DOCSLIB.ORG

NF-Y Controls Fidelity of Transcription Initiation at Gene Promoters

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
NF-Y Controls Fidelity of Transcription Initiation at Gene Promoters ARTICLE https://doi.org/10.1038/s41467-019-10905-7 OPEN NF-Y controls fidelity of transcription initiation at gene promoters through maintenance of the nucleosome-depleted region Andrew J. Oldfield 1,6, Telmo Henriques1,2,8, Dhirendra Kumar1,8, Adam B. Burkholder3,8, Senthilkumar Cinghu1, Damien Paulet4,5, Brian D. Bennett3, Pengyi Yang 1,7, Benjamin S. Scruggs1, Christopher A. Lavender3, Eric Rivals 4,5, Karen Adelman1,2 & Raja Jothi1 1234567890():,; Faithful transcription initiation is critical for accurate gene expression, yet the mechanisms underlying specific transcription start site (TSS) selection in mammals remain unclear. Here, we show that the histone-fold domain protein NF-Y, a ubiquitously expressed transcription factor, controls the fidelity of transcription initiation at gene promoters in mouse embryonic stem cells. We report that NF-Y maintains the region upstream of TSSs in a nucleosome- depleted state while simultaneously protecting this accessible region against aberrant and/or ectopic transcription initiation. We find that loss of NF-Y binding in mammalian cells disrupts the promoter chromatin landscape, leading to nucleosomal encroachment over the canonical TSS. Importantly, this chromatin rearrangement is accompanied by upstream relocation of the transcription pre-initiation complex and ectopic transcription initiation. Further, this phenomenon generates aberrant extended transcripts that undergo translation, disrupting gene expression profiles. These results suggest NF-Y is a central player in TSS selection in metazoans and highlight the deleterious consequences of inaccurate transcription initiation. 1 Epigenetics and Stem Cell Biology Laboratory, National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, Durham, NC 27709, USA. 2 Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA 02115, USA. 3 Integrative Bioinformatics Support Group, National Institute of Environmental Health Sciences, National Institutes of Health, Research Triangle Park, Durham, NC 27709, USA. 4 Department of Computer Science, LIRMM, CNRS et Université de Montpellier, Montpellier 34095, France. 5 Institut de Biologie Computationnelle (IBC), Université de Montpellier, Montpellier 34095, France. 6Present address: Institute of Human Genetics, CNRS, University of Montpellier, Montpellier 34396, France. 7Present address: Charles Perkins Centre and School of Mathematics and Statistics, University of Sydney, Sydney NSW 2006, Australia. 8These authors contributed equally: Telmo Henriques, Dhirendra Kumar, Adam B. Burkholder. Correspondence and requests for materials should be addressed to A.J.O. (email: andrew.oldfi[email protected]) or to K.A. (email: [email protected]) or to R.J. (email: [email protected]) NATURE COMMUNICATIONS | (2019) 10:3072 | https://doi.org/10.1038/s41467-019-10905-7 | www.nature.com/naturecommunications 1 ARTICLE NATURE COMMUNICATIONS | https://doi.org/10.1038/s41467-019-10905-7 hile the sequence, structure, and binding partners of Results gene promoters have been intensely scrutinized for NF-Y promotes chromatin accessibility at gene promoters. Our W 1 nearly half a century , how the cell discerns when and previous characterization of NF-Y-binding sites in ESCs revealed where to initiate transcription is still not fully understood2. that a majority of these binding sites are located within 500 base Recent studies have established basic rules regarding spatial pairs (bp) of annotated TSSs of protein-coding genes24. Further arrangements of cis-regulatory elements, ordered recruitment of analysis of our NF-Y ChIP-Seq data revealed a positional bias, general transcription