The Basic Helix-Loop-Helix Transcription Factor Neurod1 Facilitates Interaction of Sp1 with the Secretin Gene Enhancer

University of Massachusetts Medical School eScholarship@UMMS

Open Access Articles Open Access Publications by UMMS Authors

2007-09-19

The basic helix-loop-helix transcription factor NeuroD1 facilitates interaction of Sp1 with the secretin gene enhancer

Subir Ray University of Massachusetts Medical School

Et al.

Let us know how access to this document benefits ou.y Follow this and additional works at: https://escholarship.umassmed.edu/oapubs

Part of the Life Sciences Commons, and the Medicine and Health Sciences Commons

Repository Citation Ray S, Leiter AB. (2007). The basic helix-loop-helix transcription factor NeuroD1 facilitates interaction of Sp1 with the secretin gene enhancer. Open Access Articles. https://doi.org/10.1128/MCB.00438-07. Retrieved from https://escholarship.umassmed.edu/oapubs/1331

This material is brought to you by eScholarship@UMMS. It has been accepted for inclusion in Open Access Articles by an authorized administrator of eScholarship@UMMS. For more information, please contact [email protected]. MOLECULAR AND CELLULAR BIOLOGY, Nov. 2007, p. 7839–7847 Vol. 27, No. 22 0270-7306/07/$08.00ϩ0 doi:10.1128/MCB.00438-07 Copyright © 2007, American Society for Microbiology. All Rights Reserved.

The Basic Helix-Loop-Helix Transcription Factor NeuroD1 Facilitates Interaction of Sp1 with the Secretin Gene Enhancerᰔ Subir K. Ray and Andrew B. Leiter* Department of Medicine, Division of Gastroenterology, University of Massachusetts Medical School, Worcester, Massachusetts

Received 14 March 2007/Returned for modiﬁcation 24 April 2007/Accepted 8 September 2007

The basic helix-loop-helix transcription factor NeuroD1 is required for late events in neuronal differentiation, for maturation of pancreatic ␤ cells, and for terminal differentiation of enteroendocrine cells expressing the hormone secretin. NeuroD1-null mice demonstrated that this protein is essential for expression of the secretin gene in the murine intestine, and yet it is a relatively weak transcriptional activator by itself. The present study shows that Sp1 and NeuroD1 synergistically activate transcription of the secretin gene. NeuroD1, Downloaded from but not its widely expressed dimerization partner E12, physically interacts with the C-terminal 167 amino acids of Sp1, which include its DNA binding zinc ﬁngers. NeuroD1 stabilizes Sp1 DNA binding to an adjacent Sp1 binding site on the promoter to generate a higher-order DNA-protein complex containing both proteins and facilitates Sp1 occupancy of the secretin promoter in vivo. NeuroD-dependent transcription of the genes encoding the hormones insulin and proopiomelanocortin is potentiated by lineage-speciﬁc homeodomain proteins. The stabilization of binding of the widely expressed transcription factor Sp1 to the secretin promoter

by NeuroD represents a distinct mechanism from other NeuroD target genes for increasing NeuroD-dependent mcb.asm.org transcription.

The gene encoding the gut hormone secretin is highly re- glucagon, and proopiomelanocortin (POMC), as well as the at UNIV OF MASS MED SCH on December 26, 2008 stricted in expression to S-type enteroendocrine cells of the gene encoding the homeodomain protein PDX-1 (4, 21, 23, small intestine in adult animals. In addition, the secretin gene 26, 30). is expressed transiently during development in pancreatic islets Of note, the secretin gene is the only target gene identified and in serotonergic neurons of the central nervous system (18, thus far that shows an absolute requirement for NeuroD1 for 34). A proximal enhancer localized within 200 bp of the tran- in vivo expression. NeuroD1-null mice fail to develop any se- scription initiation site of the secretin gene is required and cretin-producing enteroendocrine cells. A moderate reduction sufficient for its expression in secretin-expressing cells. The in the number of glucagon-expressing ␣ cells and insulin-ex- same enhancer is relatively inactive in cell lines that do not pressing ␤ cells was noted in the endocrine pancreas, although express the endogenous secretin gene (34). Mutational analysis both insulin and glucagon immunoreactivity were readily de- revealed that the enhancer consists of four distinct protein tected in the remaining cells (22). Corticotroph differentiation binding sites important for transcription. These include two was delayed during fetal development in NeuroD1-null mice binding sites for Sp1, one sequence motif that binds to the with no reduction in POMC-expressing cells in older animals, DNA binding protein Finb/RREB1 (28), and an E-box that indicating a nonessential role for NeuroD1 (15). binds to the basic helix-loop-helix (bHLH) protein NeuroD1 In addition to its direct effects on secretin gene transcription, heterodimerized with E12/E47 (20). NeuroD1 may play a role in coordinating expression of secretin NeuroD1 is a member of the tissue-specific class (class B) of with cell cycle exit as secretin cells terminally differentiate. The bHLH transcription factors. It is expressed in neurons, the effects of NeuroD1 on cell proliferation may result from in- anterior pituitary gland, pancreatic islets, and enteroendocrine creased p21 expression (21). NeuroD1-dependent transcrip- cells. Thus, NeuroD1 is the only identified protein binding to tion is repressed by cyclin D1 by a mechanism independent of the secretin enhancer that is expressed in a very limited num- cyclin-dependent kinases (27). The presence of cyclin D1 in the ber of cell types, whereas expression of Sp1 and Finb/RREB1 proliferating cells of intestinal crypts may serve to prevent is widespread. relatively immature, proliferating cells in the intestinal crypts A number of studies suggest a potentially significant role for from prematurely differentiating. Thus, NeuroD1 has a central NeuroD1 in the terminal differentiation of pancreatic islets role in the regulation of secretin cell differentiation. (22, 23) and enteroendocrine cells (21, 22) and in the devel- Our earlier work suggested that NeuroD1 is a relatively opment of various structures in the nervous system (12, 16, 17, weak yet essential transcriptional activator of the secretin gene 19). Potential target genes that depend on NeuroD1 for ex- (28). The organization of the secretin enhancer bears little pression include the genes for the hormones secretin, insulin, similarity to that of the insulin or POMC enhancers, suggesting that the function of NeuroD1 in transcription of the secretin, insulin, and POMC genes in enteroendocrine cells, pancreatic * Corresponding author. Mailing address: University of Massachusetts ␤ cells, and pituitary corticotrophs, respectively, may depend Medical School, Department of Medicine, Division of Gastroenterology, 364 Plantation Street LRB217, Worcester, MA 01605. Phone: (508) 856- on other factors recruited to each enhancer. 8101. Fax: (508) 856-4770. E-mail: [email protected]. Finb/RREB1, a ubiquitously expressed DNA binding pro- ᰔ Published ahead of print on 17 September 2007. tein, potentiates transcriptional activation by NeuroD1 despite

7839 7840 RAY AND LEITER MOL.CELL.BIOL.

