Viral Control of SR Protein Activity

Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1078

______

CAMILLA ESTMER NILSSON

ACTA UNIVERSITATIS UPSALIENSIS UPPSALA 2001 Dissertation for the Degree of Doctor of Philosophy, Faculty of Medicine, in Medical Virology presented at Uppsala University in 2001

ABSTRACT Estmer Nilsson, C. 2001. Viral control of SR protein activity. Acta Universitatis Upsaliensis. Comprehensive Summaries of Uppsala Dissertations from the Faculty of Medicine 1078. 64 pp. Uppsala. IBSN 91-554-5124-1.

Viruses modulate biosynthetic machineries of the host cell for a rapid and efficient virus replication. One important way of modulating protein activity in eukaryotic cells is by reversible phosphorylation. In this thesis we have studied adenovirus and vaccinia virus, two DNA viruses with different replication stategies. Adenovirus replicates and assembles new virions in the nucleus, requiring the host cell transcription and splicing machinieries, whereas vaccinia virus replicates in the cytoplasm, only requiring the cellular translation machinery for its replication. Adenovirus uses alternative RNA splicing to produce its proteins. We have shown that adenovirus takes over the cellular splicing machinery by modulating the activity of the essential cellular SR family of splicing factors. Vaccinia virus, that does not use RNA splicing, was shown to completely inactivate SR proteins as splicing regulatory factors. SR proteins are highly phosphorylated, a modification which is important for their activity as regulators of cellular pre-mRNA splicing. We have found that reversible phosphorylation of SR proteins is one mechanism to regulate alternative RNA splicing. We have demonstrated that adenovirus and vaccinia virus induce SR protein dephosphorylation, which inhibit their activity as splicing repressor and splicing activator proteins. We further showed that the adenovirus E4-ORF4 protein, which binds to the cellular protein phosphatase 2A, induced dephosphorylation of a specific SR protein, ASF/SF2, and that this mechanism was important for regulation of adenovirus alternative RNA splicing. Inhibition of cellular pre-mRNA splicing results in a block in nuclear- to cytoplasmic transport of cellular mRNAs, ensuring free access of viral mRNAs to the translation machinery. We propose that SR protein dephosphorylation may be a general viral mechanism by which mammalian viruses take control over host cell gene expression.

Keywords: adenovirus, ASF/SF2, dephosphorylation, E4-ORF4, L1, MLTU, PP2A, splicing, SR proteins, vaccinia virus

Camilla Estmer Nilsson, Department of Medical Biochemistry and Microbiology, Biomedical Center, Box 582, Uppsala University, SE-751 23 Uppsala, Sweden

ISSN 0282-7476 ISBN 01-554-5124

Printed in Sweden by Eklundshofs Grafiska AB, Uppsala 2001 Till min familj MAIN REFERENCES

This thesis is based on the following papers, which in the text will be referred to by their Roman numerals:

I. Arvydas Kanopka, Oliver Mühlemann, Svend Petersen-Mahrt, Camilla Estmer, Christina Öhrmalm and Göran Akusjärvi. 1998. Regulation of adenovirus alternative RNA splicing by dephosphorylation of SR proteins. Nature 393: 185-187.

II. Camilla Estmer Nilsson, Svend Petersen-Mahrt, Celiné Durot, Ronit Shtrichman, Adrian R. Krainer, Tamar Kleinberger and Göran Akusjärvi. 2001. The adenovirus E4-ORF4 splicing enhancer protein interacts with a subset of phosphorylated SR proteins. EMBO J 20 (4): 864-871.

III. Camilla Estmer Nilsson*, David Huang* and Göran Akusjärvi. 2001. Functional inactivation of the essential SR family of splicing factors during a vaccinia virus infection. Manuscript. *these authors made equal contributions to the work

Reprints were made with permission from the publishers: Macmillan Magazines Ltd and European Molecular Biology Organization. TABLE OF CONTENTS

ABBREVIATIONS...... 6

INTRODUCTION ...... 7

FROM A GENE TO A PROTEIN ...... 8 SPLICING...... 11

BIOCHEMISTRY OF SPLICING ...... 12 HOW TO FIND AND DEFINE THE SPLICE SITES?...... 12 THE SPLICEOSOME ...... 13 Small nuclear ribonucleoprotein particles (snRNPs)...... 13 Spliceosome assembly ...... 14 SR proteins ...... 16 SR-related proteins (SRrps)...... 19 IMPORTANCE OF REVERSIBLE PHOSPHORYLATION IN SPLICING ...... 19 REGULATION OF ALTERNATIVE RNA SPLICING ...... 20 Positive regulation ...... 21 Negative regulation ...... 22 ADENOVIRUS...... 26

GENERAL BACKGROUND...... 26 THE VIRUS LIFE CYCLE...... 26 THE E4-ORF4 PROTEIN ...... 29 CONTROL OF ADENOVIRUS GENE EXPRESSION BY ALTERNATIVE RNA SPLICING...... 30 VACCINIA VIRUS...... 34

GENERAL BACKGROUND...... 34 THE VIRUS LIFE CYCLE...... 34 VIRAL CONTROL OF HOST CELL GENE EXPRESSION ...... 37

THE CELL CYCLE AND SIGNAL TRANSDUCTION ...... 37 DNA REPLICATION ...... 38 TRANSCRIPTION ...... 38 RNA PROCESSING AND EXPORT OF MRNA...... 39 TRANSLATION...... 40 PROTEIN TRANSPORT ...... 40 PRESENT INVESTIGATION ...... 41

REGULATION OF ADENOVIRUS ALTERNATIVE RNA SPLICING — INACTIVATION OF SR PROTEINS AS SPLICING REGULATORY PROTEINS BY DEPHOSPHORYLATION (PAPER I)...... 41 THE ADENOVIRUS E4-ORF4 PROTEIN INDUCES PP2A DEPENDENT SR PROTEIN DEPHOSPHORYLATION BY INTERACTING WITH A SUBSET OF PHOSPHORYLATED SR PROTEINS (PAPER I AND II)...... 42 E4-ORF4 IS A SPLICING ENHANCER PROTEIN — THE IIIA REPRESSOR ELEMENT (3RE) IS NECESSARY AND SUFFICIENT FOR E4-ORF4 ACTIVATED SPLICING (PAPER I AND II) ...... 43 STRONG E4-ORF4 INTERACTION WITH ASF/SF2 AND RECRUITMENT OF AN ACTIVE PP2A ENZYME ARE REQUIRED FOR E4-ORF4 MEDIATED ACTIVATION OF IIIA PRE-MRNA SPLICING (PAPER II) ...... 44 VACCINIA VIRUS INACTIVATES SR PROTEINS BY DEPHOSPHORYLATION (PAPER III)...... 45 CONCLUSIONS AND DISCUSSION ...... 47

ADENOVIRUS AND VACCINIA VIRUS INDUCE SR PROTEIN DEPHOSPHORYLATION — A GENERAL VIRAL MECHANISM TO CONTROL HOST CELL GENE EXPRESSION? ...... 47 E4-ORF4 — CELLULAR AND VIRAL FUNCTIONAL HOMOLOGES?...... 48 E4-ORF4 AND APOPTOSIS ...... 50 ACKNOWLEDGEMENTS ...... 51

REFERENCES ...... 52 ABBREVIATIONS

Ad-NE nuclear extract prepared from adenovirus-infected HeLa cells ASF/SF2 alternative splicing factor/ splicing factor 2, an SR protein DNA deoxyribonucleic acid ESE exonic splicing enhancer ESS exonic splicing silencer HeLa-NE nuclear extract prepared from HeLa cells hnRNPs heterogenous nuclear ribonucleoprotein particles ISE intronic splicing enhancer ISS intronic splicing silencer kDa kilo Dalton, a protein molecular weight unit L1 late region one in the MLTU of adenovirus MLTU major late transcription unit in adenovirus mRNA messenger ribonucleic acid OA okadaic acid ORF open reading frame PP2A protein phosphatase 2A p(Y)tract polypyrimidine-rich region close to a 3´ splice site RS-domain arginine- and serine-rich domain in the SR family of splicing factors snRNPs small nuclear ribonucleoprotein particles SR-Ad SR proteins purified from adenovirus-infected HeLa cells SR-HeLa SR proteins purified from HeLa cells SRrps SR-related proteins SRs the classical SR proteins SR-VV SR proteins purified from vaccinia virus-infected HeLa cells S100 cytoplasmic extract prepared from HeLa cells 3RE IIIa repressor element 3VDE IIIa viral dependent enhancer

6 INTRODUCTION

The human body consists of many different cell types, each with unique features and functions. All the information about these cells is stored within the genome, in the DNA, which is made of four different building blocks. The DNA is used as a template for the transcription of a messenger RNA, mRNA, that has similar building blocks as the DNA. In turn, the mRNA is translated into proteins, made of 20 different amino acids, each symbolized by a three ”letter” code in the gene. All cells in an organism contain an identical set of genetic material, with about 30.000-40.000 genes encoded in humans (132). However, different regions of the DNA are used as templates to produce the mRNAs that are translated into the proteins needed in a particular cell type. The cell regulates gene expression at multiple levels in order to produce the cell type specific proteins: DNA replication, transcription of RNA, RNA processing and transport, protein synthesis and stability of RNA and protein. This thesis will highlight one of these mechanisms: RNA splicing. Almost all genes in humans are interrupted by so called introns that are removed at the RNA level before the mature mRNA is translated. We have learned a lot about the cellular mechanisms controlling gene expression by studying viruses. Viruses are parasites, equipped with an RNA or DNA genome, and a protecting shell that consists of lipids and/or proteins. Viruses take over the biosynthetic machineries in the host cell and modify them for their own purpose: to support an efficient replication. Viruses can encode for their own DNA/RNA replication systems, transcription machineries, RNA processing machineries and proteins for transport of viral RNA and proteins. However, for RNA splicing and translation viruses need the cellular spliceosome and ribosome respectively. Both the spliceosome and the ribosome are complex molecular machines, which viruses modulate to suit their own purpose. In this thesis we have studied adenovirus and vaccinia virus, two DNA viruses with different replication strategies. Adenovirus replicates and assembles new virions in the nucleus and depends on the cellular transcription and splicing machineries, while vaccinia virus replicates in the cytoplasm, only requiring the cellular translation machinery. Adenovirus uses alternative RNA splicing extensively to produce its proteins and we show that adenovirus controls RNA splicing by modulating the activity of the essential SR family of cellular splicing factors (Paper I and II). Vaccinia virus on the other hand, that does not use RNA splicing, was found to completely inactivate SR proteins as splicing factors (Paper III). One important, perhaps the most important, way of modulating protein activity in all eukaryotic cells is by reversible phosphorylation. Viruses target cellular protein kinases and protein phosphatases that regulate the phosphorylated status of proteins. The SR family of splicing factors is highly phosphorylated, a modification which is crucial for their activity. We have found that reversible phosphorylation of SR proteins is one mechanism to regulate alternative RNA splicing (Paper I). We show that both adenovirus and vaccinia virus induce SR protein dephosphorylation, which inhibit their activity as splicing enhancer and repressor proteins (Paper I and Paper III). We have also found that the adenovirus E4-ORF4 protein, that binds to the cellular protein phosphatase 2A (PP2A), induces dephosphorylation of a specific SR protein and regulates adenovirus alternative RNA splicing (Paper II).

7 DNA transcription degradation PRE-mRNA capping polyadenylation splicing alternatively m7Gppp AAAA 7 spliced m Gppp AAAA 7 mRNAs m Gppp AAAA transport C B C translation Nucleus

Cytoplasm PROTEIN posttranslational modifications PROTEIN active

Figure 1. From a gene to a protein.

From a gene to a protein One important feature of the eukaryotic cell is that it has two compartments: the nucleus and the cytoplasm. The DNA is stored in the nucleus where transcription takes place. The precursor RNA (pre-mRNA) is processed in the nucleus before it is transported to the cytoplasm where the translational machinery is located. This RNA processing involves 5´ capping, splicing and 3´ end polyadenylation of the mRNA. This chapter will only briefly summarize the way from transcription of the RNA to protein translation (figure 1) keeping the focus of this thesis on pre-mRNA splicing. The DNA is transcribed by the multisubunit enzyme RNA polymerase (reviewed in 138). In the eukaryotic cell there are three different RNA polymerases (I, II and III) which synthesize different classes of cellular RNAs. RNA polymerase II transcribes mRNAs and small nuclear RNAs. All genes have a promoter area from which transcription of the gene starts. There are at least two features common to most promoters: the core promoter, which include the transcription start site and the TATA box, and sequences bound by regulatory transcription factors. RNA polymerase II does not by itself recognize the transcription start site, but needs the help of general transcription factors in order to assemble at the promoter. Transcription is regulated by two major mechanisms: (i) at the level of chromatin structure and (ii) at the level of transcription factor recruitment of the RNA polymerase to the promoter (138). There is a complex interplay between a myriad of activator and repressor proteins, some which bind directly to DNA. These factors function by directly or indirectly recruiting, or disrupting, the basal transcription machinery. The activity of many of these transcription factors are regulated by reversible phosphorylation. It has been shown that the switch from initiation to elongation of transcription involves phosphorylation of the C-terminal domain (CTD) of RNA polymerase II

8 which results in the association of many proteins with the CTD (138). A number of studies indicate that the RNA processing reactions, capping, splicing and polyadenylation happens cotranscriptionally, in intimate association with the CTD tail of RNA polymerase II (figure 2) (reviewed in 100). The 5´ end of the mRNA is capped by addition of an inverted methylated guanosine triphosphate (m7Gppp) (reviewed in 70). The capping enzymes have been shown to bind to the phosphorylated CTD and to carry out the capping reaction before the transcript has reached the size of 30 nucleotides. Two proteins bind to the cap structure in the nucleus and form the cap-binding complex (CBC), which is required for efficient mRNA export from the nucleus. This complex has also been shown to play a role in splicing, by facilitating association of U1 snRNP with the proximal 5´ splice site in a pre-mRNA (141) and for initiation of protein synthesis in the cytoplasm (see below) (100). A direct connection between the polymerase and splicing of the pre-mRNA is still somewhat controversal although recent evidence suggest a possible link. In vitro splicing reactions is stimulated by the phosphorylated form of RNA polymerase II or its CTD (101) and different types of promotors appear to dispose a specific splicing pattern to transcripts initiated on the promotor (43, 44). Some SR-related proteins have been found to associate with the CTD, called SCAFs (118, 197, 268) and the SR protein ASF/SF2 has been found to bind to the transcriptional cofactor p52 (76). In addition, the recruitment of splicing factors from their storage sites in the nucleus (speckels) to the sites of active transcription has been found to require an intact CTD of RNA polymerase II (168).

RNA pol II RNA pol II RNA pol II CPSF CstF CPSF p p p pre-mRNA p p p p p p CstF p CTD CE CTD CTD CstF p p p p p p pp p p A SCAFs SCAFs CPSF A SR A spliceosome U CBC CBC A A PAP

Figure 2. Transcription by RNA polymerase II connects capping, splicing and polyadenylation (modified from (100)). (SCAFs= SR-related CTD associated factors, CE= capping enzyme, CBC= cap binding complex, SRs= SR protein family, CPSF= cleavage- and polyadenylation-stimulatory factor, CstF= cleavage stimulatory factor, PAP= poly(A) polymerase).

The poly(A) tail at the 3´ end of the mRNA has been proposed to be important not only for termination of transcription but also for mRNA stability, transport of processed mRNA from the nucleus to the cytoplasm and promoting mRNA translation. Polyadenylation is a two-step process with an endonucleolytic cleavage followed by poly(A) synthesis (reviewed in 279). The cleavage/polyadenylation factors have also been clearly associated with the CTD during transcriptional elongation (100). Deletion of the CTD from RNA polymerase II inhibits

9 polyadenylation of reporter transcripts in transfected cells. Furthermore, the CTD stimulates 3´ cleavage in vitro. Polyadenylation and splicing appears to be connected in the recognition of the 3´ terminal exon (100). As is the case in the natural context, the presence of a 3´ splice site activates polyadenylation, while a strong 5´ splice site positioned downstream or immediately upstream of the poly(A) site inhibits polyadenylation. Thus, U1 snRNP binding inhibits polyadenylation either via inhibition of poly(A) polymerase (89) or of the 3´ cleavage (247). When the 3´ splice site upstream of the poly(A) site is weak, as is the case in many alternatively processed mRNAs, additional interactions mediated by splicing factors bound to exonic enhancer sequences may also contribute to polyadenylation. After splicing the mRNAs are transported to the cytoplasm as ribonucleoprotein complexes (RNPs). It appears that each major class of RNAs (tRNA, rRNA, UsnRNA and mRNA) uses distinct export pathways (reviewed in 48). Nucleo-cytoplasmic transport occurs through the nuclear pore complex (NPC) which provide docking sites for transport complexes. Nuclear localisation signals (NLS) and nuclear export signals (NES) direct protein import or export through interactions with transport receptors. During transcription the pre-mRNA is bound not only by splicing factors but also heterogenous nuclear ribonucleoproteins (hnRNPs) (reviewed in 274). These are thought to induce appropriate processing and folding of the pre-mRNAs. The hnRNPs remain bound after splicing is completed. During mRNA export to the cytoplasm certain hnRNPs are removed at the NPC and stay in the nucleus (hnRNP C), while others (hnRNP A1 and K), follow the mRNA to the cytoplasm and shuttles back to the nucleus. It has been found that splicing of the pre-mRNA also leaves a protein complex bound 20-24 nucleotides upstream of the splice sites in the mRNAs. This complex consists of DEK, SRm160, Y14 and RNPS1 (115, 136, 137). Importantly, this complex also bind mRNA export factors such as Aly/REF and TAP (283) and thereby provide a link between RNA splicing and transport of the mRNA. After reaching the cytoplasm the mRNA is translated into a protein by the ribosome, a complex multisubunit molecular machine consisting of RNAs and proteins. Eukaryotic initiation factors (eIFs) mediate the recruitment of the mRNA to the ribosome (reviewed in 79). The activity of eIFs is regulated in multiple ways: by transcription, reversible phosphorylation, binding to inhibitory proteins, and proteolytic cleavage. The initiation of translation is the rate limiting step in translation and involves binding of eIF4E to the 5´ cap, recruitment of the RNA helicase eIF4A to the 5´ region and bridging of the mRNA with the ribosome by eIF4G that also induces circularization of the mRNA via interaction with poly(A)-binding protein (PAB). The 40S subunit assembles with the mRNA as a ternary complex together with eIF2 and the initiator tRNA. Once loaded on the mRNA the 40S ribosomal subunit scans the mRNA for the first start codon, where it assembles with the 60S ribosomal subunit and translation can start. Multiple initiations can occur on a single mRNA creating a beads-on-a-string-like structure that can be visualized by electron microscopy. The mRNAs in the cytoplasm are sooner or later subjected to degradation (reviewed in 87). The poly(A) tail is gradually deadenylated, which in turn causes decapping at the 5´ end followed by a 5´- to 3´-exonucleolytic degradation. RNA stability can also be regulated through AU-rich elements present in the 3´ untranslated region of several short-lived mRNAs. Premature stop codons (PTCs) have also been shown to cause degradation of mRNAs.

10 SPLICING

Most eukaryotic genes contain intronic sequences that are removed by splicing in order to assemble the coding regions (exons) into a functional mRNA. The complexity of splicing increases enormously from yeast to mammals. Only 250 out of the 6000 genes in the yeast S. cerevisae contain introns, while more than 99% of the genes in humans are thought to contain introns. In yeast, most genes that have introns only have one small intron near the beginning of the transcript. In contrast, most of the mammalian genes consists of intronic sequences. The genetic complexity in mammals is also increased by the usage of alternative splicing of exons (reviewed in 82, 147). One extreme example is the Dscam gene in D. melanogaster, which produces a pre-mRNA that can be alternatively spliced into over 38.000 different mRNAs. Introns are removed before the mRNA is transported to the cytoplasm. Unspliced mRNAs are usually not transported to the cytoplasm. Although the basis for the nuclear retention of unspliced transcripts is unclear, splicing seems to deposite a specific complex of proteins on the mRNA that targets the mRNA to transport (136, 137, 150). Splicing is not always compulsory for efficient cytoplasmic accumulation of mRNAs. Thus, there are examples of genes that are intronless and still are efficiently transported to the cytoplasm, for example mRNAs encoding for the histone proteins (116), α-interferons (183) and c-jun (95) and several viral mRNAs. Pre-mRNA splicing takes place in a large macromolecular complex, the spliceosome, composed of five small nuclear ribonucleoprotein particles (snRNPs) and 50-100 polypeptides many of which are not associated with snRNPs (non-snRNP proteins) (reviewed in 20). The RNA components of snRNPs align the pre-mRNA splice sites and probably mediate splicing catalysis. The bunch of proteins required for splicing mediate the recognition and pairing of the splice sites and the structural reorganisations during spliceosome assembly and catalysis. The spliceosome is restricted to the nucleus in eukaryotic cells and not found in organelles (mitochondria or chloroplasts) or prokaryotes. From an evolutionary point of view, splicing have many advantages for the eukaryotic cell. It ensure cells a certain grade of combinatorial freedom in using their genetic information. Exons can be rearranged in the genome during the course of evolution to create new genes. This might be a faster way of adapting to environmental changes than from accumulation of mutations in an existing gene. In contrast, bacterial genes are not interrupted by introns. Instead, bacteria create an evolutionary sufficient rate of mutation by replicating very fast. Bacteria also contain mobile introns (called group I and group II introns) which can ”self-splice” by having an intrinsic catalytic activity (reviewed in 78). It is thought that the eukaryotic introns might be remnants of group II introns. Group II introns resemble spliceosomal introns and can be found in mitochondria and chloroplasts.

11 Biochemistry of splicing An intron is spliced out by two transesterification reactions without the need for an external supply of energy (figure 3). After the first cleavage at the 5´ splice site, the 2´ OH of the branchpoint adenosine attacks the intronic 5´ phosphate to form a 2´-5´ phosphodiesterbond, which results in a lariat structure and a free exon. In the second reaction the 3´ OH of the first exon attacks the 5´ phosphate of the second exon yielding the spliced exon product and the intron lariat (reviewed in 20).

3´ 3´ O H G G5´ P 3´ 5´ 5´ G P2´ A 3´OH GGPPA A PG + 2´OH step 1 step 2 P

Figure 3. The catalytic steps in splicing (from (20)).

How to find and define the splice sites? Splicing is a simple process from a chemical point of view. However, each splicing reaction takes place with a high degree of accuracy to ensure that coding information is not lost or altered. The consensus sequence elements at the splice sites directs, in part, the assembly of the spliceosome (figure 4). In mammals the 5´ splice site signal is AG/GURAGU (where / shows the exon-intron boundary). Three distinct sequence elements are found at the 3´ splice site: (i) the branchpoint sequence (YNYURAC), located 18-40 nucleotides from the 3´splice site, (ii) a polypyrimidine tract (p(Y)tract) and (iii) the actual 3´ splice site (YAG/N). In yeast the sequences are more strongly conserved (figure 4) (20).

Figure 4. Splice site signals in mammals and yeast (from (20)). Bold letters represent highly conserved nucleotides (>90%). * shows the adenosine residue forming phosphodiesterbond with the 5´ intronic phosphate. Y= pyrimidines (U or C), R= purines (G or A), N= any nucleotide.