factors (GTFs) for transcription pre- with nearly all of the NF-Y-binding sites located immediately initiation complex (PIC) formation, and the role of chromatin upstream (median distance 94 bp) of the TSS (Fig. 1a, b) and a in defining the promoter environment3–8. One key determinant positive correlation between NF-YA occupancy and CCAAT of active gene promoters is the requirement for an accessible motif occurrence (Fig. 1b, c; Supplementary Fig. 1a–c). To transcription initiation/start site (TSS), characterized by a investigate whether NF-Y promotes chromatin accessibility at nucleosome-depleted region (NDR) flanked by two well- proximal promoters, as it does at distal enhancers24, we used positioned nucleosomes (the −1 and +1 nucleosomes)9. small interfering RNA (siRNA) to knockdown (KD) the DNA- Within the NDR, several core promoter elements such as the binding subunit NF-YA in ESCs (Supplementary Fig. 1d, e) and TATA box and the initiator (Inr) element exhibit a positional bias assessed DNase I hypersensitivity at candidate promoters, either relative to the TSS10,11 and play important roles in TSS selection. bound or not bound by NF-Y. Quantitative assessment of the However, the core promoter elements vary from one promoter to relative “openness” of the probed regions revealed that depletion the next and can be either absent or present multiple times within of NF-YA results in a significant reduction in DNA accessibility a single NDR, suggesting that these elements are not the sole at promoters bound by NF-Y, but not at promoters without NF-Y determinants of TSS selection. Thus, how the RNA Polymerase II binding (Fig. 1d; Supplementary Fig. 1f, g). In agreement with (Pol II) chooses one transcription initiation site over another this, genome-wide assessment of chromatin accessibility using remains unclear. In yeast, mutational studies have identified ATAC-Seq confirmed loss in ATAC signal that is specificto several GTFs and other accessory factors with key roles in TSS promoters targeted by NF-Y (Fig. 1e, f; Supplementary Fig. 1h, i). selection12–18. However, despite greater specificity in TSS selec- These data suggest that NF-Y helps maintain accessible chro- tion in metazoans, such accessory factors have yet to be described matin at promoters. in higher eukaryotes. NF-Y, also known as the CCAAT-binding factor CBF, is a NF-Y binding protects NDRs from nucleosome encroachment. highly conserved and ubiquitously expressed heterotrimeric To further explore the role of NF-Y binding at promoters, we transcription factor (TF) composed of the NF-YA, NF-YB, and mapped nucleosomes using micrococcal nuclease (MNase) NF-YC subunits, all three of which are necessary for stable DNA – digestion followed by high-throughput sequencing (MNase-Seq). binding of the complex19 23. NF-YA, which harbors both DNA- Our data revealed that NF-Y-binding sites genome-wide are binding and transactivation domains, makes sequence-specific depleted of nucleosomes (Fig. 1g; Supplementary Fig. 2a). DNA contacts, whereas the histone-fold domain (HFD) con- Focusing on NF-Y-bound promoter regions, we noted a strong taining NF-YB and NF-YC interact with DNA via nonspecific anti-correlation between NF-Y and nucleosome occupancy HFD-DNA contacts22,23. The structure and DNA-binding mode (Fig. 1b, g). To determine whether NF-Y binding plays a direct of NF-YB/NF-YC HFDs are similar to those of the core histones role in occluding nucleosomes at its binding sites, we performed H2A/H2B, TATA-binding protein (TBP)-associated factors MNase-Seq in NF-YA-depleted cells. Examination of the (TAFs), the TBP/TATA-binding negative cofactor 2 (NC2α/β), nucleosomal landscape at candidate NF-Y target promoters in and the CHRAC15/CHRAC17 subunits of the nucleosome NF-Y-depleted cells revealed a striking gain of a nucleosome(s) remodeling