Archaea Occurrence in the Subgingival Biofilm in Patients with Peri-Implantitis and Periodontitis

677

Archaea Occurrence in the Subgingival Biofilm in Patients with Peri-implantitis and Periodontitis

Paweł Aleksandrowicz, PhD1 The human oral microbiome is com- Ewa Brzezin´ska-Błaszczyk, PhD2 prised of over 600 prevalent taxa Anna Dudko, PhD3 at the species level and has been Justyna Agier, PhD2 shown to be the second most complex microbiome in the body, after the large intestine. Microorganisms This study aimed to determine the prevalence and diversity of archaea and select present in oral sites may cause some bacteria in the subgingival biofilm of patients with peri-implantitis in comparison pathologic conditions, ie, caries to patients with unaffected implants and patients with periodontitis. Samples (tooth decay), endodontic (root ca- of subgingival biofilm from oral sites were collected for DNA extraction (n = nal) infections, alveolar osteitis (dry 139). A 16S rRNA gene–based polymerase chain reaction assay was used to 1 determine the presence of archaea and select bacteria. Seven samples were socket), and tonsillitis. Additionally, selected for direct sequencing. Archaea were detected in 10% of samples from peri-implantitis and periodontitis are peri-implantitis sites, but not in samples from the unaffected dental implant. chronic microbial-induced inflam- Archaea were present in 53% and 64% of samples from mild and moderate/ matory conditions that include both advanced periodontitis sites, respectively. The main representative of the soft tissue inflammation and pro- Archaea domain found in biofilm from periodontitis and peri-implantitis sites was gressive bone loss.2,3 Numerous Methanobrevibacter oralis. The present results revealed that archaea are present in diseased but not healthy implants. It was also found that archaea were more and diverse bacteria are involved in abundant in periodontitis than in peri-implantitis sites. Hence, the potential role of peri-implantitis and periodontitis. archaea in peri-implantitis and periodontitis should be taken into consideration. However, the most commonly asso- Int J Periodontics Restorative Dent 2020;40:677–683. doi: 10.11607/prd.4670 ciated with these conditions are Porphyromonas gingivalis, Tannerella forsythia, and Treponema denticola, called “red complex.” Although peri- implantitis is similar in symptoms to periodontitis, some differences in the composition of microbial com- munities are recognized.4 Archaea are still poorly under- stood organisms; they form the third domain of life more genetically similar to eukaryotes.5,6 The most stud- ied group of archaea in the human 1Department of Periodontology, Medical University of Lublin, Lublin, Poland. 2Department of Experimental Immunology, Medical University of Lodz, Lodz, Poland. microbiome are methanogens, which 3Department of Oral Pathology, Medical University of Lodz, Lodz, Poland. produce energy by synthesizing methane from inorganic compounds Correspondence to: Prof Ewa-Brzezin´ska-Błaszczyk, Pomorska 251, 92-213, Lodz, Poland. 7 Fax: 42 272 57 96. Email: [email protected] (H2 and CO2) as well as organic ones. Methanogenic archaea were found Submitted October 11, 2019; accepted November 18, 2019. ©2020 by Quintessence Publishing Co Inc. in the human gastrointestinal tract,