its lack of an intrinsic activation domain. The effect of Finb/ CAGCTGTCGTC (antisense strand) were annealed, and to insert a 10-bp se- RREB1 on NeuroD1 requires both its binding to the enhancer quence the oligonucleotides GCCGGACGACAGCTGGGATCGATCCACGG 5Ј to the E-box and direct physical association with NeuroD1 GGCGGCCCTGACCTT (sense strand) and GGAAGGTCAGGGCCGCCCC GTGGATCGATCCCAGCTGTCGTC (antisense strand) were annealed. (28). We and others previously identiﬁed positive cis regula- Gel shift assays. Gel shift assays and nuclear extract preparation were per- tory elements in the secretin gene enhancer that bind to Sp1 formed as described earlier (28). For reconstitution of DNA-protein complexes (13, 28). One of the Sp1 sites identiﬁed was immediately con- using recombinant Sp1 (Promega) or in vitro-translated proteins, 0.25 ␮gof tiguous to the 3Ј end of the NeuroD1 binding E-box. Because poly(dI-dC) was used in each assay. Each reaction was initiated by the addition of protein followed by incubation for 20 min at room temperature, and then 7 ␮l of the close proximity between these two sites, we examined was electrophoresed in 4% native polyacrylamide gels. For immunodetection of whether NeuroD1 and Sp1 functionally and physically interact proteins in DNA-protein complexes, the extracts were preincubated on ice for to increase the transcription-activating functions of NeuroD1. 1 h with antibody to NeuroD1 (23), E12 (7), or Sp1 (Santa Cruz Biotechnology). Our results suggest that Sp1 and NeuroD1 synergistically ac- Coimmunoprecipitation. NeuroD1 was immunoprecipitated from nuclear ex- ϳ ␮ ␮ tivate expression of the secretin gene through physical inter- tracts ( 500 g protein) from HIT cells with 2 g of anti-NeuroD1 (Sigma) antibody. Precipitated proteins were separated by sodium dodecyl sulfate-poly- actions that stabilize binding of Sp1 to DNA. acrylamide gel electrophoresis (SDS-PAGE), transferred to a nitrocellulose membrane, and immunoblotted with anti-Sp1 antibody (sc-59; Santa Cruz Bio- technology). MATERIALS AND METHODS

Binding analysis with GST fusion proteins. Bacterially expressed GST fusion Downloaded from Cell culture. The human cervical carcinoma cell lines C33A and HeLa (Amer- proteins were adsorbed to glutathione-Sepharose beads and incubated with 35 ican Type Culture Collection), the hamster insulin tumor cell line HIT-15 M2.2.2 [ S]methionine-labeled in vitro-transcribed and -translated proteins, and the (hereafter called HIT) (5), and the intestinal tumor cell line STC-1 (29) were bound proteins were analyzed by SDS-PAGE followed by autoradiography (28). cultured in Dulbecco’s modiﬁed Eagle’s medium (4.5 g of glucose/liter) supple- Chromatin immunoprecipitation (ChIP) assays. Chemical cross-linking of mented with 10% heat-inactivated fetal calf serum. Drosophila melanogaster nuclear proteins to genomic DNA and chromatin fragmentation have been Schneider cells (SL2) were grown at 25°C in Schneider medium (Life Technol- previously described (33). Cross-linked proteins from precleared chromatin su- pernatants were immunoprecipitated with anti-NeuroD (Sigma) or anti-Sp1 (sc-

ogies, Inc.) supplemented with 10% heat-inactivated fetal calf serum. mcb.asm.org Plasmid constructions. A secretin-luciferase reporter containing one copy of 59; Santa Cruz Biotechnology) antibody. DNA was purified (QIAquick PCR the secretin enhancer spanning from Ϫ209 to ϩ32 has been described previously purification kit) following reversal of cross-links and proteinase K digestion. (34). Transversion point mutations were introduced by site-directed mutagenesis DNA was amplified with primer pairs described below using semiquantitative (9) to generate the different mutant secretin reporter plasmids, mGC1 (Ϫ119, PCR and compared to serially diluted input DNA to ensure that the immuno- Ϫ117); the E-box mutant mE (Ϫ130, Ϫ127) (20); a mutant with both Sp1 sites precipitated DNA was present at a concentration that allowed visualization of at UNIV OF MASS MED SCH on December 26, 2008 mutated, MutGC (Ϫ65, Ϫ63, Ϫ119, Ϫ117); and a promoter with mutations in different amounts. the E-box and both Sp1 binding sites, MutE/GC. The Ins 6 reporter was gener- The primers used for detecting secretin promoter sequences (forward, 5Ј-CA ated by inserting 6 bp with a BamHI site between the E-box and the adjacent GGCTCCGAGGCTTCGC-3Ј, and reverse, 5Ј-GGCCCCTTTATGGCGGCG- GC1 Sp1 binding site by PCR using the wild-type secretin promoter (Ϫ209 to 3Ј) have been described earlier (13). For detecting dihydrofolate reductase ϩ32) as a template. The 10-bp insertion between the E-box and the adjacent Sp1 (DHFR) promoter sequences, the following primers were used: forward, 5Ј-TG site was generated by digesting the Ins 6 reporter construct with BamHI followed CACCTGTGGAGGAGGA-3Ј, and reverse, 5Ј-AGAACGCGCGGTCAAGTT- by end filling and religation. The human telomerase reverse transcriptase 3Ј. For detection of the transfected secretin promoter, the following primers (hTERT)-luciferase construct extending to Ϫ629 used in the present study has were used: forward, 5Ј-GGTACCGCACTACCCT-3Ј, and reverse, 5Ј-TTGGCG been previously described (2). The mammalian expression plasmids for NeuroD1 TCTTCCATTTACCA-3Ј (from the coding sequence of the luciferase gene). The (23), NeuroD1 in vitro transcription-translation and glutathione S-transferase primers used for detecting the hTERT promoter sequences (forward, 5Ј-GGT (GST) fusion plasmids (21), and Sp1-GST fusion plasmids (8) were previously ACCGACCCCCGGGTCCGCCCGGA-3Ј, and reverse, 5Ј-AAGCTTGCTGCC described. pacNeuroD1, an expression plasmid for NeuroD1 in insect cells, was TGAAACTCGCGCCG-3Ј) were described earlier (35). For detection of the constructed by subcloning NeuroD1 cDNA into BamHI and XhoI sites of the human glyceraldehyde-3-phosphate dehydrogenase (GAPDH) coding region, pacU vector (3). The plasmids encoding short hairpin RNAs (shRNAs) for green the following primers were used: forward, 5Ј-TGAAGGTCGGAGTCAACGG fluorescent protein (GFP) (32) or NeuroD1 (6) under the control of the U6 ATT-3Ј, and reverse, 5Ј-GTTCACACCCATGACGAACATG-3Ј. The PCR promoter and their use for reducing expression of each protein were described products were separated in 2% agarose gels stained with ethidium bromide. earlier. Transient transfections. Cells were plated at a density of 50,000 per well of 24-well plates 18 h prior to transfection. C33A cells were transfected by calcium RESULTS phosphate precipitation with a total of 0.82 ␮g of DNA, consisting of 0.25 ␮g secretin reporter plasmid, 0.02 ␮g Renilla luciferase plasmid, 0.05 ␮g NeuroD1 Synergistic interaction between NeuroD1 and Sp1 on the ␮ expression plasmid, and 0.5 g Sp1 expression plasmid. SL2 cells were trans- secretin promoter. Previous studies showed that expression of fected similarly except that 0.025 ␮g of Sp1 expression plasmid pacSp1 (3) and 0.25 ␮g of NeuroD1 expression plasmid were used. STC-1 cells were transfected the secretin gene in secretin-expressing cell lines is highly de- with Lipofectamine Plus. Cells were harvested 24 h later. Firefly luciferase pendent on a NeuroD1 binding E-box. In the rat, mouse, and activity was normalized to Renilla luciferase activity. human secretin genes, an Sp1 binding site is present adjacent Oligonucleotides. The following oligonucleotides were used in gel shift exper- to the E-box (Fig. 1A). Mutations in the E-box that prevent Ϫ Ϫ iments. The wild-type E-GC1 element encompassing nucleotides 137 to 96 of binding of NeuroD1 to the enhancer reduced transcriptional the rat secretin promoter was made by annealing the complementary oligonu- ϳ cleotides (sense strand, AGCGGACGACAGCTGGGGGGGCGGCCCTGAC activity of secretin reporter genes by 90% in HIT insulinoma CTTCCCGCAAT, and antisense strand, CGATTGCGGGAAGGTCAGGGCC cells and STC-1 enteroendocrine cells, both of which express GCCCCCCCAGCTGTCGTCCG) followed by end filling. Similarly, for making secretin and NeuroD (20). Introduction of point mutations the E-mGC1 element the oligonucleotides AGCGGACGACAGCTGGGGTG into the Sp1 binding site (GC1 box) adjacent to the E-box TCGGCCCTGACCTTCCCGCAAT (sense strand) and CGATTGCGGGAAG ϳ GTCAGGGCCGCACACCCAGCTGTCGTCCG (antisense strand) were an- similarly reduced ( 84%) transcriptional activity in both cell nealed, and for making the mE-GC1 element, AGCGGACGATAGTTGGGG lines (Fig. 1B). The importance of these two adjacent sites for GGGCGGCCCTGACCTTCCCGCAAT (sense strand) and CGATTGCGGG full transcriptional activity prompted us to investigate whether AAGGTCAGGGCCGCCCCCCCAACTATCGTCCG (antisense strand) were NeuroD1 and Sp1 functionally cooperate to regulate transcrip- annealed. The boldface nucleotides indicate mutations introduced into the re- tion of the secretin gene. spective binding sites. In order to insert a 6-bp sequence within the E-GC1 box the oligonucleotides GCCGGACGACAGCTGGGATCCACGGGGCGGCCC To determine whether Sp1 and NeuroD1 functionally inter- TGACCTT (sense strand) and GGAAGGTCAGGGCCGCCCCGTGGATCC act, we examined the effects of Sp1 on NeuroD1-dependent VOL. 27, 2007 FUNCTIONAL INTERACTION BETWEEN NeuroD1 AND Sp1 7841

