional fragments of DNA that can be fused by your favorite method to produce larger synthetic biological circuits." Typical bio-blocks are promoters, terminators, selectable markers, protein tags for purification or protein visualization, and protein sorting and processing sequences, which with a gene of interest (GOI) form the gene-expression cassette. Additionally, the bio-blocks can also be used for assembly with homologous gene-targeting substrates containing the gene-expression cassette for integration into specific sites in the genome of a host strain (18,19), or be designed to introduce gene modifications. Several systems have been implemented for single-step seamless joining of bio-blocks and GOIs. These include in vitro fusion by PCR, E. coli mediated USER-fusion, Gibson assembly, and Golden Gate cloning, as well as in vivo

Page 41 3. Fungal Synthetic Biology Tools

assembly by homologous recombination in either Saccharomyces cerevisiae or a filamentous fungus (6,20–23), See Figure 2B and Moore review for more details.

Figure 2 - Gene-expression cassettes (GEC) for filamentous fungi. A. Bio-block systems can be assembled using various approaches; seamless assembly or standard overhang assembly using, e.g., USER Phusion. B. Gene-expression cassette construction, right; overlay PCR using standard PCR primers. Middle; USER Phusion using uracil-modified primers and Gibson cloning. In both cases, can the construct be amplified through a transformation in E. coli. Left; homologous assembly through PCR-fragment transformation directly in the suitable host or through another organism with an efficient HR partway, e.g., Saccharomyces cerevisiae.

Gene-expression cassettes may also fit into cloning vectors designed for random ectopic multi-copy genome integration by NHEJ or, as mentioned for specific integration into defined chromosomal expression sites by homologous recombination (HR), see Figure 3. For more complex processes or pathways, where several genes need to be expressed, it is possible to simplify expression cassettes of multiple genes by constructing expression cassettes with polycistronic genes, where the Open Reading Frames (ORF) are separated by sequences encoding the picornavirus 2A peptide sequence. Individual enzymes are released from the standard transcript as the ribozyme fails to connect the C-terminal glycine and proline residues of the 2A peptide sequence during translation (24). In addition, AMA1/BAC based fungal artificial chromosomes have recently been introduced as an expression vector that allows the transfer of substantial multi-gene fragments (25,26).

Page 42 3. Fungal Synthetic Biology Tools

Figure 3 - Expression of synthetic gene-expression cassettes in filamentous fungi. Plasmid-based, e.g., using the AMA1 fungal artificial chromosomes, or through unspecific genomic integration by non-homology end joining, or through homology-directed repair for a locus-specific integration.

Activation of silent BGCs in the native host

Several successful strategies to uncovering and exploiting the hidden SM potential in silent BGCs have been presented in the literature (27–29), and here we will focus on gene activation based on synthetic biology methods, e.g., promoter swap or overexpression of a BGC-embedded TF. Essential reasons for lack of gene activity in a native host at laboratory conditions is often the lack of expression from relevant transcription factors and that genes are positioned in heterochromatin (30). It is not uncommon for filamentous fungi to embed pathway- specific TFs necessary for activating in the BGCs. In these cases, the genes within the BGC can often be activated by swapping the native TF-gene promoter for a bio-block containing an active constitutive- or inducible promoter. Alternatively, the TF ORF may be inserted into a gene-expression cassette, which is integrated elsewhere in the genome or harbored on an AMA1-based plasmid. This technique was pioneered by Bergman and co-workers, who discovered the cluster for aspyridone using the approach (31). By amplifying a putative TF activator from genomic DNA, subsequently cloning it into an expression vector and transforming a native strain of Aspergillus nidulans, an induced transformant revealed the production of two new major products and two minor. The two major products turned out to be aspyridones. In another study, activation of the silent trichosetin BGC in Fusarium fujikuroi was obtained by expressing a cluster-embedded TF under the control of the inducible Tet-on system (32). However, the expression of putative TF genes present in BGCs does not always lead to local gene activation (33), as heterochromatin may prevent access to the target genes. Moreover, the TF could also act as a repressor rather than an activator (34), or an additional partner TFs or inducers are needed to bind to the relevant promotes, or simply the TF has nothing to do with gene activation in the BGC. In case the native TF is too weak to activate the genes in the cluster, synthetic hybrid TFs can be made by fusing the native TF, or its DNA-binding domain, to a strong activation domain. In this way, activation of a gene can be enhanced by a synthetic TF that binds to its normal

Page 43 3. Fungal Synthetic Biology Tools

position in the promoter. This principle has been used to activate the silent gene cluster for the production of asperlin (35). The technique becomes particularly useful in situations with incorrectly annotated genes of a target cluster, were promoter replacement for a gene can end in the expression of a gene fragment only. It is important to note that a consequence of using strong promoters to activate TF encoding genes can be abnormally high TF regulatory protein concentrations. This may lead to undesirable and unlinked changes in the composition of the metabolome and morphology due to off-target binding of the TF to promoters of genes that it usually does not control (36). To overcome some of this "noise," it is recommended to design the expression of a TF with an inducible and tunable promoter since a controlled, and moderate expression of the TF might help to reach a more natural level of the regulatory protein. However, not all BGCs contain a TF encoding gene, and in these cases, it may be necessary to equip all genes in the cluster with new promoter bio-blocks. This can be a quite elaborate strategy and is usually only applied for BGCs that contain a few genes. A risk of using promoter swap methods is that it depends on correctly annotated genes. In cases where the transcription initiation start site is not accurately defined, it may be necessary to make several versions of the synthetic gene to increase the chances of successful SM enzyme production.

Global regulation on and beyond chromatin level

Global regulation of multiple BGCs is facilitated by the fact that a proportion of BGCs is positioned in chromosomal locations that are associated with heterochromatin, which will result in a silencing of the genes. Activation, therefore, requires a transition from hetero- to euchromatin, which is mainly controlled by the methylation and acetylation status on histone tails of nucleosomes. For example, tri-methylation of lysine 9 or 27 on H3-tails leads to heterochromatin formation (37,38), whereas euchromatin is associated with acetylation of lysine 9 and 14 in the H3-tails (39). Several global chromatin structure regulators are known, and by controlling their activity, it has been possible to alter the SM profiles of filamentous fungi to uncover new compounds, usually due to silent BGCs. As a general approach, some similar effects may also be observed by supplementing cultivation media with histone tail modifying compounds (40,41). The most characterized example of a chromatin-remodeling factor in filamentous fungi is the SAGA complex, which consists of approximately 20-polypeptide protein subunits (42). One of the proteins in the complex is GcnE, a histone acetyltransferase, which in increased amounts has resulted in significant activation of several BGCs (39). Also, as reported by both David Cánovas et al. and Marcel Nossmann et al., GcnE plays a central role in the regulation of Aspergillus asexual development, which demonstrated that SM regulation and development are sharing more

Page 44 3. Fungal Synthetic Biology Tools

levels of control (43,44). Interestingly, in Saccharomyces cerevisiae, the SAGA complex is involved in the transcriptional regulation of 12 % of the yeast genome. Approximately one- third of this 12 % are downregulated, and two-thirds are upregulated in gcn5Δ cells (45), implying a direct or indirect negative role of Gcn5. The observation that GcnE plays an SM downregulating role in global gene regulation has been exploited by Wang and co-workers to stimulate SM production in Aspergillus niger FGSC A1279 (46). Specifically, the deletion of gcnE in this strain resulted in the production of 12 polyketide compounds that were not observed in the corresponding reference strain. Among the 12 compounds were known and unknown compounds. Similar work, including the elimination of a gene, cclA, involved in methylation of H3K4, has also been conducted in Aspergillus nidulans (47). Here, several silent BGCs were activated, including a novel BGC responsible for the production of monodictyphenone, emodin, and emodin derivatives. The ability to influence regulation of SM production on a larger scale without directly interacting on histones was demonstrated with the discovery of LaeA, which is a conserved protein among Aspergilli. LaeA is a part of the Velvet complex that governs the entries into sexual and asexual proliferation, and this developmental regulation also involves several BGCs. The exact function of LaeA has been cumbersome to demonstrate. However, the consensus is that LaeA contains a binding site also found in nuclear protein methyltransferases (48). Several studies have shown that overproduction of LaeA resulting in a net increase in SM production and has led to the elucidation of previously uncharacterized metabolites. Correspondingly, the deletion of laeA has a dramatic downregulation of secondary metabolism (49). Another interesting recent discovery, equal to LaeA, is the McrA transcription factor found in A. nidulans, a negative multicluster regulator. Elimination of the encoding gene in A. nidulans, along with homologs in Aspergillus terreus and Penicillium canescens, stimulated the production of several compounds compared to a wild-type strain and might function as a universal tool for cluster activation in unexplored close-related organisms (50). Another example of an additional layer to control SM production is through SUMOylation. In general, SUMOylation is involved in adaptation to stress, cell growth, and division in a wide range of eukaryotic organisms, including fungi. Recent studies in fungi have shown that SUMOylation is required for fungal development, stress responses, and pathogenicity (51,52). However, deletion of sumO encoding the small ubiquitin-like protein SUMO reduced the production of austinol, dehydroaustinol, and sterigmatocystin in Aspergillus nidulans, conversely, absence of sumO led to the production of asperthecin, and the sumOΔ strain was used to elucidate the pathway of this compound (53). Interfering with major cellular regulatory factors can cause pleiotropic effects that may affect perturbations in SM production, where some are indirect. Therefore, proper precautions have to be taken when inferring a role in the cellular stress of the influenced compounds.

Page 45 3. Fungal Synthetic Biology Tools

Linking fungal biosynthetic gene clusters to secondary metabolite products

After discovering a novel compound based on activation from a global regulator, a specific BGC may not be given. Using bioinformatics can aid in locating BGC candidates responsible for the production of the compound of interest. The era of whole-genome sequencing, with initiatives such as Aspergillus whole-genus sequencing project and the 1000 fungal genomes project (http://genome.jgi.doe.gov/) together with tools for gene-expression, correlation-based prediction of BGCs (54), and applications like the fungal antiSMASH (55), has helped to simplify and ease the procedure for detecting and identifying new BGCs responsible for the production of NPs. Moreover, with BGC predictions and gene annotations available, it is likewise now possible to scan through whole-genome sequences and identify BGCs responsible for the production of known classes of SMs in silico (56). When using bioinformatics as a stepping stone, synthetic biology tools can now be applied in the next steps towards activating, pin-point BGC boundaries, and elucidating pathways. Strategies depend on whether the BGC is active in the native host or not. If the BGC is active, tools that allow for rapid gene deletions will be applied, and this will typically involve tools for the construction of gene-deletion cassettes in combination with CRISPR technology and/or NHEJ-deficient strains to allow for efficient gene targeting, see figure 4. If the SM BGC is not expressed and hereby not active in the native host, which the majority is not under standard laboratory conditions, synthetic biology tools for gene activation can be applied. This will typically involve, as mentioned earlier, using gene cassettes that contain alternative promoters for gene activation, expression cassettes that encode new synthetic TFs, constructs that encode proteins that change heterochromatin into euchromatin, or gene transfer into a new host for heterologous expression. A wide variety of integration strategies accompanied by several kinds of promoters have been introduced to facilitate high or tuneable gene-expression over a range of species. Many of these systems have initially been developed for protein expression, but, later applied in filamentous fungi to produce NPs have resulted in the discovery of new and useful compounds. Having a broad selection of promoter systems is an asset for the fungal community, and the continual development of new systems and platforms will increase the speed and quality of the discoveries to come.

Page 46 3. Fungal Synthetic Biology Tools

Figure 4 – Bioinformatics tools have enhanced the progress for secondary metabolite discoveries. Illustration of how interactions between bioinformatics (upper) and molecular tools (lower) can straighten both fields. Sequencing, assembly, and computer models can aid in the discovery and location of fascinating novel BGCs. On the other hand, verification of compounds from BGCs through various biosynthetic approaches can straighten and fine-tune the bioinformatics tool, e.g., by machine learning.

DISCOVERY AND CHARACTERIZATION USING HETEROLOGOUS EXPRESSION

Transfer of a BGC to a heterologous host can often be a profitable strategy. One advantage of this strategy is that the new host often offers a more developed synthetic biology toolbox that can be applied for cluster reconstruction. The apparent reason for heterologous expression is the accessibility to manipulate pathways, gain higher yield, and more straightforward elucidation, but also the possibility for the expression of genes or entire BGCs from species uncultivable under standard laboratory conditions (57). It is a known problem that not all filamentous fungi will grow in the laboratory, or sometimes at best are growing inconveniently slow. Not to mention the complication of working with pathogenic organisms. Here, the heterologous expression strategy might be the only option. Combination strategies with both promoter exchange and heterologous expression have also been successfully performed. In view of this, geodin was produced in Aspergillus nidulans by transferring the geodin BGC from Aspergillus terreus by a PCR- based method that allowed the promoter of the TF-encoding gene in the geodin producing BGC to be replaced by the strong constitutive Aspergillus nidulans promoter, PgpdA (58). Other successful examples using the approach includes asperfuranone and monacolin K

Page 47 3. Fungal Synthetic Biology Tools

(23,59). Recently, the BGC for producing psilocybin in the mushroom Psilocybe cubensis was restructured into a synthetic polycistronic based gene, where sequences encoding the 2A peptide separated each ORF. Expression of the gene in Aspergillus nidulans successfully resulted in psilocybin production (60). Similarly, the system was used for heterologous production of the cellobiohydrolase enzyme Cel7A from Penicillium funiculosum in Trichoderma reesei based on a polycistronic gene that also contained the code for eGFP (24). From the investigation, it was shown that eGFP can work as a fluorescent marker in Trichoderma reesei and that the transgene expression levels of cbh1 could be directly linked to that of eGFP. Choosing the ideal gene-expression system for a heterologous BGC requires several considerations regarding intended expression level, the impact of the natural product on the fungus, and more. An inducible promoter can, in many cases, solve the issue of unintended overproduction of a BGC product, a dilemma apparent when the novel natural product exhibits toxic effects on the host or when investigating essential genes. However, the activation source for the heterologous inducible promoter can be problematic by itself. In Aspergillus species, the activators of the widely used carbon source-dependent PalcA and PamyB promoters have shown to affect the general morphology of mycelia in regulating the target gene expression (61). Not necessarily a problem when expressing a natural product. However, the thiamine-regulatable thiA promoter (PthiA) in Aspergillus oryzae was investigated in the same study and showed no apparent influences on the morphology of the fungus. For constitutive promoters, the Aspergillus nidulans glyceraldehyde-3-phosphate dehydrogenase promoter (PgpdA) is a well-studied and reliable go-to promoter (62,63), and similar homologs can be found in other species (64). The promoter is still used in studies for efficient overexpression of regulatory proteins, here among the global regulator LeaA (65). A common feature for many of the promoters in filamentous fungi is the metabolism dependence. However, the highly useful orthogonal Tet-On and Tet-Off systems have been implemented for fungi allowing for tuneable gene expression by induction of doxycycline (66). A novel natural product named fumipyrrole was discovered in Aspergillus fumigatus using the Tet-On system. By inducing the modified strain with doxycycline, a putative transcription factor (TF) was overexpressed, resulting in the biosynthesis of 5- benzyl-1H-pyrrole-2-carboxylic acid (fumipyrrole) (67). Further enhancement of the expression output of the Tet-on system can be reached through a coupled transcriptional regulator from the terrein biosynthetic pathway found in Aspergillus terreus, namely the terR gene. The system was used with great success in Aspergillus niger in combination with the picornavirus 2A self-cleaving peptide sequence to express polycistronic mRNA for the production of Asp-melanin (68).

Page 48 3. Fungal Synthetic Biology Tools

An alternative tuneable expression system has been developed by using a weak constitutive expressed synthetic TF (sTF), and an sTF-dependent promoter with an adjustable binding site region regulating the target gene (69). The expression levels of the gene can be varied by changing the number of binding-site sequences upstream of the sTF-dependent promoter. The promoter system has been demonstrated to be highly applicable in different species, including Saccharomyces cerevisiae, Aspergillus niger, and Trichoderma reesei (70).

Fungal cell factories

Filamentous fungi as cell factories for the production of useful chemicals are broadly described in the literature (71–73). Since numerous strains have been used in the industry for a long time (74), several have been certified as "generally recognized as safe" (GRAS) by the Food and Drug Administration (U.S.A), as well as the World Health Organisation. Penicillium chrysogenum, the producer of penicillin and the precursor 6-aminopenicillic acid (6-APA), is one example of a GRAS fungal cell factory genetically modified through multiple studies to both optimize yields and generate derivatives (75). Other GRAS filamentous fungi include Aspergillus niger and Aspergillus oryzae. Here both organisms have undergone extensive studies on primary and secondary metabolism and therefore are exceptional candidates for cell factories concerning product formation bottlenecks and the ability to tolerate extreme cultivation conditions (76). Most filamentous fungi possess an elaborate secondary metabolism producing compounds derived from isoprenoids, polyketides, non-ribosomal peptide scaffolds that are decorated by a myriad of tailoring enzymes (77). Thus, filamentous fungi are from nature designed to produce SMs, hence building blocks for producing SMs may be plentiful. Heterologous expressing a fungal pathway in a fungal cell factory should, therefore, be straightforward with all the advantages of having precursors and cellular machinery available. However, the rich chemistry in filamentous fungi can also complicate both downstream analysis and lead to cross chemistry, where intermediates undesired are taken up by other pathways, thereby jeopardizing the desired product (78,79).

Optimization of fungal cell factories

Optimizing fungal cell factories for the production of SMs is important for performance and cost-efficiency. The Oakley group developed in 2013 a system for heterologous expression in Aspergillus nidulans. This study included optimization of the fungus by deleting several unwanted SM BGCs to avoid any interference with the analysis of the expressed gene products, as well as the removal of toxic effects that could hinder the growth of the fungus (23). Other approaches include increasing the available precursors. For the production of polyketide molecules in Aspergillus nidulans, overexpressing factors

Page 49 3. Fungal Synthetic Biology Tools

involved in the formation of acetyl-CoA can lead to notable higher levels of the desired NP (80). For the production of penicillin in Aspergillus nidulans, overexpressing the first step of the biosynthesis resulted in a 30-fold higher production, and through this, an important limiting step was identified. (81). However, not all approaches need to be on the genetic level. For the production of lovastatin in Aspergillus terreus, it was shown that adding microparticles to a preculture fermentation could decrease the fungal pellet size and improve lovastatin production. (82). The challenges of engineering well-functional SM pathways in fungal cell factories include, among others, sound expression systems, suitable regulatory responses, and well- annotated genes. The goal is of cause to obtain a high-quality NP in quantities favorably for the downstream task needed. However, the optimization of heterologous expression systems and streamlined hosts also has its limits. An alternative route could be to direct the localization of the pathway components into better suitable cell organelles. Subcellular compartmentalization regarding the biosynthesis of SMs is gaining more and more interest, especially the biosynthesis of aflatoxin in Aspergillus parasiticus have been studied particularly, which could serve as a guide (83). Some of the apparent benefits of subcellular compartmentalization are more controllable access to substrates, a lower rate of intermediate byproduct formation, and decreased toxic effects on the cell (84). Some pathways may originate in the cytoplasm but might be more productive in a higher pH environment with low concentrations of oxygen. Hence, redirecting the pathway enzymes to the mitochondria could result in a better yield. Many biosynthetic pathways in plants and some reported fungal biosynthetic pathways are already known to use compartmentalization to control and ensure processes concerning the substrate availability, transportation of intermediates, regulation of flux, and protection against endotoxicity as well as oxidative environments (85). For yeast, many of the necessary specific organelle-targeting signals have already been well-characterized (84,86). Learning from yeast and studies on aflatoxin in Aspergillus could bring about a better fungal cell factory for the production of SMs. Signal sequences and sorting proteins are already known to play a crucial role in the secondary metabolism biosynthesis (87). Correct cellular compartmentalization has likewise been proved to utilize complex multistep processes, and the function of the compartments work as barriers to bring enzymes together and keep the pathways apart from the rest of the cellular machinery (84). In the production of penicillin G seen in Penicillium chrysogenum and the model organism Aspergillus nidulans, the penicillanic acid acyltransferase is naturally localized to the peroxisomes, wheres the ACV synthetase (AcvA) and isopenicillin N synthase (IpnA) resides in the cytosol. Targeting AcvA to the peroxisomes can increase the production of penicillin G by 3.2-fold, wheres targeting IpnA removes any trace of the natural product. Further, increasing the number of peroxisomes by overexpressing pexK also increases the production of penicillin in Aspergillus nidulans (88,89). One could speculate that in the natural pathway, a high yield

Page 50 3. Fungal Synthetic Biology Tools

might not be the preferred objective for the organism, and, in that lies a potential for cell factory optimization to gain higher output. In comparison with heterologous protein production in filamentous fungi, it is known that bottlenecks often lie at post- transcriptional steps, possibly in the vesicle sorting proteins involved in the secretory pathway (90). Hence, locating bottlenecks through organelle markers fused with visualization tags (e.g., eGFP, mCherry, etc.) and subsequently overexpressing the relevant compartments or proteins, if possible, could furthermore be beneficial in the production of SMs. Mutations in the sorting nexins have shown to cause incorrect compartmentation of melanin, and therefore, loss of function in the context of protection against UV- radiation in both Aspergillus fumigatus and Aspergillus nidulans. Here the endosomes play an essential part in the early biosynthesis of melanin, where the mature melanin is exported through exocytosis with the help of nexins sorting proteins and other non- conventional secretory pathways (87). Research indicates that loss of transmembrane domains and cellular target sequences of enzymes involved in a pathway will, in most cases, leads to an abolishment of the specific compound of interest (91). It is, therefore, not a straightforward task to just altering the compartmentalization of a given pathway. Studying the nature of the chemical reactions in the pathway could give clues to the best suitable environment for a given pathway. However, redirecting a biosynthetic route will probably end in the abolishment of the product in most cases. On the other hand, a higher return through optimized compartmentalization could be worth the research invested.

EXPANDING THE CHEMICAL SPACE VIA BIOCOMBINATORIAL SYNTHETIC BIOLOGY

A powerful ability in applying bioengineering is no doubt the means of creating optimized pathways for known compounds in an easy-to-handle heterologous host and, using enzymes from other pathways to create derivatives of already bioactive NPs or even combining enzymatic domains across compound classes to constitute innovative products. For a schematic overview, see figure 5.

Synthetic Pathways for Production of Natural and Non-natural Products

Fungal cell factories based on synthetic and semi-synthetic pathways for the production of NPs are most often used when one or more enzymatic steps in a pathway are unknown, or when the enzymes in the pathway are incompatible with the fungal cellular infrastructure. The latter could be the case if the aim is to produce a plant metabolite where the natural production occurs in the chloroplast. A study by Okada et al. demonstrated the potential of fungi as heterologous SM producers and as platforms to enhance the chemical space of bioactive molecules. These authors constructed an Aspergillus oryzae based cell factory for the production of daurichromenic acid (DCA), a meroterpenoid with anti-HIV activities, which is naturally produced by the plant

Page 51 3. Fungal Synthetic Biology Tools

Rhododendron dauricum (92). Production of DCA was achieved via a semi-synthetic pathway based on genes from several species. Specifically, the authors exploited that the fungus Stachybotrys bisbyi produce ilicicolin B from grifolic acid [56], which is also the precursor of DCA (93). Based on these insights, an Aspergillus oryzae strain producing grifolic acid was constructed by heterologous expression of stbA and stbC from Stachybotrys bisbyi. Next, the cyclase encoding gene (DCA synthase accession number: LC184180) from Rhododendron dauricum was introduced in the grifolic acid-producing Aspergillus oryzae strain to create a cell factory for DCA production. Recently, a production of the natural red food colorant carminic acid (E120) acid in Aspergillus nidulans was achieved via a semi-natural pathway (94). This serves as an example of fungal-assisted product synthesis. Carminic acid, CA, is a glycosylated polyketide (95) commercially obtained from the scale insect Dactylopius coccus, which lives on the cactus Opuntia cacti (94). The establishment of a fungal CA cell factory was complicated by the fact that insects usually do not produce polyketides, and the origin of CA hence was unclear. Moreover, only a single enzyme of the natural pathway, the glycosyltransferase that catalyzes the C-glycosylation of flavokermesic acid (FK) and kermesic acid (KA), has been identified; and this activity is encoded by the nuclear Dactylopius coccus gene DcUGT2 (95). The first hurdle for the heterologous production of CA in Aspergillus nidulans was to produce the cyclic polyketide precursor scaffold FK. This challenge was mitigated by combining the activity of three enzymes of different origins. First, the non-reduced linear octaketide was produced using a plant type III polyketide synthase, encoded by an octaketide synthase (OKS) gene from Aloe arborescens. Folding of the formed chain was then directed by a cyclase (ZhuI) and aromatase (ZhuJ) from Streptomyces sp. R1128, resulting in the formation of the aromatic FK anthrone that spontaneously oxidizes to FK. Interestingly, the next step, conversion of FK into KA, was achieved via an endogenous monooxygenase activity encoded by an unknown gene in Aspergillus nidulans. Completion of the CA pathway in A. nidulans was achieved by inserting the Dactylopius coccus gene, DcUGT2, into the OKS, ZhuI, and ZhuJ expressing strain (94). Interestingly, the endogenous monooxygenase activity of Aspergillus nidulans proved to be the bottleneck of the semi-natural pathway and serves as a logical target for optimization of the fungal carminic acid cell factory, for a schematic strategy overview see figure 5A. The natural chemical space of SMs can also be enhanced by mixing enzymatic activities that belong to two or more different pathways. This strategy may turn out even more fruitful because biosynthetic enzymes may be promiscuous and accept a range of similar substrates. Hence, if two pathways, typically from two different species, contain intermediates with similar functional groups, mixing of enzymes belonging to the two pathways may create cross chemistry to produce non-native compounds. Swapping of enzymes among pathways with the same class compounds can yield new analogs of

Page 52 3. Fungal Synthetic Biology Tools

already known and applied NPs, see figure 5B. The requirement for the formation of alternative versions or decoration of a compound backbone is only provided if the enzymes introduced to the pathway can recognize and act on the precursors. Examples of successful reengineering of SMs can be tracked more than thirty years back, with one example being a gene transfer between several Streptomyces species resulting in new analogs of the antibiotic compound actinorhodin (96). Work conducted in filamentous fungi is so far less comprehensive compared to organisms like Streptomyces and Saccharomyces cerevisiae (97–99). In recent studies, two groups have redesigned and heterologous expressed pathways for the production of bioactive meroterpenoids. Filamentous fungi are well-known producers of meroterpenoids, and the literature gives several examples of bioactive compounds and their biosynthetic pathways (100–102). The meroterpenoids have been applied in both agriculture and human healthcare as effective insecticides and pharmaceuticals against various diseases. In the Axel Brakhage lab, the austinoid biosynthetic pathway was rewired to produce different derivatives. By rearrangement of genes between three known austinoid producing species, Aspergillus calidoustus, Aspergillus nidulans, and Penicillium brasilianum, they were able to build several new analogs of the known insecticide (103). In addition to the abovementioned establishment of the DCA pathway in Aspergillus oryzae by Okada et al., the additional introduction of a halogenase derived from Fusarium sp. resulted in the biosynthesis of (+)-5-chlorodaurichromenic acid. The antibacterial activity of the new derivative exceeded the original compounds (92). Combinatorial pathway engineering, together with a comparative analysis of genomes, makes it possible to reuse enzyme-encoded genes from already known BGCs to build a variety of new products in heterologous hosts. These semi-natural pathways may have original outputs, but established compounds with a redesigned pathway in new hosts may also be of interest to more industrially favored conditions. However, since it is not given that the combinatorial pathway components will be localized in the right compartments, not even if the components can interact, we foresee that some consideration and analysis/prediction of the cellular compartmentalization before expressing genes from different heterologous pathways can support in better yield, secure intermediate protection, and assist in a more stable product formation. To aid in this analysis, we recommend online tools like DeepLoc-1.0 (104), WoLF PSORT (105), and SignalP 4.0 (106). All algorithms predict the localization of the protein based on the amino acid sequence either by comparing known sorting signal motifs, location of signal peptide cleavage sites, or alignment of homologs with evidence of subcellular localization from knowledge databases, e.g., Uniprot. It must be acknowledged that all algorithms described here only predict and are not absolute. It is recommended to use them combined, as this will, in all probability, strengthen the predicted localization of the protein.

Page 53 3. Fungal Synthetic Biology Tools

Figure 5 - Synthetic and Semi-synthetic pathways together with combinatorial biochemistry bring novel SMs. A. Reconstruction of natural partway in fungal cell factories, e.g., through genes from various sources. B. Shuffling genes from different pathways and species can result in new derivatives and non-native metabolites. C. Reprogramming of enzymes through domain swap can produce new non-native SM scaffolds as well as new chemical decorations.

Synthetic Enzymes for Production of Non-Native Products

Most SM compound backbones in filamentous fungi are constructed by multi-domain proteins, where the domains define, which substrates are accepted, and how they are processed. When these abundant iterative or modular enzymes belong to a specific class, e.g., polyketide synthases (PKS) or non-ribosomal peptide synthetases (NRPS), it may be possible to swap domains between related synthases/synthetases to produce novel synthetic enzymes producing new non-native SMs scaffolds, see figure 5C. These scaffolds can then be further decorated by tailoring enzymes derived from the clusters hosting the synthetic backbone producing the enzyme, or by tailoring enzymes that are recruited using

Page 54 3. Fungal Synthetic Biology Tools

a bioinformatics approach. Reprogramming enzymes by swapping the domains between phylogenetically close-related entities has proved successful in both PKSs, NRPSs, and NRPS-like enzymes. New functional non-reduced PKSs (NR-PKSs) can be generated and heterologously expressed with new modifications such as replacing the reducing (R) domain with a thioesterase (TE) domain or vice versa. Small alterations to the decoration of a backbone or changes in the folding pattern all depend on the magnitude, rearrangement, and the number of domain swaps completed in the particular enzyme. As mentioned, by replacing an R domain with a phylogenetic close TE domain in an NR-PKS, Hsu-Hua Yeh and co-workers changed an aldehyde functionality of a natural product to a carboxylic moiety in Aspergillus nidulans (107). A small alteration in the molecule, but a very significant change that could, in specific scenarios, result in a new or induced bioactivity. NRP- and NRP- like synthetases only differ in the presence of the peptide-bond forming condensation domain (C). Therefore, both contain an amino acid selective adenylation domain (A). Rearranging the A domain, and hence, the amino acid can have a significant consequence on the produced SMs. In a study from the Clay C. C. Wang lab, three NRPS- like enzymes from Aspergillus terreus were investigated for retaining activity after domains were swapped among each other. By shuffling the A and T domains between NRPSs responsible for the biosynthesis of respectively aspulvinone E, butyrolactone IIa, and phenguignardic acid, the group was able to produce a new natural product phenylbutyrolactone IIa (108). The same lab also showed that it is possible to swap the SAT domain from the asperfuranone PKS (AfoE) with that of sterigmatocystin (StcA). Thus, they were creating a novel SM to the producing Aspergillus nidulans strain (109). The research illustrates the possibilities to engineer PKS, NRPS, and NRPS-like enzymes by recombining domains and retain the activity and intactness of the protein. Hybrids between the different compound classes have also been subjected to synthetic manipulation. Great work paving the way in PKS-NRPS engineering includes the heterologous expression of the tenellin synthetase (TENS) in Aspergillus oryzae. The PKS- NRPS system, originating from Beauveria bassiana, was subjected to an intensive investigation that led to a more widespread understanding of the fungal A domain selectivity (110). In 2010, the Tang group demonstrated that it is possible to separate a fungal PKS-NRPS into two independent working modules (111). Moreover, an extensive study in 2014 by the E. W. Schmidt group revealed the importance of the substrate selectivity of the C domain in the generation of recombinant products from a synthetic PKS-NRPS system (112). The assembly of a functional cross-species chimeric PKS-NRPS expressed in Aspergillus nidulans was achieved by swapping the module of two PKS-NRPS natural hybrids CcsA from Aspergillus clavatus involved in the biosynthesis of cytochalasin E and the related Syn2 from the rice plant pathogen Magnaporthe oryzae. The remodeling of the hybrid

Page 55 3. Fungal Synthetic Biology Tools

system resulted in two novel hybrid products, as well as four new pseudo-pre-cytochalasin intermediates, niduclavin, and niduporthin, along with the chimeric compounds niduchimaeralin A and B (113).

PERSPECTIVES

Synthetic biology is an emerging field in filamentous fungal molecular biology, that is already acting as a driver in the development of new cell factories and new scientific discoveries. As described above, the modular structure of SM synthases/synthetases is already being exploited by combining enzyme-domain bio-blocks to produce new SM backbones, as well as utilizing bio-blocks of different tailoring enzyme activities, which can be combined in new ways to establish pathways for the production of new compounds. In the future, we envision that large libraries containing parts of SM pathways for simple reshuffling will be constructed and that the resulting new synthetic pathways will contribute to a significant increase in the chemical space based on backbone structures that have already proven biological successful. Further technological developments will likely be inspired by the much more advanced tools that exist for the yeast S. cerevisiae (114). Compared to yeast, filamentous fungi have been more challenging to work with mainly because they often use NHEJ rather than HR for the integration of DNA, resulting in lower transformation efficiency. Moreover, transformed strains are more difficult to purify due to heterokaryon formation. However, implementation of NHEJ deficient strains and the CRISPR/Cas technology in filamentous fungi is quickly catching up, making genetic engineering as efficient as in S. cerevisiae. A bottleneck towards further progress is the low throughput of fungal transformation. New methods are needed to allow simple automated protocols for transformation and strain purification; This will bring synthetic fungal biology to the next stage, where large mutant libraries can be generated, screened for desired effects, and further manipulated on a mass scale. Furthermore, it will allow for the development of cell factories with minimal genomes to eliminate unwanted cell functions or reduce genes, which are not needed during production, but which still consume energy. Along these lines, one may envision that entirely synthetic fungi, inspired by the synthetic yeast 2.0 project (115), may be developed. In parallel, other specific synthetic biology tools will be developed. For example, the construction of fungal synthetic transcription factors is already being developed, which in the future may serve as the primary tool towards the activation of silent gene clusters by constructing synthetic chromatin remodeling factors that predictably opens heterochromatin structure in a specific gene cluster as well as transcription factors that are designed to activate specific genes. Perhaps nucleolytic inactive dCas variants acting as transcription factors (116) could be developed into a powerful tool in this context. Synthetic biology derived sensors for detecting metabolites have been developed in S. cerevisiae and E. coli, and it is easy to

Page 56 3. Fungal Synthetic Biology Tools

envision that similar systems could be used advantageously in fungi that are used as cell factories for primary and SM production.

REFERENCES

1. Endo A. A historical perspective on the discovery of statins. Proc Jpn Acad Ser B Phys Biol Sci. 2010;86(5):484–493.

2. Razzaghi-Abyaneh M, Chang PK, Shams-Ghahfarokhi M, Rai M. Global health issues of aflatoxins in food and agriculture: Challenges and opportunities. Front Microbiol [Internet]. 2014;5(AUG). Available from: www.frontiersin.org

3. Jain C, Khatana S, Vijayvergia R. Bioactivity of secondary metabolites of various plants: A review. Int J Pharm Sci Res. 2019;10(2):494–504.

4. Nayak T, Szewczyk E, Oakley CE, Osmani A, Ukil L, Murray SL, et al. A versatile and efficient gene-targeting system for Aspergillus nidulans. Genetics [Internet]. 2006;172(3):1557–1566. Available from: www.broad.mit.edu/annotation/

5. Ninomiya Y, Suzuki K, Ishii C, Inoue H. From The Cover: Highly efficient gene replacements in Neurospora strains deficient for nonhomologous end-joining. Proc Natl Acad Sci [Internet]. 2004;101(33):12248–12253. Available from: www.pnas.orgcgidoi10.1073pnas.0402780101

6. Nielsen ML, Albertsen L, Lettier G, Nielsen JB, Mortensen UH. Efficient PCR-based gene targeting with a recyclable marker for Aspergillus nidulans. Fungal Genet Biol [Internet]. 2006;43:54–64. Available from: www.elsevier.com/locate/yfgbi

7. Schrettl M, Beckmann N, Varga J, Heinekamp T, Jacobsen ID, Jö Chl C, et al. HapX- Mediated Adaption to Iron Starvation Is Crucial for Virulence of Aspergillus fumigatus. 2010; Available from: www.plospathogens.org

8. Nielsen JB, Nielsen ML, Mortensen UH. Transient disruption of non-homologous end-joining facilitates targeted genome manipulations in the filamentous fungus Aspergillus nidulans. Fungal Genet Biol. 2008;45(3):165–170.

9. Liu R, Chen L, Jiang Y, Zhou Z, Zou G. Efficient genome editing in filamentous fungus Trichoderma reesei using the CRISPR/Cas9 system. Cell Discov. 2015 May;1.

10. Katayama T, Tanaka Y, Okabe T, Nakamura H, Fujii W, Kitamoto K, et al. Development of a genome editing technique using the CRISPR/Cas9 system in the industrial filamentous fungus Aspergillus oryzae. Biotechnol Lett. 2016 Apr;38(4):637–642.

Page 57 3. Fungal Synthetic Biology Tools

11. Pohl C, Kiel JAKW, Driessen AJM, Bovenberg RAL, Nyg\aard Y. CRISPR/Cas9 Based Genome Editing of Penicillium chrysogenum. ACS Synth Biol. 2016 Jul;5(7):754– 764.

12. Wenderoth M, Pinecker C, Voß B, Fischer R. Establishment of CRISPR/Cas9 in Alternaria alternata. Fungal Genet Biol. 2017 Apr;101:55–60.

13. Nødvig CS, Nielsen JB, Kogle ME, Mortensen UH. A CRISPR-Cas9 system for genetic engineering of filamentous fungi. PLoS ONE [Internet]. 2015;10(7):e0133085. Available from: http://www.ncbi.nlm.nih.gov/pubmed/26177455

14. Nødvig CS, Hoof JB, Kogle ME, Jarczynska ZD, Lehmbeck J, Klitgaard DK, et al. Efficient oligo nucleotide mediated CRISPR-Cas9 gene editing in Aspergilli. Fungal Genet Biol [Internet]. 2018 Jun;115:78–89. Available from: https://linkinghub.elsevier.com/retrieve/pii/S1087184518300045

15. Gao Y, Zhao Y. Self‐processing of ribozyme‐flanked RNAs into guide RNAs in vitro and in vivo for CRISPR‐mediated genome editing. J Integr Plant Biol [Internet]. 2014 Apr;56(4):343–349. Available from: http://doi.wiley.com/10.1111/jipb.12152

16. Vanegas KG, Dorota Jarczynska Z, Strucko T, Mortensen UH. Cpf1 enables fast and efficient genome editing in Aspergilli. Fungal Biol Biotechnol [Internet]. 2019;6:6. Available from: https://doi.org/10.1186/s40694-019-0069-6

17. Zhang JJ, Tang X, Moore BS. Genetic platforms for heterologous expression of microbial natural products. Nat Prod Rep [Internet]. 2019 Sep 18;36(9):1313–32. Available from: https://pubs.rsc.org/en/content/articlelanding/2019/np/c9np00025a

18. Hansen BG, Salomonsen B, Nielsen MT, Nielsen JB, Hansen NB, Nielsen KF, et al. Versatile Enzyme Expression and Characterization System for Aspergillus nidulans, with the Penicillium brevicompactum Polyketide Synthase Gene from the Mycophenolic Acid Gene Cluster as a Test Case †. Appl Environ Microbiol [Internet]. 2011;77(9):3044–3051. Available from: http://aem.asm.org/

19. Guo C-J, Knox BP, Sanchez JF, Chiang Y-M, Bruno KS, C Wang CC, et al. Application of An Efficient Gene Targeting System Linking Secondary Metabolites to Their Biosynthetic Genes in Aspergillus terreus NIH Public Access Author Manuscript. Org Lett [Internet]. 2013;15(14). Available from: http://pubs.acs.org

20. Nour-Eldin HH, Hansen BG, Nørholm MHH, Jensen JK, Halkier BA. Advancing uracil-excision based cloning towards an ideal technique for cloning PCR fragments. Available from: www.neb.com/nebecomm/ManualFiles/manualE5500.pdf

Page 58 3. Fungal Synthetic Biology Tools

21. Gibson DG, Young L, Chuang R-Y, Craig Venter J, Hutchison III CA, Smith HO. Enzymatic assembly of DNA molecules up to several hundred kilobases. Nat METHODS [Internet]. 2009;6(5). Available from: http://npg.nature.com/reprintsandpermissions/

22. Engler C, Gruetzner R, Kandzia R, Marillonnet S. Golden Gate Shuffling: A One-Pot DNA Shuffling Method Based on Type IIs Restriction Enzymes. PLoS ONE [Internet]. 2009;4(5):5553. Available from: www.plosone.org

23. Chiang Y-M, Elizabeth Oakley C, Ahuja M, Entwistle R, Schultz A, Chang S-L, et al. An Efficient System for Heterologous Expression of Secondary Metabolite Genes in Aspergillus nidulans. 2013; Available from: https://pubs.acs.org/sharingguidelines

24. Subramanian V, Schuster LA, Moore KT, Taylor LE, Baker JO, Wall TAV, et al. A versatile 2A peptide-based bicistronic protein expressing platform for the industrial cellulase producing fungus, Trichoderma reesei. Biotechnol Biofuels [Internet]. 2017;10:34. Available from: https://biotechnologyforbiofuels.biomedcentral.com/track/pdf/10.1186/s13068- 017-0710-7

25. Woo Bok J, Ye R, Clevenger KD, Mead D, Wagner M, Krerowicz A, et al. Fungal artificial chromosomes for mining of the fungal secondary metabolome. 2011; Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC4413528/pdf/12864_2015_Articl e_1561.pdf

26. Clevenger KD, Bok JW, Ye R, Miley GP, Verdan MH, Velk T, et al. A scalable platform to identify fungal secondary metabolites and their gene clusters. Nat Chem Biol. 2017;

27. Ren H, Wang B, Zhao H. Breaking the silence: new strategies for discovering novel natural products. Curr Opin Biotechnol [Internet]. 2017;48:21–27. Available from: http://dx.doi.org/10.1016/j.copbio.2017.02.008

28. Reen FJ, Romano S, Dobson ADW, O’Gara F. The sound of silence: Activating silent biosynthetic gene clusters in marine microorganisms. Mar Drugs. 2015;13(8):4754–4783.

29. Brakhage AA, Schroeckh V. Fungal secondary metabolites: Strategies to activate silent gene clusters. Fungal Genet Biol [Internet]. 2011;48:15–22. Available from: 10.1016/j.fgb.2010.04.004

30. Reyes-Dominguez Y, Woo Bok J, Berger H, Keats Shwab ‡ E, Basheer A, Gallmetzer A, et al. Heterochromatic marks are associated with the repression of secondary metabolism clusters in Aspergillus nidulans. 2010; Available from: http://www3.interscience.wiley.com/

Page 59 3. Fungal Synthetic Biology Tools

31. Bergmann S, Schümann J, Scherlach K, Lange C, Brakhage AA, Hertweck C. Genomics-driven discovery of PKS-NRPS hybrid metabolites from Aspergillus nidulans. Available from: https://www-nature- com.proxy.findit.dtu.dk/articles/nchembio869.pdf

32. Janevska S, Arndt B, Baumann L, Apken LH, Maciel Mauriz Marques L, Humpf H-U, et al. Establishment of the Inducible Tet-On System for the Activation of the Silent Trichosetin Gene Cluster in Fusarium fujikuroi. Available from: www.mdpi.com/journal/toxins

33. Ahuja M, Chiang Y-M, Chang S-L, Praseuth MB, Entwistle R, Sanchez JF, et al. Illuminating the diversity of aromatic polyketide synthases in Aspergillus nidulans. Available from: http://www.broadinstitute.org/annotation/genome/aspergillus_group/MultiHom e.html

34. Macpherson S, Larochelle M, Turcotte B. A Fungal Family of Transcriptional Regulators: the Zinc Cluster Proteins. Microbiol Mol Biol Rev [Internet]. 2006;70(3):583–604. Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1594591/pdf/0015-06.pdf

35. Grau MF, Entwistle R, Chiang Y-M, Ahuja M, Oakley ▽ C Elizabeth, Akashi T, et al. Hybrid Transcription Factor Engineering Activates the Silent Secondary Metabolite Gene Cluster for (+)-Asperlin in Aspergillus nidulans. ACS Chem Biol [Internet]. 2018;13:23. Available from: http://fungidb.org/

36. Bromann K, Toivari M, Viljanen K, Vuoristo A, Ruohonen L, Nakari-Setälä T. Identification and characterization of a novel diterpene gene cluster in Aspergillus nidulans. Goldman GH, editor. PLoS ONE [Internet]. 2012 Apr;7(4):e35450. Available from: http://dx.plos.org/10.1371/journal.pone.0035450

37. Palmer JM, Perrin RM, Dagenais TRT, Keller NP. H3K9 methylation regulates growth and development in Aspergillus fumigatus. Eukaryot Cell [Internet]. 2008 Dec;7(12):2052–60. Available from: http://www.ncbi.nlm.nih.gov/pubmed/18849468 http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=PMC2593193

38. Chujo T, Scott B. Histone H3K9 and H3K27 methylation regulates fungal alkaloid biosynthesis in a fungal endophyte-plant symbiosis. Mol Microbiol [Internet]. 2014 Apr;92(2):413–434. Available from: http://doi.wiley.com/10.1111/mmi.12567

39. Nützmann H-W, Reyes-Dominguez Y, Scherlach K, Schroeckh V, Horn F, Gacek A, et al. Bacteria-induced natural product formation in the fungus Aspergillus nidulans requires Saga/ Ada-mediated histone acetylation. Available from: www.pnas.org/cgi/doi/10.1073/pnas.1103523108

Page 60 3. Fungal Synthetic Biology Tools

40. Vander Molen KM, Darveaux BA, Chen W-L, Swanson SM, Pearce CJ, Oberlies NH. Epigenetic Manipulation of a Filamentous Fungus by the Proteasome-Inhibitor Bortezomib Induces the Production of an Additional Secondary Metabolite. RSC Adv [Internet]. 2014 Jan;4(35):18329–18335. Available from: http://www.ncbi.nlm.nih.gov/pubmed/24955237 http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=PMC4061710

41. Bai J, Mu R, Dou M, Yan D, Liu B, Wei Q, et al. Epigenetic modification in histone deacetylase deletion strain of Calcarisporium arbuscula leads to diverse diterpenoids. Acta Pharm Sin B. 2018 Jul;8(4):687–697.

42. Georgakopoulos P, Lockington RA, Kelly JM. The Spt-Ada-Gcn5 Acetyltransferase (SAGA) Complex in Aspergillus nidulans. PLoS ONE [Internet]. 2013;8(6):65221. Available from: http://www.aspgd.org/

43. Cánovas D, Marcos AT, Gacek A, Ramos MS, Gutiérrez G, Reyes-Domínguez Y, et al. The histone acetyltransferase GcnE (GCN5) plays a central role in the regulation of Aspergillus asexual development. Genetics. 2014;197(4):1175–1189.

44. Nossmann M, Boysen JM, Krüger T, König CC, Hillmann F, Thomas Munder ·, et al. Yeast two-hybrid screening reveals a dual function for the histone acetyltransferase GcnE by controlling glutamine synthesis and development in Aspergillus fumigatus. 2019;65:523–538. Available from: https://doi.org/10.1007/s00294-018-0891-z

45. Ihn Lee T, Causton HC, P Holstege FC, Shenk W-C, Hannett N, Jennings EG, et al. Redundant roles for the TFIID and SAGA complexes in global transcription The transcription factors TFIID and SAGA are multi-subunit complexes involved in transcription by RNA polymerase II 1,2. TFIID and SAGA contain common TATA- binding protein (TBP)-asso [Internet]. 2000. Available from: www.nature.com

46. Wang B, Li X, Yu D, Chen X, Tabudravu J, Deng H, et al. Deletion of the epigenetic regulator GcnE in Aspergillus niger FGSC A1279 activates the production of multiple polyketide metabolites. Microbiol Res [Internet]. 2018;217:101–107. Available from: www.elsevier.com/locate/micres

47. Woo Bok J, Chiang Y-M, Szewczyk E, Reyes-Dominguez Y, Davidson AD, Sanchez JF, et al. Chromatin-level regulation of biosynthetic gene clusters. Nat Chem Biol [Internet]. 2009;5. Available from: http://www.nature.com/naturechemicalbiology/

48. Bok JW, Keller NP. LaeA, a regulator of secondary metabolism in Aspergillus spp. Eukaryot Cell [Internet]. 2004 Apr;3(2):527–35. Available from: http://www.ncbi.nlm.nih.gov/pubmed/15075281 http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=PMC387652

Page 61 3. Fungal Synthetic Biology Tools

49. Kale SP, Milde L, Trapp MK, Frisvad JC, Keller NP, Bok JW. Requirement of LaeA for secondary metabolism and sclerotial production in Aspergillus flavus. Fungal Genet Biol. 2008 Oct;45(10):1422–1429.

50. Oakley CE, Ahuja M, Sun WW, Entwistle R, Akashi T, Yaegashi J, et al. Discovery of McrA, a master regulator of Aspergillus secondary metabolism. Mol Microbiol. 2017;103(2):347–365.

51. You -J I N, Li M, Kim K-T, Yo Ng -Hw AD, Ee AL. SUMOylation is required for fungal development and pathogenicity in the rice blast fungus Magnaporthe oryzae. Available from: http://cfgp.riceblast.snu.ac.kr

52. Gujjula R, Veeraiah S, Kumar K, Thakur SS, Mishra K, Kaur R. Identification of Components of the SUMOylation Machinery in Candida glabrata ROLE OF THE DESUMOYLATION PEPTIDASE CgUlp2 IN VIRULENCE *. 2016; Available from: http://www.jbc.org/

53. Szewczyk E, Chiang Y-M, Elizabeth Oakley C, Davidson AD, C Wang CC, Oakley BR. Identification and Characterization of the Asperthecin Gene Cluster of Aspergillus nidulans †. Appl Environ Microbiol [Internet]. 2008;74(24):7607–7612. Available from: http://www.broad.mit

54. Andersen MR, Nielsen JB, Klitgaard A, Petersen M, Zachariasen M, Hansen TJ, et al. Accurate prediction of secondary metabolite gene clusters in filamentous fungi. Available from: www.pnas.org/cgi/doi/10.1073/pnas.1205532110

55. Blin K, Shaw S, Steinke K, Villebro R, Ziemert N, Lee SY, et al. antiSMASH 5.0: updates to the secondary metabolite genome mining pipeline. Nucleic Acids Res [Internet]. 2019;47(W1):W81–W87. Available from: https://docs.antismash.

