←確認用doi （左上Y座標：－17.647 pt）

Vol. 44, No. 4 Biol. Pharm. Bull. 44, 485–493 (2021) 485 Regular Article

New Inhibitory Effect of Latilactobacillus sakei UONUMA on the Pathway in Human HepG2 Cells Miho Ohta-Shimizu,a Fumiko Fuwa,a Eriko Tomitsuka,b Toshikazu Nishiwaki,c Kotaro Aihara,c Shinji Sato,d and Saori Nakagawa*,a a Department of Bio-Analytical Chemistry, Niigata University of Pharmacy and Applied Life Sciences; 265–1 Higashijima, Akiha-ku, Niigata 956–8603, Japan: b Department of Health Chemistry, Niigata University of Pharmacy and Applied Sciences; 265–1 Higashijima, Akiha-ku, Niigata 956–8603, Japan: c Niigata Agricultural Research Institute Food Research Center; 2–25 Shineicho, Kamo, Niigata 959–1381, Japan: and d Functional and Analytical Food Sciences, Niigata University of Pharmacy and Applied Life Sciences; 265–1 Higashijima, Akiha-ku, Niigata 956–8603, Japan. Received August 19, 2020; accepted February 1, 2021

Many pharmaceuticals and dietary foods have been reported to inhibit cholesterol biosynthesis, mainly by inhibiting the presqualene 3-hydroxy-3-methylglutaryl-CoA (HMG-CoA) rather than a postsqualene enzyme. In this study, we examined the inhibitory effects of Latilactobacillus sakei UONUMA on cholesterol biosynthesis, especially postsqualene, in human HepG2 hepatoma cells. We quantified choles- terol and its precursors, and the mRNA and levels of involved in cholesterol biosynthesis. Three L. sakei UONUMA strains exhibited new inhibitory effects on cholesterol biosynthesis and inhibited the mRNA level of sterol-delta24-reductase (DHCR24), which is involved in the postsqualene cholesterol bio- synthesis pathway. These strains will be useful for the prevention and treatment of hyperlipidemia. Key words Latilactobacillus sakei UONUMA; ; cholesterol; sterol-delta24-reductase

INTRODUCTION thesis and is converted to squalene, which is then transformed to . There are two pathways from lanosterol to Hyperlipidemia is a risk factor for cardiovascular dis- cholesterol: the Kandutsch–Russell pathway via lathosterol, eases, arteriosclerosis, coronary heart disease, and myocar- and the Bloch pathway via desmosterol.27) Therefore, finding dial infarction.1–4) Antihyperlipidemic therapy thus mainly uses a compound that targets these two postsqualene pathways that inhibit 3-hydroxy-3-methylglutaryl-CoA reductase could aid the treatment of hyperlipidemia and show a syner- (HMGCR), an enzyme involved in the synthesis of presqualene gistic effect in lowering cholesterol when used together with during cholesterol biosynthesis.5) Components of many dietary HMGCR inhibitors. foods inhibit HMGCR similarly to statins, such as hesperetin6) Lactobacillus spp. (formerly named28) Lactiplantibacillus in citrus fruits, lycopene7) in tomatoes, the catechin plantarum, Lacticaseibacillus casei, Lactobacillus helveticus, epigallocatechin-3-gallate8) in green tea, and procyanidins9) in Lactobacillus gasseri and Limosilactobacillus fermentum) red wine. In contrast, some compounds have been reported decrease intestinal peristalsis and alleviate constipation,29) and to inhibit the postsqualene stages of cholesterol biosynthesis, therefore are used as an intestinal medication. Lactobacillus such as daidzein10) in soybean, (3S,20S)-20-[(formyloxy)- spp. were recently reported to have various other beneficial methyl]-pregn-7-en-3β-yl acetate (SH42),11–13) N,N-dimethyl-3β- effects, such as an anti-tumor effect caused by inducing the se- hydroxy cholenamide (DMHCA),11,12,14) tyrosine kinase cretion of interleukin-12 (IL-12) and interferon-γ (IFN-γ),30,31) inhibitors (masitinib and ponatinib),15) and (3S,20S)-20-(methyl- and an antihypertensive effect following the ingestion of fer- carbamoyl)-pregn-7-en-3β-yl acetate (MGI-21)11,16,17) (which in- mented milk.32) Furthermore, Lactobacillus spp. decrease cho- hibits sterol-delta24-reductase (DHCR24)). It has been reported lesterol levels due to their cholesterol-binding ability,33,34) and that small alkyl residues, such as amide nitrogens, and N-ethyl by binding35) and deconjugating33,34) , the terminal and N-propyl derivatives, lead to inhibition of DHCR24.17) In metabolite of cholesterol. In addition, Lactobacillus plantarum addition, trans-1, 4-bis(2-chloro-benzylaminomethyl) cyclohex- (formerly named28) Lactiplantibacillus plantarum) inhibits ane (AY9944),18–22) 4-[2-[4-[3-(4-chlorophenyl)-2-propenyl]-1- HMGCR.36) However, the effect of Lactobacillus spp. on post- piperazinyl]ethyl] benzoic acid (BM15766),12,21,22) and antipsy- squalene cholesterol synthesis has not been reported. chotic (aripiprazole)18,19) inhibit sterol 7-reductase (DHCR7), Latilactobacillus sakei is a psychotropic lactic acid bacte- and 2-(4-phenethylpiperazin-1-yl)-1-(pyridine-3-yl) ethanol rium with biotechnological potential for biopreservation37) and (LK-980)23) inhibits DHCR7 and DHCR24. The inhibition of immunomodulation.38,39) L. sakei UONUMA strains 1, 2 and DHCR24 leads to select reprogramming of fatty acid metabo- 3 were isolated from Japanese pickles in snow caverns in the lism, activating liver X receptor (LXR) target , inhibit- Uonuma region of Niigata, Japan.40) The sugar fermentation ing sterol regulatory element-binding protein (SREBP) target processes of each of these strains are different,40,41) and thus genes, and suppressing inflammatory-response genes, as ob- these bacteria were classified as three separate strains.40,42) served in macrophage foam cells.13,24–26) The flavor and components of koji amazake (a fermented drink Acetyl-CoA is the starting material in cholesterol biosyn- made from rice) can be altered by lactic acid fermentation using