complex CHRAC22. within what was previously a well-defined NDR (Fig. 1e, h), an NF-Y has an established role in gene regulation through cell observation we confirmed by both MNase-qPCR (Fig. 1i) and type-invariant promoter-proximal binding24,25. However, the histone H3 ChIP-qPCR analyses (Supplementary Fig. 2b). mechanisms through which NF-Y influences gene expression Genome-wide gain of ectopic nucleosome(s) within the NDR remain unclear. Several lines of evidence have pointed toward a upon NF-YA KD is observed specifically at NF-Y bound pro- possible role in the recruitment of chromatin modifiers and/or moters (Fig. 1h), rather than non-NF-Y-bound promoters (Sup- the PIC to the promoters of its target genes (for a review, see plementary Fig. 2d), suggesting a direct effect. Interestingly, Dolfini et al.20). Previously, we reported a critical role for NF-Y in ectopic nucleosomes observed in NF-YA-depleted cells overlap facilitating a permissive chromatin conformation at cell type- the TSS of NF-Y bound genes (Fig. 1e, h; Supplementary Fig. 2d), specific distal enhancers to enable master transcription factor suggesting that NF-Y binding could protect the TSS from inhi- binding24. Here, we investigate the role NF-Y plays at gene bitory nucleosome binding. Moreover, this ectopic nucleosome promoters, what effect it may have on chromatin accessibility and positioning in NF-Y-depleted cells is consistent with sequence- recruitment of the transcription machinery, and how this might based predictions of nucleosome binding preference at these impact gene expression. regions26 (Supplementary Fig. 2e). Altogether, these data suggest Through genome-wide studies in mouse embryonic stem a role for NF-Y binding at gene promoters in protecting the NDR cells (ESCs), we find that NF-Y is essential for the maintenance and the TSS from nucleosome encroachment and that in NF-Y’s of the NDR at gene promoters. Depletion of the NF-YA protein absence, nucleosomes are able to bind within this region. leads to the
Load more

Recommended publications
  • Detection of Interacting Transcription Factors in Human Tissues Using
    Myšičková and Vingron BMC Genomics 2012, 13(Suppl 1):S2 http://www.biomedcentral.com/1471-2164/13/S1/S2 PROCEEDINGS Open Access Detection of interacting transcription factors in human tissues using predicted DNA binding affinity Alena Myšičková*, Martin Vingron From The Tenth Asia Pacific Bioinformatics Conference (APBC 2012) Melbourne, Australia. 17-19 January 2012 Abstract Background: Tissue-specific gene expression is generally regulated by combinatorial interactions among transcription factors (TFs) which bind to the DNA. Despite this known fact, previous discoveries of the mechanism that controls gene expression usually consider only a single TF. Results: We provide a prediction of interacting TFs in 22 human tissues based on their DNA-binding affinity in promoter regions. We analyze all possible pairs of 130 vertebrate TFs from the JASPAR database. First, all human promoter regions are scanned for single TF-DNA binding affinities with TRAP and for each TF a ranked list of all promoters ordered by the binding affinity is created. We then study the similarity of the ranked lists and detect candidates for TF-TF interaction by applying a partial independence test for multiway contingency tables. Our candidates are validated by both known protein-protein interactions (PPIs) and known gene regulation mechanisms in the selected tissue. We find that the known PPIs are significantly enriched in the groups of our predicted TF-TF interactions (2 and 7 times more common than expected by chance). In addition, the predicted interacting TFs for studied tissues (liver, muscle, hematopoietic stem cell) are supported in literature to be active regulators or to be expressed in the corresponding tissue.
