Rasamsonia, a New Genus Comprising Thermotolerant and Thermophilic Talaromyces and Geosmithia Species

Home , Geosmithia, Mycelium, Rasamsonia, Talaromyces, Trichocoma, Trichocomaceae

View metadata,Downloaded citation and from similar orbit.dtu.dk papers on:at core.ac.uk Dec 19, 2017 brought to you by CORE

provided by Online Research Database In Technology

Rasamsonia, a new genus comprising thermotolerant and thermophilic Talaromyces and Geosmithia species

Houbraken, J.; Spierenburg, H.; Frisvad, Jens Christian

Published in: Antonie van Leeuwenhoek

Link to article, DOI: 10.1007/s10482-011-9647-1

Publication date: 2012

Document Version Publisher's PDF, also known as Version of record

Link back to DTU Orbit

Citation (APA): Houbraken, J., Spierenburg, H., & Frisvad, J. C. (2012). Rasamsonia, a new genus comprising thermotolerant and thermophilic Talaromyces and Geosmithia species. Antonie van Leeuwenhoek, 101(2), 403-421. DOI: 10.1007/s10482-011-9647-1

General rights Copyright and moral rights for the publications made accessible in the public portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights.

• Users may download and print one copy of any publication from the public portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain • You may freely distribute the URL identifying the publication in the public portal

If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your claim.

Antonie van Leeuwenhoek (2012) 101:403–421 DOI 10.1007/s10482-011-9647-1

ORIGINAL PAPER

Rasamsonia, a new genus comprising thermotolerant and thermophilic Talaromyces and Geosmithia species

J. Houbraken • H. Spierenburg • J. C. Frisvad

Received: 1 March 2011 / Accepted: 16 September 2011 / Published online: 2 October 2011 Ó The Author(s) 2011. This article is published with open access at Springerlink.com

Abstract The phylogenetic relationship among covering. Species within the genus Rasamsonia were Geosmithia argillacea, Talaromyces emersonii, Ta- distinguished using a combination of phenotypic laromyces byssochlamydoides and other members of characters, extrolite patterns, ITS and partial calmod- the Trichocomaceae was studied using partial RPB2 ulin and b-tubulin sequences. Rasamsonia brevistipi- (RNA polymerase II gene, encoding the second largest tata sp. nov. is described and five new combinations protein subunit), Tsr1 (putative ribosome biogenesis are proposed. protein) and Cct8 (putative chaperonin complex component TCP-1) gene sequences. The results Keywords Emersonii Argillacea Taxonomy showed that these species form a distinct clade within Extrolites Phylogeny Trichocomaceae the Trichocomaceae and Trichocoma paradoxa is phylogenetically most closely related. Based on phenotypic and physiological characters and molecu- Introduction lar data, we propose Rasamsonia gen. nov. to accom- modate these species. This new genus is distinct from Thermophilia and thermotolerance have been vari- other genera of the Trichocomaceae in being thermo- ously defined (Apinis 1963; Cooney and Emerson tolerant or thermophilic and having conidiophores 1964; Craveri et al. 1964; Crisan 1973). The com- with distinctly rough walled stipes, olive-brown monly accepted definition is that of Cooney and conidia and ascomata, if present, with a scanty Emerson (1964), who defined thermophilic species as those which can grow at or above 50°C, but not below 20°C. The definition of thermotolerance is similar Electronic supplementary material The online version of except that the maximum growth temperature is at or this article (doi:10.1007/s10482-011-9647-1) contains supplementary material, which is available to authorized users. above 45°C, having a maximum near 50°C, and the minimum growth temperature is below 20°C. Ther- J. Houbraken (&) H. Spierenburg mophilic fungi have gained much attention in bio- Department of Applied and Industrial Mycology, technology the last decades, primarily because of their CBS-KNAW Fungal Biodiversity Centre, Uppsalalaan 8, 3584 CT Utrecht, The Netherlands capacity to produce thermostable enzymes, which are e-mail: [email protected] stable at room temperature and can be purified by heat treatment (Maheshwari et al. 2000; Turner et al. 2007). J. C. Frisvad For example, the thermophilic species Talaromyces Department of Systems Biology, Technical University of Denmark, Building 221, Søltofts Plads, emersonii produces multiple b-glucosidase enzymes, 2800 Kongens Lyngby, Denmark a number of which are components of a potent 123 404 Antonie van Leeuwenhoek (2012) 101:403–421 cellulytic enzyme system and are used in commercial TCP-1) gene sequences. These data indicate that these applications (Collins et al. 2007; Coughlan et al. 1993; species are closely related and phenotypic and physio- McHale and Coughlan 1981; Murray et al. 2004). logical characters show that they represent a new genus. Thermophilic fungi are not restricted to a specific The taxonomy of this new genus is studied here using a taxonomic order and occur all over the fungal tree of combination of phenotypic characters, extrolite pat- life. Examples are Rhizomucor in the Mucorales, terns, ITS and partial calmodulin and b-tubulin Myceliophthora in Sordariales and Talaromyces, sequences. One new species is described and five new Thermomyces and Thermoascus in the Eurotiales combinations are proposed. (Mouchacca 1997). The majority of Talaromyces species are mesophiles but exceptions are species within sections Emersonii and Thermophila. Section Materials and methods Emersonii includes Talaromyces emersonii, T. byssochlamydoides, T. bacillisporus and T. leycettanus, Strains all of which grow well at 40°C. Talaromyces bacillisporus is thermotolerant, T. leycettanus is thermo- The strains used in the study on the phylogeny of the tolerant to thermophilic, and T. emersonii and Trichocomaceae are listed in Supplementary Table 1. T. byssochlamydoides are truly thermophilic (Stolk An overview of strains used for phenotypic analysis and Samson 1972). The sole member of Talaromyces and phylogeny is shown in Table 1. All cultures are section Thermophila, T. thermophilus, grows rapidly maintained in the culture collection of the CBS- at 50°C (Evans and Stolk 1971; Evans 1971; Stolk and KNAW Fungal Biodiversity Centre, Utrecht, The Samson 1972). The current classification of these Netherlands. thermophilic Talaromyces species is mainly based on phenotypic and physiological characters, such as their Morphological characterization ability to grow above 40°C, ascospore color, the structure of ascomatal covering and the formation of a Cultures for morphological observation were inocu- certain type of anamorph. Stolk and Samson (1972) lated in a three point position onto the following agar stated that the members of the section Emersonii have media: Czapek yeast extract agar (CYA), CYA anamorphs of either Paecilomyces (T. byssochlamydoi- supplemented with 5% NaCl (CYAS), yeast extract des and T. leycettanus)orPenicillium cylindrosporum sucrose agar (YES), creatine sucrose agar (CREA), series (T. emersonii and T. bacillisporus). Later, dichloran 18% glycerol agar (DG18), oatmeal agar Pitt (1979) transferred the species belonging to the (OA) and malt extract agar (Oxoid) (MEA). All media Penicillium cylindrosporum series to the genus were prepared as described by Samson et al. (2010). Geosmithia, based on various characters such as the Two sets were inoculated per strain: one set was formation of conidia from terminal pores instead of incubated at 25°C, the other at 37°C. Colony diameter on collula (necks), a character of Penicillium and and other macroscopical features were recorded after Paecilomyces. Within the genus Geosmithia, only 7 days of incubation. Microscopical features were G. argillacea is thermotolerant, and Stolk et al. (1969) studied by light microscopy (Olympus BH2 and Zeiss and Evans (1971) proposed a connection with mem- Axioskop 2 Plus) and microscopic mounts were made bers of Talaromyces sect. Emersonii. The phyloge- from MEA or OA. netic relationship of the thermophilic Talaromyces species within Talaromyces and the Trichocomaceae Molecular analysis is unknown. In this study, the phylogenetic relationship among Strains were grown on MEA for 7–14 days prior to Geosmithia argillacea, T. emersonii, T. byssochlamydoi- DNA extraction. Genomic DNA was extracted using des and other thermotolerant/thermophilic members of the UltracleanTM Microbial DNA isolation Kit the Trichocomaceae is studied using partial RPB2(RNA (MoBio, Solana Beach, U.S.A.) according to the polymerase II gene, encoding the second largest protein manufacturer’s instructions. For the phylogenetic subunit), Tsr1 (putative ribosome biogenesis protein) analysis of the Eurotialean taxa, parts of the RPB2, and Cct8 (putative chaperonin complex component Tsr1 and Cct8 genes were sequenced. The latter two 123 noi a euehe 21)101:403–421 (2012) Leeuwenhoek van Antonie Table 1 Rasamsonia isolates used in this study CBS no. Name Other collections Origin GenBank accession numbers (ITS/BenA/Cmd)

