Multigene Phylogeny of Cyprinodontiform Fishes Suggests Continental Radiations and a Rogue Taxon Position of Pantanodon

Total Page:16

File Type:pdf, Size:1020Kb

Multigene Phylogeny of Cyprinodontiform Fishes Suggests Continental Radiations and a Rogue Taxon Position of Pantanodon 65 (1): 37 – 44 4.5.2015 © Senckenberg Gesellschaft für Naturforschung, 2015. Multigene phylogeny of cyprinodontiform fishes suggests continental radiations and a rogue taxon position of Pantanodon Moritz Pohl 1, Finn C. Milvertz 2, Axel Meyer 3 & Miguel Vences 1, * 1 Zoological Institute, Technische Universität Braunschweig, Mendelssohnstr. 4, 38106 Braunschweig, Germany. —2 Litorinaparken 27, 2680 Solrød Strand, Denmark — 3 Lehrstuhl für Zoologie und Evolutionsbiologie, Department of Biology, University of Konstanz, 78457 Kon- stanz, Germany — * Corresponding author; m.vences(at)tu-bs.de Accepted 19.ii.2015. Published online at www.senckenberg.de / vertebrate-zoology on 4.v.2015. Abstract We studied phylogenetic relationships among major clades in the tooth carps (Cyprinodontiformes) based on a concatenated DNA se- quence alignment of two mitochondrial and three nuclear gene segments, totalling 2553 bp, in 66 ingroup terminals. The inferred tree sup- ports monophyly of the major tooth carp subgroups, aplocheiloids and cyprinodontoids, and of several aplocheiloid subclades correspond- ing to the well-established families (Aplocheilidae, Nothobranchiidae, Rivulidae), each of which is restricted to major continental settings (India-Madagascar, Africa, South America). Contrary to previous molecular studies, our tree supports a sister-group relationship of the aplocheilids and nothobranchiids, rather than a nothobranchiid-rivulid clade. Within cyprinodontoids, the phylogeny matched more closely continent-scale distribution than current classiication, suggesting that the delimitation of the families Cyprinodontidae, Poeciliidae, and Valenciidae is in need of revision. The East African Pantanodon stuhlmanni did not show close relationships with any other taxon in our analysis, suggesting that the phylogenetic position and classiication of this rogue taxon is in need of further study. Key words Tooth carps; Cyprinodontiformes; Pantanodon; phylogeny; phylogeography; Madagascar. Introduction Tooth carps, order Cyprinodontiformes, comprise kil- model species in evolutionary, developmental, toxico- lifishes, live bearers, as well as several allied forms. logical, and ageing research such as the guppy, sword- According to current classiications C( OSTA, 2012; HUBER, tail, mummichog, and turquoise killifish (e.g., ATZ, 2006; FROESE & PAULY, 2014) this group contains over 1986; REZNICK et al., 2008; JONES et al., 2013; SCHARTL, 1100 species in ca. 125 genera and ten families, allocated 2014). Numerous molecular studies have addressed the to two suborders, Aplocheiloidei and Cyprinodontoidei phylo geny of particular subclades of cyprinodontiforms (PARENTI, 1981). Cyprinodontiforms occur mainly in (e.g., MURPHY & COLLIER, 1997; MURPHY et al., 1998, tropical regions of Africa, South America, Madagascar 1999; HRBEK & MEYER, 2003; DOADRIO & DOMINGUEZ, and South Asia, as well as some temperate waters in 2004; WEBB et al., 2004; HRBEK et al., 2005, 2007; North America and Eurasia, and are part of the acanto- AGNÈSE et al., 2006; COLLIER et al., 2009; JONES et al., morph radiation (NEAR et al., 2013). They comprise many 2013; Sedláček et al., 2014). However, the interre- prominent aquarium ishes and established or emerging lationships among deep cyprinodontiform clades are ISSN 1864-5755 37 Pohl, M. et al.: Multigene phylogeny of cyprinodontiform ishes and taxon position of Pantanodon largely unassessed from a molecular perspective, and Materials and Methods the current higher-level classification