56. Theobald S, Vesth TC, Rendsvig JK, Nielsen KF, Riley R, de Abreu LM, et al. Uncovering secondary metabolite evolution and biosynthesis using gene cluster networks and genetic dereplication. Sci Rep [Internet]. 2018;8(1). Available from: https://doi.org/10.1038/s41598-018-36561-3

57. Magnuson JK, Lasure LL, Richland W. Fungal diversity in soils as assessed by direct culture and molecular techniques. 102nd Gen Meet Am Soc Microbiol Salt Lake City [Internet]. 2002;19–23. Available from: http://www.pnl.gov/biobased/docs/fungal_diversity.pdf

58. Nielsen MT, Nielsen JB, Anyaogu DC, Holm DK, Nielsen KF. Heterologous Reconstitution of the Intact Geodin Gene Cluster in Aspergillus nidulans through a Simple and Versatile PCR Based Approach. PLoS ONE [Internet]. 2013;8(8):72871. Available from: www.plosone.org

Page 62 3. Fungal Synthetic Biology Tools

59. Sakai K, Kinoshita H, Nihira T. Heterologous expression system in Aspergillus oryzae for fungal biosynthetic gene clusters of secondary metabolites. Appl Genet Mol Biotechnol [Internet]. Available from: 10.1007/s00253-011-3657-9

60. Hoefgen S, Lin J, Fricke J, Stroe MC, Mattern DJ, Kufs JE, et al. Facile assembly and fluorescence-based screening method for heterologous expression of biosynthetic pathways in fungi. Metab Eng. 2018 Jul;48:44–51.

61. Shoji JY, Maruyama JI, Arioka M, Kitamoto K. Development of Aspergillus oryzae thiA promoter as a tool for molecular biological studies. FEMS Microbiol Lett. 2005;244(1):41–46.

62. Punt PJ, Dingemanse MA, Jacobs-Meijsing BJ, Pouwels PH, AMJJ van den Hondel C. Isolation and characterization of the glyceraldehyde-3-phosphate dehydrogenase gene of Aspergillus nidulans. 1988 p. 49–57.

63. Punt PJ, Dingemanse MA, Kuyvenhoven A, Seede RDM, Peuwels PH, Van Den Hondel CAMJ. Functional elements in the promoter region of the Aspergillus nidulans gpdA gene encoding glycer-aldehyde-3-phosphate dehydrogenase. 1990 p. 1–109.

64. Paul S, Stacey Klutts J, Scott Moye-Rowleya W. Analysis of promoter function in Aspergillus fumigatus. Eukaryot Cell. 2012 Sep;11(9):1167–1177.

65. Yu J, Han H, Zhang X, Ma C, Sun C, Che Q, et al. Discovery of two new sorbicillinoids by overexpression of the global regulator LaeA in a marine-derived fungus Penicillium dipodomyis YJ-11. Mar Drugs [Internet]. 2019;17(8). Available from: www.mdpi.com/journal/marinedrugs

66. Park Y-N, Morschhäuser J. Tetracycline-Inducible Gene Expression and Gene Deletion in Candida albicans. Eukaryot CELL [Internet]. 2005;4(8):1328–1342. Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC1214539/pdf/0155-05.pdf

67. Macheleidt J, Scherlach K, Neuwirth T, Schmidt‐Heck W, Straßburger M, Spraker J, et al. Transcriptome analysis of cyclic AMP-dependent protein kinase A–regulated genes reveals the production of the novel natural compound fumipyrrole by Aspergillus fumigatus. Mol Microbiol [Internet]. 2015 [cited 2020 Jan 22];96(1):148–62. Available from: https://onlinelibrary.wiley.com/doi/abs/10.1111/mmi.12926

68. Geib E, Brock M. ATNT: an enhanced system for expression of polycistronic secondary metabolite gene clusters in Aspergillus niger. Fungal Biol Biotechnol [Internet]. 2017;4. Available from: https://doi.org/10.1186/s40694-017-0042-1

Page 63 3. Fungal Synthetic Biology Tools

69. Rantasalo A, Landowski CP, Kuivanen J, Korppoo A, Reuter L, Koivistoinen O, et al. A universal gene expression system for fungi. Nucleic Acids Res. 2018;46(18):e111.

70. Rantasalo A, Vitikainen M, Paasikallio T, Jäntti J, Landowski CP, Mojzita D. Novel genetic tools that enable highly pure protein production in Trichoderma reesei. Available from: https://doi.org/10.1038/s41598-019-41573-8

71. Punt PJ, Van Biezen N, Conesa A, Albers A, Mangnus J, Van Den Hondel C. Filamentous fungi as cell factories for heterologous protein production. TRENDS in Biotechnology; 2002.

72. Nevalainen KMH, Te’o VSJ, Bergquist PL. Heterologous protein expression in filamentous fungi. Vol. 23. TRENDS in Biotechnology; 2005. 468–474 p.

73. Meyer V, Wu B, Ram AFJ. Aspergillus as a multi-purpose cell factory: Current status and perspectives. Vol. 33. Bioethanol; 2011. 469–476 p.

74. Frisvad JC, Møller LLH, Larsen TO, Kumar R, Arnau J. Safety of the fungal workhorses of industrial biotechnology: update on the mycotoxin and secondary metabolite potential of Aspergillus niger, Aspergillus oryzae, and Trichoderma reesei. Available from: https://doi.org/10.1007/s00253-018-9354-1

75. Guzmán-Chávez F, Zwahlen RD, Bovenberg RAL, Driessen AJM. Engineering of the filamentous fungus Penicillium chrysogenumas cell factory for natural products. Vol. 9. Frontiers Media S.A.; 2018.

76. Kis-Papo T, Oren A, Wasser SP, Nevo E. Survival of filamentous fungi in hypersaline Dead Sea water. Microb Ecol. 2003;45(2):183–190.

77. Keller NP. Fungal secondary metabolism: regulation, function and drug discovery. Nat Rev Microbiol [Internet]. 2019 Mar;17(3):167–180. Available from: http://www.nature.com/articles/s41579-018-0121-1

78. Scharf DH, Brakhage AA. Engineering fungal secondary metabolism: A roadmap to novel compounds. J Biotechnol. 2013 Jan;163(2):179–183.

79. Anyaogu DC, Mortensen UH. Heterologous production of fungal secondary metabolites in Aspergilli. Front Microbiol. 2015;6(FEB):1–6.

80. Panagiotou G, Andersen MR, Grotkjaer T, Regueira TB, Nielsen J, Olsson L. Studies of the production of fungal polyketides in Aspergillus nidulans by using systems biology tools. Appl Environ Microbiol. 2009 Apr;75(7):2212–2220.

81. Kennedy J, Turner G. δ(L-α-Aminoadipyl)-L-cysteinyl-D-valin synthetase is a rate limiting enzyme for penicillin production in Aspergillus nidulans. Mol Gen Genet. 1996;253(1–2):189–197.

Page 64 3. Fungal Synthetic Biology Tools

82. Gonciarz J, Bizukojc M. Adding talc microparticles to Aspergillus terreus ATCC 20542 preculture decreases fungal pellet size and improves lovastatin production. Eng Life Sci [Internet]. 2014 [cited 2020 Jan 22];14(2):190–200. Available from: https://onlinelibrary.wiley.com/doi/abs/10.1002/elsc.201300055

83. Roze LV, Chanda A, Linz JE. Compartmentalization and molecular traffic in secondary metabolism: A new understanding of established cellular processes. Fungal Genet Biol [Internet]. 2011;48:35–48. Available from: 10.1016/j.fgb.2010.05.006

84. Kistler HC, Broz K. Cellular compartmentalization of secondary metabolism. Front Microbiol. 2015;6(FEB):1–11.

85. Heinig U, Gutensohn M, Dudareva N, Aharoni A. The challenges of cellular compartmentalization in plant metabolic engineering. Curr Opin Biotechnol [Internet]. 2013;24:239–246. Available from: http://dx.doi.org/10.1016/j.copbio.2012.11.006

86. Schrader M, Rostovtseva T, Erdmann R, Kunze M, Berger J. The similarity between N-terminal targeting signals for protein import into different organelles and its evolutionary relevance Mechanisms of Protein Translocation across Cellular Membranes. Front Physiol Wwwfrontiersinorg [Internet]. 2015;6:259. Available from: www.frontiersin.org

87. Upadhyay S, Xu X, Lowry D, Jackson JC, Roberson RW, Correspondence L. Subcellular Compartmentalization and Trafficking of the Biosynthetic Machinery for Fungal Melanin. Cell Rep [Internet]. 2016;14. Available from: http://dx.doi.org/10.1016/j.celrep.2016.02.059

88. Meijer WH, Gidijala L, Fekken S, Kiel JAKW, Van Den Berg MA, Lascaris R, et al. Peroxisomes Are Required for Efficient Penicillin Biosynthesis in Penicillium chrysogenum † Downloaded from. Appl Environ Microbiol [Internet]. 2010;76(17):5702–5709. Available from: http://aem.asm.org/.http://aem.asm.org/

89. Herr A, Fischer R. Improvement of Aspergillus nidulans penicillin production by targeting AcvA to peroxisomes. Metab Eng [Internet]. 2014;25:131–139. Available from: http://dx.doi.org/10.1016/j.ymben.2014.07.002

90. Kuratsu M, Taura A, Shoji J, Kikuchi S, Arioka M, Kitamoto K. Systematic analysis of SNARE localization in the filamentous fungus Aspergillus oryzae. Fungal Genet Biol [Internet]. 2007 Dec;44(12):1310–1323. Available from: https://www.sciencedirect.com/science/article/pii/S1087184507000874?via%3Di hub

91. Ban A, Tanaka M, Fujii R, Minami A, Oikawa H, Shintani T, et al. Subcellular localization of aphidicolin biosynthetic enzymes heterologously expressed in

Page 65 3. Fungal Synthetic Biology Tools

Aspergillus oryzae. Biosci Biotechnol Biochem [Internet]. 2018;82(1):139–147. Available from: http://www.tandfonline.com/action/journalInformation?journalCode=tbbb20

92. Okada M, Saito K, Wong CP, Li C, Wang D, Iijima M, et al. Combinatorial Biosynthesis of (+)-Daurichromenic Acid and Its Halogenated Analogue. 2017; Available from: https://pubs.acs.org/sharingguidelines

93. Iijima M, Munakata R, Takahashi H, Kenmoku H, Nakagawa R, Kodama T, et al. Identification and Characterization of Daurichromenic Acid Synthase Active in Anti-HIV Biosynthesis. Plant Physiol [Internet]. 2017 Aug;174(4):2213–2230. Available from: http://www.ncbi.nlm.nih.gov/pubmed/28679557

94. Frandsen RJN, Khorsand-Jamal P, Kongstad KT, Nafisi M, Kannangara RM, Staerk D, et al. Heterologous production of the widely used natural food colorant carminic acid in Aspergillus nidulans. Sci Rep [Internet]. 2018;8(1):12853. Available from: http://www.nature.com/articles/s41598-018-30816-9

95. Kannangara R, Siukstaite L, Borch-Jensen J, Madsen B, Kongstad KT, Staerk D, et al. Characterization of a membrane-bound C-glucosyltransferase responsible for carminic acid biosynthesis in Dactylopius coccus Costa. Nat Commun [Internet]. 2017;8(1). Available from: https://doi.org/10.1038/s41467-017-02031-z

96. Hopwood, D. A.; Malpartida, F.; Kieser, H. M.; Ikeda, H.; Duncan, J.; Fujii, I.; Rudd, B. A. M.; Floss, H. G.; Ōmura S. Production of “hybrid” antibiotics by genetic engineering. Nature. 1985;316:452–457.

97. Pham JV, Yilma MA, Feliz A, Majid MT, Maffetone N, Walker JR, et al. A review of the microbial production of bioactive natural products and biologics. Front Microbiol. 2019;10(JUN).

98. Bai J, Lu Y, Xu Y-M, Zhang W, Chen M, Lin M, et al. Diversity-Oriented Combinatorial Biosynthesis of Hybrid Polyketide Scaffolds from Azaphilone and Benzenediol Lactone Biosynthons. 2016; Available from: https://pubs.acs.org/sharingguidelines

99. Tang MC, Lin HC, Li D, Zou Y, Li J, Xu W, et al. Discovery of Unclustered Fungal Indole Diterpene Biosynthetic Pathways through Combinatorial Pathway Reassembly in Engineered Yeast. J Am Chem Soc [Internet]. 2015;137(43):13724– 13727. Available from: http://pubs.acs.org.

100. Matsuda Y, Wakimoto T, Mori T, Awakawa T, Abe I. Complete Biosynthetic Pathway of Anditomin: Nature’s Sophisticated Synthetic Route to a Complex Fungal Meroterpenoid. 2014;

101. Guo C-J, Knox BP, Chiang Y-M, Lo H-C, Sanchez JF, Lee K-H, et al. Molecular genetic characterization of a cluster in A. terreus for biosynthesis of the

Page 66 3. Fungal Synthetic Biology Tools

meroterpenoid terretonin NIH Public Access Author Manuscript. Org Lett [Internet]. 2012;14(22):5684–5687. Available from: https://www.ncbi.nlm.nih.gov/pmc/articles/PMC3538129/pdf/nihms-419265.pdf

102. Matsuda Y, Iwabuchi T, Fujimoto T, Awakawa T, Nakashima Y, Mori T, et al. Discovery of Key Dioxygenases that Diverged the Paraherquonin and Acetoxydehydroaustin Pathways in Penicillium brasilianum. 2016; Available from: https://pubs.acs.org/sharingguidelines

103. Mattern DJ, Valiante V, Horn F, Petzke L, Brakhage AA. Rewiring of the Austinoid Biosynthetic Pathway in Filamentous Fungi. 2017; Available from: https://pubs.acs.org/sharingguidelines

104. Juan J, Armenteros A, Kaae Sønderby C, Kaae Sønderby S, Nielsen H, Winther O. DeepLoc: prediction of protein subcellular localization using deep learning.

105. Horton P, Park K-J, Obayashi T, Fujita N, Harada H, Adams-Collier CJ, et al. WoLF PSORT: protein localization predictor. Nucleic Acids Res [Internet]. 2007;35:585– 587. Available from: www.arabidopsis.org

106. Nordahl Petersen T, Brunak S, von Heijne G, Nielsen H. SignalP 4.0: discriminating signal peptides from transmembrane regions [Internet]. 2011. Available from: http://www.nature.com/naturemethods/.

107. Yeh H-H, Chang S-L, Chiang Y-M, Bruno Ψ KS, Oakley Φ BR, Wu T-K, et al. Engineering fungal non-reducing polyketide synthase by heterologous expression and domain swapping NIH Public Access Author Manuscript. Org Lett [Internet]. 2013;15(4):756–759. Available from: http://pubs.acs.org.

108. Van Dijk JWA, Guo C-J, Wang CCC. Engineering Fungal Nonribosomal Peptide Synthetase-like Enzymes by Heterologous Expression and Domain Swapping. 2016; Available from: https://pubs.acs.org/sharingguidelines

109. Liu T, Chiang Y-M, Oakley BR, Wang CCC. Engineering of an “unnatural” natural product by swapping polyketide synthase domains in Aspergillus nidulans. Available from: http://pubs.acs.org.

110. Halo LM, Marshall JW, Yakasai AA, Song Z, Butts CP, Crump MP, et al. Authentic heterologous expression of the tenellin iterative polyketide synthase nonribosomal peptide synthetase requires cooexpression with an enoyl reductase. ChemBioChem. 2008;9(4):585–594.

111. Xu W, Cai X, Jung ME, Tang Y. Analysis of intact and dissected fungal polyketide synthase-nonribosomal peptide synthetase in vitro and in saccharomyces cerevisiae. J Am Chem Soc. 2010 Oct;132(39):13604–13607.

Page 67 3. Fungal Synthetic Biology Tools

112. Kakule TB, Lin Z, Schmidt EW. Combinatorialization of fungal polyketide synthase- peptide synthetase hybrid proteins. J Am Chem Soc. 2014 Dec;136(51):17882– 17890.

113. Nielsen ML, Isbrandt T, Petersen M, Mortensen H, Andersen MR, Hoof JB, et al. Linker Flexibility Facilitates Module Exchange in Fungal Hybrid PKS-NRPS Engineering. 2016;

114. Lian J, Mishra S, Zhao H. Recent advances in metabolic engineering of Saccharomyces cerevisiae: New tools and their applications. Metab Eng [Internet]. 2018 Nov;50:85–108. Available from: https://linkinghub.elsevier.com/retrieve/pii/S1096717618300028

115. Richardson SM, Stracquadanio G, Mitchell LA, Lee D, DiCarlo JE, Chandrasegaran S, et al. Design of a synthetic yeast genome. Science [Internet]. 2017;355(6329):1040–1044. Available from: http://science.sciencemag.org/

116. Jensen ED, Ferreira R, Jakočiūnas T, Arsovska D, Zhang J, Ding L, et al. Transcriptional reprogramming in yeast using dCas9 and combinatorial gRNA strategies. Microb Cell Fact [Internet]. 2017;16:46. Available from: https://www.ncbi.nlm.nih.gov

Page 68 4. Acurin A, a novel hybrid compound

Acurin A, a novel hybrid compound, biosynthesized by individually translated PKS- and NRPS-encoding genes in Aspergillus aculeatus

Peter B. Wolff a,1, Maria L. Nielsena,1, Jason C. Slotb, Lasse N. Andersena, Lene M. Petersena, Thomas Isbrandta, Dorte K. Holma, Uffe H. Mortensena, Christina S. Nødviga, Thomas O. Larsen*a, Jakob B. Hoof*a

a Department of Biotechnology and Biomedicine (DTU Bioengineering), Technical University of Denmark, Søltofts Plads, Building 221/223, 2800 Kgs. Lyngby (Denmark). *E-mail: [email protected]/[email protected]. b Department of Plant Pathology, The Ohio State University, 481C Kottman Hall, 2021 Coffey Road, Columbus, OH 43210 (USA). 1 These authors have contributed equally to this work.

Abstract

This work presents the identification and proposed biosynthetic pathway for a compound of mixed polyketide-nonribosomal peptide origin that we named acurin A. The compound was isolated from an extract of the filamentous fungus Aspergillus aculeatus, and its core structure resemble that of the mycotoxin fusarin C produced by several Fusarium species. Based on bioinformatics in combination with RT-qPCR experiments and gene-deletion analysis, we identified a biosynthetic gene cluster (BGC) in A. aculeatus responsible for the biosynthesis of acurin A. Moreover, we were able to show that a polyketide synthase (PKS) and a nonribosomal peptide synthetase (NRPS) enzyme separately encoded by this BGC are responsible for the synthesis of the PK-NRP compound, acurin A, core structure. In comparison, the production of fusarin C is reported to be facilitated by a linked PKS-NRPS hybrid enzyme. Phylogenetic analyses suggest the PKS and NRPS in A. aculeatus resulted from a recent fission of an ancestral hybrid enzyme followed by gene duplication. In addition to the PKS- and NRPS-encoding genes of acurin A, we show that six other genes are influencing the biosynthesis including a regulatory transcription factor. Altogether, we have demonstrated the involvement of eight genes in the biosynthesis of acurin A, including an in-cluster transcription factor. This study highlights the biosynthetic capacity of A. aculeatus and serves as an example of how the CRISPR/Cas9 system can be exploited for the construction of fungal strains that can be readily engineered.

Keywords: Aspergillus aculeatus, CRISPR/Cas9, Secondary metabolism, Acurin A, hybrid compound, PKS, NRPS.

Page 69 4. Acurin A, a novel hybrid compound

1. Introduction

The Aspergillus genus contains several species that are used as industrial workhorses in biotechnology. Importantly, this includes species that are potential producers of mycotoxins that may pose a risk to human health (Bennett and Klich, 2003). For example, Aspergillus niger is a recognized producer of both ochratoxin A and fumonisin B2 (Frisvad et al., 2011). Importantly, by identifying the genetics that is necessary for the production of mycotoxins, it is possible to create safe production strains as the relevant secondary metabolite (SM) encoding genes can be eliminated. Aspergillus aculeatus is known to produce several industrially relevant enzymes (Banerjee et al., 2007; Suwannarangsee et al., 2014) and numerous bioactive SMs (Andersen et al., 1977; Hayashi et al., 1999; Petersen et al., 2014), e.g., secalonic acid toxins, the anti-insectan okaramines, and the antifungal calbistrins. Moreover, an analysis of its genome has uncovered 71 Biosynthetic Gene Clusters (BGCs), indicating that its potential for the production of SMs is substantial (JGI portal; Vesth et al., 2018). The BGC count are based on a locus, which include a gene that encode the main scaffold of the SM; either polyketide synthases (PKSs, 23), non-ribosomal synthetases (NRPSs, 18), PKS-NRPS hybrids (4), NRPS-likes (21), terpene cyclases (TCs, 4)/prenyl transferases (PTs, 3). The scaffold producing enzymes utilizes different building blocks. Thus, PKSs typically polymerize acyl-CoA starter units with malonyl-CoA extender units for synthesis, NRPSs require ATP-activated amino acids (proteinogenic and non- proteinogenic), whereas TC/PT uses C5-isoprenoid units. Depending on the respective enzyme type and organization, the PKS may, or may not, reduce and methylate the scaffold, where the specificity and promiscuity of amino-acid selection in NRPSs reside in the adenylation domain. In addition, the genes that code for the scaffold function are typically flanked by other genes that participate in the biosynthesis of the SM by decorating or modifying the scaffold(s) or regulates the production. Assigning genes to a BGC requires experimental validation. To date, only a few SMs (e.g., aculinic acid, aculenes, and Acu-dioxomorpholine A (Lee et al., 2019; Petersen et al., 2015; Robey et al., 2018)) have been linked experimentally to their corresponding BGC. For example, aculinic acid is synthesized from the polyketide (PK) 6-methylsalicylic acid (6-MSA), which is a precursor of other PKs, including the mycotoxin patulin (Puel et al., 2010). Therefore, considering the industrial potential of A. aculeatus, it is highly desirable to improve the genetic map of its SM metabolism to identify new

Page 70 4. Acurin A, a novel hybrid compound

bioactive compounds and uncover potential mycotoxins (Clevenger et al., 2017). Recently, efficient genetic tools, including CRISPR/Cas technology, have been introduced to A. aculeatus. To set the stage for efficient SM gene discovery, we have further elaborated on the genetic toolbox for A. aculeatus by constructing a non-homologous end joining (NHEJ) deficient strain mediated by CRISPR/Cas9, where subsequent gene-targeting efforts becomes highly efficient. Using bioinformatics, our chemical-analysis platform, and genetic toolbox, we set out to explore an unknown compound with the exact mass 373.1889 Da that we had previously identified in A. aculeatus (Petersen et al., 2015). Here we show that this compound is related to the mycotoxin fusarin C, which is produced by several Fusarium species (Cantalejo et al., 1999; Gelderblom et al., 1984; Niehaus et al., 2013; Song et al., 2004). We also identified the BGC responsible for the production of acurin A and proposed a biosynthetic pathway for its biosynthesis. Phylogenetic analyses suggest the PKS and NRPS in A. aculeatus resulted from a recent fission of an ancestral hybrid enzyme followed by gene duplication.

2. Materials and Methods

2.1. Strains and media

A list of all strains constructed in this study is provided in Table S1. Gene deletions in A. aculeatus was performed using strain ACU11 (pyrG1, akuAΔ), while overproduction of transcription factor AcrR was performed either ectopically for screening purposes using the NHEJ proficient strain ACU9 (pyrG1) (Nødvig et al., 2015), or specifically in ACU11 for gene deletions; both ACU11 and ACU9 are derived from the WT genome sequenced A. aculeatus ATCC16872 and have growth requirement for uridine. We used annotation v1.1 of the A. aculeatus genome sequence (Joint Genome Institute, JGI) or GenBank, NCBI, to retrieve relevant sequence information. Genomic DNA was extracted from A. aculeatus ATCC16872 using the FastDNATM SPIN Kit for Soil DNA extraction (MP Biomedicals, USA). Escherichia coli strain DH5α was used for plasmid propagation. Aspergillus solid and liquid minimal medium (MM), transformation medium (TM), and yeast extract sucrose (YES) medium was supplemented with 10 mM uridine and 10 mM uracil when necessary. MM and TM were prepared as described by Nødvig et al. (Nødvig et al., 2015), and YES was prepared as described in Samson et al. (Samson et al., 2010). E. coli was grown on solid- and in liquid Luria-Bertani (LB) medium containing 10 g/l

Page 71 4. Acurin A, a novel hybrid compound

tryptone (Bacto), 5 g/l yeast extract (Bacto), and 10 g/l NaCl (pH 7.0) supplemented with 100 µg/ml ampicillin.

2.2. Vector- and strain construction

All primers (Integrated DNA Technology, Belgium) used for amplification of A. aculeatus derived PCR fragments and qPCR are listed in Table S2. PCR fragments were generated using the PfuX7 polymerase (Nørholm, 2010), and plasmids were constructed by Uracil-Specific Excision Reagent (USER) fusion as described previously (Hansen et al., 2011; Nielsen et al., 2013) and were purified using the GenEluteTM Plasmid Miniprep Kit (Sigma-Aldrich). All constructed plasmids for gene deletions contained two SwaI restriction sites, the ampicillin-resistance gene and an origin of replication for propagation in E. coli. Plasmids for gene deletions were constructed based on pU2002A by introducing the PCR-amplified up- and downstream fragments into two PacI/Nt.BbvCI USER cassettes on each side of either the A. fumigatus/A. flavus pyrG marker (AFpyrG and AFLpyrG, respectively) flanked by a direct repeat (DR) sequence for marker recycling (pU2002A) (Hansen et al., 2011). The plasmid for ectopic overexpression of the acrR transcription factor in the A. aculeatus pyrG1 strain (Nødvig et al., 2015) was constructed by cloning of the PCR amplified acrR fragment into a vector (pU2115) containing the constitutive A. nidulans promoter PgpdA, the terminator TtrpC, and AFpyrG as well as targeting sequences for integration site 1, IS1, in A. nidulans (Hansen et al., 2011). Alternatively, the cloning vector for specific integration into IS1 in A. aculeatus was assembled from pU2002A using a combined Upstream targeting sequence with PgpdA and TtrpC split by a PacI/Nt.BbvCI USER cassette as one cloning part together with the downstream targeting sequence. After vector preparation with PacI and Nt.BbvCI, this vector could receive any gene such as acrA. The selection of AACU_IS1 targeting sequences were based on non- coding sequences placed close to what we believed were conserved and highly expressed genes as targeting regions. In this case between AACU_117954 and AACU_59915, see Table S2. As all gene deletions of putative BGC residing genes were carried out based on the pyrG1 akuAΔ strain background. The akuA (Protein ID 127270, encoding the NHEJ factor Ku70) was deleted in A. aculeatus pyrG1 by co-transforming a linearized gene-targeting substrate containing AFLpyrG gene flanked by a DR and an argB/AMA1-based CRISPR vector containing cas9 and akuA-targeting sgRNA (Nødvig et al., 2015) (see Nødvig et al., 2015; and Table S1). Plasmids for gene targeting were linearized prior to transformation with SwaI (New England Biolabs).

Page 72 4. Acurin A, a novel hybrid compound

2.3. Protoplastation and transformation

Spores from a single agar plate of A. aculeatus were harvested and grown over night in liquid yeast extract peptone dextrose (YPD) medium at 30 °C while shaking. The biomass was filtered through sterile Miracloth (EMD Millipore), washed with sterile Milli-Q water, and subsequently digested in a 50 ml Falcon tube in a 20 ml solution of 40 mg/ml Glucanex (Novozymes A/S) while shaking. For digestion, the biomass was incubated at 30 °C for approximately 3 hours at 150 rpm. Following digestion, the biomass was again filtered through sterile Miracloth and the flow-through was collected and centrifuged at 1200 x g for 10 min. The supernatant was discarded and the pellet was washed twice in ST buffer (1.0 M sorbitol; 50 mM Tris, pH 8.0). The final pellet was resuspended in approximately 2 ml STC buffer (1.0 M sorbitol; 50 mM Tris, pH 8.0; 50 mM 7 CaCl2) for a final concentration of 1.2x10 cells/ml. PCT buffer (40 % PEG 4000 in STC) was added to the protoplast suspension for a final concentration of approximately 20 % PEG. Transformation was performed using linearized plasmids as described by Nødvig et al. (Nødvig et al., 2015). Transformation plates were incubated at 30 °C until colonies appeared on the plates (5-10 days). All strains were verified as homokaryotic gene-deletion mutants by diagnostic tissue-PCR (see Fig. S1 for validation scheme and Fig. S2-7 for analysis of strains, and Table S3 for analysis parameters).

2.4. Molecular evolution analyses

Homologs of biosynthetic gene clusters in a database of 475 fungal genomes (Table S4) were defined as overlapping pairs of query gene homologs (as retrieved by usearch version 8.0.1517 (Edgar, 2010) using the ublast algorithm; sequences with at least 45 % amino acid similarity were retained) with a maximum of six intervening genes in each genome. Hybrid KS (Blin et al., 2019) and AMP binding (PF00501.28) domains were extracted from protein sequences using hmmer (v. 3.1b2) for analysis separately. For each domain and all unique genes in acurin and fusarin C BGC, phylogenies were constructed by first aligning amino acid sequences with mafft (v. 7.221) (Katoh and Standley, 2013) and removing ambiguously aligned characters with Trimal (v. 1.4) (Capella-Gutiérrez et al., 2009) using the automated method. Preliminary phylogenetic analyses constructed by fasttree (v. 2.1.7) (Price et al., 2010) were used to manually reduce alignments to strongly supported bipartitions, where required. Final phylogenies were inferred using maximum likelihood in IQ-TREE

Page 73 4. Acurin A, a novel hybrid compound

(v. 1.6.12) (Nguyen et al., 2015), with standard model selection and branch support assessed by 1000 ultrafast bootstraps.

2.5. RNA purification and RT-qPCR

RNA purification was conducted with the RNeasy Plus Mini Kit (Qiagen) in accordance with the supplied manual with an additional pre-step. A small scrape from a selected colony was transferred to a sterile 2 ml Eppendorf tube together with 1-3 sterile metal beads (d= 3 mm). The samples were placed in dry ice or liquid nitrogen for 2-3 min before being transferred to a Tissuelyser LT (Qiagen). The samples were lysed at a frequency of 45 Hz for 1:30 min. 350 µl RLT plus (from the kit) with 1 % β-mercaptoethanol was added and following were as described in manufacturer’s protocol. Complementary DNA synthesis was performed using the QuantiTech Reverse Transcription Kit (Qiagen) in accordance with manufacturer’s protocol, where all RNA samples were adjusted to 700 ng RNA/20 µl. RNA concentrations were measured using a Nanodrop lite spectrophotometer (Thermo Scientific). The QuantiTech SYBRR Green RT-PCR kit was used as mastermix for analysis of the selected genes. All primers were designed with a Tm range of 58-62 °C. The fragments were designed to be between 150-300 bp and, if possible, traversing an intron to distinguish mRNA from gDNA. All samples were analyzed on a Bio-Rad GFX connect Real-Time system. The PCR reaction mixture was as follows: 10 µl SYBR green, 2 µl of primer-f (10 M), 2 µl of primer-r (10 M), 2 µl diluted cDNA (25 times diluted), and Milli-Q water up to 20 µl. The PCR program was 95 °C for 5 min followed by 40 cycles of 95 °C for 10 s and 60 °C for 30 s. A melting curve test from 65 °C to 95 °C with reads every 0.2 min ended the program to evaluate the purity of the reaction products. All RT-qPCR data were normalized to two housekeeping genes; actA (Protein ID 1882512) and hhtA (Protein ID 1892954) for actin and histone 3, respectively. The normalized data were calculated using the following equations: Fold change = 2x, x = (geneOE-housekeepingOE)- (generef.-housekeepingref.). All RT-qPCR data were analyzed in triplicates and submitted to a significance test using a two-tailed t-test provided by Microsoft Excel.

2.6. Chemical analysis

All validated strains were cultivated on solid YES and MM medium as three- point stabs and incubated for 7 days at 30 °C. Plug extractions were performed as Smedsgaard et al. (Smedsgaard, 1997) with the exception that secondary metabolites were extracted with 3:1 ethylacetate:isopropanol containing 1%

Page 74 4. Acurin A, a novel hybrid compound

formic acid. The samples were analyzed on a maXis 3G orthogonal acceleration quadrupole time-of-flight mass spectrometer (Bruker Daltonics) equipped with an electrospray ionization (ESI) source and connected to an Ultimate 3000 UHPLC system (Dionex), equipped with a Kinetex 2.6 m C18, 100mm x 2.1 mm column (Phenomenex). The method applied was described by Holm et al.(Holm et al., 2014). MS/MS analysis were performed on an Agilent Infinity 1290 UHPLC system (Agilent Technologies, Santa Clara, CA, USA) equipped with a diode array detector. Separation was obtained on an Agilent Poroshell 120 phenyl- hexyl column (2.1 x 250 mm, 2.7 m) with a linear gradient consisting of water (A) and acetonitrile (B) both buffered with 20 mM formic acid, starting at 10 % B and increased to 100 % in 15 min where it was held for 2 min, returned to 10 % in 0.1 min and remaining for 3 min (0.35 mL/min, 60 C). An injection volume of 1 µl was used. MS detection was performed in positive detection mode on an Agilent 6545 QTOF MS equipped with Agilent Dual Jet Stream electrospray ion source with a drying gas temperature of 250 °C, gas flow of 8 ml/min, sheath gas temperature of 300 °C and flow of 12 ml/min. Capillary voltage was set to 4000 V and nozzle voltage to 500 V. Mass spectra were recorded at 10, 20 and 40 eV as centroid data for m/z 85–1700 in MS mode and m/z 30–1700 in MS/MS mode, with an acquisition rate of 10 spectra/s. Lock mass solution in 70:30 methanol:water was infused in the second sprayer using an extra LC pump at a flow of 15 ml/min using a 1:100 splitter. The solution contained 1 M tributylamine (Sigma-Aldrich) and 10 M Hexakis (2,2,3,3- tetrafluoropropoxy)phosphazene (Apollo Scientific Ltd., Cheshire, UK) as lock masses. The [M+H]+ ions (m/z 186.2216 and 922.0098 respectively) of both compounds was used.

2.7. Preparative isolation of acurin A

A. aculeatus was cultivated in 200 petri dishes with solid MM and incubated at 30 °C for five days. The plates were harvested and extracted twice overnight with ethyl acetate (EtOAc) with 1 % formic acid. The extract was filtered and concentrated in vacuo. The combined extract was dissolved in methanol

(MeOH) and H2O (9:1), and an equal amount of heptane was added where after

the phases were separated. To the MeOH/H2O phase H2O was added to a ratio of 1:1, and metabolites were then extracted with dichlormethane (DCM). The phases were then concentrated separately in vacuo. The DCM phase was subjected to further purification on a semi-preparative HPLC, a Waters 600 Controller with a 996 photodiode array detector (Waters, Milford, MA, USA). This was achieved using a Luna II C18 column (250 x 10 mm, 5 m, Phenomenex),

Page 75 4. Acurin A, a novel hybrid compound

a flowrate of 4 mL/min and an isocratic run at 40 % acetonitrile for 18 minutes. 50 ppm TFA was added to acetonitrile of HPLC grade and MilliQ-water. This yielded 4.4 mg of acurin A.

2.8. NMR and structural elucidation

The 1D and 2D spectra were recorded on a Unity Inova-500 MHz spectrometer (Varian, Palo Alto, CA, USA). Spectra were acquired using standard pulse sequences and 1H spectra as well as DQF-COSY, NOESY, HSQC and HMBC spectra were acquired. The deuterated solvent was DMSO-d6 and signals were

referenced by solvent signals for DMSO-d6 at δH = 2.49 ppm and δC = 39.5 ppm. The NMR data was processed in Bruker Topspin 3.1. Chemical shifts are reported in ppm (δ) and scalar couplings in hertz (Hz). The sizes of the J coupling constants reported in Table S5 are the experimentally measured values from the spectra. There are minor variations in the measurements which may be explained by the uncertainty of J. The structural elucidation can be found in the supplementary material where NMR data for acurin A are listed in Table S5.

3. Results and Discussion

3.1. Acurin A – a novel PK-NRP hybrid compound from Aspergillus aculeatus

During our previous investigations of the 6-MSA synthase BGC, we discovered that A. aculeatus also produces a set of two minor compounds, both having the exact mass of 373.1889 Da (Petersen et al., 2015) corresponding to the

elementary composition C21H27NO5. Dereplication did not find a match from any known compounds with the same elementary composition present in Antibase, Reaxys, or our in-house collection of metabolites. The most significant (slightly earlier eluting) compound was isolated, and the structure was elucidated based on 2D NMR spectroscopy, see Table S5. This analysis revealed a compound likely to be a highly reduced polyketide coupled to an amino acid via a peptide bond, see Fig. 1A. Searching for the structure revealed that it had previously been reported in a Japanese patent, however without establishment of any stereochemistry, which we report here. We have therefore named the compound acurin A. The PK-derived core carbon backbone part of acurin showed to be highly comparable to motifs previously observed in, e.g., lucilactaene produced by a Fusarium sp. (Kakeya et al., 2001), epolactaene from a marine Penicillium sp. (Kakeya et al., 1995), and most notably the mycotoxin fusarin C from various species of Fusarium (Cantalejo et al., 1999; Díaz-Sánchez et al., 2012; Niehaus et al., 2013; Song et al., 2004; Steyn

Page 76 4. Acurin A, a novel hybrid compound

and Vleggaar, 1985), see Figure 1. Amongst these compounds, the biosynthesis of fusarin C is best characterized. Hence, based on isotope labeling and genetic experiments, the scaffold of fusarin C appears to be made by the incorporation of a C4-unit amino acid, most likely L-homoserine, into the PK moiety of the fusarin C scaffold (Song et al., 2004). In agreement with this model, identification and analysis of the BGC responsible for fusarin C production demonstrated that it contained a gene, fus1, encoding a PKS-NRPS hybrid enzyme (Niehaus et al., 2013). The structural similarity to fusarin C suggests that acurin A may also originate from a PK and amino acid fusion. Assuming that the amino acid is L-serine (see later) the stereochemistry of the lactam ring can be established, since we observed an NOE correlation between the protons at positions C-15 and C-20. We note that this is similar to that observed for fusarin C (Fig. 1).

Fig. 1. Acurin A related compounds. A) Proposed structure of acurin A (C21H27NO5, exact mass 373.1889 Da), assuming that L-serine is fused with the PK backbone. B) Structure of fusarin C (C23H29NO7, exact mass 431.1944 Da). C) Structure of lucilactaene (C22H27NO6, exact mass 401.1838 Da) D) Structure of epolactaene (C21H27NO6, exact mass 389.4480 Da).

Page 77 4. Acurin A, a novel hybrid compound

3.2. Identification of putative PKS and NRPS genes for the production of acurin

Based on the hypothesis that acurin is a fusion of a PK and an amino acid, we examined the genome sequence of A. aculeatus for the presence of a Fus1 homolog by a BlastP search to identify a BGC responsible for acurin production. Surprisingly, the protein with the highest degree of identity, 54 % (65 % query coverage), was a PKS (protein JGI ID 48) rather than a PKS-NRPS. This PKS was predicted to contain the following domains: ketosynthase (KS) - acyltransferase (AT) - dehydratase (DH) - methyltransferase (MT) - ketoreductase (KR) - acyl- carrier protein (ACP). The KS-AT-ACP are the basic domains for a non-reducing PKS, and the presence of DH and KR domains, shows the PKS is a reducing type. The MT domain points to methylation of the scaffold. Strikingly, it did not appear to contain a release domain or an NRPS module (Marchler-Bauer et al., 2015). We, therefore, inspected the locus containing the gene (AACU_48) encoding this PKS for other genes that could be relevant for acurin formation. Initially, the analysis identified a putative NRPS gene (AACU_122295) with start- codon located approximately 31 kb upstream of the PKS encoding gene. The result indicates that the scaffold for acurin formation potentially could be synthesized by unlinked PKS and NRPS enzymes. The NRPS encoded by AACU_122295 showed only 37 % identity to the NRPS part of the Fus1 PKS- NRPS fusion protein, see Table 1 (Bushley and Turgeon, 2010; Lawrence et al., 2011). Importantly, the predicted NRPS contained a reductase domain for the potential release of a PKS-NRPS hybrid molecule.

Page 78 Table 1. Genes surrounding acrA encoding the PKS involved in the biosynthesis of acurin, and the corresponding homologs in the F. fujikuroi fusarin C BGC .Aui ,anvlhbi compound hybrid novel a A, Acurin 4.

Protein/transcript Protein/transcript Predicted Gene name in A. Homolog in F. Gene name in F. Identity AACU_ID (JGI) Aspac1_ID Function aculeatusa fujikuroi fusarin C fujikuroi in % BGCb 1857757 - Unknown - - - 122297 62005 Endopeptidase - 10055/11839 fus4 - 62004 - CYP450 acrF - - 122295 773 NRPS acrB 10058/11836 fus1* 37% 1857753 45009 Unknown - - - 122294 31172 Dioxygenase - - - 79887 31451 Transporter - - - 122290 45006 TF acrR - - ae79 Page 122285 53353 FAD Oxidoreductase acrE - - 122283 61997 Methyl transferase acrG 10050/11844 fus9* 46% 45003 61996 CYP450 acrD 10051/11843 fus8* 58% Aldehyde 1903457 31526 Dehydrogenase - 10052/11842 fus7 57% 1881869 - MFS- transporter - 10053/11841 fus6 47% 61993 53349 α/β hydrolase acrC 10057/11837 fus2* 59% 48 - PKS acrA 10058/11836 fus1* 54% 61991 - Unknown - - - 1881866 - β-transducin-like protein - - - 1881865 - Dehydrogenase - - - a Names as defined and summarized in Figure. b To denote the corresponding gene, the ID number is initiated with FFUJ_ (Niehaus et al., 2013) or Fusfu. Different IDs for same protein are separated by / in this Table. *Essential for fusarin C biosynthesis (Niehaus et al., 2013). 4. Acurin A, a novel hybrid compound

3.3. Separate PKS- and NRPS enzymes synthesize the acurin A core structure

To investigate whether AACU_48 (PKS) and AACU_122295 (NRPS) are involved in acurin production, the two genes were deleted. Conveniently, we previously used CRISPR/Cas9 to establish a pyrG marker in A. aculeatus (Nødvig et al., 2015), and we used this strain and CRISPR/Cas9 to construct an NHEJ deficient strain to increase the efficiency of gene-targeting experiments further. Specifically, we used an equivalent CRISPR/Cas9 vector with a protospacer targeting akuA accompanied by gene-targeting substrate employing a heterologous pyrG as selection marker, see Experimental section for details, Table S2 for genotypes, Table S3 and Fig. S1 & S2 for the strain validation. The resulting akuAΔ deletion strain, ACU10, did not produce a visible phenotype on solid minimal medium as compared to the wild-type strain. Next, in the akuAΔ pyrG1 strain background, we individually deleted AACU_48 and AACU_122295, see Experimental section and Figure S3 and S4, and analyzed the resulting mutant strains on solid minimal medium. Extracts from the resulting two strains were analyzed by ultra-high-performance liquid chromatography (UHPLC) coupled with diode array detection (DAD) and high- resolution mass spectrometry (HRMS) and compared with the corresponding chromatogram obtained with the reference strain. As expected, with the reference strain, we observed a significant but low-intensity peak representing acurin A. In contrast, with the AACU_48 and AACU_122295 deletion strains, the production of acurin A was abolished, see Figure 2. Based on these findings, we, therefore, named the two genes acrA (AACU_48) and acrB (AACU_122295), respectively. Moreover, together with the bioinformatics analyses, these results strongly suggest that acrA encodes a PKS required for the biosynthesis of the PK moiety of acurin, and acrB encodes an NRPS, which catalyzes the fusion of an amino acid to the PK backbone of acurin and anticipated releases the primary precursor hybrid product. Further bioinformatics analyses showed that no epimerase domain is present in the NRPS. This supports our conclusion that L-serine is incorporated into not only acurin A, but also the slightly later elution isomer with the same elemental composition (Figure 2). It therefore seems likely that the later eluting minor isomer of acurin A has the opposite stereochemistry at positon-15.

Page 80 4. Acurin A, a novel hybrid compound

Fig 2. UHPLC-DAD-HRMS analysis of two A. aculeatus deletion strains and the reference strain cultivated on YES media. Traces represent extracted ion chromatograms (EICs) @ m/z = 374.1962 ± 0.002 for the acurin A. Production of acurin A (and a likely slightly later eluting minor isomeric compound) was abolished when the genes encoding the PKS (acrA) and the NRPS (acrB) were deleted.

3.4. Uncoupled polyketide and non-ribosomal peptide synthetase activity is conserved in a fungal clade in section Nigri.

To our knowledge, most fungal PK-NRP SM scaffolds described prior to this study are synthesized by a PKS-NRPS hybrid enzyme. Since the acurin A-like compounds are synthesized in genetically diverse fungi, we explored the possibility that BGCs for production of an identical or similar SM scaffold as the one used for acurin A production are present in other fungi. We therefore examined all available fungal genomes in the MycoCosm database, JGI, as well as NCBI using a BlastP search and the Acurin A producing PKS as a query. Strikingly, this analysis revealed that nine other species within Aspergillus section Nigri had close homologs to AcrA as well as a separated AcrB (i.e. A. fijensis, A. brunneoviolaceus, A. aculeatinus, A. violaceofuscus, A. japonicus, A. indologenus, A. uvarum, A. elipticus and A. heteromorphus), see Fig. S8. Moreover, these ten species are split in two clades in the overall species phylogeny within section Nigri (Vesth et al., 2018). Moreover, the species that are grouping in subclades share the organization of the majority of genes within the putative BGC spanning from the genes encoding acrA and acrB, whereas species in the most distant subclade, e.g. A. uvarum, showed an alternative organization in the BGC. This finding of multiple species having the BGC also rules out that the separation genes encoding the PKS and NRPS were an artefact from sequencing and genome assembly. Among the top hits from Section Nigri, we identified numerous PKS-NRPS hybrids, including Fus1 homologs. Similarly, when using Fus1 as a query the best hits were predominantly PKS-NRPS hybrids, except for the AcrA-like PKSs from

Page 81 4. Acurin A, a novel hybrid compound

Aspergillus section Nigri. This was also the outcome from an AcrB-based BlastP search. Notably, coordinating catalytic moieties is favorable as it may support channeling effects to increase catalytic efficiency (Huang et al., 2001). However, the possibility exists that AcrA and AcrB achieve the same catalytic setup by forming a physical complex. This view is supported by the fact that the NRPS, but not the PKS, contains a recognized domain that provides a product- release mechanism. It was therefore of interest to us whether AcrA and AcrB enzymes represent an evolutionary stage that preceded the emergence of PKS- NRPS fusion enzymes or that fission occurred from the PKS-NRPS fusion after a horizontal gene transfer event to an ancestor of the A. aculeatus group. In order to better understand the origin and evolution of the putative acurin A producing BGC, in particular for AcrA and AcrB, we conducted a comprehensive analysis of clustering and gene family evolution (Fig. S9) using a local database of 475 publicly available fungal genomes (Table S4). The functionally characterized fusarin C BGC and potential acurin A BGC were used as independent queries in a cluster discovery algorithm described previously (Reynolds et al., 2017). Seventeen BGCs of similar composition were recovered in Sordariomycetes, Dothideomycetes, Leotiomycetes, and Eurotiomycetes. Among recovered clusters, eight genes were widely conserved and shared by fusarin C and acurin A BGC loci. Several signature genes accompanied few or no other homologs of BGC genes in 5 Dothideomycetes and 3 Leotiomycetes and one Sordariomycete. Out of the 17 total BGCs, the acurin BGC is the only large cluster with separately encoded PKS and NRPS enzymes. All query genes were subjected to maximum likelihood analyses, and Hybrid KS and AMP binding domain phylogenies were inferred separately. These analyses revealed that fusarin C and acurin BGCs form a clade along with similar gene clusters in a few distantly related fungi. A homologous cluster in Metarrhizium spp (Krasnoff et al., 2006), which are known to produce 7-desmethyl analogues of fusarin C, and in Ophiocordyceps unilateralis suggests that this may be the ancestral product of these clusters in Hypocreales. Most genes that are found in both acurin and fusarin C BGCs have a similar phylogenetic history among those genes that occur in the BGCs. This is consistent with the genes in the gene cluster evolving in a coordinated fashion. Despite this coordinated evolution, there is a minimal correspondence between the evolution of these genes and that of the species included in the database. Sporadic horizontal gene transfer might explain the sparse and distant distribution of homologous gene clusters, but there was no strong consistent signal for any specific transfer events. The

Page 82 4. Acurin A, a novel hybrid compound

restriction of the fusarin C homologs in the acurin BGC to Aspergillus section Nigri suggests a fusarin C-like cluster was recently acquired in Aspergillus; however, the AMP binding domain and MFS transporter (AACU_1881869) phylogenies, in which A. aculeatus is sister to another Eurotiomycete species, are also consistent with a longer history in Eurotiomycetes. Acurin BGC genes that are not homologous to fusarin C BGC genes are more broadly found among Aspergillus spp. The distribution and pattern of coordinated evolution among seven genes in these clusters suggests the ancestral state is a seven gene BGC, which broke down or rearranged in alternate lineages following its dispersal. Similarly, a parsimonious reconstruction suggests the ancestral state of the PKS/NRPS signature gene was a hybrid gene, which either fragmented (in Aspergillus section Nigri) or was degraded to a polyketide synthase in lineages (e.g., Zymoseptoria) where no homologous AMP binding domain was found. The AMP binding domain phylogeny roughly agrees with the Hybrid KS phylogeny, although the independent NRPS in Aspergillus section Nigri (e.g., Aspac1_802, Aspac1_773) do not agree with the A. aculeatus placement seen in the Hybrid KS phylogeny and most other gene phylogenies, see Figure 3. This conflict in gene phylogenies could be phylogenetic artifacts of accelerated evolution that followed the gene fragmentation and also a subsequent domain duplication, which might have relaxed selection on one or both of these paralogs. Other notable gene-cluster evolution events include a rearrangement, possibly by a rolling circle transposition that gave rise to the fusarin C gene cluster in Fusarium with its one unique gene (fus5) at the recombination breakpoint, and a gene cluster expansion in Trichoderma.