Volume 40, Number 5, 2020

© 2020 BY QUINTESSENCE PUBLISHING CO, INC. PRINTING OF THIS DOCUMENT IS RESTRICTED TO PERSONAL USE ONLY. NO PART MAY BE REPRODUCED OR TRANSMITTED IN ANY FORM WITHOUT WRITTEN PERMISSION FROM THE PUBLISHER. 678 specifically in the large intestine,8 participation, the purpose and pro- mean age: 50.5 ± 11.6 years), who but also in the vagina9 and on the cedures were fully explained to all had moderate/advanced periodon- skin.10 Archaea can be detected in individuals, and written informed con- titis (PD > 5 mm). the oral cavity. In physiologic condi- sent was obtained from each patient. Criteria for patient inclusion tions, they were identified in tongue The study protocol was approved were as follows: (1) no treatment of scrapings,11 in subgingival biofilm by the Bioethics Commission. periodontitis/peri-implantitis within samples of patients with unaffected Patients were divided into four the previous 6 months; (2) no use implants,12 and in subgingival plaque groups. One group of 78 partici- of antibiotics and anti-inﬂammatory of subjects with healthy periodon pants (37 men, 41 women; mean drugs within the previous 3 months; tium.13,14 However, it needs to be age: 54.0 ± 12.7 years) was selected and (3) no systemic diseases (eg, mentioned that not all studies de- randomly from the Department of diabetes, osteoporosis, and immu- tected those microorganisms in Periodontology of the Medical Uni- nologic disorders). Criteria for exclu- healthy gingival pockets.15,16 In path versity of Lublin. These study sub- sion from the study were as follows: ologic conditions, archaea were jects received dental implantation. (1) pregnancy or breastfeeding; (2) identified within infected dental pulp Among them, Group I consisted cigarette smoking; (3) having < 20 tissue,17–22 and the present authors of 37 patients (18 men, 19 women; teeth; and (4) undergoing orthodon- have previously showed archaeal mean age: 52.8 ± 11.9 years) with tic therapy. presence in infected root canals.23,24 no clinical evidence of gingival in- These microorganisms were also flammation around the implant, no found in subgingival plaque samples radiographic evidence of alveolar Sampling Procedure from periodontal pockets4,13–16,25,26 bone loss, and probing depth (PD) and tongue biofilm obtained from ≤ 4 mm. The remaining 41 patients In patients with peri-implantitis and patients with periodontitis.11 How- (19 men, 22 women; mean age: 55.4 periodontitis, the site with the deep- ever, there is limited information ± 13.2 years) had peri-implantitis and est PD was selected for sample- that archaea are present in subgin- comprised Group II. Peri-implantitis taking. If two or more sites presented gival biofilm of subjects with peri- was defined by PD > 4 mm, sup- similar PD values, the anterior-most implantitis.4,12 Thus, this study aimed puration, bleeding on probing, and site was chosen. In patients with no to determine the prevalence and a noticeable three-thread loss, vis- sign of peri-implantitis, the sample diversity of archaea, as well as select ible on a radiograph, of the alveolar was collected from the mesial site of bacteria (Fusobacterium nucleatum, bone to a certain extent around the an implant. Before sampling, saliva T denticola, T forsythia, P gingivalis, implant. and supramucosal deposits were re- and Prevotella intermedia) in sam- A group of 61 patients with moved, and the tooth/implant was ples of subgingival biofilm of pa- periodontitis (32 men, 29 women; isolated with cotton rolls. The supra- tients with peri-implantitis in mean age: 53.2 ± 12.9 years) was gingival plaque was removed, and comparison to patients with unaf- selected from the Dental Institute subgingival biofilm samples were fected implants and patients with at the Medical University of Lodz. taken with individual sterile Gracey periodontitis. Periodontitis was defined according curettes and put into a sterile tube to the current classiﬁcation of the containing 1 mL of transport fluid American Academy of Periodon- (phosphate buffered saline [PBS]), Materials and Methods tology. Fifteen of these patients (8 immediately frozen and stored at men, 7 women; mean age: 49.2 ± –80ºC until laboratory analysis. Study Population 9.9 years) with mild periodontitis (PD Taking control samples was per- ≤ 5 mm) comprised Group III, and formed with a sterile Gracey curette A total of 139 nonsmoking patients Group IV consisted of the remain- (not used for sampling) to check for were enrolled in this study. Before ing 46 patients (24 men, 22 women; microbial contamination, using the