of tooth carps is predominantly based on a limited number of emi- nent in-depth morphological studies (PARENTI, 1981; If not indicated as wild caught by precise collecting lo- COSTA, 1998, 2011; HERTWIG, 2008). As an exception, cations (Table 1), samples were from aquarium strains. SETIAMARGA et al. (2008), based on complete mitochon- Voucher specimens of the majority of specimens were drial genome sequences, placed cyprinodontiforms in preserved, labeled with provisional numbers (ZCMV – the Atherinomorpha clade, along with medakas, lying Miguel Vences Zoological Collection) and will be de- ishes, and silversides, and found evidence for mono- posited in the Zoologische Staatssammlung München, phyly of cyprinodontiforms and of the two suborders, Germany. Tissue samples were preserved in pure ethanol. aplocheiloids and cyprinodontoids. DNA was sampled from in clips of the preserved vouch- Understanding cyprinodontiform phylogeny has the ers, or from eggs. Total genomic DNA was extracted from potential to inform studies on the evolution of annual- tissue or swab samples using Proteinase K (10mg/ml) ism and live bearing, and on the biogeographic origins di gestion followed by a standard salt-extraction protocol of these ishes. Traditionally the origins of tooth carps, (BRU FORD et al., 1992). especially those in the Aplocheiloidei, are interpreted as Two markers of the mitochondrial and three markers being a consequence of ancient vicariance (e.g., MURPHY of the nuclear genome were targeted: Segments of the & COLLIER, 1997; SPARKS & SMITH, 2005; SAMONDS et al., mito chondrial genes cytochrome oxidase sub unit I 2012; COSTA, 2013), in particular because their clado- (COX1) and 16S rRNA were ampliied, respectively, genesis largely relects the breakup of the Gondwana with the primers COI-Chmf4 (TYTCWACWAAYCAYA supercontinent in deep Mesozoic times, with the Indian AAGAYATCGG) and COI-Chmr4 (ACYTCRGGRTG Aplocheilus considered being sister to the Malagasy- RCCRAARAATCA) of CHE et al. (2012), and 16SAr-L Seychellean Pachypanchax, and the South Amercan Ri- (CGCCTGTTTATCAAAAACAT) and 16SBr-H vu lidae sister to the African Nothobranchiidae (MURPHY (CCGGTCTGAACTCAGATCACGT) of PALUMBI et al. & COLLIER, 1997; SPARKS & SMITH, 2005). The vicari- (1991). Segments of the nuclear genes for recombination ance hypothesis for aplocheiloid origins however re- activating protein 1 (RAG1), brain super conserved re- quires conirmation as it conlicts with clade ages re- ceptor (SREB2) and glycosyltransferase (GLYT), were covered in several studies (e.g., CROTTINI et al., 2012; ampliied, respectively, with primers L2891_RAG1ex3 NEAR et al., 2012, 2013; BROUGHTON et al., 2013) that (AAGGAGTGYTGYGATGGCATGGG) and H3405_ place the origin of the entire cyprinodontiform clade into RAG1ex3 (GCNGAGACTCCTTTGACTCTGTC) of the latest Mesozoic or early Cenozoic, similar to that of NEAR et al. (2012), and newly developed primers Rag1- cichlids (VENCES et al., 2001; FRIEDMAN et al., 2013). Pachyp-F1 (TGAAAArGCTGTTCGCTTCT), SREB2- Particularly relevant for this aspect of cyprinodontiform Pachyp-F1 (CAyrCTrACCTGCAAAGTGA), SREB2- biogeography are the endemic tooth carps occurring on Pachyp-R1 (CCCATARTGCCARGAAGAAA), GLYT- Madagascar, the fourth largest island of the world. This Pachyp-F2 (CTGAATGAAsCCGAGCTrrTmATGG), island has been separated from all other landmasses GLYT-Pachyp-R1 (CATGGGATCTGCCAAGAGAC). since the Mesozoic and is characterized by a unique and Polymerase chain reactions were performed in a inal highly endemic biota, yet many of its radiations appear volume of 10 μl using 0.3 μM of each primer, 0.25 mM to have originated after its isolation (YODER & NOWAK, of dNTPs, 0.4 U GoTaq and 1.25× Reaction Buffer (Pro- 2006; SAMONDS et al., 2012). Madagascar is inhabited mega). by two native genera