DOCSLIB.ORG

A Novel Clade of Sporocarp-Forming Species of Glomeromycotan Fungi in the Diversisporales Lineage

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
A Novel Clade of Sporocarp-Forming Species of Glomeromycotan Fungi in the Diversisporales Lineage View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by RERO DOC Digital Library Mycol Progress (2007) 6:35–44 DOI 10.1007/s11557-007-0524-2 ORIGINAL ARTICLE A novel clade of sporocarp-forming species of glomeromycotan fungi in the Diversisporales lineage Dirk Redecker & Philipp Raab & Fritz Oehl & Francisco J. Camacho & Regis Courtecuisse Received: 13 October 2006 /Revised: 12 January 2007 /Accepted: 12 January 2007 / Published online: 14 February 2007 # German Mycological Society and Springer-Verlag 2007 Abstract In the early times of taxonomy of arbuscular porales. The phylogenetic divergence from other known mycorrhizal fungi (Glomeromycota), exclusively sporo- species suggests that this clade may constitute a new genus. carpic species were described. Since then the focus has These findings will have important consequences for taxon mainly shifted to species forming spores singly. For many definition in the Diversisporales. They will facilitate of the sporocarpic species, no molecular data have been identification of these fungi using rDNA sequences within made available, and their phylogenetic position has colonized roots or the environment. remained unclear. We obtained small subunit ribosomal rDNA and internal transcribed spacer data from specimens of glomeromycotan sporocarps from tropical areas that were assigned to three morphospecies. The complete Introduction sequence of the 18S small rDNA subunit sequence, internal transcribed spacers (ITS) 1 and 2 and 5.8S rDNA subunit, Arbuscular mycorrhiza is a symbiosis formed by the vast was determined from a sporocarp of Glomus fulvum. Partial majority of land plants. In this interaction, the plant partner sequences of the small subunit and the other regions were provides carbohydrates to the fungal symbiont, which obtained from Glomus pulvinatum and the newly described improves the uptake of mineral nutrients using its fine species Glomus megalocarpum. Molecular phylogenetic hyphal network. Approximately 200 morphospecies of analyses placed all species analyzed as a monophyletic arbuscular mycorrhizal fungi in ten genera have been sister group to the Diversispora spurca/Glomus versiforme described, mostly based on spore morphology. These fungi clade group (“Glomus group C”) within the Diversis- were previously placed in the family Endogonaceae (Gerdemann and Trappe 1974), later in the order Glomales of the Zygomycota (Morton and Benny 1990). Recently, a Taxonomic novelties: Glomus megalocarpum D. Redecker : : separate phylum Glomeromycota was established for them D. Redecker (*) P. Raab F. Oehl (Schüßler et al. 2001). As the spore morphology is rather Botanical Institute, University of Basel, simple in many species, molecular phylogenetic methods Hebelstrasse 1, Basel 4056, Switzerland have helped to clarify the evolutionary relationships in the e-mail: [email protected] Glomeromycota (Redecker and Raab 2006). One result of these analyses was that the largest genus Glomus, with F. J. Camacho about 70 species, is polyphyletic (Redecker et al. 2000a; Department of Environmental Science, University of California, Riverside, CA 92521, USA Schwarzott et al. 2001). Fungi falling within the previous morphological definition of Glomus have been shown to be R. Courtecuisse in at least four different monophyletic lineages. In fact, Faculté des sciences pharmaceutiques et biologiques, some dimorphic species even form glomoid spores as well Département de Botanique, B.P. 83, as other types of spores (Redecker et al. 2000a). Some of 59006 Lille Cedex, France these lineages were separated in the new genera (Morton 36 Mycol Progress (2007) 6:35–44 and Redecker 2001), partly