The International Journal of Periodontics & Restorative Dentistry

Table 1 PCR Primers Used for Identification of Archaea and Bacteria

Target Sequence (5’– 3’) Amplicon size, bp Annealing temperature, ºC F nucleatuma AGAGTTTGATCCTGGCTCAG 407 55 GTCATCGTGCACACAGAATTGCTG T denticolaa TAATACCGAATGTGCTCATTTACAT 316 57 TCAAAGAAGCATTCCCTCTTCTTCTTA T forsythiaa TACAGGGGAATAAAATGAGATACG 746 57 ACGTCATCCCAACCTTCCTC P gingivalisa AGGCAGCTTGCCATACTGCG 405 57 ACTGTTAGCAACTACCGATGT P intermediaa CGTGGACCAAAGATTCATCGGTGGA 260 57 CCGCTTTACTCCCCAACAAA Archaeab ACKGCTCAGTAACACGT 793 56 GTGCTCCCCCGCCAATTCCT PCR = polymerase chain reaction. aDetection and amplification performed as described by Vickerman et al.18 bDetection and amplification performed as described by Vianna et al.17 following procedure: Swabs were using lysis buffer with proteinase K. T forsythia, P gingivalis, and P inter- taken, then streaked on blood agar Deoxyribonucleic acid (DNA) was media) and archaea, oligonucleotide- plates and cultivated aerobically and adsorbed onto a silica spin-column specific primers (presented in Table 1) anaerobically. Additionally, the ab- matrix and purified from contami- targeting the 16S rRNA gene were sence of investigated microorgan- nants by centrifugation. The isolat- used. The Primer-BLAST tool27 was isms was confirmed by polymerase ed microbial DNA was suspended used for selecting the PCR primer in chain reaction (PCR) targeting the in 100 µL of Tris-EDTA (ethylenedi- particular, to avoid primer-dimer in- 16S rRNA gene as described below. aminetetraacetic acid) buffer (pH terference. The reactions were per- All procedures were performed in 7.4). Picodrop Microliter Spectro- formed using previously described a way that prevents contamination, photometer (Picodrop Limited) was methods.24 Electrophoresis in a 2% and a strict sterility regime was ap- used to determine the purity (A260/ agarose gel in TBE buffer (90 mM plied. A280) and the concentration (A260) Tris-borate; 2 mM EDTA) was per- of extracted DNA. DNA samples formed to separate the PCR prod- were immediately frozen at –80ºC ucts. Next, gel was stained with Genomic DNA Isolation and kept until further analysis. ethidium bromide and visualized under ultraviolet light. The negative Samples were thawed on ice and controls consisted of (1) ultra-pure dispersed by stirring for 3 minutes. PCR Amplification of the 16S water instead of template DNA, and Next, samples were discarded and rRNA Gene (2) DNA extracted from a subgingi- centrifuged at 2,000 g for 5 min- val plaque sample of periodontally utes. After that, PBS was removed, Detection, as well as amplification, healthy patients who earlier tested and the pellets containing microbial of archaeal and bacterial DNA was negative for presence of archaea cells were resuspended in 100 µL of performed with 2720 Thermal Cycler and select bacteria. The positive Tris-HCl buffer (pH 8.5). To isolate (Life Technologies, Fisher Scientific) contained: (1) DNA extracted from a microbial DNA, a Genomic Mini kit under standardized conditions, as subgingival plaque sample that ear- (A&A Biotechnology) was used ac- described by Vianna et al17 and Vick- lier tested positive for presence of cording to the manufacturer’s in- erman et al.18 For detection of select archaea and chosen bacteria, and structions. Cell lysis was performed bacteria (F nucleatum, T denticola, (2) reference DNA isolated from

Volume 40, Number 5, 2020

from peri-implantitis sites and 38%

F nucleatum of samples from healthy sites. P intermedia was the least-prevalent

T denticola bacterial species, found only in 27% of samples from peri-implantitis

T forsythia sites and 14% from healthy implants. The statistical analysis (chi-square