CBS 101.69T R. argillacea (= Geosm. argillacea) DTO 97E4 = IMI Mine tip with a very high JF417491; JF417456; JF417501 156096 = IBT 31199 surface temperature; Staffordshire, UK CBS 102.69 R. argillacea (= Geosm. argillacea) DTO 97E5 = IBT 31200 Air; UK JF417490; JF417457; JF417502 CBS 907.70 R. argillacea (= Geosm. argillacea) DTO 97E7 Unknown source; Reading, JF417474; JF417458; JF417503 UK CBS 128787 R. argillacea (= Geosm. argillacea) DTO 73F3 Heat treated fruit JF417475; JF417459; JF417504 concentrate; imported into the Netherlands CBS 128785T R. brevistipitata DTO 25H2 = IBT 31187 Indoor environment of JF417488; JF417454; JF417499 school, from cork with bitumen, Germany CBS 128786 R. brevistipitata DTO 26B1 = IBT 31188 Indoor environment of JF417489; JF417455; JF417500 school, from cork with bitumen, Germany CBS 413.71T R. byssochlamydoides (= Tal. byssochlamydoides) DTO 149D6 = IBT 11604 Dry soil under Douglas ﬁr; JF417476; JF417460; JF417512 Oregon, USA CBS 533.71 R. byssochlamydoides (= Tal. byssochlamydoides) DTO 138G6 = IBT Piles of peat; near JF417477; JF417461; JF417513 11601 = IBT 31184 Oldenburg, Germany CBS R. cylindrospora (= Geosm. cylindrospora) DTO 138F8 = IBT Culture contaminant; JF417470; JF417448; JF417493 275.58NT 31202 = ATCC Berkshire, England, UK 18223 = IMI 071623 CBS 432.62 R. cylindrospora (= Geosm. cylindrospora) DTO 138F7 = IBT 31201 Man, sputum; the JF417471; JF417449; JF417492 Netherlands CBS 100538T R. eburnea (= Tal. eburneus) DTO 105D6 = IBT 17519 Soil; Taipei, Taiwan JF417483; JF417462; JF417494 CBS 124445 R. eburnea (= Tal. eburneus) DTO 49D7 = IBT 31193 Blood culture, patient with JF417472; JF417450; JF417495 peritonitis; UK CBS 102881 R. eburnea (= Tal. eburneus) DTO 97E9 = IBT Man, bronchial washing JF417484; JF417451; JF417496 31195 = UAMH 9714 (apparently etiologic); Toronto, Ontario, Canada CBS 124447 R. eburnea (= Tal. eburneus) DTO 45I3 = IBT 31191 Contaminant of blood JF417473; JF417452; JF417497 culture (pseudo- outbreak); UK CBS 124446 R. eburnea (= Tal. eburneus) DTO 49D9 = IBT 31192 Peritoneal dialysis ﬂuid; JF417487; JF417453; JF417498 123 UK 405 406 123 Table 1 continued CBS no. Name Other collections Origin GenBank accession numbers (ITS/BenA/Cmd)

CBS 393.64T R. emersonii (= Tal. emersonii) DTO 48I1 = ATCC Compost; Italy JF417478; JF417463; JF417510 16479 = IMI 116815 = IMI 116815ii = IBT 31218 = IBT 21695 CBS 396.64 R. emersonii (= Tal. emersonii) DTO 108B2 = IBT 31180 Soil; Baarn, the JF417479; JF417467; JF417511 Netherlands CBS 397.64 R. emersonii (= Tal. emersonii) DTO 108B3 = IMI Soil; near Nottingham, UK JF417480; JF417466; JF417509 105413 = IBT 31179 CBS 355.92 R. emersonii (= Tal. emersonii) DTO 138G4 Young mushroom compost; JF417482; JF417465; JF417508 Beitem-Roeselare, Belgium CBS 549.92 R. emersonii (= Tal. emersonii) DTO 138G5 = CBS Sugar cane bagasse; JF417481; JF417464; JF417507 814.70 = IMI Reading, UK 154228 = IBT 31203 = IBT 31181 = IBT 24759 CBS 103.73 Trichocoma paradoxa IBT 31160 Unknown; Japan JF417486; JF417469; JF417506 CBS 247.57 Trichocoma paradoxa IBT 31159 Unknown; Hachijoˆ, Japan JF417485; JF417468; JF417505 CBS culture collection of the CBS-KNAW Fungal Biodiversity Centre, Utrecht, Netherlands; DTO internal culture collection of CBS-KNAW Fungal Biodiversity Centre; IMI CABI Genetic Resources Collection, Surrey, UK; IBT culture collection of Center for Microbial Biotechnology (CMB) at Department of Systems Biology, Technical University of Denmark; ATCC American Type Culture Collection, Manassas, VA, USA noi a euehe 21)101:403–421 (2012) Leeuwenhoek van Antonie Antonie van Leeuwenhoek (2012) 101:403–421 407 genes were chosen, since they were among the best- replicates (Stamatakis et al. 2008). A second measure performing genes for recovering robust phylogenies in of branch support was conducted using a Bayesian tree the study by Aguileta et al. (2008). The partial RPB2, inference (BI) analysis. Prior to analysis, the best Tsr1 and Cct8 sequences consists of exon data only nucleotide substitution models were determined for and the alignment of the data set was performed using each partition with MrModeltest v2.2 (Nylander the Muscle software on the translated amino acid data. 2004). A BI analysis was performed with MrBayes The ITS (incl. 5.8S rDNA), b-tubulin and calmodulin v3.1.2 (Huelsenbeck and Ronquist 2001). One tree loci were sequenced in order to study the phylogenetic was saved per 100 generations, and the run was relationship among T. emersonii, T. byssochlamydo- automatically ended when the standard deviation of ides, T. eburneus, G. argillacea and G. cylindrospora. split frequencies was below 0.01. To avoid suboptimal The obtained sequences were aligned using the trees being taken into account for the consensus tree, a software Muscle on the EMBL-EBI website and burn-in of 25% of the saved trees was used. Coccid- subsequently combined. Primers used for ampliﬁca- ioides immitis sequences were downloaded from the tion and sequencing and annealing temperatures are full genome data set (Sharpton et al. 2009) and used as shown in Table 2. Maximum likelihood analysis was an outgroup in the study of the phylogeny of selected performed on the two data sets using RAxML version Trichocomaceae. Trichocoma paradoxa CBS 247.57 7.2.8. Each locus was treated as a separate partition. and CBS 103.73 were used as an outgroup in the The number of bootstrap replicates was set on 1,000 phylogenetic analysis.

Table 2 Primers used in this study for ampliﬁcation and sequencing Locus Primer Sequence (50–30) Annealing Fragment References temperature size (bp) (°C)

RPB2 5F_Eur (Fwd) GAYGAYCGKGAYCAYTTCGG 48–51 ca. 1220 Modiﬁed after RPB2-5F; Liu et al. (1999) 7CR_Eur (Rev) CCCATRGCYTGYTTRCCCAT Modiﬁed after RPB2-7CR; Liu et al. (1999) Tsr1 F1526Pc (Fwd) 48–50 ca. 820 This study GARTAYCCBCARTCNGAGATGT R2434 (Rev) This study ASAGYTGVARDGCCTTRAACCA Cct8 F94 (Fwd) CGCAAC 50–52 F94–R1595: This study AAGATYGTBATYAACCA 1400–1450 F660 (Fwd) F660–R1595: This study GIGTKGTBAAGATCATGGGWGG 850–890 R1595 (Rev) RTCMACRCCNGTIGTCCAGTA This study BenA T10 (Fwd) 55 T10–Bt2b: O’Donnell and Cigelnik (1997) ACGATAGGTTCACCTCCAGAC 570–620 Bt2a (Fwd) Bt2a–Bt2b: Glass and Donaldson (1995) GGTAACCAAATCGGTGCTGCTTTC 520–550 Bt2b (Rev) Glass and Donaldson (1995) ACCCTCAGTGTAGTGACCCTTGGC ITS V9G (Fwd) TTACGTCCCTGCCCTTTGTA 55 ca. 1000 de Hoog and Gerrits van den Ende (1998) LS266 GCATTCCCAAACAACTCGACTC Masclaux et al. (1995) Cmd Cmd5 (Fwd) CCGAGTACAAGGARGCCTTC 55 ca. 630 Hong et al. (2006) Cmd6 (Rev) CCGATRGAGGTCATRACGTGG Hong et al. (2006)

123 408 Antonie van Leeuwenhoek (2012) 101:403–421

Extrolite analysis Results

All strains, except Trichocoma paradoxa isolates, Generic delimitation (Table 1) were grown for 7 and 14 days at 37°C on the solid media YES, CYA, OA, malt extract agar (MEA- Macro- and microscopical analysis of Talaromyces B) (Blakeslee formula, Difco malt extract) (Raper and emersonii, T. byssochlamydoides, T. eburneus, Geo- Thom 1949, p. 67), MEA, Wickerham’s Antibiotic smithia argillacea and G. cylindrospora showed that Test Medium (WATM) (Raper and Thom 1949, these species share various phenotypic and physio- pp. 69–70) and Raulin-Thom (Smith 1960, p. 259) logical characters. Shared phenotypic characters with added oat meal (RTO agar) (using 2.67 g include condiophores with distinct rough-walled sti- ammonium tartrate and 30 g oatmeal/l) prior to pes and ellipsoidal, ovoid or cylindrical conidia, which extrolite extraction. Trichocoma paradoxa was grown are in shades of olive-brown. The ascomata of on the above mentioned agar media for 4 weeks at T. emersonii, T. byssochlamydoides, T. eburneus have 25°C. All media contained a trace metal mixture of a scanty covering and the ascospores are smooth