based on molecular characters. sporocarps were collected on the Caribbean islands of One remaining clade of Glomus comprises Glomus group A Guadeloupe and Martinique in August/September 2005 by (e.g. G. intraradices, G. mosseae) and group B (e.g. G. Christophe Lécuru. Details were as follows: specimen CL/ etunicatum, G. claroideum), which are rather distantly Mart05-35: Ste. Luce, Forêt départementalo-domaniale de related but still form a monophyletic group together Montravail, on forest floor; specimen CL/Mart05-049: Case (Schwarzott et al. 2001). pilote, Crête Jean Louis (Martinique), fruiting on dead Another Glomus clade, referred to as Glomus group C, is wood; specimen CL/Guad05-51: Vieux-Fort (Guadeloupe), more closely related to the Acaulosporaceae in rDNA Ravine Blondeau, mesophile forest, on forest floor, close to phylogenies. It comprises the species G. versiforme, G. Boletellus sp.; specimen CL/Mart05-111: Forêt départa- spurcum, and G. aurantium, as well as an isolate fitting the mentalo-domaniale de La Source Berry (Martinique), morphological definition of G. etunicatum,whichis plantation of mahogany with indigenous species. otherwise thought to belong to group B. Glomus group C Slides to examine the spore morphology were obtained was recently defined as a new family Diversisporaceae with by scratching a few spores from the surface of cross- Diversispora spurca as type species of the new genus sections and embedding them into Polyvinyl alcohol (Walker and Schüßler 2004). Other species have not been lactoglycerol (PVLG, Koske and Tessier 1983). Pictures formally renamed. Because of the scarcity of morphological of the whole sporocarps or parts of them were taken using a characteristics on the light microscopic level that could aid Hewlett Packard ScanJet 5470 flatbed scanner at maximum separation from other Glomus species, signature sequences resolution (2,400 dpi). Microscopical pictures of the spores in the 18S ribosomal subunit were used for the definition of were taken with an Olympus DP70-CU CCD camera Diversispora as well as the corresponding family and order. attached to a Zeiss Axioplan compound microscope equipped Numerous Glomus species form sporocarps, which with differential interference contrast optics. For size mea- mostly are relatively undifferentiated assemblages of surements, 20 spores of each specimen were used, unless spores. An exception are some of the species previously indicated otherwise. Colors were described as a percentage of placed in the genus Sclerocystis. However, it was shown CMYK values using the INVAM color chart (http://invam. that Sclerocystis is an advanced clade within a group of caf.wvu.edu/otherinfo/articles/colorchart.htm). well-defined nonsporocarpic Glomus group A species DNA was extracted from 10 mg subsamples using a (Redecker et al. 2000b). Generally, the sporocarp-forming Qiagen DNeasy Plant Mini Kit (Qiagen, Hilden, Germany). habit is not well correlated with phylogeny, and sporocarpic Polymerase chain reaction (PCR) was conducted in two as well as nonsporocarpic representatives can be found in steps as a nested PCR using various primer combinations. different phylogenetic groups. Very often, sporocarp for- For amplifying the complete 18S small subunit of specimen mers are closely related to species forming spores singly in 1, universal primers were used (White et al. 1990). the soil, or a single species is known to form sporocarpic Preliminary experiments with universal primers had shown and nonsporocarpic spores (e.g. G. mosseae, G. corona- that the specimens belonged to the Diversisporales clade. tum). Early taxonomy of the Glomales focused very much Therefore, a primer was designed for specific amplification on sporocarpic species, a trend that has not continued of the 3′ end of the small subunit and the ITS of this lineage recently. The phylogenetic relationships of many of the (GLOC1355: TCTTAGAGGGACTATTGGCATTT). It