P gingivalis test) showed no association in co

Frequency (%) Frequency existence between any of bacterial

P intermedia species (P > .05). In all samples taken from healthy implant sites, no

Archaea archaeal DNA was detected. How- ever, archaeal DNA was found in 10% 0 50 100 of samples from peri-implantitis sites. Only one sample from an im- Fig 1 Frequency of archaea and select bacteria in samples from peri-implantitis sites plant with peri-implantitis was posi- (green) and from healthy implants (gray). tive for all bacterial species and archaea simultaneously. Prevalence of archaea and select bacteria in healthy and peri- Methanobrevibacter oralis DSM ated using Pearson chi-square test. implantitis sites was compared with 7256.28 All experiments were per- The significance level was P < .05. the occurrence of those microorgan formed in duplicate. isms in samples obtained from periodontal pockets (mild [PD ≤ 5 mm] Results and moderate/advanced periodon- Gene Sequencing titis [PD > 5 mm]; Fig 2). Similar to First, the presence of select bacteri- samples from peri-implantitis sites, Identification of archaea was based al species and archaea in samples F nucleatum was the most preva- on a sequence of the 16S rRNA gene. from peri-implantitis sites (n = 41) lent bacterial species in periodontitis Three archaea-positive samples from and healthy implant sites (n = 37) sites, with a 93% prevalence in patients with peri-implantitis and was evaluated (Fig 1). Twelve per- plaque samples from mild periodon- four archaea-positive samples of pa- cent of the samples from diseased titis sites and 98% in samples from tients with periodontitis were ran- implants and 8% of samples from moderate/advanced sites. T dentic- domly selected for direct sequencing healthy implant sites were positive ola was found in 53% and 60% of using previously described methods.24 for all tested bacteria. The most samples from mild and moderate/ prevalent bacterial species in peri- advanced periodontitis sites, re- implantitis probes were F nucleatum spectively; hence, its prevalence was Statistical Analysis (98%) and T denticola (93%). In sam- lower than in peri-implantitis sites. T ples from healthy implants, their forsythia was present in 53% (mild Statistical analysis was made using frequencies were 57% and 32%, re- periodontitis) and 70% (moderate/ the Statistica 13.1 program (TIBCO spectively. T forsythia was detected advanced periodontitis) of samples, Software). The association between in 68% of samples from diseased which was similar to its occurrence in the presence of archaea and bacte- sites and only in 32% of samples peri-implantitis subgingival plaque. ria in samples from peri-implantitis from healthy sites. Similarly, P gingi- P gingivalis was present in 87% and and periodontitis sites was evalu- valis was found in 68% of samples 72% of samples from mild and

The International Journal of Periodontics & Restorative Dentistry

F nucleatum T denticola 100 100

50 50 Frequency (%) Frequency (%) Frequency

0 0 PI HI PD ≤ 5 PD > 5 PI HI PD ≤ 5 PD > 5

T forsythia P gingivalis 100 100

50 50 Frequency (%) Frequency Frequency (%) Frequency

0 0 PI HI PD ≤ 5 PD > 5 PI HI PD ≤ 5 PD > 5

P intermedia Archaea

100 100

50 50 Frequency (%) Frequency Frequency (%) Frequency

0 0 PI HI PD ≤ 5 PD > 5 PI HI PD ≤ 5 PD > 5

Fig 2 Frequency of archaea and select bacteria in samples from peri-implantitis (PI), healthy implant (HI), and periodontitis sites with probing depth (PD) ≤ 5 mm and PD > 5 mm.

moderate/advanced sites, respec- DNA was found in 53% of samples between each other. In samples from tively. Similar to samples from peri- from mild periodontitis sites and periodontitis and peri-implantitis implantitis, P intermedia was the 64% of samples from moderate/ sites, the chief representative of ar- least-prevalent bacterial species; its advanced periodontitis sites. chaea domain was M oralis, as es- occurrence was 47% in samples from Direct sequencing of the ar- tablished based on the profile of mild sites and 21% in samples from chaeal 16S rRNA gene was used for obtained sequencing profiles. The moderate/advanced sites. Presence identification of archaea. Obtained similarity of all analyzed fragments of archaea was more pronounced in sequences were compared with the compared to the reference sequence samples from periodontitis. Archaeal GenBank database (using BLAST) and was between 98% and 100%.

