Signaling Cascade Mitogen-Activated Protein Kinase Α /P38 Β -Activated

Activation of Discoidin Domain Receptor 1 Facilitates the Maturation of Human Monocyte-Derived Dendritic Cells Through the TNF Receptor Associated Factor 6/TGF- β This information is current as -Activated Protein Kinase 1 Binding Protein 1β of September 27, 2021. /p38α Mitogen-Activated Protein Kinase Signaling Cascade Wataru Matsuyama, Michel Faure and Teizo Yoshimura Downloaded from J Immunol 2003; 171:3520-3532; ; doi: 10.4049/jimmunol.171.7.3520 http://www.jimmunol.org/content/171/7/3520 http://www.jimmunol.org/ References This article cites 51 articles, 22 of which you can access for free at: http://www.jimmunol.org/content/171/7/3520.full#ref-list-1

Why The JI? Submit online.

• Rapid Reviews! 30 days* from submission to initial decision

by guest on September 27, 2021 • No Triage! Every submission reviewed by practicing scientists

• Fast Publication! 4 weeks from acceptance to publication

*average

Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts Errata An erratum has been published regarding this article. Please see next page or: /content/185/3/1984.full.pdf

The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2003 by The American Association of Immunologists All rights reserved. Print ISSN: 0022-1767 Online ISSN: 1550-6606. The Journal of Immunology

Activation of Discoidin Domain Receptor 1 Facilitates the Maturation of Human Monocyte-Derived Dendritic Cells Through the TNF Receptor Associated Factor 6/ TGF-␤-Activated Protein Kinase 1 Binding Protein 1␤/p38␣ Mitogen-Activated Protein Kinase Signaling Cascade

Wataru Matsuyama,* Michel Faure,† and Teizo Yoshimura1*

Maturation of dendritic cells (DCs) is critical for their ability to stimulate restingnggnaive T cells in primprimarprimaprimary immune responses. Previous studies demonstrated that collagen, such as type I collagen, couldfacilitate acilitate DC maturation; hohowhowever, the basis of collagen-mediated DC maturation remains unclear. Discoidin domain receptorceptoreptorptorr1 (DD(DDR1(DDR1) is a nonintegrin ccocollagen receptor Downloaded from constitutively expressed in a variety of epithelial cells, including tumorcells, ,a anddisind is inducibleinduc in leukocytes. In thtthis study, we evaluated the role of DDR1 in DC maturation using human monocyte-derivede-derived-derivedrivedDCs. DC . Two DDDR1 isoforms, DDR1a aand DDR1b, were expressed in both immature and mature DCs. Activation ofDDR1 DR11oon immaturere DCDCs resulted in their partpartiapartial maturation; however, DDR1 activation markedly ampliﬁed TNF-␣- and LPS-inducedS-induced-inducedinduceducedphenotypic p aand functional maturatiomaturation of DCs through activation of p38 mitogen-activated protein kinase (MAPK),suggesting uggestingsting the involvementvolve of DDR1b in this prpprocess. Activation of DDR1b on differentiated DDR1b-overexpressing THP-1 cellsllslss orr DDR1R1R on maturematu DCs induced the formatformaformatiformation of TNFR associated http://www.jimmunol.org/ factor 6 (TRAF6)/TGF-␤-activated kinase 1 binding proteinroteoteitein 1␤/p38␣ MAMAPKK complex and p38␣ autophosphorylation.autoutoptoph Transfec- tion of differentiated DDR1b-overexpressing THP-1 cellsells withwi dominantm negativen TRAF6 completelycompletel abrogated DDR1b-mediated p38 MAPK phosphorylation, indicating a critical roleole off TRAF6TRA 6inDDR ini DDR1b-mediated p38 MAPK activation. Taken together, our data suggest that DDR1b-collagen interaction augments thehe maturationmmatura of DCs in a tissue microenvironmentmmi through a unique TRAF6/TGF-␤-activated kinase 1 bindingproteinprpro teinin 1␤/p3838␣ MAPK signaling cascadeean andaan contributes to the development of adaptive immune responses. The Journalnalall ofofI Immunology,mmuno 2003,20 171: 3520–3532.

2 endritic cells (DCs) are professionalrofeofessionalofe sional APCsAPCs that play a ECM, could proprompromote the differentiation of murine DC precursors by guest on September 27, 2021 predominant role in stimulatingmulaulatinging reresting naivnaiveT cells in or humanmomon mmonocyte-derived iDCs into mDCs (5–7). Cell surface primary immune responsespononsonseses (1, 2). MostM tDC DCs in periph- receptors,ors,rs, ssuch as ␤ integrins, are well-known collagen receptors, D 1 ␤ eral tissues have an immaturetureure phenotype,phenenotype, the prototype being and ligationligliga of 1 integrin could induce the expression of proin- Langerhans cells in the epidermisepidpidepidermisrmismis (2).(2 Immature I DCs (iDCs) can flamflammatoryamm cytokines in monocytes (8). However, collagen-medi- take up Ags, but do not presentresentent themth efficientlyefficeffifi to T cells. In atated maturation of monocyte-derived DCs occurred independently response to microbialobiabialial productscts or proinflammatoryproin cytokines, ␣ ␤ ␣ ␤ of the classical collagen receptors, 1 1 or 2 1 integrins (7). iDCs mature andd migrate from peripheraleriphe tissue sites to lymphatic Furthermore, the expression of these integrins is low or undetect- organs using thehe CCR7 (3) through the extracellular matrix (ECM)(ECM(EC able on monocyte-derived macrophages and DCs (9, 10), suggest- and afferenttlymphatics (4). As iDCs mature into maturematur DCs ing the presence of as yet unidentified collagen receptors that may (mDCs), their capacityapacity for Ag uptake is reduced, but theythe express promote maturation of iDCs. high levels of MHCHCC class I and class II molecules andan costimula- Discoidin domain receptor 1 (DDR1) is a receptor tyrosine ki- tory molecules that enablenable them to activate T cellscellcel (2). Previous nase activated by the binding to its ligand, collagen (11, 12). We studies demonstrated thathatatt collagen, the major componentc of the previously demonstrated that the expression of the two DDR1 isoforms, DDR1a and DDR1b, could be induced in human leuko-

*Laboratory of Molecular Immunoregulation,ion,on,n, NaNNatNational Cancer Institute, Frederick, cytes, including neutrophils, monocytes, and lymphocytes. Over- MD 21702; and †SUGEN, Inc., South San Francisco,ran CA 94080 expression of DDR1a in the human monocytic leukemic cell line, Received for publication April 30, 2003. Accepted for publication July 29, 2003. THP-1, promoted their migration through three-dimensional col- The costs of publication of this article were defrayed in part by the payment of page lagen lattices (13). Recently, we also observed that collagen-acti- charges. This article must therefore be hereby marked advertisement in accordance vation of DDR1b promoted PMA-induced differentiation of THP-1 with 18 U.S.C. Section 1734 solely to indicate this fact. cells through activation of the p38 mitogen-activated protein ki- 1 Address correspondence and reprint requests to Dr. Teizo Yoshimura, Building 559, Room 9, National Cancer Institute, Frederick, MD 21702. E-mail address: nase (MAPK) pathway. Activation of DDR1 endogenously ex- [email protected] pressed on monocyte-derived macrophages resulted in an in- 2 Abbreviations used in this paper: DC, dendritic cell; iDC, immature DC; mDC, creased level of HLA-DR expression (14). These ﬁndings led us to mature DC; ECM, extracellular matrix; DDR1, discoidin domain receptor 1; TAK1, TGF-␤-activated protein kinase 1; TAB1, TAK1 binding protein 1; MAPK, mitogen- hypothesize that activation of DDR1, especially DDR1b, may con- activated protein kinase; ATF2, activating transcription factor 2; ERK, extracellular tribute to the collagen-mediated maturation of iDCs to mDCs signal-regulated kinase; TRAF, TNFR associated factor; MKK, MAPK kinase; PI, through activation of the p38 MAPK pathway, a pathway reported propidium iodide; MIP-3␤, macrophage inﬂammatory protein-3␤; DN, dominant neg- ative; PGA, protein G-agarose. to be involved in DC maturation (15).

In the present study, we tested this hypothesis using human every other day, to obtain a population of iDCs. Final maturation to mDCs monocyte-derived DCs, and have found that the expression of was induced by an additional 2-day incubation with TNF-␣ (50 ng/ml) or ␮ ␮ DDR1a and DDR1b occurs in human DCs, and that activation of LPS (1 g/ml). A total of 5 g/ml 513 Ab was used to activate DDR1. An unrelated mouse monoclonal IgM was used as control. DDR1 on iDCs, in combination with other DC-maturation signals such as TNF-␣ or LPS, up-regulates the expression of cell surface Flow cytometry analysis molecules characteristic of mDCs, including CD80, CD83, CD86, HLA-DR, CCR7, and MHC class I molecules. mDCs produced by The expression of cell surface molecules was evaluated by flow cytometry ␮ activating DDR1 stimulated allogeneic MLR, produced the Th1 analysis. A total of 100,000 cells were suspended in 50 l of cold PBS containing 0.1% sodium azide, 10 ng/ml BSA, and 20 ␮g/ml human IgG, cytokine IL-12 p70, migrated to the CCR7 ligand, and primed ϩ incubated for 10 min on ice, and incubated with primary mouse mAbs or CD8 T lymphocytes to become CTL at significantly higher levels biotinylated rabbit polyclonal Ab for an additional 15 min on ice. Cells than DDR1-nonactivated mDCs. The effects of DDR1 activation were washed with PBS and incubated with FITC-conjugated goat anti- appear to be caused by the recently described TGF-␤-activated mouse IgG or avidin-FITC for 15 min on ice. At the end of the incubation, ␮ protein kinase 1 (TAK1) binding protein 1 (TAB1)␤-mediated au- PI was added to each tube to give the final concentration of 100 M. The ␣ cells were washed with PBS andnddsu susubsequently analyzed by flow cytometry tophosphorylation of p38 MAPK (16) through DDR1b. This is using a FACScan (BD Biosciences,ciences,iences,ences, SSaSan Jose, CA). Dead cells, determined the first report demonstrating that DDR1 plays a role in the mat- by the incorporation ofPI, I, were gated oout. Results were processed using uration of DCs by activating its unique and distinct signaling path- CellQuest software(BD BDD Biosciences). To determine the effect of way. Our study also suggests a contribution of DDR1-collagen SB203580, iDCs wereereree pretreated with SB20SB2035SB203SB203580 or DMSO for 30 min. interaction to the development of adaptive immune responses.