was sporocarpic species listed in the groundbreaking study of used in the second step of the nested PCR together with Gerdemann and Trappe (1974) have not been elucidated. ITS4i (Redecker et al. 2003), as second primer. In the first Therefore, it is impossible to recognize these taxa if they PCR step primers NS5/ITS4 (White et al. 1990) were used. are detected by molecular methods within colonized roots. Cycling parameters were as described by Hijri et al. (2006). In this study, we sequenced regions of the ribosomal PCR products were ligated into pGEM-T (Promega, rDNA of some sporocarpic glomeromycotan species col- Wallisellen, Switzerland) and used to transform competent lected in tropical regions to elucidate their phylogenetic Escherichia coli DH5alpha. Clones were screened by blue/ relationships and to allow the design of specific primers for white screening and colony PCR and sequenced in both molecular detection of these species. directions using a Applied Biosystems Prism Dye Termi- nator 3.1 kit on an ABI 310 capillary sequencer (Applied Biosystems, Foster City, USA). Materials and methods Sequence Navigator (Applied Biosystems) and Bio Edit (Hall 1999) were used to proofread and assemble the Specimen AC/Pohn99-001 was collected by Francisco J. sequences. The near-complete sequence of the small Camacho in 1999 in a native forest at the ridge trail near the subunit was assembled from sequenced fragments using top of Sokehs Mountain on the pacific island of Pohnpei, variable regions for verifying that the fragments were from Federated States of Micronesia (6.97°N 158.22°E). Other the same organism. To exclude chimaera formation, the Mycol Progress (2007) 6:35–44 37 fragments were subjected separately to phylogenetic anal- Table 1 Specimens studied and sequences obtained from them ysis in PAUP* 4 (Swofford 2001). Moreover, the sequences Species Specimen Origin Sequences were tested using
Load more

Recommended publications
  • Sacculospora Felinovii, a Novel Arbuscular Mycorrhizal Fungal Species (Glomeromycota) from Dunes on the West Coast of India
    Mycol Progress (2016) 15:791–798 DOI 10.1007/s11557-016-1208-6 ORIGINAL ARTICLE Sacculospora felinovii, a novel arbuscular mycorrhizal fungal species (Glomeromycota) from dunes on the west coast of India Andy Willis1,2 & Janusz Błaszkowski3 & Tanvi Prabhu 1 & Gerard Chwat3 & Anna Góralska3 & Burla Sashidhar 4 & Phil Harris2 & James D’Souza1 & Jyoti Vaingankar1 & Alok Adholeya4 Received: 12 January 2016 /Revised: 11 June 2016 /Accepted: 14 June 2016 /Published online: 27 June 2016 # German Mycological Society and Springer-Verlag Berlin Heidelberg 2016 Abstract During an arbuscular mycorrhiza fungal spore Keywords Entrophosporoid spore . Molecular phylogeny . survey on a primary coastal sand-dune system in Goa Morphology . Tropical coastal dunes on the west coast of India, entrophosporoid spores tight- ly covered with a dense hyphal mantle were recovered. When intact, the spores, at first sight, seemed to be Introduction identical in morphology to those of Sacculospora baltica (originally described as Entrophospora baltica) Of the ca. 280 described arbuscular mycorrhizal fungal extracted from Polish maritime sand dunes and, to date, (AMF) species of the phylum Glomeromycota C. Walker & the sole member of the recently described genus A. Schüßler, only five form spores inside the neck of a Sacculospora in the new family Sacculosporaceae, phy- sporiferous saccule (Błaszkowski 2012). From one side, the lum Glomeromycota. Later detailed morphological stud- neck is continuous with a mycorrhizal extraradical hypha and ies indicated that both fungi produce two-walled spores from the other side, the neck passes into a globose to ellipsoi- but the structure and phenotypic features of components dal saccule. Contents from both structures are used in spore of the outer spore wall in the novel fungus differ con- genesis.