Page 83 .Aui ,anvlhbi compound hybrid novel a A, Acurin 4.

ae84 Page

Fig. 3. Evolution of the acurin BGC. A maximum-likelihood phylogeny of the Hybrid KS domain (left) corresponds to the purple component of the PKS/NRPS signature gene in clusters (center). The maximum likelihood phylogeny (right) of the AMP binding domain corresponds to the dark green domain in the PKS/NRPS signature genes. Fusarin C and acurin gene clusters are shaded, and filled circles below the genes indicate the fungal class of the nearest sequence to acurin gene homologs. The clusters presented represent the total homologous clusters in a database of 475 publicly available fungal genomes (Table S4). 4. Acurin A, a novel hybrid compound

3.5 The acurin-associated BGC contains genes encoding tailoring enzymes and a transcription factor.

For the formation of acurin A, the primary PK-NRP product arising from AcrA and AcrB would likely need to be modified by a set of tailoring enzymes. We, therefore, made a careful inspection of the locus harboring acrA and acrB for other activities that could contribute to the biosynthesis. This analysis uncovered thirteen genes encoding potential SM biosynthesis activities, e.g., putative methyltransferases, oxidoreductases, cytochrome P450s. Thus, acrA and acrB would likely be part of a larger BGC. We reasoned that the acurin A and fusarin C BGCs likely share several genes, and since the Fus1 containing BGC in F. fujikuroi IMI 58289 had been characterized previously by Niehaus et al. (Niehaus et al., 2013), we decided to first compare the gene arrangement at the fus locus to that of the acr locus (Fig. 4). From the study in Fusarium, nine genes surrounding a central PKS-NRPS hybrid were co-regulated, but only four genes were found to be essential for fusarin C biosynthesis, see Table 1. From our syntenic analysis, at least six gene products shared homologs between the BGCs.

Fig. 4. Synteny between the fusarin C producing BGC and the BGC for producing acurin in A. aculeatus. The presumed acurin-producing BGC contains a gene encoding an iterative type I PKS and another gene encoding a single NRPS module. Neighboring the PKS- and NRPS- encoding genes are several genes representing various tailoring enzyme activities. Genes that we find are relevant for acurin production are shown by black arrows with their respective names above. Also, black arrows identify the proposed BGC for fusarin C, regardless of they being essential for production of fusarin C(Niehaus et al., 2013). Grey indicates an unrelated gene to the respective BGC (in A. aculeatus conformed by gene deletions (data not shown)).

Interestingly, the acr locus also contained a gene (AACU_122290) encoding a putative transcription factor (TF). To examine whether this TF had a regulatory impact on acrA and acrB and other genes in the locus, we eliminated AACU_122290, see Fig. S5. The mutation did not alter the morphology compared to the reference strain, but only by the abolition of acurin production, see Fig. S10. The result gave a direct link between the TF and acurin

Page 85 4. Acurin A, a novel hybrid compound

production, therefore, strongly indicating that the TF is involved in the activation of acrA and acrB. Hence, we named the gene AACU_122290, acrR. Next, we performed RT-qPCR analysis to investigate the relative expression in the reference with the acrRΔ strain. Unfortunately, the relative expression levels of the genes in the acr locus between the reference and the acrRΔ strains were too low and unreliable for our measurement methods. Therefore, an overexpression (OE) construct for constitutive expression of the acrR was assembled to address whether the TF could activate the BGC and increase acurin production, see Experimental section for details. As no defined integration site was established in A. aculeatus at this point, we decided to transform the pyrG- strain, which has a fully functional NHEJ pathway facilitating random integration of the acrR expression construct into the genome. The overexpression of acrR resulted in a significant phenotypic change with the production of a dark-red soluble pigment, and a decreased sporulation compared to the reference strain (Fig. S11). Four of the resulting transformants were analyzed by UHPLC-DAD-HRMS. All of the four mutants showed similar metabolite profiles, and interestingly, the metabolite profile revealed a drastic change in the metabolite profile when compared to the reference strain (Fig. S12). The analysis also showed that the production of acurin was increased by the overexpression of acrR (Fig. S12). We likewise performed an RT-qPCR to determine how the overexpression of acrR influenced the genes in the acr locus compared to gene-expression levels of a reference strain (Fig. 5 and S13). RNA was sampled after 3, 5, and 7 days growth on solid MM. We expected to see a significant change in the relative expression level in the acr locus between the two strains as the level of acurin significantly increased in the acrR-OE strain. Indeed, the expression levels of acrA and acrB were a 1000-fold increased at all measuring times in the acrR-OE strain. This trend was also observed for ten other genes in the locus. Four genes showed to be unaffected by the acrR overexpression, which indicated that they were not participating in the production of acurin.

Page 86 4. Acurin A, a novel hybrid compound

Fig. 5. Real-time quantitative PCR (RT-qPCR) data. Relative gene expression for the acr BGC compared between the reference strain and the acrR-OE strain measured at day 5, also see Fig. S13.

Based on our RT-qPCR analyses, it appears that AcrR regulates the BGC responsible for the formation of acurin and that the acurin responsible BGC may contain up to twelve genes. The massive increase in metabolites produced by the acrR-OE strain could be an artefact from excess AcrR available in the nucleus, or it could indicate an impact on regulation of the secondary metabolism that is beyond the control of the acurin BGC for example as part of a broader and general response to an environmental cue (Fig. S12). The little influence on metabolism in the acrRΔ strain points to the first option, but it would be interesting to investigate in future studies.

3.6. Gene deletions identify genes in the acr biosynthetic gene cluster.

Deletion or overexpression of a TF gene regulating a BGC may influence the chromatin structure of the locus that harbors the BGC (Reyes-Dominguez et al., 2010; Woo Bok et al., 2009). Genes that are not part of the BGC, but happens to be situated close, or in the locus, may therefore also be transcribed differentially as the result of these genetic changes. To examine whether the genes that appear to be regulated by AcrR are directly involved in the production of acurin, we decided to delete the nine genes, which were affected

Page 87 4. Acurin A, a novel hybrid compound

by both the deletion and overexpression of acrR, see Fig. S6 and S7 for validation of strains. Since the amounts of acurin were much higher in the strain that overexpressed acrR, we decided to use this genetic feature in the background to aid the remaining gene-deletion analysis Since the ectopic integration of acrA was made in an NHEJ-proficient strain, an equivalent plasmid was constructed where the A. nidulans integration sites were replaced with integration site 1, IS1, for A. aculeatus. This insertion locus was between the genes AACU_117954 and AACU_59915, which encode putative a xylose transporter and RNA-binding protein/translational repressor, respectively. Therefore, spores from all the remaining gene-deletion strains were cultivated on 5-FOA enriched medium, and a uridine-requiring pyrG pop- out recombinant strain was for each gene deletion selected as host strain for the subsequent integration of acrR in IS1. All transformants had the same extreme phenotype as the ectopic integration of acrR, and one colony was restreaked and metabolites were extracted from each strain and were analyzed by UHPLC-DAD-HRMS. Chromatograms from gene-deletion strains were compared to a reference (acrR-OE) for acurin A production levels and changes in other peaks. For differentiating peaks, the fragmentation pattern in mass spectra were analyzed in comparison to that of acurin A, since differences in such a complex background could originate from other compounds not relating to acurin A. Three of the deletion strains (i.e., AACU_122297Δ, AACU_122294Δ, AACU_1881869Δ) were unaffected in acurin levels relative to the acrR-OE strain. We hypothesize that the induced expression of the three genes in the acrR-OE strain could be a result of the abnormal AcrR levels and its influence on the locus expression. Also, if AACU_1881869 encoding a putative MFS transporter has a role in the biosynthesis of acurin, either in extra- or intracellular transport, data would indicate that accumulation of acurin inside the fungus does not pose a threat to the fitness of the strain, or that this transport function was redundant. The deletion of the five genes (AACU_61993/acrC, AACU_122285/acrD, AACU_62004/acrE, ACU_45003/acrF, and AACU_122283/acrG) resulted in the abolishment of acurin A production, as summarized in Figure 6 and Table 1, hence these genes were named according to the acr locus. To our surprise, four of these strains (acrCΔ, acrDΔ, acrEΔ, acrFΔ) revealed no accumulation of potential intermediates, which were not present in equivalent amounts in the reference strain. There are several plausible reasons for not detecting any compounds

Page 88 4. Acurin A, a novel hybrid compound

that appear in the deletion strains of arcC, acrD, acrE, and acrF. First, intermediate compounds could be unstable and, therefore, untraceable in the extracts of this genetic background displaying high complexity. Second, two or more of the enzymes in the pathway could interact physically during the reactions, which would mean that one missing enzyme would result in no formation of the enzyme complex. One of the deletion mutant strains, AACU_122283/acrG (Fig. S14), did show an accumulating product that was not found in the acrAΔ strain.

Fig. 6. UHPLC-DAD-HRMS analysis of A. aculeatus deletion strains cultivated on YES media. Traces represent EICs @ m/z = 374.1962 ± 0.005 for acurin A. It appears that acurin A eluting around 5.8 min in the case of the acrR-OE strain is produced in much larger quantities than the co-eluting isomer detected in the reference strain (figure 2). Instead a later eluting other isomer is now detected in high quantities. We speculate that the appearance of this more aploar isomer of acurin A most likely represents an isomer with a changed stereochemistry in one of the double bonds in the PK part of the molecule, since both compounds are detected as having the same mass and thereby elemental composition.

3.7. Proposed biosynthesis of acurin A

The acurin A producing BGC consists of at least eight genes; the PKS (acrA), NRPS (acrB), TF (acrR), and five genes that were encoding characteristic SM tailoring-enzyme activities; hydrolase (acrC), oxidoreductase (acrD), CYP450 (acrE), CYP450 (acrF), and O-methyltransferase (acrG). Interestingly, five of the gene products AcrA, AcrB, AcrC, AcrD, AcrG displayed homology (ranging from 37-59 % identity) to gene products essential for the fusarin C biosynthesis (Table 1). Therefore, it is plausible that these enzymes carry out equivalent functions in their respective biosynthetic pathways. On the other hand, since there are structural differences between acurin and fusarin C, the respective BGCs or genomes need to contain genes that are only present in that specific BGC. One example is the epoxide formation in fusarin C, where the responsible gene product remains elusive, and it may be performed by a gene located outside of the fus locus. This molecular feature is not present in acurin A, and has either been lost or never transferred between the respective species. In acurin A biosynthesis, the activities of the PKS (AcrA) and NRPS (AcrB) are Page 89 4. Acurin A, a novel hybrid compound

collectively responsible for the synthesis of the acurin A core structure with a heptaketide backbone covalently fused to an amino-acid moiety, which we speculate could be L-serine, since this is the simplest possible scenario and L- serine is an abundant amino acid in the cell. After the formation of the PK-NRP hybrid product, we envision that it is detached from the enzyme by reductive release to set up the formation of the lactam ring by Aldol condensation follow by AcrC (hydrolase) catalyzed water loss to generate a double bond in the ring. Although AcrC is the closest homolog to Fus2 (59 % identity) from F. fujikuroi, which Niehaus and co-workers claim is responsible for lactam formation in fusarin C (Niehaus et al., 2013), we cannot, with our data prove that this is the equivalent function in A. aculeatus. We hypothesize that the double bond is reduced followed by three oxidations at C-22 to generate the carboxylic acid moiety. This hypothesis may be supported by the fact that AcrD-F encodes putative monooxygenases and two CYP450s (Fig. 7). However, the carboxylic acid formation is also occurring in fusarin C synthesis where there are no close homologs to AcrE and AcrF. If these enzymes are participating in this series of reactions, the genes responsible could have been recruited from another BGC. Both acrE and acrF reside in the left part of the BGC outside the region with high synteny to the fusarin C BGC. Alternatively, the homologs to AcrC and AcrD are Fus2 and Fus8, respectively, and both are essential for fusarin C biosynthesis. Thus, the steps carried out by the homologs in the two BGCs could be highly similar. However, resolving their biosynthetic roles solely by predicted enzyme functions is complicated by the fact that all of the four AcrC-F are not well-characterized enzymes. An O-methyltransferase is needed for the final step in the biosynthesis of acurin A, and AcrG performs this step backed by MS/MS verification of the accumulating compound (Fig. S15 and S16) and the reported activity of the homolog Fus9 in fusarin C biosynthesis(Niehaus et al., 2013). We, therefore, conclude that AcrG is the O-methyltransferase acting as the final step in the biosynthesis of acurin A (Fig. 7).

Page 90 4. Acurin A, a novel hybrid compound

Figure 7. The proposed biosynthetic pathway of acurin A. See text for details. For a proposed hypothetical biosynthetic pathway for acurin A, see Figure S10.

Conclusions

In the present study, we demonstrate the power of employing analytical chemistry, comparative genomics, an efficient CRISPR/Cas9 system, and an NHEJ deficient strain to present a scheme of the route towards of acurin A in Aspergillus aculeatus. Acurin A shows high structural similarity to the mycotoxin fusarin C, differentiated by an epoxide functionality in fusarin C, another methylation pattern, and incorporation of a slightly different amino acid. Both BGCs seem to share the same putative enzymatic activities. Interestingly, we found that separate entities of PKS, AcrA, and NRPS, AcrB, fuse the heptaketide backbone to an L-serine moiety at the onset of the biosynthesis, while it has been shown that fusarin C is synthesized by a natural PKS-NRPS hybrid (Niehaus et al., 2013). The analyses from this study indicate that a fission of an ancestral gene encoding the PKS-NRPS hybrid resulted in separated acrA and acrB genes present in a few subclades in Aspergillus Section Nigri, and that AcrB involved in acurin A production may have been recruited for production of this compound at a later stage after the fission. Also, the activation of acrA and acrB, including the remainder of the BGC, were related to the transcription factor AcrR, which was encoded in BGC. At least eight genes (acrA-G and acrR) are vital for the biosynthesis of acurin A. The biological relevance and bioactivity of acurin A still needs to be investigated.

Page 91 4. Acurin A, a novel hybrid compound

Acknowledgements

The work in the present study was supported by the Novo Nordisk Foundation, http://www.novonordiskfonden.dk/en, grants NNF15OC0016610 (PBW) and NNF12OC0000796 (MLN), and the National Science Foundation grant DEB- 1638999 (JCS), which we gratefully acknowledge.

References

Andersen, R., Büchi, G., Kobbe, B., Demain, A.L., 1977. Secalonic Acids D and F Are Toxic Metabolites of Aspergillus aculeatus. UTC. https://doi.org/10.1021/jo00422a042 Banerjee, D., Mondal, K.C., Pati, B.R., 2007. Tannase production by Aspergillus aculeatus DBF9 through solid-state fermentation. Acta Microbiol. Immunol. Hung. 54, 159–166. https://doi.org/10.1556/AMicr.54.2007.2.6 Bennett, J.W., Klich, M., 2003. Mycotoxins. Clin. Microbiol. Rev. 16, 497–516. https://doi.org/10.1128/CMR.16.3.497-516.2003 Blin, K., Shaw, S., Steinke, K., Villebro, R., Ziemert, N., Lee, S.Y., Medema, M.H., Weber, T., 2019. antiSMASH 5.0: updates to the secondary metabolite genome mining pipeline. Nucleic Acids Res. 47, W81–W87. https://doi.org/10.1093/nar/gkz310 Bushley, K.E., Turgeon, B.G., 2010. Phylogenomics reveals subfamilies of fungal nonribosomal peptide synthetases and their evolutionary relationships. BMC Evol. Biol. 10, 11. https://doi.org/10.1186/1471- 2148-10-26 Cantalejo, M.J., Torondel, P., Amate, L., Carrasco, J.M., Hernández, E., 1999. Detection of fusarin C and trichothecenes in Fusarium strains from Spain. J. Basic Microbiol. 39, 143–153. https://doi.org/10.1002/(SICI)1521-4028(199906)39:3<143::AID- JOBM143>3.0.CO;2-U Capella-Gutiérrez, S., Silla-Martínez, J.M., Gabaldón, T., 2009. trimAl: a tool for automated alignment trimming in large-scale phylogenetic analyses. Bioinformatics 25, 1972–1973. https://doi.org/10.1093/bioinformatics/btp348 Clevenger, K.D., Bok, J.W., Ye, R., Miley, G.P., Verdan, M.H., Velk, T., Chen, C., Yang, K.H., Robey, M.T., Gao, P., Lamprecht, M., Thomas, P.M., Islam, M.N., Palmer, J.M., Wu, C.C., Keller, N.P., Kelleher, N.L., 2017. A scalable platform to identify fungal secondary metabolites and their

Page 92 4. Acurin A, a novel hybrid compound

gene clusters. Nat. Chem. Biol. https://doi.org/10.1038/nchembio.2408 Díaz-Sánchez, V., Avalos, J., Limón, M.C., 2012. Identification and regulation of fusA, The polyketide synthase gene responsible for fusarin production in Fusarium fujikuroi. Appl. Environ. Microbiol. 78, 7258–7266. https://doi.org/10.1128/AEM.01552-12 Edgar, R.C., 2010. Search and clustering orders of magnitude faster than BLAST. Bioinformatics 26, 2460–2461. https://doi.org/10.1093/bioinformatics/btq461 Frisvad, J.C., Larsen, T.O., Thrane, U., Meijer, M., Varga, J., Samson, R.A., Nielsen, K.F., 2011. Fumonisin and ochratoxin production in industrial Aspergillus niger strains. PLoS ONE 6, 23496. https://doi.org/10.1371/journal.pone.0023496 Gelderblom, W.C.A., Marasas, W.F.O., Steyn, P.S., Thiel, P.G., Van Der Merwe, K.J., Van Rooyen, P.H., Vleggaar, R., Wessels, P.L., 1984. Structure elucidation of fusarin C, a mutagen produced by fusarium moniliforme. J. Chem. Soc. Chem. Commun. 122–124. https://doi.org/10.1039/C39840000122 Hansen, B.G., Salomonsen, B., Nielsen, M.T., Nielsen, J.B., Hansen, N.B., Nielsen, K.F., Regueira, T.B., Nielsen, J., Patil, K.R., Mortensen, U.H., 2011. Versatile Enzyme Expression and Characterization System for Aspergillus nidulans, with the Penicillium brevicompactum Polyketide Synthase Gene from the Mycophenolic Acid Gene Cluster as a Test Case †. Appl. Environ. Microbiol. 77, 3044–3051. https://doi.org/10.1128/AEM.01768-10 Hayashi, H., Furutsuka, K., Shiono, Y., 1999. Okaramines H and I, new okaramine congeners, from Aspergillus aculeatus. J. Nat. Prod. 62, 315–317. https://doi.org/10.1021/np9802623 Holm, D.K., Petersen, L.M., Klitgaard, A., Knudsen, P.B., Jarczynska, Z.D., Nielsen, K.F., Gotfredsen, C.H., Larsen, T.O., Mortensen, U.H., 2014. Molecular and chemical characterization of the biosynthesis of the 6- MSA-derived meroterpenoid yanuthone D in Aspergillus niger. Chem. Biol. 21, 519–529. https://doi.org/10.1016/j.chembiol.2014.01.013 Huang, X., Holden, H.M., Raushel, F.M., 2001. Channeling of Substrates and Intermediates in Enzyme-Catalyzed Reactions. Annu. Rev. Biochem. 70, 149–180. https://doi.org/10.1146/annurev.biochem.70.1.149 Kakeya, H., Kageyama, S.I., Nie, L., Onose, R., Okada, G., Beppu, T., Norbury, C.J., Osada, H., 2001. Lucilactaene, a new cell cycle inhibitor in p53-

Page 93 4. Acurin A, a novel hybrid compound

transfected cancer cells, produced by a Fusarium sp. [2]. J. Antibiot. (Tokyo) 54, 850–854. https://doi.org/10.7164/antibiotics.54.850 Kakeya, H., Takahashi, I., Okada, G., Isono, K., Osada, H., 1995. Epolactaene, a Novel Neuritogenic Compound in Human Neuroblastoma Cells, Produced by a Marine Fungus. J. Antibiot. (Tokyo) 48, 733–735. https://doi.org/10.7164/antibiotics.48.733 Katoh, K., Standley, D.M., 2013. MAFFT Multiple Sequence Alignment Software Version 7: Improvements in Performance and Usability. Mol. Biol. Evol. 30, 772–780. https://doi.org/10.1093/molbev/mst010 Krasnoff, S.B., Sommers, C.H., Moon, Y.-S., Donzelli, B.G.G., Vandenberg, J.D., Churchill, A.C.L., Gibson, D.M., 2006. Production of Mutagenic Metabolites by Metarhizium anisopliae. J. Agric. Food Chem. 54, 7083– 7088. https://doi.org/10.1021/jf061405r Lawrence, D.P., Kroken, S., Pryor, B.M., Arnold, A.E., 2011. Interkingdom gene transfer of a hybrid NPS/PKS from bacteria to filamentous ascomycota. PLoS ONE 6, e28231. https://doi.org/10.1371/journal.pone.0028231 Lee, C.F., Chen, L.X., Chiang, C.Y., Lai, C.Y., Lin, H.C., 2019. The Biosynthesis of Norsesquiterpene Aculenes Requires Three Cytochrome P450 Enzymes to Catalyze a Stepwise Demethylation Process. Angew. Chem. - Int. Ed. 18414–18418. https://doi.org/10.1002/anie.201910200 Marchler-Bauer, A., Derbyshire, M.K., Gonzales, N.R., Lu, S., Chitsaz, F., Geer, L.Y., Geer, R.C., He, J., Gwadz, M., Hurwitz, D.I., Lanczycki, C.J., Lu, F., Marchler, G.H., Song, J.S., Thanki, N., Wang, Z., Yamashita, R.A., Zhang, D., Zheng, C., Bryant, S.H., 2015. CDD: NCBI’s conserved domain database. Nucleic Acids Res. 43, D222–D226. https://doi.org/10.1093/nar/gku1221 Nguyen, L.-T., Schmidt, H.A., von Haeseler, A., Minh, B.Q., 2015. IQ-TREE: A Fast and Effective Stochastic Algorithm for Estimating Maximum- Likelihood Phylogenies. Mol. Biol. Evol. 32, 268–274. https://doi.org/10.1093/molbev/msu300 Niehaus, E.M., Kleigrewe, K., Wiemann, P., Studt, L., Sieber, C.M.K., Connolly, L.R., Freitag, M., Güldener, U., Tudzynski, B., Humpf, H.U., 2013. Genetic manipulation of the fusarium fujikuroi fusarin gene cluster yields insight into the complex regulation and fusarin biosynthetic pathway. Chem. Biol. 20, 1055–1066. https://doi.org/10.1016/j.chembiol.2013.07.004 Nielsen, M.T., Nielsen, J.B., Anyaogu, D.C., Holm, D.K., Nielsen, K.F., 2013. Heterologous Reconstitution of the Intact Geodin Gene Cluster in

Page 94 4. Acurin A, a novel hybrid compound

Aspergillus nidulans through a Simple and Versatile PCR Based Approach. PLoS ONE 8, 72871. https://doi.org/10.1371/journal.pone.0072871 Nødvig, C.S., Nielsen, J.B., Kogle, M.E., Mortensen, U.H., 2015. A CRISPR-Cas9 system for genetic engineering of filamentous fungi. PLoS ONE 10, e0133085. https://doi.org/sa Nørholm, M.H.H., 2010. A mutant Pfu DNA polymerase designed for advanced uracil-excision DNA engineering. BMC Biotechnol. 10, 21. https://doi.org/10.1186/1472-6750-10-21 Petersen, L.M., Hoeck, C., Frisvad, J.C., Gotfredsen, C.H., Larsen, T.O., 2014. Dereplication guided discovery of secondary metabolites of mixed biosynthetic origin from Aspergillus aculeatus. Molecules 19, 10898– 10921. https://doi.org/10.3390/molecules190810898 Petersen, L.M., Holm, D.K., Gotfredsen, C.H., Mortensen, U.H., Larsen, T.O., 2015. Investigation of a 6-MSA Synthase Gene Cluster in Aspergillus aculeatus Reveals 6-MSA-derived Aculinic Acid, Aculins A-B and Epi- Aculin A. ChemBioChem 16, 2200–2204. https://doi.org/10.1002/cbic.201500210 Price, M.N., Dehal, P.S., Arkin, A.P., 2010. FastTree 2 – Approximately Maximum-Likelihood Trees for Large Alignments. PLoS ONE 5. https://doi.org/10.1371/journal.pone.0009490 Puel, O., Galtier, P., Oswald, I.P., 2010. Biosynthesis and Toxicological Effects of Patulin. Toxins 2, 613–631. https://doi.org/10.3390/toxins2040613 Reyes-Dominguez, Y., Woo Bok, J., Berger, H., Keats Shwab, ‡ E, Basheer, A., Gallmetzer, A., Scazzocchio, C., Keller, † Nancy, Strauss, J., 2010. Heterochromatic marks are associated with the repression of secondary metabolism clusters in Aspergillus nidulans. https://doi.org/10.1111/j.1365-2958.2010.07051.x Reynolds, H.T., Slot, J.C., Divon, H.H., Lysøe, E., Proctor, R.H., Brown, D.W., 2017. Differential Retention of Gene Functions in a Secondary Metabolite Cluster. Mol. Biol. Evol. 34, 2002–2015. https://doi.org/10.1093/molbev/msx145 Robey, M.T., Ye, R., Bok, J.W., Clevenger, K.D., Islam, M.N., Chen, C., Gupta, R., Swyers, M., Wu, E., Gao, P., Thomas, P.M., Wu, C.C., Keller, N.P., Kelleher, N.L., 2018. Identification of the First Diketomorpholine Biosynthetic Pathway Using FAC-MS Technology. ACS Chem. Biol. 13, 1142–1147. https://doi.org/10.1021/acschembio.8b00024

Page 95 4. Acurin A, a novel hybrid compound

Samson, R. a., Houbraken, J., Thrane, U., Frisvad, J.C., Andersen, B., 2010. Food and Indoor Fungi. CBS Lab. Man. Ser. 375–377. Secondary Metabolism Clusters - Aspergillus aculeatus ATCC16872 v1.1 [WWW Document], n.d. URL https://mycocosm.jgi.doe.gov/pages/sm- clusters- summary.jsf?organism=Aspac1&genomes=Aspac1,Aspni5,Aspca3 (accessed 12.22.19). Smedsgaard, J., 1997. Micro-scale extraction procedure for standardization screening of fungal metabolite production in cultures. J. Chromatogr. A 760, 264–270. https://doi.org/10.1016/S0021-9673(96)00803-5 Song, Z., Cox, R.J., Lazarus, C.M., Simpson, T.J., 2004. Fusarin C biosynthesis in Fusarium moniliforme and Fusarium venenatum. ChemBioChem 5, 1196–1203. https://doi.org/10.1002/cbic.200400138 Steyn, P.S., Vleggaar, R., 1985. Biosynthetic studies on the fusarins, metabolites of Fusarium moniliforme. J. Chem. Soc. Chem. Commun. 1189–1191. https://doi.org/10.1039/c39850001189 Suwannarangsee, S., Arnthong, J., Eurwilaichitr, L., Champreda, V., 2014. Production and characterization of multi-polysaccharide degrading enzymes from Aspergillus aculeatus BCC199 for saccharification of agricultural residues. J. Microbiol. Biotechnol. 24, 1427–1437. https://doi.org/10.4014/jmb.1406.06050 Vesth, T.C., Nybo, J.L., Theobald, S., Frisvad, J.C., Larsen, T.O., Nielsen, K.F., Hoof, J.B., Brandl, J., Salamov, A., Riley, R., Gladden, J.M., Phatale, P., Nielsen, M.T., Lyhne, E.K., Kogle, M.E., Strasser, K., McDonnell, E., Barry, K., Clum, A., Chen, C., LaButti, K., Haridas, S., Nolan, M., Sandor, L., Kuo, A., Lipzen, A., Hainaut, M., Drula, E., Tsang, A., Magnuson, J.K., Henrissat, B., Wiebenga, A., Simmons, B.A., Mäkelä, M.R., de Vries, R.P., Grigoriev, I.V., Mortensen, U.H., Baker, S.E., Andersen, M.R., 2018. Investigation of inter- and intraspecies variation through genome sequencing of Aspergillus section Nigri. Nat. Genet. 50, 1688– 1695. https://doi.org/10.1038/s41588-018-0246-1 Woo Bok, J., Chiang, Y.-M., Szewczyk, E., Reyes-Dominguez, Y., Davidson, A.D., Sanchez, J.F., Lo, H.-C., Watanabe, K., Strauss, J., Oakley, B.R., Wang, C.C.C., Keller, N.P., 2009. Chromatin-level regulation of biosynthetic gene clusters. Nat. Chem. Biol. 5. https://doi.org/10.1038/nchembio.177

Page 96 5. Genetic Manipulation and Molecular Networking

Genetic Manipulation and Molecular Networking for Biosynthetic Pathway Characterization of Tetracycline-like Compounds in Aspergillus sydowii

Peter B. Wolff1,a and Karolina Subko1,a, Sebastian Theobalda, Jakob B. Hoofa, Jens C. Frisvada, Charlotte H. Gotfredsenb, Mikael R. Andersena, Uffe H. Mortensena*, and Thomas O. Larsena*

a Department of Biotechnology and Biomedicine, Technical University of Denmark, Build. 221/223, 2800, Kgs. Lyngby, Denmark b Department of Chemistry, Technical University of Denmark, Build. 207, 2800, Kgs. Lyngby, Denmark 1 These authors have contributed equally to this work * Correspondence: [email protected] and [email protected]

Abstract

In order to broaden the understanding of the genetics behind tricyclic and tetracycline compound biosynthesis from NR-PKS loci, this study used a genomics driven discovery approach to search for tetracycline-like BGC candidates in the genus Aspergillus. The fungus Aspergillus sydowii was selected based on the presence of a silent BGC likely to produce either tetracycline- or neosartoricin-like compounds predicted by bioinformatics. The study shows a comprehensive approach for pathway elucidation using the Global Natural Products Social Molecular Networking (GNPS) platform, where HRMS-MS/MS data from overexpression and deletion mutant strains was used coupled with references of NMR-characterized BGC products. This approach allows for an easier comparison of all mutant strains, revealing pathway intermediates, end- products, and their off-pathway biotransformation, all of which, in this case, provide evidence for a complex branched pathway, involving tricyclic, tetracycline and neosartoricin compounds. In particular, the combined molecular networking procedure also revealed an unexpected enzymatic tetracycline degrading function in Aspergillus sydowii, indicating a self-protective mechanism.

Introduction

Tetracyclines (TCs) have a long history in the treatment of infectious diseases [1]. Due to advancing TC resistance mechanisms [2], novel derivatives could secure more vital treatments in the future. Filamentous fungi have the potential of providing these TCs based on the distinct tailoring enzyme activities found within the genera [3]–[5]. Fungal non-reducing polyketide synthases (NR-PKSs) are responsible for the assembly of a wide range of aromatic natural products (NPs) valuable to human health, including tetracyclines. The hallmark of NR-PKSs is a characteristic product template (PT) domain responsible for catalyzing aldol cyclization [6], together with the absence of the reducing domains (i.e., ketoreductase (KR), dehydratase (DH), and enoylreductase (ER)) [7]. The elongation of the polyketides is initiated by the starter unit ACP transacylase (SAT), which provides the acyl-carrier protein (ACP) with a selected starter unit. The ketosynthase (KS) domain catalyzes the iterative condensations consuming Page 97 5. Genetic Manipulation and Molecular Networking

malonyl-CoA extender units provided by the malonyl-Coenzyme A ACP transacylase (MAT) domain. Different domain options for the release can either be thioesterase (TE), thioesterase/Claisen cyclase (TE/CLC), or reductase (R). However, for NR-PKSs belonging to group V, the chain-releasing domain is missing. The releasing mechanism has, in some cases, been linked to a trans-metallo-β-lactamase-type thioesterase (MβL-TE) in pathways for biosynthesis of fungal tricyclic (e.g., asperthecin and neosartoricin) [8] and tetracyclines (e.g., TAN-1612 and viridicatumtoxin) compounds [9], [10]. In the pathway of TAN-1612, the MβL-TE (AdaB) depends on a C2 hydroxylation for the successful fourth ring formation. In the absence of the flavin- dependent hydrolase (AdaC), responsible for the hydroxylation, a tricyclic neosartoricin-like compound is produced instead. Numerous whole-genome bioinformatics studies have revealed a vast potential for the discovery of new bioactive agents in filamentous fungi, and one example is potential tetracycline biosynthetic gene clusters (BGCs) [11]. Importantly, bioinformatics knowledge solely based on NR-PKS sequences, domain structures, and their entire BGC organizations can be inadequate for predicting whether a given BGC encodes production of a tricyclic or a tetracycline structure as the final BGC compound. An enhanced understanding of the differences between the biosynthesis of these compounds and their related BGC compositions could prove significant when locating potentially high-value loci involved in tetracycline or tetracycline-like compound production. In this study, a complex pathway elucidation is shown in response to activation of a silent potential tetracycline-like BGC in A. sydowii.

Results

Screening the genus Aspergillus for a potential tetracycline-like BGC In a quest for new BGCs for the production of tetracycline or tetracycline-like compounds, the genus Aspergillus was analyzed using a BLAST-based approach searching for sequences with similarities to previously identified tetracycline- producing loci. Specifically, ada from Aspergillus niger and vrt from Penicillium aethiopicum, responsible for TAN-1612 [9] and viridicatumtoxin [10] production, respectively, were used as queries in the BLAST analysis. One of the resulting hits, PKS gene (JGI: 157033) from Aspergillus sydowii, defines a small BGC, which has previously been identified in an in-silico study and proposed to be involved in either neosartoricin or fumicycline production [11]. In agreement with this, the BGC shows similarity to the nsc locus of Neosartorya fischeri, which is responsible for neosartoricin production [8]. However, a comparison of the gene organization between the BGC from A. sydowii to the A. niger ada and the N. fischeri nsc loci, see Figure 1A, as well as the P. aethiopicum vrt loci, see Table S1, indicates that it is not trivial to predict exactly what product type A. sydowii produces. When searching for tetracycline BGCs, better insight into these differences could aid in a more confident differentiation. To address this

Page 98 5. Genetic Manipulation and Molecular Networking

Figure 1: Gene cluster comparison and predicted compounds. (A) Full gene cluster comparison between the A. sydowii locus (middle) and the ada/nsc loci from A. niger and N. fischeri, respectively. The A. sydowii BGC shows homology to the biosynthetic core genes in both loci. Furthermore, the A. sydowii locus hold a prenyltransferase encoding gene with homology to nscD. No homologs to adaD (O-methyltransferase) or nscE (NAD-dependent dehydratase) could be identified in the A. sydowii locus. (Green indicates validated genes). (B) The confirmed ada BGC compound, TAN-1612 (left). The predicted tetracycline compound from the A. sydowii locus (right), red indicates the expected modification in relative to TAN- 1612. (C) The confirmed nsc BGC compound, neosartoricin (left). The predicted neosartoricin analog compound from the A. sydowii locus (right), red indicates the expected modification in relative to neosartoricin.

issue and learn more about the diversity in these types of BGCs, the 157033 BCG was investigated in more detail. Firstly, in a more careful comparison to A. niger, the A. sydowii PKS (JGI: 157033) encoding gene was found to have 64% identity to adaA (PKS), with both containing the SAT-KS-MAT-PT-ACP domains. Moreover, the BGC located in A. sydowii had a similar gene combination to that of the ada-locus, including genes encoding a metallo-β- lactamase (MβL, JGI: 92454) with 62% identity to adaB (MβL), a flavin-dependent monooxygenase (FMO; JGI: 134988) with 63% identity to adaC (FMO), and a putative transcription factor (TF, JGI: 183300) with 45% identity to adaR (TF). In contrast, the A. sydowii locus showed no homology to adaD, responsible for the TAN-1612 O- methylation at the C9 position [9]. Further, the A. sydowii comparison to the vrt locus revealed similar homology, as seen in the A. sydowii and A. niger (ada) loci comparison (Table S1). Furthermore, an A. sydowii prenyltransferase encoding gene (PTA, JGI: 48554) with 46% identity to vrtC (PTA) was discovered directly upstream from the PKS (JGI: 157033). In the biosynthesis of viridicatumtoxin, the predicted function of VrtC is a monoterpene addition to the C12 position, with VrtD (geranyl-PP synthase) providing the necessary substrate [10]. However, with no A. sydowii homolog to vrtD, it was proposed, that the A. sydowii PTA is responsible for prenylation with a single isoprene unit. Therefore, based on these observations, we hypothesized that the expected tetracycline product resembles TAN-1612; however, without an O-methylation at C9 but is C12-prenylated (Figure 1B). In the comparison of A. sydowii to N. fischeri responsible for neosartoricin production (nsc), the A. sydowii locus revealed a significantly higher homology to the nsc locus, rather than to ada or vrt loci (Table S1). All five tentatively identified genes in A.

Page 99 5. Genetic Manipulation and Molecular Networking

sydowii had homologs in the nsc locus, as follows: the highest identity (80%) was observed between the A. sydowii PKS and nscA, followed by PTA and nscD with 79%, FMO and nscC with 74%, MβL and nscB with 72%, and TF with nscR with 50% identity score. Additionally, NscD from N. fischeri was shown to be able to prenylate both the tricyclic neosartoricin precursor in vivo, as well as the tetracycline compound TAN- 1612 in vitro at position C12 [8]. In further comparison, there was no homolog between any of the genes in the A. sydowii locus and nscE (a NAD-dependent dehydratase) from N. fischeri, a gene with no apparent role in the biosynthesis, but an essential attribute for neosartoricin-producing BGC characterization. Moreover, since an unidentified O-acetyltransferase catalyzes the C2-O-acetylation of neosartoricin in N. fischeri, several predicted O-acetyltransferase encoding genes in A. sydowii were compared to the O-acetyltransferases predicted or characterized within N. fischeri. However, no significant homologs were found. Thus, it was proposed that an alternative BGC product might be neosartoricin B, a neosartoricin analog, with a missing C2-O-acetylation (Figure 1C). In addition to the homologs identified through genome comparison, other genes close to the A. sydowii PKS encoding gene were identified. Using the NCBI CD-search further revealed genes encoding a putative major facilitated superfamily transporter (MFS, JGI: 48554), a gene resembling a hydrolase family, but with a middle region similar to a fungal TF regulation domain (JGI: 34258), and two genes encoding unknown functions (JGI: 34253 and JGI: 134993), see Table S1.

Homologous expression of a putative pathway-specific transcription factor Based on the comparative genomics observations, initial LC-MS analysis of the wild- type (WT) A. sydowii extract was performed. However, no expected UV absorption + (UVmax 400nm) nor the monoisotopic masses of protonated adducts ([M+H] ) for both predicted TC (m/z 469.1493) and neosartoricin B (m/z 443.1700) were detected (Figure 2A). Hence, it was considered that the BGC was silent in the WT strain under standard laboratory conditions. The PKS encoding gene was targeted for deletion in order to prove the BGC was not responsible for any unexpected compounds in the WT strain. The resulting PKSΔ strain shared a full comparable metabolome to the WT strain. In an attempt to activate the BGC, a one-strain-many-compounds (OSMAC) approach, as well as a studies involving epigenetic factors (SAHA and 5-azacitidine) and Lipopolysaccharides (LPS), a Gram-negative bacteria cell wall constituents used to simulate the fungi-bacteria co-culturing and thus the production of “defensive” secondary metabolites [12], were performed, but without any success. The putative upstream TF was then overexpressed (OE) under the control of the A. nidulans gpdA promoter. The construct was integrated into an intergenic region using a non- homology-end-joining (NHEJ) deficient strain, and the resulting OE TF-transformed (OE TF) strain exhibited a high yellow pigment secretion when grown on both minimal media (MM) and yeast extract sucrose (YES) media (Figure S1).

Page 100 5. Genetic Manipulation and Molecular Networking

Figure 2: Chemical profile of A. sydowii and characterized compounds from OE TF mutant. Base peak chromatogram (BPC) (black) and extracted wavelength chromatograms (EWCs) at 400nm (yellow) and 520nm (red) of A. sydowii WT (A) and OE TF (B) mutant. (C) Chemical structures of compounds purified from A. sydowii OE TF mutant strain. Shunt pathway products are shaded in blue, neosartoricin compounds are shaded in green, while expected tetracycline and sydopurpurin A are shaded in yellow and red, respectively. Compounds marked with * refers to compounds purified prior to the molecular networking analysis. The subsequent LC-MS analysis of the OE TF strain extract revealed the presence of the two expected [M+H]+ masses for TC and neosartoricin B. Furthermore, based on the expected UV absorption, a number of related compounds of variable carbon

backbone chain length (C17-C20), mainly prenylated to give C22-C25, were also identified. Among these, two additional TC-like compounds (m/z 355 and m/z 423B), with an

unexpected UVmax of 520nm, were found (Figure 2B). Further compound purification and structure elucidation led to four subclasses of compounds: tricyclic compounds

with C17, neosartoricins, the UVmax 520nm compound with C19, hereby named

sydopurpurin A (m/z 423B), and the expected TC with C20 carbon backbones (Figure 2C). Although both sydopurpurin A and neosartoricins have the same carbon backbone length, sydopurpurin A exhibits a fourth ring cyclization more similar to that of TC: here instead of a C1-C18 six-membered ring, a C2-C18 five-membered ring is observed (Figure 2C). To achieve a more controlled BGC activation, the TF was subsequently expressed under the control of the inducible A. nidulans alcA promoter. However, it was observed that with the varying concentration of the promoter-activating compound (threonine), only the relative amount of all BGC intermediates was regulated. On the other hand, at lower threonine concentrations, the ratio between neosartoricin B, tricyclic, and TC compounds were observed to be in favor of neosartoricin, than observed at the high concentrations of threonine (Figure S2).

Page 101 5. Genetic Manipulation and Molecular Networking

Targeted gene deletions for tetracycline-like BGC characterization The five expected core biosynthetic genes were targeted for deletion based on the gene comparison analysis (Figure 1), as were the additional genes at each end of the proposed locus. All the deletions were performed in the OE TF strain since the inducible activation of the TF resulted in significantly lower compound production in comparison to the OE TF strain. The resulting strains included OE TF PKSΔ, OE TF PTAΔ, OE TF FMOΔ, and OE TF MβLΔ. Deletion strains were also constructed for the putative MFS transporter (OE TF 48554Δ) encoding gene, as well as for a gene encoding an unknown function (OE TF 34253Δ). However, no successful transformant was obtained in several attempts to delete a putative hydrolase encoding gene (JGI: 34258) directly downstream to the PKS. Subsequently, the deletion of the hydrolase encoding gene in the A. sydowii WT strain was achieved in a single attempt. In order to observe an overall TF overexpression effect on the proposed BGC, an RT- qPCR gene expression analysis was performed using biosynthesis-essential deletion mutant strains (i.e., PKSΔ, FMOΔ, MβLΔ, as well as the OE TF strain). The TF affected genes in the new locus were compared on the relative gene expression levels to the WT strain. The genes encoding the FMO and MβL had significantly higher gene expression when the TF was overexpressed. The RT-qPCR analysis likewise revealed a high expression from the PTA encoding gene directly upstream to the PKS. Also, the putative hydrolase encoding gene (JGI: 34258) displayed a significant response in the presence of the TF. However, the gene revealed a decrease in gene activity when both the PKS and FMO encoding genes were eliminated, but the gene expression was restored in the MβLΔ strain, see Figure 3A.

Figure 3: Gene expression and metabolite profiles of A. sydowii mutant strains. (A) RT-qPCR gene expression data of OE TF and OE TF mutant strains. (B) EWC at 400nm (yellow) and 500nm (red) of OE TF mutant strains.

Page 102 5. Genetic Manipulation and Molecular Networking

Further chemical analysis of the OE TF deletion strains indicated that the proposed BGC is responsible for the production of all aforementioned compounds since upon deletion of the PKS encoding gene in the OE TF strain, all the compounds with UV

absorption above 400nm, including sydopurpurin A and the UVmax 520nm compound with lower mass, were no longer produced (Figure3B). The chemical profile of the OE TF PTAΔ strain revealed a mass decrease of 68Da for all the BGC-related secondary metabolites (SM), which fits with the observed polarity shift of BGC products. Deletion of the FMO encoding gene in the OE TF mutant had a major effect on SM production, as there were only a few compounds detected in significantly lower amounts, all of which, however, with an expected 16Da mass difference. In the OE TF MβLΔ strain, almost all of the compounds observed from the OE TF strain were gone, with mainly the compound 14 (m/z 469B) found in trace amounts. The OE TF 48554Δ and OE TF 34253Δ deletion strains did not show any changes in chemical profile in comparison to OE TF. However, in comparison to the OE TF strain, the UV intensity in the MFS transporter (JGI: 48554) deletion strain was lower, leading to speculations, that this gene might be part of the pathway genes, but in the absence of the specific transporter, other transporters could replace the activity resulting in only minor effects. Based on all findings in this study, the newly found locus, responsible for producing both neosartoricin and tetracycline, was named the nst-locus, see Figure 4.

Figure 4: The nst BGC. Gene names located within the arrows, JGI ID no. below. Predicted gene function sorted by colors.

Molecular networking as a tool for intermediate characterization For molecular networking, WT, OE nstR along with four OE nstR deletion mutants (i.e., nstAΔ, nstBΔ, nstCΔ, and nstDΔ) were used. The first network generated was a comparison between the WT and OE nstR strains, where the majority of the compounds produced by the OE nstR strain were clustered in their own subnetwork with no correlations to the SMs produced by the WT strain (Figure S3). In the WT and OE nstR-nstAΔ network, neither new subnetworks nor individual nodes with masses unique to OE nstR-nstAΔ were observed, confirming the PKS to be responsible for the production of all the unique OE nstR strain compounds (Figure S4). For further analysis, WT and OE nstR strains were analyzed together with each mutant (i.e., nstAΔ, nstBΔ, nstCΔ, and nstDΔ), to track which compound masses that were results of missing enzymatic activities (Figures S5-S8).

Page 103 .GntcMnplto n oeua Networking Molecular and Manipulation Genetic 5. ae104 Page

Figure 5: Molecular networking approach for proposal of intermediate structures. (A) Molecular network subcluster containing compounds unique to the OE nstR strain, with nodes colored according to missing enzymatic activity. The circles represent the consensus MS/MS spectrum for a given parent mass (decimals removed for legibility). The thickness of edges describe similarity between individual nodes by a cosine score. Nodes marked with * refer to initially NMR characterized compounds, while • refers to compounds characterized after molecular networking analysis; nodes marked with # and ¤ were identified as [M+Na]+ adducts and in-source fragments. (B) A subcluster close-up, illustrating molecular walkthrough approach.

5. Genetic Manipulation and Molecular Networking

Figure 5A shows a cluster unique to the OE nstR strain, with nodes colored according to masses seen in the individual mutant strains. It was clearly observed that the network is subclustered into two major groups, with prenylated compounds found on the right side, while non-prenylated compounds were observed to the left side of the subcluster. The m/z values of each individual node were investigated to identify other molecular adducts, rather than [M+H]+, present in the network, as well as in-source fragments of most abundant SMs, by referring to raw data files. By assigning the initially NMR characterized compounds (*), their immediate neighbors could be characterized based on similarity score and enzyme activity (Figure 5B). Compound m/z 401B, assigned as tricyclic compound 4b, contains one extra oxygen in comparison to compound m/z 385C, and no observed FMO activity for the m/z 385C, lead to the proposal of a structure identical to the tricyclic compound, but with missing oxygen at C2. A step further to compound m/z 427B, with a mass difference of 42Da, corresponding to the mass of a PKS extension unit, suggested a structure similar to compound m/z 385, but with a carbon backbone two carbons longer. Compound m/z

425C, assigned as neosartoricin D, and its neighbor m/z 443B differ by an H2O moiety. Thus, the structure of m/z 443B is proposed to be a spirocyclic hemiacetal compound, with a dioxabicyclo-octanone ring being open in comparison to neosartoricin D. A step further from m/z 443B to m/z 443A shows no mass difference, however the presence of a spirocyclic hemiacetal proposed the open ring structure, neosartoricin B, which fits with the proposed nst BGC product. Moreover, the proposed hemiacetal formation fits with the observed peak broadening corresponding to m/z443AB, observed at RT

8-9min (Figure 2). Another step from 443B to 425B showed an H2O loss and suggested dehydration at C19, and thus the presence of neosartoricin C, which along with Neosartoricins B and D, fit with previously published data [13]. Following a similar manner, the number of nodes was assigned tentative structures and summarized in Table S2, and several proposed structures were further confirmed by NMR (•).