* To whom correspondence should be addressed. e-mail: [email protected] © 2021 The Pharmaceutical Society of Japan 486 Biol. Pharm. Bull. Vol. 44, No. 4 (2021)

L. sakei UONUMA,41) which aids in alleviating constipation.43) of >90% in toxicity tests) for 40 h (with cholesterol precur-

Here, we investigated the effect of the three strains of L. sors) or 72 h (with cholesterol) at 37 °C and 5% CO2. Culturing sakei UONUMA on the postsqualene pathway in choles- the cells in this LPDS medium resulted in increased levels of terol biosynthesis of DHCR24. Using human HepG2 hepatoma desmosterol and lathosterol (a cholesterol precursor) at 36 and cells, we quantified cholesterol and its precursors, as well as 48 h, and an increase in cholesterol at 72 h (data not shown). the mRNA and protein levels of enzymes involved in choles- We therefore determined cholesterol precursors by culturing terol biosynthesis. for 40 h and cholesterol by culturing for 72 h. The cells were collected by trypsin-EDTA treatment. MATERIALS AND METHODS For quantitative RT-PCR (qPCR) assays, human HepG2 cells (1 × 106 cells/10 mL) were cultured in DMEM contain- Bacterial Strains and Growth Conditions L. sakei ing 10% FBS and 1% penicillin-streptomycin in a 100 mm UONUMA strains were cultured in MRS medium (Becton dish; then, the cells were cultured with or without medium Dickinson and Company, Franklin Lakes, NJ, U.S.A.) for 24 h from freeze-dried L. sakei UONUMA strains 1, 2, or 3 (dis- at 30 °C. solved in DMSO to final concentrations of 0.03, 0.075, 0.15, Reagents Methanol, n-hexane, squalene and 5α- 0.3 mg/mL) for 40 h. (an internal standard, I.S.) were purchased from FUJIFILM For Western blot analysis, human HepG2 cells (1 × 106 Wako Pure Chemical Corporation (Osaka, Japan), lanos- cells/10 mL) were cultured as above, and then the cells were terol was manufactured by Nagara Science Corporation (Gifu, cultured with or without medium from freeze-dried L. sakei Japan), and Dulbecco’s modified Eagle’s medium (DMEM) UONUMA strains 1, 2, or 3 (dissolved in DMSO to final con- with high-glucose lipoprotein-deficient bovine calf serum centrations of 0.03, 0.15, 0.3 mg/mL) for 15, 24, and 40 h. (LPDS), penicillin–streptomycin, 7-dehydrocholesterol, des- GC-MS Analysis Cholesterol and its precursors were mosterol, lathosterol, and cholesterol were purchased from measured using a previously described method.45) Briefly, Sigma-Aldrich Corporation (St. Louis, MO, U.S.A.). Fetal methanol (5 mL) containing 250 ng I.S. and 0.9 g zirconia beads bovine serum (FBS), 0.25% trypsin-ethylenediamineteraacetic was added to the cell sample (2 × 106 cells) and the cells were acid (EDTA), and Tri-Sil HTP reagent (hexamethyldisilazane disrupted by vortexing at room temperature for 5 min. The cell [HMDS] : trimethylchlorosilane [TMCS] : pyridine = 2 : 1 : 10), a lysate was saponified with 10 mol/L potassium hydroxide for trimethylsilyl derivatizing agent, were purchased from Ther- 1 h, neutralized by adding 50% phosphoric acid, and extracted mo Fisher Scientific Corporation (Waltham, MA, U.S.A.). Di- with n-hexane. The n-hexane layer was collected and dried methyl sulfoxide (DMSO) was obtained from Nacalai Tesque under a stream of nitrogen, then derivatized with trimethyl- (Kyoto, Japan). Zirconia beads (0.5 mm diameter) for cell silyl ester. The GC-MS conditions were as follows: capillary disruption were from Tomy Seiko Corporation (Tokyo, Japan). column, DB-5MS (30 m × 0.25 mm, 0.25 µm particle size); RevaTraAce qPCR RTmix, Thunderbird SYBR qPCR mix, carrier gas, helium (1 mL/min); column temperature, 180 °C and KOD SYBR qPCR mix were from Toyobo Corporation for 1 min→20 °C/min→250 °C→5 °C/min→280 °C→3 °C/min→ (Osaka, Japan), and polyvinylidene fluoride (PVDF) mem- 300 °C for 12 min; inlet temperature, 230 °C; ion source tem- brane (Immbilon-P) was purchased from Merck Corporation perature, 250 °C; interface temperature, 250 °C; injection vol- (Darmstadt, Germany). ume, 1 µL; detection mode, selected ion monitoring; GC-MS Cell Cultures For GC-MS analysis, human HepG2 instrument, Shimadzu QP2010Plus; monitoring ions, m/z 69, hepatoma cells (National Institutes of Biomedical Innova- 81 for squalene, m/z 393, 498, 483 for lanosterol, m/z 458, tion, Health and Nutrition, Osaka, Japan) (1 × 106 cells/10 mL) 459, 255 for lathosterol, m/z 325, 351 for 7-dehydrocholesterol, were pre-cultured in DMEM containing 10% FBS and 1% m/z 343, 456, 253 for desmosterol, m/z 368, 458, 329 for cho- penicillin-streptomycin in a 100 mm dish. After 6 h, the me- lesterol, and m/z 217, 357 for 5α-cholestane (bold underline dium was replaced with 1% penicillin–streptomycin and 10% indicates the quantitative ion). LPDS to enhance cholesterol biosynthesis.10,44) The cells were qPCR Assay RNA was isolated from human HepG2 cultured with or without medium from freeze-dried L. sakei cells, cDNA was synthesized using RevaTraAce qPCR RTmix, UONUMA strains 1, 2, or 3 (dissolved in DMSO to final con- and qPCR was conducted using THUNDERBIRD SYBR centrations of 0.03, 0.1, 0.3 mg/mL, which gave a survival rate qPCR mix or KOD SYBR qPCR mix. The primers were