A major question to be answered is how the correct splice sites are found. Splice site signals in mammals are short and often degenerate. The specificity in splicing vertebrate genes is not determined only by the splice site signals but also by exonic or intronic splicing enhancer or splicing repressor elements. The initial

12 recognition of splice sites involves multiple relatively weak RNA-RNA and RNA- protein interactions that commit the pre-mRNA to splicing. In mammals, the 5´ and 3´ splice sites at internal exons are thought to be recognized by a process called ”exon definition” (4). A general finding is that the mammalian exons are usually very short (50-300 bases). In the exon definition model, the initial recognition of splice sites is thought to occur by interactions between splicing factors binding to the 3´ and 5´ splice sites across the exon (see figure 7). This model is supported by the observation that mutations in a 5´ splice site can affect the splicing efficiency of the upstream 3´ splice site. The assembly of the spliceosome may also occur by the interaction between the splice sites over long distances. Strong candidate proteins for these types of interactions, both in the exon definition model and over the introns, are the SR proteins. However, terminal exons appear to be defined by alternative mechanisms. The cap nucleotide has been shown to promote recognition of the first 5´ splice site in a pre-mRNA and the polyadenylation signal has been shown to promote the use of the last 3´ splice site (140). As discussed in the previous chapter, these processing events all seem to occur co-transcriptionally. Thus, in addition to delivering factors to the splice sites, the RNA polymerase II can possibly play a more direct role in the processing reactions. Perhaps splicing factors simultaneously binding to the CTD of RNA polymerase II and the splice site are brought along with the polymerase to the next splice site for efficient pairing (figure 2). It has been estimated that around 15 % of human genetic diseases are caused by mutations that destroy functional splice sites or generate new ones (reviewed in 199). The majority of these mutations are within the conserved sequences at the 3´ and 5´ splice sites. However, there are also examples of mutations in exons that destroy cis-acting elements required for correct splice site choice. One example is the survival of motor neuron gene (SMN). Loss of SMN protein expression correlates with the development of spinal muscular atrophy (SMA). A mutation in exon 7 appears to destroy an exonic splicing enhancer and cause exon 7 skipping, which results in a nonfunctional SMN protein (148, 149, 172).

The spliceosome

Small nuclear ribonucleoprotein particles (snRNPs) SnRNPs are defined as tight complexes of several proteins and a short RNA molecule (usually 60-300 nucleotides) (reviewed in 267). They exist both in the nucleus and in the cytoplasm of eukaryotic cells. Those that are in the nucleus are divided into two families: the snRNPs in the nucleoplasm, which are required for mRNA formation and the snoRNPs in the nucleolus that are involved in ribosomal RNA formation. Mammalian cells contain about 200 distinct kinds of snRNPs. The snRNPs involved in splicing are very abundant, exceeding 106 copies per cell. These are the (uridine- rich) U1, U2, U4, U5 and U6 snRNPs. The secondary structure and the sequence of the UsnRNPs are conserved from yeast to human. Each UsnRNP particle consists of a UsnRNA molecule complexed with a set of seven Sm or Sm-like proteins and several particle-specific proteins. Via interactions between their RNA and protein components with the pre-mRNA, the UsnRNPs mediate the recognition and pairing of the 5´ and 3´ splice sites during spliceosome assembly. There are also a group of less abundant snRNPs (U11, U12, U4atac and U6atac) that together with U5 snRNP are subunits of the so-called minor spliceosome (U12-type) (20). The major class (U2-

13 type) spliceosome is universal in eukaryotes and splices introns containing the canonical GT-AG sequence at the splice sites, whereas the minor class (U12-type) spliceosome, splices introns with AT-AC (and GT-AG) termini. The proportion of nuclear introns that are spliced by the U12 spliceosome seem to be very small, about one in a thousand. This thesis will focus on pre-mRNA splicing with the major U2- type spliceosome. All UsnRNAs except for U6 are transcribed by RNA polymerase II and are exported to the cytoplasm, where they assemble in a step-wise manner with the Sm proteins, to form the UsnRNP Sm core structure (reviewed in 257). The snRNPs are also modified in several ways, for example, their cap is methylated. The methylated cap and the Sm core are required for the snRNPs to be transported back to the nucleus. In the nucleus snRNPs are assembled with their individually specific snRNP proteins. U6 snRNA, on the other hand, is transcribed by RNA polymerase III and is assembled in the nucleus. The La protein helps U6 snRNA to assemble with the Sm- like proteins. Then, U6 and U4 snRNPs pairs to from the U4/U6 snRNP.

Spliceosome assembly Spliceosome assembly occurs in a stepwise fashion (figure 5) (reviewed in 230). It is initiated by binding of U1 snRNP to the 5´ splice site, SF1/mBBP (splicing factor 1/ mammalian branch point binding protein) to the branchpoint sequence and U2 auxiliary factor (U2AF) to the polypyrimidine tract (p(Y)tract) and the 3´ AG to form the E (early) complex. Subsequently, U2 snRNP binds to the branchpoint to form complex A, followed by the association of the U4/U6-U5 tri-snRNP to form complex B. Next the spliceosome rearranges to form the catalytically active C complexes. SR proteins are required for spliceosome assembly at several steps. They help to commit a pre-mRNA to splicing by recruiting splicing factors to the pre-mRNA. SR proteins and their function will be further discussed in the next chapter. The recognition of the 5´ splice site by U1 snRNP, which is ATP independent, involves base pairing between the 5´ splice site and the well conserved 10 nucleotides at the 5´ end of U1 snRNA. U1 snRNP association with the 5´ splice site is critical for splicing in vitro. However, increasing the concentration of SR proteins can overcome the requirement for U1 snRNP (45, 239). In this case the 5´ splice site is recognized by U6 snRNA and other spliceosomal components before the first step of splicing (46, 238). U2 snRNP has been found to be present already in the E complex, but stable binding to the branch point requires ATP (49). Many proteins are devoted to help U2 snRNP to recognize the branch point at the 3´ splice site. U2AF is required for targeting of U2 snRNP to the branch point (213). Human U2AF is a heterodimer consisting of a 65 kDa and a 35 kDa subunit (see section ”SR-related proteins”) (272, 273, 276). The U2AF65kDa binds to the p(Y)tract (74, 272) and the U2AF35kDa contacts the 3´ splice site (160, 260, 285). The binding affinity of U2AF to the p(Y)tract depends on the length and the pyrimidine content of the p(Y)tract, which is important in regulation of alternative splicing. U2AF35kDa interacts with SR proteins which stabilize binding of U2AF to the p(Y)tract (see figure 7). For further discussion about U2AF, see ”Regulation of alternative RNA splicing”.

5´ ss 3´ss

GUAp(y) AG pre-mRNA

SF1 SR U2AF U1 65 35

SR SR SR 35 U1 U2AF E complex 65 A commitment SF1 complex U2 p14 SF1

SF3b SF3a SR SR SR 35 U1 U2AF A complex U2 A pre-spliceosome

U5 U2AF U6 U4 65 35

SR SR U5 U1 B complex U6 spliceosome A U4 U2

U4 U5 U6 C complex U2A active spliceosome

Figure 5. Spliceosome assembly.

SF1/mBBP cooperates with U2AF to recognize the branch point (1, 5). SF1/mBBP is displaced when U2 snRNP binds to the branch point. The U2 snRNP associated factors, SF3a and SF3b, are also required for stable association of U2 snRNP to the branch point (3, 14, 15, 128). Another protein binding to the branch point is p14, that interacts with SF3b and U2 snRNP (203, 258). When the U4/U6-U5 tri-snRNP then joins the complex dynamic rearrangements of RNA-RNA interactions occurs which forms the spliceosome. U5 snRNP makes contact with exon and intron sequences at the 5´ and 3´ splice sites and basepaires with the 5´ end of U1 snRNA (267). These interactions bring the two splice sites close together. U5 snRNP interaction with the 5´ exon is required for the

15 second catalytic step of splicing (187, 191). U6 snRNP dissociates from U4 snRNP and forms basepairing with U2 snRNP and replaces U1 snRNP as the factor interacting with the 5´ end of the intron (reviewed in 181). It is suggested that competition between U1 snRNP and U6 snRNP for interaction with the 5´ splice site is involved in regulating the transition from an inactive to an active spliceosome (130, 231) . Studies in yeast have shown that the U2-U6 helix I is required for splicing catalysis, argueing that it contributes to the catalytic core of the spliceosome (20). During the first catalytic step of splicing the lariat intermediate and the free 5´ exon are generated. Before the second catalytic step, the spliceosome undergoes additional conformational changes, creating new RNA-RNA interactions. The U2-U6 snRNP interaction changes and makes contact with the 5´ splice site in the lariat intermediate and the free 5´ exon is joined together with the 3´ exon (20). All steps in spliceosome assembly require ATP hydrolysis, except formation of the E-complex. Many proteins with sequence similarity to DNA helicases have been found to associate with the spliceosome. It is believed that the spliceosome consumes ATP to rearrange RNA-RNA interactions during assembly and the catalytic steps of splicing (230).

SR proteins SR proteins are a family of highly conserved nuclear factors that play multiple important roles both in constitutive and regulated splicing of pre-mRNAs in metazoan organisms. Some SR protein functions are redundant, but other functions are unique and specific to a certain family member (reviewed in 66, 83, 153, 234). SR proteins were independently discovered by two groups taking different approaches. ASF/SF2 (Alternative Splicing Factor/ Splicing factor 2) was purified from HeLa cell nuclear extracts as a factor required to complement splicing deficient cytoplasmic HeLa cell extracts (S100) (77, 127) and to induce splice site switching (75, 126). In another approach, monoclonal antibodies recognizing structures of sites of transcription in oocyte nuclei, were used to identify SR proteins, named after their high serine and arginine content (68, 69, 209, 269). All the ”classical” SR proteins (figure 6), range in size of 20-75 kDa and can by themselves complement a splicing deficient S100 extract in vitro (66). SR proteins have been found in plants and all metazoan species examined but not in all eukaryotes. There are two SR proteins found in S. pombe (86, 151) while none has been discovered in S. cerevisae (so far). Some, but not all, SR proteins are essential. SRp55 is essential for development in D. melanogaster (B52, (205)), and ASF/SF2 is essential for viability in chicken DT40 cells (254) and in C.elegans (rsp-3, (146)). The basis for this is not known. Either the nonessential SR proteins do not participate in the splicing of essential genes, or other SR proteins can functionally substitute for the missing SR protein.

SRp75 RBD1GR RBD2 RS 494aa SRp55 RBD1GR RBD2 RS 344aa SRp54 RBD RS 484aa SRp40 RBD1RRBD2 RS 273aa ASF/SF2 RBD1G RBD2 RS 248aa SRp30c RBD1 GRSRBD2 221aa

9G 8 RBD RP Z RSRS 238aa SC35 RBD PG RS 221aa SRp20 RBD RP RS 164aa

Figure 6. The classical SR proteins. RBD= RNA binding domain, RS= arginine- and serine-rich domain, aa= amino acids. The regions between the RBDs and RS domains are rich in glycine (G), arginine (R), and proline (P) residues respectively. The figure is modified from (153). SRp54 structure is from (34, 277).

SR proteins have a modular structure. They have one or two N-terminal RNA binding domains (RBDs) and a C-terminal domain rich in arginine- and serine dipeptide repeats (the RS domain). RNA sequences recognized by SR proteins have been studied by SELEX (28, 142, 143, 216, 233, 235, 236) (systematic evolution of ligands by exponential enrichment), which selects high-affinity binding sites from pools of random RNA sequences (58, 245). In general, selected sequences have short consensus binding sites (6-10 nucleotides) without evidence of a secondary structure. SR proteins with two RBDs appear to require both for specific high affinity RNA binding (235). In several cases, sequences identified as binding sites for one SR protein are also recognized by other SR proteins (143, 235, 236). This may in part explain their redundancy in function. Importantly, many reports have shown that high-affinity binding sites are sufficient to function as exonic splicing enhancers (ESEs, see section Regulation of alternative RNA splicing). Examples of such high- affinity binding sites are shown in Table 1. The RS domain in SR proteins function as a protein-protein interaction domain. SR proteins have been found to interact with eachother, the U2AF35kDa and the U1 snRNP specific protein U1-70K (for example, ASF/SF2 and SC35 in (259)). In contrast, SRp54 interacts with U2AF65kDa but not U1-70K or U2AF35kDa (277). Different protein interactions may have distinct RS domain requirements. For example, ASF/SF2 binds to both U1-70K and RSF1. While the RS domain is sufficient for the interaction with RSF1, both the RS domain and the RBDs are necessary for ASF/SF2 interaction with U1-70K (131, 262). In many respects, the RS domain in different SR proteins appear to have redundant functions. First, when artificially bound to the pre-mRNA, the RS domains of several SR proteins are sufficient to activate enhancer-dependent splicing (84), an activity that probably is mediated by protein-protein interactions. Second, RS domains have been found to be exchangeable between different SR proteins both in vitro and in vivo. For example, the RS domain of TRA2 (a D. melanogaster SR-related protein) can substitute for the ASF/SF2 RS domain in chicken cells lacking endogenous ASF/SF2 (255), and several RS domains can replace the TRA2 RS domain in D. melanogaster (50). Also, exchanging the RS domains of ASF/SF2 and SC35 has no negative effects for the

17 respective protein to complement splicing deficient S100 extracts in vitro (32). However, the RS domains seem to have distinct properties in directing subcellular localisation of the SR proteins. SR proteins migrate from speckels (subnuclear domains that may function as storage sites for certain splicing factors) to sites of active transcription and ASF/SF2 and SRp20 have been shown to shuttle in and out of the nucleus. The RS domain of ASF/SF2 can convert the nonshuttling protein SRp40 to a protein that shuttles (22). In, addition, the RS domain of SRp20 can target an unrelated fusion protein to speckels (21).

SR protein RNA binding site

SRp55 USCGKM SRp40 ACDGS 9G 8 GGACGACGA ASF/SF2 SRSASGA SC35 GRYYCSYR SRp20 CCUCGUCC

Table 1. SR protein RNA binding sites (reviewed in 83, 234). Examples of ESEs binding respective SR protein identified by functional SELEX (randomized sequences that enhance in vitro splicing). The SRp55 binding sequence was found by conventional SELEX (randomized sequences that bind the SR protein). Sequences for ASF/SF2, SRp40 and SRp55 are from (143), 9G8 and SRp20 from (216) and SC35 from (142). (R=purine, Y=pyrimidine, S=G/C, D=A/G/U, M=A/C, K=U/G).

Many papers have demonstrated that SR proteins functions as splicing enhancer proteins by binding to ESEs. These elements have been identified in a number of constitutively and alternatively spliced metazoan exons. SR proteins are proposed to enhance splicing from ESEs by a number of mechanisms (figure 7):

• by recruiting U2AF to the p(Y)tract via an interaction with the RS domain of U2AF35kDa (”U2AF recruitment model”). • by binding to the U1-70K protein and possibly also the 5´ splice site thereby recruiting U1 snRNP to the 5´ splice site (59, 107, 123, 271, 287). • by recruiting the U4/U6-U5 tri-snRNP to the spliceosome, potentially via interaction with the RS domains of U5-27K and U5-100K (SR-related proteins) (63, 206, 238, 242). • by bridging splicing factors bound to the 3´ and 5´ splice sites respectively over the exon (”exon definition model”; (4)).

SR proteins are also proposed to promote an interaction between U1 and U2 snRNPs, on the pre-mRNA over the intron, by simultaneously interacting with U1- 70K and U2AF35kDa (67, 259). In addition, SR proteins are required for trans-splicing, where the 5´ and 3´ splice sites are present on separate RNA molecules (17, 36).

18 SR proteins can also repress splicing both by binding to exonic and intronic sequence elements (for further discussion see chapters ”Adenovirus” and ”Negative regulation of alternative RNA splicing”). It seems that the repressor and enhancer functions of ASF/SF2 are encoded by distinct domains in the protein (Dauksaite and Akusjärvi, submitted). The RNA binding domain 2 (RBD2) of ASF/SF2 are both necessary and sufficient for the splicing repressor function of ASF/SF2. For further discussion of SR protein function in alternative RNA splicing and the U2AF recruitment model, see Regulation of alternative RNA splicing.

U5 U6 U4

SR SR

U2AF SR SR U2A F SR A 65 35 U1 A 65 35

Figure 7. SR proteins different functions. SR proteins recruit splicing factors to the splice sites and are thought to bridge both over the intron and the exon.

SR-related proteins (SRrps) There are also a number of additional RS-domain containing proteins, distinct from the classical SR proteins, that are reqiured for pre-mRNA splicing. These are collectively referred to as SRrps (reviewed in 9). Examples include U2AF35kDa (276), U2AF65kDa (272, 273), U1-70K (229), Sip1 (278), U5-27K (63) and U5-100K (242). Most of the SRrps do not contain an RNA binding domain and eventhough many of the SRrps are essential splicing factors, they can not, as the classical SR proteins, complement splicing deficient S100 extracts. U2AF65kDa contains three RNA binding domains responsible for binding to the p(Y)tract (273) and an amino-terminal RS domain, which is believed to facilitate binding of U2 snRNP to the branch point (248). The RS domain of U2AF35kDa stabilizes U2AF65kDa binding to the p(Y)tract and is proposed to mediate interactions with SR proteins at the 3´ splice site (259, 286). Although U2AF35kDa does not contain a canonical RNA binding domain, it contacts the 3´ splice site AG (160, 260, 285). The U1-70K protein has one RNA binding domain which tethers the protein to U1 snRNA and an RS domain required for U1 snRNP interaction with SR proteins (25, 123, 185). Another SRrp is the splicing coactivator SRm160/300 that have one RS domain (8, 10). SRm160/300 has been shown to be required for an ESE to promote splicing of a pre-mRNA, by interacting with U2 snRNP and SR proteins over the intron (57).

Importance of reversible phosphorylation in splicing Several studies have shown that reversible protein phosphorylation contributes to spliceosome dynamics at almost every step of the splicing reaction. Generally, it seems that spliceosome assembly requires protein phosphorylation while the catalytic reactions require dephosphorylation (166). Protein phosphatase 1 (PP1) is required for the first step of catalysis, while protein phosphatase 2A (PP2A) is required for the

19 second step (161, 162, 240). Although, neither of these phosphatases have been shown to be stably associated with the spliceosome. SR proteins appear to be a key target of reversible phosphorylation in splicing. Both phosphorylation and dephosphorylation of SR proteins are required for splicing in vitro (26, 262, 263), apparently at different steps. Phosphorylated SR proteins are required for the assembly of the spliceosome (162) while dephosphorylation of SR proteins are required for splicing catalysis (263). It has been shown that SR proteins are highly phosphorylated in vivo (208), mainly at serine residues in the RS domain (40). Phosphorylation of the RS domain influences the RNA binding capacity of SR proteins. Phosphorylated SR proteins bind more specifically to the RNA (233, 262). RS domain phosphorylation also regulates protein-protein interactions. For example, it enhances binding to U1-70K which is probably important for 5´ splice site recognition and changes interactions among SR proteins (255, 262). It is speculated that the dephosphorylation of SR proteins helps to weaken the interaction of U1 snRNP to the 5´ splice site in complex B. However, dephosphorylation of U1-70K is also required for splicing catalysis (241). Reversible phosphorylation has also an influence on the subcellular localisation of SR proteins. Phosphorylation of SR proteins causes redistribution of SR proteins from speckels to sites of active transcription in the nucleus (22, 167). Many types of protein kinases have been identified that can phosphorylate SR proteins: SRPK1 (88), SRPK2 (255b), the Clk-Sty family (40), DNA topoisomerase I (207) and cdc2 (194). Evidence have been presented that Clk-Sty regulates alternative RNA splicing, both of its own pre-mRNA (55) and in two pre-mRNAs involved in the control of sex development in D. melanogaster (54). Phosphorylation of hnRNP proteins may also be important for splicing regulation. Induced phosphorylation of hnRNP A1 results in change of the alternative splicing of the hnRNP A1 pre-mRNA (249). There are exceptions to the ”general rule” of phosphorylation in assembly and dephosphorylation in splicing catalysis. SAP155 is a U2 snRNP protein, that has been found to become phosphorylated during the catalytic steps of splicing (255c). Also, a protein phosphatase 2Cγ (PP2Cγ) has been found to be associated with the spliceosome and required early in assembly prior to complex A formation. PP2Cγ remains associated with the spliceosome and may be involved also in later steps of splicing catalysis (182). As described earlier, there are many rearrangements of RNA-RNA and RNA- protein interactions occuring during spliceosome assembly and catalysis. A number of spliceosome-associated components have amino acid sequences similar to ATP- dependent helicases and GTPases (91).

Regulation of alternative RNA splicing Alternative splicing is frequent in metazoans from C. Elegans and D. Melanogaster to humans (reviewed in 82, 94, 147, 225). A low estimate suggests that around 59% of human genes have at least two splice variants (132). Although many sequences within mammalian transcripts match the consensus splice sites, most of them are not used. Instead it seems that many positive and negative cis-acting sequence elements binding various trans-acting factors regulate splice site usage. Positive elements promote splicing at correct splice sites and appropriate times. Negative elements may block splicing at pseudo splice sites and partially or completely repress splicing at inefficient or regulated splice sites.

20 Alternative splicing is an important mechanism increasing protein diversity by allowing multiple, sometimes functionally distinct, protein isoforms to be encoded by a single gene. Alternative splicing can be tissue specific, developmental specific or induced under stress conditions or in pathological states. Some alternative splicing events appear to be constitutive, with mRNA variants coexisting at a constant ratio in the same cell, whereas others are regulated. Alternative splicing patterns result from the usage of alternative 5´ splice sites, alternative 3´ splice sites, optional exons, mutually exclusive exons, or retained introns (figure 8). Alternative splicing decisions involve competition among potential splice sites. Thus, splicing patterns can be controlled by any mechanism that changes the relative rates of splice site recognition. Therefore, splicing patterns that look similar can involve fundamentally different pathways. Splice sites with weak signals can be regulated by positive trans-acting factors binding enhancers. At the same time, weak splice sites can efficiently compete with a stronger site when the latter is repressed by negative regulation. Highly specific alternative splicing factors have not been identified in vertebrate cells, and few have been identified in invertebrates. Instead, it seems that the specificity comes from variations in relative concentrations or activity of competing and cooperating factors together with the strength of binding sites for regulatory and constitutive splicing factors. SR proteins and hnRNP proteins are some of the factors that have been shown to regulate alternative splicing. The following sections will describe basic mechanisms of enhancement and repression of splicing.

retained intron

al t ernative 3´ spl ice sit es

al t ernative 5´ spl ice sit es

exon skipping or inclusion

mutually exclusive exons

Figure 8. Different scenarios of alternative RNA splicing.

Positive regulation Splicing enhancer elements have been identified in many regulated and constitutively spliced pre-mRNAs (reviewed in 7, 82, 94, 147, 225). Splicing enhancers are position dependent. Changing their location, can change their dependence on particular trans- acting factors or determine whether they activate 5´ or 3´ splice site usage. ESEs are often purine-rich and it is generally believed that SR proteins activate splice sites by binding to ESEs and recruit splicing factors to the nearby 3´ and/or 5´ splice sites. The primary sequences of ESEs are degenerate and not conserved. This may be important because it means that the protein coding capacity of the ESE is not strictly determined by the ESE activity. In the ”U2AF recruitment model” SR proteins binding to an ESE recruit the U2AF65kDa to the p(Y)tract by interacting with the RS domain of U2AF35kDa (figure 7).

21 This seems to be most important for weak 3´ splice sites which bind U2AF poorly. In these cases the RS domain of the SR proteins are required for activation. However, there are pre-mRNAs where ESE function do not correlate with increased binding of U2AF to the p(Y)tract. For example, introns with strong p(Y)tracts that bind efficiently to U2AF65kDa, do not require the U2AF35kDa for activation (284). This suggests that SR proteins binding to an ESE may act through other mechanisms. Perhaps by competing with repressing factors, such as hnRNP proteins (see ”Negative regulation”). This activity does not require the RS domain of the SR proteins (284). Collectively, available data suggests that SR proteins both may have RS domain dependent and independent functions in activating splicing through ESEs (reviewed in 94). Much of our understanding of ESE function has been derived from studies on alternative splicing of key factors involved in sex determination in D. melanogaster (reviewed in 147). A well characterized example is the ESE present in the D. melanogaster double-sex gene (dsx). In males, dsx exon 4 is skipped, while in females, exon 4 is included. Exon 4 inclusion requires a complex ESE in exon 4 that consists of six 13-nucleotide repeats, called the dsx repeat element (dsxRE). Each repeat is recognized by the SR protein 9G8, the D. melanogaster SR protein RBP1 and the splicing regulators TRA and TRA2 (152). All four proteins bind cooperatively to the splicing enhancer and activates the upstream weak dsx 3´ splice site. ESEs can also activate the usage of a downstream 5´ splice site. For example, the D. melanogaster fruitless gene (fru), has an ESE consisting of three nearly perfect copies of the dsxRE repeat unit, immediately upstream of the female specific 5´ splice site (214). TRA, TRA2 and RBP1 are also important in female specific fru 5´ splice selection splicing, although the mechanistic details are not yet known (97). There are also intronic splicing enhancers (ISEs), mostly pyrimidine-rich and located close to the 5´ splice site. In c-src the inclusion of the N1 exon is enhanced in neuronal cells by a complex of hnRNP proteins binding to an ISE downstream of the 5´ splice site (figure 9) (37, 164, 165, 170).