    [Show full text]
  • Belowground Microbial Processes Underpin Forest Productivity
    Belowground Microbial Processes Underpin Forest Productivity By C. Y. LI1) & E. STRZELCZYK2) Key words : Microbial processes, ecological functions, microbial interactions. Summary LI C. Y. & STRZELCZYK E. 2000. Belowground microbial processes underpin forest pro- ductivity. - Phyton (Horn, Austria) 40 (4): (129) - (134). Nitrogen-fixing bacteria associated with mycorrhizal fungi and mycorrhizas can be dem- onstrated with microaerophilic procedures. The chemical substrates in mycorrhizal fungi or mycorrhizas often stimulate the growth and nitrogenase activity of the associated N2 fixers. In addition, the associ- ated N2 fixers are producers of plant-growth-promoting substances and B-group vitamins. Combined inoculation of mycorrhizal fungi with N2 fixers enhances mycorrhiza formation. Other microbes in the mycorrhizosphere have capacities to breakdown primary minerals, thereby releasing nutrients available for uptake by plants. Thus, land restoration can be achieved by planting trees with nitrogen-fixing and rock weathering capacities, such as alders and some pines. The treatment can enhance nutrient availability and increase soil organic matter that provides organic substrate for nutri- ent release, maintain soil structure and enhance water-holding capacity. Also changes in tree species compositions on the site are likely to alter belowground processes through changes in functional processes of organisms that constitute ecosystems. Introduction Soil microbial populations are metabolically active in the mycorrhizosphere, where a continuous
    [Show full text]
  • Fossil Fungi with Suggested Affinities to the Endogonaceae from the Middle Triassic of Antarctica
    KU ScholarWorks | http://kuscholarworks.ku.edu Please share your stories about how Open Access to this article benefits you. Fossil fungi with suggested affinities to the Endogonaceae from the Middle Triassic of Antarctica by Michael Krings. Thomas N. Taylor, Nora Dotzler, and Gianna Persichini 2012 This is the published version of the article, made available with the permission of the publisher. The original published version can be found at the link below. [Citation] Published version: http://www.dx.doi.org/10.3852/11-384 Terms of Use: http://www2.ku.edu/~scholar/docs/license.shtml KU ScholarWorks is a service provided by the KU Libraries’ Office of Scholarly Communication & Copyright. Mycologia, 104(4), 2012, pp. 835–844. DOI: 10.3852/11-384 # 2012 by The Mycological Society of America, Lawrence, KS 66044-8897 Fossil fungi with suggested affinities to the Endogonaceae from the Middle Triassic of Antarctica Michael Krings1 INTRODUCTION Department fu¨ r Geo- und Umweltwissenschaften, Pala¨ontologie und Geobiologie, Ludwig-Maximilians- Documenting the evolutionary history of fungi based Universita¨t, and Bayerische Staatssammlung fu¨r on fossils is generally hampered by the incompleteness Pala¨ontologie und Geologie, Richard-Wagner-Straße 10, of the fungal fossil record (Taylor et al. 2011). Only a 80333 Munich, Germany, and Department of Ecology few geologic deposits have yielded fungal fossils and Evolutionary Biology, and Natural History preserved in sufficient detail to permit assignment to Museum and Biodiversity Research Institute, University of Kansas, Lawrence, Kansas 66045 any one of the major lineages of fungi with any degree of confidence. Perhaps the most famous of these Thomas N.
    [Show full text]
  • Fungal Evolution: Major Ecological Adaptations and Evolutionary Transitions
    Biol. Rev. (2019), pp. 000–000. 1 doi: 10.1111/brv.12510 Fungal evolution: major ecological adaptations and evolutionary transitions Miguel A. Naranjo-Ortiz1 and Toni Gabaldon´ 1,2,3∗ 1Department of Genomics and Bioinformatics, Centre for Genomic Regulation (CRG), The Barcelona Institute of Science and Technology, Dr. Aiguader 88, Barcelona 08003, Spain 2 Department of Experimental and Health Sciences, Universitat Pompeu Fabra (UPF), 08003 Barcelona, Spain 3ICREA, Pg. Lluís Companys 23, 08010 Barcelona, Spain ABSTRACT Fungi are a highly diverse group of heterotrophic eukaryotes characterized by the absence of phagotrophy and the presence of a chitinous cell wall. While unicellular fungi are far from rare, part of the evolutionary success of the group resides in their ability to grow indefinitely as a cylindrical multinucleated cell (hypha). Armed with these morphological traits and with an extremely high metabolical diversity, fungi have conquered numerous ecological niches and have shaped a whole world of interactions with other living organisms. Herein we survey the main evolutionary and ecological processes that have guided fungal diversity. We will first review the ecology and evolution of the zoosporic lineages and the process of terrestrialization, as one of the major evolutionary transitions in this kingdom. Several plausible scenarios have been proposed for fungal terrestralization and we here propose a new scenario, which considers icy environments as a transitory niche between water and emerged land. We then focus on exploring the main ecological relationships of Fungi with other organisms (other fungi, protozoans, animals and plants), as well as the origin of adaptations to certain specialized ecological niches within the group (lichens, black fungi and yeasts).