Based on an individual node investigation and proposed chemical structures, the network was grouped into individual regions, revealing a splitting of the biosynthetic pathway (Figure 5A). The shunt products, representing a biosynthesis with one less PK extension unit, shaded in blue; here the enzyme order for the biosynthetic intermediates could be determined, with a PKS product (m/z 361) undergoing spontaneous decarboxylation (m/z 317), followed by prenylation (m/z 385) and FMO activity (m/z 401B) to give a final product, which we have named sydotricyclin A. Neosartoricin B (m/z 443A) and its hemiacetal form (m/z 443B), together with neosartoricins C and D (m/z 425C and m/z 425B, respectively), as well as the precursor with missing FMO activity (m/z 427B), were shaded in green. However, under the given networking parameters, no non-prenylated pathway intermediates, as observed with the shunt products, but with an extra extension unit, were observed. In contrast, the tetracycline (m/z 469B), shaded in yellow, showed no pathway intermediates, suggesting that tailoring enzyme activity happens either before release from the ACP

Page 105 5. Genetic Manipulation and Molecular Networking

domain or immediately after with a nearly 100% conversion rate. Pathway

intermediates related to sydopurpurin A (m/z 423B) varying in either oxygen or H2O moiety (m/z 441, m/z 425A, and m/z 457), and a non-prenylated analog (m/z 355), are shaded in red. All of them exhibited tetracyclic structures, however instead of a C1- C18 six-membered ring as observed in tetracyclines, they exhibited a C2-C18 five- membered ring formation (Table S2). Such ring formation was previously hypothesized to be a result of tetracycline destructase activity, which is triggered either by oxidation of C17 or by hydroxylation of C18 [14]. These observations propose that A. sydowii is capable of degrading tetracycline and that the putative hydrolase (nstE), observed in the nst BGC, could likely be involved, as in reference to the gene expression analysis. NstE might be a protective enzyme against the TC formation, further explaining the absence of expected non-prenylated tetracycline (m/z 469) intermediate in the molecular network.

Proposed biosynthetic pathway The biosynthetic pathway (Figure 6) was proposed based on the molecular networking analysis of intermediates observed uniquely in the OE nstR strain, as well as in individual deletion mutant and OE nstR pairwise comparison (Figure 5; Figures S3-S8). Based on the similarity of intermediate formation in mutant strains and clustering patterns in the molecular network, the tricyclic compound (4b) is deemed to be a shunt product of neosartoricin B (9) biosynthesis, where both are likely to follow parallel pathways to each other. Based on all intermediates readily observed in the OE nstR molecular network for 4b, NstA synthesizes and cyclizes PK backbone, which is released by NstB through hydroxylation, followed by immediate decarboxylation; NstD is responsible for the prenylation at the aromatic C12, and finally, NstC mediates the C2 hydroxylation. Additionally, for both compound 4b and neosartoricin B (9), an off-pathway dehydration results in compound 5, compound 10, and neosartoricins C (11) and D (12), respectively. Although, the molecular network of OE nstR reveals the presence a C-2 hydroxylated, but non-prenylated intermediate (m/z 375, 29ab, Figure S10) in the biosynthesis of neosartoricin B, the relative amounts of m/z 375 are significantly lower compared to that of the prenylated and non-hydroxylated intermediate 8 (m/z 427B), suggesting m/z 375 to be an overexpression artifact. Upon deletion of nstD in the OE nstR strain, the non-prenylated analogs of both 4b and 9 were observed (20, Figure S9 and 29ab, Figure S10, respectively), suggesting that NstC can accept both non- prenylated and prenylated pathway intermediates as a substrate. Interestingly, both the non-prenylated tricyclic compound (20, Figure S9) and neosartoricin B (29ab, Figure S10) still undergoing dehydration to result in non-prenylated analogs of compound 5 (21, Figure S9), compound 10, and Neosartoricins C and D (30-32, Figure S10), respectively. Upon nstC deletion, both shunt and neosartoricin B pathways terminate at penultimate pathway steps (3 and 7, respectively). Deletion of nstB results in a complete abolishment of the neosartoricin B pathway, with only trace

Page 106 5. Genetic Manipulation and Molecular Networking

amounts of the tricyclic compound 4b present. In contrary, the main compound observed in the OE TF nstBΔ mutant strain is a TC (m/z 469B, 14), suggesting that the MβL is not essential, but potentially boosts the C1-C18 cyclization for the production of TC compound, as proposed by Li et al. [9], and in contrast to the neosartoricin B pathway, the FMO activity is essential for production of 14, since upon nstC deletion the TC pathway is completely abolished. Furthermore, neither OE nstR nor OE nstR nstBΔ strains reveal potential pathway intermediates for TC (14) biosynthesis, however upon deletion of nstD, a new node of m/z 401C appears (*, Figure S8), corresponding to a non-prenylated TC (13), suggesting that NstD mediated prenylation happens after the release from ACP domain. Moreover, since non-prenylated sydopurpurin A (15) is the only non-prenylated compound readily observed in the OE nstR mutant, it suggests that NstE acts on non-prenylated TC to result in compound 15, which is subsequently prenylated by NstD to result in sydopurpurin A (16). The latter can be supported by the observed UV intensity increase of non-prenylated sydopurpurin A (15) in the OE nstR-nstDΔ in comparison to the OE nstR mutant (Figure 3). Moreover, with no non-prenylated sydopurpurin A intermediates observed in the OE nstR, it might be speculated that NstD has low substrate specificity and is able to prenylate a variety of polycyclic compounds, including unstable TC degradation intermediates (Figure S11).

Page 107 .GntcMnplto n oeua Networking Molecular and Manipulation Genetic 5. ae108 Page

Figure 6: The proposed biosynthetic pathway for A. sydowii nst gene cluster.

5. Genetic Manipulation and Molecular Networking

Discussion

Screening the genus Aspergillus for potential tetracycline BGCs Proposing the function of an unexplored BGC and linking it to the resulting SMs in silico requires more than just a comparison of core biosynthetic genes to previously characterized BGCs, and an in-depth analysis of the entire locus is often required. For the initial characterization of the A. sydowii nst-locus, only the three core genes, i.e., group V NRPKS, MβL, and FMO from A. niger (ada A-C), essential for the biosynthesis of core fungal TC structure were used for comparative studies. However, it was found that the same three core genes are also homologous to the genes in the neosartoricin- producing cluster of N. fischeri [11]. Further differentiation based on full nst-locus comparison to both ada and nsc loci suggests that the presence of a prenyltransferase and the absence of an O-methyltransferase in the locus, altogether is responsible for biosynthesis of a neosartoricin rather than a tetracycline [11]. However, no observed homology to NAD-dependent dehydratase (nscE) or any indications of the presence of acetyltransferases in A. Sydowii with homology to N. fischeri acetyltransferases, indicate the nst differentiation from the known neosartoricin producing BGCs [8]. Based on our study, a key differentiation point between TC- and neosartoricin- producing gene clusters could be a presence of a homolog to nstE, hydrolase-like encoding gene, indicating a “self-protecting” capacity against “accidental” TC production. However, more research must be conducted to prove this hypothesis.

Overexpression of nstR leads to an unnatural behavior in A. sydowii. Based on the inducible nstR expression regulated by the alcA promoter, it could be concluded, that the main BGC product is neosartoricin B since it is the first SM readily detected at the low concentration of the promoter-activating compound and is produced in the highest amounts in comparison to other pathway intermediates (Figure S2). However, overexpression using the strong constitutive A. nidulans promoter, gpdA, could have led to an abnormal upregulation of nst-locus genes (Figure 2B). Here, the link between the nst BGC and the biosynthesis of neosartoricins, the tricyclic compound, and the prenylated TC was verified by overexpressing the transcriptional regulator nstR and subsequent deleting nstA in A. sydowii. The excessive upregulation of the pathway could explain the tricyclic compounds with the

C17 backbone being the pre-release products, which indicates a failed event for the PKS to perform the final elongation. However, the same cannot be said about the TC production, since it undergoes a full elongation process. On the other hand, TC is the main product observed in the nstB (MβL) deletion mutant, suggesting that the expression of the putative hydrolase (nstE) might be regulated by the presence of TC, suggesting that TC production is most likely to be secondary rather than a shunt pathway. This is further supported by a lack of expression of nstE in the nstA and nstC deletion mutant strains, as TC is not detected here.

Page 109 5. Genetic Manipulation and Molecular Networking

Targeted gene deletions verify neosartoricin B as the main BGC product The core biosynthetic genes and their functions in the nst locus were verified by the deletion of nstA-nstD genes in the OE nstR strain. No successful deletion of the putative hydrolase, nstE, was achieved in the OE nstR strain, suggesting that the gene is an essential part of the BGC. The deletion of nstE in the WT strain further suggests that the enzyme-activity only is needed when the nst-locus is active. Interestingly, the core gene composition can be proposed depending on the target compound: instead of three expected core genes, i.e., NRPKS, MβL, and FMO, only two were found to be essential for either neosartoricin or TC production. For the neosartoricin production, only nstA and nstB were needed for neosartoricin backbone formation, with nstC and nstD responsible for subsequent tailoring activity. On the other hand, TC production required nstA and nstC, with nstB being preferred but not essential for the fourth ring formation and release from the ACP domain [9]. Further, TC compounds were either prenylated by nstD or degraded to sydopurpurin A suggestively by the putative hydrolase nstE. These observations further support the neosartoricin B being the main product of nst BGC in A. sydowii.

Molecular networking as a tool for biosynthetic pathway characterization With a BGC capable of producing different polycyclic polyketides, the conventional gene deletion and characterization of resulting SMs are no longer applicable. However, the combination of targeted gene deletion in the OE nstR strain with molecular networking was found to be a remarkable tool for understanding the SMs of a given BGC. The use of molecular networking was essential for unstable intermediate detection, such as the putative PKS product prior to decarboxylation, which could have otherwise been missed. Moreover, the intermediates and final products of the potential TC degrading enzyme could be identified, which were essential in the prediction of enzymatic function and hypothesizing the TC degradation pathway. On the other hand, finding the right processing parameters for the molecular networking of the overexpression mutants is challenging, since the compromise between being able to see the key pathway intermediates, and avoiding the unwanted biotransformation products (e.g., multiple water loss), insource fragmentation ions or numerous molecular adduct being included in the molecular network, is needed.

Enzyme order in the biosynthetic pathway is defined by the environmental factors The key difference between neosartoricin and TC production is the order of the enzymatic activities: for the biosynthesis of neosartoricins, NstC is the final tailoring enzyme, whereas for the TC production C2-oxidation happens while the core structure is still attached to the ACP domain, which is essential for the fourth ring cyclization. Although the primary function of NstB is release by thioester hydrolysis of neosartoricin precursor from the ACP domain, the drastic decrease of TC production upon nstB deletion suggests MβL being bi-functional, thus explaining the TC

Page 110 5. Genetic Manipulation and Molecular Networking

production. A similar case was previously described by Li et al., where aptB, an MβL with primary function was release of a nonaketide, upon exposure to a decaketide backbone in vitro, was able to catalyze the fourth ring cyclization, which was boosted by more than two-fold upon presence of Mn2+ as a cofactor [9]. The observed nstD ability to prenylate either tricyclic or tetracyclic compounds can be correlated to a previous study, where nscD from N. fischeri, with a homolog to nstD, was shown to be able to prenylate not only a neosartoricin precursor but also a nonaketide shunt and TC compounds [8], [15]. The nstD active site being non-specific can further be supported by the prenylated TC degradation intermediates, even though the non- prenylated sydopurpurin A is observed in significantly high amounts. Furthermore, the presence of the prenylated TC (14) and absence of its immediate precursor (13), however, the only non-prenylated compound observed in the OE nstR strain being the non-prenylated sydopurpurin A (15), suggests the non-prenylated TC (13) to be a preferred substrate for NstE to produce non-prenylated sydopurpurin A (15). However, due to the extensive nstD prenylation effect, some of compound (13) gets prenylated to result in TC (14), which might subsequently be resistant to NstE activity.

Conclusion

In this work, we successfully used a combination of bioinformatics, genetic tools, chemical analyses, and molecular networking analysis, to investigate the proposed products from an uncharacterized BGC and their biosynthetic pathways in A. sydowii. The nst gene BGC was shown to be highly similar to both the TAN-1612 encoding ada BGC in A. niger, and the neosartoricin B encoding nsc gene cluster in N. fischeri. The connection between the nst gene cluster and production of both neosartoricin B and the tetracycline compound was confirmed by the overexpression of the pathway- specific transcription factor nstR in A. sydowii, followed by targeted deletion of nstA. Subsequent deletion of predicted BGC genes, with homology to both ada and nsc BGCs, followed by the UHPLC-DAD-QTOFMS analysis, confirmed the predicted encoded gene functions. By using the molecular networking algorithm, it was possible to propose a branched biosynthetic pathway and enzymatic order for each of them, with neosartoricin B production following as primary and TC production being a secondary biosynthetic pathway, whereas the tricyclic compound production being a shunt path, derived from premature release of a nonaketide by the NRPKS. Moreover, the molecular networking revealed the products of an uncharacterized enzymatic activity, later proposed to be a hydrolase, prompting the proposal of the presence of protective activity against a potential overproduction of tetracycline compound. The described method, involving the combination of targeted gene cluster mining, silent gene cluster activation, followed by deletion of homolog genes encoding tailoring enzymes, and molecular networking was shown to be very useful in proposing the enzymatic order of the branched biosynthetic pathways, as well as unraveling a new enzymatic function and its corresponding products.

Page 111 5. Genetic Manipulation and Molecular Networking

Acknowledgements

This work was supported by the Novo Nordisk foundation, grand 15OC0016610.

Experimental

Bioinformatics A Basic Local Alignment Search Tool (BLAST) was used to investigate the publicly available whole-genome sequenced Aspergillus species at the Joint Genome Institute (JGI) portal. Potential novel tetracycline producing PKSs were identified based on protein sequences obtained from AdaA and VrtA [9], [10]. All potential hits were analyzed using the antiSMASH fungal version for the delineation of BGCs and the recognition of relevant tailoring enzyme-encoding genes [16]. The Python-based application Easyfig was used for visual conformational comparison to the ada, vrt, and nsc BGCs [17].

Strains and media A list of all strains constructed in this study is provided in Table S3. Gene deletion and gene overexpression were performed using a pyrG1, akuAΔ strain, name SYD5. The SYD5 strain was derived from the genome sequenced A. sydowii WT IBT# 11834. To retrieve relevant sequence information, v1.0 A. sydowii was used [18]. The genome sequence is from the Joint Genome Institute (JGI). The media used in the project included solid and liquid minimal medium (MM), transformation medium (TM), and yeast extract sucrose (YES) medium. The media was supplemented with 10 mM uridine and 10 mM uracil when necessary. MM and TM were prepared as described in Nødvig et al. (2015) [19], and YES was prepared as described by Samson et al. (2010) [20].

Vector- and strain construction All primers (TAG Copenhagen A/S, Denmark) used for amplification of A. sydowii derived PCR fragments and qPCR are listed in Table S4. PCR fragments were amplified using PfuX7 polymerase (in-house) [21] or Phusion High-Fidelity PCR Master Mix with HF Buffer from ThermoFisher Scientific (Catalog Number: F531S). Plasmids were constructed by Uracil-Specific Excision Reagent (USER) fusion or by NEBuilder® HiFi DNA Assembly Cloning Kit. All plasmids carried the ampicillin resistance gene and an origin of replication for propagation in E. coli. Gene deletion plasmids were constructed with 2kb homologous up- and downstream regions to the target gene on each side of the A. fumigatus or A. flavus pyrG marker. Flanging the pyrG marker was direct repeats for optional recycling using 5-fluoroorotic acid (5-FOA) plates. For the deletion of the nstE encoding gene (JGI ID: 34258), a 90-mer recovery oligo was transformed in combination with a CRISPR/Cas9 vector targeting the gene of interest. The procedure is described in Nødvig et al. (2018) [22]. The transcription factor (nstR, JGI ID: 183300) encoding gene, located upstream to the PKS encoding gene (JGI ID:

Page 112 5. Genetic Manipulation and Molecular Networking

157033), was used to construct an overexpression plasmid for constitutive expression under the control of the glyceraldehyde-3-phosphate dehydrogenase promoter (PgpdA), and with the terminator TtrpC, as well as A. fumigatus pyrG marker. A similar construct for inducible activation of the nst-locus was built using the Aspergillus nidulans alcohol dehydrogenase I (alcA) promoter. Linearized overexpression plasmids were integrated into an intergenic region validated for high gene expression using a Green Fluorescents Protein-encoding reporter gene (GFP). The background strain A. sydowii (pyrG1, akuA) was constructed from the A. sydowii pyrG1 strain [19]. The akuA (Protein ID 32329) knock-out strain was made by co- transforming the akuA deletion plasmid with a CRISPR-Cas9 vector containing the Cas9 endonuclease encoding gene and the protospacer targeting akuA [19]. The GenElute™ Plasmid Miniprep Kit (Sigma-Aldrich) was used for plasmid purification, and all deletion and overexpression plasmids were linearized with SwaI before transformation (New England Biolabs).

Protoplastation and transformation Spores were collected from a single agar plate of A. sydowii and grown overnight in liquid yeast extract peptone dextrose (YPD) medium at 30˚C at 150 rpm. The biomass was filtered through sterile Miracloth (EMD Millipore) and subsequently washed with sterile Milli-Q water. In order to digest the biomass, a solution of 40 mg/ml Glucanex (Novozymes A/S) was used. The biomass was digested/incubated at 30˚C for approximately 3 hours in 50 ml Falcon® tubes at 150 rpm. After digestion, an overlay

of 5 ml 50:50 Aspergillus Protoplastation Buffer (APB) (1.1 M MgSO4 and 10 mM Na-

phosphate buffer):H2O was carefully added, before centrifuged at 3000 g for 13 min at low acceleration and slowdown. Protoplasts captured in the interconnected layer was collected with a pipette and transferred to a new Falcon® tube and washed with

Aspergillus Transformation Buffer (ATB) (1.2 M Sorbitol; 50 mM CaCl2; 20 mM Tris; and 0.6 M KCl). The final pellet was resuspended in 1 ml ATB for a final concentration of 1:2x107 cells/ml. Transformation was achieved with linearized plasmids as described by Nødvig et al. (2015) [19] Transformation plates were incubated at 28˚C until colonies appeared on the plates (7-10 days). All strains were verified as homokaryotic gene-deletion mutants by diagnostic tissue-PCR (Kit: Mytaq™ Mix, Catalog Number: BIO-25041, Bioline), see Figure S12 and Table S5.

RNA purification and RT-qPCR RNA purification was achieved with the RNeasy Plus Mini Kit (Qiagen) following the provided manual with an added pre-step. A scalpel was used to scrape off a sample (d: 1cm) from a selected colony. The mycelia were transferred to a sterile 2 ml Eppendorf tube together with 1-3 sterile metal beads. Samples were kept in liquid nitrogen for a minimum of 2 minutes before transferred to a Tissuelyser LT (Qiagen). The samples were lysed at a frequency of 45 Hz for 1:30 minutes, followed by adding 350 µl RLT plus buffer 1% β-mercaptoethanol. From here, the provided protocol was completed.

Page 113 5. Genetic Manipulation and Molecular Networking

Complementary DNA synthesis was accomplished using the SensiFAST™ cDNA synthesis kit (Catalog no. BIO-65053, bioline) in compliance with the provided protocol; all RNA samples were standardized to 900 ng RNA/20 µl. A Nanodrop lite spectrophotometer was used to measure RNA concentrations (Thermo Scientific). SensiFAST™ SYBR® No-ROX kit (Catalog no. BIO-98050, Bioline) was applied as a mastermix for RT-qPCR. Primers were designed with a TM around 60C. RT-qPCR amplified fragments were designed to be between 150-300 bp, located to span an intron, if possible. All samples were analyzed on a Bio-Rad GFX connect Real-Time system. The reaction mixture and RT-qPCR program used were in accordance with the provided manual. The two housekeeping genes, actA (Protein ID 82929, actin) and hhtA (Protein ID 98757, histone 3), were used for normalization. The normalized data were calculated using the following equations: Fold change = 2^(-x), x = (gene_in_X_strain - housekeeping_in_X_strain) - (gene_ref. - housekeeping_ref.). All RT-qPCR data were analyzed in both biological and technical triplicates. A significance test using a two-tailed t-test (Microsoft(R) Excel) was applied to detect deviations relative to the reference strain.

General experimental procedure All samples were analyzed on an Agilent Infinity 1290 UHPLC system (Agilent Technologies, Santa Clara, CA, USA) equipped with a diode array detector (DAD). Separation achieved on Agilent Poroshell 120 phenyl-hexyl column (250mm × 2.1mm,

2.7μm particles), using a linear CH3CN/water (both buffered with 20mM FA) gradient

of 10% to 100% CH3CN in 15min, followed by 2min flush at 100% CH3CN, return to starting conditions in 0.1min and equilibration at 10% for 10min before the following run (0.35ml/min, 60°C).This was coupled to an Agilent 6550 QTOF MS equipped with an iFunnel ESI source operating in positive polarity, with exact data acquisition parameters described in previously published work [23]. 1D and 2D NMR analyses were performed on a Bruker Avance 600MHz and 800MHz spectrometers using standard sequence pulses. Samples were analyzed using deuterated NMR solvents

(CDCl3 or CD3CN) on a 3mm TCl cryoprobe.

Compound extraction and purification For mutant strain analysis, strains were cultured on MM and YES plates for 10 days in the dart at 28°C. Three 6mm diameter plugs taken in triplicates and extracted with acidic (1% FA) isopropanol (iPr) – ethyl acetate (EtOAc) (1:3 v/v) as described by Smedsgaard [24]. For the large-scale extraction, the OE nstR mutant strain was cultured on 100 YES agar plates for 10 days in the dark at 28°C. The agar was extracted twice with acidic (1 % FA) EtOAc. The liquid-liquid extraction was then performed on crude extract with 90% MeOH and heptane, resulting in two phases; the 90% MeOH fraction was diluted up to 50% and further extracted with dichloromethane (DCM), resulting in three phases overall. The DCM phase was dried before loading into 50 g

SNAP column (Biotage, Uppsala, Sweden) with RP C18 material (Grace, 15µm/100Å).

Page 114 5. Genetic Manipulation and Molecular Networking

Crude fractionation was performed using Isolera One automated flash system (Biotage) with 10% stepwise (3CV per fraction) MeOH/water (both buffered with 20mM FA) gradient of 10% to 100% with a flow rate 40ml/min. The 60-70% MeOH fractions containing target compounds were further purified by Agilent Infinity 1290

HPLC (Agilent Technologies, Santa Clara, CA, USA) on Kinetex RP C18 column (5µm,

100Å, Phenomenex) using linear gradient of 40% to 60% CH3CN/water (both buffered with 50ppm TFA) over 20min at a flow rate of 4ml/min.

LC-MS/MS analysis for Molecular networking Samples for the network analysis were analyzed using Agilent LC-MS system, where automated data-dependent MS/HRMS was performed for ions detected in the full scan at an intensity above 2000 counts at 10 scans/s in the range of m/z 300−500, with a cycle time of 0.7 s, a quadrupole isolation width of m/z ± 0.65 using a collision energy of 20 eV and a maximum of 5 selected precursors per cycle, and an exclusion time of 0.04 min. Differentiation of molecular ions, adducts, and fragment ions was done by chromatographic deconvolution and identification of the [M+Na]+ ion. Acquired data were converted from d. (Agilent standard data format) to .mzML using MSConvert (vers. 3.0.20003), which is part of the ProteoWizard project [25]. The threshold peak filter with a minimum intensity of 5000 counts was applied. The converted data files were then processed using the GNPS molecular networking tool [26], [27]. The molecular network generation parameters were set as follows: minimum pairs, cos 0.65; parent mass tolerance, 0.5Da; ion tolerance, 0.02Da; network topK, 100; minimum matched peaks, 10; minimum cluster size, 10. The molecular networking data were analyzed and visualized using Cytoscape (vers. 3.7.2) [28].

References [1] M. L. Nelson and S. B. Levy, “The history of the tetracyclines,” Ann. N. Y. Acad. Sci., vol. 1241, no. 1, pp. 17–32, 2011, doi: 10.1111/j.1749- 6632.2011.06354.x. [2] J. L. Markley and T. A. Wencewicz, “Tetracycline-inactivating enzymes,” Front. Microbiol., vol. 9, no. MAY, p. 1058, 2018, doi: 10.3389/fmicb.2018.01058. [3] M. Ahuja, Y.-M. Chiang, S.-L. Chang, et al., “Illuminating the Diversity of Aromatic Polyketide Synthases in Aspergillus nidulans,” 2012, doi: 10.1021/ja3016395. [4] C. M. Lazarus, K. Williams, and A. M. Bailey, “Reconstructing fungal natural product biosynthetic pathways,” 2014, doi: 10.1039/c4np00084f. [5] D. Hoffmeister and N. P. Keller, “Natural products of filamentous fungi: Enzymes, genes, and their regulation,” Natural Product Reports, vol. 24, no. 2. pp. 393–416, 2007, doi: 10.1039/b603084j. [6] L. Liu, Z. Zhang, C.-L. Shao, J.-L. Wang, H. Bai, and C.-Y. Wang, “Bioinformatical Analysis of the Sequences, Structures and Functions of Fungal Polyketide

Page 115 5. Genetic Manipulation and Molecular Networking

Synthase Product Template Domains,” Nat. Publ. Gr., 2015, doi: 10.1038/srep10463. [7] J. M. Crawford and C. A. Townsend, “New insights into the formation of fungal aromatic polyketides,” Nature Reviews Microbiology, vol. 8, no. 12. pp. 879– 889, Dec-2010, doi: 10.1038/nrmicro2465. [8] Y. H. Chooi, J. Fang, H. Liu, S. G. Filler, P. Wang, and Y. Tang, “Genome mining of a prenylated and immunosuppressive polyketide from pathogenic fungi,” Org. Lett., vol. 15, no. 4, pp. 780–783, 2013, doi: 10.1021/ol303435y. [9] Y. Li, Y. H. Chooi, Y. Sheng, J. S. Valentine, and Y. Tang, “Comparative characterization of fungal anthracenone and naphthacenedione biosynthetic pathways reveals an α-hydroxylation-dependent claisen-like cyclization catalyzed by a dimanganese thioesterase,” J. Am. Chem. Soc., vol. 133, no. 39, pp. 15773–15785, 2011, doi: 10.1021/ja206906d. [10] Y. H. Chooi, R. Cacho, and Y. Tang, “Identification of the Viridicatumtoxin and Griseofulvin Gene Clusters from Penicillium aethiopicum,” Chem. Biol., vol. 17, no. 5, pp. 483–494, 2010, doi: 10.1016/j.chembiol.2010.03.015. [11] K. Throckmorton, P. Wiemann, and N. P. Keller, Evolution of chemical diversity in a group of non-reduced polyketide gene clusters: Using phylogenetics to inform the search for novel fungal natural products, vol. 7, no. 9. 2015. [12] Z. G. Khalil, P. Kalansuriya, and R. J. Capon, “Lipopolysaccharide (LPS) stimulation of fungal secondary metabolism,” 2014, doi: 10.1080/21501203.2014.930530. [13] W.-B. Yin, Y. H. Chooi, A. R. Smith, et al., “Discovery of Cryptic Polyketide Metabolites from Dermatophytes Using Heterologous Expression in Aspergillus nidulans,” ACS Synth. Biol., vol. 2, no. 11, pp. 629–634, Nov. 2013, doi: 10.1021/sb400048b. [14] J. Park, A. J. Gasparrini, M. R. Reck, et al., “Plasticity, dynamics, and inhibition of emerging tetracycline resistance enzymes,” Nat. Chem. Biol., vol. 13, no. 7, pp. 730–736, 2017, doi: 10.1038/nchembio.2376. [15] Y.-H. Chooi, P. Wang, J. Fang, et al., “Discovery and Characterization of a Group of Fungal Polycyclic Polyketide Prenyltransferases,” doi: 10.1021/ja3028636. [16] K. Blin, S. Shaw, K. Steinke, et al., “antiSMASH 5.0: updates to the secondary metabolite genome mining pipeline,” Nucleic Acids Res., vol. 47, no. W1, pp. W81–W87, 2019, doi: 10.1093/nar/gkz310. [17] M. J. Sullivan, N. K. Petty, and S. A. Beatson, “Easyfig: A genome comparison visualizer,” Bioinformatics, vol. 27, no. 7, pp. 1009–1010, 2011, doi: 10.1093/bioinformatics/btr039. [18] R. P. De Vries, R. Riley, A. Wiebenga, et al., “Comparative genomics reveals high biological diversity and specific adaptations in the industrially and medically important fungal genus Aspergillus,” Genome Biol., vol. 18, 2017, doi: 10.1186/s13059-017-1151-0. Page 116 5. Genetic Manipulation and Molecular Networking

[19] C. S. Nødvig, J. B. Nielsen, M. E. Kogle, and U. H. Mortensen, “A CRISPR-Cas9 system for genetic engineering of filamentous fungi,” PLoS One, vol. 10, no. 7, p. e0133085, 2015, doi: 10.1371/journal.pone.0133085. [20] R. a. Samson, J. Houbraken, U. Thrane, J. C. Frisvad, and B. Andersen, “Food and Indoor Fungi,” CBS Lab. Man. Ser., pp. 375–377, 2010. [21] M. H. H. Nørholm, “A mutant Pfu DNA polymerase designed for advanced uracil-excision DNA engineering,” BMC Biotechnol., vol. 10, p. 21, Mar. 2010, doi: 10.1186/1472-6750-10-21. [22] C. S. Nødvig, J. B. Hoof, M. E. Kogle, et al., “Efficient oligo nucleotide mediated CRISPR-Cas9 gene editing in Aspergilli,” Fungal Genet. Biol., vol. 115, pp. 78– 89, Jun. 2018, doi: 10.1016/j.fgb.2018.01.004. [23] S. Kildgaard, M. Mansson, I. Dosen, et al., “Accurate dereplication of bioactive secondary metabolites from marine-derived fungi by UHPLC-DAD-QTOFMS and a MS/HRMS library,” Mar. Drugs, vol. 12, no. 6, pp. 3681–3705, 2014, doi: 10.3390/md12063681. [24] J. Smedsgaard, “Micro-scale extraction procedure for standardization screening of fungal metabolite production in cultures,” J. Chromatogr. A, vol. 760, no. 2, pp. 264–270, Jan. 1997, doi: 10.1016/S0021-9673(96)00803-5. [25] M. C. Chambers, B. MacLean, R. Burke, et al., “A cross-platform toolkit for mass spectrometry and proteomics,” Nature Biotechnology, vol. 30, no. 10. Nature Publishing Group, pp. 918–920, 10-Oct-2012, doi: 10.1038/nbt.2377. [26] J. Watrous, P. Roach, T. Alexandrov, et al., “Mass spectral molecular networking of living microbial colonies,” Proc. Natl. Acad. Sci. U. S. A., vol. 109, no. 26, Jun. 2012, doi: 10.1073/pnas.1203689109. [27] M. Wang, J. J. Carver, V. V. Phelan, et al., “Sharing and community curation of mass spectrometry data with Global Natural Products Social Molecular Networking,” Nat. Biotechnol., vol. 34, no. 8, pp. 828–837, 2016, doi: 10.1038/nbt.3597. [28] P. Shannon, A. Markiel, O. Ozier, et al., “Cytoscape: A software Environment for integrated models of biomolecular interaction networks,” Genome Res., vol. 13, no. 11, pp. 2498–2504, Nov. 2003, doi: 10.1101/gr.1239303.

Page 117 6. Expression Platform for decoration of a Fungal-derived Tetracycline in Aspergillus niger

Expression Platform for Biocombinatorial Decoration of a Fungal-derived Tetracycline in Aspergillus niger Peter B. Wolff1 and Karolina Subko1, Benjamin S. Bejder, Jakob B. Hoof, Thomas O. Larsen, and Uffe H. Mortensen*

Department of Biotechnology and Biomedicine, Technical University of Denmark, Build. 221/223, 2800, Kgs. Lyngby, Denmark. 1 These authors have contributed equally to this work * Correspondence: [email protected]

Abstract

In order to expand the repertoire of fungal-derived tetracyclines, an expression platform was developed, allowing for a biocombinatorial tailoring-enzyme based approach. The confirmed fungal tetracycline (TAN-1612) produced by the ada-locus from Aspergillus niger was used as a precursor, and the study here shows a trim down of the biosynthetic gene cluster to express a demethylated version of TAN-1612. By overexpressing relevant tailoring-enzyme encoding genes from various organisms, the platform is able to decorate the basic tetracycline scaffold. As a proof-of-concept, an AMA1-based heterologous screening approach is used for expressing a prenyltransferase encoding gene able to decorate the platform scaffold.

Keywords: Biocombinatorial decoration, tetracycline, Aspergillus niger

Introduction

Since natural products often share similar backbone structures biosynthesized by enzymes, such as polyketide synthases (PKSs) or nonribosomal peptide synthetases (NRPSs), the different chemical diversities are often reliant upon tailoring-enzyme activities [1]. Genome-mining of fungal genera could reveal a potential for novel compound discoveries. However, since most fungal biosynthetic gene clusters (BGCs) are silent under standard laboratory conditions, a conventional metabolome screening of an organism will not necessarily bring forth novel compounds, simply because the genes responsible are not expressed. Genome analysis tools (e.g., BLAST and antiSMASH [2], [3]) can now be utilized to search for specific BGCs responsible for a potential novel derivative compound. Still, the prediction of an exact compound structure from a putative BGC can be complicated [4]. Hence, activation of a silent BGC can result in the expression of an already characterized compound. Biosynthetic pathway rearrangement among distantly or closely related fungal species (e.g., through heterologous expression) has been proved successful in the formation of unique derivatives of already characterized NPs [5], [6]. A useful and practical approach in generating compound derivatives is to establish a basic scaffold producing strain and subsequently transform it with a gene-library of potential tailoring-enzyme encoding genes (e.g., on AMA1 plasmids), see figure 1. Page 118 6. Expression Platform for decoration of a Fungal-derived Tetracycline in Aspergillus niger

Figure 1 – Strategy concept for generating compound derivatives. Expression of a basic scaffold in combination with a gene-library (Different genes are represented by colors) for decoration and chemical diversity.

A compound group of particular interest in generating novel derivatives is tetracyclines. From the discovery of the first tetracycline in the 1940s, the compound class has proved vital in clinical treatments against both Gram-positive and -negative bacterial pathogens [7]. In addition to being broad-spectrum antibiotics, tetracyclines have also proven bioactive in other clinical areas (e.g., antitumor and antifungal) [8]. The extensive bioactivities, in many cases, are the result of tetracyclines having a privileged scaffold decorated with functional groups liable to modifications. Pharmaceutical companies have over several decades, developed different methods for generating both semi-synthetic and synthetic derivatives, resulting in compounds with improved potency and better bacterial resistance endurance, see figure 2A. Still, today only a limited number of new derivatives are being developed, and even less are being approved for clinical use [9], [10]. This study shows the establishment of an A. niger background strain capable of producing readily detectable amounts of a basic tetracycline scaffold. The A. niger genome contains a BGC responsible for the production of TAN-1612 [11], a tetracycline with an O-methylation added as the only tailoring-enzyme activity. A demethylated version of TAN-1612 could be a suitable structure for further chemical modifications by heterologous expression of tailoring enzymes from related pathways from various fungal species, as well as species of bacterial origin. As a proof-of-concept, the platform tetracycline production and the decoration efficiency, are demonstrated by heterologous expressing a tailoring-enzyme resulting in prenylation of the tetracycline core structure.

Results

Homologous reconstitution of the ada pathway in A. niger. A previous study by Li et al. has demonstrated the ability of A. niger to produce a minimal chemical modified tetracycline (TAN-1612) expressed from the ada-locus [11]. The BGC is silent under standard laboratory conditions. However, when the pathway- specific transcription factor (adaR) encoding gene is placed under the regulation of an active promoter, and homologous expressed in A. niger ATCC 1015, TAN-1612 is produced, see figure 2A. The ada-locus contains five genes encoding a non-reducing Page 119 6. Expression Platform for decoration of a Fungal-derived Tetracycline in Aspergillus niger

(NR) PKS (adaA), a metallo-β-lactamase (adaB), a flavin-dependent hydrolase (adaC), an O-methyltransferase (adaD), and the transcription factor (adaR). The core structure of TAN-1612 requires the activity of the first three enzymes. The NR-PKS (AdaA) synthesizes a C20 polyketide with ring closures between C6-C11, C4-C13, and C2-C15. The flavin-dependent hydrolase (AdaC) is responsible for a C2-hydroxylation that may be essential for the Claisen cyclization of the fourth ring (C1-C18) catalyzed by the metallo-β-lactamase (AdaB), which also is responsible for the release of the compound. The only decorative tailoring-enzyme encoding gene present in the BGC is adaD, which is involved in the O-methylation of a C9 hydroxyl group. Expressing the first three genes will result in the production of a demethylated version of TAN-1612 [11], that represents a basic scaffold with positions upon for modifications, see figure 2B.

Figure 2 – Clinical developed tetracyclines, TAN-1612, and the platform basic structure. (A) Structural confirmed tetracycline. Chlortetracycline and oxytetracycline, 1st generation tetracyclines, has antibiotic bioactivity against Gram-positive and Gram-negative pathogens [12], doxycycline, a 2nd generation tetracycline, more potent than its predecessors [13], tigecycline, a 3rd generation tetracycline, active against methicillin-resistant Staphylococcus aureus [14]. (B) The platform basic tetracycline structure, demethylated TAN-1612, with possible positions and enzymatic activities for modifications.

The fundamental principle of the study was, therefore, to activate the core genes in the ada pathway, and in that, generate an A. niger strain expressing enough of the demethylated TAN-1612 to ensure availability for post-expressed tailoring enzymes related to tetracycline or tetracyclic-like pathways. The development of the background strain was attempted with two different approaches, see Figure 3. In the first version of the expression platform, the genes adaA, adaB, and adaC were expressed under the regulation of a single constitutive promoter (Ptef) with each gene separated by the picornavirus self-cleaving sequence (P2A)[15], the strain will be referred to as OE adaA-C. The construct was integrated into the albA encoding gene [16], which resulted in white colonies for easy screening, see Figure S1. The strain used

Page 120 6. Expression Platform for decoration of a Fungal-derived Tetracycline in Aspergillus niger

for integration of the genes was engineered to be deficient of the original ada BGC, but with an intergenic integration of a putative MFS transporter (with native promoter/terminator) usually located directly downstream to adaA, denoted adaT in Figure 3A. In the second version of the expression platform, the transcription factor encoding gene adaR was expressed within a construct regulated by the A. nidulans gpdA promoter, which was integrated into the genome in a CRISPR/Cas9 mediated transformation targeting the integration site. Within the same transformation, the original adaR and adaD were targeted for deletion by introducing double-stranded breaks (DSB) initiated through a CRISPR/Cas9 vector. The complete knock-out was achieved by additionally introducing a single-stranded 90-mer oligo fragment with homology sections bordering the sequence to be deleted, as previously described by Nødvig et al. [17]. The strain will be referred to as OE adaR/adaRDΔ. The second version allowed for a strain construction without any markers since these were harbored on the CRISPR/Cas9 vectors applied and could, therefore, be easily removed, see Figure 3B. All the above described genetic engineering was conducted in a pyrG disrupted and non-homologous end-joining (NHEJ) deficient A. niger strain, for further information, see the experimental section.

Figure 3 - Schematic representation of the two expression platform strains. (A) Platform version 1 (OE adaA-C). Genes were PCR amplified and cloned with the self-cleaving sequence, P2A, as illustrated. The putative MFS transporter (adaT) was amplified with the native promoter and terminator, and further integrated. The resulting strain was deficient in melanin production due to a disrobed albA gene. (B) Platform version 2 (OE adaR/adaRDΔ). The transcription factor encoding gene (adaR) was PCR amplified and expressed under the regulation of the constitutive promoter, gpdA, and integrated. Simultaneously, the genes adaR

Page 121 6. Expression Platform for decoration of a Fungal-derived Tetracycline in Aspergillus niger

and adaD were targeted for deletion by a CRISPR/Cas9 vector with a 90-mer homologous oligo fragment for recovery.

Verification and analysis of tetracycline production in the platform strains To demonstrate the performance of the two platform versions and validate the production of tetracycline, the strains were analyzed by Ultra-High-Performance Liquid Chromatography – Diode Array Detection – Quadrupole Time Of Flight Mass Spectrometry (UHPLC-DAD-QTOFMS). In platform version 1 (OE adaA-C), a new compound appeared in low concentration with the expected mass for a demethylated TAN-1612 (i.e., m/z 401.0867), which was undetectable in both the A. niger WT and the ada-locus deletion strain, see Figure 4A. For the OE adaR/adaRDΔ strain, a compound with a similar mass appeared but in high readily amounts compared to the OE adaA-C strain. However, the retention time between the two compounds from each strain was different with approximately 1.2 minutes, which clearly indicates that the two compounds are not identical, see figure 4B. In further observations, the OE adaR/adaRDΔ strain secreted an intense yellow coloring into the MM media, which could indicate a production of tetracycline compound, see figure S1. This was not observed in the OE adaA-C strain.

Figure 4 – Analysis of platform strains (A) Extracted ion Chromatogram (EIC) of 401.0867 (±5ppm), the expected mass for the tetracycline of interest. The A. niger strain with the reconstitution of OE adaA-C is depicted as the top chromatogram, followed by A. niger WT and a full ada-locus deletion strain. (B) Extracted ion Chromatogram (EIC) of 401.0867 (±5ppm), the expected mass for the tetracycline of interest. The A. niger OE adaR/adaRDΔ strain is depicted as the top chromatogram, followed by A. niger WT.

AMA1-based expression of two tailoring-enzyme encoding genes for further validation In the next phase of the validation, both the tailoring-enzyme decoration efficiency was analyzed by individually expressing two genes from verified tetracycline- modifying pathways, as well as further verification of the tetracycline production by reconstitution of the full ada-pathway. The first encoding gene was, therefore, the homologous A. niger O-methyltransferase (adaD) [11], and the second was a prenyltransferase encoding gene (nstD) from the A. sydowii nst-locus, identified in a previous study [4]. Both proteins have been confirmed as interacting with the TAN- 1612 demethylated structure. The genes were introduced into the two platform strains by an AMA1-based vector under the regulation of the strong constitutive promoter, gpdA, as illustrated in figure 5.

Page 122 6. Expression Platform for decoration of a Fungal-derived Tetracycline in Aspergillus niger

Figure 5 – Platform strategy for expression of tailoring-enzyme encoding genes. Genes of interest (GOI) can be introduced into the AMA1-based vector by homologous region overhangs (25 bp) matching part of the promoter and terminator, as illustrated. The cloning method used in this particular case is Gibson cloning. Genes can either be PCR amplified directly from genomic DNA or ordered as synthetic gene-blocks. The complete AMA1-vector is transformed into the platform strains, and subsequently, chemically analyzed.

Transformants were grown for 7 days at 30˚C before samples were collected and analyzed by UHPLC-DAD-QTOFMS. For the platform strain OE adaA-C, the resulting transformants only showed a moderate conversion of the previously detected basic structure by means of the two tailoring-enzymes expressed (i.e., adaD and nstD); see figure 6A. The chemical profile (i.e., extracted ion chromatogram (EIC) at m/z 415.1024 ±5ppm) of the transformants expressing adaD were further compared to the chemical profile of an A. niger strain overexpressing adaR with confirmed production of TAN- 1612, m/z 415.1024. The results showed inconsistency in the retention-time between the two compounds, which should be identical if the O-methyltransferase (AdaD) was interacting with the correct platform basic structure, see figure 6B. Moreover, a similar comparison was carried out between the transformants expressing nstD and an A. sydowii strain overexpressing nstR, a transcription factor involved in activation of the nst-locus responsible for producing neosartoricin B and low concentrations of a prenylated tetracycline (i.e., peak (X) at retention-time approximately 6.8 min in figure 6C), which should be identical to the expected compound from the transformants. The results showed a retention-time comparable to one of two peaks in the A. sydowii strain, see figure 6C. However, the peak (Y) at the retention-time approximately 5.6 min is not a prenylated tetracycline, but an unknown structural compound predicted to lack the C2 hydroxyl group, usually catalyzed by nstC [4]. MS/MS fragmentation patterns in a comparison between TAN-1612 and the A. sydowii prenylated tetracycline further confirmed that the compound produced by the OE adaA-C platform strain was not a demethylated TAN-1612, see Figure S2. Transformation in the OE adaR/adaRDΔ platform strain resulted in transformants with considerably higher conversion of the basic structure, see figure 6D. In comparison with TAN-1612 and the prenylated tetracycline produced in the A. sydowii OE nstR strain, the retention-time alignments were accurate in the extracted ion

Page 123 6. Expression Platform for decoration of a Fungal-derived Tetracycline in Aspergillus niger

chromatograms. This indicates a correct production of a demethylated TAN-1612 in the OE adaR/adaRDΔ strain, see figure 6E-F. MS/MS fragmentation patterns further support a correct structure, see figure S2.

Figure 6 – Validation of the tetracycline compounds produced in the two platform strains. (A) EICs of expected tetracycline compound 401.0867 (±5ppm, black), O-methylated tetracycline 415.1024 (±5ppm, blue), and prenylated tetracycline 469.1493 (±5ppm, green) for the adaA-C strain, adaA-C + adaD, and adaA-C + nstD. (B) EIC 415.1024 (±5ppm) of A. niger OE adaR reference strain and OE adaA-C + adaD strain. (C) EIC 469.1493 (±5ppm) of the A. sydowii OE nstR reference strain, with prenylated tetracycline (X) and an incomplete pathway product (Y), also observed in an A. sydowii strain with missing FMO activity [4], and the adaA-C + nstD strain. (D) EICs of expected tetracycline compound 401.0867 (±5ppm, black), O-methylated tetracycline 415.1024 (±5ppm, blue), and prenylated tetracycline 469.1493 (±5ppm, green) for the OE adaR/adaRDΔ strain, OE adaR/adaRDΔ + adaD, and OE adaR/adaRDΔ + nstD. (E) EIC 415.1024 (±5ppm) of A. niger OE adaR reference strain and OE adaR/adaRDΔ + adaD strain. (F) EIC 469.1493 (±5ppm) of the A. sydowii OE nstR reference strain, with prenylated tetracycline (X) and an incomplete pathway product (Y), and the OE adaR/adaRDΔ + nstD strain.

Identifying candidate tailoring enzyme-encoding genes for further expression With a functional platform strain available (i.e., the OE adaR/adaRDΔ strain), the following course of action was to identify gene candidates encoding either a confirmed tetracycline-interacting function or selecting genes with predicted functions that could potentially chemical modify the platform’s basic scaffold. Two genes from streptomyces spp. were identified from literature to be a halogenase and a FAD-dependent hydrolase (oxyE), both involved in tetracycline pathways (i.e., chlortetracycline and oxytetracycline, respectively) [18], [19]. The genes were codon- optimized and ordered as synthetic gene-blocks with overhangs for easy Gibson cloning into an AMA1-based expression vector, as illustrated in figure 5. The translated proteins could, if correctly interacting with the basic tetracycline scaffold, respectively

Page 124 6. Expression Platform for decoration of a Fungal-derived Tetracycline in Aspergillus niger

chlorinate and oxidize the compound, as illustrated in figure 2. In particular, the OxyE enzyme, initially responsible for oxidation required for further attachment of a dimethylamine group, could function as a pre-step in the biosynthesis with other tailoring enzymes examined. An epoxidase, also from the genus streptomyces, was likewise chosen from the literature. However, the enzyme is not involved in a tetracycline biosynthetic pathway but is from an aromatic polyketide tricyclic pathway producing a compound named mensacarcin [20]. The protein could potentially interact with the tetracycline scaffold and add an epoxide, as shown in figure 2. However, the enzymes active site most have a low substrate specificity for the reaction to be successful. The protein-encoding genes from the genus streptomyces are listed in more detail in table 1, no. 1-3. To identify relevant Aspergillus tailoring-enzyme encoding genes with potential for modifying the basic tetracycline, an analysis was conducted based on a BLAST-search with AdaA, AdaB, and AdaC as protein-sequence queries. Out of the approximately 100 public available Aspergillus genomes from JGI (the Joint Genome Institute), 23 hit loci in various strains were identified, see Table S1. Each locus was further analyzed with antiSMASH fungal version for further BGC delineation and gene recognition [3]. Genes of interest were hand-picked based on their predicted function to decorate the scaffold, and their close proximity to a BGC predicted to produce a fungal tetracycline- like compound. Genes ordered as synthetic gene-blocks are listed in table 1 (no. 4-15). Table 1 – Genes and predicted gene-encoding functions selected for screening. Gene ID Additional No. Name Species origin no. (JGI) Predicted function info. Streptomyces 1 Halogenase - Chlorine transferase [19] aureofaciens Streptomyces FAD-dependent 2 OxyE - [18] rimosus hydrolase Luciferase-like Streptomyces 3 - Epoxidation [20] monooxygenase bottropensis 4 P450 Aspergillus versicolor 34633 Oxidation 5 P450 Aspergillus vadensis 328556 Oxidation Aspergillus 6 Sugar transporter 157800 Transporter welwitschine 7 Sugar transporter Aspergillus piperis 479818 Transporter Sugar transporter/ Aspergillus 157800/ Transporter/ Separated 8 Oxidoreductase- welwitschine 167919 by P2A like Oxidoreductase- Aspergillus 9 167919 Reduction like welwitschine Dehydrogenase- 10 Aspergillus neoniger 450729 Hydroxyl to ketone like Alcohol dehydro.- Aspergillus 11 31154 Ketone to hydroxyl, like tubingensis 12 Aminotransferase Aspergillus versicolor 89713 Amine addition Tryptophan Aspergillus 13 445784 PTA-like dimethylallyltrans. novofumigatus PhzF protein family 14 Aspergillus neoniger 373920 Nitrogen addition. (phenazine) 15 Goodbye domain Aspergillus piperis 522214 Unknown

Page 125 6. Expression Platform for decoration of a Fungal-derived Tetracycline in Aspergillus niger

Discussion

The aim of the study was to develop a platform strain able to produce a suitable tetracycline for further biocombinatorial decoration in A. niger. The choice of developing the platform in the native A. niger strain is justified on the host's ability to both survive and secrete the compound. Heterologous expressing the pathway in an alternative host may possibly help in the purification of the newly biosynthesized compounds since some expression strains can be optimized for less cross chemistry [ref]. However, it is not given that they tolerate a bioactive tetracycline. The first strain developed (OE adaA-C) did not produce the compound of interest, and based on the data shown here, it could be speculated that the last gene (adaC) in the integrated P2A-based construct was not translated. Hence, the flavin-dependent hydrolase (AdaC) would be absent in the biosynthetic pathway, and in that, the C2 position in the scaffold would not be oxidized to form the hydroxyl group, which may be essential for a correct Claisen-cyclization, usually catalyzed by the metallo-β- lactamase (AdaB). This would further lead to incorrect forth-ring cyclization, as indicated by the MS/MS fragmentation pattern, see figure S2. For the platform strain, OE adaR/adaRDΔ, the compound of interest was produced in readily amounts and further confirmed by reconstitution of the ada-pathway by homologous expressing the native O-methyltransferase (AdaD) with resulting proof- of-concept production of TAN-1612. By heterologous expressing the prenyltransferase encoding gene (nstD), the strategy for an AMA1-based gene screening was demonstrated. The compounds were all verified by retention-time comparison and MS/MS fragmentation patterns, see figure S2. In both versions of the platform (i.e., OE adaA-C and OE adaR/adaRDΔ), it was possible to convert the basic scaffolds in expressing the two tailoring-enzyme encoding genes. This indicates that the OE adaA-C strain produces a compound that is similar to tetracycline in regard to the first three ring-formations and, therefore, is acceptable for the enzyme’s active sites. The entire structure of the unknown compound still needs investigation. For further use of the platform, 15 genes were ordered as synthetic gene-blocks to be cloned and transformed into the OE adaR/adaRDΔ strain. However, in lack of time before the hand-in of the present thesis, the experiment remains to be performed. For future perspective, genes screened will be part of a gene-library. The initial screen will be the AMA1-based approach with subsequent genome-integration of genes encoding a decorative-functional enzyme. Following the integration of individual enzyme- encoding genes, the AMA1-based gene-library will be rescreened in the new strain. In this way, enzymes that require a pre-step to function will have a second chance, and as the library expanse, previous non-functional enzyme-encoding genes could be relevant again.