Negative regulation Splicing can also be negatively regulated, by intronic and exonic splicing silencer elements (ISSs and ESSs). A summary of possible events is shown below (for some of the examples see figure 9).

Ways to inhibit splicing: • SR protein binding to ISSs inhibiting the usage of 3´ and 5´ splice sites. Blocks recruitment of general splicing factors to the splice sites (Ad-L1 3RE (114), CFTR exon 9 (195) and BPV-1? (281)). • SR protein binding an ESS and inhibiting the 3´ splice site usage. Sequesters SR proteins from the ESEs (BPV-1 (282)). • ISSs and ESSs binding hnRNPs inhibiting splicing probably by changing the conformation of the RNA. Are thought to ”hide” the exon by binding simultaneously to bordering introns, bridging between the introns (hnRNPA1, PTB). • Factors binding to p(Y)tract, inhibiting U2AF recruitment (SXL, PTB). • Decoy splice sites recruiting splicing factors to inappropriate splice sites (IgM (113), Caspase-2 (41), NRS in RSV (159)). • Antagonism between activators and repressors (SR proteins and hnRNPA1).

22 One repressor protein that has been extensively studied is the D. melanogaster sex-lethal protein (SXL) (147). SXL is an hnRNP like protein produced exclusively in female flies and induces female specific alternative splicing of at least three pre- mRNAs in D. melanogaster. SXL binds specifically to poly(U) in the p(Y)tract, thereby outcompeting U2AF binding. For example, SXL autoregulates its own expression by promoting skipping of the male-specific exon 3 in its own pre-mRNA (sxl). The human polypyrimidine tract binding protein (PTB or hnRNP I) is a general splicing repressor that, like SXL, binds U-rich elements often close to the 3´ splice sites in introns (reviewed in 252). It is ubiquitously expressed in mammalian tissues and contain four RNA recognition motifs (RRMs). PTB has been implicated as a regulatory protein involved in the control of tissue-specific alternative splicing of several genes, for example: α-tropomysin (81), FGF-R2 (27), c-src (figure 9) (38), GABAAreceptor (275) and α-actinin (228). The mechanism for PTB repression of splicing is not exactly clear. A common feature is that PTB binding sites are clustered near the branch point of the alternatively spliced exon and suggests that PTB may block the binding of U2AF to the p(Y)tract, similar to the SXL protein. However, in many cases multiple PTB binding sites located also at other places (in the downstream intron) are essential for the regulation. The repression is therefore probably not caused by direct competition with general splicing factors. Instead, PTB may act as an antagonist of the exon definition model. Another hnRNP protein that inhibits splicing by binding to ESSs or ISSs is the hnRNP A1 protein. For example, hnRNP A1 promotes skipping of exon 7B in its own pre-mRNA probably by binding to the introns bordering exon 7B (6). As mentioned above, SR proteins can also repress splicing, both by binding to an ISS or an ESS. In CFTR (cystic fibrosis transmembrane regulator) SR proteins inhibit the 5´ splice site of exon 9 by binding to an ISS (195). In adenovirus, SR proteins bind to the intronic 3RE and inhibit IIIa 3´ splice site usage (see Conclusions and discussion, figure 18) (114). Moving the 3RE to the downstream exon resulted in IIIa 3´ splice site activation. This show that SR protein function is dependent on where on the pre-mRNA they bind (114). However, in bovine papilloma virus 1 (BPV-1) SR proteins binding to the exon inhibit upstream 3´ splice site activation. The late mRNAs in BPV-1 has two ESEs (ESE1 and ESE2) and an ESS located close to ESE1 (figure 9) (281, 282). All three elements bind SR proteins but only the ESEs enhance the use of the weak upstream 3´ splice site. The ESS inhibits the use of the 3´ splice site probably by sequestering SR proteins from binding to the other elements or by interfering with the normal bridging activities of the SR proteins at the ESEs. ESE2 is closer to the downstream alternative 3´ splice site and potentially ESE2 works as the adenovirus 3RE. In some cases, splicing have been shown to be inhibited by decoy splice sites, that fool the splicing machinery by recruiting splicing factors to nonproductive splice sites. One example of this is in the Ig-M pre-mRNA. The M2 exon contains an ESS that binds U2 snRNP in an ATP dependent manner, to a decoy branchpoint (figure 9). This is belived to form a nonproductive inhibitory complex that hides the authentic 3´ splice site (113). The relative concentration of antagonizing factors is probably important for splice site selection. Variations in the level of SR protein and hnRNP A/B protein expression have been reported in different cell types (62, 92, 112). Under limiting U1 snRNP concentrations, U1 snRNP binds preferentially to the strongest splice site. Thus, a weak 5´ splice site will not be selected, even if it is closer to the 3´ splice site.

23 Higher levels of ASF/SF2 promote full occupancy of U1 snRNP to all 5´ splice sites and under these conditions the 5´ splice site closest to the 3´ splice site is selected (225). HnRNP A1 can antagonize this activity of ASF/SF2, and thus promote distal splice site usage. HnRNP A1 and ASF/SF2 seem to compete for binding to the pre- mRNA (60). ASF/SF2 enhances U1 snRNP binding, while hnRNPA1 interferes with U1snRNP binding such that the 5´ occupancy is lowered (94). The molar ratio of hnRNP A1 and ASF/SF2 varies over a range of at least 100-fold in different tissues, well over what is expected to be required to induce a complete shift between competing 5´ splice sites in vitro (92). SR proteins also antagonize eachother in many pre-mRNAs. For example, the β-tropomyocin gene in chicken encodes for two mutually exclusive exons. Exon 6A is specific to fibroblast and smooth muscle cells, while exon 6B is specific to skeletal muscle cells. A pyrimidine-rich element (S4) in the intron downstream of exon 6A is essential for recognition of the exon 6A 5´ splice site. ASF/SF2 binds to S4 and stimulates inclusion of exon 6A. SC35 antagonizes the stimulatory effect of ASF/SF2. The ratio between SC35 and ASF/SF2 is at least 2-fold higher in skeletal muscle compared to HeLa cells, resulting in exon 6A skipping in HeLa cells in vitro (72).

+ + - -

3´ SR SR SR 3´ 5´ BPV-1 ESE1 ES S ESE2 + SR U1 U2 A ESE ESS enhancing complex IgM

U1 U2 ESE ESS inhibitory complex

nonneuronal 3 A N1 4 PTBPTB PTB - c-src - +

3 A N1 nPTB 4 neuronal

Figure 9. Different types of regulation of alternative splicing. See text for details. (Pictures are modified from references (281) (BPV-1), (113) (IgM) and (252) (c-src)).

24 It has been suggested that many, possibly all, exons are under global repressive influence mediated by many intronic sequences (61). Thus, splice site usage is decided both by splice site strength and the repressor activity within the pre- mRNA. There are examples of alternatively spliced exons that are repressed in most tissues, but ”derepressed” in specific celltypes. One example is the c-src N1 exon (figure 9) (reviewed in 252). The N1 exon is both positively regulated in neurons and negatively regulated in non-neuronal cells. In non-neuronal cells the inclusion of the N1 exon is repressed by PTB binding to the upstream intron (30, 31). In neuronal tissues the inclusion of exon N1 is derepressed by displacement of PTB from binding to the intron by an ATP dependent mechanism (37, 38). As mentioned before, there is also a downstream control sequence (DCS), that enhances N1 exon inclusion. The DCS appears to regulate N1 exon splicing by binding hnRNP proteins (37, 164, 165, 169, 170). A neuronal specific form of PTB (nPTB) also enhances N1 exon inclusion by binding to the DCS in neuronal cells and competing with PTB binding (157).

25 ADENOVIRUS Here I will give a brief summary of the adenovirus lifecycle and explain functions of the E4-ORF4 protein and regulation of adenovirus alternative RNA splicing in more detail. Many of the mechanisms of adenoviral proteins interfering with the host cell are described more in the chapter ”Viral control of host cell gene exression”. This chapter is based on two main references, when no specific references are given in the text (64, 221).

General background Adenovirus was found as a viral agent in tonsils and adenoidal tissue from military recruits with febrile illness, hence the name ”adeno”-virus. Some adenovirus serotypes can cause tumors in rodents, but so far, adenovirus has not been associated with tumors in humans. Adenoviruses are widespread in nature infecting mostly mammals and birds. New serotypes are frequently described. Adenoviruses are transmitted by direct contact and most commonly cause respiratory tract infections, diarrhoea, pneumonia, croup and bronchitis. In recent years, there has been a lot of interest in developing adenovirus as a vector to express foreign genes for therapeutic purposes in vaccination, gene therapy and in cancer therapy. Adenovirus is a nonenveloped virus with a linear double stranded DNA genome of 30-38 kb in length. It encodes for 30-40 proteins of which around 15 are components of the virion. The virion has a regular icosahedral structure of 70-90 nm in diameter and consists of 240 hexons and 12 pentons, where each penton base projects a fiber. The genome is condensed with three histone-like proteins (V, VII and µ) and the terminal protein (TP) covalently bound to the DNA ends. The genome organisation (figure 10), which is similar to all known serotypes, consists of five early transcription units (E1A, E1B, E2, E3 and E4), two delayed early units (IX and IVa2), and one late unit (the major late transcription unit, MLTU), all of which are transcribed by RNA polymerase II. In addition, RNA polymerase III transcribes one or two (depending on the serotype) virus associated RNA (VA RNA) genes. The transcription units are encoded by both DNA strands and each unit gives rise to multiple mRNAs by a complex pattern of alternative splicing and p(A) site usage (with the exception of IX and IVa2). Thus, each transcription unit is able to encode for multiple proteins.

The virus life cycle By convention the replication cycle is divided into an early and a late phase which are separated by the onset of viral DNA replication. The infectious cycle is completed approximately 30 hours post infection, resulting in the production of about 104–105 virus particles per cell under optimal growth conditions. Adenovirus enters its host cell by interaction of the fiber and penton base proteins with a range of cellular receptors, including the primary receptor CAR (coxsackievirus-adenovirus receptor), MHC class I, and members of the integrin family. After binding to the cell, the virus is phagocytosized and inside the endosome some virion proteins are degraded. During the disassembly process the vacuole membrane is ruptured and the DNA is transported and injected into the nucleus. It is believed that the viral core proteins (V and VII) are removed from the DNA before or at the time the viral DNA enters the nucleus.

Major late transcription unit

678L1 L2 L3 L4 L5 52,55K, III, pVII, pVI, Hexon, 100K, 33K, Fibe r 12i 3 IIIa V, µ 23K pVIII xy z ) III E1B ( 55K VA RNA E3 19K pIX gp19K, 11.6K E1A 14.7K, 10.4K/14.5K () 289R 52,55K 243R ()

0 50 100

Ad-pol pTP ORF3, ORF4, IVa2 DBP ORF6, ORF6/7 123E2A E4

123E2B © G.A., IMBIM

Figure 10. The adenovirus genome. Kindly provided by G. Akusjärvi.

In the nucleus the viral DNA is converted to a virus-DNA-cell histone-complex that is used as a template for viral gene expression. The early region 1A (E1A) is the first unit to be transcribed during infection. E1A encodes for two virus-specific transcription factors required for activation of early viral gene expression, but has also the capacity to regulate a variety of cellular genes. Adenovirus genes do not contain a common promotor sequence element indicating that E1A regulates the viral promotors by different mechanisms. E1A can both activate and repress transcription by interacting with transcriptional coactivators/repressor proteins and the TATA-box binding protein (TBP). The E1A proteins induce the S-phase in the host cell by interacting with the cellular transcription factors p300/CBP and pRb. p300/CBP activates genes involved in cell differentiation and E1A binding to pRb releases transcription factor E2F, which becomes available for activation of genes involved in DNA-synthesis. Furthermore, E2F is important for activation of the viral E2 promotor. E1A also causes accumulation of the tumor suppressor protein p53 and therefore E1A by itself causes p53-dependent apoptosis. However, adenovirus also encodes for multiple proteins that block apoptosis, thereby facilitating viral growth. The E1B region encodes for two major proteins, both of which inhibit apoptosis. The E1B-19K is a homolog of the cellular anti-apoptotic Bcl-2 protein and inhibits apoptosis by heterodimerizing with pro-apoptotic factors (Bax, Bak), thereby preventing induction of apoptotis. The E1B-55K protein is a multifunctional phosphoprotein essential for efficient virus replication. E1B-55K, in complex with E4-ORF6, regulates both p53 activity and nucleocytoplasmic transport of viral and

27 cellular mRNA. E1B-55K binds to p53 and inhibits p53 transactivation of target genes, probably by localizing p53 to the cytoplasm and, together with E4-ORF6, promoting degradation of p53. The E3 region encodes a cluster of proteins that counteract the immune responses in the host. The E3-gp19K protein blocks transport of MHC class I from the ER to the cell surface. Three E3 proteins inhibit TNF-induced apoptosis: the RID (receptor of internalisation and degradation consisting of E3-10.4K and E4-14.5K heterodimers) and E3-14.7K. The viral proteins required for viral DNA replication are encoded by the E2 region: the single stranded DNA binding protein (DBP), the DNA polymerase and the preterminal protein (pTP). DBP binds to the displaced strands of the template DNA. pTP is the primer protein required for initiation of viral DNA replication. pTP is cleaved during virus assembly to TP which remains covalently bound to both ends of the linear viral DNA. Three cellular proteins are also required for efficient viral replication: transcription factors, NF-1 and Oct-1, and topoisomerase NF-II. Adenovirus replicates very efficiently in human cells and at 48 h postinfection up to 106 new DNA molecules have been synthesized, an amount of DNA that almost equals the cellular DNA content (reviewed in 51). After initiation of viral DNA replication, the structural proteins are expressed from the MLTU. The major late promotor (MLP) is active also during the early phase of the infection but the transcripts terminate prematurely prior to the L2 poly(A) site. At late time points of infection, the transcription from MLP is enhanced and produces a 29,000 nucleotides long pre-mRNA, which by alternative RNA splicing and polyadenylation gives rise to at least 18 mRNAs. The increase in MLP activity is probably due to the enormous increase in DNA templates, rather than an increase in transcription initiation from a few templates (139). However, viral and cellular proteins have also been shown to activate transcription of MLP: namely the viral proteins IVa2 and DBP (33, 244), and the cellular transcription factors SP1 and MAZ (196). At the late phase of infection the transport of cellular mRNAs to the cytoplasm is blocked despite a continuous transcription. Only viral mRNAs are efficiently transported and translated at the late stage of virus infection. Adenovirus uses two mechanisms to ensure an efficient translation of viral mRNAs late during infection. First, all mRNAs from the MLTU contain a common 5´ sequence, the tripartite leader, that allows the late viral mRNAs to be translated in a cap-independent manner by ribosome ”shunting”. Second, the virus associated RNAs (VA RNAs), prevent the translational shutoff in the host cell by inhibiting the protein kinase PKR that otherwise would inhibit eIF2α by phosphorylation. The E4 region encodes a minimum of seven polypeptides called open reading frames (ORFs) (65, 243, 251) and is required for lytic virus growth, viral DNA replication and viral late nuclear and cytoplasmic mRNA accumulation (13, 90, 117, 256). E4-ORF3 and E4-ORF6 appear to have redundant activities, since either of the two proteins is sufficient to support growth of an E4-deletion mutant virus (13, 98, 105, 117). However, the mechanisms by which E4-ORF6 and E4-ORF3 support virus growth seem to differ. E4-ORF6 forms a complex with the E1B-55K protein which has been shown to cause degradation of p53 and selective transport of late viral mRNAs from nucleus to cytoplasm (reviewed in 53). E4-ORF3 also binds to E1B- 55K, but the importance of this interaction is still unclear (53). Both E4-ORF3 and E4-ORF6 induce DNA replication, although the exact mechanisms are not known. Since virus capsid assembly takes place in the nucleus, the viral structural proteins have to be imported to the nucleus. Virion assembly and encapsidation of the

28 viral dsDNA genome is facilitated by the L1 52,55K protein that is present in capsid assembly intermediates but not mature virions. The E3-11.6K, also called the adenovirus death protein (ADP), is thought to promote virus release, by disrupting the cytoskeleton and making the cell more susceptible to lysis.

The E4-ORF4 protein The E4-ORF4 protein is not essential for virus growth (90), and an E4-mutant virus only expressing E4-ORF4 is actually less viable than a mutant virus lacking the entire E4 region (180). E4-ORF4 binds to the cellular protein phosphatase 2A (PP2A), via an interaction with the B subunit (122). PP2A is one of the major serine/threonine protein phosphatases in the cell, and plays a central role in multiple cellular processes: metabolism, transcription, RNA splicing, translation, cell cycle progression, signal transduction, development and transformation (reviewed in 108, 163, 250). PP2A is a heterotrimer composed of a 36 kDa catalytic C subunit, a 63 kDa regulatory A subunit, and a variable B subunit. The A and C subunits, that form the core enzyme, exist in two isoforms, while the multiple B subunits belongs to three unrelated gene families, B/B55/PR55, B´/B56/PR61 and B´´/PR72/PR130. The mechanisms by which PP2A can regulate such diverse cellular functions is not well understood. Different holoenzymes might dephosphorylate distinct substrates in distinct cellular compartments. Studies in yeast have suggested that different B subunits perform nonredundant functions (280). E4-ORF4 has been shown to interact with B subunits belonging to both the B and B´ families (224). It is possible that an interaction of E4- ORF4 and various PP2A subpopulations contribute to its multiple functions, all of which appears to require an active PP2A. Here follows a summary of E4-ORF4-PP2A functions known so far (see also figure 11). The E4 promotor is, as the other early adenovirus promoters, activated by E1A during the viral infection. E1A induces the activity of cellular transcription factors, for example AP-1 (a complex of junB and c-fos proteins), ATF, E4F and E2F, that transactivates the viral promoters. E1A activation leads to an increased phosphorylation of several of the transcription factors, important for viral transcription. During virus infection the E4-ORF4-PP2A complex induces hypophosphorylation of E1A and c-fos and reduce the level of AP-1 (180). This hypophosphorylation seems to be specific since neither the E1B-55K or junB proteins were affected (180). E4-ORF4-PP2A has also been found to counteract E1A-mediated activation of the E4 promotor (11) and the E2 promotor (154). Although the direct targets of the phosphatase activity are not known, it appears likely that the E4-ORF4- PP2A complex induces hypophosphorylation of the E4F and E2F transcription factors respectively, thereby inhibiting their transactivation capacity. E4-ORF4 also induces p53-independent apoptosis selectively in transformed cells (135, 156, 222). This activity appears to require the B55α subunit of PP2A (155, 223, 224). In cells expressing p53, E4-ORF4 does not alter p53 expression (222) however, the anti-apoptotic proteins Bcl-2, Bcl-XL and E1B-19K were found to inhibit E4-ORF4-induced apoptosis (121). Mutational analysis of the E4-ORF4 protein has shown that amino acids 64 to 102 are critical for PP2A-B55α interaction with E4-ORF4 (155, 223). A good correlation between E4-ORF4 binding to PP2A- B55α, the recruitment of an active phosphatase and the ability to induce apoptosis have been found. Many apoptotic pathways involve activation of caspases at various stages of the apoptotic process (reviewed in 47). Caspases are cystein proteases that cleave proteins after aspartic acid residues and thereby cause degradation and

29 inactivation of many proteins. Some reports indicates that apoptosis can be caspase independent (85, 173, 204, 261). In E4-ORF4 induced apoptosis caspase activation may not be crucial, although it appears to contribute to the process in some cell lines. Thus, activation was detected in H1299 and 293 cells but not in CHO cells (135, 145). It is currently not known which substrates the PP2A-E4-ORF4 complex targets in the apoptotic pathway. E4-ORF4 has been shown to induce PP2A-dependent G2 to M phase arrest in S.cerevisae and in 293 cells (125). The E4-ORF4-PP2A complex was found to interact with, and inhibit the anaphase-promoting complex/cyclosome (APC/C) in yeast. In addition, E4-ORF4 has been found to interact with the Src family of kinases and to downregulate Src-dependent signalling which is suggested to play a role in E4- ORF4 induced apoptosis (134). E4-ORF4 itself seems to be phosphorylated at tyrosines in cells expressing activated Src. It is not clear if E4-ORF4 association with Src kinases is facilitated by binding to PP2A, as is the case for polyoma middle T- antigen (See Py-MT in ”Viral control of host cell gene expression”) (134).

p p p p c-fos p p p p E1A

arrest G2/M

p A PP2A E1A p C c-fos B E4- apoptosis ORF4

E1A E1A pRb p p E4F p p E2F p p E4 p ppp E2 E4F E2F

Figure 11. Examples of E4-ORF4 functions.

Control of adenovirus gene expression by alternative RNA splicing Almost all pre-mRNAs encoded by the adenovirus genome are alternatively spliced. The exceptions are the genes encoding for polypeptides IX and IVa2. The pattern of alternatively spliced mRNAs expressed from the different transcription units changes from the early to late phase of infection, indicating that alternative splicing is temporally regulated. During infection there is a general tendency, that at later time points, shorter mRNAs are produced by splicing out larger introns. More and more evidence support the hypothesis that viral control of SR protein function is important for the proper expression of viral proteins during lytic virus growth. Most studies have focused on adenovirus alternative splicing of the E1A and MLTU mRNAs.

30 The E1A pre-mRNA gives rise to three major mRNAs, the 13S, the 12S and the 9S mRNA that are spliced using a common 3´ splice site and alternative 5´ splice sites (see figure 12) (reviewed in 106). During the early phase of infection the 13S is the most abundant mRNA, while the 9S mRNA is the predominant E1A mRNA expressed late in infection. Many reports indicate that the shift in E1A alternative splicing is regulated by SR proteins. High concentrations of ASF/SF2 and SC35 favours splicing of the 13S mRNA both in vitro and in vivo (23, 99, 253). In contrast, SRp40, SRp55, SRp75, SRp20 and 9G8 favour 12S mRNA splicing (12, 219, 270), while high concentrations of hnRNPA1 and SRp54 activate 9S mRNA splicing (23, 277). Extracts prepared from late adenovirus infected cells have been shown to activate 9S mRNA splicing (73). This phenomenon has been explained by nuclear splicing factors and SR proteins beeing sequestered late during infection by the enormous increase in late mRNA expression (73, 99, 133).

E1A

Early splicing pattern 12S 5´5´ 5´ 13S 3´

9S Late splicing pattern

Figure 12. Alternative splicing pattern of the E1A transcription unit. (Splicing to the minor 10S and 11S mRNAs are not shown).