Volume 40, Number 5, 2020

Discussion are present in gingival plaque from mazeii.13 In the present study, only M periodontitis sites.4,13–16,25,26 Howev- oralis was found in peri-implantitis The composition of microbial bio- er, there are only two studies about and periodontitis samples. films from peri-implantitis and peri- archaea in peri-implantitis sites. Presence of microorganisms in odontitis is similar at the phylum Faveri et al12 showed that archaea healthy tissue around a tooth as well level, and “red complex” bacteria are present in biofilm from peri- as the dental implant is quite appar- are abundant in both inflammatory implantitis sites. Moreover, these ent. Numerous oral bacteria species conditions.4,11,25,29,30 However, the authors showed a higher number may promote inflammation and/or incidence of some genera differs of sites positive for archaea from tissue degradation. Additionally, the significantly; in comparison to peri- peri-implantitis (12/25) than in sites architecture of such microbial com- odontitis, higher levels of the gen- from healthy implants (2/25). Thus, munities and, essentially, the coex- era Olsenella, Sphingomonas, and the present authors’ observations istence of bacterial and archaeal Peptostreptococcus and lower levels are consistent with data obtained species and a network of mutual in- of the genus Desulfomicrobium were by Faveri et al.12 Maruyama et al4 terdependencies may be significant. documented in peri-implantitis.4 also found archaea in biofilm sam- For example, by eliminating hydro- At the species level, differences in ples from peri-implantitis sites and gen from the environment, metha- the presence of bacteria were also noticed that archaea were more nogenic archaea can promote the noted; for example, Prevotella ni- abundant in peri-implantitis than in growth of bacteria able to oxidize grescens and Prevotella oris were periodontitis probes. In the current volatile fatty acids.31 Methanogenic more abundant in peri-implantitis study, archaea were present in both archaea may compete with aceto- samples, whereas Desulfomicrobium periodontitis and peri-implantitis genic bacteria for H2 using some orale were more frequently seen in sites, but its prevalence was lower representatives of treponemes, for periodontitis sites.4,29,30 In the pres- in peri-implantitis than periodontitis example.15,32 The discussion about ent study, the most prevalent spe- ones. It should be stressed that the sur- potential pathogenic properties of cies in both peri-implantitis and face of an implant is different from the archaea is still ongoing, and there periodontitis sites was F nucleatum. tooth’s tissue. Thus, microorganisms are no well-supported data that ar- However, it was noticed that T den- with various adhesive properties may chaea could be pathogens.26 ticola was more frequently found in be included in those inflammatory samples from peri-implantitis sites conditions. than from periodontitis ones. In turn, Available data show that M ora- Conclusions P gingivalis was less frequent in lis and M oralis–like phyloptype is samples from peri-implantitis than the most frequently detected ar- The present results revealed that ar- periodontitis. Hence, the present chaea in samples from oral sites. M chaea are present in diseased but data seems to be consistent with the oralis was found in biofilm from peri- not healthy implants. It was also view that there are some differences odontitis9,10,20 –23 and peri-implantitis12 found that archaea were more abun- between the composition of bacte- sites. M oralis was detected in in- dant in periodontitis sites than in rial flora between peri-implantitis fected root canals, as well.23,24 Be- peri-implantitis ones. Hence, the po and periodontitis. sides, Methanobacterium curvum/ tential archaeal role in peri-implantitis Data indicate that biofilm as- congelese was detected in samples as well as in periodontitis should be sociated with peri-implantitis or from peri-implantits12 and periodon- taken into consideration. However, periodontitis can be composed of titis13 sites. Few studies found other future studies are needed to pro- not only bacteria but also archaea. archaeal species, like Methanobrevi- vide more insight into the archaeal There is information that archaea bacter smithii14 and Methanosarcina role in both inflammatory conditions.