5 ppm CuSO45H2O and 10 ppm ZnSO47H2O (Smith walled, globose, subglobose or ovoidal. Furthermore, 1949). Five agar plugs taken along a diameter of the these species are thermophilic or thermotolerant and fungal colony were used for extraction. The agar plugs have optimal growth at 37°C or higher (see Supple- were transferred in ethyl acetate/dichloromethane/ mentary Fig. 1). methanol (3:2:1, v/v/v) with 1% (v/v) formic acid The phylogenetic position of T. emersonii, and ultrasonicated for 50 min. The extracts were T. byssochlamydoides, G. argillacea and G. cylin- transferred to a 1.5 ml autosampler screw-cap vials, drospora was studied using partial RPB2, Cct8 and evaporated to dryness and re-dissolved in 400 ll Tsr1 sequences. The total length of the combined data methanol by ultrasonication in 10 min. Subsequently, sets was 2343 bp (exon data only). The structure of the the extracts were filtered through 0.45 lm filter partitions was as follows: the Cct8 partition was (Minisart RC4, Sartorius, Germany) and kept at 726 bp long and had 368 variable sites; the Tsr1 data -18°C prior to analysis. The extracts were analyzed set included 639 characters, and 438 of those were by ultra high performance liquid chromatography variable and the RPB2 gene partition was 978 bp long, (U-HPLC) using alkylphenone retention indices and 502 were found to be variable. The SYM?I?G model diode array UV–VIS detection as described by Frisvad was found to be optimal for the Tsr1 partition, whereas and Thrane (1987). The U-HPLC used was Dionex the best substitution model for the RPB2 and Cct8 Ultimate 3000 with two pumps. The extrolites were sequence matrix was determined to be GTR?I?G. separated on a Kinetex C18 (150 9 2.1 mm) column The thermophilic species T. emersonii and T. bys- with 2.6 lm particles. The column temperature was sochlamydoides from section Emersonii and the held at 60°C. The extract injection volume was 1 ll. A thermotolerant species G. argillacea and G. cylin- gradient based on water with 50 ppm trifluoroacetic drospora group together, and the mesophile Tricho- acid (TFA) and acetonitrile (AcCN) with 50 ppm TFA, coma paradoxa is basal to these species. The two other at a flow rate of 0.8 ml/min, was used: Start condi- species of section Emersonii, T. bacillisporus and tions 85% H2O with TFA and 15% AcCN with TFA. T. leycettanus, are accommodated in other clades. Gradient: 15–25% AcCN in min, from 25 to 65% Talaromyces bacillisporus belongs to the genus AcCN in 5 min, from 60 to 100% AcCN in 1 min, at Talaromyces, and T. leycettanus groups with 100% AcCH in 1 min, back to 15% AcCN in 1 min and Hamigera avellanea and Warcupiella spinulosa. The then 1 min constant at 15% AcCN. The run-time was Eurotialean Geosmithia species and related teleo- therefore 10 min. UV chromatograms were recorded at morphs are polyphyletic (Fig. 1). G. argillacea and 210 and 280 nm, but diode array detection was carried G. cylindrospora are closely related to T. emersonii out in a range from 190 to 600 nm. Identification and T. byssochlamydoides, G. namyslowskii is of extrolites was performed by comparison of the placed within Penicillium and Eupenicillium, and UV–Visible spectra and retention times of the extro- G. viridis and T. bacillisporus (anamorph G. swiftii) lites with those present in the collection at Department are accommodated in a clade comprising spe- of Systems Biology, Kgs. Lyngby, Denmark. cies mainly belonging to Penicillium subgenus 123 Antonie van Leeuwenhoek (2012) 101:403–421 409

100/1.00 CBS 101.69T Rasamsonia argillacea T -/0.97 CBS 100538 Rasamsonia eburnea 96/1.00 CBS 413.71T Rasamsonia byssochlamydoides 71/0.99 CBS 393.64T Rasamsonia emersonii Rasamsonia 100/1.00 CBS 128785T Rasamsonia brevistipitata 97/1.00 CBS 275.58NT Rasamsonia cylindrospora CBS 247.57 Trichocoma paradoxa Trichocoma -/- 100/1.00 CBS 218.34 Thermomyces lanuginosus 100/1.00 CBS 224.63 Thermomyces lanuginosus 100/1.00 Thermomyces CBS 236.58HT Talaromyces thermophilus NT -/0.95 100/1.00 CBS 348.51 Talaromyces luteus CBS 371.87 Talaromyces luteus

88/0.98 CBS 398.69 Sagenomella diversispora 99/1.00 CBS 426.67 Sagenomella griseoviridis 100/1.00 CBS 429.67IsoT Sagenomella striatispora Sagenomella CBS 427.67IsoT Sagenomella humicola -/1.00 99/1.00 CBS 310.38NT Talaromyces flavus 100/1.00 ATCC 18224 Penicillium marneffei 100/1.00 CBS 252.87HT Geosmithia viridis 100/1.00 ATCC 10500 Talaromyces stipitatus Talaromyces s.str. NT 100/1.00 CBS 642.68 Penicillium mineoluteum and Penicillium subg. 100/1.00 CBS 373.48 Talaromyces trachyspermus Biverticillium 98/1.00 CBS 296.48HT Talaromyces bacillisporus CBS 100536HT Talaromyces emodensis 99/1.00 CBS 391.48NT Talaromyces wortmanii

99/1.00 NRRL 3357 Aspergillus flavus -/- Af293 Aspergillus fumigatus -/- CBS 513.88 Aspergillus niger -/- Aspergillus and teleomorphs NRRL 3357 Aspergillus flavus -/0.97 NIH 2624 Aspergillus terreus

-/- FGSC A4 Aspergillus nidulans 100 HT 1.00 CBS 398.68 Talaromyces leycettanus CBS 295.48IsoT Hamigera avellanea 87 0.99 NT 95/1.00 CBS 512.65 Warcupiella spinulosa 100/1.00 Wisconsin 54-1255 Penicillium chrysogenum 100/1.00 CBS 344.61IsoT Eupenicillium crustaceum CBS 325.48 Penicillium expansum Penicillium sensu stricto 86 NT 100/1.00 1.00 CBS 125543 Penicillium glabrum and Eupenicillium CBS 353.48NT Geosmithia namyslowskii 72/- 71/0.99 CBS 139.45NT Penicillium citrinum T 70/0.95 CBS 181.67 Thermoascus crustaceus 100/1.00 CBS 528.71NT Thermoascus thermophilus Thermoascus CBS 891.70 Thermoascus aurantiacus 80/0.96 NT 100/1.00 CBS 100.11 Byssochlamys nivea Paecilomyces & Byssochlamys CBS 101075HT Byssochlamys spectabilis Strain “RS” Coccidioides immitis 0.1

Fig. 1 Best-scoring Maximum Likelihood tree using RAxML Probabilities (second number) analysis are given at the nodes. based on combined data set of partial RPB2, Cct8 and Tsr1 Only bootstrap values above 70% or posterior probability values sequences. The thermophiles are accommodated in three higher than 0.9 are shown. Branches supported less than 70% different clades: Rasamsonia, Thermomyces and Thermoascus. bootstrap value or 0.9 posterior probability are indicated with a Rasamsonia species form a distinct clade in the Trichocomaceae hyphen and branches with 95% bootstrap or more are thickened. and are closely related to Trichocoma. The bootstrap percent- The tree is rooted with Coccidioides immitis (strain ‘‘RS’’, ages of the RAxML analysis (ﬁrst number) and BI Posterior Sharpton et al. 2009)

Biverticillium and Talaromyces. Based on phenotypic, Species delimitation in Rasamsonia physiological and molecular data, we propose to transfer the species T. emersonii, T. byssochlamydo- Species belonging to the genus Rasamsonia can be ides, T. eburneus, G. argillacea and G. cylindrospora distinguished by phenotype (Table 3). The optimum to Rasamsonia gen. nov. and maximum growth temperature on MEA, the

123 410 123

Table 3 Differential characteristics of Rasamsonia species R. argillacea R. brevistiptata R. byssochlamydoides R. cylindrospora R. eburnea R. emersonii

Growth on CYA 15–25 mm 7–13 mm No growth 3–8 mm 14–20 mm No growth (7 days, 25°C) Growth on CYA 30–40 mm 11–17 mm 19–27 mm 5–10 mm 30–40 mm 18–30 mm (7 days, 37°C) Optimum and Optimum 36°C; Optimum 33°C; Optimum around Optimum 36°C; Optimum 36°C; Optimum between 45 maximum growth maximum above maximum slightly 45°C, maximum maximum at or maximum slightly and 50°C, maximum temperature on 50°C above 45°C between 50 and 55°C slightly above 50°C above 50°C around 55°C MEA Shape and size Cylindrical or ovoid, Ellipsoidal or Cylindrical, Cylindrical, Cylindrical at ﬁrst, Cylindrical, 3.5–4.5 conidia (3–) 3.5–4.5 ovoid, (2.0– 4–8 9 1–2.5 lm 4.0–5.0 9 1.6–2.1 lm becoming ellipsoidal (–5.0) 9 1.5–3.0 lm (–5.0) 9 1.5–2.0 )2.5–3.0 (3.5) 9 or ovoid, 2.5–3.5 (–2.3) lm 1.7–2.1 lm (–4) 9 1.8–2.5 lm Ascomata/ Absent Absent Present, usually maturing Absent Occasionally present, Present, usually ascospores within 7 days, maturing slowly, maturing within 3.7–4.5 9 3.5–4 lm 4–5 9 4–4.5 lm 7 days, 3.5–4 9 2.7–3.5 lm Branching pattern Regularly branched, Regularly Irregularly branched Regularly branched, Regularly branched, Regularly branched, bi- conidiophores predominantly bi- branched, (Paecilomyces-type), predominantly mono-, bi and or terverticillate or terverticillate, monoverticillate terverticillate or biverticillate, terverticillate occasionally or biverticillate quarterverticillate occasionally