sion plasmid increased reporter gene expression by 4.9-fold. Coexpression of both Sp1 and NeuroD1 increased reporter expression approximately 32.2-fold, far exceeding the sum of the activation from either factor alone. We confirmed that synergistic transcriptional activation of the secretin gene required the binding sites for both NeuroD1 and Sp1 by expressing both factors with reporter genes containing mutations in either the E-box (20) or GC1 box (28). We observed no synergism between Sp1 and NeuroD1 with either mutant, suggesting that their interaction was dependent on promoter occupancy of their adjacent binding sites (Fig. 1C). The GC1 mutant reporter was weakly activated by Sp1, probably from the binding of Sp1 to a second binding site 48 nucleotides 3Ј to the GC1 box. However, the effects of Sp1 and NeuroD1 on the GC1 mutant reporter were additive, highlighting the importance of the GC1 site for synergism Downloaded from (Fig. 1C). To further assess the function of Sp1 in secretin gene transcription, we examined the activity of the secretin-luciferase reporter with cotransfected NeuroD1 and/or Sp1 plasmids in Schneider SL2 cells, which express neither NeuroD1 nor Sp1. mcb.asm.org Cotransfection of an Sp1 expression plasmid increased low basal reporter activity by ϳ6.4-fold. NeuroD1 had no effect by itself on expression of the secretin reporter in SL2 cells (Fig. 1C). However, NeuroD1 and Sp1 together resulted in a greater- than-additive (ϳ21.2-fold) activation of the reporter gene at UNIV OF MASS MED SCH on December 26, 2008 in SL2 cells, suggesting that they may functionally interact (Fig. 1C). Formation of a ternary DNA-protein complex involves binding cooperativity between NeuroD1 and Sp1. We examined DNA-protein complexes formed by Sp1 and NeuroD1 on the secretin enhancer by electrophoretic mobility shift assays (EMSAs) to determine if the functional interaction between these proteins observed in transfection assays was related to FIG. 1. Transcriptional synergism between NeuroD1 and Sp1 on the binding of these factors to the enhancer. It has previously the secretin gene. (A) Conserved alignment of the E-box and Sp1 been shown that NeuroD1 binds to E-boxes as a heterodimer binding sites in the rat, mouse, and human secretin gene promoters. with ubiquitously expressed bHLH proteins like E12 or E47 (B) Loss of transcriptional activity of the secretin reporter in HIT and STC-1 cells, with mutations in the E-box or the adjacent Sp1 binding but not as a homodimer (23). Binding of in vitro-translated site. Luciferase activity of the E-box mutant (black bars) and GC1 NeuroD1 and E12 to a probe containing the contiguous E-box mutant (striped bars) is expressed as a percentage of the wild-type and Sp1 binding site generated a DNA-protein complex rep- Ϯ (white bars) reporter gene activity. Results are shown as the means resenting a NeuroD1-E12 heterodimer (Fig. 2A, lane 1), standard errors of the means of three separate experiments done in whereas NeuroD1 alone did not form a complex (not shown). duplicate. *, P Ͻ 0.0001. (C) Secretin reporter gene activity in C33A cells or SL2 cells cotransfected with expression plasmids for NeuroD1, A distinct, faster-migrating complex was generated with Sp1 Sp1, or NeuroD1 plus Sp1 and the reporter plasmids indicated in panel (Fig. 2A, lane 3). However, the presence of all three proteins B. Results are expressed as luciferase activity relative to the activity in generated an additional, more slowly migrating complex com- the absence of NeuroD1 or Sp1. The dashed line indicates the sum of transcriptional activities by NeuroD1 and Sp1 expression vectors co- pared to the complexes produced by Sp1 or NeuroD1-E12 transfected individually with the respective reporter. Results are shown alone (Fig. 2A, lane 2), suggesting the formation of a ternary as the means Ϯ standard errors of the means for at least five separate complex that contained all three proteins bound to the DNA. experiments. Significant differences from the additive activities of The higher-order complex was not detected if all three pro- NeuroD1 and Sp1 are shown by asterisks (*, P Ͻ 0.0001; **, P Ͻ 0.05). WT, wild type. teins were incubated with a probe containing a mutation in either the E-box or the adjacent Sp1 binding site (Fig. 2A, lanes 4 and 7) or with a probe containing 6-bp or 10-bp spacing transcription of the secretin gene as described previously (28) between the two binding sites (lanes 10 and 11), indicating that using transient-expression assays in C33A cells, a cell line that both binding sites as well as their close proximity to each other does not express NeuroD1. Expression of a secretin-luciferase were required for the formation of this complex. Although E12 reporter gene increased by 4.7-fold above the basal level when bound to the wild-type probe as a homodimer to generate a coexpressed with NeuroD1, in agreement with our earlier ob- complex, it could not form the more slowly migrating complex servations that this bHLH protein has only a modest transac- with Sp1 (Fig. 2B, lanes 1 and 2), indicating that NeuroD1 tivating function (Fig. 1C). Cotransfection of an Sp1 expres- was required for ternary complex formation and that E12 7842 RAY AND LEITER MOL.CELL.BIOL. Downloaded from