AllogeneicMLRML Downloaded from Human T cellss werere puriﬁedpuriﬁe fromf PBMCs of healthy donorsdondo by magnetic Materials and Methods ϩ Reagents separationatiotionion using CD3C 3 microbeadsmicrrob (Miltenyi Biotec, Auburn,Aububururn CA). T cells (1 ϫ 101 5) were placedplacced in 96-well96 plates with increasinggnugn numbersn of DCs Rabbit polyclonal Abs against human DDR1 (C-20) or TAB1 (N-19 and (50(500–10,000500–10,000500–10,00,000 cells) in 2002 ␮l of complete medium. On dayd 4, 1 ␮Ci/well C-20), and mouse mAbs against human Shc, TNFR associated factor [3H]thymidineH]thymidine was added,adde and incorporation of radioactivityradioadioaoac was measured (TRAF) 6, and TAK1 were from Santa Cruz Biotechnology (Santa Cruz, after 15 h of incubation.incubati All tests were performededdin ini triplicate. To evaluate

CA). The production of rabbit polyclonal Abs specific for DDR1a or the effect of p38p 8M MAPK inhibitor, iDCs weree pretreatedprpre with SB203580 or http://www.jimmunol.org/ DDR1b was previously described (14). Mouse monoclonal anti-DDR11Ig IgM DMSO for 30 min. (513) was raised against the entire extracellular domain of DDR1 (17).17)17).7). Thee Ab was produced by growing the hybridoma cells (513GA12) inn protein-p MeasurementMeasu of endotoxin anddcycyt cytokinec concentrations free medium (Protein Free Hybridoma Medium; Life Technologies,ologlogiogies,s, Rock- ville, MD). The isotype of the Ab produced is IgM. ThissA Ab has thee ca- TheT concentrations of endotoxininnan anda cytokines were measured in the Lym- pacity to induce autophosphorylation of DDR1 (14). AAb biotinylatedotiny ed Ag- phokine Testing Laboratory,y,,Cl CClinical Services Program, Science Applica- purified rabbit polyclonal Ab against the N-terminalinalnalal regionion of humanuman tions International CorporaCorporationoratiratio Frederick (Frederick, MD), with the QCL- DDR1 (DMKGHFDPAKC) was a kind gift from TransTraTranrans Genicenic (Kumamoto,(Kumam(K oto, 1000 Chromogenic LALAL TestT kit (Cambrex, Walkersville, MD) and ELISA Japan). A mouse mAb against phosphotyrosinenee(4 (4G10)(4G10)) waswas fromfro UpstateUpsta kits (R&D Systems),ms),s), respectively.r The sensitivities of the assays were Biotechnology (Lake Placid, NY). Rabbit polyclonalpolpolyolyclonalclonal AbsAbs against phos-p Ͻ0.1–1.0 EU/mll fofor endotoxin, 5 pg/ml for IL-10, 0.5 pg/ml for IL-12 p70, phorylated or nonphosphorylated p38, p38p3 ␣, MAPK kinasenase (MKK) and 15.6 pg/mlml forfof IFN-␥. by guest on September 27, 2021 3/MKK6, activating transcription factororr 2 (ATF2),(ATF22), phosphorylatedphosphor ATF2, extracellular signal-regulated kinasee(E (ERK),(ERK), and phosphorylatedpho orylat ERK were from Cell Signaling Technologygyy(B (Beverly,( erly, MA). MouseMou mAbs against PhagocytosisPhagocyocytcyto assay CD80, CD83, CD86, HLA-DR,DR,R, andnddMH MHCM C class I molecules,mo PE-conju- DCsCs werew plated into 96-well plates (105 cells/well) in triplicate with 0.75 ␥ gated anti-CD8 mouse mAb,Ab,b, FITC-conjugatedFITC-conjugateTC-conjugaC-conj ted anti-IFN-anti mousemouse mAb,mAb, ␮m Fluoresbrite Yellow Green Carboxylate Microspheres (Polysciences, avidin-FITC, and a mouseusese monoclonalnoclonaloclonallonal IgM werewewer from BD PharMingen Warrington,W PA) at the final concentration of 0.0027% (v/v) in complete (San Diego, CA). APE-PE-c PE-conjugatedE-conjugatedd anti-humananti- CCR7 mouse monoclonal medium, and then cultured for8hat37°C in a humidified CO incubator. IgG was from R&D&DD Systems (Minneapolis,neapoliapo MN). Sheep anti-mouse or 2 3 5151 Control plates were incubated at 4°C. The percentage of phagocytic cells anti-rabbit IgGcoucoup coupledoupled with HRP, [ H]thymidineth and [ Cr]sodium chrochchr - was measured by flow cytometry using a FACScan. mate were fromomm Amersham Pharmacia Biotech (Piscataway, NJ). PPBS, RPMI 1640, recombinantecombinantcombinantombinant protein G-agarose (PGA), and TRIzol RReagent were from Invitrogen.ogen.gen.en. FCS was from HyClone Laboratories (Lo(L(Logan, UT). Chemotaxis assay LPS (Escherichia coliolilii LPS, 055:B5) was from Difco (Detro(Detroi(Detroit, MI). Para- Migration of DCs was assessed using a 48-well chemotaxis chamber (Neuro- formaldehyde, polymixininn B, human serum, and propidium iiodide (PI) were Probe, Cabin John, MD) with 5-␮m pore size polycarbonate filters as pre- from Sigma-Aldrich (St.Louis, ouis,uis, MO). Human recombinrecombinarecombinant GM-CSF, IL-4, viously described (21). Briefly, different concentrations of MIP-3␤/CCL19 TNF-␣, and macrophage inflammatoryflamammmmatory protein-3␤ (MIP-3((M ␤)/CCL19 were were placed in the wells of the lower compartment of the chamber, and 50 from PeproTech (Rocky Hill,NJ). J). SB203580 wawwas from Biochem-Nova- ␮l of cell suspensions (1 ϫ 106 cells/ml) were added to the wells of the biochem (San Diego, CA). Proteaseasese inhibitorinhibito mixture tablets, complete upper compartment. After a 90-min incubation at 37°C in a humidified CO mini, were from Roche (Indianapolis,s, IN). 2 incubator, the filters were removed and stained, and the cells migrating Preparation of human monocyte-derived DCs across the filter were counted using the Baioquant semiautomatic counting system. The results were presented as the number of cells per high power Human PBMC were isolated from leukapheresis preparations obtained by field. the Blood Bank, Clinical Center, National Institutes of Health (Bethesda, MD). The leukocyte-rich preparation was overlaid on Accu-prep in 50-ml Preparation of tumor cell lysate tubes, and the tubes were centrifuged at 800 ϫ g for 20 min at room temperature. PBMC fractions were collected, washed once with PBS at Confluent cultures of human melanoma cells (ATCC A375, HLA-A2ϩ; room temperature, and twice with RPMI 1640 containing 10% FCS (com- American Type Culture Collection (ATCC), Manassas, VA) were incu- plete medium) at 4°C, and resuspended in the same medium. Monocytes bated with 0.01% EDTA solution for 10 min, carefully detached with a cell were further purified by using iso-osmotic Percoll gradient. At this stage scraper, washed twice in PBS, and resuspended at a density of 5 ϫ 106 the purity of monocytes was higher than 90% (18). The cells (5 ϫ 106/ml) cells/ml in a serum-free medium. The cell suspensions were lysed by five were allowed to adhere to the surface of plastic plates. After a 5-h incu- cycles of freezing (methanol and dry ice for 5 min) and thawing (room bation at 37°C, nonadherent cells were removed, and remaining adherent temperature for 5 min) (22). For removal of cell debris, the lysate were cells (Ͼ95% of cells were positive for CD14 by flow cytometry analysis) centrifuged at 300 ϫ g for 10 min at 4°C. The supernatants were collected were subjected to the DC maturation protocol described previously (19, and passed through 0.2-␮m filters. Lysates were tested for the contamina- 20). Briefly, adherent cells were cultured in complete medium containing tion of endotoxin in the Lymphokine Testing Laboratory and were found to 50 ng/ml GM-CSF and 50 ng/ml IL-4 for 5 days, with cytokine added be free of any detectable level of endotoxin. 3522 ROLE OF DDR1 IN DC MATURATION

ϩ Generation of tumor lysate-pulsed mDCs and priming of CD8 anti-mouse IgG coupled with HRP. Peroxidase activity was visualized by T cells the ECL detection system. To detect phosphorylation of MAPKs, ATF2, or MKK3/6, iDCs and ϩ iDCs were generated from HLA-A2 donors as described above. The cells mDCs were activated with 513 Ab or control IgM for various times. Be- were incubated with 100 ␮g/ml melanoma cell lysate at 5 ϫ 105 cells/ml cause TNF-␣ is known to activate p38 MAPK (24), cells were washed six for4hat37°C, followed by TNF-␣ alone, TNF-␣ plus 513 Ab, or TNF-␣ times with PBS before activation to minimize the effect of TNF-␣. Twenty plus control IgM for an additional 48 h. microliters of cell lysates were directly mixed with 20 ␮l of sample buffer ϩ ϩ CD8 T cells were isolated from PBMCs of HLA-A2 donors by mag- and then analyzed. ϩ ϩ netic separation using CD8 microbeads (Miltenyi Biotec). CD8 T cells To determine the association of TRAF6, TAB1, or TAK1 with p38␣ (1.5 ϫ 106) were added to 5 ϫ 104 DCs that were matured in various MAPK, cell lysates of DCs or PMA-treated DDR1a- or DDR1b-overex- conditions, and they were cocultured for 7 days. IL-2 (40 IU/ml) was added pressing THP-1 cells (13) were subjected to immunoprecipitation with anti- on days 1 and 4. Nonadherent cells were collected (Ͼ95% were positive for p38 MAPK, p38␣ MAPK, or TRAF6 Ab, and coimmunoprecipitation of CD8 by flow cytometry) and restimulated by freshly generated TNF-␣- TRAF6, TAB1, TAK1, or p38␣ MAPK was evaluated using Abs against matured DCs at a ratio of 30:1 and incubated for 48 h. each protein. ϩ Intracellular staining of IFN-␥ in CD8 T cells Expression of dominant negativeat (DN)-TRAF6 ϩ The percentage of IFN-␥-producing CD8 cells was quantified by an in- A mammalian expression vectorectorctor for thet Flag-DN-TRAF6 (289–522) fu- tracellular staining technique (23). Briefly, nonadherent cells obtained after sion protein similar to thee previously reportedreporep construct (25) was prepared 48 h of restimulation were cultured in complete medium with brefeldin A as follows: a cDNA codingodingding for the C-terminalC-termiC-term portion of TRAF6 (289– (10 ␮g/ml) (Sigma-Aldrich) for 10 h. After incubation with brefeldin A, 522) was obtained byy RT-PCR using a full-lengthfull-lenfull-lefull-l human TRAF6 cDNA cells were incubated with PE-conjugated anti-CD8 mAb, washed with (I.M.A.G.E. 5272008;2008;008; ATCC) and a pair of primers:prprim forward primer 5Ј- PBS, resuspended in PBS containing 4% paraformaldehyde, and then in- Ј Ј