    [Show full text]
  • Taxonomic Characteristic of Arbuscular Mycorrhizal Fungi-A Review
    International Journal of Microbiological Research 5 (3): 190-197, 2014 ISSN 2079-2093 © IDOSI Publications, 2014 DOI: 10.5829/idosi.ijmr.2014.5.3.8677 Taxonomic Characteristic of Arbuscular Mycorrhizal Fungi-A Review Rafiq Lone, Shuchi Agarwal and K.K. Koul School of Studies in Botany, Jiwaji University Gwalior (M.P)-474011, India Abstract: Arbuscular mycorrhizal fungi (AMF) have mutualistic relationships with more than 80% of terrestrial plant species. Despite their abundance and wide range of relationship with plant species, AMF have shown low species diversity. AMF have high functional diversity because different combinations of host plants and AMF have different effects on the various aspects of symbiosis. Because of wide range of relationships with host plants it becomes difficult to identify the species on the morphological bases as the spores are to be extracted from the soil. This review provides a summary of morphological and molecular characteristics on the basis of which different species are identified. Key words: AMF Taxonomic Characteristics INTRODUCTION structure and the manner of colonization of roots have been recognized as the main characters [4, 5]. It has been The fungi forming arbuscules in roots of terrestrial found that some taxa are both arbuscular mycorrhizal, plants always created great taxonomic problems, in the host roots, whereas other species of mycorrhizae mainly because of difficulties to extract their spores from lacked vesicles. The first taxonomic key for the the soil and to maintain the fungi in living cultures. recognition of the types of the endogonaceous spores Peyronel [1] was first to discover the regular occurrence has been prepared by Mosse and Bowen [6].
    [Show full text]
  • Occurrence of Glomeromycota Species in Aquatic Habitats: a Global Overview
    Occurrence of Glomeromycota species in aquatic habitats: a global overview MARIANA BESSA DE QUEIROZ1, KHADIJA JOBIM1, XOCHITL MARGARITO VISTA1, JULIANA APARECIDA SOUZA LEROY1, STEPHANIA RUTH BASÍLIO SILVA GOMES2, BRUNO TOMIO GOTO3 1 Programa de Pós-Graduação em Sistemática e Evolução, 2 Curso de Ciências Biológicas, and 3 Departamento de Botânica e Zoologia, Universidade Federal do Rio Grande do Norte, Campus Universitário, 59072-970, Natal, RN, Brazil * CORRESPONDENCE TO: [email protected] ABSTRACT — Arbuscular mycorrhizal fungi (AMF) are recognized in terrestrial and aquatic ecosystems. The latter, however, have received little attention from the scientific community and, consequently, are poorly known in terms of occurrence and distribution of this group of fungi. This paper provides a global list on AMF species inhabiting aquatic ecosystems reported so far by scientific community (lotic and lentic freshwater, mangroves, and wetlands). A total of 82 species belonging to 5 orders, 11 families, and 22 genera were reported in 8 countries. Lentic ecosystems have greater species richness. Most studies of the occurrence of AMF in aquatic ecosystems were conducted in the United States and India, which constitute 45% and 78% reports coming from temperate and tropical regions, respectively. KEY WORDS — checklist, flooded areas, mycorrhiza, taxonomy Introduction Aquatic ecosystems comprise about 77% of the planet surface (Rebouças 2006) and encompass a diversity of habitats favorable to many species from marine (ocean), transitional estuaries to continental (wetlands, lentic and lotic) environments (Reddy et al. 2018). Despite this territorial representativeness and biodiversity already recorded, there are gaps when considering certain types of organisms, e.g. fungi. Fungi are considered a common and important component of almost all trophic levels.