The International Journal of Periodontics & Restorative Dentistry

Acknowledgments 9. Belay N, Mukhopadhyay B, Conway de 21. Ozok AR, Persoon IF, Huse SM, et al. Macario E, Galask R, Daniels L. Metha- Ecology of the microbiome of the in- nogenic bacteria in human vaginal fected root canal system: A comparison The authors would like to thank Magdalena samples. J Clin Microbiol 1990;28:1666– between apical and coronal root seg- 1668. ments. Int Endod J 2012;45:530–541. Efenberger, for technical support with this 10. Probst AJ, Auerbach AK, Moissl-Eichinger 22. Paiva SS, Siqueira JF Jr, Rôças IN, et al. project. This study was supported by the C. Archaea on human skin. PLoS One Supplementing the antimicrobial effects Medical University of Lodz (grant no. 502-03/ 2013;8:e65388. of chemomechanical debridement with 6-164-01/502-64-082). All procedures per- 11. Göhler A, Hetzer A, Holtfreter B, et al. either passive ultrasonic irrigation or a formed in studies involving human partici- Quantitative molecular detection of pu- final rinse with chlorhexidine: A clinical tative periodontal pathogens in clinical- study. J Endod 2012;38:1202–1206. pants were in accordance with the ethical ly healthy and periodontally diseased 23. Efenberger M, Agier J, Pawłowska E, standards of the institutional research com- subjects. PLoS One 2014;9:e99244. Brzezin´eska-Błaszczyk E. Archaea prev- mittee and with the 1964 Helsinki Declara- 12. Faveri M, Gonçalves LFH, Feres M, et al. alence in inflamed pulp tissues. Cent tion and its later amendments or comparable Prevalence and microbiological diversi- Eur J Immunol 2015;40:194–200. ethical standards. Informed consent was ty of archaea in peri-implantitis subjects 24. Brzezin´eska-Błaszczyk E, Pawłowska E, by 16S ribosomal RNA clonal analysis. J Płoszaj T, Witas H, Godzik U, Agier J. obtained from all individual participants in- Periodontal Res 2011;46:338–344. Presence of archaea and selected bac- cluded in the study. The authors declare no 13. Matarazzo F, Ribeiro AC, Feres M, Faveri teria in infected root canal systems. Can conflicts of interest. M, Alves Mayer MP. Diversity and quan- J Microbiol 2018;64:317–326. titative analysis of archaea in aggressive 25. Vianna ME, Holtgraewe S, Seyfarth I, periodontitis and periodontally healthy Conrads G, Horz HP. Quantitative analy- subjects. J Clin Periodontol 2011;38: sis of three hydrogenotrophic microbial References 621–627. groups, methanogenic archaea, sulfate- 14. Huynh HTT, Pignoly M, Nkamga VD, reducing bacteria, and acetogenic bac- 1. Dewhirst FE, Chen T, Izard J, et al. The Drancourt M, Aboudharam G. The rep- teria, within plaque biofilms associated human oral microbiome. J Bacteriol ertoire of archaea cultivated from se- with human periodontal disease. J Bac- 2010;192:5002–5017. vere periodontitis. PLoS One 2015;10: teriol 2008;190:3779–3785. 2. Renvert S, Persson GR, Pirih FQ, Camargo e0121565. 26. Yamabe K, Maeda H, Kokeguchi S, et al. PM. Peri-implant health, peri-implant 15. Lepp PW, Brinig MM, Ouverney CC, Distribution of archaea in Japanese pa- mucositis, and peri-implantitis: Case defi- Palm K, Armitage GC, Relman DA. tients with periodontitis and humoral nitions and diagnostic considerations. J Methanogenic archaea and human peri- immune response to the components. Periodontal 2018;89(suppl 1):s304–s312. odontal disease. Proc Natl Acad Sci U S FEMS Microbiol Lett 2008;287:69–75. 