The MLTU generates approximately 18 mRNAs by alternative 3´ splice site usage (figure 10) (reviewed in 106). These mRNAs are grouped into five families (L1-L5) where mRNAs within each group share the polyadenylation site. As mentioned above all mRNAs from the MLTU have a common 201 nucleotide long tripartite leader sequence at their 5´ end. In addition a fraction of the MLTU mRNAs have a fourth exon, the so called i-leader exon. In early infected cells the i-leader is preferentially included, while the majority of the late mRNAs contain the classical tripartite leader. The i-leader encodes a 16 kDa protein, which function is unknown, but appears to be dispensible for virus growth in tissue culture cells (226, 232). The E4-ORF3 and E4-ORF6 proteins have been shown to regulate tripartite leader splicing (189, 190, 193). They do this by opposite mechanisms: E4-ORF6 stimulates i-leader exon skipping while E4-ORF3 facilitates i-leader exon inclusion (189). Interestingly, E4-ORF3 and E4-ORF6 can also regulate exon inclusion/exon skipping on nonviral pre-mRNAs (188, 189). During the infection it appears that the specificity in 3´ splice site recognition changes. Generally, 3´ splice sites with long consensus-type p(Y)tracts are repressed while 3´ splice sites with short atypical p(Y)tracts, which bind U2AF65kDa inefficiently, are enhanced in splicing (176, 177). The L1 gene can be alternatively spliced using a common 5´ splice site and two competing 3´ splice sites, generating the 52,55K mRNA (proximal 3´ splice site) or the IIIa mRNA (distal 3´ splice site), respectively (figure 13) (106). During a lytic adenovirus infection, the splicing pattern of L1 is regulated such that the 52,55K

31 mRNA is produced both early and late after infection, whereas the IIIa mRNA is produced exclusively late (2, 186, 220). The shift in L1 alternative splicing can be reproduced in vitro (129). The activation of IIIa splicing results from an enhanced efficiency of IIIa 3´ splice site recognition, combined with a decrease in 52,55K splicing (129). Recent results have shown that IIIa splicing is regulated by two cis- acting elements located at the IIIa 3´ splice site: the IIIa repressor element (3RE) and the IIIa virus-infection dependent splicing enhancer (3VDE) (figure 13 and 18) (114, 178). SR proteins purified from HeLa cells (SR-HeLa) inhibit the usage of the IIIa 3´ splice site by binding to the 3RE (114). SR proteins binding to the 3RE block IIIa splicing by inhibiting recruitment of U2 snRNP to the branch point. Several of the classical SR proteins (SRp75, SRp40, SRp55 and SRp30s) were shown to individually repress IIIa splicing, with SRp30 and SRp55 being most effective. The absence of IIIa splicing in early virus-infected cells can therefore, in part, be explained by a direct inhibitory effect of SR proteins on IIIa 3´ splice site usage (see figure 18).

Early splicing pattern

5´ss3´ss 3´ss 1 2i 3 52,55K IIIa

Late splicing pattern

3RE 3VDE 3´ss GCGTGGAGGAATATGACGAGGACGATGAGTACGAGCCAGAGGACGGCGAGTACTAAGCGGTGATGTTTCTGATCAG *

Figure 13. L1 alternative splicing. 3RE= IIIa repressor element, 3VDE= IIIa virus dependent splicing enhancer. * the branch point of IIIa 3´ splice site. Sequences underlined are putative SR protein binding sites.

The 3VDE is the minimal element required for activation of IIIa splicing in nuclear extracts from adenovirus infected HeLa cells (Ad-NE) (178). It is not yet clear how the 3VDE activates splicing. Current evidence suggest that U2AF binds less efficiently to the 3VDE in Ad-NE compared to HeLa-NE ((178), Lützelberger and Akusjärvi, unpublished). Thus, available data suggest that splicing activation by 3VDE may operate via a novel U2AF independent pathway. Potentially a novel factor replaces U2AF as the p(Y)tract binding factor and helps to recruit U2 snRNP to the IIIa branch point (see figure 18). Interestingly, there are specific differences in the proteins binding to the 3VDE in Ad-NE compared to HeLa-NE (Lützelberger and Akusjärvi, unpublished). These may be important for the activation of IIIa splicing by 3VDE.

32 ASF/SF2 overexpression blocks the early to late shift in viral mRNA expression resulting in the retention of the early splicing patterns of the E1A, E1B and L1 mRNAs, also at late time points of infection (171). ASF/SF2 overexpression also reduced the efficiency of viral DNA replication, major late mRNA accumulation, and new virus particle formation (171). In addition, viral DNA replication, per se, appears to have a positive effect on the early to late shift in alternative splicing of viral mRNAs (133). However, the shift was not complete when late viral protein synthesis was blocked, suggesting that late viral protein synthesis also play a role. The requirement for late viral protein synthesis differed between E1A, E1B and L1, with L1 having the highest dependence for late protein synthesis (133). The shift to IIIa 3´ splice site usage was incomplete when protein synthesis was blocked. The L1 mRNA profile resembled that seen in an infection using a recombinant adenovirus overexpressing ASF/SF2 (171); i.e, a large fraction of the L1 mRNAs retained the i-leader sequence.

33 VACCINIA VIRUS This chapter refers to four main references (64, 111, 174, 175), when no other reference is given in the text.

General background Vaccinia virus belongs to the Poxviridae family of viruses that replicate in the cytoplasm of vertebrate and invertebrate cells. The most notorious member, variola virus, causes smallpox and has luckily been eradicated as a human pathogen. Vaccinia virus has no natural host, although it has been isolated from buffalo. Vaccinia virus was the first virus that was seen microscopically, grown in tissue culture, purified and chemically analyzed. Today, recombinant vaccinia viruses are tested as vectors for vaccination against a variety of infectious agents. Vaccinia virus has a brickshaped virion, and a dsDNA genome of about 200 kbp. The genome encodes for over 200 potential proteins. Both strands of the genome are transcribed, but in contrast to smaller DNA viruses, overlapping open reading frames (ORFs) are rare. By convention the genes are named based on their location relative to the HindIII restriction map of the genome. Open reading frames are numbered in the order they appear from left to right. The letters ”L” and ”R” indicate whereas the ORFs are encoded in the left- or rightwards direction. The majority of essential genes map within the central region of the genome, which is highly conserved among poxviruses. The life cycle is divided into three phases: the early, intermediate and late phases. There is a temporal regulation of vaccinia virus transcription. Early genes encode proteins that are important for activation of intermediate genes, which in turn are required for transcription of late genes. The virion is a complex structure consisting of a lipoprotein bilayer surrounding a biconcave core, and is composed of more than 100 polypeptides. The virus encodes for an eukaryotic-like multisubunit RNA polymerase and all of the additional enzymes required for capping, methylation and polyadenylation of its mRNAs. All of the proteins necessary for transcription and processing of the early genes are packaged within the virus particle.

The virus life cycle The infectious cycle (figure 14) is rapid and new infectious virus particles are detected already in 4-6 hours post infection, with a maximum yield of virus produced approximately 24 hours post infection (104 particles per cell). Entry of vaccinia virus into the cytoplasm involves fusion with cell membrane and subsequent virus internalization. The virus-encoded growth factor (VGF or C11R) has been found to bind to the EGF receptor and is believed to be, in part, responsible for virus entry. Immediately after the virus has entered the cell it starts to uncoat by a two-step process. In the first step of uncoating the phospholipids and about 50% of the virion proteins are released. This step of uncoating is not blocked by inhibitors of either RNA or protein synthesis. The first step of uncoating releases the factors required for early transcription and RNA processing. Induction of early gene expression induces a second uncoating reaction in which a nucleoprotein complex containing the genome is released from the core. The second step of uncoating which begins 0.5 to 2 hours post infection requires RNA and protein synthesis and is prevented by UV irradiation of the virus. It is believed that the second step of uncoating is necessary for viral DNA replication.

34 Early transcription is detected within 20 minutes post infection, with the maximum level of expression reached at 1-2 hours. The early proteins made are the RNA polymerase subunits, enzymes required for viral DNA replication, factors needed for transcription of intermediate genes and proteins that counteract the host immune system. The vaccinia virus RNA polymerase is, like the eukaryotic RNA polymerase II, a complex multisubunit enzyme built from the products of at least eight viral genes. The viral RNA polymerase transcribes all classes of vaccinia virus genes. Like the cellular RNA polymerase, the vaccinia virus RNA polymerase recognizes the viral promotors in cooperating with additional regulatory proteins. For example, transcription from the early promotors require two viral proteins: the vaccinia early transcription factor (VETF, consisting of subunits A7L and D6R) and the protein H4L (RAP94). Vaccinia virus also encodes for its own apparatus for capping and polyadenylation of the viral mRNAs. The capping enzyme (heterodimer of D1R and D12R) binds directly to the RNA polymerase and adds the cap when the transcripts are about 30 nucleotides in length, which is similar to the cellular capping enzyme. However, transcription termination is different in vaccinia virus compared to eukaryotes. Transcription of vaccinia virus early genes terminates at discrete sites, 20- 50 bp downstream of a T-rich sequence. The viral capping enzyme remains bound to the polymerase, recognizes the termination signal (TTTTTAT) and induces the polymerase to terminate transcription. Thus, the 3´ ends of the viral mRNAs correspond to sites of transcription termination. This is in contrast to eukaryotes, where transcription is terminated at random sites, 200-2000 bp after the poly(A) signal (201). The J3L protein (VP39) is also important for the methylation of the cap and acts as a factor stimulating transcription elongation. In addition, J3L is a subunit of the poly(A) polymerase. The larger subunit, E1L (VP55), catalyzes the addition of As to the 3´ end of the transcript. J3R binds to poly(A) and stimulates E1L activity. Activation of intermediate genes requires the expression of two factors, VITF- 1 (E4L) and VITF-2 (viral intermediate transcription factors). VITF-1 is a viral protein while VITF-2 is a cellular transcription factor, which is relocated from the nucleus to the cytoplasm in infected cells. The function of VITF-2 in uninfected cells is still unclear. Vaccinia virus also encodes for all proteins needed for viral DNA replication. It replicates in the cytoplasm at discrete foci, sometimes called ”viral factories”. DNA replication begins within a few hours of infection when also the late phase of the infectious cycle starts. Activation of late gene expression requires three intermediate gene products: A1L, A2L and G8R. The proteins made at late times of infection include most of the structural proteins and many of the enzymes encapsidated into new virus particles, including the early transcription factors. Most of the late genes are encoded in clusters in the central part of the genome. The late mRNAs have unusual features with a 5´ p(A) leader and heterogenous 3´ ends. The late mRNA can self-anneal with the early RNAs to form ribonuclease resistant hybrids. The late mRNAs do not have a defined 3´ end and mRNAs encoding the same polypeptide can vary manyfold in length. Currently, there are no logical explanation for the failure of transcription termination in late viral mRNA production. The capped 5´ p(A) leader sequences may provide a binding site for translation initiation factors and the ribosomal 40S subunit. During a vaccinia virus infection cellular transcription, DNA replication and RNA processing is inhibited, but the mechanisms behind these events are not known.

35 Virion assembly is a complex process involving the cleavage of structural proteins from high-molecular precursors. The initial assembly results in formation of the immature virion, a spherical particle, that is believed to have a Golgi derived double membrane wrapped around the assembling particle. The virus particle then matures into the intracellular mature virion which is released only upon cell lysis. The particle can also aquire a second double membrane from the Golgi and then be released from the cell by fusion with the cell membrane or transferred directly into a neighbouring cell through cell-cell contacts.

7 m Gppp AAA m7Gppp AAA early

7 m Gppp AAA 7 m Gppp AAA

VITF-2

7 m Gppp AAA m7Gppp AAA

7 intermediate m Gppp AAA 7 m Gppp AAA

m7Gppp AAA 7 m Gppp AAA

7 late m Gppp AAA 7 m Gppp AAA

neighbouring cell

Figure 14. The vaccinia virus life cycle. Modified from (64).

36 VIRAL CONTROL OF HOST CELL GENE EXPRESSION In this chapter I will briefly describe how viruses regulate host cell gene expression. Most importantly, I will describe viral proteins that interact with the cellular protein phosphatase 2A and viral proteins that affect RNA processing. The main reference is (64).

The cell cycle and signal transduction Highly differentiated cells have slow rates of RNA and protein synthesis and do not express many of the components required for DNA replication. Thus, they are unable to support growth of most viruses, which prefer a rapid rate of DNA, RNA and protein synthesis. Herpesvirus provides its own replication machinery and can reproduce in highly differentiated cells, such as neuronal cells. Papovaviruses and adenoviruses, stimulate resting cells to enter the S-phase by disrupting the cellular control of cell growth and division. They do this by interfering with two important regulators in the cell: the tumor suppressor proteins pRb and p53. pRb controls cell proliferation by binding and inhibiting the activity of the cellular transcription factor E2F. E2F stimulates transcription of cellular genes whose products are involved in DNA synthesis or control of cell cycle progression. The adenovirus E1A protein, the SV40 large T-antigen (LT) and the HPV E7 protein bind to Rb and displace it from E2F which becomes activated. As a side-effect, unscheduled DNA synthesis activates p53. p53, which is a transcription factor, activates or represses transcription of several genes, leading to either cell cycle arrest or apoptosis. The E1A, SV40 LT and HPV E7 proteins cause indirectly p53 stabilisation. However, viruses have evolved to survive apoptosis and encode proteins that interfere at multiple steps in the apoptotic pathway. The HPV E6 protein and the adenoviral proteins E4-ORF6 and E1B-55K bind to p53 and cause p53 degradation. SV40 LT also binds to p53 but is believed to sequester p53 in an inactive complex, facilitated by the SV40 small T-antigen (ST). Promoting cell growth and proliferation include a myriad of signal transduction pathways in the cell, which are regulated by reversible phosphorylation. One cellular target that is important for this is the protein phosphatase 2A (PP2A, see ”Adenovirus” chapter, section E4-ORF4). Mouse polyoma virus small and middle T (Py-ST and Py-MT) as well as SV40 ST form stable complexes with the PP2A core enzyme, by replacing the B subunit and alter PP2A substrate specificity and localisation (figure 15) (reviewed in 108, 212). The viral antigens target PP2A to overcome its negative role in some signalling pathways. SV40 ST enhances SV40 LT induced proliferation by inhibiting PP2A activity towards most substrates (212, 265). This activates kinases important in signal transduction that will promote entry into S phase. For example, SV40 ST enhances AP-1 driven transcription probably by activation of the MAP kinase pathway (227). SV40 ST has also been shown to inhibit PP2A induced dephosphorylation of p53 in vitro (217). In transient transfection assays SV40 ST enhances the transactivation capacity of p53 (264). However, SV40 ST does not induce p53-mediated apoptosis (264). Although SV40 ST stimulates cell cycle progression, it arrests cells before they enter the mitosis phase (G2/M) in a PP2A dependent manner (212). Binding of both Py-ST and Py-MT to PP2A inhibit the activity of PP2A to all tested substrates. However, there are mechanistic differences (179). Thus, Py-ST promotes cell cycle progression in a PP2A dependent manner, while PP2A binding to Py-MT is not sufficient to promote cell proliferation (179). Py-MT is a multimeric

37 adaptor protein which binds several cellular signalling molecules. Apart from PP2A, Py-MT also interacts with the cellular c-Src family of kinases (42, 102, 124). Py-MT activation of the c-Src results in activation of the ras/MAP kinase pathway and cell proliferation. PP2A is required for Py-MT to interact with c-Src, but the catalytical activity of PP2A seems not to be required (24, 80, 192). A virus expressing Py-ST, but not Py-MT and Py-LT, does not transform cells. Py-ST cooperates with Py-MT to block p53-induced growth arrest and apoptosis (202). In addition, Py-ST cooperates with Py-LT to induce synthesis of specific cyclins and stimulate proliferation of resting cells (218). The PP2A core enzyme has been shown to inhibit HIV-1 transcription and virus production (211). The HIV encoded proteins Vpr and NCp7 stimulate PP2A activity in vitro (246). In addition, Vpr induces cell cycle arrest at the G2/M transition by interacting with the B55 subunit of PP2A (figure 15) (56, 104). Vpr targets the PP2A complex to the nucleus which results in dephosphorylation and inactivation of Cdc25 which regulates cyclin activity (104).

A A PP2A C PP2A B C

Py-MT HIV-Vpr SV40-ST Ad-E4-ORF4 Py-ST B HIV-NCp7

Figure 15. Viral proteins binding to PP2A. See the text for details. The adenovirus E4-ORF4 protein and its interaction with PP2A is described in the ”Adenovirus” chapter.

DNA replication DNA viruses that do not rely on components of the cellular replication system often inhibit cellular DNA synthesis, probably to eliminate the competition for substrates from cellular DNA replication. The larger viruses; herpesvirus and poxvirus, efficiently inhibit synthesis of cellular DNA during infection. There are indications that a viral DNase causes the degradation of the cellular DNA during a poxvirus infection (52). Adenovirus also inhibits cellular DNA synthesis although the virus induces resting cells to re-enter the cell cycle. However, very little is known about the mechanisms that shut down cellular DNA synthesis.

Transcription Cellular transcription is also often inhibited in virus-infected cells. This results in a more selective production of viral mRNAs and furthermore reduces the competition from cellular mRNAs during translation. Retroviruses and most DNA viruses depend on the cellular transcriptional machinery for gene expression and therefore does not inactivate this machinery. The larger DNA viruses selectively express viral genes. For example, herpes simplex virus type 1 (HSV-1) inhibits transcription of the majority of cellular genes transcribed by RNA polymerase II. The selective transcription of HSV- 1 genes depends on several viral immediate early gene products, including ICP4 and ICP27. Poxviruses which encode for its own viral transcription system, induce a rapid

38 inhibition of synthesis of all classes of cellular RNAs in infected cells. In vaccinia virus infected cells, RNA polymerase II is inactivated by translocation to the cytoplasm. The majority of RNA viruses also inhibit cellular mRNA synthesis during infection. RNA viruses encode for an RNA dependent RNA polymerase and do not need the cellular RNA polymerase for gene expression. For example, a poliovirus encoded protease cleaves TBP (a general transcription factor required for RNA polymerase II transcription). This results in an inhibition of TBP binding to DNA and as a consequence initiation of transcription.

RNA processing and export of mRNA All viruses use the cellular protein-synthesis machinery to translate their mRNAs. Viruses that rely on the cellular transription and RNA processing machineries in the nucleus cannot completely inactivate these systems. However, viruses have evolved several mechanisms to inhibit cellular gene expression by selectively inhibiting cellular RNA processing. Several viruses have been shown to encode for proteins that inhibit RNA splicing and/or transport of cellular RNAs. Most cellular pre-mRNAs undergoes splicing prior to beeing exported to the cytoplasm. Thus inhibition of RNA splicing is an efficient way of keeping cellular mRNAs in the nucleus. The influensa virus NS1 protein inhibits both polyadenylation and splicing of cellular pre-mRNAs. For example, dimers of NS1 binds to and inhibits U6 snRNA and U6atac snRNAs. NS1 thereby increases the nuclear concentrations of cellular pre- mRNAs, which the viral cap-dependent endonuclease can use to cleave primers required for viral mRNA synthesis. The HSV protein ICP27 (IE63) enhances transport of unspliced viral RNA during infection (reviewed in 215). It has been shown that ICP27 modulates the polyadenylation machinery and inhibits splicing of cellular pre-mRNAs (93), although the exact mechanisms are not yet known. In general, herpesvirus genes lacks introns and inhibition of splicing could uncouple the splicing and mRNA export pathways, facilitating nuclear export of viral intronless genes. This allows the viral mRNAs to bypass the normal requirement for splicing for mRNA export. ICP27 appears to inhibit splicing prior to the first catalytic step (19). It has been suggested that ICP27 induces SR protein dephosphorylation (215). ICP27 also interacts with the cellular splicing factor SAP145 and the SF2/ASF-associated protein p32, interactions which have been suggested to mediate ICP27 inhibition of splicing (18, 19). In retroviruses, the transport of partially spliced and unspliced viral mRNAs are essential for viral protein production and formation of virus genomes for virus assembly (96). HIV encodes for a transport protein, Rev, which interacts with the Rev-responsive-element (RRE) present in viral transcripts. Binding of Rev to an RNA results in nuclear to cytoplasmic transport of the RNA. Rev has also been suggested to inhibit splicing by repressing the formation of the spliceosome in RRE-containing transcripts (119, 120). Rev interaction with p32 could potentially be involved in the inhibition of splicing (237). Rev inhibition of splicing has also been suggested to involve recruitment of ASF/SF2 to the Rev/RRE complex (200). In addition, the equine infectious anemia virus (EIAV) ERev protein has been shown to induce alternative splicing of its own pre-mRNA, probably by simultaneously recruiting ERev and ASF/SF2 to the EIAV RRE (39). Adenovirus disrupt cellular gene expression by inhibiting export of cellular mRNAs from the nucleus to the cytoplasm (reviewed in 53). During the late phase of infection the majority of mRNAs in the cytoplasm are of viral origin. The preferential

39 export of viral late mRNAs in adenovirus infected cells requires the E1B-55K/E4- ORF6 protein complex. It is not yet known how the complex induces selective transport of viral mRNAs. One hypothesis is that E1B-55K binds up a limited cellular factor needed for cellular mRNA export and makes it available to viral mRNA export. A candidate protein is the E1B-AP5 protein, a nuclear RNA binding protein belonging to the hnRNP family. It has been speculated that E1B-AP5 bridges between viral mRNAs and the E1B-E4-ORF6 complex, which serves as an adaptor protein that connects newly synthesized mRNAs to an active shuttling machinery (71). Evidence has also been presented suggesting that E1B-55K binds directly to RNA (103).

Translation As part of the antiviral defense, the cell responds to a virus infection by inhibiting protein synthesis in an attempt to limit virus production. The infected cell produces interferons, that diffuse to neighbouring cells and enhance the transcription of a number of genes that are involved in the antiviral defense, among them encoding the cellular RNA-activated protein kinase (PKR). PKR becomes activated when it binds to double stranded (dsRNA) which is a hallmark of a virus infected cell. PKR binding to dsRNA causes PKR dimerization and auto-phosphorylation which then in turn phosphorylates many subtrates. A key substrate is the eukaryotic translation initiation factor 2α (eIF2α), which can not reload from eIF2a-GDP to eIF2a-GTP when it is phosphorylated, and therefore causes inactivation of translation initiation. Many viruses encode for proteins that inhibit PKR activity by different mechanisms: by inhibiting dsRNA binding (adenovirus VA-RNA, vaccinia virus E3L, influensa virus NS1, reovirus σ3, HIV TAR RNA), by inhibiting PKR dimerisation (influensa virus p58IPK, hepatitis C virus NS5A), by functioning as a pseudosubstrate (vaccinia virus K3L, HIV Tat) or by blocking eIF2α dephosphorylation by recruitment of the cellular protein phosphatase 1 (herpes simplex virus γ134.5). Many viruses also modify the eIF4F complex, which is required for cap recognition by the 40S ribosomal subunit. Inactivation of this complex ensures that capped cellular mRNAs are not translated while viruses which have evolved other mechanisms to initiate translation, still are able to translate the viral mRNAs. Adenovirus and influenza virus induce dephosphorylation of an eIF4F component which results in a reduced binding of eIF4F to the cap structure. A poliovirus infection inactivates a protein component of eIF4F by proteolytic cleavage. During an adenovirus infection, the tripartite leader, which is attached to the late mRNAs, mediates translation by ribosome ”shunting”. Poliovirus uses an IRES (internal ribosome entry site) to recruit the 40S ribosome to the viral mRNA.

Protein transport Some viruses encode for proteins that interfere with the transport of specific cellular proteins to their normal compartments, mostly for the purpose of hiding the infected cell from beeing recognized by the immune system. The MHC class I presents viral polypeptides on the cell surface in order to activate the immune response. The adenovirus E3-gp19K protein blocks transport of MHC class I from the ER to the cell surface. Human cytomegalovirus and HIV encode for proteins that target MHC class I for rapid degradation by the cellular proteosome. Poliovirus and other enteroviruses cause a total disruption of the ER, which efficiently inhibits protein trafficing to the cell surface.