Page 126 6. Expression Platform for decoration of a Fungal-derived Tetracycline in Aspergillus niger

Conclusion

The combination of overexpressing the transcription factor encoding gene (adaR) under the regulation of a strong constitutive promoter and simultaneously knock out the adaR and adaD in the ada-locus proved A. niger as a good tetracycline-producing platform species (i.e., OE adaR/adaRDΔ). In addition, and very promising the platform showed to be compatible with the AMA1-based vector expression of both the homologous encoding gene adaD and the heterologous prenyltransferase-encoding gene, nstD.

Acknowledgements

This work was supported by the Novo Nordisk foundation, grand 15OC0016610.

Experimental section

Strains and media All strains produced in this study are given in Table S2. All genetic engineering was achieved in a pyrG1, akuAΔ strain, locally identified as NIG96. The NIG96 strain was generated from the sequenced WT genome A. niger ATCC1015. All sequence data used in this study were obtained from v3.0 A. niger [21] genome sequence from the Joint Genome Institute (JGI). The media used in this study included solid and liquid minimal medium (MM), transformation medium (TM), and yeast extract sucrose (YES) medium. Supplemented with 10 mM uridine and 10 mM uracil was added to the media when needed. Hygromycin (100 µg/ml) was used in media-overlay when transformation included constructs carrying the hygromycin resistance marker. MM and TM were made as described in Nødvig et al. (2015) [22], and YES was made, as described by Samson et al. (2010) [23].

Vector- and strain construction All primers in this study were ordered from TAG Copenhagen A/S, Denmark, and used for amplification of A. niger or A. sydowii derived PCR-fragments, see Table S3. PCR fragments were amplified using Phusion High-Fidelity PCR Master Mix with HF Buffer from ThermoFisher Scientific (Catalog Number: F531S). CRISPR vectors were constructed by Uracil-Specific Excision Reagent (USER) fusion, and integration constructs were constructed using NEBuilder® HiFi DNA Assembly Cloning Kit. For the construction of the adaA-C strain did all plasmids harbor the ampicillin resistance gene and an origin of replication for propagation in E. coli. Gene deletion plasmids were built with 2kb homologous up- and downstream regions to the target gene on each side of the A. fumigatus pyrG marker. Flanging the pyrG marker was direct repeats for optional recycling using 5-fluoroorotic acid (5-FOA) plates. The construct for overexpressing adaA, adaB, and adaC was designed with the tef promoter and terminator. The genes were separated with picornavirus P2A, amino acid sequence:

Page 127 6. Expression Platform for decoration of a Fungal-derived Tetracycline in Aspergillus niger

GSGATNFSLLKQAGDVEENPGP [15], with the removal of the stop-codon in adaA and adaB. For the construction of the OE adaR/adaRDΔ strain, the CRISPR vector targeting the AdaD encoding gene was designed with the ampicillin resistance gene and an origin of replication for propagation in E. coli. A 90-mer recovery oligo (TAG Copenhagen A/S, Denmark) was used in combination with the CRISPR/Cas9 vector targeting the gene. The CRISPR vector targeting the integration site was designed with the hygromycin resistance marker and an origin of replication for propagation in E. coli. The integration construct for overexpression of adaR was designed with the constitutive promoter, PgpdA, and 2kb homologous up- and downstream regions to the site of integration. The procedure is described in Nødvig et al. (2018) [17]. Linearization of plasmids for integration was performed with SwaI before the transformation, as described in the protocol (New England Biolabs). All synthetic genes were ordered from IDT (Integrated DNA Technology™) with 25 bp overhangs for easy cloning into an AMA1 vector (PgpdA- X-TtrpC). If needed, the synthetic genes were codon-optimized for Aspergillus using the IDT g-block application. The background strain A. niger (pyrG1, akuA) was constructed by Nødvig et al. [17]. The GenElute™ Plasmid Miniprep Kit (Sigma-Aldrich) was used for plasmid purification. Protoplastation and Transformation Spores were collected from a single agar plate of A. niger and grown in liquid yeast extract peptone dextrose (YPD) medium at 30˚C at 150 rpm overnight. The biomass was filtered through sterile Miracloth (EMD Millipore) and afterward washed with sterile Milli-Q water. The biomass was digested in a solution of 40 mg/ml Glucanex

(Novozymes A/S)/Aspergillus Protoplastation Buffer (APB) (1.1 M MgSO4 and 10 mM Na-phosphate buffer) at 30˚C for approximately 3 hours in a 50 ml Falcon® while shaking. After digestion, an overlay of 5 ml 50:50 Aspergillus Transformation Buffer

(ATB) (1.2 M Sorbitol; 50 mM CaCl2; 20 mM Tris; and 0.6 M KCl) / H2O was carefully added, before centrifuged at 3000 g for 13 min at low acceleration and slowdown. Protoplasts captured in the interconnected layer was collected with a pipette and transferred to a new Falcon® tube and washed with ATB. The final pellet was resuspended in 1 ml ATB for a final concentration of 1:2x107 cells/ml. Transformation was achieved as described by Nødvig et al. (2015) [22]. Transformation plates were incubated at 30˚C until colonies appeared on the plates (3-5 days). All strains, except strains transformed with AMA1-based plasmids, were verified as homokaryotic gene- deletion or correct integration mutants by diagnostic tissue-PCR (Kit: Mytaq™ Mix, Catalog Number: BIO-25041, Bioline), see Figure S3 and Table S4. General experimental procedure All samples were analyzed on an Agilent Infinity 1290 UHPLC system (Agilent Technologies, Santa Clara, CA, USA) equipped with a diode array detector (DAD). Separation achieved on Agilent Poroshell 120 phenyl-hexyl column (150mm × 2.1mm, 1.7μm particles) with a flow rate of 0.35ml/min at 40°C, using a linear CH3CN/water

Page 128 6. Expression Platform for decoration of a Fungal-derived Tetracycline in Aspergillus niger

(both buffered with 20mM FA) gradient of 10% to 100% CH3CN in 10min, followed by 2min flush at 100% CH3CN, return to starting conditions in 0.1min and equilibration at 10% for 2min before the following run. This was coupled to an Agilent 6550 QTOF MS equipped with an iFunnel ESI source operating in positive polarity, with exact data acquisition parameters described in previously published work [24]. Compound extraction For mutant strain analysis, strains were cultured on MM and YES plates for 7 days in the dart at 30°C. Five 4mm diameter plugs were taken in triplicates and extracted with acidic (1% FA) isopropanol (iPr) – ethyl acetate (EtOAc) (1:3 v/v) as described by Smedsgaard [25]. References [1] C. Hertweck, “The biosynthetic logic of polyketide diversity,” Angew. Chemie - Int. Ed., vol. 48, no. 26, pp. 4688–4716, 2009, doi: 10.1002/anie.200806121. [2] S. F. Altschul, W. Gish, W. Miller, E. W. Myers, and D. J. Lipman, “Basic local alignment search tool,” J. Mol. Biol., vol. 215, no. 3, pp. 403–410, 1990, doi: 10.1016/S0022-2836(05)80360-2. [3] K. Blin, S. Shaw, K. Steinke, et al., “antiSMASH 5.0: updates to the secondary metabolite genome mining pipeline,” Nucleic Acids Res., vol. 47, no. W1, pp. W81–W87, 2019, doi: 10.1093/nar/gkz310. [4] P. B. Wolff, K. Subko, S. Theobald, et al., “Genetic Manipulation and Molecular Networking for Biosynthetic Pathway Characterization of Tetracycline-like Compounds in Aspergillus sydowii,” 2020, In preparation for submission. [5] D. J. Mattern, V. Valiante, F. Horn, L. Petzke, and A. A. Brakhage, “Rewiring of the Austinoid Biosynthetic Pathway in Filamentous Fungi,” 2017, doi: 10.1021/acschembio.7b00814. [6] M. Okada, K. Saito, C. P. Wong, et al., “Combinatorial Biosynthesis of (+)- Daurichromenic Acid and Its Halogenated Analogue,” 2017, doi: 10.1021/acs.orglett.7b01288. [7] I. Chopra and M. Roberts, “Tetracycline Antibiotics: Mode of Action, Applications, Molecular Biology, and Epidemiology of Bacterial Resistance,” Microbiol. Mol. Biol. Rev., vol. 65, no. 2, pp. 232–260, 2001, doi: 10.1128/mmbr.65.2.232-260.2001. [8] B. Zakeri and G. D. Wright, “Chemical biology of tetracycline antibiotics,” Biochem. Cell Biol., vol. 86, no. 2, pp. 124–136, 2008, doi: 10.1139/O08-002. [9] M. L. Nelson and S. B. Levy, “The history of the tetracyclines,” Ann. N.Y. Acad. Sci, doi: 10.1111/j.1749-6632.2011.06354.x. [10] The Pew Charitable Trusts, “Antibiotics Currently in Clinical Development,” 2018. [11] Y. Li, Y. H. Chooi, Y. Sheng, J. S. Valentine, and Y. Tang, “Comparative characterization of fungal anthracenone and naphthacenedione biosynthetic pathways reveals an α-hydroxylation-dependent claisen-like cyclization catalyzed by a dimanganese thioesterase,” J. Am. Chem. Soc., vol. 133, no. 39, pp. 15773–15785, 2011, doi: 10.1021/ja206906d. [12] I. Chopra, P. M. Hawkey, and M. Hinton, “Tetracyclines, molecular and clinical aspects.,” J. Antimicrob. Chemother., vol. 29, no. 3, pp. 245–77, Mar. 1992, doi: 10.1093/jac/29.3.245.

Page 129 6. Expression Platform for decoration of a Fungal-derived Tetracycline in Aspergillus niger

[13] J. L. Riond and J. E. Riviere, “Pharmacology and toxicology of doxycycline.,” Vet. Hum. Toxicol., vol. 30, no. 5, pp. 431–43, Oct. 1988. [14] P. Koomanachai, J. L. Crandon, M. A. Banevicius, L. Peng, and D. P. Nicolau, “Pharmacodynamic profile of tigecycline against methicillin-resistant Staphylococcus aureus in an experimental pneumonia model,” Antimicrob. Agents Chemother., vol. 53, no. 12, pp. 5060–5063, 2009, doi: 10.1128/AAC.00985-09. [15] T. Schuetze and V. Meyer, “Polycistronic gene expression in Aspergillus niger,” vol. 16, p. 162, 2017, doi: 10.1186/s12934-017-0780-z. [16] Y.-M. Chiang, K. M. Meyer, M. Praseuth, S. E. Baker, K. S. Bruno, and C. C. C. Wang, “Characterization of a polyketide synthase in Aspergillus niger whose product is a precursor for both dihydroxynaphthalene (DHN) melanin and naphtho-γ-pyrone.,” Fungal Genet. Biol., vol. 48, no. 4, pp. 430–7, Apr. 2011, doi: 10.1016/j.fgb.2010.12.001. [17] C. S. Nødvig, J. B. Hoof, M. E. Kogle, et al., “Efficient oligo nucleotide mediated CRISPR-Cas9 gene editing in Aspergilli,” Fungal Genet. Biol., vol. 115, pp. 78–89, Jun. 2018, doi: 10.1016/j.fgb.2018.01.004. [18] P. Wang, W. Zhang, J. Zhan, and Y. Tang, “Identification of oxyE as an ancillary oxygenase during tetracycline biosynthesis,” ChemBioChem, vol. 10, no. 9, pp. 1544–1550, Jun. 2009, doi: 10.1002/cbic.200900122. [19] T. Zhu, X. Cheng, Y. Liu, Z. Deng, and D. You, “Deciphering and engineering of the final step halogenase for improved chlortetracycline biosynthesis in industrial Streptomyces aureofaciens,” Metab. Eng., vol. 19, pp. 69–78, Sep. 2013, doi: 10.1016/j.ymben.2013.06.003. [20] S. Maier, T. Heitzler, K. Asmus, et al., “Functional characterization of different ORFs including luciferase-like monooxygenase genes from the mensacarcin gene cluster,” ChemBioChem, vol. 16, no. 8, pp. 1175–1182, May 2015, doi: 10.1002/cbic.201500048. [21] R. P. De Vries, R. Riley, A. Wiebenga, et al., “Comparative genomics reveals high biological diversity and specific adaptations in the industrially and medically important fungal genus Aspergillus,” Genome Biol., vol. 18, 2017, doi: 10.1186/s13059-017-1151-0. [22] C. S. Nødvig, J. B. Nielsen, M. E. Kogle, and U. H. Mortensen, “A CRISPR-Cas9 system for genetic engineering of filamentous fungi,” PLoS One, vol. 10, no. 7, p. e0133085, 2015, doi: 10.1371/journal.pone.0133085. [23] R. a. Samson, J. Houbraken, U. Thrane, J. C. Frisvad, and B. Andersen, “Food and Indoor Fungi,” CBS Lab. Man. Ser., pp. 375–377, 2010. [24] S. Kildgaard, M. Mansson, I. Dosen, et al., “Accurate dereplication of bioactive secondary metabolites from marine-derived fungi by UHPLC-DAD-QTOFMS and a MS/HRMS library,” Mar. Drugs, vol. 12, no. 6, pp. 3681–3705, 2014, doi: 10.3390/md12063681. [25] J. Smedsgaard, “Micro-scale extraction procedure for standardization screening of fungal metabolite production in cultures,” J. Chromatogr. A, vol. 760, no. 2, pp. 264–270, Jan. 1997, doi: 10.1016/S0021-9673(96)00803-5.

Page 130 7. Overall discussion, conclusion, and perspectives

7 Overall discussion, conclusion, and perspectives

With the intention to dig into the larger genetic machinery behind fungal secondary metabo- lites, this Ph.D. project undertook the assignment to thoroughly investigate both the origin of potential harmful mycotoxins and the possibility to discover or invent new pharmaceutical drug candidates from the genus Aspergillus. In order to reach the goal, new synthetic biology tools needed to be developed, and a new combination of already applied tools were required to gain better insights. The goal was achieved in the three experimental cases, presented in chapter 4-6. Chapter 4 describes the investigation of the potential mycotoxin acurin A from Aspergillus aculeatus, with both a thorough elucidation of the genetics involved in the biosynthesis, as well as a comprehensive phylogenetic analysis showing the ancestral heritage of the biosynthetic gene cluster (BGC). Chapter 5 outlines an investigation of the nst-locus from Aspergillus sydowii, responsible for producing both neosartoricin B and tetracycline. The study contributes to improving the understanding of the biosynthesis of these vital compounds, as well as provides a guide for complicated pathway elucidations in the use of molecular networking of MS/MS data in combination with several mutant strains. Chapter 6 covers the development of an expression platform in Aspergillus niger for biocombinatorial decoration of fungal-derived tetracyclines with the intention of broadening the chemical space from filamentous fungi.

Acurin A, a novel hybrid compound, biosynthesized by individually translated PKS- and NRPS-encoding genes in Aspergillus aculeatus (Chapter 4)

The work presented in this study shows the identification of the BGC and elucidation of the biosynthetic pathway responsible for the production of acurin A. The compound highly resembles mycotoxins identified in several Fusarium spp. (e.g., fusarin C and lucilactaene) [1], [2] and is produced by the wild-type strain under standard laboratory conditions. The primary synthase gene (PKS, acrA) was identified through a bioinformatics approach and subsequently confirmed to be part of the pathway by gene knock-out. However, acurin A is a PK-NRP hybrid compound. Hence, an NRPS encoding gene would also have to be involved in the biosynthetic pathway, and potentially be part of the BGC. This gene was located approximately 31 kbp upstream to the PKS encoding gene. Gene knock-out likewise confirmed involvement in the biosynthesis of acurin A. Usually, fungal-derived compounds that resemble acurin A are biosynthesized by enzymes encoded from a single fused gene. To further investigate the significance of this observation, a comprehensive phylogenetic analysis was conducted using a local database of 475 publicly available fungal genomes. The results showed that only a limited number of Aspergillus species within the section Nigri hold a similar BGC and suggests that the ancestral state of the acurin A PKS/NRPS arrangement was a hybrid gene. The data indicate that the early PKS-NRPS has undergone fission, which resulted in a separation to form the acrA and acrB genes present in a few subclades in Aspergillus section Nigri. Further, acrB could have been recruited to the BGC

Page 131 7. Overall discussion, conclusion, and perspectives at a later stage and, therefore, may not have been the original hybrid NRPS but rather a substitution. It can be speculated that the late recruitment of the NRPS functions as an adjustable mechanism to modify the amino acid moiety in the hybrid compound. Gene expression analysis between wild-type and a mutant strain overexpressing acrR was further conducted to delineate the BGC, which further lead to six additional gene knockouts with participation in the biosynthesis of acurin A. From these findings, it was only possible to propose a hypothetical biosynthetic pathway for acurin A since many of the knockout mutant strains did not expose an intermediate compound. This could be a consequence of a large protein complex in the biosynthesis of acurin A, where all enzymes must be connected to function. The only successful gene knockout, with a visible intermediate, was an O-methyltransferase (AcrG) responsible for the final step in the pathway. A similar homolog is also found in the biosynthesis of fusarin C [1]. The fusarin C pathway is likewise incompletely elucidated with several missing intermediates. For future analysis, the hybrid compound, acurin A, needs to be analyzed for bioactivity to determine if it is a genuine mycotoxin. In case of confirmation of toxicity, the study could lead to further assessment of industrial applied strains depending on the downstream processing. It could be recommended to eliminate the BGC in some cases. The phylogenetic analysis could contribute to bioinformatics machine learning for gene cluster recognition for structurally similar compounds. As the BGC organization is unique to these types of compounds, the study brings new information to understanding the evolution of fungal secondary metabolism. In a similar manner, overexpressing acrR leads to an extensive change in the metabolome compared to the wild-type strain, which would be interesting to research in a later study. The massive overexpression could have led to an exchange of the amino acid moiety of acurin A. However; this needs to be examined first.

Genetic Manipulation and Molecular Networking for Biosynthetic Pathway Characterization of Tetracycline-like Compounds in Aspergillus sydowii (Chap- ter 5)

The study provides an insight into some of the significant differences between the biosyn- thesis of tetracycline and the tricyclic compound neosartoricin B. Both types of compounds are biosynthesized by non-reducing PKSs and have the same core enzyme encoding genes present in their respective BGCs (i.e., metallo-β-lactamase and a FAD-dependent hydro- lase/monooxygenase). This constellation makes it challenging to distinguish the two types of BGCs from each other. A BGC from the fungus Aspergillus sydowii was identified in a genomics-driven approach and predicted to produce either tetracycline or neosartoricin, which made Aspergillus sydowii an ideal candidate for examining the small but crucial deviations in the biosynthesis of these compounds. Surprisingly, when overexpressing a BGC-embedded transcription factor, sev- eral compounds were produced, including both neosartoricins and tetracycline compounds. To further investigate the pathway encoded by the locus, later named nst, gene knockouts,

Page 132 7. Overall discussion, conclusion, and perspectives and gene expression analysis were performed. These data only gave a limited overview of the complex biosynthetic pathway responsible for the production of the numerous com- pounds. For a closer examination of the pathway, an MS/MS molecular networking tool, GNPS [3], was applied using MS/MS based data from several mutant strains. The method allowed for pairwise comparison of the BGC unique compounds and made it possible to link intermediates otherwise extremely time-consuming or even impossible to annotate. By combining the data from all the pairwise alignments, it was possible to propose a detailed outline of the complex branched pathway. Moreover, from the molecular networking data, a potential tetracycline degradation pathway could be identified. This tetracycline degradation mechanism has not been reported from filamentous fungi until now. It could be speculated that the pathways of neosartoricin and the bioactive tetracyclines are so closely related that production can be reciprocal and, therefore, unavoidable to produce both compounds. Since the Aspergillus sydowii nst-locus was proved to be primarily a neosartoricin B BGC, the tetracycline degradation could function as self-protection against high concentration of tetracycline. The gene (nstE), encoding a putative hydrolase, located just downstream from the synthase encoding gene (nstA), could be a candidate for the degradation mechanism. The gene expression analysis indicated that the gene was only active in mutant strains with the production of tetracycline. Further, the deletion of nstE was not possible in the OE nstR strain but was archived in the wild-type strain, supporting the claim that the gene only is essential when the nst-locus is active. Future experiments can confirm the activity encoded by nstE, either by cultivating the nstE knockout mutant strain on media containing tetracycline or by heterologous expressing nstE in a tetracycline-producing fungal strain (e.g., Aspergillus niger OE adaR). If nstE encodes the intended role of degrading tetracycline, it may be easier to distinguish future neosartoricin-predicted BGCs from tetracycline-producing, if a homolog gene is present in a given gene cluster. The exploitation of the molecular networking tool in combination with mutant strains, as utilized in this study, could serve as a guide for the elucidation of complex silent pathways, not only in filamentous fungi. The GNPS tool showed particular useful for the identification of intermediates, even in low concentrations, when working in the overexpression strain (OE nstR). Moreover, the networking tool also made it possible to anticipate the enzymatic order of each branch in the pathway.

Expression platform for biocombinatorial decoration of a fungal-derived tetra- cycline in Aspergillus niger (Chapter 6)

The purpose of the study was to develop a platform for biocombinatorial expression of new tetracycline derivatives based on the fungal-derived tetracycline TAN-1612 produced by Aspergillus niger. By constructing a platform strain that is steadily producing a demethylated version of TAN-1612, the aim was to heterologously express relevant tailoring-enzyme encoding genes in an AMA1-based expression vector screenings strategy. Two approaches were attempted to express the demethylated form of the tetracycline com-

Page 133 7. Overall discussion, conclusion, and perspectives pound TAN-1612 in Aspergillus niger. Firstly, the core enzyme-encoding genes adaA, adaB, and adaC (i.e., NR-PKS, metallo-β-lactamase, and FAD-dependent hydrolase, respectively) were homologously expressed on a single integrated construct separated by the picornavirus self-cleaving sequence P2A regulated by the constitutive promoter, tef. The resulting strain (OE adaA-C) expressed an unknown structural misfolded version of the expected tetracycline compound. A similar compound was observed in the previous study [4] in the elimination of the FAD-dependent hydrolase homolog encoding gene, which led to the speculation that the last gene in the integrated P2A-construct was not translated. In the second attempt, the transcription factor encoding gene adaR was overexpressed under the regulation of the constitutive promoter, gpdA, and integrated into the genome in a euchromatin validated site. Simultaneously, the genes adaR and adaD from the ada-locus were targeted for deletion, which overall resulted in a successful tetracycline-producing platform strain. The compound produced in each platform was validated by reintroducing the O-methyltransferase encoding gene, adaD, to reconstruct the entire ada-pathway and the production of TAN-1612. To validate the AMA1-based expression vector screenings strategy, the previously identified A. sydowii prenyltransferase encoding gene (nstD) was cloned into an AMA1-vector and transformed into the platform strain (i.e., OE adaR/adaRD∆). The resulting strain (i.e., OE adaR/adaRD∆ + nstD) produced a similar prenylated tetracycline compound, as identified in the previous study. This concludes that the platform works as envisioned and that the amount of tetracycline produced is well-matched for heterologous expression of relevant tailoring-enzyme encoding genes. In future perspectives for the platform, genes identified through literature and bioinformatics can be expressed in a medium-throughput manner, and in that, build a gene-library contain- ing both genes with confirmed decorative-functions and genes with hypothetical encoded functions. Genes encoding a decorative function can be integrated into the genome, and the gene-library can be rescreened. In addition to the platform in Aspergillus niger, an enzymatic in-vitro assay approach could be developed with a purified demethylated tetracycline as a substrate. This could lead to a faster screening procedure for enzymes able to decorate the tetracycline scaffold. Further, introducing directed evolution [5], [6] to genes encoding a desirable function, however unable to function in the platform strain, could be applied to broaden the chemical diversity and even generate higher yields. For newly established pathways, it could be considered to transfer the genes into a more suitable host with less cross-chemistry (e.g., Saccharomyces cerevisiae) for a more continuous production concern- ing compounds with verified bioactivity.

Based on the findings presented in this Ph.D. thesis, the genus Aspergillus seems even more exciting than ever before, both regarding the potential for the production of harmful substances, the ability as a platform for the development of beneficial compounds, and new surprising genetics insights. This Ph.D. thesis contributes to a broader understanding of the genus Aspergillus, and in regard to future perspectives for the project, unachieved results

Page 134 7. Overall discussion, conclusion, and perspectives such as proving the function of the putative hydrolase (NstE) can now be reach through use of the expressing platform. By amplifying the encoding gene and clone it into an AMA1-vector, it can now easily be transformed into the platform for function verification. Further, a larger bioinformatics study can reveal more potential gene candidates to be expressed, even from other fungal genera, e.g., Penicillium. In perspectives for filamentous fungi in general, a bright future seems ahead for applied synthetic biology. Sequencing has already proved Aspergillus as a treasure chest for possible discoveries of secondary metabolites [7], and more tools are becoming available to explore these opportunities [8], [9]. As synthetic biology continues to develop, new steps will be taken to make filamentous fungi even more accessible in exploring uninvestigated species (e.g., synthetic expression systems [10]). Looking to yeast as inspiration, one could imagine a wider use of the popular CRISPR/Cas9 system for regulation of genes [11] or the development of an entire synthetic fungal strain, as seen in the Synthetic Yeast 2.0 [12].

References

[1] E. M. Niehaus, K. Kleigrewe, P. Wiemann, L. Studt, C. M. Sieber, L. R. Connolly, M. Freitag, U. Güldener, B. Tudzynski, and H. U. Humpf, “Genetic manipulation of the fusarium fujikuroi fusarin gene cluster yields insight into the complex regulation and fusarin biosynthetic pathway”, Chemistry and Biology, vol. 20, no. 8, pp. 1055–1066, 2013. DOI: 10.1016/j.chembiol.2013.07.004. [2] H. Kakeya, S. I. Kageyama, L. Nie, R. Onose, G. Okada, T. Beppu, C. J. Norbury, and H. Osada, “Lucilactaene, a new cell cycle inhibitor in p53-transfected cancer cells, produced by a Fusarium sp. [2]”, Journal of Antibiotics, vol. 54, no. 10, pp. 850–854, Oct. 2001. DOI: 10.7164/antibiotics.54.850. [3] M. Wang, J. J. Carver, and et al., “Sharing and community curation of mass spec- trometry data with Global Natural Products Social Molecular Networking”, Nature Biotechnology, vol. 34, no. 8, pp. 828–837, 2016, ISSN: 15461696. DOI: 10.1038/ nbt.3597. [Online]. Available: http://proteomics.. [4] P. B. Wolff, K. Subko, S. Theobald, J. B. Hoof, J. C. Frisvad, C. H. Gotfredsen, M. R. Andersen, U. H. Mortensen, and T. O. Larsen, “Genetic Manipulation and Molec- ular Networking for Biosynthetic Pathway Characterization of Tetracycline-like Compounds in Aspergillus sydowii”, 2020. DOI: Inpreparationforsubmission. [5] F. H. Arnold and A. A. Volkov, “Directed evolution of biocatalysts”, Current Opinion in Chemical Biology, no. 3, pp. 54–59, 1999, ISSN: 10836160. [6] A. Currin, N. Swainston, P. J. Day, and D. B. Kell, Synthetic biology for the directed evolution of protein biocatalysts: Navigating sequence space intelligently, Mar. 2015. DOI: 10.1039/c4cs00351a.

Page 135 7. Overall discussion, conclusion, and perspectives

[7] T. C. Vesth, J. L. Nybo, S. Theobald, and et al., “Investigation of inter- and in- traspecies variation through genome sequencing of Aspergillus section Nigri”, Na- ture Genetics, vol. 50, no. 12, pp. 1688–1695, 2018, ISSN: 15461718. DOI: 10.1038/ s41588-018-0246-1. [8] D. J. Mattern, V. Valiante, S. E. Unkles, and A. A. Brakhage, “Synthetic biology of fungal natural products”, Frontiers in Microbiology, vol. 6, no. JUL, 2015, ISSN: 1664302X. DOI: 10.3389/fmicb.2015.00775. [9] P. B. Wolff, J. B. Hoof, T. Strucko, and U. H. Mortensen, “Fungal Synthetic Bi- ology Tools to Facilitate Utilization of Secondary Metabolites: Discovery, Het- erologous Production, and Biosynthesis of Biocombinatorial Compounds.”, DOI: Inpreperation. [10] A. Rantasalo, C. P. Landowski, J. Kuivanen, A. Korppoo, L. Reuter, O. Koivistoinen, M. Valkonen, M. Penttilä, J. Jäntti, and D. Mojzita, “A universal gene expression sys- tem for fungi”, Nucleic Acids Research, vol. 46, no. 18, e111, 2018, ISSN: 13624962. DOI: 10.1093/nar/gky558. [11] K. Garcia Vanegas, B. Lehka, and U. Mortensen, “Switch: A dynamic crispr tool for genome engineering and metabolic pathway control for cell factory construction in saccharomyces cerevisiae”, English, Microbial Cell Factories, vol. 16, no. 25, 2017, ISSN: 1475-2859. DOI: 10.1186/s12934-017-0632-x. [12] S. M. Richardson, L. A. Mitchell, G. Stracquadanio, K. Yang, J. S. Dymond, J. E. DiCarlo, D. Lee, C. L. V. Huang, S. Chandrasegaran, Y. Cai, J. D. Boeke, and J. S. Bader, “Design of a synthetic yeast genome”, Science, vol. 355, no. 6329, pp. 1040– 1044, 2017. DOI: 10.1126/science.aaf4557.

Page 136 Appendix I (Chapter 4)

Supporting Information

Acurin A, a novel hybrid compound, biosynthesized by individually translated PKS- and NRPS-encoding genes in Aspergillus aculeatus

Peter B. Wolff a,1, Maria L. Nielsena,1, Jason C. Slotb, Lasse N. Andersena, Lene M. Petersena, Thomas Isbrandta, Dorte K. Holma, Uffe H. Mortensena, Christina S. Nødviga, Thomas O. Larsen*a, Jakob B. Hoof*a a Department of Biotechnology and Biomedicine (DTU Bioengineering), Technical University of Denmark, Søltofts Plads, Building 221/223, 2800 Kgs. Lyngby (Denmark). *E-mail: [email protected]/[email protected]. b Department of Plant Pathology, The Ohio State University, 481C Kottman Hall, 2021 Coffey Road, Columbus, OH 43210 (USA). 1 These authors have contributed equally to this work.

The Supporting information contains 5 tables and 16 figures.

Page 137

Appendix I (Chapter 4)

Tables: Table S1. NMR data for acurin A Table S2. List of fungal strains Table S3. Expected band lengths for deletion strains verified by tissue PCR Table S4. 475 publicly available fungal genomes Table S5. List of primers

Figures: Figure S1. Gene targeting by homologous recombination. Figure S2. Analysis of diagnostic Tissue-PCR by gel electrophoresis for verification of the akuA deletion. Figure S3. Tissue-PCR verification and gel electrophoresis for acrAΔ and acrBΔ mutant strain validation. Figure S4. Tissue-PCR confirmation for the presence of nuclei having intact acrA or acrB in the respective gene-deletion strains. Figure S5. Tissue-PCR verification for integration and homokaryon check for the acrRΔ strain. Figure S6. Tissue PCR verification for correct integration and homokaryon as well as the conformation of the pyrG insert in gene-deletion strains acrGΔ, acrDΔ, acrEΔ, 1903457Δ, and 122294Δ. Figure S7. Diagnostic Tissue-PCR and gel electrophoresis analysis for confirmation of homokaryotic acrGΔ, acrDΔ, acrEΔ, 1903457Δ, and 122294Δ strains with pyrG insertions. Figure S8. A Biosynthetic Gene Cluster (BGC) comparison and PKS alignment. Figure S9. Clustering and gene-family evolution analysis. Figure S10. Base peak chromatogram of the acrRΔ strain including an extracted ion chromatogram of m/z [M+H]+ = 374 (acurin). Figure S11. The phenotype of the acrR-OE strain compared to the reference strain cultivated on Yeast extract sucrose media. Figure S12. Base peak chromatograms for the reference strain and acrR-OE cultivated on minimal media. Figure S13. Real-time quantitative PCR (RT-qPCR) data. Figure S14. Base peak chromatogram of the acrGΔ strain. Figure S15. MS/MS spectra. Figure S16. Proposed fragmentation pathways for acurin and ”demethylacurin”.

Page 138

Appendix I (Chapter 4)

Table S1. List of fungal strains.

# Strain identifier Genotype Notes Genome sequenced wild-type ACU7 IBT3244 - strain pyrG deficient (pyrG1), Uridine ACU9 pyrG- pyrG1 requiring, [8] ACU10 akuA∆, prepop pyrG1, akuA∆::AFLpyrG akuA = Protein ID 127270 AFpyrG op-out of ACU10, pyrG ACU11 akuA∆, pop pyrG1, akuA∆ deficient (pyrG1) pyrG1, deletion of gene JGI ID: 48 ACU18 acrA∆ pyrG1, akuA∆, acrA∆::AflpyrG (acrA) pyrG1, deletion of gene JGI ID: ACU24 acrB pyrG1, akuAΔ, acrB∆::AFpyrG 122295 (acrB) pyrG1, deletion of gene JGI ID: ACU35 acrG∆ pyrG1, akuA∆, acrG∆::AflpyrG 122283 (acrG) pyrG1, deletion of gene JGI ID: ACU36 acrD∆ pyrG1, akuA∆, acrD∆::AFpyrG 45003 (acrD) pyrG1, deletion of gene JGI ID: ACU37 acrE∆ pyrG1, akuA∆, acrE∆::AFpyrG 122285 (acrE) pyrG1, deletion of gene JGI ID: ACU38 1903457∆ pyrG1, akuA∆, 1903457∆::AFpyrG 1903457 (acrG) pyrG1, deletion of gene JGI ID: ACU39 122294∆ pyrG1, akuA∆, 122294∆::AFpyrG 122294 pyrG1, ovexpression of

ACU41 OEx.acrR pyrG1, PgpdA-acrR-TtrpC::AFpyrG transcription factor JGI ID: 122290 (acrR) pyrG1, deletion of gene JGI ID: ACU46 acrC∆ pyrG1, akuA∆, acrC∆::AFpyrG 61993 (acrC) pyrG1, deletion of gene JGI ID: ACU47 1881869∆ pyrG1, akuA∆, 1881869∆::AFpyrG 1881869 pyrG1, deletion of gene JGI ID: ACU48 acrF∆ pyrG1, akuA∆, acrF∆::AFpyrG 62004 (acrF) pyrG1, deletion of gene JGI ID: ACU49 122297∆ pyrG1, akuA∆, 122297∆::AFpyrG 122297 pyrG1, deletion of gene JGI ID: ACU50 acrR∆ pyrG1, akuA∆, acrR∆::AFpyrG 122290 (acrR) pyrG1, deletion of gene JGI ID: pyrG1, akuA∆, acrC∆, PgpdA-acrR- ACU52 acrC∆ + acrR-OE TtrpC::AFpyrG 61993 (acrC), acrR-OE pyrG1, deletion of gene JGI ID: pyrG1, akuA∆, acrD∆, PgpdA-acrR- ACU53 acrD∆ + acrR-OE TtrpC::AFpyrG 45003 (acrD), acrR-OE pyrG1, deletion of gene JGI ID: pyrG1, akuA∆, acrE∆, PgpdA-acrR- ACU54 acrE∆ + acrR-OE TtrpC::AFpyrG 122285 (acrE), acrR-OE pyrG1, deletion of gene JGI ID: pyrG1, akuA∆, acrF∆, PgpdA-acrR- ACU56 acrF∆ + acrR-OE TtrpC::AFpyrG 62004 (acrF), acrR-OE pyrG1, deletion of gene JGI ID: pyrG1, akuA∆, acrG∆, PgpdA-acrR- CU57 acrG∆ + acrR-OE TtrpC::AFpyrG 1903457 (acrG), acrR-OE

Page 139

Appendix I (Chapter 4)

Table S2. List of primers.

Name Sequence Purpose in key words Up- and downstream targeting fragments for deletion vectors assembled by USER cloning AACU-ku70-up-FU GGGTTTAAUGCTTGGATGAAGATGGGGCTACC AACU_akuA deletion USER fragment Up AACU_ku70-up-RU GGACTTAAUATGACTGAGGTGTTCAAAAGAAGCT AACU_akuA deletion USER fragment Up AACU_ku70-dw-FU GGCATTAAUGACATAGGGATCTATTGCGTCGT AACU_akuA deletion USER fragment Dw AACU_ku70-dw-RU GGTCTTAAUAATGCGAGCCAACCCGATAG AACU_akuA deletion USER fragment Dw AACU_48-up-FU GGGTTTAAUCTTGCCTCTTCAGTTACTTCGC AACU_48 deletion USER fragment Up AACU_48-up-RU GGACTTAAUGGCGTGGTTTGTGTATGGAGC AACU_48 deletion USER fragment Up AACU_48-dw-FU GGCATTAAUGAATCGTCATGGTGTGTGCG AACU_48 deletion USER fragment Dw AACU_48-dw-RU GGTCTTAAUGGATTTGTCAGGAATGAGGAGG AACU_48 deletion USER fragment Dw AACU_122295-up- GGGTTTAAUGATCATGGGGTGTTTGGGG AACU_122295 deletion USER FU fragment Up AACU_122295-up- GGACTTAAUGACGGGATCTCTAGAAAGAAGGC AACU_122295 deletion USER RU fragment Up AACU_122295-dw- GGCATTAAUTTGATTGTACTGTTTATGTTATGATTGT AACU_122295 deletion USER FU TATA fragment Dw AACU_122295-dw- GGTCTTAAUCAGGGAAGGTGCTGTTCGTG AACU_122295 deletion USER RU fragment Dw AACU_122283-up- GGGTTTAAUCCTTCATAACCAGTCATGCCAC AACU_122283 deletion USER FU fragment Up AACU_122283-up- GGACTTAAUGATCGCCTGGATTTACTTGATG AACU_122283 deletion USER RU fragment Up AACU_122283-dw- GGCATTAAUGGTTCCTTGTTGTTCTTGGGTT AACU_122283 deletion USER FU fragment Dw AACU_122283-dw- GGTCTTAAUGTCGTGCCGTGGATGCTG AACU_122283 deletion USER RU fragment Dw AACU_45003-up-FU GGGTTTAAUCGACTTCACCACCTTCCACAA AACU_45003 deletion USER fragment Up AACU_45003-up-RU GGACTTAAUGGTGGCTGTCTTTCTTGGAGTG AACU_45003 deletion USER fragment Up AACU_45003-dw-FU GGCATTAAUCTGTAGTTCCGATGCTGTACATAGTTC AACU_45003 deletion USER fragment Dw AACU_45003-dw-RU GGTCTTAAUGTGGTGAATATCGCCGACG AACU_45003 deletion USER fragment Dw AACU_122285-up- GGGTTTAAUCCCTAACCAGTACCCTGCAAAC AACU_122285 deletion USER FU fragment Up AACU_122285-up- GGACTTAAUGATGCTTAGGATTGTGGGAGAGA AACU_122285 deletion USER RU fragment Up AACU_122285-dw- GGCATTAAUGTGTTTTTGTTACTGGAGTTGACTAAT AACU_122285 deletion USER FU G fragment Dw AACU_122285-dw- GGTCTTAAUGGTTTTGACCTATCAGCCGTG AACU_122285 deletion USER RU fragment Dw AACU_1903457-up- GGGTTTAAUGCGACCTTCGTGGCTGC AACU_1903457 deletion USER FU fragment Up AACU_1903457-up- GGACTTAAUGGTGTTTGTTTGTACGGAGGG AACU_1903457 deletion USER RU fragment Up AACU_1903457-dw- GGCATTAAUTACCAGGAAGTTGAAAGAAACGG AACU_1903457 deletion USER 2FU fragment Dw AACU_1903457-dw- GGTCTTAAUGGCAAGTTTGGGCTTCTCG AACU_1903457 deletion USER 2RU fragment Dw AACU_122294-up- GGGTTTAAUCTGCTGTGTCGGCATCGG AACU_122294 deletion USER FU fragment Up AACU_122294-up- GGACTTAAUTTGTTCGTGTGATTTTGCGATT AACU_122294 deletion USER RU fragment Up AACU_122294-dw- GGCATTAAUGGTAGGGGGTTGTGGAAGATAG AACU_122294 deletion USER FU fragment Dw AACU_122294-dw- GGTCTTAAUCAACAGCACCCGCTTCCTC AACU_122294 deletion USER RU fragment Dw AACU_62004-up-FU GGGTTTAAUATCGTGAACAAACTCGGCTG AACU_62004 deletion USER fragment Up

Page 140

Appendix I (Chapter 4)

AACU_62004-up-RU GGACTTAAUGGGAGGGGGGTTATGTTGT AACU_62004 deletion USER fragment Up AACU_62004-dw-FU GGCATTAAUGGGAAGAGTGCCGAAGAGGA AACU_62004 deletion USER fragment Dw AACU_62004-dw-RU GGTCTTAAUATGCACTGGATGACTGACTG AACU_62004 deletion USER fragment Dw AACU_1881869-up- GGGTTTAAUGCAAACCCACCAGTCAATCA AACU_1881869 deletion USER FU fragment Up AACU_1881869-up- GGACTTAAUGGTTGAGTGTTGCCAGGAAG AACU_1881869 deletion USER RU fragment Up AACU_1881869-dw- GGCATTAAUTTTGCATTTGGGAGCGGGAA AACU_1881869 deletion USER FU fragment Dw AACU_1881869-dw- GGTCTTAAUACCCCTTGTAGCATCATTCT AACU_1881869 deletion USER RU fragment Dw AACU_61993-up-FU GGGTTTAAUTCTTTATCGCTGAACGCCGC AACU_61993 deletion USER fragment Up AACU_61993-up-RU GGACTTAAUGAAGTTGAAAAGAAGGGGGG AACU_61993 deletion USER fragment Up AACU_61993-dw-FU GGCATTAAUGCTGTGTGAAGAGAATGATGC AACU_61993 deletion USER fragment Dw AACU_61993-dw-RU GGTCTTAAUTGTCGGTGGTGGAGAGGAAC AACU_61993 deletion USER fragment Dw AACU_122297-up- GGGTTTAAUAGAACTACAACACCGAAGCA AACU_122297 deletion USER FU fragment Up AACU_122297-up- GGACTTAAUGCAAACTCCCAATCCCTAAG AACU_122297 deletion USER RU fragment Up AACU_122297-dw- GGCATTAAUTTTCGGTTTTAGGGGGTTT AACU_122297 deletion USER FU fragment Dw AACU_122297-dw- GGTCTTAAUGACATCAACCCGGTAACCCA AACU_122297 deletion USER RU fragment Dw AACU_122290-up- GGGTTTAAUCGTCTGTATGCGTGTGCGA AACU_122290 deletion USER FU fragment Up AACU_122290-up- GGACTTAAUCGGAATTAGTGGAGCGATGT AACU_122290 deletion USER RU fragment Up AACU_122290-dw- GGCATTAAUATAGGAAGGAATCGCAGCAG AACU_122290 deletion USER FU fragment Dw AACU_122290-dw- GGTCTTAAUGGCTGGGACACACTATTCAT AACU_122290 deletion USER RU fragment Dw

Diagnostic PCRs for verifying integration of marker chkup-F + AFpyrG-R and ensuring no WT locus chkgap-F + chkgap-R* AFLpyrG-R GCGGAAACGGTGACATTGG AFLpyrG internal primer ACUkusA-Chk-Gap-F CGATGCACCAATCATCACCAC Deletion gap check primer (AACU_akuA) ACUkusA-Chk-Gap-R CACCTCCCACCTATATCCACC Deletion gap check primer (AACU_akuA) AACU_48-upchk-F TGAACGAGCAGCGAAGGTCT Deletion gap check primer (AACU_48) AACU_48-chkgap-F CCTCCGTCCTTCTGGTGGA Deletion gap check primer (AACU_48) AACU_48-chkgap-R CAATCAGACACACACTCGCACA Deletion gap check primer (AACU_48) AACU_122295- CGGGTCAGTGACTTGAAATCG Deletion up check primer upchk-F (AACU_122295) AACU_122295- GTACAATCCAATACCTCCTGTCTGATA Deletion gap check primer chkgap-F (AACU_122295) AACU_122295- CAGATTAGATAAACAGTGTGATATAACAATC Deletion gap check primer chkgap-R (AACU_122295) AACU_122283- CTGTCAGGTCAAATCGGTGC Deletion up check primer chkup-F (AACU_122283) AACU_122283- CATCTGTATCGGTAGCAACCC Deletion gap check primer chkgap-F (AACU_122283) AACU_122283- GTCCTACAACAAACACGTCCC Deletion gap check primer chkgap-R (AACU_122283) AACU_45003-chkup- CACCCAAGTATGCAGCGAC Deletion up check primer F (AACU_45003) AACU_45003- GGTATTAGCATTGGGCTGAACC Deletion gap check primer chkgap-F (AACU_45003)

Page 141

Appendix I (Chapter 4)

AACU_45003- CGGCACGGTATGTTCTAGG Deletion gap check primer chkgap-R (AACU_45003) AACU_122285- CACAGAACTGTACGCACCAG Deletion up check primer chkup-F (AACU_122285) AACU_122285- CGATATTCACCACCCGGAC Deletion gap check primer chkgap-F (AACU_122285) AACU_122285- AGGCACAACAGGCACAAC Deletion gap check primer chkgap-R (AACU_122285) AACU_1903457- CTCCTTCCCGCTCCCAAAT Deletion up check primer chkup-F (AACU_1903457) AACU_1903457- TCGCCGACACCCAAGTAT Deletion gap check primer chkgap-F (AACU_1903457) AACU_1903457- GTCCTACACGTACACGAAGAC Deletion gap check primer chkgap-R (AACU_1903457) AACU_122294- CTGATTGTGGAGGCGATTGG Deletion up check primer chkup-F (AACU_122294) AACU_122294- GTCTCCTTCCCTCCAATCCC Deletion gap check primer chkgap-F (AACU_122294) AACU_122294- CGACCCTTCCTTCTAGCAACC Deletion gap check primer chkgap-R (AACU_122294) AACU_62004-chkup- GTTTGCGTGAGTGCGACAG Deletion up check primer F (AACU_62004) AACU_62004- GCGAACATGGGGACTAAAGA Deletion gap check primer chkgap-F (AACU_62004) AACU_62004- AGTCTGCCTTTGTTACTGCC Deletion gap check primer chkgap-R (AACU_62004) AACU_1881869- GTCCAGACAATCGCGCTCAA Deletion up check primer chkup-F (AACU_1881869) AACU_1881869- GAGTTTCGGTGAGTTCGGC Deletion gap check primer chkgap-F (AACU_1881869) AACU_1881869- GACCCTAATCACAGGACACT Deletion gap check primer chkgap-R (AACU_1881869) AACU_61993-chkup- ATATGTGTGCAAGTGGTCG Deletion up check primer F (AACU_61993) AACU_61993- AGGAAGATGAGCCAGAAGCG Deletion gap check primer chkgap-F (AACU_61993) AACU_61993- CCTTGCCTGCCTCTTAACCC Deletion gap check primer chkgap-R (AACU_61993) AACU_122297- TACTTCACATCGCAGACCCT Deletion up check primer chkup-F (AACU_122297) AACU_122297- ATCGATAACCCGCCGAAGCA Deletion gap check primer chkgap-F (AACU_122297) AACU_122297- ACAAATGTCACAGGGCGAG Deletion gap check primer chkgap-R (AACU_122297) AACU_122290- CGTCGTATCACCATAGTTCC Deletion up check primer chkup-F (AACU_122290) AACU_122290- ACGGCAGCATTATCCGAAGA Deletion gap check primer chkgap-F (AACU_122290) AACU_122290- AAAAGCACCGAATGTACCCG Deletion gap check primer chkgap-R (AACU_122290) For qPCR analysis to delineate the acurin BGC AACU_hhtA-RT-F GTAAGTCCACTGGTGGCAAGG Histone H3 housekeeping gene/reference (3’) AACU_hhtA-RT-R GCGACGGATTTCACGGAGAG Histone H3 housekeeping gene/reference (3’) AACU_actA-RT-F GAAGTGTGATGTTGATGTCCGTAAG Actin housekeeping gene/reference (3’) AACU_actA-RT-R GGAAGGTGGAGAGGGAGG Actin housekeeping gene/reference (3’) AACU_1857757-RT-F CCCTCAATCATCGTTCTCGAC 1857757 qPCR primer (3’) AACU_1857757-RT-R CCGCATTCAGTTTCATCTCC 1857757 qPCR primer (3’) AACU_122297-RT-F AAACCCCTCCCATCGATCTC 122297 qPCR primer (3’) AACU_122297-RT-R CGGTTTGGTCGCTGTAGCTC 122297 qPCR primer (3’) AACU_62004-RT-F GGCGCTTTGTCAGGATGGAA 62004 qPCR primer (3’) AACU_62004-RT-R ACCAGCCCTCCATCATCAAC 62004 qPCR primer (3’) AACU_122295-RT-F CAGTCAGTCATCCAGTGCAT 122295 qPCR primer (3’) AACU_122295-RT-R GAGTCGAGGAAGAAAGCTGT 122295 qPCR primer (3’)

Page 142

Appendix I (Chapter 4)

AACU_1867753-RT-F GTTGAAGTGGGTGTGGTTCG 1867753 qPCR primer (3’) AACU_1857753-RT-R TGGGAGGGTGATTCGATGGC 1867753 qPCR primer (3’) AACU_122294-RT-F GCATGGGGAGGATCTGGAT 122294 qPCR primer (3’) AACU_122294-RT-R GACTTCACCCGCTTCTACCG 122294 qPCR primer (3’) AACU_79887-RT-F CTAGCTAACACTCCCGCA 79887 qPCR primer (3’) AACU_79887-RT-R TCTACCTGCCCCCGATCAT 79887 qPCR primer (3’) AACU_122290-RT-F TGGCTCGATCGTCTTGGTC 122290 qPCR primer (3’) AACU_122290-RT-R TCATCACACTTCCCCGAGC 122290 qPCR primer (3’) AACU_122285-RT-F CTTCACAACCTCGAACCCAG 122285 qPCR primer (3’) AACU_122285-RT-R TACCCCAACCTGTTCCACC 122285 qPCR primer (3’) AACU_122283-RT-F TGGAGAAGTCGTTGGTGGG 122283 qPCR primer (3’) AACU_122283-RT-R CAGCAGCAGCATCCAAAGC 122283 qPCR primer (3’) AACU_45003-RT-F TGTGGACGATGCGTTTGAT 45003 qPCR primer (3’) AACU_45003-RT-R CCCCAAGCTATTTCAGTACC 45003 qPCR primer (3’) AACU_190437-RT-F GTCCAGACAATCGCGCTCAA 190437 qPCR primer (3’) AACU_190437-RT-R AGGAGAAGAAGGGGAGCGA 190437 qPCR primer (3’) AACU_1881869-RT-F CAAATTCGCACTACCGGCTA 1881869 qPCR primer (3’) AACU_1881869-RT-R GTTTCTGCTGTGCTTTTTGG 1881869 qPCR primer (3’) AACU_61993-RT-F ACCGCCATCATGTTCCGAAA 61993 qPCR primer (3’) AACU_61993-RT-R ACACATACATGCCCAACGC 61994 qPCR primer (3’) AACU_PksCacurin- CGGACGGCGATTATGTCTA 48 qPCR primer (3’) RT-F AACU_PKsCacurin- AATGCCGTCTGTGAGTCT 48 qPCR primer (3’) RT-R AACU_61991-RT-F GGGTCACACTGCTCGATAGT 61993 qPCR primer (3’) AACU_61991-RT-R TAAACCCCATGCCCATCTCC 61993 qPCR primer (3’) AACU_1881866-RT-F TGAGGCGCGGTCGATATTG 1881866 qPCR primer (3’) AACU_1881866-RT-R TGCCTGGAAACACGACGAG 1881866 qPCR primer (3’) AACU_1881865-RT-F CCTGATCATACTCCCCCTCC 1881865 qPCR primer (3’) AACU_1881865-RT-R CGCCCGAAACGGTTAATCA 1881865 qPCR primer (3’) AACU_1871946-RT-F AGCTATAGTCTCCGCCCTG 1871946 qPCR primer (3’) AACU_1871946-RT-R ATGTTCTCCTCGCCACGTC 1871946 qPCR primer (3’) AACU_122277-RT-F TTGATCGGGAGTGGCAACG 122277 qPCR primer (3’) AACU_122277-RT-R ACCCGAGGACGATTTGCTA 122277 qPCR primer (3’) AACU_31167-RT-F CAGGCTGGGGATCAGGTATTC 31167 qPCR primer (3’) AACU_31167-RT-R ATCGGACTCTCTGCACTTT 31167 qPCR primer (3’) For overexpression of TF-encoding gene (acrR) AACU_122290-OE- AGAGCGAUATGTCACCGAATATGAGTTTGACG Ectopic overexpression of FU AACU_122290 AACU_122290-OE- TCTGCGAUCTAGAACCCCTCCTCACTCC Ectopic overexpression of AACU_ RU 122290 AACU_IS1 UP-FU GGGTTTAAUTCTTTGGATGAACAGTCGCC Upstream targeting region for IS1 AACU_IS1 UP-RU AGGGAAUTTTGGTTGCCTGAGGTGC Upstream targeting region for IS1 AACU_IS1 Dw-FU GGCATTAAUAGACAAGCCTGTCGCTGAA Downstream targeting region for IS1 AACU_IS1 Dw-RU GGTCTTAAUTATCGCTTGTTGGGTAGGCA Downstream targeting region for IS1 AN_PgpdA-FU GGGTTTAAUATTCCCTTGTATCTCTACAC Promoter and USER cassette for IS1 AN_PgpdA-PacI-RU AAACCCUCAGCGCGGTAGTGATGTCTGCT Promoter and USER cassette for IS1 AN_TtrpC-PacI-FU AGGGTTUAATTAAGACCTCAGCGGATCCACTTAAC Terminator and USER cassette for IS1 GTTACTG AN_TtrpC-RU GGTCTTAAUCGCTTACACAGTACACGAG Terminator and USER cassette for IS1 For CRISPR/Cas9 mediated gene targeting in the akuA locus PgpdA-pac-up-FU GGGTTTAAUGCGTAAGCTCCCTAATTGGC Upper sgRNA fragment gRNA-PS6-RU AGCTTACUCGTTTCGTCCTCACGGACTCATCAGTGC Upper sgRNA fragment TTT CGGTGATGTCTGCTCAAGCG gRNA-PS6-FU AGTAAGCUCGTCTGCTTTGCTTTGGGAAAAAT Lower sgRNA fragment GTTTTAGAGCTAGAAATAGCAAGTTAAA TtrpC-short-pac-dw- GGTCTTAAUGAGCCAAGAGCGGATTCCTC Lower sgRNA fragment RU *Except in the analysis for the acrA and acrB deletion mutants, here the respective qPCR primer pairs were used applying ACU10 as a positive control.