GCGAATTCTCAGAGGTCCGGAATTTCCAG-3TCAGAGGTCCGGAATTTCCAG-3CAGAGGTCCGGAATTTCCAG-3AGGT and reverse primer 5 - Downloaded from cubated for 20 min at 4°C. After washing with PBS, cells were resuspended CGAAGCTTCTATACCCCTGCATCAGTACTTCG-3TTCTATACCCCTGCATCAGTACTTCG-3TCTATACCCCTGCATCAGTACTTCG-TCTATACCCCTGCATCAGTACTTCGATACCCCTACCC Ј. PCR was per- in PBS containing 1% saponin and incubated with FITC-conjugated anti- formed byy 15 cyclesc les of denaturationdendenatu (1 min at 94°C), annealingannan (1 min at IFN-␥ mAbfor1hat4°C. The cells were washed in PBS containing 1% 62°C),),, and extensionextenssionn(30sa (30 s at 68°C).6 The PCR product was thenththet ligated into saponin, resuspended in PBS, and then analyzed by flow cytometry using the EcoEcE RI-HindIII siteeo of thet pCMVTag2 (Stratagene,ne,e, LaL Jolla, CA). a FACScan. DDR1b-overexpressing1b-o-overexpressinggT THP-1 cells were treated with 10 nM PMA for 121 h and then transfectedtransfect with 2 ␮g of the vectororrwi withw or without insert Cytotoxicity assay using EffeEffecteneene TransfectionTran Reagent (Qiagen,n, VVaValencia, CA) for 24 h, Forty-eight hours after re-stimulation, the cytotoxic activity of CD8ϩ T rinsrinsed with PBPBS, incubatedi for an additional 122h h in RPMI 1640 containing http://www.jimmunol.org/ ␮ cells was assessed in an 18-h 51Cr-release assay. Ten million melanomaanomanonoma 1% FCFCS,, and subsequentlys activated with 50 g/ml collagen for 60 min. A cells (target cells) in single-cell suspension were incubated with 1001000 ␮Ci totalal of 100,000,00000 cells were lysed, andnd tththe cell lysates were subjected to [51Cr]sodium chromate/106 cells for 1 h and washed five timessw withwi hP PBS. Western blotting. ϫ 3 The labeled melanoma cells (5 10 cells/well) were incubatedincuncubcubatedted withwi StatisStatistical analysis CD8ϩ T cells (effector cells) generated by coculturing withithth mDCs att E:T ratios ranging from 4:1 to 80:1 in 96-well plates. Afterran an 18-h8-h incubation,inc bation,ion Statistical analyses were performedperperferfo by Bonferroni/Dunn with One Way supernatants of each well were collected, and radioactivityoactactiactivityvityy was measuredme ured Factorical ANOVA. Datataaar area shown as the mean Ϯ SD. with a gamma counter (1480 WIZARTM 3“; PerkinElmer,rkinkinEinElmer,lmmer,, DownerDownw Grove,Grovove, IL). Specific lysis was calculated by the formula:mulaulaula: specificspecifific 51Cr-releaseC ϭ ResultsResults [(mean experimental cpm Ϫ mean spontaneoustaneaneoneousus cpm)/(meancpm) mean maximumma Expression offDfDD DDR1aD and DDR1b is induced during DC by guest on September 27, 2021 cpm Ϫ mean spontaneous cpm)] ϫ 100%,0%,0%%, innwwhich sponspontaneousneou release represents cpm in supernatants fromwellwel wellsells containingcontainining target cellsc with me- maturationn dium only, and maximum releaseere representsrepresents cpm in supernatantssupe from To studyudydy a potential role of DDR1 in collagen-mediated DC mat- wells containing target cells in mediummedimedediummwi withw 2% Triton X-100.X At the same uratiouration,ationtion we first examined the expression of DDR1 in DCs. We time, the supernatants from thehee18 118-h-h cocultucoculturecocu ure of unlabeledunlabe melanoma cells with effector cells (1:40)werewer erecollected ected anda subsubjectedubject to IFN-␥ ELISAELISA i inn incuincincubatedncu monocytes in the presence of IL-4 and GM-CSF for 5 the Lymphokine TestingnggLa LLaboratory.atory.y. DaData were presented as the mean Ϯ ddays to produce iDCs, and for an additional 2 days in the presence SD from the data offthre thrthreehree independentdent experiments.experi of IL-4, GM-CSF, and TNF-␣ to produce mDCs. As shown in Fig. Western blotanalana analysisnalysis 1A, a high level of DDR1a was already expressed on day 1. The level of DDR1a reached a peak on day 2 and gradually decreased To detect DDR1R11 isoforms expressed by DCs, cells were harvested ono each thereafter. In contrast, the level of DDR1b gradually increased and day of the maturationrationationtion process. Cells were washed three times withw PBS, and 1 ϫ 107 cells were lysed on ice for 20 min in 1 ml ofo lysis buffer reached the highest level on day 7. Because total DDR1 levels containing 50 mM HEPES,EPES,PES, 150 mM NaCl, 1% Triton X-100,X-X-1 10% glyc- were similar between days 3 and 7, it appears that DDR1a is the erol, and a mixture of proteaseoteasetease inhibitors. The lysates wwere spun, and the dominant isoform during the early stage of DC maturation, supernatants were collecteddan and stored at Ϫ80°C untilununtu use. The samples whereas DDR1b becomes the dominant isoform in mDCs. By flow were incubated with ϳ20 ␮l offfpa packed PGA for1hatr11h 4°C. After centrif- ugation, supernatants were collected,ted,ed,d, mixed withwitwi 1 ␮g/ml polyclonal anti- cytometry analysis, we confirmed cell surface expression of DDR1 human DDR1 Ab (C-20), and incubatedatedteded for1hatr1r 4°C. Twenty microliters on both iDCs and mDCs, but not on monocytes (Fig. 1B). There of PGA were then added, and the samplesleses werew incubated for an additional was no significant difference in the percentage of cells expressing 12 h. IgG-coupled PGA was washed with washing buffer containing 50 cell surface DDR1 between iDCs and mDCs (Fig. 1C). mM HEPES, 150 mM NaCl, 0.1% Triton X-100, and 10% glycerol buffer three times, and 20 ␮l of double-strength sample buffer (20% glycerol, 6% Activation of DDR1 amplifies phenotypic maturation of DCs SDS, 10% 2-ME) was added. Bound proteins were eluted by boiling for 10 min, analyzed on 8% polyacrylamide gels by SDS-PAGE, and transferred To determine the role of DDR1 in DC maturation, we treated iDCs electrophoretically to nitrocellulose membranes at 150 mA for1hbya with either 513 agonistic anti-DDR1 Ab (IgM) or control IgM for semidry system. The membranes were incubated with rabbit IgGs that rec- 2 days in the presence of GM-CSF and IL-4. We then evaluated the ognize only DDR1a, only DDR1b, or both forms of DDR1 (C-20), fol- expression of cell surface molecules, including CD80, CD83, lowed by sheep anti-rabbit IgG coupled with HRP. Peroxidase activity was visualized by the ECL Detection System (Amersham Pharmacia Biotech). CD86, HLA-DR, CCR7, and MHC class I molecules by flow cy- To analyze the kinetics of DDR1 autophosphorylation, 1 ϫ 107 iDCs or tometry and compared them with that of TNF-␣-induced mDCs. TNF-␣-induced mDCs were plated on dishes, serum-starved in RPMI 1640 As shown in Fig. 2, A and B, DDR1 activation with 513 Ab sig- containing 1% FCS for 10 h, and subsequently activated with 513 agonistic nificantly up-regulated cell surface expression of CD83 ( p Ͻ 0.01) anti-DDR1 IgM (5 ␮g/ml) or control IgM (5 ␮g/ml) for various times. Cell Ͻ lysates were prepared, subjected to immunoprecipitation with anti-DDR1 and CD86 ( p 0.01), but not of CD80, HLA-DR, CCR7, or MHC Ab (C-20), and tyrosine-phosphorylation of DDR1 was analyzed by West- class I molecules on iDCs. The level of CD83 expressed on 513 ern blotting using mouse monoclonal anti-phosphotyrosine IgG and sheep Ab-treated iDCs was similar to that expressed on TNF-␣-induced The Journal of Immunology 3523

capacity to stimulate allogeneic MLR. Our data confirmed that iDCs only weakly stimulate allogeneic MLR, and activation of DDR1 with 513 Ab had no effect (Fig. 3A). mDCs induced with TNF-␣ or LPS markedly stimulated allogeneic MLR in a cell concentration-dependent manner. TNF-␣ and LPS had an additive effect on the functional maturation of DCs. It was of great interest that activation of DDR1 with 513 Ab markedly increased the capacity of mDCs induced with TNF-␣ ( p Ͻ 0.001), LPS ( p Ͻ 0.001), or TNF-␣ plus LPS ( p Ͻ 0.001) to stimulate allogeneic MLR. As shown in Fig. 3B, the release of IL-12 p70 from LPS- induced mDCs was also up-regulated 2- to 3-fold by activation of DDR1 ( p Ͻ 0.001) without affecting the release of IL-10. Acti- vation of iDC with 513 Abbalba alone did not induce the release of either IL-12 or IL-10 (datadataatata not shshoshown). We studied the biologicalologicallogical significancesignificsignifica of CCR7 up-regulation on 513 Ab-activatedatedteded mDCs by evaluatingevaluatevaluatievaluatin the migration of cells toward MIP-3␤/CCL19, a ligand for CCRCCR7.CC As previously re-

ported (26–28),–28),28), iDCs did not respond to MIP-3␤/CCL19, whereas Downloaded from TNF-␣-inducedinducednducededmDCs dose-dependentlydo migratedmigratemigrat toward MIP- 3␤/CCL19.CL19.L19..mD mDCsDCss inducedinduc with a combination of TNF-TN ␣ and 513 Abbm migratedgrated towardardM MIP-3MIP ␤/CCL19 at signiﬁcantlysigniﬁcantlntly higher levels thanthathhan thosethosose induced withwwi TNF-␣ alonealone (F(Fig.ig. 3 C)). To furtherfu er evaluevaluate the effect of DDR1actacti activationac on the func-