    [Show full text]
  • Acaulospora Baetica, a New Arbuscular Mycorrhizal Fungal Species from Two Mountain Ranges in Andalucía (Spain)
    Nova Hedwigia PrePub Article Cpublished online June 2015 Acaulospora baetica, a new arbuscular mycorrhizal fungal species from two mountain ranges in Andalucía (Spain) Javier Palenzuela1, Concepción Azcón-Aguilar1, José-Miguel Barea1, Gladstone Alves da Silva2 and Fritz Oehl2,3 1 Departamento de Microbiología del Suelo y Sistemas Simbióticos, Estación Experimental del Zaidín, CSIC, Profesor Albareda 1, 18008 Granada, Spain 2 Departamento de Micologia, CCB, Universidade Federal de Pernambuco, Avenida da Engenharia s/n, Cidade Universitária, 50740-600, Recife, PE, Brazil 3 Agroscope, Federal Research Institute of Sustainability Sciences, Reckenholzstrasse 191, Plant-Soil-Interactions, CH-8046 Zürich, Switzerland With 11 figures and 1 table Abstract: A new Acaulospora species, A. baetica, was found in two adjacent mountain ranges in Andalucía (southern Spain), i.e. in several mountainous plant communities of Sierra Nevada National Park at 1580–2912 m asl around roots of the endangered and/or endemic plants Sorbus hybrida, Artemisia umbelliformis, Hippocrepis nevadensis, Laserpitium longiradium and Pinguicula nevadensis, and in two Mediterranean shrublands of Sierra de Baza Natural Park at 1380–1855 m asl around roots of Prunus ramburii, Rosmarinus officinalis, Thymus mastichina and Lavandula latifolia among others. The fungus produced spores in single species cultures, using Sorghum vulgare or Trifolium pratense as bait plant. The spores are 69–96 × 65–92 µm in diameter, brownish creamy to light brown, often appearing with a grayish tint in the dissecting microscope. They have a pitted surface (pit sizes about 0.8–1.6 × 0.7–1.4 µm in diameter and 0.6–1.3 µm deep), and are similar in size to several other Acaulospora species with pitted spore surfaces, such as A.
    [Show full text]
  • Sporocarp Ontogeny in Panus (Basidiomycotina): Evolution and Classification
    Sporocarp Ontogeny in Panus (Basidiomycotina): Evolution and Classification David S. Hibbett; Shigeyuki Murakami; Akihiko Tsuneda American Journal of Botany, Vol. 80, No. 11. (Nov., 1993), pp. 1336-1348. Stable URL: http://links.jstor.org/sici?sici=0002-9122%28199311%2980%3A11%3C1336%3ASOIP%28E%3E2.0.CO%3B2-M American Journal of Botany is currently published by Botanical Society of America. Your use of the JSTOR archive indicates your acceptance of JSTOR's Terms and Conditions of Use, available at http://www.jstor.org/about/terms.html. JSTOR's Terms and Conditions of Use provides, in part, that unless you have obtained prior permission, you may not download an entire issue of a journal or multiple copies of articles, and you may use content in the JSTOR archive only for your personal, non-commercial use. Please contact the publisher regarding any further use of this work. Publisher contact information may be obtained at http://www.jstor.org/journals/botsam.html. Each copy of any part of a JSTOR transmission must contain the same copyright notice that appears on the screen or printed page of such transmission. The JSTOR Archive is a trusted digital repository providing for long-term preservation and access to leading academic journals and scholarly literature from around the world. The Archive is supported by libraries, scholarly societies, publishers, and foundations. It is an initiative of JSTOR, a not-for-profit organization with a mission to help the scholarly community take advantage of advances in technology. For more information regarding JSTOR, please contact [email protected]. http://www.jstor.org Tue Jan 8 09:54:21 2008 American Journal of Botany 80(11): 1336-1348.