FIG. 3. Presence of NeuroD1 and Sp1 in a higher-order DNA- protein complex formed from nuclear extracts. Shown are results of an EMSA of factors in HIT cell nuclear extract binding to the secretin mcb.asm.org promoter regions containing the E-box and adjacent Sp1 binding site. (A) Effect of competition with unlabeled oligonucleotides for an Sp1, mutant Sp1 site, or E-box on ternary complex formation. (B) Presence of Sp1 and NeuroD1 in the ternary complex. Antibodies to NeuroD1 (lane 2) or E12 (lane 5) reduced the slow-migrating complex. Sp1 at UNIV OF MASS MED SCH on December 26, 2008 antibody (lane 3) supershifted the ternary complex. (C) EMSA showing that probes with increased spacing between the E-box and Sp1 binding site cannot generate the ternary complex from nuclear proteins extracted from HIT cells (lanes 2 and 3). (D) Effect of spacing (6 or 10 bp) between the E-box and the adjacent Sp1 binding site on secretin gene transcription. Luciferase activity of the insertion mutants is expressed as a percentage of activity of the wild-type reporter gene FIG. 2. NeuroD1 and Sp1 bind cooperatively to the secretin gene transfected in HIT (white bars) or STC-1 (black bars) cells. Results are to form a ternary DNA-protein complex. (A) EMSA showing protein shown as the means Ϯ standard errors of the means for at least four complexes formed by indicated combinations of in vitro-translated independent experiments. Significant differences from the wild type NeuroD1, E12, or Sp1 bound to a 32P-labeled probe containing the are shown by an asterisk (P Ͻ 0.001). WT, wild type. E-box and GC1 Sp1 site (lanes 1 to 3) or the same probes with mutations in either the E-box (lanes 4 to 6) or GC1 (lanes 7 to 9) or with the insertion of a 6-bp (Ins 6) or a 10-bp (Ins 10) sequence well the complexes generated by all three proteins together. between the two sites (lanes 10 and 11). The arrowhead denotes a slow-migrating complex seen only in the presence of all three proteins Sp1 and NeuroD1/E12 independently bound 15.6% and 6.4% (lane 2) but not seen with any of the mutant probes (lanes 4 to 11). of the total probe, respectively (Fig. 2C). If Sp1 and NeuroD1- (B) Failure to generate the ternary complex with E12 and Sp1 in the E12 bound to DNA independently of each other, the proba- absence of NeuroD1 (lane 2). (C) Quantitation of Sp1 and NeuroD1/ bility of the two proteins simultaneously binding to a single E12 binding to DNA. The fraction of probe present in complexes formed by NeuroD1 plus E12 alone (panel A, lane 1) or Sp1 alone probe molecule should equal the product of their individual (panel A, lane 3) or in the ternary complex formed by NeuroD1, E12, probabilities of binding. The two proteins together generated a and Sp1 together (panel A, lane 2) was measured by phosphorimaging. ternary complex containing approximately 6.7% of the total Results are shown as the means Ϯ standard errors of the means for at probe versus the average predicted value of 1.8% if binding Ͻ least three separate experiments. *, significantly different (P 0.05) occurred independently and randomly. This indicates that gen- from the fraction predicted for independent binding events measured as described before (24). WT, wild type. eration of the higher-order DNA-protein complex was enhanced by cooperative binding interactions. Ternary complex formation and transactivation depend on the close proximity of the NeuroD1 and Sp1 binding sites. We homodimers appear to inhibit Sp1 binding to the same probe examined DNA-protein complexes generated with the secretin molecule. enhancer probe and nuclear extracts from HIT cells by EMSA The synergistic transcriptional activation by NeuroD1 and to determine if a similar ternary complex is formed with pro- Sp1 could arise from interactions that enhance their binding to teins in crude nuclear extracts as described with purified pro- DNA. To determine whether the observed ternary complex teins. A number of DNA-protein complexes were identified, resulted from cooperative DNA binding by the two proteins to including one that consisted of several complexes that were not the enhancer, we performed an EMSA and quantitated by well resolved on the gel (complex II) (Fig. 3A, lane 1). A phosphorimaging the fraction of probe retained in each DNA- consensus wild-type Sp1 oligonucleotide but not a mutant oli- protein complex generated by Sp1 or NeuroD1/E12 alone as gonucleotide completely competed a slowly migrating band VOL. 27, 2007 FUNCTIONAL INTERACTION BETWEEN NeuroD1 AND Sp1 7843

(complex I), as well as complex III, and partially competed complex II (Fig. 3A, lane 2 versus lane 3). An Sp1 antibody completely supershifted the slowly migrating complex I and reduced the amount of the broad complex II, suggesting that Sp1 was present in complex I and probably in complex II (Fig. 3B, lane 3). Complex III was minimally altered by the Sp1 antibody, suggesting that it may contain another protein with an affinity for GC-rich sequences. Similarly, the more slowly migrating complex I was competed by unlabeled E-box sequences indicating the presence of bHLH proteins in this complex with Sp1 (Fig. 3A, lane 4). Antibodies to NeuroD1 (Fig. 3B, lane 2) or E12 (Fig. 3B, lane 5) completely disrupted the formation of complex I, indicating the presence of NeuroD1 and E12 in addition to Sp1. This same complex was not generated by extracts of C33A cells, which do not express NeuroD1 (not shown). Finally insertion Downloaded from of 6 bp or 10 bp between the E-box and the adjacent Sp1 binding site of the probe disrupted the formation of complex I without affecting the other complexes, as was shown earlier with the reconstituted complex I (Fig. 2A). The presence of both Sp1 and NeuroD1 in complex I as well as its dependence on the normal spacing between the Sp1 and NeuroD binding mcb.asm.org sites indicates that this complex corresponds to the higher- order complex observed in Fig. 2A with recombinant proteins. To determine if transcriptional activation also was dependent on the proximity of the E-box to the Sp1 binding site, we at UNIV OF MASS MED SCH on December 26, 2008 compared the activity of reporter genes where the spacing between the E-box and the adjacent Sp1 binding site in the secretin promoter was increased by either 6 bp or 10 bp versus the wild-type secretin-reporter in two secretin-expressing cell lines, HIT cells and STC-1 cells. Insertion of either 6 bp or 10 bp significantly reduced the transcriptional activity of the enhancer in both cell lines, indicating that the position of the E-box adjacent to the Sp1 binding site was necessary for maximal transcription of the gene (Fig. 3D). Thus, increasing the spacing between the two sites both reduced transcription and prevented formation of the higher-order complex, suggesting FIG. 4. Physical association between Sp1 and NeuroD1. (A) Co- that generation of the ternary complex may be required for immunoprecipitation of Sp1 with NeuroD1 in HIT cells. Lane 1 shows 4% of the input used for immunoprecipitation. (B) Sp1 directly inter- maximal transcription. acts with NeuroD1 but not its dimerization partner, E12, through zinc Sp1 physically associates with NeuroD1. The spacing be- finger domains. 35S-labeled NeuroD1 (left) or 35S-labeled E12 (right) tween the E-box and GC1 box required for ternary complex was incubated with GST or the indicated GST-Sp1 fusion proteins as formation and maximal enhancer activity suggested that indicated in panel C. NeuroD1 bound to fusion proteins was affinity NeuroD1 and Sp1 might physically interact with each other. isolated, subjected to SDS-PAGE, and detected by autoradiography. Input lanes were loaded with 10% of the labeled proteins used in the We immunoprecipitated NeuroD1 from unfractionated ex- binding assay. (C) Structure of the Sp1 deletion mutants and summary tracts of HIT cells with NeuroD1 antibodies and tested for the of the results. (D and E) Identification of the Sp1 binding domain of presence of Sp1 by immunoblotting the precipitated proteins NeuroD1. (D) Wild type or different 35S-labeled NeuroD1 mutants (Fig. 4A). Sp1 antibodies detected a single band in the bound to GST-Sp1 (amino acids 622 to 788) were affinity isolated and separated by SDS-PAGE (left panel). Input (right panel) lanes were NeuroD1 immunoprecipitates (lane 3) but not proteins pre- loaded with 10% of the labeled proteins used in the binding assay. cipitated by control immunoglobulin G (IgG) (lane 2), indicat- (E) Structures of the NeuroD1 deletion mutants. WT, wild type; ND, ing that Sp1 and NeuroD1 associate at their native levels. To NeuroD1. rule out the possibility that DNA present in extracts led to an artifactual association between NeuroD1 and Sp1, we repeated the coimmunoprecipitation experiment with the HIT cell ex- NeuroD1 was retained on an affinity column containing full- tracts following pretreatment with ethidium bromide (50 ␮g/ length GST-Sp1, indicating that these two proteins directly ml) as described before (10). The interaction of NeuroD1 with interact with each other (Fig. 4B). Sp1 was not significantly changed by ethidium bromide, indi- We expressed three deletion mutants of Sp1 as GST fusion cating that their interaction did not result from the presence of proteins and examined whether they could bind to NeuroD1 to DNA (not shown). We expressed full-length Sp1 as a GST identify the region of Sp1 that associates with NeuroD1. A fusion protein and tested its ability to directly bind to NeuroD1 GST fusion protein containing residues 622 to 788 of Sp1 was using in vitro binding assays. Labeled in vitro-translated sufficient for NeuroD1 binding (Fig. 4B and C). This 167- 7844 RAY AND LEITER MOL.CELL.BIOL. residue fragment at the C terminus contained the three zinc fingers of Sp1 that comprise its DNA binding domain. Neither of two N-terminal transactivation domains rich in serine-threo- nine and glutamine residues appears to physically interact with NeuroD1 (Fig. 4B and C). In contrast, E12, the ubiquitously expressed bHLH dimerization partner of NeuroD1, did not bind to GST-Sp1, indicating that the interaction between Sp1 and NeuroD1 is specific for NeuroD1 as opposed to other bHLH proteins capable of binding to the same E-box (Fig. 4B). To determine the domain of NeuroD1 necessary for interaction with Sp1, we tested the GST-Sp1 fusion containing the C- terminal 167 amino acids (GST-Sp1622–788) for its ability to bind to different truncation/deletion mutants of NeuroD1. The 158 amino acids at the N terminus of NeuroD1 were sufficient for binding to Sp1 (Fig. 4D and E). The inability of the mutant