tionaltiono maturationmatur io of DCs, we examineddDCDC DC-dependentD priming of http://www.jimmunol.org/ MHC classlass I-restricted CD8ϩ T cells.cellsells.lls. We prepared iDCs from monocytesonoc of HLA-A2ϩ donorspulpuls pulsedpu with cell lysates of HLA- A2ϩ humanh melanoma cells,and an then induced their final matura- tiontii with TNF-␣ in the presencepresensenenc of 513 Ab or control mouse IgM. FIGURE 1. Expression of DDR1 in DCs. A, Detectionctiotionon of DDR1aDD 1a and These tumor Ag-loadeddm mDCs were used to prime HLA-A2ϩ DDR1b by Western blotting. Ten million monocytestesess werewere platedplate ini each CD8CD8ϩ T cells. Wefirst firsrst evaluated an Ag-specific response of the dish and incubated for 5 days in the presence of 500 ng/mlng/mml GM-CSFGM-CC and 505 ϩ primedprimed CD8CD8 TTcecelcell cells by detecting intracellular IFN-␥ after re- ng/ml IL-4 to obtain a population of immatureemoem monocyte-derivednocyte--derivedi DCs. For priming by tumortumomor Ag-loaded mDCs induced with TNF-␣ alone. As terminal maturation, iDCs were treated withiththh TNF-TNF-␣ (50 ng/ml)n /ml) fromfro days by guest on September 27, 2021 ϩ 5 to 7. Cells were collected each day, andnd cellellll lysateslyl were prepared.ep The shown inFig. g. 4A, the percentage of IFN-␥- positive CD8 T cells lysates were subjected to immunoprecipitationecipcipitationtationtion with anti-DDR1a -DDR Ab (C-20), primed by mDCsm that were induced with 513 Ab plus TNF-␣ was and bound proteins were analyzed.zed.ed.d. Membranesembranesmbranes were probedp with either approximatedapproxioxim 3-fold higher than that of the cells primed by mDCs anti-DDR1 (C-20), anti-DDR1a,1a,a, ooranti-DD anti-DDR1bnti-DDDDR1bR1b Ab. RepresentativeReR data of inducedinduduc with TNF-␣ alone. three experiments with cellsellsllsls fromromm three differentdiffeferent donors are shown. B, We next compared their tumor cytotoxic activity using a 51Cr Expression profiles ofcell ellll ssurfacece DDR1DDR on DCs by flow cytometry. Rep- C resentative data of threehreereeee experimentsts with cellsc from three different donors release assay. As shown in Fig. 4 , CTLs generated with mDCs ␣ are shown. C, Percentagesercentagesrcentagescentages of DDR1-positiveposit iDCs and mDCs. Data aarear induced with 513 Ab plus TNF- killed melanoma cells at signif- shown as meansnss Ϯ SD of three experiments with cells from three diffdifferentdiffeffer icantly higher levels than CTLs generated with mDCs induced donors. with TNF-␣ alone. The concentrations of IFN-␥ in the supernatants of CTLs generated with mDCs induced with 513 Ab plus TNF-␣ were also significantly higher than those of CTLs gener- mDCs, whereas the levelsevelsvelsels of CD86 on 513 Ab-treatedAb-treAb-trea iDCs were ated with mDCs induced with TNF-␣ alone. None of the DC pop- lower. When 513 Abwas as used in combinaticombinatcombinatiocombination with 50 ng/ml ulations or tumor cells released measurable IFN-␥ (data not TNF-␣ or 1 ␮g/ml LPS, 513133 Ab further upup-up-regulated TNF-␣-in- shown). DDR1 activation did not affect the phagocytic activity of duced expression of CD80 ( p Ͻ 0.01),,C CD83C ( p Ͻ 0.05), CD86 DCs (data not shown). Taken together, our results indicate that ( p Ͻ 0.01), HLA-DR ( p Ͻ 0.01),),,CC CCR7CCC ( p Ͻ 0.01), and MHC mDCs produced with 513 Ab plus TNF-␣ are capable of priming Ͻ Ͻ ϩ class I molecules ( p 0.01, p 0.05). The 513 Ab preparation we CD8 T cells more efficiently than mDCs produced with TNF-␣ used contained no detectable level of endotoxin, and the addition alone, and this increased priming effect is probably caused by the ␮ of 50 g/ml polymixin B had no effect (Fig. 2C). As shown in Fig. up-regulated expression of MHC class I molecules rather than up- 2, D and E, the effects of 513 Ab were more evident with lower regulated uptake of tumor Ags by DDR1-activated mDCs. concentrations of TNF-␣ or LPS. These results indicate that activation of DDR1 by itself induces partial phenotypic maturation of DCs and is not sufficient to induce full maturation of DCs; how- Activation of DDR1 induces phosphorylation of p38 MAP ␣ ever, activation of DDR1 markedly amplifies TNF- - and LPS- kinase, but not MKK3/6, in DCs induced phenotypic maturation of DCs. We recently reported that the activation of the DDR1b isoform, but Activation of DDR1 amplifies functional maturation of DCs not the DDR1a isoform, facilitated the differentiation of THP-1 The most important function of DCs is to present Ags to naive T cells and primary macrophages. Collagen activation of DDR1b cells. We treated iDCs with 513 Ab or control IgM for 2 days in induced its autophosphorylation, followed by the recruitment of the presence or absence of TNF-␣ and/or LPS, and evaluated their the adaptor protein Shc to the juxtamembrane domain of the re- 3524 ROLE OF DDR1 IN DC MATURATION Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021

FIGURE 2. Effects of DDR1 activationctivationtivation on thetth expression of CD80, CD83, CD86, HLA-DR, CCR7, and MHC class I molecules on DCs. Monocyte- derived iDCs were treated for 2 days with 513551 agonistic anti-DDR1Ab (5 ␮g/ml) and control IgM (5 ␮g/ml) in the presence or absence of 50 ng/ml TNF-␣ or 1 ␮g/ml LPS. The expression of CD80,800 CD83, CD86, HLA-DR, CCR7, and MHC class I molecules was analyzed by flow cytometry. A, Representative profiles of three individual experiments with almost identical results are shown. B, The percentages of CD80-, CD83-, CD86-, HLA-DR-, CCR7-, or MHC class I-positive cells were quantified. C, Effect of polymixin B on 513 Ab-induced amplification of CD80, CD83, CD86, HLA-DR, CCR7, and MHC class I molecule expression. A total of 50 ␮g/ml polymixin B was used. D and E, Different concentrations of TNF-␣ or LPS were used in combination with 5 ␮g/ml 513 Ab to induce DC maturation, and the percentages of CD80-, CD83-, CD86-, HLA-DR-, CCR7-, or MHC class I Ag-positive cells were .p Ͻ 0.05, n ϭ 3 ,ءء .p Ͻ 0.01, n ϭ 3 ,ء .quantified. Statistical analysis was performed by Bonferroni/Dunn with One Way Factorial ANOVA ceptor and subsequent activation of p38 MAPK in differentiated autophosphorylation and the recruitment of Shc in response to 513 THP-1 cells. Interestingly, activation of p38 MAPK was indepen- Ab or control IgM. In both iDCs (Fig. 5A) and mDCs (Fig. 5B), dent of its upstream kinases, MKK3 and 6 (14). These previous autophosphorylation of DDR1 was detected at 30 min (lane 3), and observations led us to the hypothesis that DDR1-mediated ampli- DDR1 remained phosphorylated at 120 min (lane 6). Treatment fication of DC maturation is also regulated by the p38 MAPK with control IgM did not induce autophosphorylation of DDR1 in pathway activated through DDR1b, independent of MKK3 and 6. either iDCs or mDCs (lanes 1–6). In addition to tyrosine phos- To test this hypothesis, we first evaluated the kinetics of DDR1 phorylated DDR1, we detected another tyrosine-phosphorylated The Journal of Immunology 3525 Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021

FIGURE 2. Continued.

protein, Shc. DDR1 remained phosphorylated in mDCs 8 h after was also phosphorylated with similar kinetics. Phosphorylation of 513 Ab activation (data not shown); however, coimmunoprecipi- p38 MAPK and ATF2 was also detected in 513 Ab-activated TNF- tation of Shc was seen only between 30 and 90 min, identical with ␣-induced mDCs with similar kinetics, but the levels of phosphor- that observed in differentiated DDR1b-overexpressing THP-1 cells ylation were much greater in mDCs than in iDCs (Fig. 6B, lanes (14). The recruitment and phosphorylation of Shc were signiﬁ- 9–12). In contrast to 513 Ab, control IgM did not induce phos- cantly higher in mDCs than in iDCs (Fig. 5C). phorylation of p38 MAPK (lanes 1–6). Phosphorylation of other We next examined whether p38 MAPK could be phosphory- MAPKs, such as ERK1, ERK2, or MKK3/6, was not induced in lated in DCs upon activation with 513 Ab. As shown in Fig. 6A, response to 513 Ab (Fig. 5, C and D). These results indicated that p38 MAPK was phosphorylated 30 min after activation of iDCs activation of DDR1 causes phosphorylation of p38 MAPK inde- with 513 Ab, and it remained phosphorylated after 120 min (lanes pendently of MKK3 and 6, most likely through activation of 9–12). The transcriptional factor ATF2, a substrate of p38 MAPK, DDR1b. 3526 ROLE OF DDR1 IN DC MATURATION Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021