Page 143

Appendix I (Chapter 4)

Table S3. Expected band lengths for deletion strains verified by tissue PCR. Corresponding gel-electrophoresis of tissue-PCR reactions can be found in Figures S2 – S7.

Expected WT Expected Strain ID JGI gene ID Gene Primer position banda transformant band name ACU10 - akuA pyrG insert 0 bp 3179 bp Integration 2868 bp 3644 bp ACU18 48 acrA pyrG insert 0 bp 3333 bp Internal check 268 bp 0 bp ACU46 61993 acrC pyrG insert 0 bp 3201 bp Integration 2737 bp 3156 bp ACU47 1881869 - pyrG insert 0 bp 3086 bp Integration 2112 bp 3126 bp ACU38 1903457 - pyrG insert 0 bp 3875 bp Integration 2041 bp 2433 bp ACU36 45003 acrD pyrG insert 0 bp 3949 bp Integration 1785 bp 2425 bp ACU35 122283 acrG pyrG insert 0 bp 3993 bp Integration 1465 bp 2460 bp ACU37 122285 acrE pyrG insert 0 bp 3856 bp Integration 2062 bp 2469 bp ACU50 122290 acrR pyrG insert nd nd Integration 2212 bp 3255 bp ACU39 122294 - pyrG insert 0 bp 3809 bp Integration 1419 bp 2344 bp ACU24 122295 acrB pyrG insert 0 bp 3493 bp Internal check 309 bp 0 bp ACU48 62004 acrF pyrG insert 0 bp 3146 bp Integration 1812 bp 3258 bp ACU49 122297 - pyrG insert nd nd Integration 1826 bp 3245 bp and = not done

Table S4. 475 publicly available fungal genomes.

Genome code Genome Taxonomy Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; 4NY16 Pseudogymnoascus sp. 04NY16 Pseudeurotiaceae; Pseudogymnoascus Fungi; Dikarya; Basidiomycota; Ustilaginomycotina; Exobasidiomycetes; Acain1 Acaromyces ingoldii MCA 4198 Exobasidiales; Cryptobasidiaceae; Acaromyces Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Dothideomycetes Aciri1iso Acidomyces richmondensis incertae sedis; Acidomyces Agaricus bisporus var. burnettii Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agabivarbur1 JB137-S8 Agaricomycetidae; Agaricales; Agaricaceae; Agaricus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Pleosporomycetidae; Pleosporales; Pleosporineae; Pleosporaceae; Alternaria; Alternaria Altal1 Alternaria alternata SRC1lrK2f alternata group Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Pleosporomycetidae; Altbr1 Alternaria brassicicola Pleosporales; Pleosporineae; Pleosporaceae; Alternaria Fungi; Blastocladiomycota; Blastocladiomycetes; Blastocladiales; Amac Allomyces macrogynus Blastocladiaceae; Allomyces Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Amamu1 Amanita muscaria Koide Agaricomycetidae; Agaricales; Amanitaceae; Amanita Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Amath1 Amanita thiersii Skay4041 Agaricomycetidae; Agaricales; Amanitaceae; Amanita Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Leotiomycetes; Leotiomycetes incertae Amore1 Amorphotheca resinae sedis; Myxotrichaceae; Amorphotheca

Page 144

Appendix I (Chapter 4)

Antlo1 Antonospora locustae HM-2013 Fungi; Microsporidia; Microsporidia incertae sedis; Antonospora Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Armme11 Armillaria mellea Agaricomycetidae; Agaricales; Physalacriaceae; Armillaria Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Armos1 Armillaria ostoye Agaricomycetidae; Agaricales; Physalacriaceae; Armillaria Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Agaricales; Physalacriaceae; Armillaria; Armillaria Armost2 Armillaria ostoyae 28-4 ostoyae Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Arthroderma benhamiae CBS leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Onygenales; Artbe1 112371 Arthrodermataceae; Arthroderma Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Arthrobotrys oligospora ATCC Orbiliomycetes; Orbiliales; Orbiliaceae; Orbilia; mitosporic Orbilia Artol1 24927 auricolor Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Ascim1 Ascobolus immersus RN42 Pezizomycetes; Pezizales; Ascobolaceae; Ascobolus Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Ascru1 Ascoidea rubescens NRRL Y17699 Saccharomycetes; Saccharomycetales; Ascoideaceae; Ascoidea Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Ascocoryne_sarcoides_NRRL5007 leotiomyceta; sordariomyceta; Leotiomycetes; Helotiales; Helotiaceae; Ascsa1 2 Ascocoryne Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Ashgo1 Ashbya gossypii ATCC 10895 Eremothecium Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspac1 Aspergillus aculeatus ATCC16872 Trichocomaceae; mitosporic Trichocomaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspbr1 Aspergillus brasiliensis Trichocomaceae; mitosporic Trichocomaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspca3 Aspergillus carbonarius Trichocomaceae; mitosporic Trichocomaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspcam1 Aspergillus campestris IBT 28561 Trichocomaceae; mitosporic Trichocomaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Aspergillus clavatus NRRL 1 from leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspcl1 AspGD Trichocomaceae; mitosporic Trichocomaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspfl1 Aspergillus flavus NRRL3357 Trichocomaceae; mitosporic Trichocomaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspfo1 Aspergillus acidus Trichocomaceae; mitosporic Trichocomaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Aspergillus fumigatus Af293 from leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspfu1 AspGD Trichocomaceae; mitosporic Trichocomaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; AspfuA11631 Aspergillus fumigatus A1163 Aspergillaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspgl1 Aspergillus glaucus Trichocomaceae; mitosporic Trichocomaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspka11 Aspergillus kawachii IFO 4308 Trichocomaceae; mitosporic Trichocomaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspni7 Aspergillus niger ATCC 1015 Trichocomaceae; mitosporic Trichocomaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspnid1 Aspergillus nidulans from AspGD Trichocomaceae; mitosporic Trichocomaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; AspniDSM1 Aspergillus niger CBS 513.88 Trichocomaceae; mitosporic Trichocomaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; AspniNRRL31 Aspergillus niger NRRL3 Trichocomaceae; mitosporic Trichocomaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Aspergillus novofumigatus IBT leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspnov1 16806 Trichocomaceae; mitosporic Trichocomaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Aspergillus ochraceoroseus IBT leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspoch1 24754 Trichocomaceae; mitosporic Trichocomaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspor1 Aspergillus oryzae RIB40 Trichocomaceae; mitosporic Trichocomaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspste1 Aspergillus steynii IBT 23096 Trichocomaceae; mitosporic Trichocomaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspsy1 Aspergillus sydowii Trichocomaceae; mitosporic Trichocomaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspte1 Aspergillus_terreus_NIH_2624 Aspergillaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Asptu1 Aspergillus tubingensis Trichocomaceae; mitosporic Trichocomaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspve1 Aspergillus versicolor Trichocomaceae; mitosporic Trichocomaceae; Aspergillus

Page 145

Appendix I (Chapter 4)

Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspwe1 Aspergillus_wentii Aspergillaceae; Aspergillus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Aspzo1 Aspergillus zonatus Trichocomaceae; mitosporic Trichocomaceae; Aspergillus Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetes incertae sedis; Auriculariales; Auriculariaceae; Aurde31 Auricularia subglabra Auricularia Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Aureobasidium pullulans var. leotiomyceta; dothideomyceta; Dothideomycetes; Dothideomycetidae; Aurpuvarmel1 melanogenum CBS 110374 Dothideales; Aureobasidiaceae; Aureobasidium Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Aureobasidium pullulans var. leotiomyceta; dothideomyceta; Dothideomycetes; Dothideomycetidae; Aurpuvarnam1 namibiae CBS 147.97 Dothideales; Aureobasidiaceae; Aureobasidium Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Aureobasidium pullulans var. leotiomyceta; dothideomyceta; Dothideomycetes; Dothideomycetidae; Aurpuvarpul1 pullulans EXF-150 Dothideales; Aureobasidiaceae; Aureobasidium Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Dothideomycetidae; Aureobasidium pullulans var. Dothideales; Dothioraceae; mitosporic Dothioraceae; Aureobasidium; Aurpuvarsub1 subglaciale EXF-2481 Aureobasidium pullulans Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; B308 Pseudogymnoascus sp. BL308 Pseudeurotiaceae; Pseudogymnoascus Babjeviella inositovora NRRL Y- Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Babin1 12698 Saccharomycetes; Saccharomycetales; Debaryomycetaceae; Babjeviella Basidiobolus meristosporus CBS Fungi; Entomophthoromycota; Basidiobolomycetes; Basidiobolales; Basme2 931.73 Basidiobolaceae; Basidiobolus; Basidiobolus meristosporus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Dothideomycetidae; Baudoinia compniacensis UAMH Capnodiales; Teratosphaeriaceae; mitosporic Teratosphaeriaceae; Bauco1 10762 Baudoinia Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Onygenales; Bder Blastomyces dermatitidis Ajellomycetaceae; Ajellomyces Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Beaba1 Beauveria bassiana ARSEF 2860 Hypocreales; Cordycipitaceae; Beauveria Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Beaps1 Beauveria pseudobassiana Hypocreales; Cordycipitaceae; Beauveria Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Bjead1 Bjerkandera adusta Agaricomycetes incertae sedis; Polyporales; Meruliaceae; Bjerkandera Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; BL549 Pseudogymnoascus sp. BL549 Pseudeurotiaceae; Pseudogymnoascus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Blumeria graminis f.sp. Hordei leotiomyceta; sordariomyceta; Leotiomycetes; Erysiphales; Blugr1 DH14 Erysiphaceae; Blumeria Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetes incertae sedis; Cantharellales; Botryobasidiaceae; Botbo1 Botryobasidium botryosum Botryobasidium Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Leotiomycetes; Helotiales; Botci1 Botrytis_cinerea Sclerotiniaceae; Botrytis Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Leotiomycetes; Helotiales; BotciB05 Botrytis_cinerea Sclerotiniaceae; Botrytis Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Leotiomycetes; Helotiales; BotciBcDW1 Botrytis_cinerea Sclerotiniaceae; Botrytis Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Leotiomycetes; Helotiales; BotciP1 Botrytis_cinerea Sclerotiniaceae; Botrytis Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Leotiomycetes; Helotiales; BotciT4 Botrytis_cinerea Sclerotiniaceae; Botrytis Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Dothideomycetes Botdo1 Botryosphaeria dothidea incertae sedis; Botryosphaeriales; Botryosphaeriaceae; Botryosphaeria Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Leotiomycetes; Helotiales; mitosporic Cadsp1 Cadophora sp. DSE1049 Helotiales; Cadophora Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; mitosporic Saccharomycetales; Calb Candida albicans Candida Fungi; Dikarya; Basidiomycota; Agaricomycotina; Dacrymycetes; Calco1 Calocera cornea Dacrymycetales; Dacrymycetaceae; Calocera Fungi; Dikarya; Basidiomycota; Agaricomycotina; Dacrymycetes; Calvi1 Calocera viscosa Dacrymycetales; Dacrymycetaceae; Calocera Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Candida arabinofermentans NRRL Saccharomycetes; Saccharomycetales; mitosporic Saccharomycetales; Canar1 YB-2248 Candida Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; mitosporic Saccharomycetales; Canca1 Candida caseinolytica Y-17796 Candida Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Candida tanzawaensis NRRL Y- Saccharomycetes; Saccharomycetales; mitosporic Saccharomycetales; Canta1 17324 Candida Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; mitosporic Saccharomycetales; Cante1 Candida tenuis NRRL Y-1498 Candida Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Chaetothyriomycetidae; Chaetothyriales; Capco1 Capronia coronata cbs 617.96 Herpotrichiellaceae; Capronia

Page 146

Appendix I (Chapter 4)

Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Chaetothyriomycetidae; Chaetothyriales; Capep1 Capronia epimyces cbs 606.96 Herpotrichiellaceae; Capronia Fungi; Blastocladiomycota; Blastocladiomycetes; Blastocladiales; Catan1 Catenaria anguillulae PL171 Catenariaceae; Catenaria Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Pleosporomycetidae; Pleosporomycetidae incertae sedis; Gloniaceae; Cenococcum; Cenge3 Cenococcum geophilum 1.58 Cenococcum geophilum Fungi; Dikarya; Basidiomycota; Ustilaginomycotina; Exobasidiomycetes; Cersp1 Ceraceosorus sp. MCA 4658 Ceraceosorales; Ceraceosoraceae; Ceraceosorus Ceriporiopsis Gelatoporia Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Cersu1 subvermispora B Agaricomycetes incertae sedis; Polyporales; Meruliaceae; Ceriporiopsis Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Cgla Candida glabrata Nakaseomyces; mitosporic Nakaseomyces Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Cgla138 Candida glabrata Nakaseomyces; mitosporic Nakaseomyces Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Debaryomycetaceae; Cgui Candida guilliermondii Meyerozyma Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Pezizomycetes; Pezizales; Tuberaceae; Choiromyces; Choiromyces Chove1 Choiromyces venosus 120613-1 venosus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Cladophialophora carrionii cbs leotiomyceta; Eurotiomycetes; Chaetothyriomycetidae; Chaetothyriales; Claca1 160.54 Herpotrichiellaceae; mitosporic Herpotrichiellaceae; Cladophialophora Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Dothideomycetidae; Capnodiales; Mycosphaerellaceae; mitosporic Mycosphaerellaceae; Clafu1 Cladosporium fulvum Passalora Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Lecanoromycetes; OSLEUM clade; Lecanoromycetidae; Clagr3 Cladonia grayi Cgr DA2myc ss Lecanorales; Lecanorineae; Cladoniaceae; Cladonia Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Cladophialophora psammophila cbs leotiomyceta; Eurotiomycetes; Chaetothyriomycetidae; Chaetothyriales; Claps1 110553 Herpotrichiellaceae; mitosporic Herpotrichiellaceae; Cladophialophora Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Clapu20 Claviceps purpurea 20.1 Hypocreales; Clavicipitaceae; Claviceps; Claviceps purpurea Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Cladophialophora yegresii cbs leotiomyceta; Eurotiomycetes; Chaetothyriomycetidae; Chaetothyriales; Claye1 114405 Herpotrichiellaceae; mitosporic Herpotrichiellaceae; Cladophialophora Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Clus Candida lusitaniae Saccharomycetes; Saccharomycetales; Metschnikowiaceae; Clavispora Fungi; Dikarya; Basidiomycota; Agaricomycotina; Tremellomycetes; Tremellales; Tremellaceae; Filobasidiella; Filobasidiella/Cryptococcus Cneb Cryptococcus neoformans neoformans species complex Fungi; Dikarya; Basidiomycota; Agaricomycotina; Tremellomycetes; Tremellales; Tremellaceae; Filobasidiella; Filobasidiella/Cryptococcus Cneg Cryptococcus gattii neoformans species complex Fungi; Dikarya; Basidiomycota; Agaricomycotina; Tremellomycetes; Tremellales; Tremellaceae; Filobasidiella; Filobasidiella/Cryptococcus Cnew Cryptococcus gattii neoformans species complex Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Pleosporomycetidae; Cocca1 Cochliobolus carbonum 26-R-13 Pleosporales; Pleosporineae; Pleosporaceae; Cochliobolus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Pleosporomycetidae; CocheC4 Cochliobolus heterostrophus C4 Pleosporales; Pleosporineae; Pleosporaceae; Cochliobolus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Pleosporomycetidae; CocheC5 Cochliobolus heterostrophus C5 Pleosporales; Pleosporineae; Pleosporaceae; Cochliobolus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Onygenales; mitosporic Cocim1 Coccidioides immitis RS Onygenales; Coccidioides Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Pleosporomycetidae; Coclu2 Cochliobolus lunatus m118 Pleosporales; Pleosporineae; Pleosporaceae; Cochliobolus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Cochliobolus miyabeanus ATCC leotiomyceta; dothideomyceta; Dothideomycetes; Pleosporomycetidae; Cocmi1 44560 Pleosporales; Pleosporineae; Pleosporaceae; Cochliobolus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Pleosporomycetidae; Cocsa1 Cochliobolus sativus ND90Pr Pleosporales; Pleosporineae; Pleosporaceae; Cochliobolus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Pleosporomycetidae; Cocvi1 Cochliobolus victoriae FI3 Pleosporales; Pleosporineae; Pleosporaceae; Cochliobolus Fungi; Fungi incertae sedis; Early diverging fungal lineages; Coere1 Coemansia reversa NRRL 1564 Kickxellomycotina; Kickxellales; Kickxellaceae; Coemansia Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Colgr1 Colletotrichum graminicola M1.001 Glomerellales; Glomerellaceae; Colletotrichum Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Colletotrichum higginsianum IMI leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Colhi1 349063 Glomerellales; Glomerellaceae; Colletotrichum Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Chaetothyriomycetidae; Chaetothyriales; Conap1 Coniosporium apollinis cbs 100218 Herpotrichiellaceae; mitosporic Herpotrichiellaceae; Coniosporium Fungi; Fungi incertae sedis; Early diverging fungal lineages; Conidiobolus coronatus Entomophthoromycotina; Entomophthorales; Ancylistaceae; Conco1 NRRL28638 Conidiobolus

Page 147

Appendix I (Chapter 4)

Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; Conlig1 Coniochaeta ligniaria NRRL 30616 Coniochaetales; Coniochaetaceae; Coniochaeta Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Boletales; Coniophorineae; Coniophoraceae; Conpu1 Coniophora puteana Coniophora Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Copci1 Coprinopsis cinerea Agaricomycetidae; Agaricales; Psathyrellaceae; Coprinopsis Coprinopsis cinerea AmutBmut Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; CopciAmutBmut1 pab1-1 Agaricomycetidae; Agaricales; Psathyrellaceae; Coprinopsis Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Copmic2 Coprinellus micaceus FP101781 Agaricomycetidae; Agaricales; Psathyrellaceae; Coprinellus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Corbr1 Cordyceps brongniartii Hypocreales; Cordycipitaceae; Cordyceps Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Pleosporomycetidae; Corca1 Corynespora cassiicola CCP Pleosporales; Corynesporascaceae; Corynespora Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Cormi1 Cordyceps militaris CM01 Hypocreales; Cordycipitaceae; Cordyceps Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; CormiAloha Cordyceps militaris Aloha Hypocreales; Cordycipitaceae; Cordyceps Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; CormiSym Cordyceps militaris MycoSymbiont Hypocreales; Cordycipitaceae; Cordyceps Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; mitosporic Saccharomycetales; Cpar Candida parapsilosis Candida Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Onygenales; mitosporic Cpos Coccidioides posadasii Onygenales; Coccidioides crap exudate unknown yeast strain Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; CRAB102001A 10.200.1a Saccharomycetes;unknown crap exudate unknown yeast strain Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; CRAB102021 10.202.1 Saccharomycetes;unknown crap exudate unknown yeast strain Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; CRAB102091 10.209.1 Saccharomycetes;unknown Cronartium quercuum f. sp. Fungi; Dikarya; Basidiomycota; Pucciniomycotina; Pucciniomycetes; Croqu1 fusiforme G11 Pucciniales; Cronartiaceae; Cronartium Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Crula1 Crucibulum laeve CBS 166.37 Agaricomycetidae; Agaricales; Nidulariaceae; Crucibulum Fungi; Dikarya; Basidiomycota; Agaricomycotina; Tremellomycetes; Cryptococcus_neoformans_var._gr Tremellales; Tremellaceae; Filobasidiella; Filobasidiella/Cryptococcus CryneH991 ubii_H99 neoformans species complex Fungi; Dikarya; Basidiomycota; Agaricomycotina; Tremellomycetes; Cryptococcus neoformans var Tremellales; Tremellaceae; Filobasidiella; Filobasidiella/Cryptococcus CryneJEC211 neoformans JEC21 neoformans species complex Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; mitosporic Saccharomycetales; Cs918151 Candida sonorensis Candida Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; mitosporic Saccharomycetales; Cs941571 Candida sonorensis Candida Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; mitosporic Saccharomycetales; Cs961314 Candida sonorensis Candida Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; mitosporic Saccharomycetales; Csonorensis Candida sonorensis Candida Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; mitosporic Saccharomycetales; Ctro Candida tropicalis Candida Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Phaffomycetaceae; Cybja1 Cyberlindnera jadinii NRRL Y-1542 Cyberlindnera Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetes incertae sedis; Corticiales; Corticiaceae; Cylto1 Cylindrobasidium torrendii Cylindrobasidium Fungi; Dikarya; Basidiomycota; Agaricomycotina; Dacrymycetes; Dacsp1 Dacryopinax sp. DJM 731 SSP1 Dacrymycetales; Dacrymycetaceae Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Daequ1 Daedalea_quercina Agaricomycetes incertae sedis; Polyporales; Coriolaceae; Daedalea Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Xylariomycetidae; DalEC121 Daldinia eschscholzii EC12 Xylariales; Xylariaceae; Daldinia Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Debaryomycetaceae; Debha01 Debaryomyces hansenii COTA2 Debaryomyces Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Debaryomycetaceae; Debha1 Debaryomyces hansenii Debaryomyces Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Dekbr2 Dekkera bruxellensis CBS 2499 Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Dekkera Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Denbi1 Dendrothele bispora CBS 962.96 Agaricomycetes incertae sedis; Corticiales; Corticiaceae; Dendrothele Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Dicsq1 Dichomitus squalens Agaricomycetes incertae sedis; Polyporales; Polyporaceae; Dichomitus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Dothideomycetes DippiCMW190 Diplodia pinea CMW190 incertae sedis; Botryosphaeriales; Botryosphaeriaceae; Diplodia

Page 148

Appendix I (Chapter 4)

Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Dothideomycetes Dipsc1 Diplodia scrobiculata incertae sedis; Botryosphaeriales; Botryosphaeriaceae; Diplodia Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Dothideomycetes Dipse1 Diplodia seriata incertae sedis; Botryosphaeriales; Botryosphaeriaceae; Diplodia Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Dothideomycetidae; Dotse1 Dothistroma septosporum NZE10 Capnodiales; Mycosphaerellaceae; Mycosphaerella Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Drechmeria coniospora ARSEF leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Dreco1 6962 Hypocreales; Ophiocordycipitaceae Fungi; Microsporidia; Apansporoblastina; Unikaryonidae; Ecun Encephalitozoon cuniculi Encephalitozoon Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Ecym Eremothecium cymbalariae Eremothecium Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Chaetothyriomycetidae; Chaetothyriales; Eder Exophiala dermatitidis UT8656 Herpotrichiellaceae; mitosporic Herpotrichiellaceae; Exophiala Fungi; Microsporidia; Apansporoblastina; Unikaryonidae; Enccu1 Encephalitozoon cuniculi GB-M1 Encephalitozoon Encephalitozoon hellem ATCC Fungi; Microsporidia; Apansporoblastina; Unikaryonidae; Enche1 50504 Encephalitozoon Encephalitozoon intestinalis ATCC Fungi; Microsporidia; Apansporoblastina; Unikaryonidae; Encin1 50506 Encephalitozoon Fungi; Microsporidia; Apansporoblastina; Unikaryonidae; Encro1 Encephalitozoon romaleae SJ-2008 Encephalitozoon Fungi; Microsporidia; Apansporoblastina; Enterocytozoonidae; Entbi1 Enterocytozoon bieneusi H348 Enterocytozoon Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Eurhe1 Eurotium rubrum Aspergillaceae Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Xylariomycetidae; Eutla1 Eutypa lata UCREL1 Xylariales; Diatrypaceae; Eutypa Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Exigl1 Exidia glandulosa Agaricomycetes incertae sedis; Auriculariales; Exidiaceae Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Chaetothyriomycetidae; Chaetothyriales; Exoaq1 Exophiala aquamarina cbs 119918 Herpotrichiellaceae; mitosporic Herpotrichiellaceae; Exophiala Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Chaetothyriomycetidae; Chaetothyriales; Exome1 Exophiala mesophila CBS 120910 Herpotrichiellaceae; mitosporic Herpotrichiellaceae; Exophiala Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Chaetothyriomycetidae; Chaetothyriales; Exool01 Exophiala oligosperma Herpotrichiellaceae; mitosporic Herpotrichiellaceae; Exophiala Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Chaetothyriomycetidae; Chaetothyriales; ExoolCBS72588 Exophiala oligosperma CBS 72.588 Herpotrichiellaceae; mitosporic Herpotrichiellaceae; Exophiala Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Chaetothyriomycetidae; Chaetothyriales; Exoxe01 Exophiala xenobiotica Herpotrichiellaceae; mitosporic Herpotrichiellaceae; Exophiala Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Fibra1 Fibroporia radiculosa TFFH 294 Agaricomycetes incertae sedis; Polyporales; Polyporaceae; Fibroporia Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Atheliales; Atheliaceae; mitosporic Atheliaceae; Fibsp1 Fibulorhizoctonia sp. CBS 109695 Fibulorhizoctonia Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Fishe1 Fistulina hepatica Agaricomycetidae; Agaricales; Fistulinaceae; Fistulina Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetes incertae sedis; Hymenochaetales; Hymenochaetaceae; Fomme1 Fomitiporia mediterranea Fomitiporia Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Fompi3 Fomitopsis pinicola FP-58527 SS1 Agaricomycetes incertae sedis; Polyporales; Coriolaceae; Fomitopsis Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Fusfu1 Fusarium fujikuroi IMI 58289 Hypocreales; Nectriaceae; Fusarium; Fusarium fujikuroi species complex Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Hypocreales; Nectriaceae; Fusarium; Fusarium sambucinum species Fusgr1 Fusarium graminearum complex Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Fusarium oxysporum f. sp. Hypocreales; Nectriaceae; Fusarium; Fusarium oxysporum species Fusox1 lycopersici strain 4287 complex Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Hypocreales; Nectriaceae; Fusarium; Fusarium oxysporum species Fusoxcl57 Fusarium oxysporum cl57 complex Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Hypocreales; Nectriaceae; Fusarium; Fusarium oxysporum species Fusoxcotton Fusarium oxysporum cotton complex Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Hypocreales; Nectriaceae; Fusarium; Fusarium oxysporum species Fusoxfo47 Fusarium oxysporum fo47 complex Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Hypocreales; Nectriaceae; Fusarium; Fusarium oxysporum species Fusoxfo5176 Fusarium oxysporum fo5176 complex Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Fusoxfspmelonis Fusarium oxysporum f. sp. melonis leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae;

Page 149

Appendix I (Chapter 4)

Hypocreales; Nectriaceae; Fusarium; Fusarium oxysporum species complex Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Hypocreales; Nectriaceae; Fusarium; Fusarium oxysporum species Fusoxhdv247 Fusarium oxysporum hdv247 complex Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Hypocreales; Nectriaceae; Fusarium; Fusarium oxysporum species Fusoxii5 Fusarium oxysporum ii5 complex Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Hypocreales; Nectriaceae; Fusarium; Fusarium oxysporum species Fusoxmn25 Fusarium oxysporum mn25 complex Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Hypocreales; Nectriaceae; Fusarium; Fusarium oxysporum species Fusoxnrrl32931 Fusarium oxysporum nrrl32931 complex Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Hypocreales; Nectriaceae; Fusarium; Fusarium oxysporum species Fusoxphw808 Fusarium oxysporum phw808 complex Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Hypocreales; Nectriaceae; Fusarium; Fusarium oxysporum species Fusoxphw815 Fusarium oxysporum phw815 complex Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Fusve1 Fusarium verticillioides 7600 Hypocreales; Nectriaceae; Fusarium; Fusarium fujikuroi species complex Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Gaeumannomyces graminis var. leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; Gaegr1 tritici r3-111a-1 Magnaporthales; Magnaporthaceae; Gaeumannomyces Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Galma1 Galerina marginata Agaricomycetidae; Agaricales; Strophariaceae; Galerina Fungi; Chytridiomycota; Monoblepharidomycetes; Monoblepharidales; Ganpr1 Gonapodya prolifera Gonapodyaceae; Gonapodya Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetes incertae sedis; Polyporales; Ganodermataceae; Gansp1 Ganoderma sp. 10597 SS1 Ganoderma Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Leotiomycetes; Helotiales; Helotiaceae; Glalo1 Glarea lozoyensis ATCC 20868 Glarea Rhizophagus irregularis DAOM Fungi; Glomeromycota; Glomeromycetes; Glomerales; Glomeraceae; Gloin1 181602 Rhizophagus Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetes incertae sedis; Gloeophyllales; Gloeophyllaceae; Glotr1 Gloeophyllum trabeum Gloeophyllum Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; Grocl1 Grosmannia_clavigera_kw1407 Ophiostomatales; Ophiostomataceae; Grosmannia Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Gymlu1 Gymnopus luxurians Agaricomycetidae; Agaricales; Tricholomataceae; Gymnopus Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Gymlu2 Gymnopilus dilepis Agaricomycetidae; Agaricales; Cortinariaceae; Gymnopilus Hansenula polymorpha NCYC 495 Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Hanpo2 leu1.1 Saccharomycetes; Saccharomycetales; Pichiaceae; Ogataea Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Hanseniaspora valbyensis NRRL Saccharomycetes; Saccharomycetales; Saccharomycodaceae; Hanva1 Y-1626 Hanseniaspora Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Hebcy2 Hebeloma cylindrosporum h7 Agaricomycetidae; Agaricales; Cortinariaceae; Hebeloma Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Helsul1 Heliocybe sulcata OMC1185 Agaricomycetes incertae sedis; Polyporales; Polyporaceae; Heliocybe Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetes incertae sedis; Russulales; Bondarzewiaceae; Hetan2 Heterobasidion annosum Heterobasidion; Heterobasidion annosum species complex Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Onygenales; Hiscag186ar Histoplasma capsulatum g186ar Ajellomycetaceae; Histoplasma Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Onygenales; Hiscag217b Histoplasma capsulatum g217b Ajellomycetaceae; Histoplasma Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Onygenales; Hiscah143 Histoplasma capsulatum h143 Ajellomycetaceae; Histoplasma Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Onygenales; Hiscah88 Histoplasma capsulatum h88 Ajellomycetaceae; Histoplasma Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Onygenales; Hiscanam1 Histoplasma capsulatum nam1 Ajellomycetaceae; Histoplasma Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Onygenales; Hiscatmu Histoplasma capsulatum tmu Ajellomycetaceae; Histoplasma Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetales incertae Hpol Hansenula polymorpha sedis; Ogataea Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Boletales; Paxilineae; Paxillineae incertae sedis; Hydpi2 Hydnomerulius pinastri Hydnomerulius Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Metschnikowiaceae; Hypbu1 Hyphopichia burtonii NRRL Y-1933 Hyphopichia

Page 150

Appendix I (Chapter 4)

Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Xylariomycetidae; HypCI4A1 Hypoxylon sp. CI-4A Xylariales; Xylariaceae; Hypoxylon Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Xylariomycetidae; HypCO2751 Hypoxylon sp. CO27-5 Xylariales; Xylariaceae; Hypoxylon Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Xylariomycetidae; HypEC381 Hypoxylon sp. EC38 Xylariales; Xylariaceae; Hypoxylon Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Hypsu1 Hypholoma sublateritium Agaricomycetidae; Agaricales; Strophariaceae; Hypholoma Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Pleosporomycetidae; Hyspu1 Hysterium pulicare Hysteriales; Hysteriaceae; Hysterium Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Ilysp1 Ilyonectria sp. Hypocreales; Nectriaceae; Ilyonectria Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Isafu1 Isaria fumosorosea ARSEF 2679 Hypocreales; Cordycipitaceae; Isaria Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Jaaar1 Jaapia argillacea Agaricomycetidae; Jaapiales; Jaapiaceae; Jaapia Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Klula1 Kluyveromyces lactis Kluyveromyces Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Kthe Kluyveromyces thermotolerans Lachancea Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Kwal Kluyveromyces waltii Lachancea Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Lacam1 Laccaria amethystina LaAM-08-1 Agaricomycetidae; Agaricales; Tricholomataceae; Laccaria Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Agaricales; Tricholomataceae; Laccaria; Laccaria Lacam2 Laccaria amethystina LaAM-08-1 amethystina Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Lacbi2 Laccaria bicolor Agaricomycetidae; Agaricales; Tricholomataceae; Laccaria Laetiporus sulphureus var. Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Laesu1 Sulphureus Agaricomycetes incertae sedis; Polyporales; Coriolaceae; Laetiporus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Lecle1 Lecanicillium lecanii Hypocreales; Cordycipitaceae; Cordyceps Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Debaryomycetaceae; Lelo Lodderomyces elongisporus Lodderomyces Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Lenti71 Lentinus tigrinus ALCF2SS1-7 Agaricomycetes incertae sedis; Polyporales; Lentinaceae; Lentinus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Pleosporomycetidae; Pleosporales; Pleosporineae; Leptosphaeriaceae; Leptosphaeria; Lepmu1 Leptosphaeria maculans Leptosphaeria maculans complex Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Dothideomycetes Leppa1 Lepidopterella_palustris incertae sedis; Argynnaceae; Lepidopterella Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Leugo1 Leucoagaricus gongylophorus Ac12 Agaricomycetidae; Agaricales; Agaricaceae; Leucoagaricus Fungi; Fungi incertae sedis; Kickxellomycotina; Kickxellales; Linpe1 Linderina pennispora ATCC 12442 Kickxellaceae; Linderina; Linderina; Linderina pennispora Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Lipst1 Lipomyces starkeyi NRRL Y-11557 Saccharomycetes; Saccharomycetales; Lipomycetaceae; Lipomyces Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetes incertae sedis; Russulales; Peniophoraceae; Lopni1 Peniophora sp. CONTA Peniophora Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; M1372 Pseudogymnoascus sp. M1372 Pseudeurotiaceae; Pseudogymnoascus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Dothideomycetes Macph1 Macrophomina phaseolina MS6 incertae sedis; Botryosphaeriales; Botryosphaeriaceae; Macrophomina Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; Maggr1 Magnaporthe oryzae 70-15(MG6) Magnaporthales; Magnaporthaceae; Magnaporthe Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; MaggrBR29 Magnaporthe grisea BR29 Magnaporthales; Magnaporthaceae; Magnaporthe Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; MaginM35 Magnaporthiopsis incrustans M35 Magnaporthales; Magnaporthaceae; Magnaporthiopsis Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; MagorBR32 Magnaporthe oryzae BR32 Magnaporthales; Magnaporthaceae; Magnaporthe Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; MagorCD156 Magnaporthe oryzae CD156 Magnaporthales; Magnaporthaceae; Magnaporthe Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; MagorFR13 Magnaporthe oryzae FR13 Magnaporthales; Magnaporthaceae; Magnaporthe Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; MagorGY11 Magnaporthe oryzae GY11 Magnaporthales; Magnaporthaceae; Magnaporthe Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; MagorPH14 Magnaporthe oryzae PH14 Magnaporthales; Magnaporthaceae; Magnaporthe

Page 151

Appendix I (Chapter 4)

Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; MagorTH12 Magnaporthe oryzae TH12 Magnaporthales; Magnaporthaceae; Magnaporthe Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; MagorTH16 Magnaporthe oryzae TH16 Magnaporthales; Magnaporthaceae; Magnaporthe Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; MagorUS71 Magnaporthe oryzae US71 Magnaporthales; Magnaporthaceae; Magnaporthe Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; Magnaporthiopsis poae ATCC Magnaporthales; Magnaporthaceae; Magnaporthiopsis; Magpo1 64411 Magnaporthiopsis poae Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; MagrhM23 Magnaporthiopsis rhizophila M23 Magnaporthales; Magnaporthaceae; Magnaporthiopsis Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; MagsaM69 Magnaporthe salvinii M69 Magnaporthales; Magnaporthaceae; Nakataea Fungi; Dikarya; Basidiomycota; Ustilaginomycotina; Malasseziomycetes; Malgl1 Malassezia globosa Malasseziales; Malasseziaceae; Malassezia Malassezia sympodialis ATCC Fungi; Dikarya; Basidiomycota; Ustilaginomycotina; Malasseziomycetes; Malsy11 42132 Malasseziales; Malasseziaceae; Malassezia Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Marssonina brunnea f. sp. leotiomyceta; sordariomyceta; Leotiomycetes; Helotiales; Dermateaceae; Marbr1 multigermtubi MB m1 Marssonina Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Onygenales; Mcan Microsporum canis CBS113480 Arthrodermataceae; Arthroderma Fungi; Fungi incertae sedis; Early diverging fungal lineages; Mcir Mucor circinelloides Mucoromycotina; Mucorales; Mucorineae; Mucoraceae; Mucor Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Leotiomycetes; Helotiales; Helotiaceae; Melbi2 Meliniomyces bicolor E mitosporic Helotiaceae; Meliniomyces Fungi; Dikarya; Basidiomycota; Pucciniomycotina; Pucciniomycetes; Mellp1 Melampsora laricis-populina Pucciniales; Melampsoraceae; Melampsora Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Leotiomycetes; Helotiales; Helotiaceae; Melva1 Meliniomyces variabilis F mitosporic Helotiaceae; Meliniomyces Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Metac1 Metarhizium acridum CQMa 102 Hypocreales; Clavicipitaceae; mitosporic Clavicipitaceae; Metarhizium Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Metal1 Metarhizium album ARSEF1941 Hypocreales; Clavicipitaceae; mitosporic Clavicipitaceae; Metarhizium Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Metan1 Metarhizium robertsii ARSEF 23 Hypocreales; Clavicipitaceae; mitosporic Clavicipitaceae; Metarhizium Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Metan2 Metarhizium anisopliae ARSEF549 Hypocreales; Clavicipitaceae; mitosporic Clavicipitaceae; Metarhizium Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Metschnikowia bicuspidata NRRL Saccharomycetes; Saccharomycetales; Metschnikowiaceae; Metbi1 YB-4993 Metschnikowia Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Metarhizium brunneum leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Metbr1 ARSEF3297 Hypocreales; Clavicipitaceae; mitosporic Clavicipitaceae; Metarhizium Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Metarhizium guizhouense leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Metgu1 ARSEF977 Hypocreales; Clavicipitaceae; mitosporic Clavicipitaceae; Metarhizium Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Metma1 Metarhizium majus ARSEF297 Hypocreales; Clavicipitaceae; mitosporic Clavicipitaceae; Metarhizium Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Metri1 Metarhizium rileyi RCEF4871 Hypocreales; Clavicipitaceae; mitosporic Clavicipitaceae; Metarhizium Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Onygenales; Mgyp Microsporum gypseum Arthrodermataceae; Arthroderma; Arthroderma gypseum Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Onygenales; Micca1 Microsporum canis CBS 113480 Arthrodermataceae; Arthroderma Fungi; Dikarya; Basidiomycota; Pucciniomycotina; Mixiomycetes; Mixos1 Mixia osmundae IAM 14324 Mixiales; Mixiaceae; Mixia Fungi; Dikarya; Basidiomycota; Pucciniomycotina; Pucciniomycetes; Mlar Melampsora laricis-populina Pucciniales; Melampsoraceae; Melampsora Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Moeli1 Moelleriella libera RCEF2490 Hypocreales; Clavicipitaceae Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Monacrosporium haptotylum CBS Orbiliomycetes; Orbiliales; Orbiliaceae; mitosporic Orbiliaceae; Monha1 200.50 Dactylellina Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Agaricales; Marasmiaceae; mitosporic Monpe11 Moniliophthora perniciosa FA553 Marasmiaceae; Moniliophthora Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Agaricales; Marasmiaceae; mitosporic Monro1 Moniliophthora roreri MCA 2997 Marasmiaceae; Moniliophthora Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Morco1 Morchella conica CCBAS932 Pezizomycetes; Pezizales; Morchellaceae; Morchella Fungi; Fungi incertae sedis; Early diverging fungal lineages; Morel1 Mortierella elongata Mortierellomycotina; Mortierellales; Mortierellaceae; Mortierella

Page 152

Appendix I (Chapter 4)

Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Pezizomycetes; Pezizales; Morchellaceae; Morchella; Morchella elata Morimp1 Morchella importuna SCYDJ1-A1 clade Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; Mpoa Magnaporthe poae ATCC 64411 Magnaporthales; Magnaporthaceae; Magnaporthe Fungi; Fungi incertae sedis; Early diverging fungal lineages; Mucci2 Mucor circinelloides CBS277.49 Mucoromycotina; Mucorales; Mucorineae; Mucoraceae; Mucor Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Dothideomycetidae; Mycfi2 Mycosphaerella fijiensis Capnodiales; Mycosphaerellaceae; Pseudocercospora Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Dothideomycetidae; Mycgr3 Mycosphaerella graminicola Capnodiales; Mycosphaerellaceae; Zymoseptoria Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Myxmu1 Myxozyma mucilagina type Saccharomycetes;unknown Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Nadsonia fulvescens var. elongata Saccharomycetes; Saccharomycetales; Saccharomycodaceae; Nadfu1 DSM 6958 Nadsonia Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Ndai Naumovozyma dairenensis Naumovozyma Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Necha2 Nectria haematococca Hypocreales; Nectriaceae; Fusarium; Fusarium solani species complex Nempa1 Nematocida parisii ERTm1 Fungi; Microsporidia; Microsporidia incertae sedis; Nematocida Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Neofi1 Neosartorya fischeri NRRL 181 Aspergillaceae; Neosartorya; Neosartorya fischeri group Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetes incertae sedis; Gloeophyllales; Gloeophyllaceae; Neole1 Neolentinus lepideus Neolentinus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Dothideomycetes Neopa1 Neofusicoccum parvum UCRNP2 incertae sedis; Botryosphaeriales; Botryosphaeriaceae; Neofusicoccum Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; Neucr2 Neurospora crassa OR74A Sordariales; Sordariaceae; Neurospora Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; Neucrtrp31 Neurospora crassa FGSC 73 trp-3 Sordariales; Sordariaceae; Neurospora Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Neurospora tetrasperma FGSC leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; Neutemata1 2509 mat a Sordariales; Sordariaceae; Neurospora Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Neurospora tetrasperma FGSC leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; NeutematA2 2508 mat A Sordariales; Sordariaceae; Neurospora Nosce1 Nosema ceranae BRL01 Fungi; Microsporidia; Apansporoblastina; Nosematidae; Nosema Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Obbri1 Obba rivulosa 3A-2 Agaricomycetes incertae sedis; Polyporales; Meruliaceae; Obba Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Leotiomycetes; Leotiomycetes incertae Oidma1 Oidiodendron maius Zn sedis; Myxotrichaceae; mitosporic Myxotrichaceae; Oidiodendron Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Ompol1 Omphalotus olearius Agaricomycetidae; Agaricales; Omphalotaceae; Omphalotus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Ophioceras dolichostomum leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; Ophdo1 CBS114926 Magnaporthales; Magnaporthaceae; Ophioceras Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; Ophpc1 Ophiostoma piceae UAMH 11346 Ophiostomatales; Ophiostomataceae; Ophiostoma Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Hypocreales; Ophiocordycipitaceae; Ophiocordyceps; Ophiocordyceps Ophsi1 Ophiocordyceps sinensis CO18 sinensis Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Ophsu1 Ophiocordyceps subramanianii Hypocreales; Ophiocordycipitaceae; Ophiocordyceps Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Hypocreales; Ophiocordycipitaceae; Ophiocordyceps; Ophiocordyceps Ophun1 Ophiocordyceps unilateralis unilateralis Fungi; Neocallimastigomycota; Neocallimastigomycetes; Orpsp1 Orpinomyces sp. C1A Neocallimastigales; Neocallimastigaceae; Orpinomyces Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Pachysolen tannophilus NRRL Y- Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Pacta12 2460 v1.2 Pachysolen Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Pancy2 Panaeolus cyanescens Agaricomycetidae; Agaricales; Bolbitiaceae; Panaeolus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Paracoccidioides_brasiliensis_Pb0 leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Onygenales; mitosporic Parbr1 3 Onygenales; Paracoccidioides Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Paraconiothyrium sporulosum leotiomyceta; dothideomyceta; Dothideomycetes; Pleosporomycetidae; Parsp1 AP3s5-JAC2a Pleosporales; Massarineae; Didymosphaeriaceae; Paraphaeosphaeria Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Paxin1 Paxillus involutus ATCC 200175 Agaricomycetidae; Boletales; Paxilineae; Paxillaceae; Paxillus Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Paxru1 Paxillus_rubicundulus_Ve08.2h10 Agaricomycetidae; Boletales; Paxilineae; Paxillaceae; Paxillus Pseudogymnoascus destructans Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; Pdes 20631-21 Pseudeurotiaceae; Pseudogymnoascus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Pench1 Penicillium chrysogenum leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales;