⌬49/155 to bind Sp1 indicates that the N terminus of NeuroD1, Downloaded from which contains the bHLH domain, is necessary for Sp1 binding, whereas the C-terminal activation domain of NeuroD1 does not appear to be involved. The NeuroD1 deletion mutants ⌬49/96 and ⌬113/128 retained the ability to bind to Sp1, suggesting that the deleted acidic and basic domains and helix 1 were not required. A final NeuroD1 truncation, N138, which retained 138 mcb.asm.org residues at the N terminus but lacks helix 2, was unable to bind to Sp1, suggesting that sequences in helix 2 of the bHLH domain of NeuroD1 are essential for its association with Sp1 (Fig. 4D and E). at UNIV OF MASS MED SCH on December 26, 2008 Sp1 binding to the secretin enhancer is stabilized in Sp1- FIG. 5. Stabilization of Sp1-DNA binding in the ternary DNA- NeuroD1 ternary complex. To determine whether the binding protein complex with NeuroD1. (A) EMSA performed with indicated cooperativity between NeuroD1 and Sp1 arises from stabilized recombinant proteins and a probe containing the contiguous E-box DNA binding of either protein in the presence of the other, we and Sp1 binding site. Slower-migrating complex i represents the ter- compared the relative stability of the ternary complex com- nary DNA-protein complex (lane 3) whereas complexes ii (lanes 1 and 3) and iii (lanes 2 and 3) were generated by NeuroD1-E12 and Sp1, pared to complexes generated by Sp1 or NeuroD1/E12 alone respectively. All three complexes were competed by a 100-fold molar by EMSA. In order to better resolve the ternary complex from excess of the unlabeled probe added to the probe prior to the binding the complexes generated by either Sp1 alone or NeuroD1/E12, reaction. (B) An EMSA where a 500-fold molar excess of unlabeled oligonucleotide competitor was added after the probe and proteins we used the truncated GST-Sp1622–788 fusion protein that contains both the DNA binding and NeuroD1-interacting domains reached equilibrium. Aliquots were removed at 4-minute intervals and quickly loaded onto an acrylamide gel for electrophoresis. (C) Time of Sp1. The truncated Sp1 protein by itself generated a fast- course of dissociation of DNA-protein complexes. The percentage of migrating DNA-protein complex (complex iii, Fig. 5A, lane 2) probe remaining in complexes with Sp1 alone (complex iii), with that was easily resolved from the slower-migrating complex NeuroD1-E12 (complex ii), or with NeuroD1-E12-Sp1 (complex i) was produced by NeuroD1/E12 (complex ii, Fig. 5A, lane 1). A quantitated by phosphorimaging and plotted relative to the zero time point. Results are shown as the means Ϯ standard errors of the means more slowly migrating complex appeared with NeuroD1/E12 for three separate experiments. *, significantly different (complex iii in and GST-Sp1622–788 (complex i) (Fig. 5A, lane 3), suggesting comparison to complex i or complex ii; P Ͻ 0.01). that the truncated Sp1 protein could form the ternary complex as well. All three complexes (i, ii, and iii) were competed by an excess of unlabeled competitor containing the contiguous E- box and Sp1 binding site added to the probe prior to the of the Sp1-NeuroD1/E12-DNA complex (complex i). Only binding reaction, indicating that all complexes resulted from 35% of the probe initially present in complex iii remained after sequence-specific DNA binding (lane 4). 4 minutes, and only 22% remained after 8 minutes. In contrast, We compared the stabilities of each of the three DNA- the rate of loss of complex i or ii was lower than that of protein complexes by measuring their rate of dissociation after complex iii at all of the time points examined, suggesting that equilibrium binding following addition of an excess of compet- both the NeuroD1/E12 and ternary complexes were more sta- ing DNA fragments. For these studies we incubated GST- ble than the complex generated by Sp1. The relative stability of

Sp1622–788, NeuroD1, and E12 with a probe containing the the ternary complex (complex i) suggests that Sp1 binding is contiguous E-box and Sp1 binding site. Upon completion of stabilized in the presence of NeuroD1 bound to the adjacent the binding reaction, a 500-fold excess of unlabeled probe E-box, potentially accounting for its enhanced formation. DNA was added and samples were withdrawn every 4 min for To determine whether NeuroD1 stabilizes Sp1 binding to EMSA (Fig. 5B). The amount of probe remaining in each the secretin promoter in vivo, we examined the effects of complex was quantitated for each time point by phosphor- NeuroD1 on chromatin occupancy of the secretin enhancer by imaging (Fig. 5C). The results indicated that the dissociation of Sp1. As expected ChIP assays revealed no occupancy of the the Sp1-DNA complex (complex iii) was much faster than that secretin enhancer by NeuroD1 in HeLa cells, which do not VOL. 27, 2007 FUNCTIONAL INTERACTION BETWEEN NeuroD1 AND Sp1 7845 Downloaded from