FIGURE 3. Effects of DDR1 activationvationation ono the functional maturation of DCs. A, iDCs were incubated in the presenceesense of GM-CSF (50 ng/ml) and IL-4 (50 ng/ml) for 2 days with various combinations of TNF-␣ (50 ng/ml), LPS (1 ␮g/ml), 513 agonistic anti-DDR1 Ab, or control IgM. The resultant cell populations were used to evaluate their capacity to stimulate allogeneic FIGURE 4. Effects of DDR1-activation on the generation of tumor-spe- MLR. Data were analyzed by Bonferroni/Dunn with One Way Factorial cific CD8ϩ CTLs. A, CD8ϩ T lymphocytes (HLA-A2ϩ) were cocultured with Ͻ ϭ ء ANOVA. , p 0.001, n 3. B, iDCs were incubated in the presence of tumor lysate-pulsed mDCs (HLA-A2ϩ) for 7 days. After restimulation with GM-CSF (50 ng/ml) and IL-4 (50 ng/ml) for 2 days with various combi- tumor lysate-pulsed mDCs, the presence of IFN-␥ was analyzed by flow cy- ␮ ␮ nations of LPS (1 g/ml), 513 anti-DDR1 Ab (5 g/ml), and control IgM tometry using an intracellular staining technique. Representative profiles of ␮ (5 g/ml). Culture supernatants were collected, and cytokine levels were three individual experiments with almost identical results are shown. B, The measured by ELISA. Data were analyzed by Bonferroni/Dunn with One percentages of IFN-␥-positive CD8ϩ T cells were quantified. C, 51Cr release -p Ͻ 0.0001, n ϭ 8. C, iDCs were incubated in assay was performed with 51Cr-labeled malignant melanoma cells (HLA ,ء .Way Factorial ANOVA the presence of GM-CSF (50 ng/ml) and IL-4 (50 ng/ml) for 2 days with A2ϩ), and CTLs were generated using various mDC preparations. Data were ,p Ͻ 0.01 ,ء .various combinations of TNF-␣, 513 agonistic anti-DDR1 Ab, or control analyzed by Bonferroni/Dunn with One Way Factorial ANOVA IgM. The numbers of migrated cells in response to MIP-3␤/CCL19 were n ϭ 3. D, Release of IFN-␥ from CTLs generated using different mDC prep- counted. Data were analyzed by Bonferroni/Dunn with One Way Factorial arations was quantified by ELISA. Data were analyzed by Bonferroni/Dunn .p Ͻ 0.01, n ϭ 3 ,ء .p Ͻ 0.001, n ϭ 3. with One Way Factorial ANOVA ,ء .ANOVA The Journal of Immunology 3527 Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021

FIGUREF 6. Phosphorylation of p38 MAPK, ATF2, but not ERK or MKK3/6, in iDCs or mDCs in response to 513 Ab. Ten million iDCs or mDCs were plated on each dish and serum-starved in RPMI 1640 containing 1% FCS for 10 h. A total of 5 ␮g/ml 513 anti-DDR1 Ab or control IgM was subsequently added, and cell lysates were prepared after incubation for additional times. Twenty microliters of cell lysates were directly mixed with 20 ␮l of sample buffer and subjected to Western blotting. A, Mem- branes from iDCs were blotted with Abs specific for phospho-p38 MAPK, p38 MAPK, phospho-ATF2, or ATF2. B, Membranes from mDCs were blotted with Abs specific for phospho-p38 MAPK, p38␣ MAPK, phospho- ATF2, or ATF2. C, Membranes from mDCs were blotted with Abs specific for phospho-ERK or ERK. D, Membranes from mDCs were blotted with Abs specific for phospho-MKK3/6 or MKK3/6. Representative data of FIGURE 5. DDR1 phosphorylation and the recruitment of Shc to DDR1 three individual experiments using cells from three different donors are in immature and mDCs in response to 513 Ab. Ten million iDCs or mDCs shown. were serum-starved in RPMI 1640 containing 1% FCS for 10 h on culture dishes and then incubated for various times in the presence of 5 ␮g/ml 513 anti-DDR1 Ab or control IgM. Cell lysates were prepared and subjected to immunoprecipitation with anti-DDR1 Ab (C-20). Bound proteins were an- Activation of DDR1b induces the formation of TRAF6/TAB1␤/ alyzed by Western blotting. A, Membranes prepared from iDCs were p38␣ protein complex and subsequent p38␣ probed with either anti-phosphotyrosine Ab, anti-DDR1 Ab (C-20), or anti- Shc Ab. Arrows indicate phosphorylated DDR1 or Shc. B, Membrane pre- autophosphorylation pared from mDCs was probed with either anti-phosphotyrosine Ab, anti- It was recently reported that the interaction of p38␣ MAPK, but DDR1 Ab (C-20), or anti-Shc Ab. Arrows indicate phosphorylated DDR1 not other forms of p38 MAPK, with TAB1 leads to autophosphor- or Shc. C, Cell lysates of iDCs or mDCs prepared from the same donor ␣ were simultaneously subjected to immunoprecipitation, and the recruit- ylation and activation of p38 MAPK independently of MKKs, ment of Shc to DDR1 was compared. Representative data of three indi- and these proteins could form a protein complex with TRAF6 (16). vidual experiments using cells from three different donors are shown. To examine a potential involvement of this alternative pathway in 3528 ROLE OF DDR1 IN DC MATURATION

DDR1b-mediated p38 MAPK activation, we used differentiated two phosphorylation events. As shown in Fig. 7A, p38 MAPK was DDR1b-overexpressing THP-1 cells as a model (14). We ﬁrst eval- phosphorylated in response to collagen (lane 2), and it was almost uated whether DDR1b-mediated p38 MAPK phosphorylation was completely inhibited by SB203580 (lane 4). DMSO had no effect caused by autophosphorylation. Because SB203580 blocks auto- (lane 6). Thus, DDR1b-mediated activation of p38 MAPK in dif- phosphorylation of p38␣ MAPK, but not transphosphorylation by ferentiated THP-1 cells was indeed caused by the autophosphor- MKKs (16), this inhibitor enabled us to discriminate between the ylation of p38␣ MAPK. Downloaded from http://www.jimmunol.org/ by guest on September 27, 2021

FIGURE 7. DDR1b-mediated autophosphorylation of p38␣ MAPK and its association with TRAF6 and TAB1␤ in differentiated THP-1 cells. A, DDR1b-overexpressing cells were incubated with PMA for 12 h, treated with SB203580 (10 ␮M) or DMSO for 30 min, and then activated with collagen. Cell lysates were subjected to immunoprecipitation with anti-p38 MAPK Ab, and the phosphorylation of p38 MAPK was analyzed by Western blotting. B, Differentiated DDR1a- or DDR1b-overexpressing THP-1 cells were activated with collagen for various times. Cell lysates were subjected to immunoprecipitation with anti-p38 MAPK Ab, and coimmunoprecipitation of TRAF6, TAB1, and TAK1 was analyzed by Western blotting with Ab speciﬁc for each protein. C, Differentiated DDR1b-overexpressing THP-1 cells were activated with collagen for 60 min. Cell lysates were subjected to immunoprecipitation with anti-TRAF6 Ab, and coimmunoprecipitation of p38␣ was analyzed by Western blotting. D, Differentiated DDR1b-overexpressing THP-1 cells were activated with collagen for various times. Cell lysates were subjected to immunoprecipitation with anti-TRAF6 Ab, and coimmunoprecipitation of TAB1 isoforms was analyzed by Western blotting. E, Differentiated DDR1a- or DDR1b-overexpressing THP-1 cells were activated with 513 Ab for various times. Cell lysates were subjected to immunoprecipitation with anti-p38␣ MAPK Ab, and coimmunoprecipitation of TRAF6, TAB1, and TAK1 was analyzed by Western blotting with Ab speciﬁc for each protein. Representative results of two to three individual experiments with similar results are shown. The Journal of Immunology 3529

We next examined the association of p38 MAPK with TRAF6 association of p38␣ MAPK with TRAF6 and TAB1␤. As shown in and TAB1 by immunoprecipitating p38 MAPK from cell lysates of Fig. 7E, direct activation of DDR1b with 513 Ab induced the collagen-activated, differentiated DDR1b-overexpressing THP-1 association of p38␣ MAPK with TRAF6 and TAB1␤. cells and searching for these proteins by Western blotting. As We evaluated the functional role of TRAF6 in DDR1b-mediated predicted, TRAF6 was coimmunoprecipitated with p38 MAPK p38 MAPK activation by overexpressing a DN form of TRAF6 in collagen-activated cells (Fig. 7B, lanes 9–12). Coimmunopre- (25) in differentiated DDR1b-overexpressing THP-1 cells (Fig. cipitation of p38␣ MAPK with TRAF6 was confirmed by using 7F). Expression of DN-TRAF6 completely abrogated collagen- anti-TRAF6 Ab for immunoprecipitation and anti-p38␣ MAPK induced p38 MAPK phosphorylation (Fig. 7G, lane 4), indicating Ab for immunoblotting (Fig. 7C). TAB1 was also coimmunopre- that TRAF6 plays a critical role in DDR1b-mediated activation of cipitated with p38 MAPK (Fig. 7B) and with TRAF6 (Fig. 7D). p38 MAPK. Taken together, our results indicate that DDR1b-me- The presence of TAB1 in the protein complex was readily detected diated activation of p38 MAPK in differentiated THP-1 cells was with an Ab against the N terminus of TAB1, but surprisingly not caused by p38␣ autophosphorylation, and it was regulated through with an Ab against the C terminus of TAB1, despite the fact that the TRAF6/TAB1␤/p38␣ signalinggn cascade. Ab that specifically TAB1 recognized by these two Abs was present in these cells (data recognizes TAB1␤ is currentlyrentlyently nnot available. not shown). Furthermore, TAK1, which is known to bind to TAB1 Finally, we used mDCsDCsCs to detedetermdeterdetermine whether 513Ab-induced and to be activated by TAB1 (29, 30), was not detected in this p38 MAPK activationiononn detected in mDmDCmDCs was also caused by the complex (Fig. 7B). Recently, Ge et al. (31) cloned a splice variant TAB1-mediatedp38 38␣ autophosphorylation.autophosphorylatiationatio As shown in Fig. 8A, of TAB1, called TAB1␤. The C-terminal 69-aa residues of TAB1 p38 MAPK wasas phosphorylated in responserespons to 513 Ab (lane 2), are replaced by an unrelated 27-aa sequence in TAB1␤, and and it wass almostosttco completelycomp inhibited by SB203580SBS (lane 4). Downloaded from TAB1␤ no longer binds or activates TAK1. Thus, our data DMSO hadad no effecte (lanelaane 6). Activation ofDDR DDR1DR with 513 Ab strongly suggest that the TAB1 detected in the p38 MAPK com- inducedceded associationssociaationon of p38p MAPK with TRAF6 (Fig.(Fig 8, B and C, plex was TAB1␤, explaining the absence of TAK1 in the protein lanesneses 3–6) andTAB1 TAB1 (F(Fig. 8, D, lanelaness 3– 3–66, andnd E, lane 3)in complex. To confirm that these results were the consequence of mDCs.Cs. TAB1T includedincludd in this protein complex reacted with Ab DDR1b activation, we activated the cells with 513 Ab. We also against theth N terminus,termi but not against theeC CCt terminus, of TAB1, used a p38␣ MAPK-specific Ab for immunoprecipitation to detectectct despitedes the factact that TAB1 recognizeddbydb by these two Abs was http://www.jimmunol.org/ by guest on September 27, 2021