    [Show full text]
  • Arbuscular Mycorrhizal Fungi (AMF) Communities Associated with Cowpea in Two Ecological Site Conditions in Senegal
    Vol. 9(21), pp. 1409-1418, 27 May, 2015 DOI: 10.5897/AJMR2015.7472 Article Number: 8E4CFF553277 ISSN 1996-0808 African Journal of Microbiology Research Copyright © 2015 Author(s) retain the copyright of this article http://www.academicjournals.org/AJMR Full Length Research Paper Arbuscular mycorrhizal fungi (AMF) communities associated with cowpea in two ecological site conditions in Senegal Ibou Diop1,2*, Fatou Ndoye1,2, Aboubacry Kane1,2, Tatiana Krasova-Wade2, Alessandra Pontiroli3, Francis A Do Rego2, Kandioura Noba1 and Yves Prin3 1Département de Biologie Végétale, Faculté des Sciences et Techniques, Université Cheikh Anta Diop de Dakar, BP 5005, Dakar-Fann, Sénégal. 2IRD, Laboratoire Commun de Microbiologie (LCM/IRD/ISRA/UCAD), Bel-Air BP 1386, CP 18524, Dakar, Sénégal. 3CIRAD, Laboratoire des Symbioses Tropicales et Méditerranéennes (LSTM), TA A-82 / J, 34398 Montpellier Cedex 5, France. Received 10 March, 2015; Accepted 5 May, 2015 The objective of this study was to characterize the diversity of arbuscular mycorrhizal fungal (AMF) communities colonizing the roots of Vigna unguiculata (L.) plants cultivated in two different sites in Senegal. Roots of cowpea plants and soil samples were collected from two fields (Ngothie and Diokoul) in the rural community of Dya (Senegal). Microscopic observations of the stained roots indicated a high colonization rate in roots from Ngothie site as compared to those from Diokoul site. The partial small subunit of ribosomal DNA genes was amplified from the genomic DNA extracted from these roots by polymerase chain reaction (PCR) with the universal primer NS31 and a fungal-specific primer AML2. Nucleotide sequence analysis revealed that 22 sequences from Ngothie site and only four sequences from Diokoul site were close to those of known arbuscular mycorrhizal fungi.
    [Show full text]
  • Biomass and Community Structure of Sporocarps Formed by Hypogeous Ectomycorrhizal Fungi Within Selected Forest Habitats of the H
    Biomass and Community Structure of Sporocarps Formed by Hypogeous Ectomycorrhizal Fungi within Selected Forest Habitats of the H. J. Andrews Experimental Forest, Oregon by Daniel L. Luoma A THESIS submitted to Oregon State University in partial fulfillment of the requirements for the degree of Doctor of Philosophy Completed December 16, 1988 Commencement June 1989 `Some kinds of science dote on graphs, tabfes, and computer readouts. The finest naturalists have always known that biology without romance, without poetry, is not only incomplete but very often hopelessly distorted" — Frank Graham Jr., 1983 AN ABSTRACT OF THE THESIS OF Daniel L. Luoma for the degree of Doctor of Philosophy in Geography presented on December 16. 1988. Title: Biomass and Community Structure of Sporocarps Formed by Hypogeous Ectomycorrhizal Fungi within Selected Forest Habitats of the H. J. Andrews Experimental Forest. Oregon Abstract approved: Robert E. Frenkel This study characterizes the production of hypogeous sporocarps (broadly referred to as truffles) by ectomycorrhizal fungi within Douglas-fir dominated forests that are considered typical of those found on the west slopes of the central Cascade mountains in Oregon. Three aspects of sporocarp production are addressed: 1) the distribution of total biomass and biomass of each species by season and habitat, 2) analysis of sporocarp biomass from the perspective of community structure, and 3) correlation of biomass production with sporocarp number and selected forest floor parameters. Sporocarps with an equivalent dry standing biomass of 1.3 kg/ha were harvested from ten Douglas-fir stands in and near the H. J. Andrews Experimental forest. The maximum single stand sample biomass was equivalent to 9.9 kg/ha.