monoverticillate terverticillate or 101:403–421 (2012) Leeuwenhoek van Antonie simple Extrolitesa ‘‘DOK’’, ‘‘FLIR’’, Brefeldin Ab ‘‘BYB’’, ‘‘BYS’’, A Atrovenetinb, ‘‘CORT’’, ‘‘FLIR’’, ‘‘ALKI’’, atrovenetinb, ‘‘FLOX’’, ‘‘FXU’’, corymbiferan lactone, funalenoneb, ‘‘FLOX’’, ‘‘MÆCO’’, funalenoneb, ‘‘QOQ’’, ‘‘RAI’’, emodin, emodin naphthalic anhydrideb, ‘‘RAI’’ ‘‘GUAX’’, an ‘‘SCOT’’ anthroneb, emodin ‘‘POLVE’’ isocoumarin, bisanthronesb, ‘‘JAJA’’, naphthalic ‘‘INDOL1’’, ‘‘RUI’’ anhydrideb, ‘‘PULSO’’, secalonic acid D, ‘‘VIOL’’ a All extrolites with ‘‘capitals’’ have characteristic UV spectra and retention times, but could not be identified b Tentatively identified based on UV spectra Antonie van Leeuwenhoek (2012) 101:403–421 411 growth rate on CYA and YES and the reverse color on R. argillacea, best produced on YES agar, and (4) MEA at 36°C proved to be valuable characters for R. brevistipitata, a producer of only a few extrolites differentiation. Supplementary Fig. 1 compares tem- including a compound tentatively identified as brefel- perature growth relations among Rasamsonia species din A. Media with nitrate, CYA and WATM, were and with the phylogenetically related species Tricho- highly inhibitory to extrolite production. Trichocoma coma paradoxa. Rasamsonia emersonii and R. bys- paradoxa IFM H-53524 (= DTO 78H2 = CBS sochlamydoides are thermophilic and have an 788.83) and CBS 103.73 (= IBT 31160) were also optimum growth temperature around 45°C. The other analyzed for extrolites and found to produce rugul- Rasamsonia species are thermotolerant and have ovasine A, corymbiferone (Overy et al. 2005a, b), optimal growth around 33°C(R. brevistipitata)or corymbiferane lactones (Overy and Blunt 2004), and 36°C(R. argillacea, R. eburnea and R. cylindrospora). compounds related to naphthalic anhydride, atrovene- Trichocoma paradoxa is mesophilic and has optimum tin and funalenone (Turner 1971), in addition to between 21 and 24°C and a maximum between 30 and several unique extrolites. The latter three chromo- 33°C. The grouping of thermotolerant and thermo- phore families were also detected in R. cylindrospora philic Rasamsonia species, although not supported by and R. emersonii. One of the corymbiferan lactones high bootstrap values, is also reflected in the phylo- was also found in R. byssochlamydoides. geny: R. emersonii and R. byssochlamydoides form a In order to study the phylogenetic relationship clade, and the other four species form another cluster. among Rasamsonia species, the ITS regions and Growth of Rasamsonia species on CYA is poor with partial calmodulin and tubulin sequences were com- no or weak sporulation except for R. argillacea and bined and the total length of this data set was 1,766 R. eburnea, which grow well producing colony nucleotides. The length of each partition was 706, 553 diameters larger than 30 mm. Rasamsonia species and 507 nucleotides for the ITS regions, and the partial also differ in micro-morphology. The size and shape of calmodulin and tubulin gene regions, respectively, and the conidia, branching pattern of the conidiophores number of variable sites were 158, 240 and 206 and the formation of ascomata are useful characters for nucleotides, respectively. The SYM?G model was differentiation. Rasamsonia byssochlamydoides devi- found to be optimal for the calmodulin partition, ates from the other species in having irregularly GTR?I?G was the best model for ITS, whereas the branched conidiophores (Paecilomyces-type). Asco- best substitution model for the tubulin matrix was mata were observed only in cultures of R. emersonii determined to be K80 ? I. Multilocus sequence and R. byssochlamydoides. Although ascomata and analysis of the genus Rasamsonia revealed the pre- ascospores were reported in R. eburnea (Yaguchi et al. sence of six species (Fig. 2). Five new combinations 1994), these were not detected in the present study are proposed: R. eburnea, R. argillacea, R. cylindro- after prolonged incubation of 8 weeks on OA and spora, R. emersonii and R. byssochlamydoides, and MEA at 33, 36 and 40°C. Rasamsonia argillacea and one new species is described. We propose the name R. eburnea are phenotypically and phylogenetically R. brevistipitata sp. nov. for this species. The phylo- closely related. The major phenotypic difference gram supports the sibling relationship of R. eburnea and between these species is the blackish brown reverse R. argillacea, however, the relationships between the of R. eburnea when grown on MEA at 36°C. other species are poorly or not supported (\95% bs). The results of the chemical analyses of the extracts of the different Rasamsonia species are listed in Table 3. Chemotaxonomically, the species of Taxonomy Rasamsonia can be divided into four groups: (1) the naphthalenone producers, R. emersonii and R. cylin- Rasamsonia Houbraken & Frisvad gen. nov. Myco- drospora, which produce most extrolites on RTO agar, bank MB 519868. (2) the emodin, emodin anthron, and emodin bisan- Latin diagnosis: Habitatione thermophila et ther- thron producer R. byssochlamydoides, which also motoleranti, culturis circa vel ultra 37°C optime produce most extrolites on RTO, (3) the producers of crescentibus. Ascomatibus parce obtectis, ascosporis what was tentatively identified as Raistrick phenols laevibus, globosis vel ovoideis, stipitibus conidiopho- and other small polar polyketides R. eburnea and rum et/vel hyphis sustinentibus distincte exasperates. 123 412 Antonie van Leeuwenhoek (2012) 101:403–421

CBS 124445 R. eburnea Notes: Rasamsonia phenotypically resembles CBS 124446 R. eburnea Paecilomyces and its teleomorph Byssochlamys and

100/1.00 CBS 100538T R. eburnea is placed within the order Eurotiales, family Trichocomaceae. CBS 102881 R. eburnea Byssochlamys/Paecilomyces and Rasamsonia both CBS 124447 R. eburnea 100/1.00 contain thermotolerant species, produce olive-brown 87 CBS 102.69 R. argillacea 1.00 conidia and form ascomata with no or scarce asco- CBS 101.69T R. argillacea matal covering. Rasamsonia differs in having regularly 78/- CBS 128787 R. argillacea branched conidiophores with distinct rough walled 100/1.00 CBS 907.70 R. argillacea structures and asci are borne in chains, while the

-/- conidiophores of Paecilomyces are irregularly 100/1.00 CBS 128786 R. brevistipitata branched, smooth walled and asci of Byssochlamys CBS 128785T R. brevistipitata are born from croziers. Furthermore, the phialides of NT 100/1.00 CBS 275.58 R. cylindrospora most Rasamsonia species (except R. byssochlamydoi- CBS 432.62 R. cylindrospora 100 des) are cylindrical and taper gradually towards the CBS 355.92 R. emersonii apices, while the phialides of Paecilomyces have a CBS 396.64 R. emersonii broad base tapering into a long narrow neck (Paeci- 100/1.00 CBS 397.64 R. emersonii lomyces-type). The monotypic genus Trichocoma is 99/1.00 phylogenetically closely related to Rasamsonia (Pet- CBS 393.64T R. emersonii erson 2008, this study). Trichocoma is characterized CBS 549.92 R. emersonii 71/- by asci borne in hyphal masses or tufts, which measure T 100/1.00 CBS 413.71 R. byssochlamydoides up to 10–20 mm in length (Kominami et al. 1952; CBS 533.71 R. byssochlamydoides Malloch 1985), while the covering of the ascomata of

100 CBS 247.57 Trichocoma paradoxa Rasamsonia are scanty. Furthermore, Trichocoma is a

0.1 CBS 103.73 Trichocoma paradoxa mesophile and has a maximum growth temperature of 33°C, while members of Rasamsonia have a maxi- Fig. 2 Best-scoring Maximum Likelihood tree using RAxML mum above 45°C (see Supplementary Fig. 1). There based on combined data set of ITS, and partial b-tubulin and are also similarities between both genera: both share calmodulin sequences. Both Rasamsonia brevistipitata strains are on a single branch and positioned within the Rasamsonia formation of bi- and terverticillate Penicillium-like clade. The bootstrap percentages of the RAxML analysis (ﬁrst structures, conidia are in shades of brown en masse, number) and BI Posterior Probabilities (second number) and both form rough walled hyphae. analysis are given at the nodes. Only bootstrap values above Recently, the proposal to revise article 59 of the 70% or posterior probability values higher than 0.9 are shown International Code of Botanical Nomenclature (ICBN) was accepted at the 2011 IBC Nomenclature Section at Melbourne and the principle of ‘one fungus : one Conidiis ellipsoideis, ovoideis vel cylindraceis, name’ was established (Norvell 2011). In light of this diverse olivaceo-brunneis. decision, we propose a single name nomenclature for Typus: Rasamsonia emersonii (Stolk) Houbraken & Rasamsonia. Frisvad comb. nov. Rasamsonia argillacea (Stolk, Evans & Nilsson) Etymology: Named in honor of Robert A. Samson, Houbraken & Frisvad comb. nov. Mycobank MB for his excellent work in fungal taxonomy, and 519878. Supplementary Fig. 2. marking his 65th birthday and 40 years of service at Basionym: Penicillium argillaceum Stolk, Evans the CBS-KNAW Fungal Biodiversity Centre. and Nilsson, Trans. Br. Mycol. Soc. 53: 307. 1969. Diagnostic features: Ascomata, if present, with a = Geosmithia argillacea (Stolk, Evans and Nils- scanty covering, ascospores smooth walled, globose, son) Pitt, Can. J. Bot. 57: 2026. 1979. subglobose or ovoidal. Stipes of conidiophores often Description: Colony diameters, 7 days, in mm., distinctly rough walled, conidia ellipsoidal, ovoid or 25°C: CYA 15–25; CYAS 0–2; MEA 15–25; YES cylindrical, in shades of olive-brown. Thermophilic or 15–24; DG18 6–12; OA 18–27; CREA: no growth. thermotolerant, optimum around 37°C or higher. Colony diameters, 37°C: CYA 30–40; CYAS 9–10; 123 Antonie van Leeuwenhoek (2012) 101:403–421 413