Table 1. Primer Sequences

Gene Sequence (5′→3′) GenBank Accession No.

Human actb (β-Actin) FP: CTGGAACGGTGAAGGTGACA NM_01101 RP: AAGGGACTTCCTGTAACAATGCA Human dhcr7 FP: ACGTAGGAGGCATCCAGGAG NM_001360 RP: GCGAGAACCAGGACAGGAGA Human sc5dl FP: CTTGCTGGAGATAAGAGGTTACAGC NM_006918 RP: AGTCTATGATGAAGGCCTCTGTGAA Human dhcr24 FP: CTGCCGCTCTCGCTTATCTTC NM_014762 RP: TCTTGCTACCCTGCTCCTTCC Human hmgcr FP: GGTGGCCTCTAGTGAGATCTGGA NM_000859 RP: TCACTGTCCCCACTATGATTCC

FP, forward primer; RP, reverse primer. Vol. 44, No. 4 (2021) Biol. Pharm. Bull. 487 designed during this study and the sequences and GenBank cells using radio immunoprecipitation assay buffer (FUJIFILM Accession numbers are shown in Table 1. The expres- Wako Pure Chemical Corporation) with protease inhibitors sion levels were determined using the comparative Ct method (cOmplete, EDTA-free: Roche, Basel, Switzerland). Sodium (comparative quantification method) with actb (actin, beta) as dodecyl sulfate-polyacrylamide gel electrophoresis was con- the endogenous control.46) ducted using 12.5% polyacrylamide gels, were trans- Western Blot Analysis Protein was extracted from the ferred to a PVDF membrane, and then the target protein was

Fig. 1. Effect of Latilactobacillus sakei UONUMA on the Levels of Cholesterol Precursors and Cholesterol Produced by HepG2 Cells (A) Strain 1, (B) Strain 2, (C) Strain 3. *: p < 0.05, The Mann–Whitney U test. Concentration (%) indicates the concentration of each compound relative to that in the absence of Latilactobacillus sakei UONUMA (represented as 100%). 488 Biol. Pharm. Bull. Vol. 44, No. 4 (2021)

Fig. 2. Effect of Latilactobacillus sakei UONUMA on the mRNA Expression Levels of Cholesterol Biosynthesis Enzymes (A) Strain 1, (B) Strain 2, (C) Strain 3. *: p < 0.05, The Mann–Whitney U test. Gene expression levels were determined with actb as the endogenous control, using a value of 1 for the untreated sample. detected. The following antibodies were used in this study: using Image J with ACTB (actin, beta) as the endogenous β-actin monoclonal antibody (Catalog No.66009-1-lg: Pro- control. teintech, Rosemont, IL, U.S.A.), DHCR7 polyclonal antibody Statistical Analysis Statistical analysis was performed (GTX130695: GeneTex, Irvine, CA, U.S.A.) and DHCR24 using the statistical software package EZR, version 1.40.47) The polyclonal antibody (GTX103712: GeneTex). Protein expres- mean and standard deviation of each cholesterol precursor and sion levels were determined by measuring the band amount cholesterol were determined, the Mann–Whitney U test was Vol. 44, No. 4 (2021) Biol. Pharm. Bull. 489