3. Savage A, Eaton KA, Moles DR, Needle- A 2004;101:6176 – 6181. 27. U.S. National Library of Medicine. man I. A systematic review of definitions 16. Li CL, Liu DL, Jiang YT, et al. Prevalence Primer-Blast: A tool for finding specific of periodontitis and methods that have and molecular diversity of archaea in primers. https://www.ncbi.nlm.nih.gov/ been used to identify this disease. J Clin subgingival pockets of periodontitis pa- tools/primer-blast/. Accessed 21 May Periodontol 2009;36:458–467. tients. Oral Microbiol Immunol 2009;24: 2020. 4. Maruyama N, Maruyama F, Takeuchi Y, 343–346. 28. DSMZ German Collection of Microor- Aikawa C, Izumi Y, Nakagawa I. Intra 17. Vianna ME, Conrads G, Gomes BPFA, ganisms and Cell Cultures. Methanobre- individual variation in core microbiota Horz HP. Identification and quantifica- vibacter oralis. https://www.dsmz.de/ in peri-implantitis and periodontitis. Sci tion of archaea involved in primary end- collection/catalogue/details/culture/ Rep 2014;4:6602. odontic infections. J Clin Microbiol 2006; DSM-7256. Accessed 21 May 2020. 5. Jarrell KF, Walters AD, Bochiwal C, 44:1274–1282. 29. Ebadian AR, Kadkhodazadeh M, Borgia JM, Dickinson T, Chong JP. Ma- 18. Vickerman MM, Brossard KA, Funk DB, Zarnegarnia P, Dahlén G. Bacterial anal- jor players on the microbial stage: Why Jesionowski AM, Gill SR. Phylogenetic ysis of peri-implantitis and chronic peri- archaea are important. Microbiology analysis of bacterial and archaeal spe- odontitis in Iranian subjects. Acta Med 2011;157:919–936. cies in symptomatic and asymptomatic Iran 2012;50:486–492. 6. Pohlschroder M, Pfeiffer F, Schulze S, endodontic infections. J Med Microbiol 30. Dabdoub SM, Tsigarida AA, Kumar PS. Halim MFA. Archaeal cell surface bio- 2007;56:110 –118. Patient-specific analysis of periodontal genesis. FEMS Microbiol Rev 2018;42: 19. Jiang YT, Xia WW, Li CL, Jiang W, Liang and peri-implant microbiomes. J Dent 694 –717. JP. Preliminary study of the presence Res 2013;92(suppl 12):s168–s175. 7. Liu Y, Whitman WB. Metabolic, phylo- and association of bacteria and archaea 31. Horz HP, Conrads G. Methanogenic ar- genetic, and ecological diversity of the in teeth with apical periodontitis. Int En- chaea and oral infections—Ways to un- methanogenic archaea. Ann N Y Acad dod J 2009;42:1096–1103. ravel the black box. J Oral Microbiol Sci 2008;1125:171–189. 20. Vianna ME, Conrads G, Gomes BPFA, 2011;3. 8. Gaci N, Borrel G, Tottey W, O’Toole PW, Horz HP. T-RFLP–based mcrA gene 32. Nguyen-Hieu T, Khelaifia S, Aboudharam Brugère JF. Archaea and the human analysis of methanogenic archaea in G, Drancourt M. Methanogenic archaea gut: New beginning of an old story. association with oral infections and evi- in subgingival sites: A review. APMIS World J Gastroenterol 2014;20:16062– dence of a novel Methanobrevibacter 2013;121:467– 477. 16078. phylotype. Oral Microbiol Immunol 2009;24:417–422.

Volume 40, Number 5, 2020