MEA 30–40; YES 35–46; DG18 13–22; OA 36–47; a chronic colonist of airways of cystic fibrosis patients CREA: 14–21, poor growth, no acid and no base (Giraud et al. 2010; Barton et al. 2010). Rasamsonia production. Optimum growth temperature 36°C, argillacea might be more common than reported in maximum above 50°C. literature. Retrospective identification showed that all Good sporulation on CYA at 25 and 37°C, velvety, stored P. variotii strains from patient with CGD were olive brown or cre`me-brown conidia, exudates and R. argillacea and similar misidentifications also occur soluble pigments absent, colonies not or weakly from non-CGD patients (Houbraken et al. 2010;De sulcate, reverse pale brown with brown centre at Ravin et al. 2011). 25°C and cre`me-brown at 37°C. Good sporulation on Notes: After comparison of the D1/D2 region of the YES at 25°C, weak sporulation at 37°C, soluble 28S rDNA, Yaguchi et al. (2005) concluded that pigments absent, mycelium inconspicuous, white, R. eburnea (as T. eburneus) is the teleomorph of olive brown conidia, reverse brown. Colonies on R. argillacea (as P. argillacea). However, both species MEA velvety to floccose, olive brown conidia, reverse are distinct based on phenotype and sequences (see light brown, occasionally with darker brown centre. ‘‘Results’’ section). Stipes terminating in bi- or terverticillate structures, Rasamsonia brevistipitata Weidner, Houbraken & 60–350 9 2.0–3.5 lm, verrucose; branches subtermi- Frisvad sp. nov. Mycobank MB 519870 (Fig. 3). nally present and at lower levels of the stipe, monov- Latin diagnosis: Habitatione thermotoleranti, cul- erticillate and short, suggesting the presence of turis restricte crescentibus in CYA (11–17 mm) et monoverticillate conidiophores. Metulae in terminal YES (22–30 mm) ad 37°C, coloniis reversis whorls of 2–5, unequal in length, 10–15 (–30) 9 incoloratis vel dilute brunneis in agaro MEA, stipit- 1.5–2.5 lm. Phialides, 5–8 (–12) per metula, cylindri- ibus brevibus, conidiis ellipsoideis vel ovoideis, (2.0–) cal base tapering more or less abruptly to a narrowed 2.5–3.0 (3.5) 9 1.7–2.1 lm. collula, 10–14 (–18) 9 1.5–2.5 lm. Conidia smooth Etymology: Rasamsonia brevistipitata is referring walled, cylindrical or ovoid, (3–) 3.5–4.5 (–5.0) 9 to short stipes formed by this species. 1.5–2.0 (–2.3) lm. Typus: Germany, Balingen: isolated from water Extrolites: Production better on YES agar than damaged floor composed of bitumen and cork in a RTO, poor on other media. No extrolites could be school, 2006, U. Weidner (holotype: CBS H-20546; identified, but among the chromophore families were culture ex type—CBS 128785 = DTO 25H2 = IBT several unidentified compounds with characteristic 31187). UV spectra (Table 3). Strain IBT 31197 (= DTO Description: Colony diameters, 7 days, in mm, 137A4) was the best producer of extrolites, while CBS 25°C: CYA 7–13; CYAS 0.5–2; MEA 17–25; YES 102.69 and IBT 31196 (= DTO 137C1) produced few 11–18; DG18 5–10; OA 20–28; CREA: 2–7, poor and CBS 101.69 produced none. growth, no acid and no base production. Colony Diagnostic features: Thermotolerant, good growth diameters at 37°C: CYA 11–17; CYAS 0; MEA on CYA (30–40 mm) and YES (35–46 mm) at 37°C, 24–30; YES 22–30; DG18 8–14; OA 28–32; CREA: reverse on MEA uncolored or light brown, conidia 2–7, poor growth, no acid and no base production. cylindrical or ovoid and measuring (3–) 3.5–4.5 Optimum growth temperature 33°C; maximum (–5.0) 9 1.5–2.0 (–2.3) lm. slightly above 45°C. Distribution and ecology: Rasamsonia argillacea is Colonies on CYA at 25 and 37°C restricted, no or a commonly occurring species and was isolated from poor sporulation, velvety, pale olive brown conidia, hot environments, such as mine tips with a very high cre`me colored mycelium, exudates and soluble pig- surface temperature, (indoor) air, clinical specimens ments absent, colonies not sulcate, reverse cre`me or and heat treated fruit concentrates. The presence of light brown. Moderate to good sporulation on YES at this species in heat treated food products suggests the 25°C and 37°C, obverse pale olive brown, reverse potential presence of a teleomorph. Recently, this light brown with dark brown centre. Colonies on MEA species was described as the cause of invasive mycosis velvety, conidia olive brown, reverse uncolored or in patients with chronic granulomatous disease light brown. (CGD, De Ravin et al. 2011; Machouart et al. 2011). Conidiophores predominantly arising from aerial Furthermore, this emerging pathogen was reported as mycelium, occasionally arising from basal mycelium; 123 414 Antonie van Leeuwenhoek (2012) 101:403–421