of cyprinodontiforms: the genus PCR products were puriied using Exonuclease I and Pachypanchax with currently six Malagasy and one Shrimp Alkaline Phosphatase (SAP) or Antarctic Phos- Seychellean species; and the genus Pantanodon, with phatase (AP) according to the manufacturer’s instruc- one described and one undescribed species known from tions (NEB). Puriied PCR templates were directly se- Madagascar, and one species occurring in Eastern Africa quenced using dye-labeled dideoxy terminator chemistry (SPARKS, 2003; LOISELLE, 2006). So far, no molecular data on an ABI 3130 automated DNA sequencer (Applied are available for Pantanodon, and only one Malagasy Biosystems). We checked chromatograms and corrected species of Pachypanchax has been included in molecular errors manually in CodonCode Aligner 3.5.6 (CodonCode phylogenies (MURPHY & COLLIER, 1997; CROTTINI et al., Corporation). Newly obtained sequences were submitted 2012). to GenBank (accession numbers: KJ844613-KJ844868). As a irst step to improve the understanding of high- Sequences of outgroup taxa were taken from Genbank, er-level cyprinodontiform relationships, we newly deter- and largely correspond to those determined by NEAR et mined a data set of two mitochondrial and three nuclear al. (2012). We used a representative of the Gobiiformes genes for a set of 66 cyprinodontiform terminals. Our (Perccottus) as outgroup and included a series of ather- data set spans seven of the ten currently accepted families iniform, beloniform and perciform species as hierarchical and includes the enigmatic Pantanodon. By highlighting outgroups. various unsolved questions and taxa that merit furter We used MEGA 5 (TAMURA et al., 2011) to align pro- phylogenetic study, we anticipate our study inform and tein-coding sequences (COX1, RAG1, GLYT, SREB2) facilitate future systematic revisions of tooth carps. manually and the non-coding 16S using the MUSCLE 38 V E RT E B R AT E ZO O LOGY — 65 (1) 2015 algorithm. The 16S alignment was subsequently pro- the most divergent within Madagascar, so that monophyly cessed with Gblocks 0.91b software C( ASTRESANA, 2000) of the entire Malagasy clade vs. the single Seychellean with a less stringent 50% threshold for
Recommended publications
  • Article Evolutionary Dynamics of the OR Gene Repertoire in Teleost Fishes
    bioRxiv preprint doi: https://doi.org/10.1101/2021.03.09.434524; this version posted March 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Article Evolutionary dynamics of the OR gene repertoire in teleost fishes: evidence of an association with changes in olfactory epithelium shape Maxime Policarpo1, Katherine E Bemis2, James C Tyler3, Cushla J Metcalfe4, Patrick Laurenti5, Jean-Christophe Sandoz1, Sylvie Rétaux6 and Didier Casane*,1,7 1 Université Paris-Saclay, CNRS, IRD, UMR Évolution, Génomes, Comportement et Écologie, 91198, Gif-sur-Yvette, France. 2 NOAA National Systematics Laboratory, National Museum of Natural History, Smithsonian Institution, Washington, D.C. 20560, U.S.A. 3Department of Paleobiology, National Museum of Natural History, Smithsonian Institution, Washington, D.C., 20560, U.S.A. 4 Independent Researcher, PO Box 21, Nambour QLD 4560, Australia. 5 Université de Paris, Laboratoire Interdisciplinaire des Energies de Demain, Paris, France 6 Université Paris-Saclay, CNRS, Institut des Neurosciences Paris-Saclay, 91190, Gif-sur- Yvette, France. 7 Université de Paris, UFR Sciences du Vivant, F-75013 Paris, France. * Corresponding author: e-mail: [email protected]. !1 bioRxiv preprint doi: https://doi.org/10.1101/2021.03.09.434524; this version posted March 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract Teleost fishes perceive their environment through a range of sensory modalities, among which olfaction often plays an important role.