40 PRESENT INVESTIGATION

Regulation of adenovirus alternative RNA splicing — inactivation of SR proteins as splicing regulatory proteins by dephosphorylation (paper I) The adenovirus L1 region is regulated at the level of alternative RNA splicing, producing either the 52,55K mRNA or the IIIa mRNA (see ”Adenovirus” chapter). IIIa mRNA splicing is restricted to the late phase of the infection. It was previously demonstrated that IIIa splicing is repressed in nuclear extracts prepared from uninfected cells (HeLa-NE) by the SR family of splicing factors that bind to the intronic repressor element 3RE (114). Removing the 3RE element from a mini- 52,55K-IIIa tandem transcript, mimiced the early to late shift in L1 alternative splicing in an in vitro splicing assay. This result indicated that SR protein inhibition of IIIa splicing is important for L1 alternative splicing. The steady-state amount of the classical SR proteins does not change during virus infection. We therefore analyzed whether SR proteins were post translationally modified late during virus infection. For this experiment, we purified SR proteins from late adenovirus-infected cells (SR-Ad) and compared their biological activity with SR proteins simultaneously prepared from uninfected HeLa cells (SR-HeLa). The results showed that SR-Ad was much less active, compared to SR-HeLa, in in vitro splicing reactions: both in activation of 52,55K pre-mRNA splicing in splicing deficient S100 extracts (HeLa- S100), and repression of IIIa pre-mRNA splicing in nuclear extracts (HeLa-NE) (Paper I, fig.1a and b). It was also found that SR-Ad bound less efficiently to the IIIa pre-mRNA, compared to SR-HeLa (Paper I, fig.1c). The reduced capacity of SR-Ad to bind RNA did not result from a copurification of late adenovirus RNA, because pre-incubation of SR-Ad with micrococcal nuclease gave the same result in the crosslinking assay. This result indicated that SR-Ads are not sequestered from repressing IIIa splicing by binding to late RNA, the mechanism that was previously suggested to control the alternative splicing of the E1A pre-mRNA (99). As desribed earlier, SR proteins are highly phosphorylated in vivo, mainly at serine residues in the RS-domain, a modification which is important for their function as splicing enhancer proteins. To investigate whether the decrease in activity and RNA binding of SR-Ad correlated with a change in phosphorylation, 32P-labelled SR- HeLa and SR-Ad proteins were analyzed by two-dimensional gel electrophoresis (paper I, fig. 2). The result demonstrated that SR-HeLa had more 32P incorporated compared to SR-Ad and furthermore, that the isoelectric point of a large fraction of the SR-Ad proteins was shifted towards the basic side. Collectively, the results suggested that SR-Ad were underphosphorylated. One exception was the SRp20 protein, which appeared to behave similarly in the two SR preparations. Interestingly, SRp20 also showed a low activity as a repressor protein of IIIa pre-mRNA splicing in vitro (114). In conclusion, these results showed that SR proteins from adenovirus infected HeLa cells are inactivated as splicing enhancer or splicing repressor proteins by a virus-induced dephosphorylation. This work lead to the first description of a regulated system where changes in the phosphorylated status of SR proteins control the alternative RNA splice site choice.

41 The adenovirus E4-ORF4 protein induces PP2A dependent SR protein dephosphorylation by interacting with a subset of phosphorylated SR proteins (paper I and II) The results presented in paper I raised the question, how does adenovirus induce SR protein dephosphorylation. The E4-ORF4 protein was a good candidate protein because it was previously shown to bind to PP2A and induce dephosphorylation of specific transcription factors (11, 122, 180). We therefore tested whether E4-ORF4 also could induce SR protein dephosphorylation. The results showed that E4-ORF4 in the presence of HeLa-NE, induced SR protein dephosphorylation (see figure 16). E4- ORF4 by itself did not induce dephosphorylation, the HeLa-NE was required apparently to recruit the actual phosphatase to the reaction. Addition of okadaic acid (OA), which inhibits PP2A activity (20 mM OA), also inhibited the effect of E4- ORF4 on SR protein dephosphorylation, again suggesting the importance of this phosphatase. Incubating SR proteins in HeLa-NE induced phosphate release that was not PP2A dependent. This result was not unexpected, considering the number of different phosphatases that are present in the nuclear extract and that potentially could dephosphorylate SR proteins. Importantly, addition of E4-ORF4 to nuclear extracts induced a specific increase in SR protein dephosphorylation.

50 SR+NE+E4-ORF4

i t 40

r 30

s a SR+NE e

r 20 SR+NE+OA % SR+NE+E4-ORF4 +OA 10 SR+E4-ORF4 SR 0 1h 2h 3h Incubation time

Figure 16. E4-ORF4 causes SR protein dephosphorylation. (paper I, fig. 3a).

In paper I we showed that all SR proteins, except SRp20, were underphosphorylated during an adenovirus infection. In paper II we determined whether E4-ORF4 targets all SR proteins. In our model, E4-ORF4 makes simultaneous interactions with the SR proteins and PP2A. Therefore, we determined the binding specificity of E4-ORF4 interaction with SR proteins both by in vitro binding assays and by co-immunoprecipitations from extracts of transiently cotransfected cells. Surprisingly, E4-ORF4 was shown to bind efficiently to only two of the SR proteins tested: ASF/SF2 and SRp30c (paper II, fig. 1). Interestingly, testing ASF/SF2 mutant proteins showed that the RS domain of ASF/SF2 was dispensible for the interaction between E4-ORF4 and ASF/SF2 (paper II, fig. 2). The observation that the RRMs of ASF/SF2 are required for interaction with E4-ORF4 was not an indirect effect, mediated by E4-ORF4 and ASF/SF2 simultaneously binding to contaminating RNA in the extract. Two results suggested this: (i) E4-ORF4 did not interact with

42 other SR proteins, although they are also expected to bind to RNA, (ii) RNase treatment of the in vitro translated ASF/SF2 protein or extracts used for the immunoprecipitations, did not disrupt the interaction with E4-ORF4. Since E4-ORF4 induces SR protein dephosphorylation, one would predict that E4-ORF4 interacts preferentially with hyperphosphorylated SR proteins. To test this hypothesis, we compared the capacity of E4-ORF4 to interact with SR-HeLa and SR- Ad. Equal amounts of SR-Ad and SR-HeLa were analyzed by a western blot assay (paper II, fig. 3). Probing filters with the SR protein specific monoclonal antibody 104 (mAb104), that recognizes phospho-epitopes in the RS domain, provided additional support for our conclusion that SR-Ad are hypophosphorylated (paper II, fig. 3A). (i), SR-HeLa were efficiently recognized by mAb104, while SR-Ad were not. (ii), the SR-Ad proteins recognized by mAb104 migrated slightly faster than the corresponding proteins in SR-HeLa. (iii), incubating SR-Ad in a small amount of HeLa-NE under conditions supporting phosphorylation restored the phospho-epitopes recognized by mAb104. Also, the mobility of the re-phosphorylated SR-Ad proteins was reduced such that SR-Ad migration was identical to SR-HeLa. Reprobing this filter with mAb96, that recognizes RRM1 in ASF/SF2, showed even more clearly the difference in migration pattern between ASF/SF2 in SR-HeLa and SR-Ad (paper II, fig. 3B). A far western blot assay detecting E4-ORF4 protein interacting with SR proteins, showed that E4-ORF4 interacts efficiently only with the 30 kDa fraction in SR-HeLa (paper II, fig. 3C). This finding supported the binding studies described above, since ASF/SF2 and SRp30c both belong to the SRp30 fraction. However, E4- ORF4 did not interact efficiently with SR-Ad. Interestingly, in vitro phosphorylation of SR-Ad in HeLa-NE restored E4-ORF4 interaction, suggesting that E4-ORF4 preferentially interacted with the hyperphosphorylated form of SR proteins. In conclusion, these experiments suggest that E4-ORF4 induces SR protein dephosphorylation by interacting with a subset of phosphorylated SR proteins. Still, the observation that E4-ORF4 interacts preferentially with hyperphosphorylated SR proteins seems paradoxical. Thus, E4-ORF4 interacts efficiently with SF2-∆RS, which lacks the RS domain encoding the phosphorylated serines. However, results have been presented suggesting that ASF/SF2 also is phosphorylated at residues in the RRMs (40, 198). Potentially E4-ORF4 induces RS domain dephosphorylation, but the actual binding to ASF/SF2 is mediated through phosphorylated residues in the RRMs. Alternatively, RS domain dephosphorylation may change the structure of ASF/SF2 such that E4-ORF4 cannot bind. Finally, nearly all SR proteins (except SRp20) were shown to be dephosphorylated in SR proteins prepared from adenovirus-infected HeLa cells (paper I). In paper II, E4-ORF4 was found to interact specifically with ASF/SF2. Thus, there are apparently other mechanisms during an adenovirus infection that cause SR protein dephosphorylation.

E4-ORF4 is a splicing enhancer protein — the IIIa repressor element (3RE) is necessary and sufficient for E4-ORF4 activated splicing (Paper I and II) The E4-ORF4-PP2A complex was previously suggested to regulate transcription by inducing dephosphorylation of specific transcription factors (11, 122, 154, 180). Since E4-ORF4 was shown to induce SR protein dephosphorylation, we tested whether E4- ORF4 also controls RNA splicing. The results showed that preincubation of SR-HeLa with a recombinant E4-ORF4 protein in HeLa-NE alleviated the repressive effect of SR-HeLa on IIIa pre-mRNA splicing (paper I, fig. 3b). As previously shown, SR

43 proteins inhibit IIIa splicing by blocking U2 snRNP recruitment to the spliceosome and thus A complex formation (114). Accordingly, addition of E4-ORF4 to splicing extracts alleviated the inhibitory effect of SR-HeLa on A complex formation (paper I, fig.3c). Collectively, these results suggested that E4-ORF4 could convert the splicing properties of SR-HeLa to that of SR-Ad. This finding argues against the hypothesis that the reduced splicing repressor activity of SR-Ad was due to copurification of an unknown splicing repressor protein with SR-Ad. Preincubation of E4-ORF4 with HeLa-NE alone also had a minor activating effect on A complex formation, suggesting that the endogenous pool of SR proteins in the nuclear extract is enough to repress complex A formation on the IIIa 3´ splice site. To further investigate the role of E4-ORF4 in IIIa pre-mRNA splicing (paper I) we reproduced the effect of E4-ORF4 in a transient transfection assay. The results showed that E4-ORF4 expression activated IIIa splicing both on the single IIIa pre- mRNA and the mini-52,55K-IIIa-tandem pre-mRNA (paper I, fig. 4). Deletion of the 3RE from the IIIa pre-mRNA enhanced basal IIIa splicing, confirming the previous in vitro splicing data (114). However, E4-ORF4 did not activate IIIa splicing in a transcript lacking the 3RE. This result suggested that the effect of E4-ORF4 on IIIa splicing was 3RE dependent. As described previously, IIIa splicing is also regulated by a second viral element, the 3VDE (178). Therefore in paper II we examined whether the 3RE was the only element required for E4-ORF4 induced activation of splicing. Inserting either the 3RE or the 3VDE into a β-globin minigene reduced β-globin pre-mRNA splicing. This result was in agreement with previous in vitro splicing data; the 3RE was shown to be the minimal sequence element required for SR protein mediated inhibition of splicing (114), and the 3VDE was shown to only function as a splicing enhancer in the context of virus-infected cells (178). However, cotransfection of E4-ORF4 activated the glob (3RE) splicing, but only marginally the glob (3VDE) splicing. Collectively, these data show that the 3RE is the primary element both necessary and sufficient for E4-ORF4 enhanced splicing.

Strong E4-ORF4 interaction with ASF/SF2 and recruitment of an active PP2A enzyme are required for E4-ORF4 mediated activation of IIIa pre-mRNA splicing (paper II) In paper II we examined more thoroughly how E4-ORF4 activated IIIa splicing. Our hypothesis was that E4-ORF4 functions as a specificity factor that targets ASF/SF2 for PP2A dephosphorylation, thereby reducing its activity as a IIIa splicing repressor protein. In a previous study, Shtrichman et al. 1999 (223) analyzed the capacity of different E4-ORF4 mutant proteins to bind to PP2A and to recruit a functional phosphatase activity. In paper II we used this collection of E4-ORF4 mutant proteins to analyze their capacity to interact with ASF/SF2 in vitro and to activate IIIa pre- mRNA splicing in a transient transfection assay. The results were compared with the data presented on PP2A recruitment (223). The summary of the three different assays is presented in figure 17. The E4-ORF4 mutants have point mutations (one to three amino acids) at conserved regions in E4-ORF4 (figure 17). The in vitro binding assays showed that two regions were important for E4-ORF4 interaction with ASF/SF2; the N-terminal part and amino acids 61 to 95. Probably, the interaction between E4-ORF4 and ASF/SF2 depends on E4-ORF4 protein conformation, since a simple amino acid sequence determinant for binding was not identified.

44 12 R4 N61S RRR73-75AAA R2 R3- 2 WLG21-23ALR R1 R3- 9 A10 PP9-10AA REW55-57AAA C78R T100A E4-O RF4 116aa

Y42C TER64-66YAAA S95P A1 1 p2 0 A3

O 9 2

1 0

- - -

1 3 1

4 1 2 3 2 4 3

E R R A R 1 p R R A A

SF2/ASF binding* ++(+)-++(+)- (+) -+

PP2A recruitment* +++--+-(+) + -(+) Activation of IIIa +----+-- - -- pre-mRNA splicing

Figure 17. Summary of studies with mutant E4-ORF4 proteins (paper II, fig. 6). E4-ORF4 mutants pictured above are from (223). * the percentage binding or recruitment: -, 0-30%; (+), 30-60%; +, 60-100%.

Collectively the results suggested that both strong binding to ASF/SF2 and an efficient recruitment of a functional phosphatase is necessary for E4-ORF4 activation of IIIa splicing (figure 17). E4-ORF4 interaction with only one component was not enough for E4-ORF4 induced activation of IIIa splicing. R3-9 was the only mutant that did not conform to this general rule. Although it bound strongly to ASF/SF2 and recruited PP2A efficiently it did not, for unknown reasons, activate IIIa splicing. Potentially, the interaction of R3-9 with ASF/SF2 and PP2A is nonproductive, and fail to present ASF/SF2 correctly for dephosphorylation. However, these experiments do not exclude the possibility that E4-ORF4 also targets another splicing factor required for E4-ORF4 function in splicing. Although E4-ORF4 also interacted with SRp30c, all the E4-ORF4 mutant proteins bound with that same efficiency to SRp30c (data not shown). Thus, SRp30c probably does not make a significant contribution to the E4-ORF4-induced activation of IIIa splicing. In conclusion, we showed that reduced interaction of E4-ORF4 to ASF/SF2 or the PP2A phosphatase complex did not activate IIIa splicing in transient transfection experiments, suggesting that an interaction between all three proteins is required for E4-ORF4 to induce SR protein dephosphorylation.

Vaccinia virus inactivates SR proteins by dephosphorylation (Paper III) In paper III we investigated whether control of SR protein activity was a strategy used by viruses other than adenovirus to limit host cell gene expression. Since RNA splicing is required for most cellular mRNAs to be exported to the cytoplasm, a virus- induced suppression of RNA splicing could be an important mechanism by which viruses inhibit host cell gene expression. We selected vaccinia virus as our first

45 candidate virus causing SR protein inactivation, since vaccinia virus genes lack introns and its gene expression therefore should not dependent on the host cell splicing machinery. For this experiment, we purified SR proteins from vaccinia virus- infected HeLa cells (SR-VV) and compared their activity as splicing regulatory proteins with that of SR-HeLa and SR-Ad. The results show that SR-VV were completely inactivated as splicing repressor and splicing activator proteins in in vitro splicing reactions using the IIIa and the 52,55K pre-mRNAs, respectively (paper III, fig.1 and 2). SR-Ad had an intermediate activity compared to SR-HeLa and SR-VV. Based on our finding that SR-Ad were inactivated as splicing regulatory proteins by a virus-induced dephosphorylation, we hypothesized that the SR-VV would similarly be inactivated by dephosphorylation. To test this we compared SR-HeLa, SR-Ad and SR-VV in a western blot assay using the phospho-epitope specific mAb104. The results showed that SR-VV was dephosphorylated to a similar extent as SR-Ad (paper III, fig. 3). Importantly, incubation of SR-Ad and SR-VV in a small amount of HeLa nuclear extract restored the phospho-epitopes recognized by mAb104 to both SR protein preparations. In addition, this in vitro rephosphorylation assay restored the IIIa splicing repressor activity to SR-Ad and SR-VV (paper III, fig 4), further emphasizing our conclusion that both SR-Ad and SR-VV are inactivated as splicing proteins by dephosphorylation. Compared to the splicing activity of SR-HeLa, SR-VV did not regain full activity to repress IIIa splicing, as did SR-Ad. Based on our current work we can not explain this finding. Potentially SR-VV are subjected to another posttranslational modification. A modification that is not reversed under the rephosphorylation conditions. How does vaccinia virus cause SR protein dephosphorylation? Vaccinia virus encodes, in fact, a dual specificity phosphatase (VH1), that is required for vaccinia virus gene expression, and is vital for virus growth (144). VH1 has been shown to induce dephosphorylation of a specific transcription factor, STAT1, and in this way inhibit the interferon-gamma response pathway (184). We therefore tested if VH1 could induce SR protein dephosphorylation. The results show that a recombinant VH1 protein could dephosphorylate SR-HeLa in an in vitro dephosphorylation assay system (data not shown). Since preincubation of E4-ORF4 with SR-HeLa in HeLa- NE induced SR protein dephosphorylation and activated IIIa pre-mRNA splicing, we tested VH1 in the same assay. However, even at low concentrations, VH1 repressed IIIa splicing (data not shown). Potentially VH1 is more efficient compared to E4- ORF4 in dephosphorylation of SR proteins and hence all the SR proteins, essential for splicing, are inactivated in VH1 treated extracts. Alternatively, VH1 may dephosphorylate (an)other important splicing factor(s). Further experiments are required to determine whether VH1 is the vaccinia virus protein causing SR protein dephosphorylation during virus growth. Based on the experiments presented in paper I and III we propose that SR protein inactivation may be an important strategy used by viruses to ensure an efficient virus production. Inhibition of SR proteins ensures that host cell pre-mRNA splicing is inhibited, and hence the mRNAs are not transported to the cytoplasm.

46 CONCLUSIONS AND DISCUSSION

Adenovirus and vaccinia virus induce SR protein dephosphorylation — a general viral mechanism to control host cell gene expression? We have demonstrated that both adenovirus and vaccinia virus modulate the activity of the essential SR family of splicing factors (Paper I and III). SR proteins are highly phosphorylated, a modification important for their activity in splicing. We show that adenovirus and vaccinia virus induce SR protein dephosphorylation, a modification that inhibits their activity as splicing repressor and splicing enhancer proteins. Vaccinia virus replicates in the cytoplasm and encodes for genes that do not contain introns. Thus, vaccinia virus is not dependent on the cellular splicing machinery for its replication. We found that vaccinia virus completely inactivates SR proteins as splicing regulatory proteins. In adenovirus the situation is more complex. Adenovirus replicates in the nucleus and most adenovirus genes contain introns (although few compared to cellular genes). Therefore, adenovirus is dependent on the cellular splicing machinery. Adenovirus also causes SR protein inactivation, which might seem contradictory to the requirement of a functional splicing system during an adenovirus infection. However, adenovirus appears to redirect the splicing machinery such that splicing of late viral mRNAs are enhanced. Three observations support this hypothesis. (i), in general, splicing of 3´ splice sites with short atypical p(Y)tracts, that bind U2AF65kDa inefficiently, are selectively enhanced in Ad-NE (176). (ii), efficient activation of IIIa splicing in Ad-NE requires the 3VDE element (178). U2 snRNP binds to the IIIa branch point late in infection. However, U2AF binds less efficiently, which point to a viral mediated recruitment of U2 snRNP. (iii), SR-Ad were not completely inactivated as splicing regulatory proteins as was the case for SR-VV (paper III). It is likely that some SR protein activity is still needed for splicing of adenovirus late mRNAs. In conclusion, both alleviation of the repressive effect of SR proteins binding to the 3RE and activation of IIIa splicing through the 3VDE is important for regulation of L1 alternative splicing in an adenovirus infection (see figure 18) (178).

Early Late U2 p SR p p x p p 3´ ss SR 3´ ss U2 * * 3RE 3VDE IIIa 3RE 3VDE IIIa

12i 3 52,55K IIIa 1 2i 3 52,55K IIIa

Figure 18. Models of L1 alternative splicing regulation. 3RE=IIIa repressor element, 3VDE= IIIa virus dependent splicing enhancer.

Interestingly, SR-Ad could be reactivated as splicing repressor proteins by in vitro phosphorylation. In contrast, SR-VV were only partially reactivated as splicing

47 repressor proteins. Potentially, SR-VV are subjected to an additional modification. Methylation and acetylation have also been found to be important post-translational modifications of many proteins regulating gene expression, for example transcription factors and histones. Thus, it could be worthwhile to investigate whether these modifications also are important for SR protein activity in splicing. Both adenovirus and vaccinia virus infections inhibit cellular mRNA production. In adenovirus, viral mRNAs are selectively transported to the cytoplasm by the help of the E4-ORF6/E1B-55K protein complex. However, the exact mechanisms behind the selective inhibition of host cell mRNA production are still unclear for both viruses. We propose that an SR protein inactivation through a virus- induced dephosphorylation contributes to the selective expression of viral mRNAs in adenovirus and vaccinia virus infected cells. As described in the section ”Viral control of host cell gene expression”, additional viruses have been shown to inhibit cytoplasmic accumulation of cellular mRNAs during the course of infection. Most cellular mRNAs have to be spliced before they are transported to the cytoplasm. Thus a virus-induced inhibition of RNA splicing will ensure that cellular pre-mRNAs stays in the nucleus. It is possible that modulation of SR protein activity is a general mechansim by which viruses control host cell gene expression. Future studies should be aimed at determening whether additional virus families inactivate the SR family of splicing factors.

E4-ORF4 — cellular and viral functional homologes? We have shown that the adenovirus E4-ORF4 protein interacts with a subset of SR proteins, induces PP2A dephosphorylation of SR proteins and regulates adenovirus alternative RNA splicing (figure 19) (Paper I and II). In future studies, E4-ORF4 could potentially be used as a tool to investigate ASF/SF2 specific functions in splicing regulation. As previously mentioned, the repressor and enhancer functions of ASF/SF2 are encoded by distinct domains in the protein (V. Dauksaite and G. Akusjärvi, submitted). Thus, it could be worthwile to investigate whether E4-ORF4 also inactivates ASF/SF2 as a splicing enhancer protein. In addition, the mapping of the phosphorylated residues in ASF/SF2 targeted by the E4-ORF4-PP2A complex will be important. E4-ORF4 also interacted with SRp30c, although SRp30c did not seem to contribute to the E4-ORF4 induced activation of IIIa splicing. The functional importance of the E4-ORF4 and SRp30c interaction should be further characterized. Another issue to be addressed is whether the E4-ORF4/PP2A complex targets additional splicing factors controlling virus and cell specific splicing events. In an adenovirus infection all SR proteins, except SRp20, were shown to be dephosphorylated (Paper I). Since E4-ORF4 appears to specifically target ASF/SF2 and SRp30c, E4-ORF4 can not account for all SR protein dephosphorylations. Thus, there should exist additional factors that regulate SR protein dephosphorylation during an infection. Two other adenovirus proteins have been found to regulate splicing: E4- ORF3 and E4-ORF6 (189, 193). Preliminary studies suggest that E4-ORF6 also activates IIIa splicing in a 3RE dependent manner (S. Fan, T. Punga and G. Akusjärvi, unpublished results). However, it is not yet known if this activation operates via SR protein dephosphorylation. The E1B-55K protein appears to enhance the activity of E4-ORF6 as an enhancer protein of IIIa splicing in vitro (S. Fan, T. Punga and G. Akusjärvi, unpublished results). It is therefore possible that the E4-ORF6/E1B-55K complex regulates RNA transport by directly controlling RNA splicing.

p p p p 5´ss ASF - 3´ ss * 3RE 3VDE IIIa

B E4- ORF4 A p PP2A p p C p AS F

A PP2A B C E4- ORF4 ASF p ASF

p ASF

5´ ss 3´ ss * 3RE 3VDE IIIa

Figure 19. E4-ORF4 activates IIIa splicing in a 3RE dependent manner.