FIGURE 8. DDR1-mediated autophosphorylationosp of p38 MAPK and its association with TRAF6 and TAB1 in mDCs. A, mDCs induced with TNF-␣ (50 ng/ml) were pretreated with 10 ␮M SB203580 or DMSO for 30 min, rinsed with PBS, and activated with 513 anti-DDR1 Ab. Cell lysates were prepared and subjected to immunoprecipitation with anti-p38 MAPK, and phosphorylation of p38 MAPK was analyzed by Western blotting. B, mDCs were activated with 513 anti-DDR1 Ab for various times, and cell lysates were prepared. The lysates were subjected to immunoprecipitation with anti-p38 MAPK Ab, and coimmunoprecipitation of TRAF6 was analyzed by Western blotting with Ab specific for TRAF6. C, mDCs were activated with 513 anti-DDR1 Ab for various times, and cell lysates were prepared. The lysates were subjected to immunoprecipitation with anti-TRAF6, and coimmunoprecipitation of p38 MAPK was analyzed by Western blotting with Ab specific for p38 MAPK. D, mDCs were activated with 513 anti-DDR1 Ab for various times, and cell lysates were prepared. The lysates were subjected to immunoprecipitation with anti-p38 MAPK Ab, and coimmunoprecipitation of TAB1 was analyzed by Western blotting with Abs specific for the N terminus or C terminus of TAB1. E, Cell lysates were prepared from TNF-␣-induced mDCs before and after a 60-min activation with 513 anti-DDR1 Ab. The lysates were subjected to immunoprecipitation with anti-p38 MAPK Ab, and coimmunoprecipitation of TAB1 was analyzed by Western blotting with Abs specific for the N terminus or C terminus of TAB1. Cell lysates were also prepared from 1 ϫ 107 unstimulated human PBMC and subjected to immunoprecipitation with anti-TAB1 Ab (C terminus). The immunoprecipitated proteins were used as a control for TAB1 detection (lane 1). F, Cell lysates were prepared from TNF-␣-induced mDCs before and after a 60-min activation with 513 anti-DDR1 Ab. The lysates were subjected to immunoprecipitation with anti-p38 MAPK Ab, and coimmunoprecipitation of TAK1 was analyzed by Western blotting with Ab specific for TAK1. Cell lysates were also prepared from 1 ϫ 107 unstimulated human PBMC and subjected to immunoprecipitation with anti-TAK1 Ab. The immunoprecipitated proteins were used as a control for TAK1 detection (lane 1). Representative data of at least two experiments are shown. 3530 ROLE OF DDR1 IN DC MATURATION

FIGURE 9. Effects of SB203580 on phenotypic and functional maturation of DCs. Monocyte-derived iDCs were pretreated with SB203580 or DMSO for 30 min and then incubated for 2 days in the presence of GM- CSF (50 ng/ml), IL-4 (50 ng/ml), and TNF-␣ (50 ng/ ml), with 5 ␮g/ml 513 agonistic anti-DDR1Ab or control IgM. A, The expression of CD80, CD83, CD86, HLA-DR, CCR7, and MHC class I molecules was analyzed by flow cytometry. B, Ag-presenting capacity of Downloaded from each cell population was evaluated by allogeneic MLR. Data were analyzed by Bonferroni/Dunn with One Way ,p Ͻ 0.01 ,ءء ;p Ͻ 0.001, n ϭ 3 ,ء .Factorial ANOVA n ϭ 3. http://www.jimmunol.org/ by guest on September 27, 2021 present in mDCs (data not shown).)..TATAK1 TAK1was w not detedetected in this tact sensitizesensitizersizezer such as dinitrochlorobenzene or NiCl2 (39). Mat- complex (Fig. 8F). Thus, the signalingignagnalinggna ing events dedetectedected in 513 Ab- urationnof of DCsD can also be influenced by components of the ECM. activated mDCs are identicalall withwith thatthhhat in collagecollagen-activated, dif- Collagen,Collaglageage such as type I collagen, has been reported to induce the ferentiated DDR1b-overexpressingexpxpressingxpressinging THPTHP-1T P-1 cellscells. maturationmamatu of murine DC precursors or human monocyte-derived ␤ iDCsiD independent of the classical collagen receptors, 1 integrins Phenotypic and functionalnctioctiotional maturationaturationra of DDCs is dependent on (5, 7), suggesting the presence of an as yet uncharacterized recep- p38 MAP kinase tor involved in the interaction of iDCs with collagen. Suri and To evaluatethe he involvement of the p38 MAPK pathway in DDRDDDDR1- Austyn (9) investigated the mechanisms involved in collagen-me- mediated up-regulation-regulationregulationegulation of CD80, CD83, CD86, HLA-DR, CCCR7, diated DC maturation and proposed that LPS contamination might and MHC class I expression, we pretreated iDCs with SB203580SBS at least partially explain this phenomenon, because collagen prep- before inducing theireirirr mmaturation with TNF-␣ alone oro TNF-␣ plus arations free of LPS failed to induce DC maturation. In the present 513 Ab. As shown innFi Fig.Fig 9A, SB203580 almosalmostmostost completely in- study, we have identified the expression of the nonintegrin colla- hibited TNF-␣-inducedexpression xpressionpression of CD80, CCDCD83, CD86, HLA- gen receptor DDR1, in human monocyte-derived DCs. By using an DR, CCR7, and MHC class I expression and itsi amplification with agonistic mouse monoclonal anti-DDR1 Ab, we have demon- 513 Ab. Stimulation of allogeneicneiceic MLR byb mDCs produced with strated that activation of DDR1 amplifies the phenotypic and func- either TNF-␣ alone or TNF-␣ plususs51 51351 Ab was also almost com- tional maturation of iDCs induced with TNF-␣ or LPS. Thus, a pletely abrogated by SB203580 (Fig. 9B). Thus, our data indicate combination of collagen and LPS, a formula found in commer- that TNF-␣-induced DC maturation and its amplification by DDR1 cially available collagen preparations, produces highly mDCs in a ␤ activation was dependent on the p38 MAPK pathway. 1 integrin-independent manner, providing a mechanism for the previously disputed collagen-mediated DC maturation. Discussion Activation of DDR1 alone is not sufficient to induce full matu- In comparison with monocytes, macrophages, or B cells that have ration of iDCs into mDCs. However, when iDCs were activated a limited capacity to present Ags to T cells, DCs are potent, pro- with 513 Ab along with TNF-␣ or LPS, resulting mDCs expressed fessional APCs, and play a central and unique role in the genera- high levels of MHC class I and class II molecules and costim- tion of primary T cell responses. Among DCs, mDCs, but not ulatory molecules, including CD80, CD83, and CD86. As a iDCs, present Ags to T cells at an exceptionally high level; there- consequence, these highly mDCs stimulated allogeneic MLR at a fore, maturation of DCs is crucial for the initiation of immunity significantly higher level than mDCs produced without DDR1- (1). A wide variety of inflammatory signals induce DC maturation. activation. mDCs use MHC class I molecules to present foreign These signals include LPS (32–34), cytokines such as TNF-␣ and Ags, such as tumor Ags, to CD8ϩ T cells (40). In our study, CD8ϩ IL-1␤ (32, 35), CD40 ligand (36, 37), viral dsRNA (38), and con- T cells primed by Ag-loaded DDR1-activated mDCs exhibited The Journal of Immunology 3531

3-fold higher CTL activity, as determined by the 51Cr release In addition to DDR1b, DDR1a is also expressed during DC assay, than those generated by mDCs without DDR1-activation. maturation. DDR1a expression was rapid, reached a peak on day 2, One of the major issues in the field of anti-tumor immunity is how and gradually decreased from day 3 as the cells became more to generate an efficient tumor Ag-specific immune response. It is mature. Our previous findings using DDR1a-overexpressing clear that CD8ϩ CTLs are the most potent anti-tumor effector cells THP-1 cells (13) suggest that cells in an early stage of DC matu- and the subject of many studies (41). Our results strongly suggest ration have the greater capacity to migrate through the ECM than that highly mDCs produced by activating DDR1 with DDR1 terminally matured DCs. It was previously reported that the adap- agonists, such as agonistic anti-DDR1 Ab, in combination with tor protein fibroblast growth factor receptor substrate 2 was capa- other agents that are capable of inducing DC maturation provide a ble of binding to the juxtamembrane domain of DDR1a using a useful means of inducing efficient anti-tumor CTLs in vitro. In chimeric receptor that consisted of the extracellular domain of addition, mDCs that are loaded with soluble proteins in vitro can platelet-derived growth factor receptor,the transmembrane and jux- also prime CD8ϩ T cells in vivo (42, 43). Several clinical trials tamembrane domain of DDR1a, and thekinase domain of TrkA (51). have been performed using in vitro generated DCs; however, some However, we were not ablee to detect either the recruitment or problems still exist. Especially, improvements in optimizing the phosphorylation of fibroblastblastlastast grggrogrowth factor receptor substrate 2 maturation and activation of DCs for the enhancement of anti- after activation of DDR1DR1R1 in DCs ((our unpublished data). Addi- tumor efficiency of DC-based anti-tumor vaccine need to be tional studies are necessaryecessarycessary to determdetermidetermine the role of DDR1a ex- established (43, 44). Activation of DDR1 provides a way of pressed on DCsand nd to unveil as yet uncunchuncharacterized DDR1a sig- enhancing the maturation of DCs and subsequent anti-tumor ac- naling pathways.ays.ys. Downloaded from tivity. Up-regulated CCR7 expression on mDCs would also en- Activationonn ofDDR1 DR1 sigsignaling in DCs is regularegulreguregulated at least at two hance their migration to the secondary lymphoid organs for better levels.First, irst,the e expressioexpressexpression of DDR1 needs to beb induced. Sec- priming of CD8ϩ T cells. Our next goal is to investigate the ondly,y, DDR1DR1 signaling,si naling, especiallyes DDR1b signaling,signaling requires ad- ␣ effectiveness of DDR1-activated mDC-based vaccine for tumor ditionalitiotionionall signals, sucsuchuchha as TNF- or LPS, to beable ble to maximally ␣ treatment using mouse tumor transplantation models. activateacact vate p38p MAPK.MAPKK Thus, DDR1b signalingnggoc occurso only when The p38 MAPK pathway has been reported to play a critical rolee thehe maturationmatu tion of iiDCs is induced throughhacact aactivation of other re- in the maturation of human monocyte-derived iDCs to mDCssinin ceptorscepp duringduri gi immune responses andDDRDD DDR1b acts as a costimu- http://www.jimmunol.org/ lating receptorecepto for DC maturation.AnotAno AnAnother potentially important response to CpG-DNA, LPS, TNF-␣, and contact sensitizersrsssu suchs mechanismechan involved in the regulatioregulationtionion of the DDR1 signaling is the as dinitrochlorobenzene and NiSO (15, 45, 46). Theeffe effectsffects off 4 physicalphysic state of collagen optimoptimalimamal for DDR1-activation. Normal DDR1 activation on DC maturation was also dependententntt oonthe ep3 p38 tissuestitissu are composed of a fibrfibrifibrillarbril mesh of ECM, including poly- MAPK pathway. We recently reported that activationctivtivaivation ofthe merized type I collagen.In inflammatory conditions such as ath- DDR1b isoform, but not DDR1a isoform, inducescesess thethe activationactivactiva on of erosclerosis, polymerizepolymerizedizedzed collagen fibrils are absent from interme- p38 MAPK (14), strongly suggesting thathatat thehee activationactivactivatio of diate stages of lesionsionion development that instead contain thin and DDR1b, the major isoform expressed onmDCs,mD Cs,s, isis responsibleespo forf disordered collagecollagenagegen fibers and collagen fragments. Previous stud-