    [Show full text]
  • A New Genus of Miniature Cynolebiasine from the Atlantic
    64 (1): 23 – 33 © Senckenberg Gesellschaft für Naturforschung, 2014. 16.5.2014 A new genus of miniature cynolebiasine from the Atlantic Forest and alternative biogeographical explanations for seasonal killifish distribution patterns in South America (Cyprinodontiformes: Rivulidae) Wilson J. E. M. Costa Laboratório de Sistemática e Evolução de Peixes Teleósteos, Instituto de Biologia, Universidade Federal do Rio de Janeiro, Caixa Postal 68049, CEP 21944 – 970, Rio de Janeiro, Brasil; wcosta(at)acd.ufrj.br Accepted 21.ii.2014. Published online at www.senckenberg.de/vertebrate-zoology on 30.iv.2014. Abstract The analysis of 78 morphological characters for 16 species representing all the lineages of the tribe Cynopoecilini and three out-groups, indicates that the incertae sedis miniature species ‘Leptolebias’ leitaoi Cruz & Peixoto is the sister group of a clade comprising the genera Leptolebias, Campellolebias, and Cynopoecilus, consequently recognised as the only member of a new genus. Mucurilebias gen. nov. is diagnosed by seven autapomorphies: eye occupying great part of head side, low number of caudal-fin rays (21), distal portion of epural much broader than distal portion of parhypural, an oblique red bar through opercle in both sexes, isthmus bright red in males, a white stripe on the distal margin of the dorsal fin in males, and a red stripe on the distal margin of the anal fin in males.Mucurilebias leitaoi is an endangered seasonal species endemic to the Mucuri river basin. The biogeographical analysis of genera of the subfamily Cynolebiasinae using a dispersal-vicariance, event-based parsimony approach indicates that distribution of South American killifishes may be broadly shaped by dispersal events.
    [Show full text]
  • FAMILY Poeciliidae Bonaparte 1831
    FAMILY Poeciliidae Bonaparte 1831 - viviparous toothcarps, livebearers SUBFAMILY Poeciliinae Bonaparte 1831 - viviparous toothcarps [=Unipupillati, Paecilini, Belonesocini, Cyprinodontidae limnophagae, Gambusiinae, Tomeurinae, Poeciliopsinae, Heterandriini, Guirardinini, Cnesterodontini, Pamphoriini, Xiphophorini, Alfarini, Quintanini, Xenodexiinae, Dicerophallini, Scolichthyinae, Priapellini, Brachyrhaphini, Priapichthyini] GENUS Alfaro Meek, 1912 - livebearers [=Furcipenis, Petalosoma, Petalurichthys] Species Alfaro cultratus (Regan, 1908) - Regan's alfaro [=acutiventralis, amazonum] Species Alfaro huberi (Fowler, 1923) - Fowler's alfaro GENUS Belonesox Kner, 1860 - pike topminnows Species Belonesox belizanus Kner, 1860 - pike topminnow [=maxillosus] GENUS Brachyrhaphis Regan, 1913 - viviparous toothcarps [=Plectrophallus, Trigonophallus] Species Brachyrhaphis cascajalensis (Meek & Hildebrand, 1913) - Río Cascajal toothcarp Species Brachyrhaphis episcopi (Steindachner, 1878) - Obispo toothcarp [=latipunctata] Species Brachyrhaphis hartwegi Rosen & Bailey, 1963 - Soconusco gambusia Species Brachyrhaphis hessfeldi Meyer & Etzel, 2001 - Palenque toothcarp Species Brachyrhaphis holdridgei Bussing, 1967 - Tronadora toothcarp Species Brachyrhaphis olomina (Meek, 1914) - Orotina toothcarp Species Brachyrhaphis parismina (Meek, 1912) - Parismina toothcarp Species Brachyrhaphis punctifer (Hubbs, 1926) - Quibari Creek toothcarp Species Brachyrhaphis rhabdophora (Regan, 1908) - Río Grande de Terraba toothcarp [=tristani] Species Brachyrhaphis roseni
    [Show full text]
  • The Evolution of the Placenta Drives a Shift in Sexual Selection in Livebearing Fish
    LETTER doi:10.1038/nature13451 The evolution of the placenta drives a shift in sexual selection in livebearing fish B. J. A. Pollux1,2, R. W. Meredith1,3, M. S. Springer1, T. Garland1 & D. N. Reznick1 The evolution of the placenta from a non-placental ancestor causes a species produce large, ‘costly’ (that is, fully provisioned) eggs5,6, gaining shift of maternal investment from pre- to post-fertilization, creating most reproductive benefits by carefully selecting suitable mates based a venue for parent–offspring conflicts during pregnancy1–4. Theory on phenotype or behaviour2. These females, however, run the risk of mat- predicts that the rise of these conflicts should drive a shift from a ing with genetically inferior (for example, closely related or dishonestly reliance on pre-copulatory female mate choice to polyandry in conjunc- signalling) males, because genetically incompatible males are generally tion with post-zygotic mechanisms of sexual selection2. This hypoth- not discernable at the phenotypic level10. Placental females may reduce esis has not yet been empirically tested. Here we apply comparative these risks by producing tiny, inexpensive eggs and creating large mixed- methods to test a key prediction of this hypothesis, which is that the paternity litters by mating with multiple males. They may then rely on evolution of placentation is associated with reduced pre-copulatory the expression of the paternal genomes to induce differential patterns of female mate choice. We exploit a unique quality of the livebearing fish post-zygotic maternal investment among the embryos and, in extreme family Poeciliidae: placentas have repeatedly evolved or been lost, cases, divert resources from genetically defective (incompatible) to viable creating diversity among closely related lineages in the presence or embryos1–4,6,11.