Fig. 3. Effects of Latilactobacillus sakei UONUMA on the Protein Level of the Cholesterol Biosynthesis Enzyme DHCR7 (A) Strain 1, (B) Strain 2, (C) Strain 3. *: p < 0.05, The Mann–Whitney U test. The amount of protein was determined by measuring the β-actin band as an endogenous control, using a value of 1 for the untreated sample. performed, and p < 0.05 was regarded as statistically significant. increased to about 128–160% at 0.03–0.3 mg/mL (p < 0.05, n = 3). However, the cholesterol level significantly decreased RESULTS to about 78% compared with the control (160 ± 37.8 µg/ 106 cells) (p < 0.05, n = 3) at 0.3 mg/mL (Fig. 1A). Effect of L. sakei UONUMA on Cholesterol Precursor Strain 2 did not significantly change the squalene level. and Cholesterol Levels in Human Hepatocytes For strain The lanosterol level significantly increased to about 185% at 1, the squalene level in human HepG2 cells did not sig- 0.3 mg/mL and the desmosterol level significantly increased to nificantly change from that of the control (1.94 ± 2.73 µg/ about 138% at 0.3 mg/mL compared with the control (p < 0.05, 106 cells). The lanosterol level significantly increased to about n = 3). However, the 7-dehydrocholesterol level signifi- 149% compared with the control (0.27 ± 0.08 µg/106 cells) cantly decreased to about 66% compared with the control at at 0.3 mg/mL (p < 0.05, n = 3). The 7-dehydrocholesterol 0.3 mg/mL (p < 0.05, n = 3). The lathosterol level decreased in level significantly increased to about 132% at 0.03 mg/mL a concentration-dependent manner to about 72% at 0.1 mg/mL and to about 114% at 0.3 mg/mL compared with the control and to about 54% at 0.3 mg/mL (p < 0.05, n = 3). The choles- (0.27 ± 0.08 µg/106 cells) (p < 0.05, n = 3). The lathosterol level terol level significantly decreased to about 67% compared with significantly increased to about 165% at 0.03 mg/mL and to the control (p < 0.05, n = 3) at 0.3 mg/mL (Fig. 1B). about 143% at 0.1 mg/mL of strain 1 compared with the control Strain 3 did not significantly change the squalene and la- (1.73 ± 0.27 µg/106 cells) (p < 0.05, n = 3). Furthermore, the nosterol levels. The 7-dehydrocholesterol level significantly desmosterol level (control 0.70 ± 0.27 µg/106 cells) significantly decreased to about 78% at 0.1 mg/mL and to about 66% at 490 Biol. Pharm. Bull. Vol. 44, No. 4 (2021)

Fig. 4. Effects of Latilactobacillus sakei UONUMA on the Protein Level of DHCR24, Which Is Involved in Cholesterol Biosynthesis (A) Strain 1, (B) Strain 2, (C) Strain 3. *: p < 0.05, The Mann–Whitney U test. The amount of protein secreted was determined by measuring the β-actin band as an endogenous control, using a value of 1 for the untreated sample.

0.3 mg/mL (p < 0.05, n = 3). The lathosterol level significantly 53-64% and 62%, respectively, compared with the control decreased to about 69% at 0.1 mg/mL and to about 60% at (p < 0.05, n = 3) (Fig. 2B). Using strain 3, the dhcr7 level 0.3 mg/mL (p < 0.05, n = 3). The desmosterol level significant- significantly increased to about 265–306% compared with the ly increased to about 193% at 0.3 mg/mL (p < 0.05, n = 3). The control (p < 0.05, n = 3) whereas the dhcr24 and hmgcr levels cholesterol level significantly decreased to about 65% com- significantly decreased to about 60–68% and 74% compared pared with the control at 0.3 mg/mL (p < 0.05, n = 3) (Fig. 1C). with the control (p < 0.05, n = 3) (Fig. 2C). All strains increased the desmosterol level and decreased None of the strains affected several other biosynthetic the cholesterol level, suggesting that L. sakei UONUMA in- enzymes: sc5dl, sterol C5-desaturase (Fig. 2); hmgcs1, hibits cholesterol biosynthesis by DHCR24. 3-hydroxy-3-methylglutaryl-CoA synthase 1; sqle, squa- Effect of L. sakei UONUMA on the mRNA Expression lene epoxidase; lss, ; cyp51, lanosterol of Cholesterol Biosynthesis Enzymes in HepG2 Cells The 14-demethylase; dhcr14, sterol 14-reductase; sc4mol, sterol effect of cholesterol biosynthesis enzymes on the expression of C4 methyl-oxidase; hsd17b7, 3-keto- reductase; nsdhl, mRNA was examined using the three stains. Using strain 1, 3-hydroxy 5-steroid dehydrogenase; ebp, sterol 8, 7- the dhcr24 level concentration-dependently decreased to about (data not shown except for sc5dl). 33–72% compared with the control (p < 0.05, n = 3) (Fig. 2A). Effect of L. sakei UONUMA on Cholesterol Biosynthesis Using strain 2, the dhcr7 level significantly increased to about Enzymes in HepG2 Cells Strain 1 significantly decreased 185–210% compared with the control (p < 0.05, n = 3) whereas the protein level of DHCR7 to about 30–35% at 0.03–0.3 mg/mL the dhcr24 and hmgcr levels significantly decreased to about in the 15 h culture compared with the control (p < 0.05, n = 3) Vol. 44, No. 4 (2021) Biol. Pharm. Bull. 491

Fig. 5. Inhibition Sites of Latilactobacillus sakei UONUMA on the Cholesterol Biosynthesis Pathway HMG-CoA, 3-hydroxy-3-methylglutaryl-CoA; HMGCS1, 3-hydroxy-3-methylglutaryl-CoA synthase 1; HMGCR, HMG-CoA reductase; SQLE, squalene epoxidase; LSS, lanosterol synthase; CYP51, lanosterol 14-demethylase; DHCR14, sterol 14-reductase; SC4MOL, sterol C4 methyl-oxidase; HSD17B7, 3-keto-; NSDHL, 3-hydroxy 5-steroid dehydrogenase; EBP, sterol 8, 7-isomerase; SC5DL, sterol C5-desaturase; DHCR7, sterol 7-reductase; DHCR24, sterol 24-reductase.