FIG. 6. NeuroD1 facilitates interaction of Sp1 with the secretin enhancer. (A) Recruitment of transiently expressed NeuroD1 to the endogenous secretin promoter in HeLa cells. ChIP experiments were performed using soluble chromatin fragments prepared from HeLa cells transfected with an expression plasmid for E12 in the absence (Ϫ) mcb.asm.org or the presence (ϩ) of a NeuroD1 expression plasmid. DNA purified from the chromatin input or the immunoprecipitate (␣-NeuroD1 or control IgG) was amplified by PCR for 32 cycles with primers covering the secretin promoter (Ϫ284 to Ϫ57) (top panel) or a control promoter (Ϫ310 to ϩ17 of human DHFR) (bottom panel). (B) Effect of at UNIV OF MASS MED SCH on December 26, 2008 NeuroD1 on recruitment of Sp1 to the secretin promoter in vivo. ChIP experiments were performed with anti-Sp1 antibody (␣-Sp1) as described for panel A. The human GAPDH gene served as a negative control (right). FIG. 7. Depletion of NeuroD1 in STC-1 cells reduces recruitment of Sp1 to the secretin promoter. Shown are results of transient ChIP assays for transfected secretin and hTERT promoters. (A) Sp1 and NeuroD1 occupancy of the wild-type secretin promoter (top panel), a normally express NeuroD1 (Fig. 6A, top panel, lane 5). How- secretin promoter with mutations in the Sp1 binding sites (MutGC; ever, in HeLa cells transfected with a NeuroD1 expression middle panel), and a mutant (MutE/GC) secretin promoter lacking plasmid we readily identified the presence of NeuroD1 at the Sp1 and NeuroD1 binding sites (bottom panel) in STC-1 cells. (B) Ef- secretin enhancer in vivo (top panel, lane 10) but not at the fect of NeuroD1 depletion on transient ChIP of Sp1 and NeuroD1 in DHFR promoter, which lacks a NeuroD1 binding site (bottom STC-1 cells cotransfected with a plasmid containing the secretin promoter (left) or hTERT promoter (right). Cells were cotransfected with panel, lane 10), indicating that transiently expressed NeuroD1 either shRNA plasmids for NeuroD1 or GFP as a control. The final was associated with the endogenous secretin gene. DNA extractions were PCR amplified for detection of the transfected ChIP assays showed occupancy of the endogenous secretin promoters using pairs of primers described in Materials and Methods. promoter by Sp1 in NeuroD1-expressing HeLa cells, whereas (C) Effect of NeuroD1 depletion on transcription of a secretin reporter gene in STC-1 cells cotransfected with shRNA plasmids for NeuroD1 recruitment of Sp1 was minimal in control HeLa cells, suggest- and GFP as indicated. Results are shown as the means Ϯ standard -signifi ,ء .ing that NeuroD1 increases recruitment of Sp1 to the secretin errors of the means of at least three separate experiments promoter (Fig. 6B, left panel). The DHFR promoter contains cantly different from control or GFP shRNAs (P Ͻ 0.01). several Sp1 binding sites. Recruitment of Sp1 to the DHFR promoter appeared identical in both wild-type HeLa cells and HeLa cells expressing NeuroD1, indicating that promoter oc- fected secretin promoter by endogenous NeuroD1 or Sp1. cupancy by Sp1 is not generally dependent on NeuroD1 (Fig. Both Sp1 and NeuroD1 were recruited to the wild-type pro- 6B, middle panel). The dependence on NeuroD1 for Sp1 bind- moter but not to a mutant promoter containing mutations in ing appears to be specific for the secretin gene. Little signal was the E-box and both Sp1 sites (MutE/GC) that prevent binding detected with control IgG or with the GAPDH gene, which of either factor to DNA (Fig. 7A, lanes 5 and 6). Introduction lacks Sp1 binding sites, confirming the specificity of protein- of mutations into the Sp1 binding sites of secretin promoter DNA complexes immunoprecipitated in ChIP assays for the slightly reduced NeuroD1 occupancy, suggesting that Sp1 DNA secretin or the DHFR promoter (Fig. 6B). binding is not essential for NeuroD1 recruitment to the promoter We further confirmed the importance of NeuroD1 for oc- (Fig. 7A, lane 6). cupancy of the secretin promoter by Sp1 in vivo in NeuroD1- We next transfected STC-1 cells with the wild-type secretin expressing STC-1 enteroendocrine cells by knocking down reporter plasmid or a control reporter plasmid containing mul- NeuroD1 expression by DNA-based RNA interference using a tiple Sp1 binding sites (hTERT-Luc) plus expression plasmids previously described NeuroD shRNA (6). We used transient for either a NeuroD1 shRNA or a GFP shRNA, which served ChIP assays (11) to examine occupancy of a transiently trans- as a control. The NeuroD1 shRNA significantly reduced 7846 RAY AND LEITER MOL.CELL.BIOL.

NeuroD1 occupancy of the secretin promoter, indicating a to E-boxes that bind to myogenic bHLH proteins (1, 14). The significant decrease in the level of NeuroD1 expression (Fig. HLH domain of the myogenic bHLH protein myogenin, like 7B, left panel). The effectiveness of the NeuroD1 shRNA was NeuroD1, physically associates with the C-terminal zinc finger further confirmed by an 85% loss of secretin promoter activity domain of Sp1. However, it is not known whether myogenin (Fig. 7C). We consistently observed a significant reduction in and Sp1 increase transcription of the cardiac actin promoter Sp1 promoter occupancy in cells with decreased expression of in an additive or synergistic manner. In this promoter, the NeuroD1, whereas Sp1 occupancy of the hTERT promoter E-box and Sp1 site are separated by an additional 10 nucleo- was unaffected by depletion of NeuroD1 (Fig. 7B, left versus tides, or approximately one complete helical turn, compared to right panel). These observations suggest that in secretin-ex- the secretin enhancer. Introduction of 10 additional nucleo- pressing cells, NeuroD1 stabilizes Sp1 binding to the secretin tides between the secretin gene E-box and the adjacent Sp1 enhancer to potentiate secretin gene transcription. site abrogated their synergistic effects on transcription. Besides the secretin gene, relatively few target genes that are DISCUSSION directly activated by NeuroD1 have been identified. These include the genes encoding the hormones insulin and POMC. Mice carrying a targeted deletion of the bHLH protein Expression of both of these genes depends on interactions