Page 153

Appendix I (Chapter 4)

Trichocomaceae; mitosporic Trichocomaceae; Penicillium; Penicillium chrysogenum complex Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Penicillium chrysogenum Wisconsin leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; PenchWisc11 54-1255 Aspergillaceae; Penicillium Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Pendi1 Penicillium digitatum PHI26 Aspergillaceae; Penicillium Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Penox1 Penicillium oxalicum 114-2 Aspergillaceae; Penicillium Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; PenroFM164 Penicillium roquefortii FM164 Aspergillaceae; Penicillium; Penicillium roqueforti Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; PenroP1 Penicillium roquefortii P1 Aspergillaceae; Penicillium; Penicillium roqueforti Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Phaeoacremonium aleophilum leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; Phaal1 UCRPA7 Calosphaeriales; Calosphaeriaceae; Togninia Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Phanerochaete carnosa HHB- Agaricomycetes incertae sedis; Polyporales; Phanerochaetaceae; Phaca1 10118-Sp Phanerochaete Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Phaop004113A Phaffomyces opuntiae 00-411-3A Saccharomycetes;unknown Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Phaop98352 Phaffomyces opuntiae 98.352 Saccharomycetes;unknown Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Phanerochaete chrysosporium RP- Agaricomycetes incertae sedis; Polyporales; Phanerochaetaceae; Phchr2 78 v2.2 Phanerochaete Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Chaetothyriomycetidae; Chaetothyriales; Phieu1 Phialophora europaea cbs 101466 Cyphellophoraceae; Cyphellophora Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Phialocephala scopiformis leotiomyceta; sordariomyceta; Leotiomycetes; Helotiales; mitosporic Phisc1 5WS22E1 Helotiales; Phialocephala Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Phlbr1 Phlebia brevispora HHB-7030 SS6 Agaricomycetes incertae sedis; Corticiales; Corticiaceae; Phlebia Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetes incertae sedis; Polyporales; Phanerochaetaceae; Phlgi1 Phlebiopsis gigantea Phlebiopsis Phycomyces blakesleeanus Fungi; Fungi incertae sedis; Early diverging fungal lineages; Phybl2 NRRL1555 Mucoromycotina; Mucorales; Phycomycetaceae; Phycomyces Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Dothideomycetes Phycit1 Phyllosticta citriasiana incertae sedis; Botryosphaeriales; Phyllostictaceae; Phyllosticta Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Pickl1 Pichia kluyveri type Saccharomycetes;unknown Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Picme2 Pichia membranifaciens Saccharomycetes; Saccharomycetales; Pichiaceae; Pichia Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Phaffomycetaceae; Picpa1 Pichia_pastoris Komagataella Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Debaryomycetaceae; Picst3 Pichia stipitis Scheffersomyces Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Pilcr1 Piloderma croceum F 1598 Agaricomycetidae; Atheliales; Atheliaceae; Piloderma Fungi; Neocallimastigomycota; Neocallimastigomycetes; PirE21 Piromyces sp. E2 Neocallimastigales; Neocallimastigaceae; Piromyces Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Piriformospora_indica_DSM_11827 Agaricomycetes incertae sedis; Sebacinales; Sebacinales group B; Pirin1 _from_MPI Piriformospora Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Boletales; Sclerodermatineae; Pisolithaceae; Pismi1 Pisolithus microcarpus 441 Pisolithus Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Boletales; Sclerodermatineae; Pisolithaceae; Pisti1 Pisolithus tinctorius Marx 270 Pisolithus Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; PleosPC152 Pleurotus ostreatus PC15 Agaricomycetidae; Agaricales; Pleurotaceae; Pleurotus Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; PleosPC91 Pleurotus ostreatus PC9 Agaricomycetidae; Agaricales; Pleurotaceae; Pleurotus Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Plicr1 Plicaturopsis crispa Agaricomycetidae; Agaricales; Agaricales incertae sedis; Plicaturopsis Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Plucer1 Pluteus cervinus NL-1719 Agaricomycetidae; Agaricales; Pluteaceae; Pluteus Fungi; Dikarya; Ascomycota; Taphrinomycotina; Pneumocystidomycetes; Pneji1 Pneumocystis_jirovecii Pneumocystidales; Pneumocystidaceae; Pneumocystis Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; Podan2 Podospora anserina S mat+ Sordariales; Lasiosphaeriaceae; Podospora Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Polar1 Polyporus arcularius Agaricomycetes incertae sedis; Polyporales; Polyporaceae; Polyporus Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Polbr1 Polyporus brumalis BRFM 1820 Agaricomycetes incertae sedis; Polyporales; Polyporaceae; Polyporus Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Pospl1 Postia placenta MAD 698-R Agaricomycetes incertae sedis; Polyporales; Coriolaceae; Postia Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; PosplRSB12 Postia placenta MAD-698-R-SB12 Agaricomycetes incertae sedis; Polyporales; Coriolaceae; Postia Pseudogymnoascus pannorum Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; Ppan ATCC-16222 Pseudeurotiaceae; Pseudogymnoascus

Page 154

Appendix I (Chapter 4)

Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Ppas Pichia pastoris GS115 Komagataella Fungi; Dikarya; Basidiomycota; Ustilaginomycotina; Ustilaginomycetes; Psean11 Pseudozyma antarctica T-34 Ustilaginales; Ustilaginaceae; mitosporic Ustilaginaceae; Pseudozyma Fungi; Dikarya; Basidiomycota; Ustilaginomycotina; Ustilaginomycetes; Psehu1 Pseudozyma hubeiensis SY62 Ustilaginales; Ustilaginaceae; mitosporic Ustilaginaceae; Pseudozyma Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; PseliM95 Pseudohalonectria lignicola M95 Magnaporthales; Magnaporthaceae; Pseudohalonectria Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Psicub11 Psilocybe cubensis Agaricomycetidae; Agaricales; Strophariaceae; Psilocybe Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Psicy2 Psilocybe cyanescens Agaricomycetidae; Agaricales; Strophariaceae; Psilocybe Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Psiser1 Psilocybe serbica Agaricomycetidae; Agaricales; Strophariaceae; Psilocybe Fungi; Dikarya; Basidiomycota; Pucciniomycotina; Pucciniomycetes; Pucgr1 Puccinia graminis Pucciniales; Pucciniaceae; Puccinia Puccinia striiformis f. sp. tritici PST- Fungi; Dikarya; Basidiomycota; Pucciniomycotina; Pucciniomycetes; Pucst1 130 Pucciniales; Pucciniaceae; Puccinia Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Punst1 Punctularia strigosozonata Agaricomycetes incertae sedis; Corticiales; Punctulariaceae; Punctularia Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Purli1 Purpureocillium lilacinum PLFJ-1 Hypocreales; Ophiocordycipitaceae Fungi; Dikarya; Basidiomycota; Pucciniomycotina; Pucciniomycetes; Putr Puccinia triticina 1-1BBBD Race 1 Pucciniales; Pucciniaceae; Puccinia Pycnoporus cinnabarinus BRFM Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Pycci1 137 Agaricomycetes incertae sedis; Polyporales; Coriolaceae; Trametes Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Pyrco1 Pyronema confluens CBS100304 Pezizomycetes; Pezizales; Pyronemataceae; Pyronema Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Pleosporomycetidae; Pyrsp1 Pyrenochaeta sp. DS3sAY3a Pleosporales; Pleosporineae; Cucurbitariaceae; Pyrenochaeta Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Pleosporomycetidae; Pyrtr1 Pyrenophora tritici-repentis Pleosporales; Pleosporineae; Pleosporaceae; Pyrenophora Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Pleosporomycetidae; Pyrtt1 Pyrenophora teres f. teres Pleosporales; Pleosporineae; Pleosporaceae; Pyrenophora Rhizopus microsporus var. Fungi; Fungi incertae sedis; Early diverging fungal lineages; Rhich1 chinensis CCTCC M201021 Mucoromycotina; Mucorales; Mucorineae; Rhizopodaceae; Rhizopus Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Leotiomycetes; Helotiales; Helotiaceae; Rhier1 Rhizoscyphus ericae UAMH 7357 Rhizoscyphus Rhizopus microsporus var. Fungi; Fungi incertae sedis; Early diverging fungal lineages; Rhimi11 Microsporus Mucoromycotina; Mucorales; Mucorineae; Rhizopodaceae; Rhizopus Fungi; Fungi incertae sedis; Mucoromycotina; Mucorales; Mucorineae; RhimiATCC11559 Rhizopus microsporus ATCC11559 Rhizopodaceae; Rhizopus; Rhizopus microsporus Rhizopus microsporus var. Fungi; Fungi incertae sedis; Mucoromycotina; Mucorales; Mucorineae; RhimiATCC52814 microsporus ATCC52814 Rhizopodaceae; Rhizopus; Rhizopus microsporus Rhizopus oryzae 99-880 from Fungi; Fungi incertae sedis; Early diverging fungal lineages; Rhior3 Broad Mucoromycotina; Mucorales; Mucorineae; Rhizopodaceae; Rhizopus Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetes incertae sedis; Cantharellales; Ceratobasidiaceae; Rhiso1 Rhizoctonia solani AG-1 IB mitosporic Ceratobasidiaceae; Rhizoctonia Rhizopogon vinicolor AM-OR11- Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Rhivi1 026 Agaricomycetidae; Boletales; Suillineae; Rhizopogonaceae; Rhizopogon Fungi; Dikarya; Basidiomycota; Pucciniomycotina; Microbotryomycetes; Rhoba1 Rhodotorula graminis strain WP1 Sporidiobolales; mitosporic Sporidiobolales; Rhodotorula Fungi; Dikarya; Basidiomycota; Pucciniomycotina; Cystobasidiomycetes; Rhomi1 Rhodotorula_minuta_MCA_4210 Cystobasidiales; Cystobasidiaceae; Cystobasidium Rhosp1 Rhodotorula sp. JG-1b Fungi; Dikarya; Basidiomycota; mitosporic Basidiomycota; Rhodotorula Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Pleosporomycetidae; Rhyru1 Rhytidhysteron rufulum Hysteriales; Hysteriaceae; Rhytidhysteron Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Ricme1 Rickenella_mellea Agaricomycetidae; Agaricales; Tricholomataceae; Rickenella Rozal11 Rozella allomycis CSF55 Fungi; Cryptomycota; Rozella Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Sacce1 Saccharomyces cerevisiae S288C Saccharomyces Saitoella complicata NRRL Y- Fungi; Dikarya; Ascomycota; Taphrinomycotina; Taphrinomycotina Saico1 17804 incertae sedis; Saitoella Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Sbay Saccharomyces bayanus Saccharomyces Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Scas Saccharomyces castellii Saccharomyces Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Scer Saccharomyces cerevisiae Saccharomyces Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Schco3 Schizophyllum commune H4-8 Agaricomycetidae; Agaricales; Schizophyllaceae; Schizophyllum Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; SchcoLoeD1 Schizophyllum commune Loenen D Agaricomycetidae; Agaricales; Schizophyllaceae; Schizophyllum Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; SchcoTatD1 Schizophyllum commune Tattone D Agaricomycetidae; Agaricales; Schizophyllaceae; Schizophyllum Fungi; Dikarya; Ascomycota; Taphrinomycotina; Schizosaccharomyces cryophilus Schizosaccharomycetes; Schizosaccharomycetales; Schcy1 OY26 Schizosaccharomycetaceae; Schizosaccharomyces

Page 155

Appendix I (Chapter 4)

Fungi; Dikarya; Ascomycota; Taphrinomycotina; Schizosaccharomyces japonicus Schizosaccharomycetes; Schizosaccharomycetales; Schja1 yFS275 Schizosaccharomycetaceae; Schizosaccharomyces Fungi; Dikarya; Ascomycota; Taphrinomycotina; Schizosaccharomyces octosporus Schizosaccharomycetes; Schizosaccharomycetales; Schoc1 yFS286 Schizosaccharomycetaceae; Schizosaccharomyces Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Schpa1 Schizopora paradoxa KUC8140 Agaricomycetes incertae sedis; Corticiales; Corticiaceae; Schizopora Fungi; Dikarya; Ascomycota; Taphrinomycotina; Schizosaccharomycetes; Schizosaccharomycetales; Schpo1 Schizosaccharomyces pombe Schizosaccharomycetaceae; Schizosaccharomyces Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Boletales; Sclerodermatineae; Sclerodermataceae; Sclci1 Scleroderma citrinum Foug A Scleroderma Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Leotiomycetes; Helotiales; Sclsc1 Sclerotinia_sclerotiorum Sclerotiniaceae; Sclerotinia Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Scom Schizophyllum commune Agaricomycetidae; Agaricales; Schizophyllaceae; Schizophyllum Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Sebve1 Sebacina vermifera MAFF 305830 Agaricomycetes incertae sedis; Sebacinales; Sebacinaceae; Sebacina Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Dothideomycetidae; Sepmu1 Septoria musiva SO2202 Capnodiales; Mycosphaerellaceae; Mycosphaerella Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Dothideomycetidae; Seppo1 Septoria populicola Capnodiales; Mycosphaerellaceae; Sphaerulina Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; SerlaS732 Serpula lacrymans S7.3 Agaricomycetidae; Boletales; Coniophorineae; Serpulaceae; Serpula Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; SerlaS792 Serpula_lacrymans_S7.9 Agaricomycetidae; Boletales; Coniophorineae; Serpulaceae; Serpula Serpula lacrymans var shastensis Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Serlavarsha1 SHA21-2 Agaricomycetidae; Boletales; Coniophorineae; Serpulaceae; Serpula Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Pleosporomycetidae; Settu1 Setosphaeria turcica Et28A Pleosporales; Pleosporineae; Pleosporaceae; Setosphaeria Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Sistotremastrum niveocremeum Agaricomycetes incertae sedis; Trechisporales; 'Trechisporaceae'; Sisni1 HHB9708 ss-1 1.0 Sistotremastrum Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetes incertae sedis; Trechisporales; 'Trechisporaceae'; Sissu1 Sistotremastrum suecicum Sistotremastrum Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Sklu Saccharomyces kluyveri Lachancea Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Skud Saccharomyces kudriavzevii Saccharomyces Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Smik Saccharomyces mikatae Saccharomyces Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Sodal1 Sodiomyces alkalinus Glomerellales; Plectosphaerellaceae; Sodiomyces Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; Sorma1 Sordaria macrospora Sordariales; Sordariaceae; Sordaria Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Spathaspora passalidarum NRRL Saccharomycetes; Saccharomycetales; Debaryomycetaceae; Spapa3 Y-27907 Spathaspora Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Sphst1 Sphaerobolus stellatus Phallomycetidae; Geastrales; Sphaerobolaceae; Sphaerobolus Fungi; Dikarya; Basidiomycota; Ustilaginomycotina; Ustilaginomycetes; Spore1 Sporisorium reilianum SRZ2 Ustilaginales; Ustilaginaceae; Sporisorium Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; Spoth2 Sporotrichum thermophile Sordariales; Chaetomiaceae; mitosporic Chaetomiaceae; Myceliophthora Fungi; Chytridiomycota; Chytridiomycetes; Spizellomycetales; Spun Spizellomyces punctatus Spizellomycetaceae; Spizellomyces Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Staam1 Starmera amethionina type Saccharomycetes;unknown Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Pleosporomycetidae; Stano2 Stagonospora nodorum SN15 Pleosporales; Pleosporineae; Phaeosphaeriaceae; Parastagonospora Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; dothideomyceta; Dothideomycetes; Pleosporomycetidae; Stasp1 Stagonospora sp. SRC1lsM3a Pleosporales; Massarineae; Massarinaceae; Stagonospora Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Stehi1 Stereum hirsutum FP-91666 SS1 Agaricomycetes incertae sedis; Russulales; Stereaceae; Stereum Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Suibr1 Suillus_brevipes Agaricomycetidae; Boletales; Suillineae; Suillaceae; Suillus Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetidae; Boletales; Suillineae; Suillaceae; Suillus; Suillus Suilu3 Suillus luteus UH-Slu-Lm8-n1 decipiens Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Talaromyces marneffei ATCC leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Talma12 18224 Trichocomaceae; Talaromyces Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Talaromyces stipitatus ATCC leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Eurotiales; Talst12 10500 Trichocomaceae; Talaromyces Fungi; Dikarya; Ascomycota; Taphrinomycotina; Taphrinomycetes; Tapde11 Taphrina deformans Taphrinales; Taphrinaceae; Taphrina

Page 156

Appendix I (Chapter 4)

Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Tdel Torulaspora delbrueckii Torulaspora Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Onygenales; Tequ Trichophyton equinum CBS127.97 Arthrodermataceae; mitosporic Arthrodermataceae; Trichophyton Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Terbo1 Terfezia boudieri S1 Pezizomycetes; Pezizales; Pezizaceae; Terfezia Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Tersp1 Termitomyces sp. J132 Agaricomycetidae; Agaricales; Lyophyllaceae Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Sordariomycetidae; Thite2 Thielavia terrestris Sordariales; Chaetomiaceae; Thielavia Fungi; Dikarya; Basidiomycota; Ustilaginomycotina; Exobasidiomycetes; Tilan2 Tilletiaria anomala UBC 951 Georgefischeriales; Tilletiariaceae; Tilletiaria Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Tolypocladium ophioglossioides leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Tolop1 CBS 100239 Hypocreales; Ophiocordycipitaceae Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Torhe1 Torrubiella hemipterigena Hypocreales; Clavicipitaceae Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Tpha Tetrapisispora phaffii CBS 4417 Tetrapisispora Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Trave1 Trametes versicolor Agaricomycetes incertae sedis; Polyporales; Coriolaceae; Trametes Fungi; Dikarya; Basidiomycota; Agaricomycotina; Tremellomycetes; Treme1 Tremella mesenterica Fries Tremellales; Tremellaceae; Tremella Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Trichoderma asperellum CBS leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Trias1 433.97 Hypocreales; Hypocreaceae; Hypocrea Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Triat2 Trichoderma_atroviride Hypocreales; Hypocreaceae; Trichoderma Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Trichoderma harzianum CBS leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Triha1 226.95 Hypocreales; Hypocreaceae; Hypocrea Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Trichoderma_longibrachiatum_ATC leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Trilo3 C_18648 Hypocreales; Hypocreaceae; Trichoderma Fungi; Dikarya; Basidiomycota; Agaricomycotina; Tremellomycetes; Triol1 Trichosporon oleaginosus IBC0246 Tremellales; mitosporic Tremellales; Trichosporon Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Trire2 Trichoderma reesei QM6a Hypocreales; Hypocreaceae; Hypocrea Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Trire2 Trichoderma reesei Hypocreales; Hypocreaceae; Trichoderma Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Trichophyton_rubrum_CBS_11889 leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Onygenales; Triru1 2 Arthrodermataceae; Trichophyton Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Onygenales; Triver1 Trichophyton verrucosum HKI 0517 Arthrodermataceae; Trichophyton Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; TriviGv2982 Trichoderma virens Gv29-8 Hypocreales; Hypocreaceae; Trichoderma Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Onygenales; Trub Trichophyton rubrum CBS118892 Arthrodermataceae; mitosporic Arthrodermataceae; Trichophyton Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Trichophyton tonsurans leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Onygenales; Tton CBS112818 Arthrodermataceae; mitosporic Arthrodermataceae; Trichophyton Tuber melanosporum from Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Tubme1 Genoscope Pezizomycetes; Pezizales; Tuberaceae; Tuber Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Agaricomycetes incertae sedis; Cantharellales; Tulasnellaceae; Tulca1 Tulasnella calospora AL13/4D Tulasnella Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Eurotiomycetes; Eurotiomycetidae; Onygenales; Uncre1 Uncinocarpus reesii 1704 Onygenaceae; Uncinocarpus Fungi; Dikarya; Basidiomycota; Ustilaginomycotina; Ustilaginomycetes; Ustma1 Ustilago maydis Ustilaginales; Ustilaginaceae; Ustilago Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Glomerellales; Plectosphaerellaceae; mitosporic Plectosphaerellaceae; Valb Verticillium albo-atrum Verticillium Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Glomerellales; Plectosphaerellaceae; mitosporic Plectosphaerellaceae; Veral1 Verticillium alfalfae VaMs.102 Verticillium Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; sordariomyceta; Sordariomycetes; Hypocreomycetidae; Glomerellales; Plectosphaerellaceae; mitosporic Plectosphaerellaceae; Verda1 Verticillium dahliae Verticillium Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; VKMF103 Pseudogymnoascus sp. VKM-F103 Pseudeurotiaceae; Pseudogymnoascus Pseudogymnoascus sp. VKM- Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; VKMF3557 F3557 Pseudeurotiaceae; Pseudogymnoascus Pseudogymnoascus sp. VKM- Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; VKMF3775 F3775 Pseudeurotiaceae; Pseudogymnoascus Pseudogymnoascus sp. VKM- Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; VKMF3808 F3808 Pseudeurotiaceae; Pseudogymnoascus

Page 157

Appendix I (Chapter 4)

Pseudogymnoascus sp. VKM- Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; VKMF4246 F4246 Pseudeurotiaceae; Pseudogymnoascus Pseudogymnoascus sp. VKM- Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; VKMF4281 F4281 Pseudeurotiaceae; Pseudogymnoascus Pseudogymnoascus sp. VKM- Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; VKMF4513 F4513 Pseudeurotiaceae; Pseudogymnoascus Pseudogymnoascus sp. VKM- Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; VKMF4514 F4514 Pseudeurotiaceae; Pseudogymnoascus Pseudogymnoascus sp. VKM- Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; VKMF4515 F4515 Pseudeurotiaceae; Pseudogymnoascus Pseudogymnoascus sp. VKM- Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; VKMF4516 F4516 Pseudeurotiaceae; Pseudogymnoascus Pseudogymnoascus sp. VKM- Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; VKMF4517 F4517 Pseudeurotiaceae; Pseudogymnoascus Pseudogymnoascus sp. VKM- Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; VKMF4518 F4518 Pseudeurotiaceae; Pseudogymnoascus Pseudogymnoascus sp. VKM- Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; VKMF4519 F4519 Pseudeurotiaceae; Pseudogymnoascus Pseudogymnoascus sp. VKM- Fungi; Dikarya; Ascomycota; Pezizomycotina; Leotiomycetes; VKMF4520 F4520 Pseudeurotiaceae; Pseudogymnoascus Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Volvo1 Volvariella volvacea V23 Agaricomycetidae; Agaricales; Pluteaceae; Volvariella Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Vpol Vanderwaltozyma_polyspora Vanderwaltozyma Fungi; Dikarya; Basidiomycota; Basidiomycota incertae sedis; Walic1 Wallemia ichthyophaga EXF-994 Wallemiomycetes; Wallemiales; Wallemiales incertae sedis; Wallemia Fungi; Dikarya; Basidiomycota; Basidiomycota incertae sedis; Walse1 Wallemia sebi Wallemiomycetes; Wallemiales; Wallemiales incertae sedis; Wallemia Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Phaffomycetaceae; Wican1 Wickerhamomyces anomalus Wickerhamomyces Fungi; Dikarya; Basidiomycota; Agaricomycotina; Agaricomycetes; Wolco1 Wolfiporia cocos MD-104 SS10 Agaricomycetes incertae sedis; Polyporales; Coriolaceae; Wolfiporia Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; leotiomyceta; Xylonomycetes; Xylonomycetales; Xylonomycetaceae; Xylhe1 Xylona heveae TC161 Xylona Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Yarli1 Yarrowia lipolytica strain CLIB122 Saccharomycetes; Saccharomycetales; Dipodascaceae; Yarrowia Fungi; Dikarya; Ascomycota; saccharomyceta; Saccharomycotina; Saccharomycetes; Saccharomycetales; Saccharomycetaceae; Zrou Zygosaccharomyces rouxii Zygosaccharomyces Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Zymoseptoria ardabiliae STIR04 leotiomyceta; dothideomyceta; Dothideomycetes; Dothideomycetidae; Zymar1 1.1.1 Capnodiales; Mycosphaerellaceae; Zymoseptoria Fungi; Dikarya; Ascomycota; saccharomyceta; Pezizomycotina; Zymoseptoria pseudotritici STIR04 leotiomyceta; dothideomyceta; Dothideomycetes; Dothideomycetidae; Zymps1 2.2.1 Capnodiales; Mycosphaerellaceae; Zymoseptoria

Page 158

Appendix I (Chapter 4)

Table S5. NMR data for acurin A (500 MHz, DMSO-d6). Signals were referenced by solvent signals for DMSO-d6 at δH = 2.49 ppm and δC = 39.5 ppm.

No. 1H-chemical shift 13C- HMBC H2BC NOE [ppm] chemical correlations correlations connectivities (integral, mult., J [Hz]) shift [ppm] 1 1.71 (dd 7.2, 1.0) 15.4 2, 3, 22 2 2, 4 2 6.88 (m) 139.9 1, 4, 22 1 1 3 - 129.8 - - 4 6.22 (s) 126.8 6, 12, 22 - 1, 6, 12 5 - 137.5 - - 6 6.69 (d 15.4) 140.0 4, 5, 8, 9, 12 7 4, 7 7 6.60 (m) 128.8 5, 8 6 6, 12 8 6.83 141.0 10 7/9 6, 7 9 6.831 (m) 128.9 7 8 10 7.38 (m) 141.3 8, 13, 14 9 9, 15 11 - 134.4 - - 12 1.64 (s) 13.8 4, 5 4 4, 7 13 1.85 (s) 11.6 10, 11, 14 10 14 - 197.8 - - 15 4.39 (m) 47.5 14, 16/16’, 19 16/16’ 16’ 16 2.33 (m) 27.3 14, 15, 17, 20 15, 17 16’, 20 16’ 1.92 (m) 27.3 - 15, 17 15, 16, 20 17 3.54 (m) 53.6 16/16’ 16/16’,20 18 7.84 (d 10) - 15, 16/16’,19, 20 - 20, 20’ 19 - 173.0 - - 20 3.35 (m) 64.4 16/16’ 17 16/16’, 18 21 - - - - 22 - 166.3 - - 23 3.66 (s) 51.6 22 -

Page 159

Appendix I (Chapter 4)

Figure S1. Gene targeting by homologous recombination. All deletions of BGC members were performed in the NHEJ deficient strain, ACU11, favoring HR-mediated integration. Screening and verification for correct homokaryotic gene-deletion strains were performed by tissue PCR. Reaction 1 is indicated by the brown arrows and primers are placed just outside the gene sequence targeted to easily amplify and reveal both the integration of the marker and the presence of an untransformed locus. The blue arrows show reaction type 2 where the two primers were placed outside the targeted region and in pyrG the integrated marker, respectively. This reaction confirms the locus has been altered. The three scenarios, WT locus, pyrG integration, and pop-out recombination of pyrG for recycling will for all cases in this study give different products size in PCR with both reactions, which eases the analysis.

Figure S2. Analysis of diagnostic Tissue-PCR by gel electrophoresis for verification of the akuA deletion. Using reaction 1, the akuAΔ transformant showed a correct size for pyrG replacing akuA (ACU10) and the following test of a pop-out recombinant candidate showed a perfect 2.6 kb loss of sequences, which fits perfectly with loss of AFLpyrG and one DR sequence (Table S2). No trace of untransformed nuclei. Reaction 2 confirmed the integration of pyrG. This ladder used is a 1 kb ladder (New England Biolabs).

Page 160

Appendix I (Chapter 4)

C acrAΔ C acrBΔ 4000 3000 2000

Figure S3. Tissue-PCR verification and gel electrophoresis for acrAΔ and acrBΔ mutant strain validation. The picture showed products of expected sizes (Table S2) for pyrG inserted in deletion-strains acrAΔ and acrBΔ compared to a WT control (C). Three reactions per strain. None of the controls showed a positive reaction, whereas reactions from both acrAΔ and acrBΔ strains showed the correctly sized products.

C acrAΔ C acrBΔ

500 300 200

Figure S4. Tissue-PCR confirmation for the presence of nuclei having intact acrA or acrB in the respective gene-deletion strains. In the cases of these genes, primers for RT-qPCR analysis were used instead of reaction 1, since these reactions would create relatively large PCR products for a WT locus. In the WT, bands are observed, but not in deletion strains acrAΔ and acrBΔ. This ladder used is a 100 bp ladder (New England Biolabs).

Figure S5. Tissue-PCR verification for integration and homokaryon check for the acrRΔ strain. Only a product matching the replacement of acrR with pyrG was observed.

Page 161

Appendix I (Chapter 4)

A

B

Figure S6. Tissue PCR verification for correct integration and homokaryon as well as the conformation of the pyrG insert in gene-deletion strains acrGΔ, acrDΔ, acrEΔ, 1903457Δ, and 122294Δ. All products showed the expected sizes listet in Table S2. A) Reaction 1 according to scheme in Figure S1. B) Reaction 2 according to scheme in Figure S1.

A

B

Figure S7. Diagnostic Tissue-PCR and gel electrophoresis analysis for confirmation of homokaryotic acrGΔ, acrDΔ, acrEΔ, 1903457Δ, and 122294Δ strains with pyrG insertions. A) Reaction 1 according to scheme in Figure S1. B) Reaction 2 according to scheme in Figure S1.

Page 162

pedxI(hpe 4) (Chapter I Appendix ae163 Page

Figure S8. Biosynthetic Gene Cluster (BGC) comparison and PKS alignment. A) The A. aculeatus acurin BGC with highly similar BGCs from A. brunneoviolaceus and A. fijiensis. Both of the latter BGCs were examples of the species with the most similar BGCs in Aspergillus Section Nigri. They contained the same set of genes as observed in the A. aculeatus acurin BGC, and had the gene encoding the NRPS upstream to the PKS. B) An alignment of the three PKS amino-acid sequences revealed high homology with only a few discrepancies.

Appendix I (Chapter 4)

Figure S9. Clustering and gene-family evolution analysis.

Page 164

Appendix I (Chapter 4)

Page 165

Appendix I (Chapter 4)

Page 166

Appendix I (Chapter 4)

Page 167

Appendix I (Chapter 4)

Page 168

Appendix I (Chapter 4)

Page 169

Appendix I (Chapter 4)

Page 170

Appendix I (Chapter 4)

Page 171

Appendix I (Chapter 4)

Page 172

Appendix I (Chapter 4)

Page 173

Appendix I (Chapter 4)

Page 174

Appendix I (Chapter 4)

Page 175

Appendix I (Chapter 4)

Page 176

Appendix I (Chapter 4)

Page 177

Appendix I (Chapter 4)

Figure S10. Base peak chromatogram of the acrRΔ strain including an extracted ion chromatogram of m/z [M+H]+ = 374 (acurin). No trace of acurin was found in the acrRΔ strain.

Figure S11. The phenotype of the acrR-OE strain compared to the reference strain cultivated on Yeast-extract sucrose media. All mutant strains constructed in this study had the same appearance as the reference strain except for the acrR-OE strain, which

Page 178

Appendix I (Chapter 4) produced an intense orange/red pigment(s) and displayed lower sporulation in the productive zone of the colony.

Figure S12. Base peak chromatograms for the reference strain and acrR-OE cultivated on minimal media. The top panel shows a zoom in at 4.0 min-7.5 min. The arrow shows the peak relating to acurin.

Page 179

Appendix I (Chapter 4)

Figure S13. Real-time quantitative PCR (RT-qPCR) data. A) Relative gene expression for the actin housekeeping gene compared between the reference strain and the acrR-OE strain. B-D) Relative gene expression for the acr BGC compared between the reference strain and the acrR-OE strain and measured over 3, 5, and 7 days, respectively, see also Figure 5 in the main taxt.

Page 180

Appendix I (Chapter 4)

Figure S14. Base peak chromatogram of the acrGΔ strain. The BPC includes an extracted ion chromatogram of m/z [M+H]+ = 374 (acurin) and m/z [M+H]+ = 360 (demethylacurin, 2). No trace of acurin was found in the acrGΔ strain. Demethylacurin elutes around 4.9 min.

Figure S15. MS/MS spectra. The MS/MS spectra (CID, 10 eV) includes A) acurin A, and B) ”demethylacurin”.

Page 181

Appendix I (Chapter 4)

Figure S16. Proposed fragmentation pathways for acurin and ”demethylacurin”.

Page 182 Appendix II (Chapter 5)

Supporting Information

Genetic Manipulation and Molecular Networking for Biosynthetic Pathway Characterization of Tetracycline-like Compounds in Aspergillus sydowii

Peter B. Wolff1,a and Karolina Subko1,a, Sebastian Theobalda, Jakob B. Hoofa, Jens C. Frisvada, Charlotte H. Gotfredsenb, Mikael R. Andersena, Uffe H. Mortensena, and Thomas O. Larsena*

a Department of Biotechnology and Biomedicine, Technical University of Denmark, Build. 221/223, 2800, Kgs. Lyngby, Denmark. b Department of Chemistry, Technical University of Denmark, Build. 207, 2800, Kgs. Lyngby, Denmark 1 These authors have contributed equally to this work * Correspondence: [email protected] and [email protected]

Page 183 Appendix II (Chapter 5)

Table of contents

Supplementary tables: Table S1: A. sydowii locus comparison to A. niger, N. fischeri and P. aethiopicum. Table S2: List of investigated compounds. Table S3: List of fungal strains. Table S4: Primers used in this study. Table S5: Expected band lengths for deletion strains. Table S6: NMR data for compound 3. Table S7: NMR data for compounds 4a. Table S8: NMR data for compounds 4b. Table S9: NMR data for compound 5. Table S10: NMR data for compound 10 (Neosartoricin C). Table S11: NMR data for compound 11 (Neosartoricin D). Table S12: NMR data for compound 14. Table S13: NMR data for compound 16. Supplementary figures: Figure S1: Phenotypes WT and mutant strains of A. sydowii. Figure S2: EWC of A. Sydowii under inducible A. nidulans alcA promoter. Figure S3: Molecular network of A. sydowii WT and OE nstR. Figure S4: Molecular network of A. sydowii WT and OE nstR-nstAΔ. Figure S5: Molecular network of A. sydowii WT, OE nstR and OE nstR-nstAΔ. Figure S6: Molecular network of A. sydowii WT, OE nstR and OE nstR-nstBΔ. Figure S7: Molecular network of A. sydowii WT, OE nstR and OE nstR-nstCΔ. Figure S8: Molecular network of A. sydowii WT, OE nstR and OE nstR-nstDΔ. Figure S9: Biosynthetic pathway and potential biotransformations of shunt products. Figure S10: Biosynthetic pathway and potential biotransformations of Neosartoricins. Figure S11: Biosynthetic pathway and potential biotransformations of TC and Sydopurpurin. Figure S12: PCR of deletion strains.

Page 184 Appendix II (Chapter 5)

Table S1. Aspergillus sydowii nst-locus compared with Aspergillus niger ada-locus, Neosartorya fischeri nsc-locus, and Penicillium aethiopicum vrt-locus. Identity given in %.

A. A. sydowii A. niger Identity N. Identity to P. Identity to P. sydowii Predicted homolo to A. fischeri N. fischeri aethiopicum aethiopicum Gene Function g and niger homolo Gene homolog and Gene JGI ID Gene ID Gene g and Gene ID no. Gene ID

134993 Unknown N.H. - - - N.H. -

34258 Hydrolase N.H. - - - N.H. -

Polyketide 157033 adaA 64% nscA 80% vrtA synthase 61%

Prenyltransf 48554 N.H. - nscD 79% vrtC erase 46%

flavin- dependent 134988 adaC 63% nscC 74% vrtH monooxyge nase 58%

Transcriptio 183300 adaR 45% nscR 50% vrtR2 n factor 37%

Metallo-β- 92454 adaB 62% nscB 72% vrtG Lactamase 59%

34253 Unknown N.H. - - - N.H. -

MFS 48550 N.H. - - - N.H. transporter -

Genes compared on protein sequence level

N.H. = No Homolog found

Page 185 Appendix II (Chapter 5)

Table S2: List of investigated compounds.

Com- Network m/z Adduct Formula Delta, RT, Proposed structure pound identifier ppm min

2 317 317.102 [M+H]+ C17H16O6 0.06 4.66

319 319.0816 [M+H]+ C16H14O7 -1.09 4.8

339 339.0865 [M+H]+ C19H14O6 -1.15 5.88

341 341.1021 [M+H]+ C19H16O6 -1.78 6.37

27 343A 343.0817 [M+H]+ C18H14O7 -1.61 6.43

343B 343.0813 [M+H]+ C18H14O7 -0.17 5.54 N/A 345 345.0611 [M+H]+ C17H12O8 -2.23 5.43 N/A

15 355 355.082 [M+H]+ C19H14O8 -1.92 7.1

357B 357.061 [M+H]+ C18H12O8 -1.73 6.24 N/A

30 357A 357.0969 [M+H]+ C19H16O7 -0.46 5.96

1 361 361.0922 [M+H]+ C18H16O8 -0.61 5.13

369 369.0966 [M+H]+ C20H16O7 -0.07 8.76 N/A 371 371.1128 [M+H]+ C20H18O7 -0.9 6.87 N/A

29a 375 375.1076 [M+H]+ C19H18O8 -1.92 5.88

381 381.1332 [M+H]+ C22O6H20 0.15 8.16 N/A 383A 383.1494 [M+H]+ C22H22O6 -1.39 7.9 N/A

5 383B 383.1495 [M+H]+ C22H22O6 -1.91 9.31

Page 186 Appendix II (Chapter 5)

25 385A 385.0924 [M+H]+ C20H16O8 -1.45 6.3

3 385C 385.1653 [M+H]+ C22H24O6 -1.92 9.06

385B 385.165 [M+H]+ C22H24O6 -1.24 8.87 N/A 387 387.1078 [M+H]+ C20H18O8 -0.57 8.76 N/A

9a 397 397.0895 [M+Na]+ C19H18O8 -0.3 5.88

399A 399.0713 [M+H]+ C20H14O9 -0.58 6.74 N/A 399B 399.1446 [M+H]+ C22H22O7 -2.52 9.03 N/A

4b 401B 401.1603 [M+H]+ C22H24O7 -1.82 8.1

423A 423.1423 [M+H]+ C24H22O7 2.51 7.9 N/A

16 423B 423.1447 [M+H]+ C24H22O7 -1.91 9.44

425A 425.1598 [M+H]+ C24H24O7 -0.97 7.7

11 425B 425.1599 [M+H]+ C24H24O7 -1 8.91

12 425C 425.1598 [M+H]+ C24H24O7 -0.97 9.81

427A 427.1391 [M+H]+ C23H22O8 -0.92 7.47 N/A

Page 187 Appendix II (Chapter 5)

8a 427B 427.1751 [M+H]+ C24H26O7 -0.08 9.66

47 441 441.1548 [M+H]+ C24H24O8 -0.92 6.72

9a 443A 443.1709 [M+H]+ C24H26O8 -1.66 8.42

9b 443B 443.1709 [M+H]+ C24H26O8 -1.66 8.78

457 457.1496 [M+H]+ C24H24O9 -0.64 7.3

9a 465 465.1526 [M+Na]+ C24H26O8 -1.38 8.42

469A 469.1497 [M+H]+ C25H24O9 -0.88 7.84 N/A

14 469B 469.1499 [M+H]+ C25H24O9 -1.21 9.43

Page 188 Appendix II (Chapter 5)

Table S3: List of fungal strains.

# Strain identifier Genotype Notes SYD1 11834 - Wild-type SYD2 pyrG13 pyrG1 Uri, ura SYD4 akuΔ prepop pyrG1, akuAΔ::AFLApyrG Project reference strain SYD5 akuΔ pop pyrG1, akuAΔ Uri, ura pyrG1, akuAΔ, - nstAΔ This project nstAΔ::AFLApyrG pyrG1, akuAΔ, PgpdA-nstR- SYD22 OE nstR (TF) This project TtrpC::AFLApyrG pyrG1, akuAΔ, PgpdA-nstR- SYD23 OE nstR - nstAΔ (PKS) This project TtrpC, nstAΔ::AFLApyrG pyrG1, akuAΔ, PgpdA-nstR- SYD24 OE nstR - nstDΔ (PTA) This project TtrpC, nstDΔ::AFLApyrG pyrG1, akuAΔ, PgpdA-nstR- SYD25 OE nstR - nstCΔ (FMO) This project TtrpC, nstCΔ::AFLApyrG OE nstR - 48550Δ (MFS pyrG1, akuAΔ, PgpdA-nstR- SYD26 This project transp.) TtrpC, 48550Δ::AFLApyrG pyrG1, akuAΔ, PgpdA-nstR- SYD27 OE nstR - adaD TtrpC, AMA- PgpdA-adaD- This project TtrpC - AFLApyrG pyrG1, akuAΔ, PgpdA-nstR- SYD28 OE nstR - nstDΔ - adaD TtrpC, AMA- PgpdA-adaD- This project TtrpC-AFLApyrG, nstDΔ pyrG1, akuAΔ, PalcA-nstR- SYD30 PalcA nstR (induc. TF) This project TtrpC::AFLApyrG pyrG1, akuAΔ, PgpdA-nstR- SYD32 OE nstR - nstBΔ (MβL) This project TtrpC, nstBΔ::AFLApyrG pyrG1, akuAΔ, PgpdA-nstR- - OE nstR - 34253Δ This project TtrpC, 34253Δ::AFLApyrG pyrG1, akuAΔ, nstEΔ, AMA- - nstEΔ This project CRISPR- AFLApyrG

Page 189 Appendix II (Chapter 5)

Table S4: Primers used in this study.

Internal Name Sequence Purpose in key words no. PW166 ASYD157033-up-FU GGGTTTAAUTCTTGTACGCTTGCTCCTCG PKS deletion PW167 ASYD157033-up-RU GGACTTAAUGCTTGGTTGTTGTTGAGGGT PKS deletion PW168 ASYD157033-dw-FU GGCATTAAUGTTGGTTGTGCTTCTTCTGT PKS deletion PW169 ASYD157033-dw-RU GGTCTTAAUGGTCCGTCCTTTGCTGCAT PKS deletion PW170 ASYD157033-chkup-F TGTCAAGGAAGTAGAGGCAAG Check primer PW171 ASYD157033-chkgap-F CGAAGTGAGCTAAAGGGAGG Check primer PW172 ASYD157033-chkgap-R GCGAAGTTCATGGGTCGGAT Check primer PW173 ASYD IS1 UP-FU GGGTTTAAUCCGGACCCTTTCCAAACATC HR region insert site 1 PW174 ASYD IS1 UP-RU AGGGAAUGGGCATTCAGCCGTTTACCAG HR region insert site 1 PW175 ASYD IS1 DW-FU GGCATTAAUCGTCCTCCGTGATTCCTTG HR region insert site 1 PW176 ASYD IS1 DW-RU GGTCTTAAUCGTCCTCCGTGATTCCTTG HR region insert site 1 PW181 ASYD OEX 183300 FU GGGTTTAAUATGGACAGGCGCAACCG TF amplification PW182 ASYD OEX 183300 RU GGTCTTAAUTCAGCATAAAAACATACATGACCA TF amplification PW186 ASYD IS1 DWNEW-RU GGTCTTAAUTTGGGCTCTGGATGTTGTG HR region insert site 1 PW191 ASYD-IS1-UP-chk-F GAGGAGCGAGACAGCAACGA Check primer PW195 ASYD IS1 RU TTGGTACCTGTTGGCCCTG Check primer PW196 ASYD 183300chk RU CGTTGTTGCCTTGTCCATT Check primer PW206 208061 qPCR FU AGATGCAAGGTACCGAAGT qPCR primer PW207 208061 qPCR RU CAATAAATGGGCGACCGAG qPCR primer PW208 34262 qPCR FU GCTCTCCATCTGCTCCTCT qPCR primer PW209 34262 qPCR RU GGTGGTCCCATTTGCATTT qPCR primer PW210 80817 qPCR FU CTGGAGCGACTGGGATTGT qPCR primer PW211 80817 qPCR RU GGTCGATTTTTCTCTGTCGG qPCR primer PW212 134993 qPCR FU CCATGTTGGTGATATGCGCT qPCR primer PW213 134993 qPCR RU AATTCTTGATCGTCGGTGC qPCR primer PW214 34258 qPCR FU CGCGTCAATTCCCAGATGT qPCR primer PW215 34258 qPCR RU CGATAGTTGAGGCCCATGC qPCR primer PW216 157033 qPCR FU CAAAGAGGAGGCAGCGAAG qPCR primer PW217 157033 qPCR RU TGCTGGATAAGGCGAGAGC qPCR primer PW218 48554 qPCR FU CGGAAGGGATCTGGTGAAC qPCR primer PW219 48554 qPCR RU GTTTGCTCTTCCATCGCTT qPCR primer PW220 134988 qPCR RU GCCGAAACAGCCGGTCAAA qPCR primer PW221 134988 qPCR RU CATGGACATCGACTCAAGAG qPCR primer PW222 183300 qPCR FU GCGTCCAGATTTCCCCAGA qPCR primer PW223 183300 qPCR RU GACAGCAGAAGCCAAAGCC qPCR primer PW224 92454 qPCR FU GTCCGTCATCAATCGCATT qPCR primer PW225 92454 qPCR RU GCATTTCAACTCTCAGCGG qPCR primer PW226 34253 qPCR FU GCAAGTGGTGGAAGTTGTT qPCR primer PW227 34253 qPCR RU GCCGCAGTATCCCTTGTTA qPCR primer PW228 48550 qPCR FU GGCCAACGCCGAAATAAGT qPCR primer PW229 48550 qPCR RU GACCATCCAAGCTGCCACT qPCR primer PW230 408188 qPCR FU GGCGACTGATAGCGAGAAA qPCR primer PW231 408188 qPCR RU GAAGAAACGGGGACAGGCCA qPCR primer PW258 A.syd-chk-183300popF TCTCTGTCCGATTTGCAGC Check primer PW259 A.syd-chk-183300popR CGAGTGTTGCTTGATAAGG Check primer PW272 ASYD_92454_del UP FU GGGTTTAAUTCCAAACATACCGAAGATGA Deletion PW273 ASYD_92454_del UP RU GGACTTAAUTAGTGAATAGAGCACGTCTTG Deletion PW274 ASYD_92454_del DW FU GGCATTAAUTGGTGGTGAACTTTTTGTGTC Deletion PW275 ASYD_92454_del DW RU GGTCTTAAUTCCAACATAGACAATAGCACC Deletion

Page 190 Appendix II (Chapter 5)

PW276 ASYD_134988_del UP FU GGGTTTAAUTATGTGACCAATGCGAATGT Deletion PW277 ASYD_134988_del UP RU GGACTTAAUTAAGACCGGAGAAGAATGTGG Deletion PW278 ASYD_134988_del DW FU GGCATTAAUTGTCTATACGTTCCCGCTTCC Deletion PW279 ASYD_134988_del DW RU GGTCTTAAUTGCCTGGAGAATGGAAAGAAT Deletion PW280 ASYD_48554_del UP FU GGGTTTAAUTCGAAGAGGAAAGAGAAGGTG Deletion PW281 ASYD_48554_del UP RU GGACTTAAUTATAGTTGGTAAGTCCGGAGC Deletion PW282 ASYD_48554_del DW FU GGCATTAAUTCGTCCTTCTCGCTTTTTCGG Deletion PW283 ASYD_48554_del DW RU GGTCTTAAUTCGCCTGTCCGTAAAATGTCC Deletion PW293 ASYD.157033.chk.R CAGCTCCCAGAAAAGGTCAG Check primer PW296 ASYD134988-chkgap-F CCACATTCTTCTCCGGTCT Check primer PW297 ASYD134988-chkgap-R CTTGCCTCTACTTCCTTGAC Check primer PW298 ASYD134988-chkup-F TTGAGGGTGAGGTGGAGAACC Check primer PW299 ASYD92454-chkgap-F TACATCACACATACACACAG Check primer PW300 ASYD92454-chkgap-R CCTTGTAATCATGAACCTAC Check primer PW301 ASYD92454-chkup-F CACCGCAGAAGAAGCGACAG Check primer PW302 ASYD48554-chkgap-F GCTCCGGACTTACCAACTA Check primer PW303 ASYD48554-chkgap-R TTGCTGTCTTGTGGCTGTC Check primer PW304 ASYD48554-chkup-F GTGGAGTGGGTGTTTGTCGAG Check primer PW305 ASYD34258-UP-FU GGGTTTAAUTCTCCCTTTATATGCCCATGC Deletion PW306 ASYD34258-UP-RU GGACTTAAUTCTTCGGTGTAATTCGTGTGG Deletion PW307 ASYD34258-DW-FU GGCATTAAUTTCATCTCCGCTACACTTGTC Deletion PW308 ASYD34258-DW-R GGTCTTAAUTCAGTCACCAAACCTCATCG Deletion PW309 ASYD48550-UP-FU GGGTTTAAUTCCAGCAGCAAGCACATTC Deletion PW310 ASYD48550-UP-RU GGACTTAAUCTGGTTAATTCTGGCAATGCG Deletion PW311 ASYD48550-DW-FU GGCATTAAUTCCAGCTCTTCATTATGTCAC Deletion PW312 ASYD48550-DW-RU GGTCTTAAUAAATGGGAATTGAAGCTGAC Deletion PW322 CIS-SYD48554-RU ATTGACAAUACTGTGCATCATCCGTGAATCGAAC CRISPR primer ATTGTCAAUGACAGCAGTTTTAGAGCTAGAAAT CRISPR primer PW323 CIS-SYD48554-F1U AGCAAG ATCGGCGAUAAATTTGCTGCATCATCCGTGAATC CRISPR primer PW324 CIS-SYD48554-R1U GAAC ATCGCCGAUTTGGTTTTAGAGCTAGAAATAGCA CRISPR primer PW325 CIS-SYD48554-F2U AG AGGGCGGAUAGCAGCGCCTTTGCATCATCCGTG CRISPR primer PW326 CIS-SYD134988-RU AATCGAAC ATCCGCCCUGTTTTAGAGCTAGAAATAGCAAGTT CRISPR primer PW327 CIS-SYD134988-F1U AAAATAAG AAAGTCAGUACGATTATCCTGCATCATCCGTGAA CRISPR primer PW328 CIS-SYD134988-R1U TCGAAC ACTGACTTUAGTTTTAGAGCTAGAAATAGCAAGT CRISPR primer PW329 CIS-SYD134988-F2U TAAAATAAG ATTTCTATUGCCTGGAAAGATGCATCATCCGTGA CRISPR primer PW330 CIS-SYD92454-RU ATCG AATAGAAAUGTTTTAGAGCTAGAAATAGCAAGT CRISPR primer PW331 CIS-SYD92454-F1U TAAAATAAG AGAGCGCGUTTTCCTCTTGCATCATCCGTGAATC CRISPR primer PW332 CIS-SYD92454-R1U GAAC ACGCGCTCUTCAGTTTTAGAGCTAGAAATAGCA CRISPR primer PW333 CIS-SYD92454-F2U AG ACGTGCAGUTGCTTCTTGCATCATCCGTGAATCG CRISPR primer PW334 CIS-SYD34258-RU AAC ACTGCACGUTGCCGTTTTAGAGCTAGAAATAGC CRISPR primer PW335 CIS-SYD34258-F1U AAG AGAGGTAAUACTACCTGTGCATCATCCGTGAATC CRISPR primer PW336 CIS-SYD34258-R1U GAAC ATTACCTCUACGGTTTTAGAGCTAGAAATAGCAA CRISPR primer PW337 CIS-SYD92454-F2U G ATCTGATAUGTCAGTCCGTGCATCATCCGTGAAT CRISPR primer PW338 CIS-SYD48550-RU CG

Page 191 Appendix II (Chapter 5)

ATATCAGAUGCGTTTTAGAGCTAGAAATAGCAA CRISPR primer PW339 CIS-SYD48550-F1U G AGAACGTGUTCGCAGCAATGCATCATCCGTGAA CRISPR primer PW340 CIS-SYD48550-R1U TCG ACACGTTCUGCGTTTTAGAGCTAGAAATAGCAA CRISPR primer PW341 CIS-SYD48550-F2U G ATGCGTCGUGGTACCAGGTGCATCATCCGTGAA CIS-SYD157033-RU CRISPR primer PW358 TCGAAC ACAGTGAAUGGGACTGTTTTAGAGCTAGAAATA CIS-SYD157033-F1U CRISPR primer PW359 GCAAG ATGCGTCGUGGTACCAGGTGCATCATCCGTGAA CIS-SYD157033-R1U CRISPR primer PW360 TCGAAC ACAGTGAAUGGGACTGTTTTAGAGCTAGAAATA CIS-SYD157033-F2U CRISPR primer PW361 GCAAGTTAAA AATAGAAAUGTTTTAGAGCTAGAAATAGCAAGT CIS-SYD92454-F1U-2 CRISPR primer PW362 TAAAATAAGG AGAGCGCGUTTTCCTCTTGCATCATCCGTGAATC CIS-SYD92454-R1U-2 CRISPR primer PW363 GAAC PW364 ASYD48550-chkup-F ACTGATAGCGAGAAAGGCCC Check primer PW365 ASYD48550-chkgap-F ATAAAGGCGGTTTGCTGCTC Check primer PW366 ASYD48550-chkgap-R ACTTCACAACGCCCTACCTG Check primer PW367 ASYD34258-chkup-F TGTTCTCACCTTCACCGGTC Check primer PW368 ASYD34258-chkgap-F TTCGCGTGTCGTTTCATCTG Check primer PW369 ASYD34258-chkgap-R GAAGCAGCGAGACGAGTAAC Check primer PW445 ASYD-DEL34253UP-FU GGGTTTAAUGACATATGGACCGAGATGATGG Deletion PW446 ASYD-DEL34253UP-RU GGACTTAAUGTGACGTAGACATCGACAGCTG Deletion PW447 ASYD-DEL34253DW-FU GGCATTAAUGCTTGATCCGGTTAGGCTG Deletion PW448 ASYD-DEL34253DW-RU GGTCTTAAUGATGACCAACAGACCGAATC Deletion AGGTCCATAUCTGGTTGCATCATCCGTGAATCGA CRISPR primer PW449 ASYD-CRIS34253-PS1-RU AC ATATGGACCUCTCGCGTTTTAGAGCTAGAAATA CRISPR primer PW450 ASYD-CRIS34253-PS1-FU GCAAGTTAAA PW451 ASYD-CRIS34253-PS2-RU ACAACCCCUGCATCATCCGTGAATCGAAC CRISPR primer AGGGGTTGUTTTTGATATTAAGTTTTAGAGCTAG CRISPR primer PW452 ASYD-CRIS34253-PS2-FU AAATAGCAAGTTAAA PW469 PalcA-NID-IS-FU ATTCCCUATAGGCGTTCCGTTCTGCTTAG PalcA amplification AAACCCUCAGCTTTGAGGCGAGGTGATAGGATT PalcA amplification PW470 PalcA-NID-IS-RU G PW471 ASYD-IS1UP-FU(sub) GGGTTTAAUCCGGACCCTTTCCAAACATC PalcA amplification PW472 ASYDTtrp-alcARU(sub) GGTCTTAAUCGCTTACACAGTACACGAG PalcA amplification GGCCGCGCTGAGGGTTTAATCCGGACCCTTTCCA HR region insert site 1 PW492 ASYD-IS1-UP-Gibson-F AACATC CACGTGTTATCCAGCTGAGGACTTAGGGCATTCA HR region insert site 1 PW493 ASYD-IS1-UP-Gibson-R GCCGTTTACCAG CTTGGCACTGGCTGAGGCCGTCCTCCGTGATTCC HR region insert site 1 PW494 ASYD-IS1-DW-Gibson-F TTG GGCCGCGCTGAGGTCTTATTGGGCTCTGGATGT HR region insert site 1 PW495 ASYD-IS1-DW-Gibson-R TGTG CGCTTGAGCAGACATCACTACCGCGATGGACAG TF amplification PW634 ASYD-TF183300-GibF GCGCAACCG GTCTGGTCCCCAAAAAGGAAGAGCCTCAGCATA TF amplification PW635 ASYD-TF183300-GibR AAAACATACATGACCAA

Page 192 Appendix II (Chapter 5)

Table S5. Expected band lengths for deletion strains verified by tissue PCR. Corresponding gel -pictures can be found in Figure S12.