Fig. 3 Rasamsonia brevistipitata. a–h Colonies 7 days old 37°C: a MEA, b CYA, c YES, d OA, e MEA reverse, f CYA reverse, g YES reverse, h CREA; i–m conidiophores; n conidia. Scale bar 10 lm stipes terminating in monoverticillate structures when subapically placed on metula or stipe, cylindrical base young and becoming biverticillate in older parts of the slowly tapering in a long neck, 10–14 lm. Conidia colony, (50–) 100–250 9 2.0–3.5 lm, branches on smooth walled, ellipsoidal or ovoid, (2.0–) 2.5–3.0 subterminally and intercalary positions, suggesting (3.5) 9 1.7–2.1 lm. Ascomata and sclerotia absent. separate conidiophores, short (10–50 (–70) 9 2.0 Extrolites: Production best on YES and MEA; both –3.5 lm) and often monoverticillate, verrucose. isolates produced an extrolite tentatively identified as Metulae, when present, in terminal whorls of 2–3 (–5), brefeldin A. vesiculate, 12–17 (–20) lm. Phialides Paecilomyces- Diagnostic features: Thermotolerant, restricted type, in appressed verticils of 4–10, outer phialides growth on CYA (11–17 mm) and YES (22–30 mm) 123 Antonie van Leeuwenhoek (2012) 101:403–421 415 at 37°C, reverse on MEA uncolored or light brown, Chlamydospores are rarely produced, globose or conidia ellipsoidal or ovoid and measuring (2.0–) subglobose, about 4 lm in diameter (Stolk and 2.5–3.0 (3.5) 9 1.7–2.1 lm. Samson 1972). Distribution and ecology: This species was isolated Extrolites: Production best on RTO, followed by from indoor environment in Germany. A BLAST MEA-B, MEA and OAT. Poor on remaining media, search on GenBank with the ITS sequence of CBS except the production of an indole-alkaloid on YES 128785 showed a 100% homology with GenBank agar by CBS 533.71. All examined strains (CBS accession number FJ820827, a sequence generated 533.71 and CBS 413.71) produced two chromophore during DNA analysis of outdoor air in Mainz, families of extrolites (Table 3) each with 4–7 different Germany (Fro¨hlich-Nowoisky et al. 2009). extrolites. In addition, CBS 533.71 produced extrolites Rasamsonia byssochlamydoides (Stolk & Samson) with UV spectra similar to Raistrick phenols, and Houbraken & Frisvad comb. nov. MB 519877. emodin, emodin anthrone and emodin bisanthrone and Supplementary Fig. 3. emodin bisanthron. This series of anthraquinones and Basiomym: Talaromyces byssochlamydoides Stolk anthrones has also been found to co-occur in Asper- & Samson, Stud. Mycol. 2: 45. 1972. gillus wentii (Rabie et al. 1986). = Paecilomyces byssochlamydoides Stolk & Sam- Diagnostic features: Thermophilic, irregularly son, Stud. Mycol. 2: 45. 1972. branched conidiophores (Paecilomyces-type), asco- Description: Colony diameters, 7 days, in mm, no mata produced and ripening within 7–10 days at 40°C, growth at 25°C; 37°C: CYA 19–27; CYAS 0; MEA poor to moderate growth on CYA and YES agar. [60; YES 22–52; DG18 20–30; OA[60; CREA: 0–7, Distribution and ecology: Rasamsonia bys- no or poor growth, no acid and no base production. sochlamydoides was isolated from dry soil under Optimum growth temperature between 40 and 45°C, Douglas fir (Oregon, USA) and piles of peat (Olden- maximum above 50°C. burg, Germany). Poor growth on CYA at 37°C, sporulation, exudate Rasamsonia cylindrospora (G. Smith) Houbraken and soluble pigments absent, colonies not sulcate, & Frisvad comb. nov. Mycobank MB 519876. mycelium inconspicuous and white, reverse pale or Supplementary Fig. 4. pale with a brown centre. Sporulation on YES at 37°C Basionym: Penicillium cylindrosporum G. Smith— weak or absent, soluble pigments absent, mycelium Trans. Br. Mycol. Soc. 40: 483, 1957 inconspicuous, obverse olive-brown when sporulation = Geosmithia cylindrospora (G. Smith) Pitt—Can. is present, reverse light brown and not influencing the J. Bot. 57(19): 2024, 1979 medium color, occasionally with dark brown centre. Description: Colony diameters, 7 days, in mm. Colonies on MEA spreading, velvety or with floccose 25°C: CYA 3–8; CYAS 0; MEA 10–20; YES 5–15; mycelial overgrowth, olive brown conidia, thin layer DG18 5–15; OA 9–17; CREA: no growth. Colony of ascomata formed near the agar, white when young, diameters at 37°C: CYA 5–10; CYAS 0; MEA 27–38; orange or pink-reddish in age, reverse uncolored or YES 10–19; DG18 15–26; OA 24–34; CREA: 1–5, brown. poor growth, no acid and no base production. Optimum Ascomata globose, up to 200 lm in diameter, growth temperature 36°C, maximum around 50°C. covering very scanty. Asci eight-spored, subglobose to Colonies on CYA at 25 and 37°C restricted, broadly ellipsoidal, 9–12.5 9 6.5–7.5 lm. Asco- velvety, olive brown conidia, exudates and soluble spores globose to subglobose, smooth, 3.5–4.5 9 4.0– pigments absent, no sulcations in colony, reverse in 5.5 lm. Conidiophores arising directly from the agar shades of brown. Good sporulation on YES, soluble or in the floccose mycelium, irregularly branched pigments absent, mycelium inconspicuous, white, (Paecilomyces-type), terverticillate or quarterverticil- olive brown conidia, reverse brown with dark brown late, up to 300 lm in length; stipes broad, 3–6 lm, centre. Colonies on MEA velvety to floccose, olive smooth to verrucose. Metulae in terminal whorls of brown conidia, distinct blackish brown reverse at 2–8, broad, unequal in length, (7) 10–15 9 2.0– 37°C. 5.0 lm. Phialides, cylindrical base tapering in a long Conidiophores predominantly arising from basal narrowed collula, 10–15 (–20) 9 2.5–3.5 lm. Co- mycelium, predominantly biverticillate, occasionally nidia smooth walled, cylindrical, 4–8 9 1–2.5 lm. terverticillate or simple, additional branch both direct 123 416 Antonie van Leeuwenhoek (2012) 101:403–421 under terminal whorl and further down the stipe, (50–) obverse pale olive-brown, mycelium inconspicuous, 100–200 9 2.0–3.5 lm, stipes verrucose, Metulae in reverse pale brown and becoming blackish brown in terminal whorls of 2–4, unequal in length, 10–17 age. Colonies on MEA velvety, olive-brown conidia, (–25) 9 2.5–3.5 lm. Phialides, 5–8 (–12) per metula, reverse distinct dark brown at 37°C (at 25°C often cylindrical, with distinct neck, 10–14 9 2.0–2.5 lm. paler brown). Conidia smooth walled, cylindrical, 4.0–5.0 9 1.6– Conidiophores predominantly arising from basal 2.1 lm. mycelium, young structures monoverticillate, biverti- Extrolites: Production best on RTO, followed by cillate in older parts, (50–) 100–350 9 2.0–3.5 lm, MEA, MEA-B and OA; production on remaining occasionally additional branches formed subterminal- media poor. CBS 275.58 produced only one extrolite ly or at lower levels, suggesting presence of separate on MEA, which was not found in CBS 433.62. CBS conidiophores and these structures are shorter 433.62 produced a large number (14) of naphthalenes, (20–70 lm), stipes verrucose. Metulae, when present, including some with UV spectra similar to ‘‘naphthalic in terminal whorls of 2–3 (–5), unequal in length, anhydride’’, atrovenetin and funalenone (Turner 1971, 10–20 9 2.5–3.5 lm. Phialides, in appressed verticils pp. 150–153; Inokoshi et al. 1999). of 2–6, cylindrical, 10–14 (–17) lm. Conidia smooth Diagnostic features: Thermotolerant, restricted walled, cylindrical at first and later becoming ellip- growth on CYA (5–10 mm) and YES (10–19 mm) at soidal or ovoid, 2.5–3.5 (–4) 9 1.8–2.5 lm. Asco- 37°C, blackish brown reverse on MEA, conidia mata not detected in this study, but reported in cylindrical and measuring 4.0–5.0 9 1.6–2.1 lm. literature (Yaguchi et al. 1994) as discrete, pale Distribution and ecology: Two R. cylindrospora yellow, maturing slowly within 28–35 days, globose isolates are currently present in the CBS culture to subglobose, (30–) 70–125 lm, soft, scarcely co- collection. One strain was isolated from sputum in the vered by hyaline, delicate mycelium. Asci eight- Netherlands; the other as a culture contaminant in spored, borne singly, subglobose to ovoid or pyriform, England, UK. 10.5–13 (15) 9 8–9.5 (–11) lm. Ascospores pale Notes: Rasamsonia cylindrospora was originally yellow, subglobose to more or less ovoid, described as Penicillium cylindrosporum by Smith 4–5 9 4–4.5 lm, thick walled, smooth but occasion- (1957) and this species was later transferred to the ally with foveolations, with an equatorial thickening genus Geosmithia (Pitt 1979). under SEM. Rasamsonia eburnea (Yaguchi, Someya & Udag- Extrolites: Production best on YES, followed by awa) Houbraken & Frisvad comb. nov. Mycobank RTO and MEA, none on other media. CBS 102881 MB 519875. Supplementary Fig. 5. and CBS 124445 (= IBT 31193) were the best Basionym: Talaromyces eburneus Yaguchi, So- producers of extrolites (Table 3). meya & Udagawa Mycoscience 35: 249, 1994 Diagnostic features: Thermotolerant, good growth = Geosmithia eburnea Yaguchi, Someya & Udag- on CYA (30–40 mm) and YES (48–55 mm) at 37°C, awa Mycoscience 35: 249, 1994 blackish brown reverse on MEA at 37°C, conidia Description: Colony diameters, 7 days, in mm. cylindrical at first and becoming ellipsoidal or ovoid. 25°C: CYA 14–20; CYAS 1–3; MEA 10–20; YES Distribution and ecology: The type strain of 14–20; DG18 5–10; OA 23–30; CREA: 5–10, poor Rasamsonia eburnea was isolated from Taiwanese soil. growth, no acid and base production. Colony diame- Other strains are isolated from clinical specimens, ters at 37°C: CYA 30–40; CYAS1–6; MEA 34–42; including blood culture, bronchial washing and dialysis YES 48–55; DG18 10–20; OA 36–46; CREA: 12–18, fluid. The studies of Houbraken et al. (2010) and Barton poor growth, no acid and no base production. et al. (2010) mainly used the same Rasamsonia strains Optimum growth temperature 36°C, maximum above (as Geosmithia). Strains NCPF 7594 and 7596 were 50°C. isolated from the same patient (respectively from blood Colonies on CYA at 37°C spreading, velvety, olive- culture and peritoneal dialysis fluid) and re-identified brown conidia, mycelium cream cre`me colored, here, based on deposited ITS sequences in GenBank, as exudates and soluble pigments absent, colonies not R. eburnea. An isolate originating from a blood culture sulcate at 25°C, and distinct sulcate at 37°C, reverse (CBS 124447; pseudo-outbreak, UK) was also re- (pale) brown. Good sporulation on YES at 37°C, identified as R. eburnea (Houbraken et al. 2010). 123 Antonie van Leeuwenhoek (2012) 101:403–421 417