NeuroD1 fail to develop secretin-expressing enteroendocrine between bHLH proteins with lineage-restricted homeodomain Downloaded from cells, indicating that this protein is essential for secretin gene transcription factors bound to nearby cis elements to potenti- expression. Paradoxically, in vitro studies suggest that NeuroD1 ate the transactivating function of NeuroD1. is a relatively weak activator of the secretin gene transcription Lineage-specific transcription of the POMC gene in the pi- by itself. Of the transcription factors that bind to the secretin tuitary gland is enhanced by the functional synergy between enhancer, only NeuroD1 is relatively restricted to a limited bHLH factors binding to an E-box and the pituitary gland- number of cell types, as opposed to the ubiquitous expression specific homeodomain protein Pitx-1 (25). Pitx-1 indirectly mcb.asm.org of the others, implying a major role for NeuroD1 in regulating modifies NeuroD1-dependent transcription by physically inter- secretin gene expression. In the present work, we show that acting with one of its ubiquitously expressed dimerization part- physical interactions between NeuroD1 and the ubiquitously ners rather than by a direct association with NeuroD1. The expressed transcription factor Sp1 on the secretin gene en- bHLH domain of Pan1 (E47) serves as a protein-protein in- at UNIV OF MASS MED SCH on December 26, 2008 hancer significantly potentiate transactivation by this tissue- teraction domain with the homeodomain of Pitx-1. The specific class B bHLH protein. We previously identified the NeuroD1 binding E-box in the POMC promoter is separated protein Finb/RREB1 as a transcription-modifying protein that from the Pitx-1 binding site by 67 bp. This spacing may indicate synergistically potentiates NeuroD1. Thus, the interaction of that the interactions on the POMC promoter involve different NeuroD1 with two widely expressed DNA binding proteins is surfaces of the bHLH proteins than in the case of the insulin one mechanism for potentiating the relatively weak transacti- and secretin promoter, where Pdx1 and Sp1 bind to sites im- vating function of NeuroD1. mediately adjacent to the E-box. Cell-type-specific gene expression depends on the presence Insulin-expressing pancreatic ␤ cells arise from the primitive of a combination of transcription factors, some of which are gut endoderm and are developmentally related to enteroendo- also highly restricted in expression, as well as the organization crine cells, and yet insulin gene expression does not occur in transcription factor binding sites controlling a gene. The prox- the intestine. The expression of insulin and secretin genes, two imal enhancer of the secretin gene is conserved in different NeuroD1-dependent genes, in distinct cell types depends in mammalian species, maintaining a nearly identical arrange- part on the expression of different sets of transcriptional acti- ment of four cis regulatory elements including the E-box and vators in islets versus enteroendocrine cells and on the orga- immediately adjacent Sp1 binding site. The close proximity of nization of transcription factor binding sites on each promoter. these two sites appears to be essential for the synergism be- The major elements responsible for ␤-cell-specific transcrip- tween Sp1 and NeuroD1. Finb/RREB1, which binds to se- tion of the insulin gene are localized to a relatively small region quences upstream of the E-box, appears to be an unusual class of the promoter that contains an E-box and two TAAT-rich A of transcription-modifying protein. Although Finb/RREB1 is elements that bind to the homeodomain protein PDX-1. In present in corepressor complexes with CtBP (31), it serves to developing animals, PDX-1 is expressed throughout the prox- potentiate NeuroD1-dependent transcription despite the ab- imal duodenum and the pancreas, but intestinal expression is sence of an intrinsic activation domain or any direct activation largely absent in adult animals, whereas expression in islets of transcription by itself. In contrast to coactivators, Finb must continues. bind to DNA to modify the activity of NeuroD1. The homeodomain of PDX-1 associates with several other The interaction of NeuroD1 with Sp1 through regions close proteins including E47, NeuroD1, and high-mobility-group to the DNA binding domain of each protein may in part ex- protein Y1 to form a higher-order transcription-activating plain why synergistic transcriptional activation depends on the complex (24). Unlike the specific interaction between adjacent positions of the E-box and Sp1 binding sites. This NeuroD1 and Sp1 on the secretin gene, PDX-1 interacts with interaction results in cooperative DNA binding and stabilized the ubiquitous dimerization partners of NeuroD1 as well as Sp1 DNA binding in the resultant ternary DNA-protein com- with NeuroD1. In the case of the insulin gene, synergistic plex with NeuroD1 and E12. transcriptional activation occurs with E47 as well as NeuroD1. The promoters of several muscle-specific genes including the In addition, high-mobility-group protein Y1 synergizes with regulatory region of human cardiac alpha-actin promoter and the other members of the insulin gene-transactivating complex. troponin I promoter have Sp1 binding sites in close proximity The absence of PDX-1 in adult enteroendocrine cells may VOL. 27, 2007 FUNCTIONAL INTERACTION BETWEEN NeuroD1 AND Sp1 7847 explain in part why insulin is not expressed in the intestine. CpG methylation, Sp1/Sp3 ratio, and the E-box element. Mol. Endocrinol. Thus, NeuroD1-dependent expression of the insulin and se- 18:1740–1755. 14. Lin, H., K. E. Yutzey, and S. F. Konieczny. 1991. Muscle-specific expression cretin genes in pancreatic ␤ cells and S-type enteroendocrine of the troponin I gene requires interactions between helix-loop-helix muscle cells, respectively, depends on different sets of transcription regulatory factors and ubiquitous transcription factors. Mol. Cell. Biol. 11: 267–280. factors that interact with NeuroD1 to potentiate its activity. 15. Liu, J., C. Lin, A. Gleiberman, K. A. Ohgi, T. Herman, H. P. Huang, M. J. NeuroD1 plays an important role in regulating terminal dif- Tsai, and M. G. Rosenfeld. 2001. Tbx19, a tissue-selective regulator of ferentiation of neurons and hormone-producing cell lineages. POMC gene expression. Proc. Natl. Acad. Sci. USA 98:8674–8679. 16. Liu, M., F. A. Pereira, S. D. Price, M. Chu, C. Shope, D. Himes, R. A. Eatock, Relatively few target genes have been identified for this bHLH W. E. Brownell, A. Lysakowski, and M. J. Tsai. 2000. Essential role of protein. Other DNA binding proteins potentiate transactiva- BETA2/NeuroD1 in development of the vestibular and auditory systems. tion of the genes encoding the hormones POMC, insulin, and Genes Dev. 14:2839–2854. 17. Liu, M., S. J. Pleasure, A. E. Collins, J. L. Noebels, F. J. Naya, M. J. Tsai, secretin by NeuroD1. The enhancer of the secretin gene shares and D. H. Lowenstein. 2000. Loss of BETA2/NeuroD leads to malformation little with the organization of the insulin or POMC genes. of the dentate gyrus and epilepsy. Proc. Natl. Acad. Sci. USA 97:865–870. Unlike the POMC and insulin genes, where NeuroD1 syner- 18. Lossi, L., L. Bottarelli, M. E. Candusso, A. B. Leiter, G. Rindi, and A. Merighi. 2004. Transient expression of secretin in serotoninergic neurons of gizes with homeodomain proteins specific for their tissue, mouse brain during development. Eur. J. Neurosci. 20:3259–3269. NeuroD1 synergizes with the widely expressed proteins Sp1 19. Miyata, T., T. Maeda, and J. E. Lee. 1999. NeuroD is required for differentiation of the granule cells in the cerebellum and hippocampus. Genes Dev. Downloaded from and RREB1 to increase secretin gene transcription. The spe- 13:1647–1652. cific arrangement of factor binding sites in the secretin en- 20. Mutoh, H., B. Fung, F. Naya, M.-J. Tsai, J. Nishitani, and A. B. Leiter. 1997. hancer provides the critical context for the interaction with Sp1 The basic helix-loop-helix transcription factor BETA2/NeuroD is expressed in mammalian enteroendocrine cells and activates secretin gene expression. and Finb that potentiates the activating function of NeuroD1. Proc. Natl. Acad. Sci. USA 94:3560–3564. 21. Mutoh, H., F. J. Naya, M.-J. Tsai, and A. B. Leiter. 1998. The basic helix loop ACKNOWLEDGMENTS helix protein BETA2 interacts with p300 to coordinate differentiation of secretin-expressing enteroendocrine cells. Genes Dev. 12:820–830. mcb.asm.org This work was supported in part by NIH grants DK43673 and 22. Naya, F. J., H. Huang, Y. Qiu, H. Mutoh, F. DeMayo, A. B. Leiter, and M.-J. DK67166 to A.B.L. and the GRASP Digestive Disease Center P30- Tsai. 1997. Diabetes, defective pancreatic morphogenesis, and abnormal DK34928. enteroendocrine differentiation in BETA2/NeuroD-deficient mice. Genes We thank Hans Rotheneder (University of Vienna, Vienna, Aus- Dev. 11:2323–2334. 23. Naya, F. J., C. M. M. Stellrecht, and M.-J. Tsai. 1995. Tissue-specific regu- tria) and Yang Shi and Azad Bonni (Harvard Medical School, Boston,