Expected ref. Expected Strain ID Gene ID Name Primer position band transformant band - 157033 nstAΔ Over gene 6112 bp 3205 bp SYD22 183300 OE nstR (TF) Over IS1 1558 bp 5512 bp SYD23 157033 OE nstR - nstAΔ Over gene 6112 bp 3205 bp (PKS) SYD24 48554 OE nstR - nstDΔ Over gene 2054 bp 2608 bp (PTA) SYD25 134988 OE nstR - nstCΔ Over gene 2209 bp 3823 bp (FMO) SYD26 48550 OE nstR - 48550Δ Over gene 3422 bp 4034 bp (MFS transp.) SYD32 92454 OE nstR - nstBΔ Over gene 1548 bp 3242 bp (MβL) - 34253 OE nstR - 34253Δ Over gene 1129 bp 2864 bp - 34258 nstEΔ Over gene 4612 bp 1155 bp

Page 193 Appendix II (Chapter 5)

Table S6: NMR data for compound 3. Solvent – CDCl3.

24 25

21

10 12 14 16 18

8 6 4 2

NO. δH, mult. (J in Hz) δC HMBC 2.96, d (1H, 17.1) 48.9 C-3, C-4, C-14, C-15, C-16 2 2.81, d (1H, 17.1) 48.9 C-3, C-14, C-15, C-16 3 201.1 4 107.8 5 166.1 6 108.0 7 161.4 8 6.37, d (1H, 1.6) 101.4 C-6, C-7, C-9, C-10 9 160.3 10 6.64, d (1 H, 1.6) 100.5 C-6, C-8, C-9, C-12 11 140.8 12 125.1 13 131.3 3.12, d (1H, 16.0) 38.8 C-2,C- 4, C-12, C-13, C-15, C-16 14 3.02, d (1H, 16.1) 38.8 C-2, C-4, C-12, C-13,C- 15,C- 16 15 71.6 2.78, d (1H, 18.0) 50.8 C-2, C-14,C- 15, C-17 16 2.74, d (1H, 17.9) 50.8 C-2, C-14, C-15, C-17 17 210.2 18 2.17, s (3H) 31.7 C-16, C-17 3.42, dd (1H, 16.5, 6.8) 27.5 C-11, C-12, C-13, C-22, C-23 21 3.34, dd (1H, 16.4, 6.7) 27.5 C-22 22 4.95, t (1H, 5.7) 122.0 C-12, C-21, C-24, C-25 23 132.8 24 1.68, s (3H) 25.8 C-22, C-23, C-25 25 1.82, s (3H) 18.3 C-22, C-23, C-24 7-OH 10.24, s C-6, C-7, C-8

Page 194 Appendix II (Chapter 5)

Table S7: NMR data for compounds 4a. Solvent – CDCl3.

24 25

21

10 12 14 16 18

2 8 6 4

NO. δH, mult. (J in Hz) δC HMBC NOESY 2 4.50, s (1H) 79.2 C-3, C-14, C-15, C-16 H-14b 3 200.4 4 106.2 5 164.3 6 107.9 7 161.2 8 6.49, d (1H, 2.2) 101.9 C-6, C-7, C-10 9 160.7 10 6.75, d (1H, 2.2) 100.7 C-6, C-8, C-9, C-12 H-21 11 140.9 12 126.0 13 130.7 C-2, C-4, C-11, C-12, C-13, C-15, C- 14 3.44, d (1H, 16.4) 38.3 H-16b 16 C-2, C-4, C-11, C-12, C-13, C-15, C- 14.5 2.95, d (1H, 16.4) 38.3 H-2, 16 15 75.8 16 2.89, d (1H, 17.5) 42.4 C-2, C-14, C-15, C-17 16.5 2.33, d (1H, 14.4) 42.4 C-2, C-14, C-15, C-17 17 211.1 18 2.07, s, (3H) 32.0 C-16, C-17 H-16a H-10, H-14, 21 3.43, m (2H) 27.3 C-11, C-12, C-13, C-22, C-23 H-25 21.5 H-10, H-24, 22 4.89, m (1H) 121.3 C-21, C-24, C-25 H-25 23 133.4 24 1.67, s (3H) 25.8 C-22, C-23, C-25 H-10 25 1.84, s (3H) 18.3 C-22, C-23, C-24 H-10 5-OH 15.3 C-5, C-6 7-OH 9.89 C-6, C-7, C-8

Page 195 Appendix II (Chapter 5)

Table S8: NMR data for compounds 4b. Solvent – CDCl3.

24 25

21

10 12 14 16 18

2 8 6 4

NO. δH, mult. (J in Hz) δC HMBC NOESY 2 4.48, s (1H) 77.0 C-3,C- 17 H-14b, H-16ab 3 200.4 4 106.6 5 163.0 6 107.6 7 160.7 8 6.29, s (1H) 101.6 C-6, C-7, C-10 9 160.1 10 6.58, s (1H) 100.5 C-6, C-8, C-9, C-12 H-21b, H-22 11 140.8 12 125.9 13 130.0 C-4, C-11, C-12, C-13, C- 3.34, d (1H, 16.9) 37.2 H-16a 15, C-16 14 C-4, C-11, C-12, C-13, C- 3.03, d (1H, 16.8) 37.2 H-2, 15, C-16 15 75.3 H-2, H-14a, H- 3.15, d (1H, 16.6) 49.4 C-14, C-15, C-17 16 18 2.82, d (1H, 16.7) 49.4 C-14, C-15, C-17 H-2 17 209.6 18 2.33, s, (3H) 32.2 C-16, C-17 H-16a C-11, C-12, C-13, C-22, C- 3.43, dd (1H, 16.8, 6.1) 27.3 23 21 C-11, C-12, C-13, C-22, C- 3.35, m (1H) 27.3 H-10 23 H-10, H-24, H- 22 4.98, t (1H, 5.6) 121.8 C-12, C-21, C-24, C-25 25 23 132.9 24 1.70, s (3H) 25.8 C-22, C-23, C-25 H-10 25 1.82, s (3H) 18.3 C-22, C-23, C-24 H-10 5-OH 14.85, s C-4,C- 5, C-6 7-OH 9.79, s C-6, C-7, C-8

Page 196 Appendix II (Chapter 5)

Table S9: NMR data for compound 5. Solvent – CDCl3.

24 25

21

10 12 14 16 18

2 8 6 4

NO. δH, mult. (J in Hz) δC HMBC 2 141.3 3 148.7 4 114.8 5 191.5 6 109.6 7 164.9 8 5.94, s (1H)/5.9, s (1H) 101.5/101.4 C-6, C-7, C-9, C-12 9 163.2 10 6.14, s (2H) 107.6 C-6, C-8, C-9, C-12 11 149.4/149.3 C-4, C-6, C-10, C-11, C-13, 12 3.79, m (2H) 43.4 C-14, C-21 13 136.2 C-2, C-3, C-4, C-5, C-12, C- 14 6.55, s (2H) 120.5 16 15 126.3/126.2 4.08, d (16.3, 1H)/4.06, d (16.3, 1H) 45.3/45.2 C-2, C-14, C-15, C-17 16 3.62, d (16.3, 1H)/3.64, d 16.3x, 1H) 45.3/45.2 C-2, C-14, C-15, C-17 17 208.3/208.1 18 2.35, s (3H)/2.34, s (3H) 30.4/30.3 C-15, C-16, C-17 21 2.35, m (4H) 41.9 C-11, C-12, C-13, C-22, C-23 22 4.59, t (2H, 7.5) 118.6 C-12, C-21, C-24, C-25 23 136.0 24 1.48, s (6H) 25.8 C-21, C-22, C-23, C-25 25 1.05, s (6H) 17.4 C-21, C-22, C-23, C-24 3-OH 12.41, s (1H)/12.40, s (1H) 2, 3, 4 7-OH 12.31, s (1H)/12.28, s (1H) 6, 7, 8, 9

Page 197 Appendix II (Chapter 5)

Table S10: NMR data for compound 10 (Neosartoricin C). Solvent – CD3CN.

24 25

21 16 18 10 12 14

20 2 8 6 4

NO. δH, mult. (J in Hz) δC HMBC 2 4.63, s (1H) 76.7 C-3, C-14, C-15, C-16 3 200.4 4 107.0 5 165.7 6 107.8 7 161.7 8 6.39, d (1H, 1.9) 102.5 C-6, C-7, C-9, C-10 9 163.1 10 6.69, d (1H, 1.9) 101.2 C-6, C-8, C-9, C-12 11 141.5 12 126.3 13 130.3 3.54, d (1H, 16.1) 33.0 C-2, C-4, C-12, C-13, C-15, C-16 14 2.95, d (1H, 16.1) 33.0 C-2, C-4, C-12, C-13, C-15, C-16 15 85.4 2.81, d (1H, 16.9) 37.4 C-2, C-14, C-15, C-17 16 2.05, d (1H, 16.9) 37.4 C-14, C-17 17 191.3 18 5.29, s (1H) 104.2 C-16, C-19, C-20 19 172.5 20 1.99, s (3H) 21.3 C-18, C-19 21 3.31, m (2H) 27.7 C-11, C-12, C-13, C-22, C-23 22 4.83, t (1H, 6.2) 122.3 C-24, C-25 23 133.5 24 1.63, s (3H) 25.7 C-22, C-23, C-25 25 1.77, s (3H) 18.2 C-22, C-23, C-24 -OH 15.63, br s -OH 9.85, br s

Page 198 Appendix II (Chapter 5)

Table S11: NMR data for compound 11 (Neosartoricin D). Solvent – CD3CN.

24 25

21 16 10 12 14

18 2 8 6 4 20

NO. δH, mult. (J in Hz) δC HMBC 1 4.50, s (1H) 78.9 C-3, C-4, C-16, C-19 3 198.1 4 106.9 5 169.5 6 108.1 7 162.4 8 6.39, d (1H, 2.2) 102.1 C-6, C-7, C-9, C-10 9 163.3 10 6.69, d (1H, 2.1) 101.6 C-5, C-6, C-8, C-9, C-12 11 142.1 12 125.4 13 130.6 3.55, d (1H, 17.8) 32.4 C-1, C-4, C-12, C-13, C-15, C-16 14 3.02, d (1H, 17.8) 32.4 C-4, C-11, C-12, C-13, C-15, C-16 15 81.7 2.74, d (1H, 16.9) 50.4 C-1, C-3, C-14, C-15, C-17 16 2.65, d (1H, 16.9) 50.4 C-1, C-17, C-18 17 204.9 18 2.61, s (2H) 51.8 C-17, C-19, C-20 19 109.0 20 1.39, s (3H) 24.5 C-17, C-18, C-19 C-11, C-12, C-13, C-14, C-22, C- 21 3.45, d (2H, 6.1) 27.7 24 22 4.97, m (1H) 122.6 C-12, C-21, C-24, C-25 23 133.7 24 1.70, d (3H, 1.7) 25.7 C-22, C-23, C-25 25 1.86, s (3H) 18.3 C-22, C-23, C-24 5-OH 16.93 C-4, C-6, C-5 7-OH 10.29 C-7, C-8

Page 199 Appendix II (Chapter 5)

Table S12: NMR data for compound 14. Solvent – CD3CN.

24 25

21

10 12 14 16

2 18 20 1 8 6 4

NO. δH, mult. (J in Hz) δC HMBC 1 n/a 2 81.1 3 n/a 4 106.9 5 161.9* 6 107.8 7 161.6 8 6.44, s (1H) 102.5 C-6, C-7, C-9, C-10 9 163.4 10 6.77, s (1H) 101.5 C-6, C-8, C-9, C-12 11 141.8 12 126.6 13 131.5 C-2, C-4, C-11, C-12, C-13, C-15, C-16, C-17, 3.20, d (1H, 16.4) 36.9 14 C-21 3.11, d (1H, 16.4) C-2, C-4, C-12, C-13, C-15, C-16 15 72.9 16 2.98*, d (1H, 17.7) 42.5* C-2, C-13, C-15, C-18 17 196.3 18 108.6* 19 202.9 20 2.58, s (3H) 28.1 C-18, C-19* 21 3.48, m (2H) 27.9 C-11, C-12, C-13, C-23 22 4.98, m (1H) 122.6 C-12, C-21, C-24, C-25 23 133.8 24 1.86, s (3H) 18.3 C-22, C-23, C-25 25 1.70, s (3H) 25.7 C-22, C-23, C-24 -OH 18.07, s (1H) -OH 15.59, s (1H) -OH 9.89, br s (1H) -OH 5.23, brs (1H) * Very weak signals

Page 200 Appendix II (Chapter 5)

Table S13: NMR data for compound 16. Solvent – CD3CN.

24 25

21

10 12 14 16

8 2 18 6 4 20

NO. δH, mult. (J in Hz) δC HMBC 2 158.8 3 179.5 4 111.7 5 176.3 6 108.2 7 164.3 8 6.37, s (1H) 102.3 C-6, C-7, C-9, C-10 9 165.4 10 6.67, s (1H) 103.7 C-6, C-8, C-9, C-12 11 142.5 12 128.4 13 131.3 C-2, C-3*, C-4, C-11, C-12, C-13, C-15, C-16, 3.58, d (1H, 16.1) 38.9 C-18 14 C-2, C-3*, C-4, C-5*, C-11, C-12, C-13, C-15, 2.99, d (1H, 16.1) 38.9 C-16, C-21, C-22 15 75.4 2.87, d (1H, 17.9) 51.0 C-2, C-14, C-15, C-17 16 2.74, d (1H, 17.9) 51.0 C-2, C-14, C-15, C-17, C-18 17 202.3 18 144.5 19 200.3 20 2.42, s (3H) 31.4 C-18, C-19 21 3.40, m (2H) 28.2 C-10, C-12, C-13, C-22, C-23 22 4.98, t (1H, 6.2) 122.9 C-12,C- 21, C-24, C-25 23 133.7 24 1.69, s (3H) 25.9 C-22, C-23, C-25 25 1.83, s (3H) 18.3 C-22, C-23, C-24 -OH 16.97, s (1H) -OH 10.95, s (1H) -OH 9.10, br s (1H) -OH 4.03, brs (1H)

Page 201 Appendix II (Chapter 5)

Figure S1: Phenotypes of A. sydowii WT and mutant strains.

MM YES

TOP BOTTOM TOP BOTTOM

WT

OE TF PKSΔ (OE nstR-nstAΔ)

OE TF (OE nstR)

OE TF MBLΔ (OE nstR-nstBΔ)

OE TF FMOΔ (OE nstR-nstCΔ)

OE TF PTAΔ (OE nstR-nstDΔ)

Page 202 Appendix II (Chapter 5)

Figure S2: EWC at 400nm of induced TF activation under alcA promoter, with variable inducer (threonine) concentration at 7d and 10d on fructose MM.

Fructose MM 7d at 28°C Fructose MM 10d at 28°C x10 2 Without Threonine Without Threonine 1.25 1 0.75 0.5 0.25 0

x10 2 0.001M Threonine 0.001M Threonine 1.25 1 0.75 0.5 0.25 0

x10 2 0.005M Threonine 0.005M Threonine 1.25 1 0.75 0.5 0.25 0

x10 2 0.01M Threonine 0.01M Threonine 1.25 1 0.75 0.5 0.25 0

x10 2 0.05M Threonine 0.05M Threonine 1.25 1 0.75 0.5 0.25 0

x10 2 0.1M Threonine 0.1M Threonine 1.25 1 0.75 0.5 0.25 0

x10 2 0.2M Threonine 0.2M Threonine 1.25 1 0.75 0.5 0.25 0 5 5.5 6 6.5 7 7.5 8 8.5 9 9.5 10 10.5 11 5 5.5 6 6.5 7 7.5 8 8.5 9 9.5 10 10.5 11 RT, min RT, min

Page 203 Appendix II (Chapter 5)

Figure S3: Molecular network of A. sydowii WT and OE nstR.

WT

OE nstR

Page 204 Appendix II (Chapter 5)

Figure S4: Molecular network of A. sydowii WT and OE nstR-nstAΔ.

WT

OE nstR nstAΔ

Page 205 Appendix II (Chapter 5)

Figure S5: Molecular network of A. sydowii WT, OE nstR and OE nstR-nstAΔ.

WT

OE nstR

OE nstR nstAΔ

Page 206 Appendix II (Chapter 5)

Figure S6: Molecular network of A. sydowii WT, OE nstR and OE nstR-nstBΔ.

WT OE nstR OE nstR nstBΔ OE nstR & OE nstR nstBΔ

Page 207 Appendix II (Chapter 5)

Figure S7: Molecular network of A. sydowii WT, OE nstR and OE nstR-nstCΔ.

WT OE nstR OE nstR nstCΔ OE nstR OE & nstR nstCΔ

Page 208 Appendix II (Chapter 5)

Figure S8: Molecular network of A. sydowii WT, OE nstR and OE nstR-nstDΔ.

WT OE nstR OE nstR nstDΔ OE nstR & OE nstR nstDΔ

*

Page 209 pedxI Catr5) (Chapter II Appendix Figure S9: Biosynthetic pathway and potential biotransformations of shunt products. Compounds in blue dashed box are proposed dehydration products.

19 (m/z 299)

nstD nstC nstA [nstB]

1 (m/z 361) 2 (m/z 317) 3 (m/z 385C) 4 (m/z 401B) nstDΔ nstC ae210 Page

17 (m/z 343) 20 (m/z 333) 23 (m/z 367) 5 (m/z 383B)

18 (m/z 325) 21 (m/z 315) 24 (m/z 365)

22 (m/z 297)

pedxI Catr5) (Chapter II Appendix Figure S10: Biosynthetic pathway and potential biotransformations of Neosartoricins. Compounds in blue dashed box are proposed dehydration products.

33 (m/z 409A) 27 (m/z 341A) 34 (m/z 409B) 28 (m/z 341B)

10 (m/z 425D)

7a (m/z 359) nstD 8a (m/z 427B) nstC 9a (m/z 443A) nstA nstB ae211 Page 6 (m/z 403) 11 (m/z 425B)

7b (m/z 359) 8b (m/z 427B) 9b (m/z 443B) nstDΔ nstC

25 (m/z 385A) 12 (m/z 425C)

29a(m/z 375) 30 (m/z 357D)

26 (m/z 367) 31 (m/z 357B) 29b (m/z 375)

32 (m/z 357A)

pedxI Catr5) (Chapter II Appendix Figure S11: Biosynthetic pathway and potential biotransformations of TC and sydopurpurin A. Compounds in blue dashed box are proposed dehydration products, while compounds in red dashed box are hypothesized degradation intermediates.

35 (m/z 383C) 36 (m/z 367)

37 (m/z 451) nstA nstC nstB nstD

13 (m/z 401C) 14 (m/z 469B)

ae212 Page nstE

38 (m/z 435)

39 (m/z 419) 40 (m/z 401) 41 (m/z 401) 42 (m/z 373) 43 (m/z 373) 15 (m/z 355)

nstD nstD nstD nstD nstD nstD

44 (m/z 487) 45 (m/z 469) 46 (m/z 469) 46 (m/z 441) 47 (m/z 441) 16 (m/z 423B)

Appendix II (Chapter 5)

Figure S12: Gel pictures for verification of fungal strains by tissue PCR. Expected band lengths can be found in Table S5

Page 213 Appendix III (Chapter 6)

Supplementary Information

Expression Platform for Biocombinatorial Decoration of a Fungal-derived Tetracycline in Aspergillus niger

Peter B. Wolff1 and Karolina Subko1, Benjamin S. Bejder, Jakob B. Hoof, Thomas O. Larsen, and Uffe H. Mortensen*

Department of Biotechnology and Biomedicine, Technical University of Denmark, Build. 221/223, 2800, Kgs. Lyngby, Denmark. 1 These authors have contributed equally to this work * Correspondence: [email protected]

Table S1. List of biosynthetic gene cluster hits using a BLAST search with protein sequences from the Aspergillus niger ada-locus (i.e., AdaA, AdaB, and AdaC)

Table S2. List of fungal strains

Table S3. List of primers

Table S4. Expected band lengths for deletion strains verified by tissue PCR.

Figure S1 – Strain pictures; Aspergillus niger WT, A. niger ada-locusΔ + adaT insert, A. niger adaA-C, A. niger OE adaR/adaRDΔ (Platform strain)

Figure S2 - (A) MS/MS data of m/z 415.1024 for A. niger OE adaR reference strain, and adaA-C + adaD and OE adaR/adaRDΔ + adaD constructs. (B) MS/MS data of 469.1493 for A. sydowii OE nstR reference strain, with prenylated TC (X) and incomplete pathway product (Y), and adaA-C + nstD and OE adaR/adaRDΔ + nstD constructs.

Figure S3 - Tissue PCR verification for correct integration and homokaryon in deletion- strain ada-locusΔ, insert adaT (JGI ID no. 1178623) , insert adaA-C, and verification of the OE adaR/adaRDΔ strain.

Page 214 Appendix III (Chapter 6)

Table S1. List of biosynthetic gene cluster hits using a BLAST search with protein sequences from the Aspergillus niger ada-locus (i.e., AdaA, AdaB, and AdaC)

% identity Predicted compound by Organism identifier PKS JGI ID no AdaA – AdaB – AdaC antiSMASH Aspergillus aeristatulus 202618 84.1 – 84.6 – 85.9 asperthecin Aspergillus amylovorus 178759 83.7 – 88.0 – 88.1 asperthecin Aspergillus carlsbadensis 323073 83.2 – 84.6 – 83.3 asperthecin Aspergillus costaricaensis 262634 89.9 – 93.0 – 90.8 TAN-1612 Aspergillus desertorum 167709 85.1 – 87.2 – 89.7 asperthecin Aspergillus eucalypticola 434282 89.8 – 89.5 – 92.7 TAN-1612 Aspergillus indicus 213432 83.3 – 86.6 – 87.1 asperthecin Aspergillus luchuensis 68040 89.8 – 90.7 – 92.7 TAN-1612 Aspergillus multicolor 186430 83.0 – 90.4 – 84.6 asperthecin Aspergillus neoechinulatus 194383 83.3 – 87.2 – 87.3 asperthecin Aspergillus neoniger 352953 89.8 – 90.6 – 93.0 TAN-1612 Aspergillus novofumigatus 454886 85.9 – 85.8 – 86.6 Neosartoricin B Aspergillus olivicola 232566 85.9 – 86.2 – 85.3 asperthecin Aspergillus piperis 470664 89.7 – 90.5 – 92.3 TAN-1612 Aspergillus recurvatus 201469 84.9 – 89.8 – 88.6 asperthecin Aspergillus stercoraria 286264 84.6 – 89.0 – 89.7 asperthecin Aspergillus sydowii 151845 85.9 – 86.2 – 86.8 asperthecin Aspergillus tubingensis 123892 90.5 – 89.2 – 92.1 TAN-1612 Aspergillus undulatus 292381 84.0 – 87.0 – 84.2 asperthecin Aspergillus vadensis 431596 90.0 – 90.9 – 92.0 TAN-1612 Aspergillus versicolor 886277 84.5 – 84.8 – 90.4 asperthecin Aspergillus versicolor 89706 86.8 – 91.8 – 84.1 Neosartoricin B Aspergillus welwitschiae 167923 98.1 – 97.5 – 97.0 TAN-1612

Table S2. List of fungal strains

# Strain identifier Genotype Notes Nig1 ATCC1015 WT - Reference strain NIG96 NIG81 akuAΔ 1, popout pyrA1, akuAΔ Uridine deficient - Ada-locus deletion pyrA1, akuAΔ, ada- locusΔ::AFLApyrG

pyrA1, akuAΔ, ada- locusΔ, Pnative-adaT- - adaT insertion IS1 Tnative::AFLApyrG pyrA1, akuAΔ, ada- locusΔ, Pnative-adaT- - adaA-C Tnative, Ptef-adaR-P2A-adaB-P2A-adaC- Ttef::AFLApyrG pyrA1, akuAΔ, ada- locusΔ, Pnative-adaT- Tnative, Ptef-adaR-P2A-adaB-P2A-adaC- - adaA-C + adaD Ttef, AMA- PgpdA-adaD- TtrpC::AFLApyrG pyrA1, akuAΔ, ada- locusΔ, Pnative-adaT- Tnative, Ptef-adaR-P2A-adaB-P2A-adaC- - adaA-C + nstD Ttef, AMA- PgpdA-nstD- TtrpC::AFLApyrG OE adaR/ pyrA1, akuAΔ, OE PgpdA-adaR-TtrpC, - Uridine deficient adaRDΔ adaRDΔ pyrA1, akuAΔ, OE PgpdA-adaR-TtrpC, OE adaR/ - adaRDΔ, AMA- PgpdA-adaD- adaRDΔ + adaD TtrpC::AFLApyrG pyrA1, akuAΔ, OE PgpdA-adaR-TtrpC, OE adaR/ - adaRDΔ, AMA- PgpdA-nstD- adaRDΔ + nstD TtrpC::AFLApyrG

Page 215 Appendix III (Chapter 6)

Table S3. List of primers

Internal Name Sequence Purpose in key words no. PW236 A.nig IS 1 UP FU GGGTTTAAUGGTGATTCTCCGTTTTGCGT HR regions for insert site 1 PW237 A.nig IS 1 UP RU AAATACTCUTGTTGGTTATGATCTGGTGG HR regions for insert site 1 PW238 A.nig IS 1 DOWN FU GGCATTAAUTTCATTACCTACTGGAACTGAG HR regions for insert site 1 PW239 A.nig IS 1 DOWN RU GGTCTTAAUGTAGAATCTTCTCCCACACCC HR regions for insert site 1 PW240 A.nig adaA FU ACCATGTCUGCCCCTACGAAGCTGGTCTT Gene amplification PW241 A.nig adaA RU ATGTCCGCUCAGCAATACTGCTCCAACCAC Gene amplification PW246 A.nig adaDel UP FU GGGTTTAAUGTTGTTGAACCTGAGTGGG BGC deletion PW247 A.nig adaDel UP RU GGACTTAAUAGTCGTGGTGGTTTTTCGC BGC deletion A.nig adaDel DOWN PW248 GGCATTAAUCATACCTCCTTCTTTGGCT BGC deletion FU A.nig adaDel DOWN PW249 GGTCTTAAUGCACTCATTCTGACAATCC BGC deletion RU PW264 A.nig-adaAupRU AGCCGGGTUGATGACTGTGGGAATGCC BGC deletion PW265 A.nig-adaAdwFU AACCCGGCUATCCCCACCGATCTTG BGC deletion PW267 PS1.adaA.del.RU ACAGTTGGUACATGCATCATCCGTGAATCGAAC Protospacer/CRISPR PW268 PS1.adaA.del.FU ACCAACTGUGCAGCATCGTTTTAGAGCTAGAAATAGCAAGTTAAA Protospacer/CRISPR PW269 PS2.adaA.del.RU AGTCTCCCUCAACGACACATGCATCATCCGTGAATCGAAC Protospacer/CRISPR PW270 PS2.adaA.del.FU AGGGAGACUTGTTTTAGAGCTAGAAATAGCAAGTTAAA Protospacer/CRISPR PW287 ada.del.insert_chk.F GGTCTGGTGGAGGAACTAA Check primer PW288 A.niger.adaR.FU AGAGCGAUATGGAACAACGCAGTTCCC Gene amplification PW289 A.niger.adaR.RU TCTGCGAUTCAACTCCCCCAGTTCATAT Gene amplification PW294 ANIG.ada_del.Chk_F GCAGCGCAAGGTTTATTTG Check primer PW295 ANIG.ada_del.Chk_R GGGTGTTTGAGTTGGTGTTG Check primer PW348 PgpdA_PacI_FU GGGTTTAAUATTCCCTTGTATCTCTACAC Gene amplification PW349 PgpdA_PacI_RU AAACCCUCAGCGCGGTAGTGATGTCTGCT Gene amplification PW350 TtrpC_PacI_FU AGGGTTUAATTAAGACCTCAGCGGATCCACTTAACGTTACTG Gene amplification PW351 TtrpC_PacI_RU GGTCTTAAUCGCTTACACAGTACACGAG Gene amplification PW352 ANIG_adaD_FU GGGTTTAAUATGTCCTCAGTCACCTTAAC Gene amplification PW353 ANIG_adaD_RU GGTCTTAAUCCCCCTAAGCATCAAGAATC Gene amplification ANIG-adaB-FU- PW464 ATAATGGCCUTCCGTATCCCCTTC Gene amplification DpATEP ANIG-adaB-RU- PW465 GGACTTAAUGGTAGGAGTTATGTGATTACTTCGAT Gene amplification DpATEP ANIGadaB-Rsub- PW466 GGTCTTAAUGGTAGGAGTTATGTGATTACTTCGAT Gene amplification DpATEP ANIG-IS2DW-FU- PW467 GGCATTAAUTCCCGCTAGGACTGACAACAC Gene amplification DpATEP ANIG-IS2DW-RU- PW468 GGTCTTAAUGCAGGCAGAAGATGAGGTCG Gene amplification DpATEP PW473 ANIG IS3 UP FU ATEP GGGTTTAAUCTGTGGACGGGAGGATTAGTTC HR regions for insert site 3 PW474 ANIG IS3 UP RU ATEP ATCCCTGCCUCTCTTCGAGACTGGCTAGATAGATAG HR regions for insert site 3 PW475 ANIG adaT ATEP FU AGGCAGGGAUGGAAAAGTGAAC Gene amplification PW476 ANIG adaT ATEP RU GGACTTAAUGCTGAAGGTTTGCTTTTGTTGG Gene amplification PW477 ANIG IS3 DW FU ATEP GGCATTAAUCACTAGACAGGTTGAAGGTACTTTG HR regions for insert site 3 PW478 ANIG IS3 DW RU ATEP GGTCTTAAUGAAGTCAGACAGCATGATAACAGC HR regions for insert site 3 PW526 ANIG-IS1-UP-F CCGCGCTGAGGGTTTAATGGTGATTCTCCGTTTTGCGT HR regions for insert site 1 PW527 ANIG-IS1-UP-R TATCCAGCTGAGGACTTATACTCTTGTTGGTTATGATCTGGTG HR regions for insert site 1 PW528 ANIG-IS1-DW-F CTTGGCACTGGCTGAGGCTTCATTACCTACTGGAACTGAGACTTC HR regions for insert site 1 PW529 ANIG-IS1-DW-R GGCCGCGCTGAGGTCTTAGTAGAATCTTCTCCCACACCCTC HR regions for insert site 1 PW530 ANIG-IS2-UP-F CCGCGCTGAGGGTTTAATGTAAGCTGATAGTCTCGTGGACCA HR regions for insert site 2 PW531 ANIG-IS2-UP-R TATCCAGCTGAGGACTTACACACGAGATGGACCCTCCA HR regions for insert site 2 PW532 ANIG-IS2-DW-F CTTGGCACTGGCTGAGGCTCCCGCTAGGACTGACAACAC HR regions for insert site 2 PW533 ANIG-IS2-DW-R GGCCGCGCTGAGGTCTTAGCAGGCAGAAGATGAGGTCGAAC HR regions for insert site 2 PW534 ANIG-IS3-UP-F CCGCGCTGAGGGTTTAATCTGTGGACGGGAGGATTAGTTC HR regions for insert site 3 PW535 ANIG-IS3-UP-R TATCCAGCTGAGGACTTACTCTTCGAGACTGGCTAGATAGATAG HR regions for insert site 3 PW536 ANIG-IS3-DW-F CTTGGCACTGGCTGAGGCCACTAGACAGGTTGAAGGTACTTTGT HR regions for insert site 3 PW537 ANIG-IS3-DW-R GGCCGCGCTGAGGTCTTAGAAGTCAGACAGCATGATAACAGC HR regions for insert site 3

Page 216 Appendix III (Chapter 6)

PW538 ANIG-IS4-UP-F CCGCGCTGAGGGTTTAATCACTAGACAGGTTGAAGGTACTTTGT HR regions for insert site 4 PW539 ANIG-IS4-UP-R TATCCAGCTGAGGACTTAGAAGTCAGACAGCATGATAACAGCC HR regions for insert site 4 PW540 ANIG-IS4-DW-F CTTGGCACTGGCTGAGGCGTCTGGTTCCTGTGAACTAACTAGACG HR regions for insert site 4 PW541 ANIG-IS4-DW-R GGCCGCGCTGAGGTCTTAGTGTTGGTATTAGAGTGGTCGTTG HR regions for insert site 4 PW542 ANIG-adaT-Gib-IS3-F AGTCCTCAGCTGGATAACACGGCAGGGATGGAAAAGTGAAC Gene amplification PW543 ANIG-adaT-Gib-IS3-R CAAAGGCGGTAATACGGCACGCTGAAGGTTTGCTTTTGTTGG Gene amplification PW544 ANIG-adaBC-Gib-IS2-F AGTCCTCAGCTGGATAAGACGTATTGGGATGAATTTTGTATGCAC Gene amplification CAAAGGCGGTAATACGGGACGGTAGGAGTTATGTGATTACTTCGA PW545 ANIG-adaBC-Gib-IS2-R Gene amplification T PW546 ANIG-adaA-Gib-IS1-F AGTCCTCAGCTGGATAAGACCGAGACAGCAGAATCACCG Gene amplification PW547 ANIG-adaA-Gib-IS1-R CAAAGGCGGTAATACGGGACGTATTGGGATGAATTTTGTATGCAC Gene amplification PW552 ANIG-adadel-GAP-F CAACATCACCGTCTATCTACAAGG Check primer PW553 ANIG-adadel-GAP-R TCTCTGTGAATCAAACGCTGC Check primer PW570 ANIG-IS1-GAP-F CGAATGGGTCGTTGGTCAG Check primer PW571 ANIG-IS1-GAP-R GTGGTTGAATGGGTGGATTG Check primer PW572 ANIG-IS2-GAP-F CAGAAGCGGAAACTGAAGG Check primer PW573 ANIG-IS2-GAP-R GACATGAGGGGTTCGTATATCAC Check primer PW574 ANIG-IS3-GAP-F GCATAGATGGTGGTGATGGC Check primer PW575 ANIG-IS3-GAP-R CTGATCGGGGATTAACTGATTG Check primer PW576 ATEP-IS2UP-ptef-F AGTCCTCAGCTGGATAAGACCGAGACAGCAGAATCACCGC Gene amplification CGGCCTGCTTCAGGAGGGAGAAGTTGGTGGCGCCGGAGCCTCAG PW577 ATEP-adaA-P2A-R Gene amplification CAATACTGCTCCAACCAC CTCCTGAAGCAGGCCGGTGACGTCGAGGAGAACCCCGGCCCCATG PW578 ATEP-adaB-P2A-F Gene amplification GCCTTCCGTATCCCCT CACCGGCCTGCTTCAGGAGGGAGAAGTTGGTGGCGCCGGAGCCCT PW579 ATEP-adaB-P2A-R Gene amplification ACAGCCTCACTGCAGTTGC CTGAAGCAGGCCGGTGACGTCGAGGAGAACCCCGGCCCCATGACC PW580 ATEP-adaC-P2A-F Gene amplification CCTCCCATCCTCAT PW581 ATEP-adaC-Ttef-R ATGTCCGCTCAATGAGCCTCCACCCC Gene amplification PW582 ATEP-Ttef-adaC-F CTCATTGAGCGGACATTCGATTTATGCC Gene amplification PW583 ATEP-Ttef-R CAAAGGCGGTAATACGGGACGTATTGGGATGAATTTTGTATGCAC Gene amplification PW586 ANIG-PgpdA-adaT-F TGAGCAGACATCACTACCGCATGGCAGCCAAAGAAGGAGG Gene amplification PW587 ANIG-adaT-TtrpC-R CAGTAACGTTAAGTGGATCCTTAGCCAGAAGCATACCTCGAC Gene amplification PW595 ATEP-adaA(Gib)-F AACATAACACAACCTTCACCATGTCTGCCCCTACGAAGCTG Gene amplification TCACCGGCCTGCTTCAGGAGGGAGAAGTTGGTGGCGCCGGAGCC PW596 ATEP-adaA-P2A-R Gene amplification GCAATACTGCTCCAACCACCC PW597 ATEP-adaB(sub)-F GGCCGCGCTGAGGGTTTAATATGGCCTTCCGTATCCCCT Gene amplification ACGTCACCGGCCTGCTTCAGGAGGGAGAAGTTGGTGGCGCCGGA PW598 ATEP-adaB(sub)-R Gene amplification GCCCAGCCTCACTGCAGTTGCAG PW599 ATEP-Ttef-adaC(sub)F GAGGCTCATTGAGCGGACATTCGATTTATGCC Gene amplification PW600 ATEP-Ttef(sub)R GCGGCCGCGCTGAGGTCTTAGTATTGGGATGAATTTTGTATGCAC Gene amplification PW609 Seq-Ptef-F AGCAGAATCACCGCCCAAGTTAAG Sequence primer PW610 Seq-Ttef-R TAATGTCTTGAATCGCGCATTGG Sequence primer PW611 Seq-PgpdA-F ATTCCCTTGTATCTCTACACACAG Sequence primer PW614 Seq.adaA.P2A-F AACACCAGGGACTTCTTCTACGTC Sequence primer PW615 Seq.adaB.P2A-F ATCTCGGCCAACAAGCCATC Sequence primer PW616 Seq.adaC.P2A-F CATGTCTCTGCTGCTGAGGCTAAG Sequence primer PW619 ANIG-adaB-AMA-FU GGGTTTAAUATGGCCTTCCGTATCCCC Gene amplification PW620 ANIG-adaB-AMA-RU GGTCTTAAUCTACAGCCTCACTGCAGTTGC Gene amplification TAGCTGTTTCCGCTGAGGGTTTAATATTCCCTTGTATCTCTACACAC PW624 PgpdA-F-Gibson Gene amplification AGGC PW625 PgpdA-R-Gibson CGCGGTAGTGATGTCTGCTCAA Gene amplification PW626 TtrpC-F-Gibson GGCTCTTCCTTTTTGGGGAC Gene amplification GTACACGAGGAGCTGAGGTCTTAATCCTCCACAGTTTGCTATTCGT PW627 TtrpC-R-Gibson Gene amplification G PW631 ANIG-adaR-GibF CGCTTGAGCAGACATCACTACCGCGATGGAACAACGCAGTTCCCC Gene amplification PW632 ANIG-adaR-GibR GTCTGGTCCCCAAAAAGGAAGAGCCAGTTGAGGGGGTCAAGTATA Gene amplification GTCTGGTCCCCAAAAAGGAAGAGCCAGTTGAGGGGGTCAAGTATA PW633 ANIG-adaR-GibR2 Gene amplification GCTTT PW640 ANIG_adaB_Gib_F CGCTTGAGCAGACATCACTACCGCGATGGCCTTCCGTATCCCC Gene amplification GTCTGGTCCCCAAAAAGGAAGAGCCCTACAGCCTCACTGCAGTTG PW641 ANIG_adaB_Gib_R Gene amplification C PW642 ANIG_adaC_Gib_F CGCTTGAGCAGACATCACTACCGCGATGACCCCTCCCATCCTCATC Gene amplification PW643 ANIG_adaC_Gib_R GTCTGGTCCCCAAAAAGGAAGAGCCTCAATGAGCCTCCACCCCC Gene amplification

Page 217 Appendix III (Chapter 6)

GTCTGGTCCCCAAAAAGGAAGAGCCTCAACTCCCCCAGTTCATATC PW644 ANIG-adaR-GibR3 Gene amplification G PW647 A.nig_adaR_FU ACTACCGCAUGGAACAACGCAGTTCCCC Gene amplification PW648 A.nig_adaR_RU ATGAAGGGGGUTTAGTGTGTTTACTAGTTGGTTGCTTG Gene amplification PW650 A.nig_gpdA_IS1up_FU AGTAGCGCGGUGGTCCCACCTGACCCCAT Gene amplification PW651 A.nig_gpdA_IS1up_RU ATGCGGTAGUGATGTCTGCTCAAGCGGGG Gene amplification PW653 A.nig_IS1dw_FU ACCCCCTTCAUTACCTACTGGAACTGAGACTTCCAG HR regions for insert site 1 PW654 A.nig_IS1dw_RU ACCGCGCTACUGCCGCCAGGCAAACAAGGG HR regions for insert site 1 PW656 A.nig_adaRDdel_chkF CAGAAGGATCTAGCCTGCCTG Gene deletion PW657 A.nig_adaRDdel_chkR GACGGACTGGTTTACGCTTG Gene deletion - A.nig_adaR_FU ACTACCGCAUGGAACAACGCAGTTCCCC Gene amplification - A.nig_adaR_RU ATGAAGGGGGUTTAGTGTGTTTACTAGTTGGTTGCTTG Gene amplification - A.nig_gpdA_IS1up_FU AGTAGCGCGGUGGTCCCACCTGACCCCAT HR regions for insert site 1 - A.nig_gpdA_IS1up_RU ATGCGGTAGUGATGTCTGCTCAAGCGGGG HR regions for insert site 1 - A.nig_IS1dw_FU ACCCCCTTCAUTACCTACTGGAACTGAGACTTCCAG HR regions for insert site 1 - A.nig_IS1dw_RU ACCGCGCTACUGCCGCCAGGCAAACAAGGG HR regions for insert site 1 - A.nig_adaR_FU ACTACCGCAUGGAACAACGCAGTTCCCC Gene amplification - A.nig_IS1dw_FU ACCCCCTTCAUTACCTACTGGAACTGAGACTTC HR regions for insert site 1 - tRNA-gRNA309-rv AGGGAGAACUTTTGGGAGGTGCATCATCCGTGAATCGAAC CRISPR vector (adaRDΔ) - gRNA309-fwd AGTTCTCCCUGGTTTTAGAGCTAGAAATAGCAAGTTAAA CRISPR vector (adaRDΔ) - tRNA-gRNA310-rv AGTCACCTUAACCACAACCTGCATCATCCGTGAATCGAAC CRISPR vector (adaRDΔ) - gRNA310-fwd AAGGTGACUGGTTTTAGAGCTAGAAATAGCAAGTTAAA CRISPR vector (adaRDΔ)

Table S4. Expected band lengths for deletion strains verified by tissue PCR. Corresponding gel -pictures can be found in figure S1.

Expected WT Expected Strain ID Gene ID Name Primer position band transformant band - ada-locus Ada-locus Over locus 15347 bp 766 bp deletion From in to out 5495 bp 0 bp In adaA 1875 bp 0 bp - JGI ID no. adaT Over IS3 513 bp 5321 bp 1178623 insertion - OE adaA-C Ptef and out 0 bp 3152 bp adaA-C insertion pyrG insert 0 bp 2810 bp Over albA 6871 bp 15911 bp - OE adaR/ OE adaR/ OE adaR IS1 236 bp 5512 bp adaRDΔ adaRDΔ adaRDΔ 4225 bp 723 bp

Page 218 Appendix III (Chapter 6)

Figure S1 – Strain pictures; Aspergillus niger WT, A. niger ada-locusΔ + adaT insert, A. niger adaA-C, A. niger OE adaR/adaRDΔ (Platform strain)

Figure S2 - (A) MS/MS data of m/z 415.1024 for A. niger OE adaR reference strain, and adaA-C + adaD and OE adaR/adaRDΔ + adaD constructs. (B) MS/MS data of 469.1493 for A. sydowii OE nstR reference strain, with prenylated TC (X) and incomplete pathway product (Y), and adaA-C + nstD and OE adaR/adaRDΔ + nstD constructs.

Page 219 Appendix III (Chapter 6)

Figure S2 - Tissue PCR verification for correct integration and homokaryon in deletion- strain ada-locusΔ, insert adaT (JGI ID no. 1178623) , insert adaA-C, and verification of the OE adaR/adaRDΔ strain.

Page 220