(Fig. 3A). Moreover, the protein level of DHCR24 signifi- DISCUSSION cantly decreased to about 28–51% (15 h culture) and 30–61% (24 h culture) compared with the control at 0.03, 0.1, and L. sakei UONUMA strain 1 decreased the cholesterol level 0.3 mg/mL (p < 0.05, n = 3), and to about 71% in the 40 h culture and increased the desmosterol level in human HepG2 hepa- at 0.3 mg/mL (p < 0.05, n = 3) (Fig. 4A). These results indicate toma cells, suggesting that it inhibits cholesterol biosynthesis that strain 1 inhibits DHCR7 in the early stage (15 h culture) and by DHCR24. Daidzein was reported to inhibit DHCR24, DHCR24 is inhibited throughout the culture period. decrease cholesterol levels, and increase desmosterol levels Strain 2 significantly reduced the protein level of DHCR7 in HepG2 cells.10) SH42, DMHCA, MGI-21, masitinib, and to about 22–34% in the 15 h culture and to about 49–52% in ponatinib inhibit DHCR24 and result in the accumulation the 40 h culture at 0.03–0.3 mg/mL compared with the control of desmosterol,11–17) but MGI-21 did not result in the ac- (p < 0.05, n = 3) (Fig. 3B). The protein level of DHCR24 sig- cumulation of zymosterol and 5α-colesta-7,24-dien-3β-ol.11) nificantly decreased to about 21–41% at 0.03–0.3 mg/mL in The kcat (Vmax/Km) values of DHCR24 using lanosterol, zy- the 15 h culture compared with the control (p < 0.05, n = 3) mosterol, 5α-colesta-7,24-dien-3β-ol, and desmosterol as and further decreased to about 17% at 0.3 mg/mL (24 h cul- substrates are 0.0033, 0.0201, 0.0586, and 0.0180, respec- ture), but increased to about 70% at 0.3 mg/mL (40 h culture) tively. 5α-Colesta-7,24-dien-3β-ol provides the highest kcat, compared with the control (p < 0.05, n = 3) (Fig. 4B). These about 18-fold higher (defining lanosterol as 1) than other 48) data show that strain 2 inhibited DHCR7 in the early stage, substrates. Although the values of kcat range from 0.03 to promoted it afterwards, and then further inhibited it again in 0.0586, the accumulation of desmosterol is caused by the the 40 h culture, and that DHCR24 is inhibited during long- inhibition of DHCR24 and thus strain 1 inhibits DHCR24 duration culture. (Fig. 5). Moreover, we comprehensively quantified the mRNA Strain 3 significantly decreased the protein level of DHCR7 levels of other enzymes involved in cholesterol biosynthesis to to about 39–53% at 0.03–0.3 mg/mL in the 15 h culture com- identify the mechanism of action of strain 1. The mRNA level pared with the control (p < 0.05, n = 3) (Fig. 3C). Moreover, of DHCR24 was significantly decreased and the protein level the protein level of DHCR24 in the 15, 24, and 40 h cultures was persistently reduced. As a result, strain 1 exhibited a new significantly decreased to about 23–60% at 0.03–0.3 mg/mL inhibitory effect on postsqualene cholesterol biosynthesis by (15 h culture), about 34–88% at 0.03–0.3 mg/mL (24 h culture), inhibiting DHCR24 at the mRNA level. In addition, strain 1 and about 47% at 0.03 mg/mL (40 h culture) (p < 0.05, n = 3) had an inhibitory effect on DHCR7 because it decreased the (Fig. 4C). Strain 3 suppressed DHCR7 early during culture protein level early during culture (15 h culture). However, des- (15 h) and persistently suppressed DHCR24. These data show mosterol significantly accumulated, suggesting that DHCR24 that strain 3 inhibits DHCR7 in the early stage (15 h culture) was more strongly inhibited than DHCR7. and throughout the culture period. Strain 2 decreased the levels of cholesterol, lathosterol, and 7-dehydrocholesterol and increased the level of desmosterol. The mRNA level of DHCR24 was significantly decreased and its protein level was persistently reduced, suggesting that 492 Biol. Pharm. Bull. Vol. 44, No. 4 (2021) strain 2 inhibits the biosynthesis of DHCR24. Moreover, the REFERENCES mRNA level of DHCR7 was significantly increased but its protein level was significantly decreased during 15 and 40 h of 1) Nelson RH. Hyperlipidemia as a risk factor for cardiovascular dis- culture, suggesting that the mRNA level of DHCR7 increased ease. Prim. Care, 40, 195–211 (2013). due to feedback after early inhibition of DHCR7.49) 2) Tanaka A. Postprandial hyperlipidemia and . J. Ath- Strain 3 decreased cholesterol, lathosterol, and eroscler. Thromb., 11, 322–329 (2004). 3) Nakamura K, Miyoshi T, Yunoki K, Ito H. Postprandial hyperlip- 7-dehydrocholesterol levels and increased desmosterol. The idemia as a potential residual risk factor. J. Cardiol., 67, 335–339 mRNA and protein levels of DHCR24 were significantly and (2016). persistently decreased, suggesting that strain 3 inhibits the 4) Shia WC, Ku TH, Tsao YM, Hsia CH, Chang YM, Huang CH, synthesis of DHCR24. Moreover, the mRNA level of DHCR7 Chung YC, Hsu SL, Liang KW, Hsu FR. Genetic copy number vari- was significantly increased but the protein level was sup- ants in myocardial infarction patients with hyperlipidemia. BMC pressed only during early culture (15 h culture), suggesting Genomics, 12(Suppl. 