    [Show full text]
  • Allele-Specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish
    Allele-specific Expression of Ribosomal Protein Genes in Interspecific Hybrid Catfish by Ailu Chen A dissertation submitted to the Graduate Faculty of Auburn University in partial fulfillment of the requirements for the Degree of Doctor of Philosophy Auburn, Alabama August 1, 2015 Keywords: catfish, interspecific hybrids, allele-specific expression, ribosomal protein Copyright 2015 by Ailu Chen Approved by Zhanjiang Liu, Chair, Professor, School of Fisheries, Aquaculture and Aquatic Sciences Nannan Liu, Professor, Entomology and Plant Pathology Eric Peatman, Associate Professor, School of Fisheries, Aquaculture and Aquatic Sciences Aaron M. Rashotte, Associate Professor, Biological Sciences Abstract Interspecific hybridization results in a vast reservoir of allelic variations, which may potentially contribute to phenotypical enhancement in the hybrids. Whether the allelic variations are related to the downstream phenotypic differences of interspecific hybrid is still an open question. The recently developed genome-wide allele-specific approaches that harness high- throughput sequencing technology allow direct quantification of allelic variations and gene expression patterns. In this work, I investigated allele-specific expression (ASE) pattern using RNA-Seq datasets generated from interspecific catfish hybrids. The objective of the study is to determine the ASE genes and pathways in which they are involved. Specifically, my study investigated ASE-SNPs, ASE-genes, parent-of-origins of ASE allele and how ASE would possibly contribute to heterosis. My data showed that ASE was operating in the interspecific catfish system. Of the 66,251 and 177,841 SNPs identified from the datasets of the liver and gill, 5,420 (8.2%) and 13,390 (7.5%) SNPs were identified as significant ASE-SNPs, respectively.
    [Show full text]
  • Huntington's Disease Mice and Human Brain Tissue Exhibit Increased
    Huntington’s disease mice and human brain tissue exhibit increased G3BP1 granules and TDP43 mislocalization Isabella I. Sanchez, … , Robert C. Spitale, Leslie M. Thompson J Clin Invest. 2021. https://doi.org/10.1172/JCI140723. Research In-Press Preview Neuroscience Chronic cellular stress associated with neurodegenerative disease can result in the persistence of stress granule (SG) structures, membraneless organelles that form in response to cellular stress. In Huntington’s disease (HD), chronic expression of mutant huntingtin generates various forms of cellular stress, including activation of the unfolded protein response and oxidative stress. However, it has yet to be determined whether SGs are a feature of HD neuropathology. We examined the miRNA composition of extracellular vesicles (EVs) present in the cerebrospinal fluid (CSF) of HD patients and show that a subset of their target mRNAs were differentially expressed in the prefrontal cortex of HD patients. Of these targets, SG components were enriched, including the SG nucleating Ras GTPase-activating protein- binding protein 1 (G3BP1). We investigated localization and levels of G3BP1 and found a significant increase in the density of G3BP1-positive granules in the cortex and hippocampus of R6/2 transgenic mice and in the superior frontal cortex of HD patient brains. Intriguingly, we also observed that the SG-associated TAR DNA-Binding Protein-43 (TDP43), a nuclear RNA/DNA binding protein, was mislocalized to the cytoplasm of G3BP1-granule positive HD cortical neurons. These findings suggest that G3BP1 SG dynamics may play a role in the pathophysiology of HD. Find the latest version: https://jci.me/140723/pdf 140723-JCI-RG-RV-3 Huntington’s disease mice and human brain tissue exhibit increased G3BP1 granules and TDP43 mislocalization Isabella I.
    [Show full text]
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Tolerance to Sustained Activation of the Camp/Creb Pathway Activity in Osteoblastic Cells Is Enabled by Loss of P53 Mannu K
    Walia et al. Cell Death and Disease (2018) 9:844 DOI 10.1038/s41419-018-0944-8 Cell Death & Disease ARTICLE Open Access Tolerance to sustained activation of the cAMP/Creb pathway activity in osteoblastic cells is enabled by loss of p53 Mannu K. Walia1, Scott Taylor1,PatriciaW.M.Ho1,T.JohnMartin1,2 and Carl R. Walkley 1,2,3 Abstract The loss of p53 function is a central event in the genesis of osteosarcoma (OS). How mutation of p53 enables OS development from osteoblastic lineage cells is poorly understood. We and others have reported a key role for elevated and persistent activation of the cAMP/PKA/Creb1 pathway in maintenance of OS. In view of the osteoblast lineage being the cell of origin of OS, we sought to determine how these pathways interact within the context of the normal osteoblast. Normal osteoblasts (p53 WT) rapidly underwent apoptosis in response to acute elevation of cAMP levels or activity, whereas p53-deficient osteoblasts tolerated this aberrant cAMP/Creb level and activity. Using the p53 activating small-molecule Nutlin-3a and cAMP/Creb1 activator forskolin, we addressed the question of how p53 responds to the activation of cAMP. We observed that p53 acts dominantly to protect cells from excessive cAMP accumulation. We identify a Creb1-Cbp complex that functions together with and interacts with p53. Finally, translating these results we find that a selective small-molecule inhibitor of the Creb1-Cbp interaction demonstrates selective toxicity to OS cells where this pathway is constitutively active. This highlights the cAMP/Creb axis as a potentially actionable therapeutic vulnerability in p53-deficient tumors such as OS.