Notes: De Ravin et al. (2011) mention that R. ebur- extrolite production by the ex-type strain CBS 393.64, nea is heterothallic and fails to form a teleomorph which produced one naphthalenone and secalonic acid without mating appropriate strains. However, no D. CBS 549.92 produced a large number (10) of additional details are given for this observation in naphthalenones, including some with UV spectra their publication. similar to naphthalic anhydride, atrovenetin and Rasamsonia emersonii (Stolk) Houbraken & Fris- funalenone (Turner 1971, pp. 150–153; Inokoshi vad comb. nov. Mycobank MB 519874. Supplemen- et al. 1999) and and other as yet unknown extrolites tary Fig. 6. (Table 3). Strain CBS 549.92 differed from the other Basionym: Talaromyces emersonii Stolk, Antonie strains in additionally producing an indole alkaloid, van Leeuwenhoek 31: 262. 1965. and an isocoumarin and two partially characterized = Penicillium emersonii Stolk, Antonie van Leeu- extrolites (Table 3). It also produced more naphthale- wenhoek 31: 262. 1965. nones than the other strains. Description: Colony diameters, 7 days, in mm., no Diagnostic features: Thermophilic, regularly growth at 25°C; 37°C: CYA 18–30; CYAS 0; MEA branched conidiophores with olive-brown colored [50; YES 16–45; DG18 10–22; OA[60; CREA: 0–5, conidia, ascomata present and ripening within no or poor growth, no acid and no base production. 7–10 days at 37°C, poor to moderate growth on Optimum growth temperature between 45 and 50°C, CYA and YES agar. maximum above 50°C. Distribution and ecology: Rasamsonia emersonii is Poor to moderate growth on CYA at 37°C, no or a relatively common fungus, but is probably over- poor sporulation, exudates and soluble pigments looked since it is not able to grow at 25°C. This species absent, colonies not sulcate, mycelium inconspicuous was isolated from hot environments such as compost, and white, reverse pale to light brown. Sporulation on but also from soil and outdoor air (Fro¨hlich-Nowoisky YES at 37°C weak or absent, soluble pigments absent, et al. 2009; Hultman et al. 2009). Rasamsonia mycelium inconspicuous, if sporulation is present, emersonii was also reported to be the causal agent of then colony observe pale olive-brown, reverse light a chronic airway colonization. Reexamination of the brown and not influencing the medium color. Colonies deposited ITS sequences showed that these strains are on MEA spreading, velvety to floccose, olive brown more close to R. argillacea (Cimon et al. 1999; Giraud conidia; ascomata present and often covered under et al. 2010). layer of conidiophores, white when young, becoming Notes: The results of the multigene analysis shows yellow-brown or orange-brown within 7–10 days, that CBS 549.92 (= CBS 814.70) deviates from other reverse light brown, occasionally dark brown (CBS strains of R. emersonii. This strain is also phenoty- 549.92). pically different and has intensely bright yellow Ascomata reddish to orange brown, globose to colored mycelium, but this could not be related to subglobose, up to 300 lm in diameter; covering any extrolites in the extract of the fungus. The isolate scanty. Asci eight-spored, subglobose or broadly may represent a new species, and more strains should ellipsoidal, 8–10.5 9 6.5–8 lm. Ascospores smooth, be collected and examined to determine its taxonomic subglobose to broadly ellipsoidal, 3.5–4 9 2.5– status. 3.5 lm. Conidiophores arising directly from the agar, regularly branched, bi- or terverticillate, 50–150 lm, stipes verrucose, width 2.0–3.5 lm. Metulae in ter- Discussion minal whorls of 3–5, equal in length, 10–15 (–20) 9 2.0–3.0 lm. Phialides, 5–10 per metula, The genus Rasamsonia encompasses one new species, cylindrical with a short collula, 8.5–10 9 2–2.5 lm. three species formally accommodated in Talaromyces Conidia smooth walled, cylindrical, 3.5–4.5 (–5.0) 9 and two species previously classified in Geosmithia. 1.5–3.0 lm. Phylogenetic analyses showed that the genus Geo- Extrolites: Production best on OAT, followed by smithia is polyphyletic and forms lineages in the RTO, MEA-B and MEA; no production on other Hypocreales and Eurotiales (Ogawa et al. 1997; media. CBS 549.92 is the best extrolite-producer Ogawa and Sugiyama 2000; this study). Geosmithia followed by CBS 396.64 and CBS 397.64. Weak lavendula, the type species of Geosmithia,is 123 418 Antonie van Leeuwenhoek (2012) 101:403–421 accommodated in the Hypocreales and is related to Rasamsonia eburnea and R. argillacea produced Acremonium alternatum, the type species of Acremo- extrolites not seen in any other fungal species yet. nium (Ogawa et al. 1997; Rossman and Seifert 2011). Trichocoma paradoxa is phylogenetically related to Several new Geosmithia species belonging to the Rasamsonia and this species produces species specific Hypocreales were described in the last decade and the extrolites, but also naphthalenones, which indicates a majority of these species are associated with galleries relationship with R. cylindrospora and R. emersonii. of phloem feeding bark beetles (Kolarˇ´ık et al. 2004, However, naphthalenones are found in T. macrospo- 2005, 2010). Four of eight Geosmithia species rus and P. duclauxii (Frisvad et al. 1990) and also in belonging to the Eurotiales are reclassified in Ra- the phylogenetically more distant species Penicillium samsonia. Geosmithia swiftii (teleomorph Talaromy- atrovenetum, P. raistrickii, P. hordei and P. hirsutum ces bacillisporus) and G. viridis belong to a clade (Turner 1971; Overy et al. 2005a, b) and so these comprising mainly Talaromyces species and members antioxidant metabolites may have evolved more than of Penicillium subgenus Biverticillium (Fig. 1), and G. once. namyslowskii and G. malachitea (teleomorph Chro- The Eurotialean genera Talaromyces, Thermoas- mocleista malachitea) belong to Penicillium s. str. cus, Thermomyces, Coonemeria and Dactylomyces (Ogawa et al. 1997). The transfer of these species to contain thermophilic species (Apinis 1967; Mou- other genera and making Geosmithia a monophyletic chacca 1997; Stolk and Samson 1972; Stolk 1965). genus will be performed in another study. Our results The current study shows that no thermophiles are show that the members of the Talaromyces section accommodated in Talaromyces. Talaromyces emer- Emersonii, as defined by Stolk and Samson (1972), sonii and T. byssochlamydoides are combined in belong to different genera. Two species are disposed in Rasamsonia and Talaromyces thermophilus is phylo- Rasamsonia, but T. bacillisporus and T. leycettanus genetically closely related to the type species of are retained in Talaromyces. Talaromyces bacillispo- Thermomyces, T. lanuginosus, and not to the type of rus is related to Talaromyces flavus, which is the type Talaromyces, T. flavus. Talaromyces thermophilus species of Talaromyces. Stolk and Samson (1972), and T. lanuginosus share similar features including who showed that the ascomatal coverings of thermophilicity, thick-walled chlamydospores or chla- T. bacillisporus are much better developed than those mydospore-like conidia. Further research is needed to of R. emersonii and R. byssochlamydoides, already clarify the taxonomy of Thermomyces and the rela- had doubts about the relationship between T. bacilli- tionship between T. thermophilus and the other species sporus and R. emersonii. They suggest that T. bacilli- in Thermomyces. Various taxonomical studies of the sporus resembles an intermediate form between the thermophilic genus Thermoascus were performed section Emersonii and section Talaromyces. Pitt (Apinis 1967; Mouchacca 1997; Pitt et al. 2000; Stolk (1979) placed the anamorph of T. bacillisporus in 1965). Apinis (1967) split this genus in two: Ther- Geosmithia (as G. swiftii), suggesting a close rela- moascus was retained for its type species T. aurantia- tionship with R. argillacea and R. cylindrospora. cus, and T. thermophilus and T. crustaceus were However, the conidia of T. bacillisporus are cream transferred to Dactylomyces. Based on anamorph coloured not olive-brown. Phylogenetic analysis differences, Mouchacca (1997) divided Dactylomyces shows that T. leycettanus is not related to Talaromyces further in two, creating the genus Coonemeria for but rather to Hamigera and Warcupiella and this T. crustaceus. Although these species have different confirms earlier findings (Peterson 2008). anamorphs (Paecilomyces/Polypaecilum), our phylo- Extrolite analysis showed that R. emersonii, genetic study (Fig. 1) shows that these three species R. cylindrospora and R. byssochlamydoides produced are related and should be retained in the genus naphthalenones or anthraquinones. Many species in Thermoascus. In conclusion, our data shows that Talaromyces sensu stricto also produce naphthale- eurotialian thermophiles are not present in Talaromy- nones and anthraquinones (Frisvad et al. 1990), and ces s. str. but only in Thermomyces, Thermoascus and these metabolites could act ecologically as antioxi- Rasamsonia. dants and thermoprotectants. It seems that these type of compounds have been present in a common Acknowledgments The excellent technical assistance of ancestor of Talaromyces and Rasamsonia. Tineke van Doorn, Martin Meijer, Neriman Yilmaz and Ellen 123 Antonie van Leeuwenhoek (2012) 101:403–421 419

Kirstine Lyhne is greatly acknowledged. Uwe Braun is thanked Geosmithia argillacea: an emerging cause of invasive for providing the Latin diagnosis, Ursula Weidner for providing mycosis in human chronic granulomatous disease. Clin the Rasamsonia brevistipitata isolates, Vanessa Barrs for Infect Dis 52:e136–e143 critically reading the manuscript and all anonymous reviewers Evans HC (1971) Thermophilous fungi of coal spoil tips. II. for their helpful suggestions. Occurrence, distribution and temperature relationships. Trans Br Mycol Soc 57:255–266 Open Access This article is distributed under the terms of the Evans HC, Stolk AC (1971) Talaromyces leycettanus sp. nov. Creative Commons Attribution Noncommercial License which Trans Br Mycol Soc 56:45–49 permits any noncommercial use, distribution, and reproduction Fedorova ND, Khaldi N, Joardar VS et al (2008) Genomic in any medium, provided the original author(s) and source are islands in the pathogenic filamentous fungus Aspergillus credited. fumigatus. PLoS Genet 4:e1000046 Frisvad JC, Thrane U (1987) Standardized high-performance liquid chromatography of 182 mycotoxins and other fungal metabolites based on alkylphenone retention indices and UV-VIS spectra (diode array detection). J Chromatogr 404:195–214 References Frisvad JC, Filtenborg O, Samson RA, Stolk AC (1990) Che- motaxonomy of the genus Talaromyces. Antonie van Aguileta G, Marthey S, Chiapello H, Lebrun MH, Rodolphe F, Leeuwenhoek 57:179–189 Fournier E, Gendrault-Jacquemard A, Giraud T (2008) Fro¨hlich-Nowoisky J, Pickersgill DA, Despre´s VR, Po¨schl U Assessing the performance of single-copy genes for (2009) High diversity of fungi in air particulate matter. recovering robust phylogenies. Syst Biol 57:613–627 Proc Natl Acad Sci USA 106:12814–12819 Apinis AE (1963) Occurrence of thermophilous microfungi in Galagan JE, Calvo SE, Cuomo C et al (2005) Sequencing certain alluvial soils near Nottingham. Nova Hedwigia of Aspergillus nidulans and comparative analysis with 5:57–78 A. fumigatus and A. oryzae. Nature 438:1105–1115 Apinis AE (1967) Dactylomyces and Thermoascus. Trans Br Giraud S, Pihet M, Razafimandimby B, Carre`re J, Degand N, Mycol Soc 50:573–582 Mely L, Favennec L, Dannaoui E, Bouchara J-P, Calenda Barton RC, Borman AM, Johnson EM, Houbraken J, Hobson A (2010) Geosmithia argillacea: an emerging pathogen in RP, Denton M, Conway SP, Brownlee KG, Peckham D, cystic fibrosis patients? J Clin Microbiol 48:2381–2386 Lee TW (2010) Isolation of the fungus Geosmithia arg- Glass NL, Donaldson GC (1995) Development of primer sets illacea in sputum of people with cystic fibrosis. J Clin designed for use with the PCR to amplify conserved genes Microbiol 178(48):2615–2617 from filamentous ascomycetes. Appl Environ Microbiol Cimon B, Carrere J, Chazalette JP, Vinatier JF, Chabasse D, 61:1323–1330 Bouchara JP (1999) Chronic airway colonization by Pen- Hong SB, Cho HS, Shin HD, Frisvad JC, Samson RA (2006) icillium emersonii in a patient with cystic fibrosis. Med Novel Neosartorya species isolated from soil in Korea. Int Mycol 37:291–293 J Syst Evol Microbiol 56:477–486 Collins CM, Murray PG, Denman S, Morrissey JP, Byrnes L, Houbraken J, Verweij PE, Rijs AJ, Borman AM, Samson RA Teeri TT, Tuohy MG (2007) Molecular cloning and (2010) Identification of Paecilomyces variotii in clinical expression analysis of two distinct beta-glucosidase genes, samples and settings. J Clin Microbiol 48:2754–2761 bg1 and aven1, with very different biological roles from the Huelsenbeck JP, Ronquist F (2001) MrBayes: Bayesian infer- thermophilic, saprophytic fungus Talaromyces emersonii. ence of phylogenetic trees. Bioinformatics 17:754–755 Mycol Res 111:840–849 Hultman J, Vasara T, Partanen P, Kurola J, Kontro MH, Paulin Cooney DG, Emerson R (1964) Thermophilic fungi. W.H. L, Auvinen P, Romantschuk M (2009) Determination of Freeman and Co., San Francisco fungal succession during municipal solid waste compost- Coughlan MP, Tuohy MG, Filho EXF, Puls J, Claeyssens M, ing using a cloning-based analysis. J Appl Microbiol Vrsanska M, Hughes MM (1993) Enymological aspects 108:472–487 of microbial hemicellulases with emphasis on fungal Inokoshi J, Shiomi K, Masuma R, Tanaka H, Yamada H, O¯ mura systems. In: Coughlan MP, Hazlewood CP (eds) Hemi- S (1999) Funalenone, a novel collagenase inhibitor pro- cullulose and hemicellulases. Portland Press, London, duced by Aspergillus niger. J Antibiot 52:1095–1100 pp 53–58 Kolarˇ´ık M, Kuba´tova´ A, Pazˇoutova´ S, Sˇru˚tka P (2004) Mor- Craveri R, Manachini PL, Craveri A (1964) Eumiceti termofili phological and molecular characterisation of Geosmithia presenti nel suolo. Ann Microbiol Enzimol 14:13–26 putterillii, G. pallida comb. nov. and G. flava sp. nov., Crisan EV (1973) Current concepts of thermophilism and the associated with subcorticolous insects. Mycol Res thermophilic fungi. Mycologia 65:1171–1198 108:1053–1069 de Hoog GS, Gerrits van den Ende AHG (1998) Molecular Kolarˇ´ık M, Kuba´tova´ A, Cˇ epicˇka I, Pazˇoutova´ S, Sˇru˚tka P diagnostics of clinical strains of filamentous Basidiomy- (2005) A complex of three new white-spored, sympatric, cetes. Mycoses 41:183–189 and host range limited Geosmithia species. Mycol Res De Ravin SS, Challipalli M, Anderson V, Shea YR, Marciano B, 109:1323–1336 Hilligoss D, Marquesen M, Decastro R, Liu YC, Sutton Kolarˇ´ık M, Freeland E, Utley C, Tisserat N (2010) Geosmithia DA, Wickes BL, Kammeyer PL, Sigler L, Sullivan K, morbida sp. nov., a new phytopathogenic species living in Kang EM, Malech HL, Holland SM, Zelazny AM (2011) symbiosis with the walnut twig beetle (Pityophthorus 123 420 Antonie van Leeuwenhoek (2012) 101:403–421