    [Show full text]
  • A Higher-Level Phylogenetic Classification of the Fungi
    mycological research 111 (2007) 509–547 available at www.sciencedirect.com journal homepage: www.elsevier.com/locate/mycres A higher-level phylogenetic classification of the Fungi David S. HIBBETTa,*, Manfred BINDERa, Joseph F. BISCHOFFb, Meredith BLACKWELLc, Paul F. CANNONd, Ove E. ERIKSSONe, Sabine HUHNDORFf, Timothy JAMESg, Paul M. KIRKd, Robert LU¨ CKINGf, H. THORSTEN LUMBSCHf, Franc¸ois LUTZONIg, P. Brandon MATHENYa, David J. MCLAUGHLINh, Martha J. POWELLi, Scott REDHEAD j, Conrad L. SCHOCHk, Joseph W. SPATAFORAk, Joost A. STALPERSl, Rytas VILGALYSg, M. Catherine AIMEm, Andre´ APTROOTn, Robert BAUERo, Dominik BEGEROWp, Gerald L. BENNYq, Lisa A. CASTLEBURYm, Pedro W. CROUSl, Yu-Cheng DAIr, Walter GAMSl, David M. GEISERs, Gareth W. GRIFFITHt,Ce´cile GUEIDANg, David L. HAWKSWORTHu, Geir HESTMARKv, Kentaro HOSAKAw, Richard A. HUMBERx, Kevin D. HYDEy, Joseph E. IRONSIDEt, Urmas KO˜ LJALGz, Cletus P. KURTZMANaa, Karl-Henrik LARSSONab, Robert LICHTWARDTac, Joyce LONGCOREad, Jolanta MIA˛ DLIKOWSKAg, Andrew MILLERae, Jean-Marc MONCALVOaf, Sharon MOZLEY-STANDRIDGEag, Franz OBERWINKLERo, Erast PARMASTOah, Vale´rie REEBg, Jack D. ROGERSai, Claude ROUXaj, Leif RYVARDENak, Jose´ Paulo SAMPAIOal, Arthur SCHU¨ ßLERam, Junta SUGIYAMAan, R. Greg THORNao, Leif TIBELLap, Wendy A. UNTEREINERaq, Christopher WALKERar, Zheng WANGa, Alex WEIRas, Michael WEISSo, Merlin M. WHITEat, Katarina WINKAe, Yi-Jian YAOau, Ning ZHANGav aBiology Department, Clark University, Worcester, MA 01610, USA bNational Library of Medicine, National Center for Biotechnology Information,
    [Show full text]
  • Arbuscular Mycorrhizal Fungi in Soil Aggregates from Fields of “Murundus” Converted to Agriculture
    Arbuscular mycorrhizal fungi in soil aggregates from fields of “murundus” converted to agriculture Marco Aurélio Carbone Carneiro(1), Dorotéia Alves Ferreira(2), Edicarlos Damacena de Souza(3), Helder Barbosa Paulino(4), Orivaldo José Saggin Junior(5) and José Oswaldo Siqueira(6) (1)Universidade Federal de Lavras, Departamento de Ciência do Solo, Caixa Postal 3037, CEP 37200‑000 Lavras, MG, Brazil. E‑mail: [email protected](2) Universidade de São Paulo, Escola Superior de Agricultura Luiz de Queiroz, Departamento de Ciência do Solo, Avenida Pádua Dias, no 11, CEP 13418‑900 Piracicaba, SP, Brazil. E‑mail: [email protected] (3)Universidade Federal de Mato Grosso, Campus de Rondonópolis, Instituto de Ciências Agrárias e Tecnológicas de Rondonópolis, Rodovia MT 270, Km 06, Sagrada Família, CEP 78735‑901 Rondonópolis, MT, Brazil. E‑mail: [email protected] (4)Universidade Federal de Goiás, Regional Jataí, BR 364, Km 192, CEP 75804‑020 Jataí, GO, Brazil. E‑mail: [email protected] (5)Embrapa Agrobiologia, BR 465, Km 7, CEP 23891‑000 Seropédica, RJ, Brazil. E‑mail: [email protected] (6)Instituto Tecnológico Vale, Rua Boaventura da Silva, no 955, CEP 66055‑090 Belém, PA, Brazil. E‑mail: [email protected] Abstract – The objective of this work was to evaluate the spore density and diversity of arbuscular mycorrhizal fungi (AMF) in soil aggregates from fields of “murundus” (large mounds of soil) in areas converted and not converted to agriculture. The experiment was conducted in a completely randomized design with five replicates, in a 5x3 factorial arrangement: five areas and three aggregate classes (macro‑, meso‑, and microaggregates).
    [Show full text]