As described earlier, other viruses also encode for proteins that target PP2A. Thus, they could also have a role as regulators of RNA splicing. Interestingly, Py-ST activates IIIa splicing both in vitro and transient transfection experiments (S. Fan, E. Boija and G. Akusjärvi, manuscript in preparation). However, the mechanism of Py- ST activation of IIIa splicing appears to differ from that of E4-ORF4 activation. First, Py-ST activates IIIa splicing by a mechanism requiring the 3VDE. Second, Py-ST activation of IIIa splicing appears to be PP2A independent (S. Fan, E. Boija and G. Akusjärvi, manuscript in preparation). Another viral protein that would be particularly interesting to test as a homolog to the E4-ORF4 protein is the HIV Vpr protein. Both Vpr and E4-ORF4 proteins bind to the B55 subunit of PP2A, activate PP2A activity and induce growth arrest of G2/M phase (104, 125). Although SV40 ST, in contrast to Vpr and E4-ORF4, binds to the core enzyme of PP2A and inhibits PP2A activity against many substrates, SV40 also induces cell cycle arrest at G2/M. Potentially, all three proteins acts by the same mechanism in causing G2/M arrest. Future studies should be aimed at investigating if also SV40 ST and Vpr has a role as regulators of splicing. There is a cellular protein that like E4-ORF4 inhibits ASF/SF2 as a splicing regulatory protein. We have shown that the ASF/SF2-associated protein p32 regulates splicing by inhibiting ASF/SF2 RNA binding and phosphorylation (198). Thus, both E4-ORF4 and p32 induce accumulation of hypophosphorylated ASF/SF2. However, they do this by different mechanisms. E4-ORF4 induces SR protein dephosphorylation, while p32 inhibits SR protein phosphorylation by binding to and sequestering ASF/SF2. Another similarity between p32 and E4-ORF4 is that p32 also

49 interacts with SRp30c. Importantly, p32 does not inhibit SRp30c as a repressor of IIIa splicing. Potentially, the same could be true for E4-ORF4 interaction with SRp30c. The functional difference between ASF/SF2 and SRp30c should be further characterized. Interestingly, as with PP2A, there are many viral proteins that interact with p32. In addition to the previously mentioned HIV-Rev and HPV-ICP27 proteins (18, 237), the Ad-pV (158), HIV-Tat (266), EBV-EBNA 1 (35) and HSV-Orf-P (16) proteins all interact with p32. Although the significance of these interactions are currently unknown, they could potentially influence RNA splicing. The viral factor(s) causing SR protein dephosphorylation in vaccinia virus infected cells is(are) currently not known. As described in ”Present investigation”, one candidate protein is the virus encoded phosphatase VH1. In future studies it should be investigated whether there actually is an interaction between VH1 and SR proteins. Futhermore, purifying SR proteins from VH1 mutant vaccinia virus infected cells may also yield interesting results. However, such an experiment could be difficult since VH1 is required for viral gene expression. An alternative strategy to study the effect of VH1 on SR protein dephosphorylation would be to investigate SR protein localisation in the nucleus. As previously mentioned, SR protein phosphorylation have been shown to cause redistribution of SR proteins from speckels in the nucleus (22, 167).

E4-ORF4 and apoptosis E4-ORF4 induces p53-independent apoptosis in transformed cells (135, 156, 222) by binding to the B55α subunit of PP2A (155, 223, 224). It is not known what substrates are important for E4-ORF4-induced apoptosis, or what functions of E4-ORF4 contribute to induction of apoptosis. E4-ORF4-induced apoptosis is not required for the viral infection, and is possibly a byproduct of its other activites. E4-ORF4-induced apoptosis is anyway not harmful for the virus, since the virus encodes for several proteins that inhibit apoptosis: the E1B proteins and E4-ORF6. It has been suggested that E4-ORF4, together with the adenovirus death protein (E3-11.6K), could be responsible for lysis of the infected cell at the end of the infectious cycle (210). E4-ORF4 induces apoptosis either by up/down-regulating the expression of specific proteins that cause apoptosis or by regulating the phosphorylation levels of kinases or other proteins important in signal transduction during apoptosis. E4-ORF4 might regulate protein expression by influencing transcription factor activity or inducing alternative splicing of genes involved in the apoptotic pathway. Recent studies seem to favour the latter mechanism. Many genes involved in apoptosis are alternatively spliced producing products with opposite effects in apoptosis, for example Bcl-X, caspase-9, caspase-2 and CED-4 (109). Interestingly, E4-ORF4 has been shown to induce alternative splicing pattern of caspase-2 in 293 cells (R. Aravalli and G. Akusjärvi, unpublished). In addition, SR proteins have been found to regulate specific splicing patterns of the caspase-2 (110) and activation of Fas- receptor mediated apoptotis results in SR protein dephosphorylation (29). E4-ORF4 binds to several B subunits of PP2A (224). Potentially the interaction of E4-ORF4 with the varios PP2A subpopulations could contribute to E4- ORF4s multiple functions. Future studies should be aimed at investigating which B subunit(s) that is(are) involved in E4-ORF4s activity in splicing and transcription. This may provide a more direct link between these events and E4-ORF4-induced apoptosis.

50 ACKNOWLEDGEMENTS This work was carried out at the Department of Biochemistry and Microbiology, section Microbiology at the Uppsala University.

Jag skulle vilja ge ETT STORT TACK OCH EN JÄTTEKRAM till alla som på något sätt bidragit till att denna avhandling blev till:

Först och främst till min handledare Göran Akusjärvi. Tack för ditt osvikliga engagemang, det har varit guld värt. Tack för alla dessa år, för hjälp (på alla tänkbara håll och kanter) med avhandlingen, både experimentellt och med skrivandet. Tack för att du har öppnat mina sinnen och introducerat mig i forskningsvärlden.

To all former and present members of the ”adenogroup”. Thank you for your contribution to a stimulating and entertaining environment both in the lab and at other places. THANK YOU for all your help!!! Former: Edyta Bajak, Shaoan Fan, David Huang, Arvydas Kanopka, Mattias Mannervik, Magnus Molin, Oliver Mühlemann, Svend Petersen-Mahrt, Anne-Christine Ström, Baigong Yue and Karin Öhman- Forslund. Present: Raj Aravelli, Saideh Berenjian, Elisabet Boija, Vita Dauksaite, Cecilia Johansson, Fredrik Granberg, Peter Kreivi, Anette Lindgren, Martin Lützelberger, Tanel Punga, Josef Seibt, Anders Sundqvist, Catharina Svensson, Regine Wagner, Bin Wang, Hongxin Zhao and Christina Öhrmalm. Thank you for broadening my knowledge and for always beeing there, helping with all kinds of things. Thank you very much for all your ideas, it contributed a lot! Many hugs to the ”lunch-group” for discussions about everything from science to life-outside-BMC. Thank you, my roommates, for sharing the office and the computer with me (perhaps not so much ”sharing” lately, but anyway).

To Göran Magnusson, Stefan Schwarz and their groups. Thank you for all your help and your contribution to the stimulating and entertaining environment in the lab!

Till alla övriga anställda på IMBIM, bland andra Erika Enström, Tony Grundin, Ylva Jansson, Kerstin Lidholt, Olav Nordli and Maud Pettersson. Tack för er ovärderliga hjälp!

Till mina vänner: Axel, Dennis, Eva, EvaStina, John, Kicki, Lotta, Magnus, Sussi och Ulf. Tack för alla underbara (även regniga!) stunder utanför labbet. Tack för fantastiska gourmémiddagar (mmm…), svettiga pass, resor och äventyr till fjälls, alps, sjöss och havs.

Till mina föräldrar: Tack för att ni alltid har stöttat mig i vått och torrt. Ni är helt otroliga! Tack även hela ”tjocka släkten” för att ni finns där.

Slutligen till min Per. Du är det bästa och roligaste jag vet. Därför är det ju fantastiskt att det snart kommer att finnas en till av dig…. Tack för all service den senaste tiden, även för kontrollläsningen av avhandlingen!

51 REFERENCES

1. Abovich, N., and M. Rosbash. 1997. Cross-intron bridging interactions in the yeast commitment complex are conserved in mammals. Cell 89:403-12. 2. Akusjarvi, G., and H. Persson. 1981. Controls of RNA splicing and termination in the major late adenovirus transcription unit. Nature 292:420-6. 3. Bennett, M., and R. Reed. 1993. Correspondence between a mammalian spliceosome component and an essential yeast splicing factor. Science 262:105-8. 4. Berget, S. M. 1995. Exon recognition in vertebrate splicing. J Biol Chem 270:2411-4. 5. Berglund, J. A., N. Abovich, and M. Rosbash. 1998. A cooperative interaction between U2AF65 and mBBP/SF1 facilitates branchpoint region recognition. Genes Dev 12:858-67. 6. Blanchette, M., and B. Chabot. 1999. Modulation of exon skipping by high-affinity hnRNP A1-binding sites and by intron elements that repress splice site utilization. Embo J 18:1939- 52. 7. Blencowe, B. J. 2000. Exonic splicing enhancers: mechanism of action, diversity and role in human genetic diseases. Trends Biochem Sci 25:106-10. 8. Blencowe, B. J., G. Bauren, A. G. Eldridge, R. Issner, J. A. Nickerson, E. Rosonina, and P. A. Sharp. 2000. The SRm160/300 splicing coactivator subunits. Rna 6:111-20. 9. Blencowe, B. J., J. A. Bowman, S. McCracken, and E. Rosonina. 1999. SR-related proteins and the processing of messenger RNA precursors. Biochem Cell Biol 77:277-91. 10. Blencowe, B. J., R. Issner, J. A. Nickerson, and P. A. Sharp. 1998. A coactivator of pre- mRNA splicing. Genes Dev 12:996-1009. 11. Bondesson, M., K. Ohman, M. Manervik, S. Fan, and G. Akusjarvi. 1996. Adenovirus E4 open reading frame 4 protein autoregulates E4 transcription by inhibiting E1A transactivation of the E4 promoter. J Virol 70:3844-51. 12. Bourgeois, C. F., M. Popielarz, G. Hildwein, and J. Stevenin. 1999. Identification of a bidirectional splicing enhancer: differential involvement of SR proteins in 5' or 3' splice site activation. Mol Cell Biol 19:7347-56. 13. Bridge, E., and G. Ketner. 1989. Redundant control of adenovirus late gene expression by early region 4. J Virol 63:631-8. 14. Brosi, R., K. Groning, S. E. Behrens, R. Luhrmann, and A. Kramer. 1993. Interaction of mammalian splicing factor SF3a with U2 snRNP and relation of its 60-kD subunit to yeast PRP9. Science 262:102-5. 15. Brosi, R., H. P. Hauri, and A. Kramer. 1993. Separation of splicing factor SF3 into two components and purification of SF3a activity. J Biol Chem 268:17640-6. 16. Bruni, R., and B. Roizman. 1996. Open reading frame P--a herpes simplex virus gene repressed during productive infection encodes a protein that binds a splicing factor and reduces synthesis of viral proteins made from spliced mRNA. Proc Natl Acad Sci U S A 93:10423-7. 17. Bruzik, J. P., and T. Maniatis. 1995. Enhancer-dependent interaction between 5' and 3' splice sites in trans. Proc Natl Acad Sci U S A 92:7056-9. 18. Bryant, H. E., D. A. Matthews, S. Wadd, J. E. Scott, J. Kean, S. Graham, W. C. Russell, and J. B. Clements. 2000. Interaction between herpes simplex virus type 1 IE63 protein and cellular protein p32. J Virol 74:11322-8. 19. Bryant, H. E., S. E. Wadd, A. I. Lamond, S. J. Silverstein, and J. B. Clements. 2001. Herpes simplex virus IE63 (ICP27) protein interacts with spliceosome- associated protein 145 and inhibits splicing prior to the first catalytic step. J Virol 75:4376-85. 20. Burge, C. B., T. Tuschl, and P. A. Sharp. 1999. Splicing of precursors to mRNAs by the spliceosome, p. 525-560. In R. F. Gesteland, T. R. Cech, and J. F. Atkins (ed.), THE RNA WORLD, vol. Second Edition. Cold Spring Harbor Laboratory Press, CSH, New York. 21. Caceres, J. F., T. Misteli, G. R. Screaton, D. L. Spector, and A. R. Krainer. 1997. Role of the modular domains of SR proteins in subnuclear localization and alternative splicing specificity. J Cell Biol 138:225-38. 22. Caceres, J. F., G. R. Screaton, and A. R. Krainer. 1998. A specific subset of SR proteins shuttles continuously between the nucleus and the cytoplasm. Genes Dev 12:55-66.

52 23. Caceres, J. F., S. Stamm, D. M. Helfman, and A. R. Krainer. 1994. Regulation of alternative splicing in vivo by overexpression of antagonistic splicing factors. Science 265:1706-9. 24. Campbell, K. S., K. R. Auger, B. A. Hemmings, T. M. Roberts, and D. C. Pallas. 1995. Identification of regions in polyomavirus middle T and small t antigens important for association with protein phosphatase 2A. J Virol 69:3721-8. 25. Cao, W., and M. A. Garcia-Blanco. 1998. A serine/arginine-rich domain in the human U1 70k protein is necessary and sufficient for ASF/SF2 binding. J Biol Chem 273:20629-35. 26. Cao, W., S. F. Jamison, and M. A. Garcia-Blanco. 1997. Both phosphorylation and dephosphorylation of ASF/SF2 are required for pre-mRNA splicing in vitro. Rna 3:1456-67. 27. Carstens, R. P., E. J. Wagner, and M. A. Garcia-Blanco. 2000. An intronic splicing silencer causes skipping of the IIIb exon of fibroblast growth factor receptor 2 through involvement of polypyrimidine tract binding protein. Mol Cell Biol 20:7388-400. 28. Cavaloc, Y., C. F. Bourgeois, L. Kister, and J. Stevenin. 1999. The splicing factors 9G8 and SRp20 transactivate splicing through different and specific enhancers. Rna 5:468-83. 29. Chalfant, C. E., B. Ogretmen, S. H. Galadari, B. Kroesen Bj, B. J. Pettus, and Y. A. Hannun. 2001. FAS activation induces dephosphorylation of SR proteins. Dependence on the de novo generation of ceramide and activation of protein phosphatase-1. J Biol Chem 13:13. 30. Chan, R. C., and D. L. Black. 1995. Conserved intron elements repress splicing of a neuron- specific c-src exon in vitro. Mol Cell Biol 15:6377-85. 31. Chan, R. C., and D. L. Black. 1997. The polypyrimidine tract binding protein binds upstream of neural cell- specific c-src exon N1 to repress the splicing of the intron downstream. Mol Cell Biol 17:4667-76. 32. Chandler, S. D., A. Mayeda, J. M. Yeakley, A. R. Krainer, and X. D. Fu. 1997. RNA splicing specificity determined by the coordinated action of RNA recognition motifs in SR proteins. Proc Natl Acad Sci U S A 94:3596-601. 33. Chang, L. S., and T. Shenk. 1990. The adenovirus DNA-binding protein stimulates the rate of transcription directed by adenovirus and adeno-associated virus promoters. J Virol 64:2103-9. 34. Chaudhary, N., C. McMahon, and G. Blobel. 1991. Primary structure of a human arginine- rich nuclear protein that colocalizes with spliceosome components. Proc Natl Acad Sci U S A 88:8189-93. 35. Chen, M. R., J. F. Yang, C. W. Wu, J. M. Middeldorp, and J. Y. Chen. 1998. Physical association between the EBV protein EBNA-1 and P32/TAP/hyaluronectin. J Biomed Sci 5:173-9. 36. Chiara, M. D., and R. Reed. 1995. A two-step mechanism for 5' and 3' splice-site pairing. Nature 375:510-3. 37. Chou, M. Y., N. Rooke, C. W. Turck, and D. L. Black. 1999. hnRNP H is a component of a splicing enhancer complex that activates a c-src alternative exon in neuronal cells. Mol Cell Biol 19:69-77. 38. Chou, M. Y., J. G. Underwood, J. Nikolic, M. H. Luu, and D. L. Black. 2000. Multisite RNA binding and release of polypyrimidine tract binding protein during the regulation of c- src neural-specific splicing. Mol Cell 5:949-57. 39. Chung, H., and D. Derse. 2001. Binding sites for Rev and ASF/SF2 map to a 55-nucleotide purine-rich exonic element in equine infectious anemia virus RNA. J Biol Chem 276:18960-7. 40. Colwill, K., T. Pawson, B. Andrews, J. Prasad, J. L. Manley, J. C. Bell, and P. I. Duncan. 1996. The Clk/Sty protein kinase phosphorylates SR splicing factors and regulates their intranuclear distribution. Embo J 15:265-75. 41. Cote, J., S. Dupuis, Z. Jiang, and J. Y. Wu. 2001. Caspase-2 pre-mRNA alternative splicing: Identification of an intronic element containing a decoy 3' acceptor site. Proc Natl Acad Sci U S A 98:938-43. 42. Courtneidge, S. A., and A. E. Smith. 1983. Polyoma virus transforming protein associates with the product of the c- src cellular gene. Nature 303:435-9. 43. Cramer, P., J. F. Caceres, D. Cazalla, S. Kadener, A. F. Muro, F. E. Baralle, and A. R. Kornblihtt. 1999. Coupling of transcription with alternative splicing: RNA pol II promoters modulate SF2/ASF and 9G8 effects on an exonic splicing enhancer. Mol Cell 4:251-8. 44. Cramer, P., C. G. Pesce, F. E. Baralle, and A. R. Kornblihtt. 1997. Functional association between promoter structure and transcript alternative splicing. Proc Natl Acad Sci U S A 94:11456-60.

53 45. Crispino, J. D., B. J. Blencowe, and P. A. Sharp. 1994. Complementation by SR proteins of pre-mRNA splicing reactions depleted of U1 snRNP. Science 265:1866-9. 46. Crispino, J. D., and P. A. Sharp. 1995. A U6 snRNA:pre-mRNA interaction can be rate- limiting for U1-independent splicing. Genes Dev 9:2314-23. 47. Cryns, V., and J. Yuan. 1998. Proteases to die for. Genes Dev 12:1551-70. 48. Cullen, B. R. 2000. Nuclear RNA export pathways. Mol Cell Biol 20:4181-7. 49. Das, R., Z. Zhou, and R. Reed. 2000. Functional association of U2 snRNP with the ATP- independent spliceosomal complex E. Mol Cell 5:779-87. 50. Dauwalder, B., and W. Mattox. 1998. Analysis of the functional specificity of RS domains in vivo. Embo J 17:6049-60. 51. de Jong, R. N., and P. C. van der Vliet. 1999. Mechanism of DNA replication in eukaryotic cells: cellular host factors stimulating adenovirus DNA replication. Gene 236:1-12. 52. Des Gouttes Olgiati, D., B. G. Pogo, and S. Dales. 1976. Biogenesis of vaccinia:specific inhibition ofrapidly labeled host DNA in vaccinia inoculated cells. Virology 71:325-335. 53. Dobner, T., and J. Kzhyshkowska. 2001. Nuclear export of adenovirus RNA. Curr Top Microbiol Immunol 259:25-54. 54. Du, C., M. E. McGuffin, B. Dauwalder, L. Rabinow, and W. Mattox. 1998. Protein phosphorylation plays an essential role in the regulation of alternative splicing and sex determination in Drosophila. Mol Cell 2:741-50. 55. Duncan, P. I., D. F. Stojdl, R. M. Marius, and J. C. Bell. 1997. In vivo regulation of alternative pre-mRNA splicing by the Clk1 protein kinase. Mol Cell Biol 17:5996-6001. 56. Elder, R. T., M. Yu, M. Chen, X. Zhu, M. Yanagida, and Y. Zhao. 2001. HIV-1 Vpr Induces Cell Cycle G2 Arrest in Fission Yeast (Schizosaccharomyces pombe) through a Pathway Involving Regulatory and Catalytic Subunits of PP2A and Acting on Both Wee1 and Cdc25. Virology 287:359-70. 57. Eldridge, A. G., Y. Li, P. A. Sharp, and B. J. Blencowe. 1999. The SRm160/300 splicing coactivator is required for exon-enhancer function. Proc Natl Acad Sci U S A 96:6125-30. 58. Ellington, A. D., and J. W. Szostak. 1990. In vitro selection of RNA molecules that bind specific ligands. Nature 346:818-22. 59. Eperon, I. C., D. C. Ireland, R. A. Smith, A. Mayeda, and A. R. Krainer. 1993. Pathways for selection of 5' splice sites by U1 snRNPs and SF2/ASF. Embo J 12:3607-17. 60. Eperon, I. C., O. V. Makarova, A. Mayeda, S. H. Munroe, J. F. Caceres, D. G. Hayward, and A. R. Krainer. 2000. Selection of alternative 5' splice sites: role of U1 snRNP and models for the antagonistic effects of SF2/ASF and hnRNP A1. Mol Cell Biol 20:8303-18. 61. Fairbrother, W. G., and L. A. Chasin. 2000. Human genomic sequences that inhibit splicing. Mol Cell Biol 20:6816-25. 62. Faura, M., J. Renau-Piqueras, O. Bachs, and R. Bosser. 1995. Differential distribution of heterogeneous nuclear ribonucleoproteins in rat tissues. Biochem Biophys Res Commun 217:554-60. 63. Fetzer, S., J. Lauber, C. L. Will, and R. Luhrmann. 1997. The [U4/U6.U5] tri-snRNP- specific 27K protein is a novel SR protein that can be phosphorylated by the snRNP- associated protein kinase. Rna 3:344-55. 64. Flint, S. J., L. W. Enquist, R. M. Krug, V. R. Racaniello, and A. M. Skalka. 2000. Principles of Virology: molecular biology, pathogenesis and control. ASM Press, Washington DC. 65. Freyer, G. A., Y. Katoh, and R. J. Roberts. 1984. Characterization of the major mRNAs from adenovirus 2 early region 4 by cDNA cloning and sequencing. Nucleic Acids Res 12:3503-19. 66. Fu, X. D. 1995. The superfamily of arginine/serine-rich splicing factors. Rna 1:663-80. 67. Fu, X. D., and T. Maniatis. 1992. The 35-kDa mammalian splicing factor SC35 mediates specific interactions between U1 and U2 small nuclear ribonucleoprotein particles at the 3' splice site. Proc Natl Acad Sci U S A 89:1725-9. 68. Fu, X. D., and T. Maniatis. 1990. Factor required for mammalian spliceosome assembly is localized to discrete regions in the nucleus. Nature 343:437-41. 69. Fu, X. D., and T. Maniatis. 1992. Isolation of a complementary DNA that encodes the mammalian splicing factor SC35. Science 256:535-8. 70. Furuichi, Y., and A. J. Shatkin. 2000. Viral and cellular mRNA capping: past and prospects. Adv Virus Res 55:135-84.