lation of the insulin gene by a novel basic helix-loop-helix transcription at UNIV OF MASS MED SCH on December 26, 2008 MA) for generously providing plasmids as noted in Materials and factor. Genes Dev. 9:1009–1019. Methods. 24. Ohneda, K., R. G. Mirmira, J. Wang, J. D. Johnson, and M. S. German. 2000. The homeodomain of PDX1 mediates multiple protein-protein inter- REFERENCES actions in the formation of a transcriptional activation complex on the insulin 1. Biesiada, E., Y. Hamamori, L. Kedes, and V. Sartorelli. 1999. Myogenic promoter. Mol. Cell. Biol. 20:900–911. basic helix-loop-helix proteins and Sp1 interact as components of a multi- 25. Poulin, G., M. Lebel, M. Chamberland, F. W. Paradis, and J. Drouin. 2000. protein transcriptional complex required for activity of the human cardiac Specific protein-protein interaction between basic helix-loop-helix transcrip- ␣-actin promoter. Mol. Cell. Biol. 19:2577–2584. tion factors and homeoproteins of the Pitx family. Mol. Cell. Biol. 20:4826– 2. Cong, Y.-S., J. Wen, and S. Bacchetti. 1999. The human telomerase catalytic 4837. ␤ subunit hTERT: organization of the gene and characterization of the pro- 26. Poulin, G., B. Turgeon, and J. Drouin. 1997. NeuroD1/ 2 contributes to moter. Hum. Mol. Genet. 8:137–142. cell-specific transcription of the proopiomelanocortin gene. Mol. Cell. Biol. 3. Courey, A. J., and R. Tjian. 1988. Analysis of Sp1 in vivo reveals multiple 17:6673–6682. transactivational domains, including a novel glutamine-rich activation motif. 27. Ratineau, C., M. W. Petry, H. Mutoh, and A. B. Leiter. 2002. Cyclin D1 Cell 55:887–898. represses the basic helix-loop-helix transcription factor, BETA2/NeuroD. 4. Dumonteil, E., B. Laser, I. Constant, and J. Philippe. 1998. Differential J. Biol. Chem. 277:8847–8853. regulation of the glucagon and insulin I gene promoters by basic helix-loop- 28. Ray, S. K., J. Nishitani, M. W. Petry, M. Y. Fessing, and A. B. Leiter. 2003. helix transcription factors E47 and Beta2. J. Biol. Chem. 273:19945–19954. Novel transcriptional potentiation of BETA2/NeuroD on the secretin gene 5. Edlund, T., M. D. Walker, P. J. Barr, and W. J. Rutter. 1985. Cell-specific promoter by the DNA-binding protein Finb/RREB-1. Mol. Cell. Biol. 23: expression of the rat insulin gene: evidence for role of two distinct 5Ј flanking 259–271. elements. Science 230:912–916. 29. Rindi, G., S. G. N. Grant, Y. Yiangou, M. A. Ghatei, S. R. Bloom, V. L. 6. Gaudilliere, B., Y. Shi, and A. Bonni. 2002. RNA interference reveals a Bautch, E. Solcia, and J. M. Polak. 1990. Development of neuroendocrine requirement for myocyte enhancer factor 2A in activity-dependent neuronal tumors in the gastrointestinal tract of transgenic mice. Am. J. Pathol. 136: survival. J. Biol. Chem. 277:46442–46446. 1349–1363. 7. German, M. S., M. A. Blanar, C. Nelson, L. G. Moss, and W. J. Rutter. 1991. 30. Sharma, S., U. S. Jhala, T. Johnson, K. Ferreri, J. Leonard, and M. Montminy. Two related helix-loop-helix proteins participate in separate cell-specific 1997. Hormonal regulation of an islet-specific enhancer in the pancreatic ho- complexes that bind the insulin enhancer. Mol. Endocrinol. 5:292–299. meobox gene STF-1. Mol. Cell. Biol. 17:2598–2604. 8. Karlseder, J., H. Rothender, and E. Wintersberger. 1996. Interaction of Sp1 31. Shi, Y., J. Sawada, G. Sui, E. B. Affar, J. R. Whetstine, F. Lan, H. Ogawa, with the growth- and cell cycle-regulated transcription factor E2F. Mol. Cell. M. P. Luke, Y. Nakatani, and Y. Shi. 2003. Coordinated histone modifica- Biol. 16:1659–1667. tions mediated by a CtBP co-repressor complex. Nature 422:735–738. 9. Kunkel, T. A. 1985. Rapid and efficient site-specific mutagenesis without 32. Sui, G., C. Soohoo, E. B. Affar, F. Gay, Y. Shi, W. C. Forrester, and Y. Shi. phenotypic selection. Proc. Natl. Acad. Sci. USA 82:488–492. 2002. A DNA vector-based RNAi technology to suppress gene expression in 10. Lai, J.-S., and W. Herr. 1992. Ethidium bromide provides a simple tool for mammalian cells. Proc. Natl. Acad. Sci. USA 99:5515–5520. identifying genuine DNA-independent protein associations. Proc. Natl. 33. Weinmann, A. S., S. M. Bartley, T. Zhang, M. Q. Zhang, and P. J. Farnham. Acad. Sci. USA 89:6958–6962. 2001. Use of chromatin immunoprecipitation to clone novel E2F target 11. Lavrrar, J. L., and P. J. Farnham. 2004. The use of transient chromatin promoters. Mol. Cell. Biol. 21:6820–6832. immunoprecipitation assays to test models for E2F1-specific transcriptional 34. Wheeler, M. B., J. Nishitani, A. M. J. Buchan, A. S. Kopin, W. Y. Chey, T. activation. J. Biol. Chem. 279:46343–46349. Chang, and A. B. Leiter. 1992. Identification of a transcriptional enhancer 12. Lee, J. E., S. M. Hollenberg, L. Snider, D. L. Turner, N. Lipnick, and H. important for enteroendocrine and pancreatic islet cell-specific expression of Weintraub. 1995. Conversion of Xenopus ectoderm into neurons by neuroD, the secretin gene. Mol. Cell. Biol. 12:3531–3539. a basic helix-loop-helix protein. Science 268:836–844. 35. Wooten, L. G., and B. Ogretmen. 2005. Sp1/Sp3-dependent regulation of 13. Lee, L. T., K. C. Tan-Un, R. T. Pang, D. T. Lam, and B. K. Chow. 2004. human telomerase reverse transcriptase promoter activity by the bioactive Regulation of the human secretin is controlled by the combined effects of sphingolipid ceramide. J. Biol. Chem. 280:28867–28876.