3), S23 (2011). that the mRNA level of DHCR7 increased due to feedback 5) Japan Atherosclerosis Society. Japan Atherosclerosis Society (JAS) after the early inhibition of DHCR7,49) similar to strain 2. guidelines for prevention of atherosclerotic cardiovascular disease. Our findings suggest that L. sakei UONUMA (strains 1–3) Japan Atherosclerosis Society, Tokyo, pp. 80–96 (2017). exhibits a new inhibitory effect on postsqualene cholesterol 6) Lee YS, Huh JY, Nam SH, Moon SK, Lee SB. Enzymatic bio- conversion of citrus hesperidin by Aspergillus sojae naringinase: biosynthesis by inhibiting the mRNA level of DHCR24. In ad- enhanced solubility of hesperetin-7-O-glucoside with in vitro inhibi- dition, all strains weakly inhibited the protein level of DHCR7. tion of human intestinal maltase, HMG-CoA reductase, and growth LK-980 mainly inhibits DHCR7 and results in the accumula- of Helicobacter pylori. Food Chem., 135, 2253–2259 (2012). 23) tion of lathosterol and 7-dehydrocholesterol. L. sakei strains 7) Alvi SS, Iqbal D, Ahmad S, Khan MS. Molecular rationale delineat- 2 and 3 mainly inhibit the synthesis of DHCR24 and weakly ing the role of lycopene as a potent HMG-CoA reductase inhibitor: inhibit DHCR7 as they decrease the levels of lathosterol and in vitro and in silico study. Nat. Prod. Res., 30, 2111–2114 (2016). 7-dehydrocholestrerol (Fig. 5). Only strain 1 increased the 8) Liu G, Zheng X, Xu Y, Lu J, Chen J, Huang X. Long non-coding levels of lathosterol and 7-dehydrocholesterol, and the mRNA RNAs expression profile in HepG2 cells reveals the potential role of levels of DHCR7 did not change significantly. These results long non-coding RNAs in the cholesterol . Chin. Med. may explain the differences in feedback times of strains 1–3, J., 128, 91–97 (2015). although the details remain unclear. L. sakei UONUMA 9) Rong S, Zhao S, Kai X, Zhang L, Zhao Y, Xiao X, Bao W, Liu L. Procyanidins extracted from the litchi pericarp attenuate atheroscle- strains 1–3 reportedly ferment sugars differently,40,41) suggest- rosis and hyperlipidemia associated with consumption of a high fat ing that each strain produces different fermentation products diet in apolipoprotein-E knockout mice. Biomed. Pharmacother., 97, and thus may inhibit different sites on the cholesterol bio- 1639–1644 (2018). synthesis pathway. These strains have been identified using 10) Nakagawa S, Fuwa F, Shimizu-Ohta M, Yamato S. New inhibitiory 42) primers in a random amplified polymorphic DNA assay, effect of Daidzein on desmosterol pathway in HepG2 cells. Interna- although details have not been reported. tional Journal of Analytical Bio-Science, 41, 147–152 (2018). This is the first study to demonstrate the inhibitory effect 11) Müller C, Hemmers S, Bartl N, Plodek A, Körner A, Mirakaj V, of L. sakei UONUMA toward DHCR24 in the cholesterol Giera M, Bracher F. New chemotype of selective and potent inhibi- biosynthesis pathway. The inhibition of DHCR24 leads to tors of human delta 24-dehydrocholesterol reductase. Eur. J. Med. select reprogramming of fatty acid metabolism, activation Chem., 140, 305–320 (2017). 12) Müller C, Junker J, Bracher F, Giera M. A gas chromatography- of LXR target genes, inhibition of SREBP target genes, and mass spectrometry-based whole-cell screening assay for target suppression of inflammatory-response genes, as observed in 13,24–26) identification in distal cholesterol biosynthesis. Nat. Protoc., 14, macrophage foam cells. All L. sakei UONUMA strains 2546–2570 (2019). inhibited DHCR24 in the cholesterol biosynthesis pathways, 13) Körner A, Zhou E, Müller C, Mohammed Y, Herceg S, Bracher suggesting that all strains could be useful for the preven- F, Rensen PCN, Wang Y, Mirakaj V, Giera M. Inhibition of Δ24- tion and treatment of hyperlipidemia. L. sakei UONUMA dehydrocholesterol reductase activates pro-resolving lipid mediator may provide a synergistic effect in lowering cholesterol biosynthesis and inflammation resolution. Proc. Natl. Acad. Sci. when used together with HMGCR inhibitors. Lactobacillus U.S.A., 116, 20623–20634 (2019). spp. are reported to decrease cholesterol levels due to their 14) Pfeifer T, Buchebner M, Chandak PG, Patankar J, Kratzer A, cholesterol-binding ability,33,34) and due to binding35) and Obrowsky S, Rechberger GN, Kadam RS, Kompella UB, Kostner deconjugation33,34) of bile acid, the final metabolite of cho- GM, Kratky D, Levak-Frank S. Synthetic LXR agonist suppresses endogenous cholesterol biosynthesis and efficiently lowers plasma lesterol. L. plantarum inhibits HMGCR during presqualene 36) cholesterol. Curr. Pharm. Biotechnol., 12, 285–292 (2011). cholesterol biosynthesis, suggesting that other Lactobacillus 15) Wages PA, Kim H-YH, Korade Z, Porter NA. Identification spp. may also inhibit cholesterol biosynthesis. and characterization of prescription drugs that change levels of 7-dehydrocholesterol and desmosterol. J. Lipid Res., 59, 1916–1926 Acknowledgments This research was partly supported (2018). by the Regional Revitalization Project of the Cabinet Office, 16) Giera M, Müller C, Bracher F. Analysis and experimental inhibition Government of Japan (A3007). of distal cholesterol biosynthesis. Chromatographia, 78, 343–358 (2015). Conflict of Interest The authors declare no conflict of 17) Giera M, Renard D, Plössl F, Bracher F. Lathosterol side chain am- interest. ides: a new class of human lathosterol oxidase inhibitors. , 73, 299–308 (2008). 18) Genaro-Mattos TC, Tallman KA, Allen LB, Anderson A, Mirnics Supplementary Materials The online version of this ar- K, Korade Z, Porter NA. Dichlorophenyl piperazines, including a ticle contains supplementary materials. Vol. 44, No. 4 (2021) Biol. Pharm. Bull. 493