    [Show full text]
  • Deterministic Shifts in Molecular Evolution Correlate with Convergence to Annualism in Killifishes
    bioRxiv preprint doi: https://doi.org/10.1101/2021.08.09.455723; this version posted August 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Deterministic shifts in molecular evolution correlate with convergence to annualism in killifishes Andrew W. Thompson1,2, Amanda C. Black3, Yu Huang4,5,6 Qiong Shi4,5 Andrew I. Furness7, Ingo, Braasch1,2, Federico G. Hoffmann3, and Guillermo Ortí6 1Department of Integrative Biology, Michigan State University, East Lansing, Michigan 48823, USA. 2Ecology, Evolution & Behavior Program, Michigan State University, East Lansing, MI, USA. 3Department of Biochemistry, Molecular Biology, Entomology, & Plant Pathology, Mississippi State University, Starkville, MS 39759, USA. 4Shenzhen Key Lab of Marine Genomics, Guangdong Provincial Key Lab of Molecular Breeding in Marine Economic Animals, BGI Marine, Shenzhen 518083, China. 5BGI Education Center, University of Chinese Academy of Sciences, Shenzhen 518083, China. 6Department of Biological Sciences, The George Washington University, Washington, DC 20052, USA. 7Department of Biological and Marine Sciences, University of Hull, UK. Corresponding author: Andrew W. Thompson, [email protected] bioRxiv preprint doi: https://doi.org/10.1101/2021.08.09.455723; this version posted August 10, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract: The repeated evolution of novel life histories correlating with ecological variables offer opportunities to test scenarios of convergence and determinism in genetic, developmental, and metabolic features. Here we leverage the diversity of aplocheiloid killifishes, a clade of teleost fishes that contains over 750 species on three continents.
    [Show full text]
  • Ecosystem Profile Madagascar and Indian
    ECOSYSTEM PROFILE MADAGASCAR AND INDIAN OCEAN ISLANDS FINAL VERSION DECEMBER 2014 This version of the Ecosystem Profile, based on the draft approved by the Donor Council of CEPF was finalized in December 2014 to include clearer maps and correct minor errors in Chapter 12 and Annexes Page i Prepared by: Conservation International - Madagascar Under the supervision of: Pierre Carret (CEPF) With technical support from: Moore Center for Science and Oceans - Conservation International Missouri Botanical Garden And support from the Regional Advisory Committee Léon Rajaobelina, Conservation International - Madagascar Richard Hughes, WWF – Western Indian Ocean Edmond Roger, Université d‘Antananarivo, Département de Biologie et Ecologie Végétales Christopher Holmes, WCS – Wildlife Conservation Society Steve Goodman, Vahatra Will Turner, Moore Center for Science and Oceans, Conservation International Ali Mohamed Soilihi, Point focal du FEM, Comores Xavier Luc Duval, Point focal du FEM, Maurice Maurice Loustau-Lalanne, Point focal du FEM, Seychelles Edmée Ralalaharisoa, Point focal du FEM, Madagascar Vikash Tatayah, Mauritian Wildlife Foundation Nirmal Jivan Shah, Nature Seychelles Andry Ralamboson Andriamanga, Alliance Voahary Gasy Idaroussi Hamadi, CNDD- Comores Luc Gigord - Conservatoire botanique du Mascarin, Réunion Claude-Anne Gauthier, Muséum National d‘Histoire Naturelle, Paris Jean-Paul Gaudechoux, Commission de l‘Océan Indien Drafted by the Ecosystem Profiling Team: Pierre Carret (CEPF) Harison Rabarison, Nirhy Rabibisoa, Setra Andriamanaitra,