513 Ab-induced activation of p38 MAPKAPKPK andnd amamplificationamp ficationcatio of DC by guest on September 27, 2021 ies have indicaindicatedicatcate that the triple helical configuration of collagen maturation. In this study, we furthertherherer investigatedinvesnvvestigatedstigated ththem molecular is requirededdto tot serve as a DDR1 ligand and also for DDR1 activa- mechanisms regulating the DDR1b-mediatedDR1R1b-mediatedR1b-mediatedmediated p388MAM MAPK activation (11,11,1, 112). However, it is not clear whether normal intact col- tion and have shown that theheeea activationvationation of DDDDRDDR1b induces the lagenennc can activate DDR1, and it will be important to clarify the ␤ ␣ ␣ formation of the TRAF6/TAB1TATABAB11 /p38p protein complexc and p38 forformorm of collagen optimal to activate DDR1. Considering the fact autophosphorylation innbobothbo differentiated fferenteren TTH THP-1 cells and mDCs. ththat collagen is abundant and present everywhere in the ECM, tight TRAF6 is a criticalalsignalingsig si moleculemolel regulatingre DDR1b-medi- regulation of DDR1 activation is necessary to avoid unwanted sig- ated activationof fp38 MAPK. Duringuringing thet signaling of IL-1R, Toll- naling through DDR1. like receptors,s,, CD40, and TRANCE-R, TRAF6 is used as an imiim- In conclusion, we have identified DDR1, most likely DDR1b, as portant moleculeeculecule to transfer signals to their downstream sigsignsignaling a novel coreceptor involved in DC maturation, and have demon- pathways (47,48). 8). The major difference in the signaling bbetween strated that activation of DDR1, in combination with TNF-␣ or DDR1b and thesee receptors is that the TRAF6 proteinproteiprotprote complex LPS, results in the production of highly potent mDCs. We have ␤ induced by DDR1bactiv activationctivtivation contains TAB1 ,,ininstins instead of TAB1. also revealed that the DDR1b signaling pathway is unique and ␤ Interestingly, TAB1 lackscksks the TAK1-binding sitsitessi located in the C regulated by the recently described TAB1␤-mediated alternative terminus; therefore, it is unableableblele to bind to TAKTATAK1. Therefore, TAK1 pathway of p38 MAPK activation. Further studies addressing the is not a target of the DDR1b signaling.ignaling.gnaling.naling. TaTTakTaken together, our results role and signaling pathways of DDR1 will provide new informa- indicate that the DDR1b signalingalingingng iin mDCs uses the novel tion regarding the involvement of the ECM protein, collagen, in TRAF6/TAB1␤/p38␣ MAPK cascade to amplify their maturation. the development of immune responses and bring a new insight into In contrast to the p38 MAPK signaling, the ERK signaling path- the mechanisms regulating this complex system in a tissue way appears to negatively regulate the phenotypic and functional microenvironment. maturation of monocyte-derived DCs, and the balance of activation levels between p38 and ERK may regulate the initial com- Acknowledgments mitment of naive T cells toward Th1 or Th2 subsets (49). In our We are grateful to Dr. Joost J. Oppenheim for his invaluable comments, study, mDCs prepared in the presence of LPS and 513 Ab secreted and to Dr. Morihiro Watanabe for his technical assistance (National Cancer 2- to 3-fold higher level of the Th1 cytokine IL-12 p70, the func- Institute-Frederick, Frederick, MD). We are also grateful to Trans Genic tional form of IL-12. Transcription of the IL-12 p40 gene in DCs for a kind gift of anti-DDR1 Ab and to the National Cancer Institute, has been reported to be regulated by p38 MAPK (50). DDR1 ac- Center for Cancer Research Fellows Editorial Board for their excellent editing during the preparation of this manuscript. tivation did not affect the secretion of the Th2 cytokine IL-10 or phosphorylation of ERKs. Therefore, DDR1 signaling contributes References to the development of Th1 responses by activating p38 MAPK, but 1. Banchereau, J., and R. Steinman. 1998. Dendritic cells and the control of immu- not ERKs. nity. Nature 392:245. 3532 ROLE OF DDR1 IN DC MATURATION

2. Mellman, I., and R. M. Steinmann. 2001. Dendritic cells: specialized and regu- immature and mature dendritic cells by distinct chemokines expressed in different lated antigen processing machines. Cell 106:255. anatomic sites. J. Exp. Med. 188:373. 3. Forster, R., A. Schubel, D. Breitfeld, E. Kremmer, I. Renner-Muller, E. Wolf, and 27. Sozzani, S., P. Allavena, G. D’Amico, W. Luini, G. Bianchi, M. Kataura, T. Imai, M. Lipp. 1999. CCR7 coordinates the primary immune response by establishing O. Yoshie, R. Bonecchi, and A. Mantovani. 1998. Differential regulation of che- functional microenvironments in secondary lymphoid organs. Cell 99:23. mokine receptors during dendritic cell maturation: a model for their trafficking 4. Aiba, S., S. Nakagawa, H. Ozawa, K. Miyake, H. Yagita, and H. Tagami. 1993. properties. J. Immunol. 161:1083. Up-regulation of alpha-4 integrin on activated Langerhans cells: analysis of ad- 28. Yanagihara, S., E. Komura, J. Nagafune, H. Watarai, and Y. Yamaguchi. 1998. hesion molecules on Langerhans cells relating. J. Invest. Dermatol. 100:143. EBI1/CCR7 is a new member of dendritic cell chemokine receptor that is up- 5. Lu, L., J. Woo, A. S. Rao, Y. Li, S. C. Watkins, S. Qian, T. E. Starzl, regulated upon maturation. J. Immunol. 161:3096. A. J. Demetris, and A. W. Thomson. 1994. Propagation of dendritic cell progen- 29. Shibuya, H., K. Yamaguchi, K. Shirakabe, A. Tonegawa, Y. Gotoh, N. Ueno, itors from normal mouse liver using granulocyte/macrophage colony-stimulating K. Irie, E. Nishida, and K. Matsumoto. 1996. TAB1: an activator of the TAK1 factor and their maturational development in the presence of type-1 collagen. MAPKKK in TGF-␤ signal transduction. Science 272:1179. J. Exp. Med. 179:1823. 30. Kishimoto, K., K. Matsumoto, and J. Ninomiya-Tsuji. 2000. TAK1 mitogen- 6. Mahnke, K., R. S. Bhardwaj, T. A. Lugare, T. Schwarz, and S. Grabbe. 1996. activated protein kinase kinase kinase is activated by autophosphorylation within Interaction of murine dendritic cells with collagen up-regulates allostimulatory its activation loop. J. Biol. Chem. 275:7359. capacity, surface expression of heat stable antigen, and release of cytokines. 31. Ge, B., X. Xiong, Q. Jing, J. L. Mosley, A. Filose, D. Bian, H. Huang, and J. Han. J. Leukocyte Biol. 60:465. 2003. TAB1␤, a novel splicing variant of TAB1 that interacts with p38␣ but not 7. Brand, U., I. Bellinghausen, A. H. Enk, H. Jonuleit, D. Becker, J. Knop, and TAK1. J. Biol. Chem. 278:22866. J. Saloga. 1998. Influence of extracellular matrix proteins on the development of 32. Roake, J. A., A. S. Rao, P..J.M J. Morris,MMo C. P. Larsen, D. F. Hankins, and cultured human dendritic cells. Eur. J. Immunol. 28:1673. J. M. Austyn. 1995. Dendriticriticitictic cell loss fromffr nonlymphoid tissues after systemic 8. Marra, F., S. Pastacaldi, R. G. Romanelli, M. Pinzani, P. Ticali, V. Carloni, administration of lipopolysaccharide,polysaccharide,olysaccharide,lysaccharide, tumortumtumo necrosis factor, and interleukin 1. G. Laffi, and P. Gentilini. 1997. Integrin-mediated stimulation of monocyte che- J. Exp. Med. 181:2237237377. motactic protein-1 expression. FEBS Lett. 414:221. 33. De Smedt, T., B. Pajak,ajak, E. Muraille, L. Lespagnard,LespagnarLespagnaLespagn E. Heinen, P. De Baetselier, 9. Suri, R. M., and J. M. Austyn. 1998. Bacterial lipopolysaccharide contamination J. Urbain, O. Leo,eo,o, and M. Moser. 1996. Regulation ofo dendritic cell numbers and of commercial collagen preparations may mediate dendritic cell maturation in maturation byyyli lipopolysaccharidel polysac in vivo. J. Exp. Med.MedMe 184:1413. culture. J. Immunol. Methods 214:149. 34. Verhasselt,lt,t, V., C. Buelens,uelen F.F Willems, D. De Groote, N.N Haeffner-Cavaillon,H and Downloaded from 10. Ammon, C., S. P. Meyer, L. Schwarzfischer, S. W. Krause, R. Andressen, and M. Goldman.oldman.ldman.dman.n. 1997.997. BacterialBacteriaBacte lipopolysaccharide stimulatesstimulatstimulate the production of M. Kreutz. 2000. Comparative analysis of integrin expression on monocyte-de- cytokinesokineskines andd thee expressionexpressi of costimulatory molecules by humanh peripheral rived macrophages and monocyte-derived dendritic cells. Immunology 100:364. bloodloodood dendritic cells:c : evidenceevideevidenc for a soluble CD14-dependent pathway.pappat J. Immu- 11. Vogel, W., G. D. Gish, F. Alves, and T. Pawson. 1997. The discoidin domain nol.nno 158:2919. receptor tyrosine kinases are activated by collagen. Mol. Cell. 1:13. 35.5. Jonuleit,onuleileit, H., U. Kuhn, G.G Muller, K. Steinbrink, L. Paragnik,ParagniParagnik E. Schmitt, J. Knop, 12. Shrivastava, A., C. Radziejewski, E. Campbell, L. Kovac, M. McGlynn, and A.A H. Enk. 1997.1997 Pro-inflammatory cytokines andan prostaglandins induce T. E. Ryan, S. Davis, M. P. Goldfarb, D. J. Glass, G. Lemke, and maturationmaturat of potentpote immunostimulatory dendriticcce cellscelc under fetal calf serum-