54 71. Gabler, S., H. Schutt, P. Groitl, H. Wolf, T. Shenk, and T. Dobner. 1998. E1B 55- kilodalton-associated protein: a cellular protein with RNA- binding activity implicated in nucleocytoplasmic transport of adenovirus and cellular mRNAs. J Virol 72:7960-71. 72. Gallego, M. E., R. Gattoni, J. Stevenin, J. Marie, and A. Expert-Bezancon. 1997. The SR splicing factors ASF/SF2 and SC35 have antagonistic effects on intronic enhancer-dependent splicing of the beta-tropomyosin alternative exon 6A. Embo J 16:1772-84. 73. Gattoni, R., K. Chebli, M. Himmelspach, and J. Stevenin. 1991. Modulation of alternative splicing of adenoviral E1A transcripts: factors involved in the early-to-late transition. Genes Dev 5:1847-58. 74. Gaur, R. K., J. Valcarcel, and M. R. Green. 1995. Sequential recognition of the pre-mRNA branch point by U2AF65 and a novel spliceosome-associated 28-kDa protein. Rna 1:407-17. 75. Ge, H., and J. L. Manley. 1990. A protein factor, ASF, controls cell-specific alternative splicing of SV40 early pre-mRNA in vitro. Cell 62:25-34. 76. Ge, H., Y. Si, and A. P. Wolffe. 1998. A novel transcriptional coactivator, p52, functionally interacts with the essential splicing factor ASF/SF2. Mol Cell 2:751-9. 77. Ge, H., P. Zuo, and J. L. Manley. 1991. Primary structure of the human splicing factor ASF reveals similarities with Drosophila regulators. Cell 66:373-82. 78. Gilbert, W., and S. J. de Souza. 1999. Introns and the RNA world, p. 221-231. In R. F. Gesteland, T. R. Cech, and J. F. Atkins (ed.), THE RNA WORLD, vol. Second Edition. Cold Spring Harbor Laboratory Press, CSH, New York. 79. Gingras, A. C., B. Raught, and N. Sonenberg. 1999. eIF4 initiation factors: effectors of mRNA recruitment to ribosomes and regulators of translation. Annu Rev Biochem 68:913-63. 80. Glover, H. R., C. E. Brewster, and S. M. Dilworth. 1999. Association between src-kinases and the polyoma virus oncogene middle T- antigen requires PP2A and a specific sequence motif. Oncogene 18:4364-70. 81. Gooding, C., G. C. Roberts, and C. W. Smith. 1998. Role of an inhibitory pyrimidine element and polypyrimidine tract binding protein in repression of a regulated alpha- tropomyosin exon. Rna 4:85-100. 82. Graveley, B. R. 2001. Alternative splicing: increasing diversity in the proteomic world. Trends Genet 17:100-7. 83. Graveley, B. R. 2000. Sorting out the complexity of SR protein functions. Rna 6:1197-211. 84. Graveley, B. R., and T. Maniatis. 1998. Arginine/serine-rich domains of SR proteins can function as activators of pre-mRNA splicing. Mol Cell 1:765-71. 85. Green, D., and G. Kroemer. 1998. The central executioners of apoptosis: caspases or mitochondria? Trends Cell Biol 8:267-71. 86. Gross, T., K. Richert, C. Mierke, M. Lutzelberger, and N. F. Kaufer. 1998. Identification and characterization of srp1, a gene of fission yeast encoding a RNA binding domain and a RS domain typical of SR splicing factors. Nucleic Acids Res 26:505-11. 87. Guhaniyogi, J., and G. Brewer. 2001. Regulation of mRNA stability in mammalian cells. Gene 265:11-23. 88. Gui, J. F., H. Tronchere, S. D. Chandler, and X. D. Fu. 1994. Purification and characterization of a kinase specific for the serine- and arginine-rich pre-mRNA splicing factors. Proc Natl Acad Sci U S A 91:10824-8. 89. Gunderson, S. I., M. Polycarpou-Schwarz, and I. W. Mattaj. 1998. U1 snRNP inhibits pre- mRNA polyadenylation through a direct interaction between U1 70K and poly(A) polymerase. Mol Cell 1:255-64. 90. Halbert, D. N., J. R. Cutt, and T. Shenk. 1985. Adenovirus early region 4 encodes functions required for efficient DNA replication, late gene expression, and host cell shutoff. J Virol 56:250-7. 91. Hamm, J., and A. I. Lamond. 1998. Spliceosome assembly: the unwinding role of DEAD- box proteins. Curr Biol 8:R532-4. 92. Hanamura, A., J. F. Caceres, A. Mayeda, B. R. Franza, Jr., and A. R. Krainer. 1998. Regulated tissue-specific expression of antagonistic pre-mRNA splicing factors. Rna 4:430- 44. 93. Hardy, W. R., and R. M. Sandri-Goldin. 1994. Herpes simplex virus inhibits host cell splicing, and regulatory protein ICP27 is required for this effect. J Virol 68:7790-9. 94. Hastings, M. L., and A. R. Krainer. 2001. Pre-mRNA splicing in the new millennium. Curr Opin Cell Biol 13:302-9.

55 95. Hattori, K., P. Angel, M. M. Le Beau, and M. Karin. 1988. Structure and chromosomal localization of the functional intronless human JUN protooncogene. Proc Natl Acad Sci U S A 85:9148-52. 96. Hauber, J. 2001. Nuclear export mediated by the Rev/Rex class of retroviral Trans- activator proteins. Curr Top Microbiol Immunol 259:55-76. 97. Heinrichs, V., L. C. Ryner, and B. S. Baker. 1998. Regulation of sex-specific selection of fruitless 5' splice sites by transformer and transformer-2. Mol Cell Biol 18:450-8. 98. Hemstrom, C., K. Nordqvist, U. Pettersson, and A. Virtanen. 1988. Gene product of region E4 of adenovirus type 5 modulates accumulation of certain viral polypeptides. J Virol 62:3258-64. 99. Himmelspach, M., Y. Cavaloc, K. Chebli, J. Stevenin, and R. Gattoni. 1995. Titration of serine/arginine (SR) splicing factors during adenoviral infection modulates E1A pre-mRNA alternative splicing. Rna 1:794-806. 100. Hirose, Y., and J. L. Manley. 2000. RNA polymerase II and the integration of nuclear events. Genes Dev 14:1415-29. 101. Hirose, Y., R. Tacke, and J. L. Manley. 1999. Phosphorylated RNA polymerase II stimulates pre-mRNA splicing. Genes Dev 13:1234-9. 102. Horak, I. D., T. Kawakami, F. Gregory, K. C. Robbins, and J. B. Bolen. 1989. Association of p60fyn with middle tumor antigen in murine polyomavirus- transformed rat cells. J Virol 63:2343-7. 103. Horridge, J. J., and K. N. Leppard. 1998. RNA-binding activity of the E1B 55-kilodalton protein from human adenovirus type 5. J Virol 72:9374-9. 104. Hrimech, M., X. J. Yao, P. E. Branton, and E. A. Cohen. 2000. Human immunodeficiency virus type 1 Vpr-mediated G(2) cell cycle arrest: Vpr interferes with cell cycle signaling cascades by interacting with the B subunit of serine/threonine protein phosphatase 2A. Embo J 19:3956-67. 105. Huang, M. M., and P. Hearing. 1989. Adenovirus early region 4 encodes two gene products with redundant effects in lytic infection. J Virol 63:2605-15. 106. Imperiale, M. J., G. Akusjnarvi, and K. N. Leppard. 1995. Post-transcriptional control of adenovirus gene expression. Curr Top Microbiol Immunol 199:139-71. 107. Jamison, S. F., Z. Pasman, J. Wang, C. Will, R. Luhrmann, J. L. Manley, and M. A. Garcia-Blanco. 1995. U1 snRNP-ASF/SF2 interaction and 5' splice site recognition: characterization of required elements. Nucleic Acids Res 23:3260-7. 108. Janssens, V., and J. Goris. 2001. Protein phosphatase 2A: a highly regulated family of serine/threonine phosphatases implicated in cell growth and signalling. Biochem J 353:417- 39. 109. Jiang, Z. H., and J. Y. Wu. 1999. Alternative splicing and programmed cell death. Proc Soc Exp Biol Med 220:64-72. 110. Jiang, Z. H., W. J. Zhang, Y. Rao, and J. Y. Wu. 1998. Regulation of Ich-1 pre-mRNA alternative splicing and apoptosis by mammalian splicing factors. Proc Natl Acad Sci U S A 95:9155-60. 111. Johnson, G. P., S. J. Goebel, and E. Paoletti. 1993. An update on the vaccinia virus genome. Virology 196:381-401. 112. Kamma, H., D. S. Portman, and G. Dreyfuss. 1995. Cell type-specific expression of hnRNP proteins. Exp Cell Res 221:187-96. 113. Kan, J. L., and M. R. Green. 1999. Pre-mRNA splicing of IgM exons M1 and M2 is directed by a juxtaposed splicing enhancer and inhibitor. Genes Dev 13:462-71. 114. Kanopka, A., O. Muhlemann, and G. Akusjarvi. 1996. Inhibition by SR proteins of splicing of a regulated adenovirus pre- mRNA. Nature 381:535-8. 115. Kataoka, N., J. Yong, V. N. Kim, F. Velazquez, R. A. Perkinson, F. Wang, and G. Dreyfuss. 2000. Pre-mRNA splicing imprints mRNA in the nucleus with a novel RNA- binding protein that persists in the cytoplasm. Mol Cell 6:673-82. 116. Kedes, L. H. 1979. Histone genes and histone messengers. Annu Rev Biochem 48:837-70. 117. Ketner, G., E. Bridge, A. Virtanen, C. Hemstrom, and U. Pettersson. 1989. Complementation of adenovirus E4 mutants by transient expression of E4 cDNA and deletion plasmids. Nucleic Acids Res 17:3037-48.

56 118. Kim, E., L. Du, D. B. Bregman, and S. L. Warren. 1997. Splicing factors associate with hyperphosphorylated RNA polymerase II in the absence of pre-mRNA. J Cell Biol 136:19-28.

119. Kjems, J., A. D. Frankel, and P. A. Sharp. 1991. Specific regulation of mRNA splicing in vitro by a peptide from HIV-1 Rev. Cell 67:169-78.

120. Kjems, J., and P. A. Sharp. 1993. The basic domain of Rev from human immunodeficiency virus type 1 specifically blocks the entry of U4/U6.U5 small nuclear ribonucleoprotein in spliceosome assembly. J Virol 67:4769-76. 121. Kleinberger, T. 2000. Induction of apoptosis by adenovirus E4orf4 protein. Apoptosis 5:211- 5. 122. Kleinberger, T., and T. Shenk. 1993. Adenovirus E4orf4 protein binds to protein phosphatase 2A, and the complex down regulates E1A-enhanced junB transcription. J Virol 67:7556-60. 123. Kohtz, J. D., S. F. Jamison, C. L. Will, P. Zuo, R. Luhrmann, M. A. Garcia-Blanco, and J. L. Manley. 1994. Protein-protein interactions and 5'-splice-site recognition in mammalian mRNA precursors. Nature 368:119-24. 124. Kornbluth, S., M. Sudol, and H. Hanafusa. 1987. Association of the polyomavirus middle- T antigen with c-yes protein. Nature 325:171-3. 125. Kornitzer, D., R. Sharf, and T. Kleinberger. 2001. Adenovirus E4orf4 protein induces PP2A-dependent growth arrest in Saccharomyces cerevisiae and interacts with the anaphase- promoting complex/cyclosome. J Cell Biol 154:331-44. 126. Krainer, A. R., G. C. Conway, and D. Kozak. 1990. The essential pre-mRNA splicing factor SF2 influences 5' splice site selection by activating proximal sites. Cell 62:35-42. 127. Krainer, A. R., A. Mayeda, D. Kozak, and G. Binns. 1991. Functional expression of cloned human splicing factor SF2: homology to RNA-binding proteins, U1 70K, and Drosophila splicing regulators. Cell 66:383-94. 128. Kramer, A., F. Mulhauser, C. Wersig, K. Groning, and G. Bilbe. 1995. Mammalian splicing factor SF3a120 represents a new member of the SURP family of proteins and is homologous to the essential splicing factor PRP21p of Saccharomyces cerevisiae. Rna 1:260- 72. 129. Kreivi, J. P., and G. Akusjarvi. 1994. Regulation of adenovirus alternative RNA splicing at the level of commitment complex formation. Nucleic Acids Res 22:332-7. 130. Kuhn, A. N., Z. Li, and D. A. Brow. 1999. Splicing factor Prp8 governs U4/U6 RNA unwinding during activation of the spliceosome. Mol Cell 3:65-75. 131. Labourier, E., H. M. Bourbon, I. E. Gallouzi, M. Fostier, E. Allemand, and J. Tazi. 1999. Antagonism between RSF1 and SR proteins for both splice-site recognition in vitro and Drosophila development. Genes Dev 13:740-53. 132. Lander, E. S., L. M. Linton, B. Birren, C. Nusbaum, M. C. Zody, J. Baldwin, K. Devon, K. Dewar, M. Doyle, W. FitzHugh, R. Funke, D. Gage, K. Harris, A. Heaford, J. Howland, L. Kann, J. Lehoczky, R. LeVine, P. McEwan, K. McKernan, J. Meldrim, J. P. Mesirov, C. Miranda, W. Morris, J. Naylor, C. Raymond, M. Rosetti, R. Santos, A. Sheridan, C. Sougnez, N. Stange-Thomann, N. Stojanovic, A. Subramanian, D. Wyman, J. Rogers, J. Sulston, R. Ainscough, S. Beck, D. Bentley, J. Burton, C. Clee, N. Carter, A. Coulson, R. Deadman, P. Deloukas, A. Dunham, I. Dunham, R. Durbin, L. French, D. Grafham, S. Gregory, T. Hubbard, S. Humphray, A. Hunt, M. Jones, C. Lloyd, A. McMurray, L. Matthews, S. Mercer, S. Milne, J. C. Mullikin, A. Mungall, R. Plumb, M. Ross, R. Shownkeen, S. Sims, R. H. Waterston, R. K. Wilson, L. W. Hillier, J. D. McPherson, M. A. Marra, E. R. Mardis, L. A. Fulton, A. T. Chinwalla, K. H. Pepin, W. R. Gish, S. L. Chissoe, M. C. Wendl, K. D. Delehaunty, T. L. Miner, A. Delehaunty, J. B. Kramer, L. L. Cook, R. S. Fulton, D. L. Johnson, P. J. Minx, S. W. Clifton, T. Hawkins, E. Branscomb, P. Predki, P. Richardson, S. Wenning, T. Slezak, N. Doggett, J. F. Cheng, A. Olsen, S. Lucas, C. Elkin, E. Uberbacher, M. Frazier, et al. 2001. Initial sequencing and analysis of the human genome. Nature 409:860-921. 133. Larsson, S., J. P. Kreivi, and G. Akusjarvi. 1991. Control of adenovirus alternative RNA splicing: effect of viral DNA replication on RNA splice site choice. Gene 107:219-27. 134. Lavoie, J. N., C. Champagne, M. C. Gingras, and A. Robert. 2000. Adenovirus E4 open reading frame 4-induced apoptosis involves dysregulation of Src family kinases. J Cell Biol 150:1037-56.

57 135. Lavoie, J. N., M. Nguyen, R. C. Marcellus, P. E. Branton, and G. C. Shore. 1998. E4orf4, a novel adenovirus death factor that induces p53-independent apoptosis by a pathway that is not inhibited by zVAD-fmk. J Cell Biol 140:637-45.

136. Le Hir, H., E. Izaurralde, L. E. Maquat, and M. J. Moore. 2000. The spliceosome deposits multiple proteins 20-24 nucleotides upstream of mRNA exon-exon junctions. Embo J 19:6860-9.

137. Le Hir, H., M. J. Moore, and L. E. Maquat. 2000. Pre-mRNA splicing alters mRNP composition: evidence for stable association of proteins at exon-exon junctions. Genes Dev 14:1098-108. 138. Lee, T. I., and R. A. Young. 2000. Transcription of eukaryotic protein-coding genes. Annu Rev Genet 34:77-137. 139. Leong, K., and A. J. Berk. 1986. Adenovirus early region 1A protein increases the number of template molecules transcribed in cell-free extracts. Proc Natl Acad Sci U S A 83:5844-8. 140. Lewis, J. D., S. I. Gunderson, and I. W. Mattaj. 1995. The influence of 5' and 3' end structures on pre-mRNA metabolism. J Cell Sci Suppl 19:13-9. 141. Lewis, J. D., E. Izaurralde, A. Jarmolowski, C. McGuigan, and I. W. Mattaj. 1996. A nuclear cap-binding complex facilitates association of U1 snRNP with the cap-proximal 5' splice site. Genes Dev 10:1683-98. 142. Liu, H. X., S. L. Chew, L. Cartegni, M. Q. Zhang, and A. R. Krainer. 2000. Exonic splicing enhancer motif recognized by human SC35 under splicing conditions. Mol Cell Biol 20:1063-71. 143. Liu, H. X., M. Zhang, and A. R. Krainer. 1998. Identification of functional exonic splicing enhancer motifs recognized by individual SR proteins. Genes Dev 12:1998-2012. 144. Liu, K., B. Lemon, and P. Traktman. 1995. The dual-specificity phosphatase encoded by vaccinia virus, VH1, is essential for viral transcription in vivo and in vitro. J Virol 69:7823- 34. 145. Livne, A., R. Shtrichman, and T. Kleinberger. 2001. Caspase activation by adenovirus e4orf4 protein is cell line specific and Is mediated by the death receptor pathway. J Virol 75:789-98. 146. Longman, D., I. L. Johnstone, and J. F. Caceres. 2000. Functional characterization of SR and SR-related genes in Caenorhabditis elegans. Embo J 19:1625-37. 147. Lopez, A. J. 1998. Alternative splicing of pre-mRNA: developmental consequences and mechanisms of regulation. Annu Rev Genet 32:279-305. 148. Lorson, C. L., and E. J. Androphy. 2000. An exonic enhancer is required for inclusion of an essential exon in the SMA-determining gene SMN. Hum Mol Genet 9:259-65. 149. Lorson, C. L., E. Hahnen, E. J. Androphy, and B. Wirth. 1999. A single nucleotide in the SMN gene regulates splicing and is responsible for spinal muscular atrophy. Proc Natl Acad Sci U S A 96:6307-11. 150. Luo, M. J., and R. Reed. 1999. Splicing is required for rapid and efficient mRNA export in metazoans. Proc Natl Acad Sci U S A 96:14937-42. 151. Lutzelberger, M., T. Gross, and N. F. Kaufer. 1999. Srp2, an SR protein family member of fission yeast: in vivo characterization of its modular domains. Nucleic Acids Res 27:2618-26. 152. Lynch, K. W., and T. Maniatis. 1996. Assembly of specific SR protein complexes on distinct regulatory elements of the Drosophila doublesex splicing enhancer. Genes Dev 10:2089-101. 153. Manley, J. L., and R. Tacke. 1996. SR proteins and splicing control. Genes Dev 10:1569-79. 154. Mannervik, M., S. Fan, A. C. Strom, K. Helin, and G. Akusjarvi. 1999. Adenovirus E4 open reading frame 4-induced dephosphorylation inhibits E1A activation of the E2 promoter and E2F-1-mediated transactivation independently of the retinoblastoma tumor suppressor protein. Virology 256:313-21. 155. Marcellus, R. C., H. Chan, D. Paquette, S. Thirlwell, D. Boivin, and P. E. Branton. 2000. Induction of p53-independent apoptosis by the adenovirus E4orf4 protein requires binding to the Balpha subunit of protein phosphatase 2A. J Virol 74:7869-77. 156. Marcellus, R. C., J. N. Lavoie, D. Boivin, G. C. Shore, G. Ketner, and P. E. Branton. 1998. The early region 4 orf4 protein of human adenovirus type 5 induces p53- independent cell death by apoptosis. J Virol 72:7144-53.

58 157. Markovtsov, V., J. M. Nikolic, J. A. Goldman, C. W. Turck, M. Y. Chou, and D. L. Black. 2000. Cooperative assembly of an hnRNP complex induced by a tissue-specific homolog of polypyrimidine tract binding protein. Mol Cell Biol 20:7463-79. 158. Matthews, D. A., and W. C. Russell. 1998. Adenovirus core protein V interacts with p32--a protein which is associated with both the mitochondria and the nucleus. J Gen Virol 79:1677- 85.

159. McNally, L. M., and M. T. McNally. 1998. An RNA splicing enhancer-like sequence is a component of a splicing inhibitor element from Rous sarcoma virus. Mol Cell Biol 18:3103- 11.

160. Merendino, L., S. Guth, D. Bilbao, C. Martinez, and J. Valcarcel. 1999. Inhibition of msl- 2 splicing by Sex-lethal reveals interaction between U2AF35 and the 3' splice site AG. Nature 402:838-41. 161. Mermoud, J. E., P. Cohen, and A. I. Lamond. 1992. Ser/Thr-specific protein phosphatases are required for both catalytic steps of pre-mRNA splicing. Nucleic Acids Res 20:5263-9. 162. Mermoud, J. E., P. T. Cohen, and A. I. Lamond. 1994. Regulation of mammalian spliceosome assembly by a protein phosphorylation mechanism. Embo J 13:5679-88. 163. Millward, T. A., S. Zolnierowicz, and B. A. Hemmings. 1999. Regulation of protein kinase cascades by protein phosphatase 2A. Trends Biochem Sci 24:186-91. 164. Min, H., R. C. Chan, and D. L. Black. 1995. The generally expressed hnRNP F is involved in a neural-specific pre- mRNA splicing event. Genes Dev 9:2659-71. 165. Min, H., C. W. Turck, J. M. Nikolic, and D. L. Black. 1997. A new regulatory protein, KSRP, mediates exon inclusion through an intronic splicing enhancer. Genes Dev 11:1023- 36. 166. Misteli, T. 1999. RNA splicing: What has phosphorylation got to do with it? Curr Biol 9:R198-200. 167. Misteli, T., J. F. Caceres, J. Q. Clement, A. R. Krainer, M. F. Wilkinson, and D. L. Spector. 1998. Serine phosphorylation of SR proteins is required for their recruitment to sites of transcription in vivo. J Cell Biol 143:297-307. 168. Misteli, T., and D. L. Spector. 1999. RNA polymerase II targets pre-mRNA splicing factors to transcription sites in vivo. Mol Cell 3:697-705. 169. Modafferi, E. F., and D. L. Black. 1999. Combinatorial control of a neuron-specific exon. Rna 5:687-706. 170. Modafferi, E. F., and D. L. Black. 1997. A complex intronic splicing enhancer from the c- src pre-mRNA activates inclusion of a heterologous exon. Mol Cell Biol 17:6537-45. 171. Molin, M., and G. Akusjarvi. 2000. Overexpression of essential splicing factor ASF/SF2 blocks the temporal shift in adenovirus pre-mRNA splicing and reduces virus progeny formation. J Virol 74:9002-9. 172. Monani, U. R., C. L. Lorson, D. W. Parsons, T. W. Prior, E. J. Androphy, A. H. Burghes, and J. D. McPherson. 1999. A single nucleotide difference that alters splicing patterns distinguishes the SMA gene SMN1 from the copy gene SMN2. Hum Mol Genet 8:1177-83. 173. Monney, L., I. Otter, R. Olivier, H. L. Ozer, A. L. Haas, S. Omura, and C. Borner. 1998. Defects in the ubiquitin pathway induce caspase-independent apoptosis blocked by Bcl-2. J Biol Chem 273:6121-31. 174. Moss, B. 1996. Poxviridae: the viruses and their replication, p. 2637-2659. In B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields virology, Third ed. Lippincott- Raven Publishers, Philadelphia. 175. Moss, B. 1990. Regulation of vaccinia virus transcription. Annu Rev Biochem 59:661-88. 176. Muhlemann, O., J. P. Kreivi, and G. Akusjarvi. 1995. Enhanced splicing of nonconsensus 3' splice sites late during adenovirus infection. J Virol 69:7324-7. 177. Muhlemann, O., J. P. Kreivi, and G. Akusjarvi. 1995. Splicing of two weak 3' splice sites from the adenovirus major late region is enhanced in nuclear extracts from adenovirus infected cells. Nucleic Acids Symp Ser 33:220-3. 178. Muhlemann, O., B. G. Yue, S. Petersen-Mahrt, and G. Akusjarvi. 2000. A novel type of splicing enhancer regulating adenovirus pre-mRNA splicing. Mol Cell Biol 20:2317-25. 179. Mullane, K. P., M. Ratnofsky, X. Cullere, and B. Schaffhausen. 1998. Signaling from polyomavirus middle T and small T defines different roles for protein phosphatase 2A. Mol Cell Biol 18:7556-64.