    [Show full text]
  • Diversity of the Southern Africa
    A peer-reviewed open-access journal ZooKeys 923: 91–113Diversity (2020) within the southern Africa Lacustricola and species redescriptions 91 doi: 10.3897/zookeys.923.48420 RESEARCH ARTICLE http://zookeys.pensoft.net Launched to accelerate biodiversity research Diversity of the southern Africa Lacustricola Myers, 1924 and redescription of Lacustricola johnstoni (Günther, 1894) and Lacustricola myaposae (Boulenger, 1908) (Cyprinodontiformes, Procatopodidae) Pedro H.N. Bragança1, Ryan M. van Zeeventer1, Roger Bills1, Denis Tweddle1, Albert Chakona1,2 1 South African Institute for Aquatic Biodiversity, Private Bag 1015, Grahamstown, 6140, South Africa 2 Department of Ichthyology and Fisheries Science, Rhodes University, Grahamstown, South Africa Corresponding author: Pedro H.N. Bragança ([email protected]) Academic editor: N. Bogutskaya | Received 13 November 2019 | Accepted 20 January 2020 | Published 1 April 2020 http://zoobank.org/F138D1ED-8A51-4628-8829-9617AC5D3029 Citation: Bragança PHN, van Zeeventer RM, Bills R, Tweddle D, Chakona A (2020) Diversity of the southern Africa Lacustricola Myers, 1924 and redescription of Lacustricola johnstoni (Günther, 1894) and Lacustricola myaposae (Boulenger, 1908) (Cyprinodontiformes, Procatopodidae). ZooKeys 923: 91–113. https://doi.org/10.3897/ zookeys.923.48420 Abstract Through the analysis of a comprehensive database of COI sequences, with the sequencing of 48 speci- mens, a first insight into the genetic diversity, distribution and relationships between the southern Africa “Lacustricola” species is presented. Species from “Lacustricola” occur mainly in freshwater systems within the arid savanna, and are considered to be widely distributed in southern Africa, but most of them are data deficient taxa. Two species are redescribed, “Lacustricola” johnstoni (Günther, 1894) and “Lacustri- cola” myaposae (Boulenger, 1908), based on specimens collected at their respective type localities.
    [Show full text]
  • 2010 by Lee Harper, 2011-2018 Compiled by R. Mccabe .Xls
    JAKA INDEX 1962- 2010 by Lee Harper, 2011-2018 compiled by R. McCabe .xls First Last Document Volume Issue Year Date Title Author Page Page Killie Notes 1 1 1962 3 4 February-62 A Chartered Flight Albert J. Klee Killie Notes 1 1 1962 5 5 February-62 Ballot Tabulation Killie Notes 1 1 1962 6 6 February-62 A Message from the Board of Trustees Albert J. Klee Killie Notes 1 1 1962 7 7 February-62 Why Not Panchax Albert J. Klee Killie Notes 1 1 1962 8 10 February-62 Remarks on the Identification of Three Aphyosemions Albert J. Klee Killie Notes 1 1 1962 11 11 February-62 Flash... Just in from New York City Killie Notes 1 1 1962 12 12 February-62 Help for Beginning Killie fanciers Killie Notes 1 1 1962 12 12 February-62 A few remarks on sending eggs Killie Notes 1 1 1962 12 12 February-62 Egg listings start in March Killie Notes 1 1 1962 13 13 February-62 Let's support the AKA Killie Notes 1 1 1962 13 13 February-62 Our new Roster Killie Notes 1 1 1962 13 14 February-62 Editorially speaking Killie Notes 1 1 1962 14 15 February-62 George Maier addresses Chicago Group Killie Notes 1 1 1962 15 15 February-62 Wamted for research Purposes -Cubanichthys cubanensis Neal R. Foster Killie Notes 1 2 1962 3 4 March-62 Report from your Board of Trustees Albert J. Klee Killie Notes 1 2 1962 5 7 March-62 The Egg Bank (N.