    [Show full text]
  • Nucleolin and Its Role in Ribosomal Biogenesis
    NUCLEOLIN: A NUCLEOLAR RNA-BINDING PROTEIN INVOLVED IN RIBOSOME BIOGENESIS Inaugural-Dissertation zur Erlangung des Doktorgrades der Mathematisch-Naturwissenschaftlichen Fakultät der Heinrich-Heine-Universität Düsseldorf vorgelegt von Julia Fremerey aus Hamburg Düsseldorf, April 2016 2 Gedruckt mit der Genehmigung der Mathematisch-Naturwissenschaftlichen Fakultät der Heinrich-Heine-Universität Düsseldorf Referent: Prof. Dr. A. Borkhardt Korreferent: Prof. Dr. H. Schwender Tag der mündlichen Prüfung: 20.07.2016 3 Die vorgelegte Arbeit wurde von Juli 2012 bis März 2016 in der Klinik für Kinder- Onkologie, -Hämatologie und Klinische Immunologie des Universitätsklinikums Düsseldorf unter Anleitung von Prof. Dr. A. Borkhardt und in Kooperation mit dem ‚Laboratory of RNA Molecular Biology‘ an der Rockefeller Universität unter Anleitung von Prof. Dr. T. Tuschl angefertigt. 4 Dedicated to my family TABLE OF CONTENTS 5 TABLE OF CONTENTS TABLE OF CONTENTS ............................................................................................... 5 LIST OF FIGURES ......................................................................................................10 LIST OF TABLES .......................................................................................................12 ABBREVIATION .........................................................................................................13 ABSTRACT ................................................................................................................19 ZUSAMMENFASSUNG
    [Show full text]
  • Comprehensive Array CGH of Normal Karyotype Myelodysplastic
    Leukemia (2011) 25, 387–399 & 2011 Macmillan Publishers Limited All rights reserved 0887-6924/11 www.nature.com/leu LEADING ARTICLE Comprehensive array CGH of normal karyotype myelodysplastic syndromes reveals hidden recurrent and individual genomic copy number alterations with prognostic relevance A Thiel1, M Beier1, D Ingenhag1, K Servan1, M Hein1, V Moeller1, B Betz1, B Hildebrandt1, C Evers1,3, U Germing2 and B Royer-Pokora1 1Institute of Human Genetics and Anthropology, Medical Faculty, Heinrich Heine University, Duesseldorf, Germany and 2Department of Hematology, Oncology and Clinical Immunology, Heinrich Heine University, Duesseldorf, Germany About 40% of patients with myelodysplastic syndromes (MDSs) 40–50% of MDS cases have a normal karyotype. MDS patients present with a normal karyotype, and they are facing different with a normal karyotype and low-risk clinical parameters are courses of disease. To advance the biological understanding often assigned into the IPSS low and intermediate-1 risk groups. and to find molecular prognostic markers, we performed a high- resolution oligonucleotide array study of 107 MDS patients In the absence of genetic or biological markers, prognostic (French American British) with a normal karyotype and clinical stratification of these patients is difficult. To better prognosticate follow-up through the Duesseldorf MDS registry. Recurrent these patients, new parameters to identify patients at higher risk hidden deletions overlapping with known cytogenetic aberra- are urgently needed. With the more recently introduced modern tions or sites of known tumor-associated genes were identi- technologies of whole-genome-wide surveys of genetic aberra- fied in 4q24 (TET2, 2x), 5q31.2 (2x), 7q22.1 (3x) and 21q22.12 tions, it is hoped that more insights into the biology of disease (RUNX1, 2x).