G. D. Yancopoulos. 1997. An orphan receptor tyrosine kinase family whoseosesee free conditions.condi ns Eur.Eur. J.J. Immunol. 27:3135. http://www.jimmunol.org/ members serve as nonintegrin collagen receptors. Mol. Cell. 1:25. 36. Sallusto,Sa usto, F., and A. Lanzavecchia. 1994. EfficientEfficieficiencien presentation of soluble antigen 13. Kamohara, H., S. Yamashiro, C. Galligan, and T. Yoshimura. 2001.Disc Discoidiniscoscoidin by culturedc ured human dendritic cells is maintainedmaintaintainaine by granulocyte/macrophage col- domain receptor 1 isoform a (DDR1a) promotes migration of leukocytestesess ini three- ony-stimulatingony- factor plus interleukinn4 44a and downregulated by tumor necrosis dimensional collagen lattices. FASEB J. 15:2724. factorfacto ␣. J. Exp. Med. 179:1109. 14. Matsuyama, W., H. Kamohara, C. Gilligan, M. Fauer, and T.Yosh Yoshimura.oshshimura.ura.200 2003. 37. Caux,Ca C., C. Massacrier, B. Vanbervliet,Vanbebervber B. Dubois, C. van Kooten, I. Durand, Interaction of discoidin domain receptor 1 isoform b (DDR1b)R1bR1b)1b) withcol collagenlagen and J. Banchereau. 1994. ActivationActivctivativat of human dendritic cells through CD40 activates p38 mitogen-activated protein kinase and promotesmoteotestes differentiationdiffere tionno of cross-linking.cross-linking. J. Exp. Med.18018 180:1263. macrophages. FASEB J. 17:1286. 38. Cella, M., M. Salio, Y. Sakakibara,Sakakakaka H. Langen, I. Julkunen, and A. Lanzavecchia. 15. Arrighi, J.-F., M. Rebsamen, F. Rousset, V. Kindler,er,r,, anda d C. Hauser.Hause 2002001.1. A 1999. Maturation, activation,activaivatvatio and protection of dendritic cells induced by double- critical role of p38 mitogen-activated protein kinaseasesee ini the e maturationm turatio of humhuman strandedstranded RNA.RNA. J. Exp.Exp Med. 189:821. blood-derived dendritic cells induced by lipopolysaccharide,olyslysaysaccharide,charide, TNF- ␣, and cocontact 39. Aiba, S., A. Terunuma,Terunrunuunu H. Manome, and H. Tagami. 1997. Dendritic cells dif-

sensitizers. J. Immunol. 166:3837. ferently respondondnd to haptens and irritants by their production of cytokines and by guest on September 27, 2021 16. Ge, B., H. Gram, F. Di Padova, B. Huang,ng,g,, L.L New,Newew, R. J. Ulevitch,Ulev ha and J. Han. expressionnof ofo co-stimulatoryc molecules. Eur. J. Immunol. 27:3031. 2002. MAPKK-independent activationnonof of p38␣ mediatedmed dbyTA by TAB1-dependent 40. Rock, K. L.L 1996. A new foreign policy: MHC class I molecules monitor the autophosphorylation of p38␣. Sciencencecee 295:1291.2 5:1291. outsidedeew world. Immunol. Today 17:131. 17. Alves, F., S. Saupe, M. Ledwon,n,F. F Schaub,haub, W. HiddenmHiddenmann, and W. Vogel. 41. Lanzavecchia,Lanzanzanza A. 1993. Identifying strategies for immune intervention. Science 2001. Identification of two novel,ovelvel,el,kinase defideficientficient variantvariants of discoidin domain 260:937226026 . receptor 1: differential expressionpresressessionon inn humahuman coloncoolon cancancer cell lines. FFASEBASEB J. 42.2. Inaba,I K., J. P. Metlay, M. T. Crowley, and R. M. Steinman. 1990. Dendritic cells 15:1321. pulsed with protein antigens in vitro can prime antigen-specific, MHC-restricted 18. Xu, L. L., D. W.McVicar,McMcV A. Be Ben-Baruch, D. B. Kuhns, J. Johnston, T cells in situ. J. Exp. Med. 172:631. J. J. Oppenheim,and J. M. Wang.g. 1995. Monocyte chemotactic protein-3 43. Banchereau, J., B. Schuler-Thurner, A. K. Palucka, and G. Schuler. 2001. Den- (MCP3) interactsctstswith multiple leukocytecyte rreceptors: binding and signaling oof dritic cells as vectors for therapy. Cell 106:271. MCP3 throughghh shared as well as unique receptors on monocytes and neutropneutrophneutrophils. 44. Fukao, T. 2002. Dendritic-cell-based anticancer vaccination: has it matured? Eur. J. Immunol.muunol.un 25:2612. Trends Immunol. 23:231. 19. Romani, N.,,D. Reider, M. Heuer, S. Ebner, E. Kampgen, BB. Eibl, 45. Hacker, H., H. Mischak, T. Miethke, S. Liptay, R. Schmid, T. Sparwasser, D. Niederwieser,r,and G. Schuler. 1996. Generation of mature dendridendritdendritic cells from K. Heeg, G. B. Lipford, and H. Wagner. 1998. CpG-DNA-specific activation of human blood: an improvedmprovedproved method with special regard to clinicclinicalclinica applicability. antigen-presenting cells requires stress kinase activity and is preceded by non- J. Immunol. Methods19196 196:13796:137. specific endocytosis and endosomal maturation. EMBO J. 17:6230. 20. Akagawa, K. S., N. Takasuka,kasuka,asuka, Y. Nozaki, I. Komuro, MM. Azuma, M. Ueda, 46. Ardeshna, K. M., A. R. Pizzey, S. Devereux, and A. Khwaja. 2000. The PI3 M. Naito, and K. Takahashi..191996.199 Generation of CD1ϩRelBRRe ϩ dendritic cells and kinase, p38 SAP kinase, and NF-␬B signal transduction pathways are involved in tartrate-resistant acid phosphatase-positiveatase-positivetase-positivease-positive osteoclast-likeosteoclasosteoclastosteoclast- multinucleated giant the survival and maturation of lipopolysaccharide-stimulated human monocyte- cells from human monocytes. Bloodoodod 88:4029. derived dendritic cells. Blood 96:1039. 21. Falk, W., R. H. Goodwin, Jr., and E. J. Leonard.Leonard 1980. A 48-well micro chemo- 47. Bradley, J. R., and J. S. Pober. 2001. Tumor necrosis factor receptor-associated taxis assembly for rapid and accurate measurementmeasuremeasureasur of leukocyte migration. J. Im- factors (TRAFs). Oncogene 20:6842. munol. Methods 33:239. 48. Chung, J. E., Y. C. Park, H. Ye, and H. Wu. 2002. All TRAFs are not created 22. Nestle, F. O., S. Alijagic, M. Gilliet, Y. Sun, S. Grabbe, R. Dummer, G. Burg, and equal: common and distinct molecular mechanisms of TRAF-mediated signal D. Schadendorf. 1998. Vaccination of melanoma patients with peptide- or tumor transduction. J. Cell Sci. 115:679. lysate-pulsed dendritic cells. Nat. Med. 4:328. 49. Puig-Kroger, A., M. Relloso, O. Fernandez-Capetillo, A. Zubiaga, A. Silva, 23. Sander, B., J. Andersson, and U. Andersson. 1991. Assessment of cytokines by C. Bernabeu, and A. L. Corbi. 2001. Extracellular signal-regulated protein kinase immunofluorescence and the paraformaldehyde-saponin procedure. Immunol. signaling pathway negatively regulates the phenotypic and functional maturation Rev. 119:65. of monocyte-derived human dendritic cells. Blood 98:2175. 24. Ono, K., and J. Han. 2000. The p38 signal transduction pathway: activation and 50. Saccani, S., S. Pantano, and G. Natoli. 2002. p38-dependent marking of inflam- function. Cell. Signal. 12:1. matory genes for increased NF-␬B recruitment. Nat. Immunol. 3:69. 25. Cao, Z., J. Xiong, M. Takeuchi, T. Kurama, and D. V. Goeddel. 1996. TRAF6 is 51. Foehr, E. D., A. Tatavos, E. Tanabe, S. Raffioni, S. Goetz, E. Dimarco, a signal transducer for interleukin-1. Nature 383:443. M. de Luca, and R. H. Bradshaw. 2000. Discoidin domain receptor 1 (DDR1) 26. Dieu, M.-C., B. Vanbervliet, A. Vicari, J.-M. Bridon, E. Oldham, S. Ait-Yahia, signaling in PC12 cells: activation of juxtamembrane domains in PDGFR/DDR/ F. Briere, A. Zlotnik, S. Lebecque, and C. Caux. 1998. Selective recruitment of TrkA chimeric receptors. FASEB J. 14:973. The Journal of Immunology

Letter of Retraction

I wish to retract the article titled “Activation of Discoidin Domain Receptor 1 Facilitates the Maturation of Human Monocyte-Derived Dendritic Cells Through the TNF Receptor Associated Factor 6/TGF-b-Activated Protein Kinase 1 Binding Protein 1b/p38a Mitogen- Activated Protein Kinase Signaling Cascade” by Wataru Matsuyama, Michel Faure, and Teizo Yoshimura, The Journal of Immunology, 2003, 171: 3520–3532. I recently became aware of problems associated with the FACS data presented in Figs. 1B and 2A in the paper. In Fig. 1B, some of the histograms were identical to those published in another paper, and in Fig. 2A, each set of control histograms was duplicated for each experimental condition. Although we still believe the conclusions of this study to be valid, the supporting evidence is now lacking because we cannot authenticate the FACS data. Therefore, I wish to retract the article.

Teizo Yoshimura Laboratory of Molecular Immunoregulation National Cancer Institute Frederick, MD

Copyright Ó 2010 by The American Association of Immunologists, Inc. 0022-1767/10/$16.00 www.jimmunol.org/cgi/doi/10.4049/jimmunol.1090057