recently-approved atypical antipsychotic, are potent inhibitors of Wang XH, Liu XW, Wang CL, Lu FG. Effects of two Lactobacillus DHCR7, the last enzyme in cholesterol biosynthesis. Toxicol. Appl. strains on and intestinal microflora in rats fed a Pharmacol., 349, 21–28 (2018). high-cholesterol diet. BMC Complement. Altern. Med., 11, 53 (2011). 19) Kim H-YH, Korade Z, Tallman KA, Liu W, Weaver CD, Mirnics K, 35) Hashimoto H, Yamazaki K, He F, Kawase M, Hosoda M, Hosono Porter NA. Inhibitors of 7-dehydrocholesterol reductase: screening A. Hypocholesterolemic effects of Lactobacillus casei subsp. casei of a collection of pharmacologically active compounds in Neuro2a TMC0409 strain observed in rats fed cholesterol contained diets. cells. Chem. Res. Toxicol., 29, 892–900 (2016). Anim. Sci. J., 70, 90–97 (1999). 20) Dvornik D, Hill P. Effect of long-term administration of AY-9944, 36) Jeon YB, Lee JJ, Chang HC. Characterization of juice fermented an inhibitor of 7-dehydrocholesterol Δ7-reductase, on serum and tis- with Lactobacillus plantarum EM and its cholesterol-lowering sue lipids in the rat. J. Lipid Res., 9, 587–595 (1968). effects on rats fed a high-fat and high-cholesterol diet. Food Sci. 21) Moebius FF, Fitzky BU, Lee JN, Paik YK, Glossmann H. Molecu- Nutr., 7, 3622–3634 (2019). lar cloning and expression of the human Δ7-sterol reductase. Proc. 37) Bredholt S, Nesbakken T, Holck A. Industrial application of an Natl. Acad. Sci. U.S.A., 95, 1899–1902 (1998). antilisterial strain of Lactobacillus sakei as a protective culture and 22) Chevy F, Illien F, Wolf C, Roux C. Limb malformations of rat its effect on the sensory acceptability of cooked, sliced, vacuum- fetuses exposed to a distal inhibitor of cholesterol biosynthesis. packaged meats. Int. J. Food Microbiol., 66, 191–196 (2001). J. Lipid Res., 43, 1192–1200 (2002). 38) Masuda Y, Takahashi T, Yoshida K, Nishitani Y, Mizuno M, Mizo- 23) Acimovic J, Korosec T, Seliskar M, Bjorkhem I, Monostory K, guchi H. TLR ligands of Lactobacillus sakei LK-117 isolated from Szabo P, Pascussi JM, Belic A, Urleb U, Kocjan D, Rozman D. seed mash for brewing sake are potent inducers of IL-12. J. Biosci. Inhibition of human sterolΔ7-reductase and other postlanosterol Bioeng., 112, 363–368 (2011). enzymes by LK-980, a novel inhibitor of cholesterol synthesis. Drug 39) Masuda Y, Takahashi T, Yoshida K, Nishitani Y, Mizuno M, Mizo- Metab. Dispos., 39, 39–46 (2011). guchi H. Anti-allergic effect of lactic acid bacteria isolated from 24) Muse ED, Yu S, Edillor CR, Tao J, Spann NJ, Troutman TD, Seid- seed mash used for brewing sake is not dependent on the total IgE man JS, Henke A, Roland JT, Ozeki KA, Thompson BM, McDon- levels. J. Biosci. Bioeng., 114, 292–296 (2012). ald JG, Bahadorani J, Tsimikas S, Grossman TR, Tremblay MS, 40) Nishiwaki T, Shimojyo A. New lactic acid bacteria and method for Glass CK. Cell-specific discrimination of desmosterol and desmo- producing fermented food using this lactic acid bacteria. Japan Pat- sterol mimetics confers selective regulation of LXR and SREBP ent JP5577559B2 (2014). in macrophages. Proc. Natl. Acad. Sci. U.S.A., 115, E4680–E4689 41) Oguro Y, Nishiwaki T, Shinada R, Kobayashi K, Kurahashi A. (2018). Metabolite profile of koji amazake and its lactic acid fermentation 25) Spann NJ, Garmire LX, McDonald JG, et al. Regulated accumula- by Lactobacillus sakei UONUMA. J. Biosci. Bioeng., 124, tion of desmosterol integrates macrophage lipid metabolism and 178–183 (2017). inflammatory responses. Cell, 151, 138–152 (2012). 42) Nishiwaki T, Shimojyo S. Discrimination of the psychrotrophic lac- 26) Spann NJ, Glass CK. Sterols and in immune cell func- tic acid bacteria Lactobacillus sakei UONUMA strains using PCR. tion. Nat. Immunol., 14, 893–900 (2013). J. Niigata Agri. Res. Inst., 14, 69–73 (2016). 