    [Show full text]
  • A Replacement Name for the Preoccupied Genus Name Adamas Huber, 1979 (Actinopterygii: Cyprinodontiformes)
    _____________Mun. Ent. Zool. Vol. 1, No. 1, January 2006___________ 167 A REPLACEMENT NAME FOR THE PREOCCUPIED GENUS NAME ADAMAS HUBER, 1979 (ACTINOPTERYGII: CYPRINODONTIFORMES) Hüseyin Özdikmen*, Nazmi Polat**, Mahmut Yılmaz*** and Okan Yazıcıoğlu*** * Gazi Üniversitesi, Fen-Edebiyat Fakültesi, Biyoloji Bölümü, 06500 Ankara / TÜRKİYE, e-mail: [email protected] ** Gazi Üniversitesi, Fen-Edebiyat Fakültesi, Biyoloji Bölümü, 06500 Ankara / TÜRKİYE, e-mail: [email protected] *** Gazi Üniversitesi, Fen-Edebiyat Fakültesi, Biyoloji Bölümü, 06500 Ankara / TÜRKİYE, e-mails: [email protected]; [Özdikmen, H., Polat, N., Yılmaz, M. & Yazıcıoğlu, O. 2006. A replacement name for the preoccupied genus name Adamas Huber, 1979 (Actinopterygii: Cyprinodontiformes). Munis Entomology & Zoology, 1 (1): 167-168] ABSTRACT: A replacement name, Fenerbahce is proposed for the genus name Adamas Huber, 1979 in the fish family Aplocheilidae (Cyprinodontiformes). KEY WORDS: Fenerbahce, Adamas, homonymy, replacement name, Actinopterygii, Cyprinodontiformes, Aplocheilidae. Class Actinopterygii Order Cyprinodontiformes Family Aplocheilidae Genus Fenerbahce nom. nov. Adamas Huber, 1979. Journal Am. Killifish Ass. 12 (6): 166 and Revue fr. Aquariol. Herpetol. 6 (1): 6. (Actinopterygii: Cyprinodontiformes: Aplocheiloidei: Aplocheilidae: Aplocheilinae). Preoccupied by Adamas Malaise, 1945. Opusc. ent., Lund, Suppl. 4, 97. (Hymenoptera: Symphyta: Tenthredinoidea: Tenthredinidae: Allantinae: Adamasini). The genus name Adamas was proposed by Malaise, 1945 as an objective replacement name of the genus Dinax Konow, 1897 with the type species Dinax jakowleffi Konow, 1897. For the present, the genus Adamas Malaise, 1945 includes six species (Wei, 2004). Subsequently, the genus Adamas was described by Huber, 1979 with the type species Adamas formosus Huber, 1979 by monotypy from in front of Ntokou village near the banks of Likouala-Mossaka River, Congo.
    [Show full text]
  • Monophyly and Taxonomy of the Neotropical Seasonal Killifish Genus Leptolebias (Teleostei: Aplocheiloidei: Rivulidae), with the Description of a New Genus
    Zoological Journal of the Linnean Society, 2008, 153, 147–160. With 11 figures Monophyly and taxonomy of the Neotropical seasonal killifish genus Leptolebias (Teleostei: Aplocheiloidei: Rivulidae), with the description of a new genus WILSON J. E. M. COSTA* Downloaded from https://academic.oup.com/zoolinnean/article/153/1/147/2606377 by guest on 23 November 2020 Laboratório de Ictiologia Geral e Aplicada, Departamento de Zoologia, Universidade Federal do Rio de Janeiro, Caixa Postal 68049, CEP 21944-970, Rio de Janeiro, Brazil Received 30 March 2007; accepted for publication 4 July 2007 A phylogenetic analysis based on morphological characters indicates that Leptolebias Myers, 1952, a genus of small killifishes highly threatened with extinction, from Brazil, is paraphyletic. As a consequence, Leptolebias is restricted in this study to a well-supported clade that includes Leptolebias marmoratus (Ladiges, 1934), Leptolebias splendens (Myers, 1942), Leptolebias opalescens (Myers, 1942), and Leptolebias citrinipinnis (Costa, Lacerda & Tanizaki, 1988), from the coastal plains of Rio de Janeiro, and Leptolebias aureoguttatus (Cruz, 1974) (herein redescribed, and for which a lectotype is designated) and Leptolebias itanhaensis sp. nov., from the coastal plains of São Paulo and Paraná, in southern Brazil. Leptolebias is diagnosed by three synapomorphies: a caudal fin that is longer than deep, a single anterior supraorbital neuromast, and dark pigmentation that does not extend to the distal portion of the dorsal fin in males. A key is provided for the identification of species of Leptolebias. Three species formerly placed in Leptolebias, Leptolebias minimus (Myers, 1942), Leptolebias fractifasciatus (Costa, 1988), and Leptolebias cruzi (Costa, 1988), are transferred to Notholebias gen.