59 180. Muller, U., T. Kleinberger, and T. Shenk. 1992. Adenovirus E4orf4 protein reduces phosphorylation of c-Fos and E1A proteins while simultaneously reducing the level of AP-1. J Virol 66:5867-78. 181. Murray, H. L., and K. A. Jarrell. 1999. Flipping the switch to an active spliceosome. Cell 96:599-602. 182. Murray, M. V., R. Kobayashi, and A. R. Krainer. 1999. The type 2C Ser/Thr phosphatase PP2Cgamma is a pre-mRNA splicing factor. Genes Dev 13:87-97.

183. Nagata, S., N. Mantei, and C. Weissmann. 1980. The structure of one of the eight or more distinct chromosomal genes for human interferon-alpha. Nature 287:401-8. 184. Najarro, P., P. Traktman, and J. A. Lewis. 2001. Vaccinia virus blocks gamma interferon signal transduction: viral VH1 phosphatase reverses Stat1 activation. J Virol 75:3185-96.

185. Nelissen, R. L., C. L. Will, W. J. van Venrooij, and R. Luhrmann. 1994. The association of the U1-specific 70K and C proteins with U1 snRNPs is mediated in part by common U snRNP proteins. Embo J 13:4113-25. 186. Nevins, J. R., and M. C. Wilson. 1981. Regulation of adenovirus-2 gene expression at the level of transcriptional termination and RNA processing. Nature 290:113-8. 187. Newman, A. J. 1997. The role of U5 snRNP in pre-mRNA splicing. Embo J 16:5797-800. 188. Nissim-Rafinia, M., O. Chiba-Falek, G. Sharon, A. Boss, and B. Kerem. 2000. Cellular and viral splicing factors can modify the splicing pattern of CFTR transcripts carrying splicing mutations. Hum Mol Genet 9:1771-8. 189. Nordqvist, K., K. Ohman, and G. Akusjarvi. 1994. Human adenovirus encodes two proteins which have opposite effects on accumulation of alternatively spliced mRNAs. Mol Cell Biol 14:437-45. 190. Nordqvist, K., K. Zerivitz, J. P. Kreivi, K. Ohman, and G. Akusjarvi. 1990. Characterization of factors involved in regulated adenovirus-2 major late pre-mRNA splicing. Mol Biol Rep 14:203-4. 191. O'Keefe, R. T., and A. J. Newman. 1998. Functional analysis of the U5 snRNA loop 1 in the second catalytic step of yeast pre-mRNA splicing. Embo J 17:565-74. 192. Ogris, E., I. Mudrak, E. Mak, D. Gibson, and D. C. Pallas. 1999. Catalytically inactive protein phosphatase 2A can bind to polyomavirus middle tumor antigen and support complex formation with pp60(c-src). J Virol 73:7390-8. 193. Ohman, K., K. Nordqvist, and G. Akusjarvi. 1993. Two adenovirus proteins with redundant activities in virus growth facilitates tripartite leader mRNA accumulation. Virology 194:50-8. 194. Okamoto, Y., H. Onogi, R. Honda, H. Yasuda, T. Wakabayashi, Y. Nimura, and M. Hagiwara. 1998. cdc2 kinase-mediated phosphorylation of splicing factor SF2/ASF. Biochem Biophys Res Commun 249:872-8. 195. Pagani, F., E. Buratti, C. Stuani, M. Romano, E. Zuccato, M. Niksic, L. Giglio, D. Faraguna, and F. E. Baralle. 2000. Splicing factors induce cystic fibrosis transmembrane regulator exon 9 skipping through a nonevolutionary conserved intronic element. J Biol Chem 275:21041-7. 196. Parks, C. L., and T. Shenk. 1997. Activation of the adenovirus major late promoter by transcription factors MAZ and Sp1. J Virol 71:9600-7. 197. Patturajan, M., X. Wei, R. Berezney, and J. L. Corden. 1998. A nuclear matrix protein interacts with the phosphorylated C-terminal domain of RNA polymerase II. Mol Cell Biol 18:2406-15. 198. Petersen-Mahrt, S. K., C. Estmer, C. Ohrmalm, D. A. Matthews, W. C. Russell, and G. Akusjarvi. 1999. The splicing factor-associated protein, p32, regulates RNA splicing by inhibiting ASF/SF2 RNA binding and phosphorylation. Embo J 18:1014-24. 199. Philips, A. V., and T. A. Cooper. 2000. RNA processing and human disease. Cell Mol Life Sci 57:235-49. 200. Powell, D. M., M. C. Amaral, J. Y. Wu, T. Maniatis, and W. C. Greene. 1997. HIV Rev- dependent binding of SF2/ASF to the Rev response element: possible role in Rev-mediated inhibition of HIV RNA splicing. Proc Natl Acad Sci U S A 94:973-8. 201. Proudfoot, N. J. 1989. How RNA polymerase II terminates transcription in higher eukaryotes. Trends Biochem Sci 14:105-10. 202. Qian, W., and K. G. Wiman. 2000. Polyoma virus middle T and small t antigens cooperate to antagonize p53- induced cell cycle arrest and apoptosis. Cell Growth Differ 11:31-9.

60 203. Query, C. C., S. A. Strobel, and P. A. Sharp. 1996. Three recognition events at the branch- site adenine. Embo J 15:1392-402. 204. Quignon, F., F. De Bels, M. Koken, J. Feunteun, J. C. Ameisen, and H. de The. 1998. PML induces a novel caspase-independent death process. Nat Genet 20:259-65. 205. Ring, H. Z., and J. T. Lis. 1994. The SR protein B52/SRp55 is essential for Drosophila development. Mol Cell Biol 14:7499-506. 206. Roscigno, R. F., and M. A. Garcia-Blanco. 1995. SR proteins escort the U4/U6.U5 tri- snRNP to the spliceosome. Rna 1:692-706.

207. Rossi, F., E. Labourier, T. Forne, G. Divita, J. Derancourt, J. F. Riou, E. Antoine, G. Cathala, C. Brunel, and J. Tazi. 1996. Specific phosphorylation of SR proteins by mammalian DNA topoisomerase I. Nature 381:80-2.

208. Roth, M. B., C. Murphy, and J. G. Gall. 1990. A monoclonal antibody that recognizes a phosphorylated epitope stains lampbrush chromosome loops and small granules in the amphibian germinal vesicle. J Cell Biol 111:2217-23. 209. Roth, M. B., A. M. Zahler, and J. A. Stolk. 1991. A conserved family of nuclear phosphoproteins localized to sites of polymerase II transcription. J Cell Biol 115:587-96. 210. Roulston, A., R. C. Marcellus, and P. E. Branton. 1999. Viruses and apoptosis. Annu Rev Microbiol 53:577-628. 211. Ruediger, R., N. Brewis, K. Ohst, and G. Walter. 1997. Increasing the ratio of PP2A core enzyme to holoenzyme inhibits Tat- stimulated HIV-1 transcription and virus production. Virology 238:432-43. 212. Rundell, K., and R. Parakati. 2001. The role of the SV40 ST antigen in cell growth promotion and transformation. Semin Cancer Biol 11:5-13. 213. Ruskin, B., P. D. Zamore, and M. R. Green. 1988. A factor, U2AF, is required for U2 snRNP binding and splicing complex assembly. Cell 52:207-19. 214. Ryner, L. C., S. F. Goodwin, D. H. Castrillon, A. Anand, A. Villella, B. S. Baker, J. C. Hall, B. J. Taylor, and S. A. Wasserman. 1996. Control of male sexual behavior and sexual orientation in Drosophila by the fruitless gene. Cell 87:1079-89. 215. Sandri-Goldin, R. M. 2001. Nuclear export of herpes virus RNA. Curr Top Microbiol Immunol 259:2-23. 216. Schaal, T. D., and T. Maniatis. 1999. Selection and characterization of pre-mRNA splicing enhancers: identification of novel SR protein-specific enhancer sequences. Mol Cell Biol 19:1705-19. 217. Scheidtmann, K. H., M. C. Mumby, K. Rundell, and G. Walter. 1991. Dephosphorylation of simian virus 40 large-T antigen and p53 protein by protein phosphatase 2A: inhibition by small-t antigen. Mol Cell Biol 11:1996-2003. 218. Schuchner, S., and E. Wintersberger. 1999. Binding of polyomavirus small T antigen to protein phosphatase 2A is required for elimination of p27 and support of S-phase induction in concert with large T antigen. J Virol 73:9266-73. 219. Screaton, G. R., J. F. Caceres, A. Mayeda, M. V. Bell, M. Plebanski, D. G. Jackson, J. I. Bell, and A. R. Krainer. 1995. Identification and characterization of three members of the human SR family of pre-mRNA splicing factors. Embo J 14:4336-49. 220. Shaw, A. R., and E. B. Ziff. 1980. Transcripts from the adenovirus-2 major late promoter yield a single early family of 3' coterminal mRNAs and five late families. Cell 22:905-16. 221. Shenk, T. 1996. Adenoviridae: the viruses and their replication, p. 2111-2148. In B. N. Fields, D. M. Knipe, and P. M. Howley (ed.), Fields Virology, Third ed. Lippincott- Raven Publishers, Philadelphia. 222. Shtrichman, R., and T. Kleinberger. 1998. Adenovirus type 5 E4 open reading frame 4 protein induces apoptosis in transformed cells. J Virol 72:2975-82. 223. Shtrichman, R., R. Sharf, H. Barr, T. Dobner, and T. Kleinberger. 1999. Induction of apoptosis by adenovirus E4orf4 protein is specific to transformed cells and requires an interaction with protein phosphatase 2A. Proc Natl Acad Sci U S A 96:10080-5. 224. Shtrichman, R., R. Sharf, and T. Kleinberger. 2000. Adenovirus E4orf4 protein interacts with both Balpha and B' subunits of protein phosphatase 2A, but E4orf4-induced apoptosis is mediated only by the interaction with Balpha. Oncogene 19:3757-65. 225. Smith, C. W., and J. Valcarcel. 2000. Alternative pre-mRNA splicing: the logic of combinatorial control. Trends Biochem Sci 25:381-8.

61 226. Soloway, P. D., and T. Shenk. 1990. The adenovirus type 5 i-leader open reading frame functions in cis to reduce the half-life of L1 mRNAs. J Virol 64:551-8. 227. Sontag, E., S. Fedorov, C. Kamibayashi, D. Robbins, M. Cobb, and M. Mumby. 1993. The interaction of SV40 small tumor antigen with protein phosphatase 2A stimulates the map kinase pathway and induces cell proliferation. Cell 75:887-97. 228. Southby, J., C. Gooding, and C. W. Smith. 1999. Polypyrimidine tract binding protein functions as a repressor to regulate alternative splicing of alpha-actinin mutally exclusive exons. Mol Cell Biol 19:2699-711.

229. Spritz, R. A., K. Strunk, C. S. Surowy, S. O. Hoch, D. E. Barton, and U. Francke. 1987. The human U1-70K snRNP protein: cDNA cloning, chromosomal localization, expression, alternative splicing and RNA-binding. Nucleic Acids Res 15:10373-91. 230. Staley, J. P., and C. Guthrie. 1998. Mechanical devices of the spliceosome: motors, clocks, springs, and things. Cell 92:315-26.

231. Staley, J. P., and C. Guthrie. 1999. An RNA switch at the 5' splice site requires ATP and the DEAD box protein Prp28p. Mol Cell 3:55-64. 232. Symington, J. S., L. A. Lucher, K. H. Brackmann, A. Virtanen, U. Pettersson, and M. Green. 1986. Biosynthesis of adenovirus type 2 i-leader protein. J Virol 57:848-56. 233. Tacke, R., Y. Chen, and J. L. Manley. 1997. Sequence-specific RNA binding by an SR protein requires RS domain phosphorylation: creation of an SRp40-specific splicing enhancer. Proc Natl Acad Sci U S A 94:1148-53. 234. Tacke, R., and J. L. Manley. 1999. Determinants of SR protein specificity. Curr Opin Cell Biol 11:358-62. 235. Tacke, R., and J. L. Manley. 1995. The human splicing factors ASF/SF2 and SC35 possess distinct, functionally significant RNA binding specificities. Embo J 14:3540-51. 236. Tacke, R., M. Tohyama, S. Ogawa, and J. L. Manley. 1998. Human Tra2 proteins are sequence-specific activators of pre-mRNA splicing. Cell 93:139-48. 237. Tange, T. O., T. H. Jensen, and J. Kjems. 1996. In vitro interaction between human immunodeficiency virus type 1 Rev protein and splicing factor ASF/SF2-associated protein, p32. J Biol Chem 271:10066-72. 238. Tarn, W. Y., and J. A. Steitz. 1995. Modulation of 5' splice site choice in pre-messenger RNA by two distinct steps. Proc Natl Acad Sci U S A 92:2504-8. 239. Tarn, W. Y., and J. A. Steitz. 1994. SR proteins can compensate for the loss of U1 snRNP functions in vitro. Genes Dev 8:2704-17. 240. Tazi, J., M. C. Daugeron, G. Cathala, C. Brunel, and P. Jeanteur. 1992. Adenosine phosphorothioates (ATP alpha S and ATP tau S) differentially affect the two steps of mammalian pre-mRNA splicing. J Biol Chem 267:4322-6. 241. Tazi, J., U. Kornstadt, F. Rossi, P. Jeanteur, G. Cathala, C. Brunel, and R. Luhrmann. 1993. Thiophosphorylation of U1-70K protein inhibits pre-mRNA splicing. Nature 363:283-6. 242. Teigelkamp, S., C. Mundt, T. Achsel, C. L. Will, and R. Luhrmann. 1997. The human U5 snRNP-specific 100-kD protein is an RS domain-containing, putative RNA helicase with significant homology to the yeast splicing factor Prp28p. Rna 3:1313-26. 243. Tigges, M. A., and H. J. Raskas. 1984. Splice junctions in adenovirus 2 early region 4 mRNAs: multiple splice sites produce 18 to 24 RNAs. J Virol 50:106-17. 244. Tribouley, C., P. Lutz, A. Staub, and C. Kedinger. 1994. The product of the adenovirus intermediate gene IVa2 is a transcriptional activator of the major late promoter. J Virol 68:4450-7. 245. Tuerk, C., and L. Gold. 1990. Systematic evolution of ligands by exponential enrichment: RNA ligands to bacteriophage T4 DNA polymerase. Science 249:505-10. 246. Tung, H. Y., H. De Rocquigny, L. J. Zhao, X. Cayla, B. P. Roques, and R. Ozon. 1997. Direct activation of protein phosphatase-2A0 by HIV-1 encoded protein complex NCp7:vpr. FEBS Lett 401:197-201. 247. Vagner, S., U. Ruegsegger, S. I. Gunderson, W. Keller, and I. W. Mattaj. 2000. Position- dependent inhibition of the cleavage step of pre-mRNA 3'-end processing by U1 snRNP. Rna 6:178-88. 248. Valcarcel, J., R. K. Gaur, R. Singh, and M. R. Green. 1996. Interaction of U2AF65 RS region with pre-mRNA branch point and promotion of base pairing with U2 snRNA [corrected]. Science 273:1706-9.

62 249. van der Houven van Oordt, W., M. T. Diaz-Meco, J. Lozano, A. R. Krainer, J. Moscat, and J. F. Caceres. 2000. The MKK(3/6)-p38-signaling cascade alters the subcellular distribution of hnRNP A1 and modulates alternative splicing regulation. J Cell Biol 149:307- 16. 250. Virshup, D. M. 2000. Protein phosphatase 2A: a panoply of enzymes. Curr Opin Cell Biol 12:180-5. 251. Virtanen, A., P. Gilardi, A. Naslund, J. M. LeMoullec, U. Pettersson, and M. Perricaudet. 1984. mRNAs from human adenovirus 2 early region 4. J Virol 51:822-31. 252. Wagner, E. J., and M. A. Garcia-Blanco. 2001. Polypyrimidine tract binding protein antagonizes exon definition. Mol Cell Biol 21:3281-8.

253. Wang, J., and J. L. Manley. 1995. Overexpression of the SR proteins ASF/SF2 and SC35 influences alternative splicing in vivo in diverse ways. Rna 1:335-46. 254. Wang, J., Y. Takagaki, and J. L. Manley. 1996. Targeted disruption of an essential vertebrate gene: ASF/SF2 is required for cell viability. Genes Dev 10:2588-99. 255a. Wang, J., S. H. Xiao, and J. L. Manley. 1998. Genetic analysis of the SR protein ASF/SF2: interchangeability of RS domains and negative control of splicing. Genes Dev 12:2222-33.

255b. Wang, H.Y., Lin, W., Dyck, J.A., Yeakley, J.M., Songyang, Z., Cantley, L.C. and X.D. Fu. 1998. SRPK2: a differentially expressed SR protein specific kinase involved in mediating the interaction and localisation of pre-mRNA splicing factors in mammalian cells. J Cell Biol. 140:737-50. 255c. Wang, C., Chua, K., Seghezzi, W., Lees, E., Gozani, O. and R. Reed. 1998. Phosphorylation of spliceosomal protein SAP 155 coupled with splicing catalysis. Genes Dev 12:1409-1414. 256. Weinberg, D. H., and G. Ketner. 1986. Adenoviral early region 4 is required for efficient viral DNA replication and for late gene expression. J Virol 57:833-8. 257. Will, C. L., and R. Luhrmann. 2001. Spliceosomal UsnRNP biogenesis, structure and function. Curr Opin Cell Biol 13:290-301. 258. Will, C. L., C. Schneider, A. M. MacMillan, N. F. Katopodis, G. Neubauer, M. Wilm, R. Luhrmann, and C. C. Query. 2001. A novel U2 and U11/U12 snRNP protein that associates with the pre-mRNA branch site. Embo J 20:4536-46. 259. Wu, J. Y., and T. Maniatis. 1993. Specific interactions between proteins implicated in splice site selection and regulated alternative splicing. Cell 75:1061-70. 260. Wu, S., C. M. Romfo, T. W. Nilsen, and M. R. Green. 1999. Functional recognition of the 3' splice site AG by the splicing factor U2AF35. Nature 402:832-5. 261. Xiang, J., D. T. Chao, and S. J. Korsmeyer. 1996. BAX-induced cell death may not require interleukin 1 beta-converting enzyme-like proteases. Proc Natl Acad Sci U S A 93:14559-63. 262. Xiao, S. H., and J. L. Manley. 1997. Phosphorylation of the ASF/SF2 RS domain affects both protein-protein and protein-RNA interactions and is necessary for splicing. Genes Dev 11:334-44. 263. Xiao, S. H., and J. L. Manley. 1998. Phosphorylation-dephosphorylation differentially affects activities of splicing factor ASF/SF2. Embo J 17:6359-67. 264. Yan, Y., J. W. Shay, W. E. Wright, and M. C. Mumby. 1997. Inhibition of protein phosphatase activity induces p53-dependent apoptosis in the absence of p53 transactivation. J Biol Chem 272:15220-6. 265. Yang, S. I., R. L. Lickteig, R. Estes, K. Rundell, G. Walter, and M. C. Mumby. 1991. Control of protein phosphatase 2A by simian virus 40 small-t antigen. Mol Cell Biol 11:1988- 95. 266. Yu, L., P. M. Loewenstein, Z. Zhang, and M. Green. 1995. In vitro interaction of the human immunodeficiency virus type 1 Tat transactivator and the general transcription factor TFIIB with the cellular protein TAP. J Virol 69:3017-23. 267. Yu, Y., E. C. Scharl, C. M. Smith, and J. A. Steitz. 1999. The growing world of small nuclear ribonucleoproteins, p. 487-524. In R. F. Gesteland, T. R. Cech, and J. F. Atkins (ed.), THE RNA WORLD, vol. Second Edition. Cold Spring Harbor Laboratory Press, CSH, New York. 268. Yuryev, A., M. Patturajan, Y. Litingtung, R. V. Joshi, C. Gentile, M. Gebara, and J. L. Corden. 1996. The C-terminal domain of the largest subunit of RNA polymerase II interacts with a novel set of serine/arginine-rich proteins. Proc Natl Acad Sci U S A 93:6975-80.

63 269. Zahler, A. M., W. S. Lane, J. A. Stolk, and M. B. Roth. 1992. SR proteins: a conserved family of pre-mRNA splicing factors. Genes Dev 6:837-47. 270. Zahler, A. M., K. M. Neugebauer, W. S. Lane, and M. B. Roth. 1993. Distinct functions of SR proteins in alternative pre-mRNA splicing. Science 260:219-22. 271. Zahler, A. M., and M. B. Roth. 1995. Distinct functions of SR proteins in recruitment of U1 small nuclear ribonucleoprotein to alternative 5' splice sites. Proc Natl Acad Sci U S A 92:2642-6. 272. Zamore, P. D., and M. R. Green. 1989. Identification, purification, and biochemical characterization of U2 small nuclear ribonucleoprotein auxiliary factor. Proc Natl Acad Sci U S A 86:9243-7. 273. Zamore, P. D., J. G. Patton, and M. R. Green. 1992. Cloning and domain structure of the mammalian splicing factor U2AF. Nature 355:609-14.

274. Zenklusen, D., and F. Stutz. 2001. Nuclear export of mRNA. FEBS Lett 498:150-6. 275. Zhang, L., W. Liu, and P. J. Grabowski. 1999. Coordinate repression of a trio of neuron- specific splicing events by the splicing regulator PTB. Rna 5:117-30. 276. Zhang, M., P. D. Zamore, M. Carmo-Fonseca, A. I. Lamond, and M. R. Green. 1992. Cloning and intracellular localization of the U2 small nuclear ribonucleoprotein auxiliary factor small subunit. Proc Natl Acad Sci U S A 89:8769-73.

277. Zhang, W. J., and J. Y. Wu. 1996. Functional properties of p54, a novel SR protein active in constitutive and alternative splicing. Mol Cell Biol 16:5400-8. 278. Zhang, W. J., and J. Y. Wu. 1998. Sip1, a novel RS domain-containing protein essential for pre-mRNA splicing. Mol Cell Biol 18:676-84. 279. Zhao, J., L. Hyman, and C. Moore. 1999. Formation of mRNA 3' ends in eukaryotes: mechanism, regulation, and interrelationships with other steps in mRNA synthesis. Microbiol Mol Biol Rev 63:405-45. 280. Zhao, Y., G. Boguslawski, R. S. Zitomer, and A. A. DePaoli-Roach. 1997. Saccharomyces cerevisiae homologs of mammalian B and B' subunits of protein phosphatase 2A direct the enzyme to distinct cellular functions. J Biol Chem 272:8256-62. 281. Zheng, Z. M., P. J. He, and C. C. Baker. 1997. Structural, functional, and protein binding analyses of bovine papillomavirus type 1 exonic splicing enhancers. J Virol 71:9096-107. 282. Zheng, Z. M., M. Huynen, and C. C. Baker. 1998. A pyrimidine-rich exonic splicing suppressor binds multiple RNA splicing factors and inhibits spliceosome assembly. Proc Natl Acad Sci U S A 95:14088-93. 283. Zhou, Z., M. J. Luo, K. Straesser, J. Katahira, E. Hurt, and R. Reed. 2000. The protein Aly links pre-messenger-RNA splicing to nuclear export in metazoans. Nature 407:401-5. 284. Zhu, J., and A. R. Krainer. 2000. Pre-mRNA splicing in the absence of an SR protein RS domain. Genes Dev 14:3166-78. 285. Zorio, D. A., and T. Blumenthal. 1999. Both subunits of U2AF recognize the 3' splice site in Caenorhabditis elegans. Nature 402:835-8. 286. Zuo, P., and T. Maniatis. 1996. The splicing factor U2AF35 mediates critical protein-protein interactions in constitutive and enhancer-dependent splicing. Genes Dev 10:1356-68. 287. Zuo, P., and J. L. Manley. 1994. The human splicing factor ASF/SF2 can specifically recognize pre-mRNA 5' splice sites. Proc Natl Acad Sci U S A 91:3363-7.

64 Bemöda dig icke om att veta allt, ty då blir du okunnig om allt. Demokritos