27) Acimovic J, Lövgren-Sandblom A, Monostory K, Rozman D, Gol- 43) Sakurai M, Kubota M, Iguchi A, Shigematsu T, Yamaguchi T, icnik M, Lutjohann D, Björkhem I. Combined gas chromatographic/ Nakagawa S, Kurahashi A, Oguro Y, Nishiwaki T, Aihara K, Sato mass spectrometric analysis of cholesterol precursors and plant S. Effects of koji amazake and its lactic acid fermentation product sterols in cultured cells. J. Chromatogr. B Analyt. Technol. Biomed. by Lactobacillus sakei UONUMA on defecation status in healthy Life Sci., 877, 2081–2086 (2009). volunteers with relatively low stool frequency. Food Sci. Technol. 28) Zheng J, Wittouck S, Salvetti E, Franz CMAP, Harris HMB, Mat- Res., 25, 853–861 (2019). tarelli P, O’Toole PW, Pot B, Vandamme P, Walter J, Watanabe K, 44) Haigh LS, Leatherman GF, O’Hara DS, Smith TW, Galper JB. Wuyts S, Felis GE, Gänzle MG, Lebeer S. A taxonomic note on Effects of low density lipoproteins and mevinolin on cholesterol the genus Lactobacillus: description of 23 novel genera, emended content and muscarinic cholinergic responsiveness in cultured description of the genus Lactobacillus Beijerinck 1901, and union of chick atrial cells. Regulation of levels of muscarinic receptors and Lactobacillaceae and Leuconostocaceae. Int. J. Syst. Evol. Micro- guanine nucleotide regulatory proteins. J. Biol. Chem., 263, 15608– biol., 70, 2782–2858 (2020). 15618 (1988). 29) Zhao X, Qian Y, Li G, Yi R, Park KY, Song JL. Lactobacillus 45) Hirayama S, Nakagawa S, Soda S, Kamimura Y, Nishioka E, Ueno plantarum YS2 (yak yogurt Lactobacillus) exhibited an activity to T, Fukushima Y, Higuchi K, Inoue M, Seino U, Ohmura H, Yamato attenuate activated carbon-induced constipation in male Kunming S, Miida T. Ezetimibe decreases serum oxidized cholesterol without mice. J. Dairy Sci., 102, 26–36 (2019). impairing bile acid synthesis in Japanese hypercholesterolemic pa- 30) Shida K, Suzuki T, Kiyoshima-Shibata J, Shimada S, Nanno M. tients. Atherosclerosis, 230, 48–51 (2013). Essential roles of monocytes in stimulating human peripheral blood 46) Livak KJ, Schmittgen TD. Analysis of relative gene expression data −ΔΔC mononuclear cells with Lactobacillus casei to produce cytokines using real-time quantitative PCR and the 2T method. Methods, and augment natural killer cell activity. Clin. Vaccine Immunol., 13, 25, 402–408 (2001). 997–1003 (2006). 47) Kanda Y. Investigation of the freely available easy-to-use software 31) Kato I, Tanaka K, Yokokura T. Lactic acid bacterium potently ‘EZR’ for medical statistics. Bone Marrow Transplant., 48, 452–458 induces the production of interleukin-12 and interferon-gamma by (2013). mouse splenocytes. Int. J. Immunopharmacol., 21, 121–131 (1999). 48) Bae SH, Paik YK. Cholesterol biosynthesis from lanosterol: devel- 32) Yamamoto N, Akino A, Takano T. Antihypertensive effects of dif- opment of a novel assay method and characterization of rat liver ferent kinds of fermented milk in spontaneously hypertensive rats. microsomal lanosterol Δ24-reductase. Biochem. J., 326, 609–616 Biosci. Biotechnol. Biochem., 58, 776–778 (1994). (1997). 33) Usman, Hosono A. Bile tolerance, taurocholate deconjugation, and 49) Ness GC. Physiological feedback regulation of cholesterol biosyn- binding of cholesterol by Lactobacillus gasseri strains. J. Dairy thesis: role of translational control of hepatic HMG-CoA reductase Sci., 82, 243–248 (1999). and possible involvement of oxylanosterols. Biochim. Biophys. Acta, 34) Xie N, Cui Y, Yin YN, Zhao X, Yang JW, Wang ZG, Fu N, Tang Y, 1851, 667–673 (2015).