    [Show full text]
  • The Neotropical Genus Austrolebias: an Emerging Model of Annual Killifishes Nibia Berois1, Maria J
    lopmen ve ta e l B D io & l l o l g e y C Cell & Developmental Biology Berois, et al., Cell Dev Biol 2014, 3:2 ISSN: 2168-9296 DOI: 10.4172/2168-9296.1000136 Review Article Open Access The Neotropical Genus Austrolebias: An Emerging Model of Annual Killifishes Nibia Berois1, Maria J. Arezo1 and Rafael O. de Sá2* 1Departamento de Biologia Celular y Molecular, Facultad de Ciencias, Universidad de la República, Montevideo, Uruguay 2Department of Biology, University of Richmond, Richmond, Virginia, USA *Corresponding author: Rafael O. de Sá, Department of Biology, University of Richmond, Richmond, Virginia, USA, Tel: 804-2898542; Fax: 804-289-8233; E-mail: [email protected] Rec date: Apr 17, 2014; Acc date: May 24, 2014; Pub date: May 27, 2014 Copyright: © 2014 Rafael O. de Sá, et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Abstract Annual fishes are found in both Africa and South America occupying ephemeral ponds that dried seasonally. Neotropical annual fishes are members of the family Rivulidae that consist of both annual and non-annual fishes. Annual species are characterized by a prolonged embryonic development and a relatively short adult life. Males and females show striking sexual dimorphisms, complex courtship, and mating behaviors. The prolonged embryonic stage has several traits including embryos that are resistant to desiccation and undergo up to three reversible developmental arrests until hatching. These unique developmental adaptations are closely related to the annual fish life cycle and are the key to the survival of the species.
    [Show full text]
  • Draft Risk Assessment Report Nothobranchius Furzeri (Turquoise
    APPLICATION TO AMEND THE LIST OF SPECIMENS SUITABLE FOR LIVE IMPORT Draft Risk Assessment Report 1. Taxonomy of the species a. Family name: Aplocheilidae b. Genus name: Nothobranchius c. Species: N. furzeri d. Subspecies: No e. Taxonomic Reference: http://www.uniprot.org/taxonomy/105023 f. Common Names: Turquoise killifish g. Is the species a genetically-modified organism (GMO)? No 2. Status of the species under CITES Species is not listed in the CITES Appendices. 3. Ecology of the species a. Longevity: what is the average lifespan of the species in the wild and in captivity? The average lifespan of the species in captivity is 13 weeks (1). Wild derived N. furzeri from three different habitats showed a maximum lifespan of 25-32 weeks (1). b. What is the maximum length and weight that the species attains? Provide information on the size and weight range for males and females of the species. As per the original formal description of the species, the standard length of N. furzeri from a wild population ranged from 2.5cm to 4.4cm (2). The maximum length the species can attain is 7cm (3). The mean maximal body weight reported for males is 3.8 ± 1.1 g (range: 0.5 – 6.7 g) and 2.2 ± 0.6 g (range: 0.2 - 3.6 g) for females (4). Growth rates of Nothobranchius in the wild have been reported to be similar to those in captivity (5). c. Discuss the identification of the individuals in this species, including if the sexes of the species are readily distinguishable, and if the species is difficult to distinguish from other species.
    [Show full text]