    [Show full text]
  • Supplementary Table
    Supporting information Additional Supporting Information may be found in the online version of this article: Supplementary Table S1: List of deregulated genes in serum of cancer patients in comparision to serum of healthy individuals (p < 0.05, logFC ≥ 1). ENTREZ Gene ID Symbol Gene Name logFC p-value q-value 8407 TAGLN2 transgelin 2 3,78 3,40E-07 0,0022 7035 TFPI tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 3,53 4,30E-05 0,022 28996 HIPK2 homeodomain interacting protein kinase 2 3,49 2,50E-06 0,0066 3690 ITGB3 integrin, beta 3 (platelet glycoprotein IIIa, antigen CD61) 3,48 0,00053 0,081 7035 TFPI tissue factor pathway inhibitor (lipoprotein-associated coagulation inhibitor) 3,45 1,80E-05 0,014 4900 NRGN neurogranin (protein kinase C substrate, RC3) 3,32 0,00012 0,037 10398 MYL9 myosin, light chain 9, regulatory 3,22 8,20E-06 0,011 3796 KIF2A kinesin heavy chain member 2A 3,14 0,00015 0,04 5476 CTSA cathepsin A 3,08 0,00015 0,04 6648 SOD2 superoxide dismutase 2, mitochondrial 3,07 4,20E-06 0,0077 2982 GUCY1A3 guanylate cyclase 1, soluble, alpha 3 3,07 0,0015 0,13 8459 TPST2 tyrosylprotein sulfotransferase 2 3,05 0,00043 0,074 2983 GUCY1B3 guanylate cyclase 1, soluble, beta 3 3,04 3,70E-05 0,021 145781 GCOM1 GRINL1A complex locus 3,02 0,00027 0,059 10611 PDLIM5 PDZ and LIM domain 5 2,87 1,80E-05 0,014 5567 PRKACB protein kinase, cAMP-dependent, catalytic, beta 2,85 0,0015 0,13 25907 TMEM158 transmembrane protein 158 (gene/pseudogene) 2,84 0,0068 0,27 8848 TSC22D1 TSC22 domain family, member 1 2,83 0,00058 0,084 26 351 APP amyloid beta (A4) precursor protein 2,82 0,00018 0,045 9240 PNMA1 paraneoplastic antigen MA1 2,78 0,00028 0,06 400073 C12orf76 chromosome 12 open reading frame 76 2,78 0,00069 0,091 649260 ILMN_35781 PREDICTED: Homo sapiens similar to LIM and senescent cell antigen-like domains 1 (LOC649260), mRNA.