juglandis)onJuglans in USA. Mycologia. doi:10.3852/ Overy DP, Blunt JW (2004) Corymbiferan lactones from Pen- 10-124 icillium hordei: stimulation of novel phenolic metabolites Kominami K, Kobayasi Y, Tubaki K (1952) Is Trichocoma using plant tissue media. J Nat Prod 67:1850–1853 paradoxa conspecific with Penicillium luteum? Nagaoa Overy DP, Valdez JG, Frisvad JC (2005a) Revisions to Peni- 2:18–23 cillium ser. Corymbifera: agents responsible for blue Liu Y, Whelen S, Hall BD (1999) Phylogenetic relationships mould storage rot of various flower and vegetable bulbs. among ascomycetes: evidence from an RNA polymerase II Can J Bot 83:1422–1433 subunit. Mol Biol Evol 16:1799–1808 Overy DP, Zidorn C, Petersen BO, Duus JO, Dalsgaard PW, Machouart M, Garcia-Hermoso D, Rivier A, Hassouni N, Larsen TO, Phipps RK (2005b) Medium dependent pro- Catherinot E, Salmon A, Debourgogne A, Coignard H, duction of corymbiferone a novel products from Pencilli- Lecuit M, Bougnoux M-E, Blanche S, Lortholary O (2011) um hordei cultures on plant tissue agar. Tetrahedron Lett Emergence of disseminated infections due to Geosmithia 46:3225–3228 argillacea in patients with chronic granulomatous disease Pel HJ, de Winde JH, Archer DB et al (2007) Genome receiving long-term azole antifungal prophylaxis. J Clin sequencing and analysis of the versatile cell factory Microbiol. doi:10.1128/JCM.02456-10 Aspergillus niger CBS 513.88. Nat Biotechnol 7:221–231 Maheshwari R, Bharadwaj G, Bhat MK (2000) Thermophilic Peterson SW (2008) Phylogenetic analysis of Aspergillus spe- fungi: their physiology and enzymes. Microbiol Mol Biol cies using DNA sequences from four loci. Mycologia 100: Rev 64:461–488 205–226 Malloch D (1985) The Trichocomaceae: relationships with Pitt J (1979) Geosmithia gen. nov. for Penicillium lavendulum other Ascomycetes. In: Samson RA, Pitt JI (eds) Advances and related species. Can J Bot 57:2021–2030 in Penicillium and Aspergillus systematic. Plenum Press, Pitt JI, Samson RA, Frisvad JC (2000) List of accepted species New York, pp 365–382 and their synonyms in the family Trichocomaceae. In: Masclaux F, Gue´ho H, de Hoog GS, Christen R (1995) Phylo- Samson RA, Pitt JI (eds) Integration of modern taxonomic genetic relationships of human-pathogenic Cladosporium methods for Penicillium and Aspergillus classification. (Xylohypha) species inferred from partial LSU rRNA Plenum Press, New York, pp 149–161 sequences. J Med Vet Mycol 33:327–338 Rabie CJ, Steyn PS, van Heerden FR (1986) The isolation and McHale A, Coughlan MP (1981) The components of the identification of some toxic constituents of Aspergillus cullulase system of Talaromyces emersonii with emphasis wentii Wehmer. Mycotoxin Res 2:19–24 on b-glucosidase. Biochim Biophys Acta 662:145–159 Raper KB, Thom C (1949) Manual of the Penicillia. Williams Mouchacca J (1997) Thermophilic fungi: biodiversity and tax- and Wilkins, Baltimore onomic status. Crypt Mycol 18:19–69 Rossman A, Seifert K (2011) Phylogenetic revision of taxo- Murray P, Aro N, Collins C, Grassick A, Panttila¨ M, Saloheimo nomic concepts in the Hypocreales and other Ascomy- M, Tuohy M (2004) Expression in Trichoderma reesei and cota—a tribute to Gary J. Samuels. Stud Mycol 68:1–248 characterization of a thermostable family 3 beta-glucosi- Samson RA, Houbraken J, Thrane U, Frisvad JC, Andersen B dase from the moderately thermophilic fungus Talaromy- (2010) Food and indoor fungi. CBS laboratory manual ces emersonii. Protein Expr Purif 38:248–257 series 2. CBS-Fungal Biodiversity Centre, Utrecht Nierman WC, Pain A, Anderson MJ et al (2005) Genomic Sharpton TJ, Stajich JE, Rounsley SD et al (2009) Comparative sequence of the pathogenic and allergenic filamentous genomic analyses of the human fungal pathogens Coccid- fungus Aspergillus fumigatus. Nature 438:1151–1156 ioides and their relatives. Genome Res 19:1722–1731 Norvell LL (2011) Fungal nomenclature. 1. Melbourne Smith G (1949) The effect of adding trace elements to Czapek- approves a new code. Mycotaxon 116:481–490 Dox culture medium. Trans Br Mycol Soc 32:280–283 Nylander JAA (2004) MrModeltest 2.2. Program distributed by Smith G (1957) Some new and interesting species of micro- the author. Evolutionary Biology Centre, Uppsala Uni- fungi. Trans Br Mycol Soc 40:81–488 versity, Uppsala Smith G (1960) Industrial mycology, 5th edn. Edward Arnold O’Donnell K, Cigelnik E (1997) Two divergent intragenomic Ltd., London rDNA ITS2 types within a monophyletic lineage of the Stamatakis A, Hoover P, Rougemont J (2008) A rapid bootstrap fungus Fusarium are nonorthologous. Mol Phylogenet algorithm for the RAxML Web-Servers. Syst Biol 75: Evol 7:103–116 758–771 Ogawa H, Sugiyama J (2000) Evolutionary relationships of the Stolk AC (1965) Thermophilic species of Talaromyces Benja- cleistothecial genera with Penicillium, Geosmithia, Mer- min and Thermoascus Miehe. Antonie van Leeuwenhoek imbla and Sarophorum anamorphs as inferred from 18S 31:262–276 rDNA sequence divergence. In: Samson RA, Pitt JI (eds) Stolk AC, Samson RA (1972) The genus Talaromyces. Studies Integration of modern taxonomic methods for Penicillium on Talaromyces and related genera II. Stud Mycol 2:1–67 and Aspergillus classification. Plenum Press, New York, Stolk AC, Evans HC, Nilsson T (1969) Penicillium argillaceum pp 149–161 sp. nov., a thermotolerant Penicillium. Trans Br Mycol Soc Ogawa H, Yoshimura A, Sugiyama J (1997) Polyphyletic ori- 53:307–311 gins of species of the anamorphic genus Geosmithia and Turner WB (1971) Fungal metabolites. Academic Press, London the relationships of the cleistothecial genera: evidence Turner P, Mamo G, Nordberg-Karlsson E (2007) Potential and from 18S, 5S and 28S rDNA sequence analyses. Mycologia utilization of thermophiles and thermostable enzymes in 89:756–771 biorefining. Microb Cell Fact 6:9

123 Antonie van Leeuwenhoek (2012) 101:403–421 421 van den Berg MA, Albang R, Albermann K et al (2008) Genome Yaguchi T, Udagawa S, Nishimura K (2005) Geosmithia arg- sequencing and analysis of the ﬁlamentous fungus Peni- illacea is the anamorph of Talaromyces eburneus as a heat cillium chrysogenum. Nat Biotechnol 26:1161–1168 resistant fungus. Crypt Mycol 26:133–141 Yaguchi T, Someya A, Udagawa S (1994) Two new species of Talaromyces from Taiwan and Japan. Mycoscience 35:249–255

123