    [Show full text]
  • 1 G3BP1 Tethers the TSC Complex to Lysosomes and Suppresses Mtorc1 in the Absence 1 of Stress Granules 2 Mirja T. Prentzell1-4,*
    bioRxiv preprint doi: https://doi.org/10.1101/2020.04.16.044081; this version posted October 29, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 G3BP1 tethers the TSC complex to lysosomes and suppresses mTORC1 in the absence 2 of stress granules 3 Mirja T. Prentzell1-4,*, Ulrike Rehbein2,5,*, Marti Cadena Sandoval2,6,*, Ann-Sofie De 4 Meulemeester7,*, Ralf Baumeister3,4,8, Laura Brohée9, Bianca Berdel1, Mathias Bockwoldt10, 5 Bernadette Carroll11, Andreas von Deimling12,, Constantinos Demetriades9,13, Gianluca 6 Figlia14,15, Alexander M. Heberle2,6, Ines Heiland10, Birgit Holzwarth3, Lukas A. Huber16,17, 7 Jacek Jaworski18, Katharina Kern1, Andrii Kopach18, Viktor I. Korolchuk19, Ineke van 't Land- 8 Kuper2,5, Matylda Macias18, Mark Nellist20, Stefan Pusch12, Michele Reil1, Anja Reintjes6, 9 Friederike Reuter1, Chloë Scheldeman7,21, Eduard Stefan6, Aurelio Teleman14,15, Omar Torres- 10 Quesada6, Saskia Trump22, Peter de Witte7, Teodor Yordanov16,23, Christiane A. Opitz1,24,|,§, 11 Kathrin Thedieck2,5,6,|,§ 12 13 1Brain Cancer Metabolism Group, German Consortium of Translational Cancer Research 14 (DKTK) & German Cancer Research Center (DKFZ), Heidelberg, Germany 15 2Department of Pediatrics, Section Systems Medicine of Metabolism and Signaling, University 16 of Groningen, University Medical Center Groningen, The Netherlands 17 3Department
    [Show full text]
  • Genetics of Gene Expression in Primary Immune Cells Identifies Cell
    ARTICLES Genetics of gene expression in primary immune cells identifies cell type–specific master regulators and roles of HLA alleles Benjamin P Fairfax1, Seiko Makino1, Jayachandran Radhakrishnan1, Katharine Plant1, Stephen Leslie2, Alexander Dilthey3, Peter Ellis4, Cordelia Langford4, Fredrik O Vannberg1,5 & Julian C Knight1 Trans-acting genetic variants have a substantial, albeit poorly characterized, role in the heritable determination of gene expression. Using paired purified primary monocytes and B cells, we identify new predominantly cell type–specific cis and trans expression quantitative trait loci (eQTLs), including multi-locus trans associations to LYZ and KLF4 in monocytes and B cells, respectively. Additionally, we observe a B cell–specific trans association of rs11171739 at 12q13.2, a known autoimmune disease locus, with IP6K2 (P = 5.8 × 10−15), PRIC285 (P = 3.0 × 10−10) and an upstream region of CDKN1A (P = 2 × 10−52), suggesting roles for cell cycle regulation and peroxisome proliferator-activated receptor γ (PPARγ) signaling in autoimmune pathogenesis. We also find that specific human leukocyte antigen (HLA) alleles form trans associations with the expression of AOAH and ARHGAP24 in monocytes but not in B cells. In summary, we show that mapping gene expression in defined primary cell populations identifies new cell type–specific trans-regulated networks and provides insights into the genetic basis of disease susceptibility. Defining the genetic determinants of gene expression is crucial to especially pertinent in the elucidation of trans-acting eQTLs, where understanding the biological and medical significance of genetic var- context specificity may be of greater relevance12. iation. This is particularly relevant in the drive to identify functional Here we sought to determine cell type–specific eQTLs relevant to variants underlying observed disease associations from genome- immunity and inflammation in paired samples of primary monocytes wide association studies (GWAS)1.
    [Show full text]
  • Human C7orf50 ORF Mammalian Expression Plasmid, C-Gfpspark Tag
    Human C7orf50 ORF mammalian expression plasmid, C-GFPSpark tag Catalog Number: HG14587-ACG General Information Plasmid Resuspension protocol Gene : chromosome 7 open reading frame 50 1. Centrifuge at 5,000×g for 5 min. Official Symbol : C7ORF50 2. Carefully open the tube and add 100 l of sterile water to Synonym : YCR016W dissolve the DNA. Source : Human 3. Close the tube and incubate for 10 minutes at room cDNA Size: 585bp temperature. RefSeq : BC006224 4. Briefly vortex the tube and then do a quick spin to Description concentrate the liquid at the bottom. Speed is less than Lot : Please refer to the label on the tube 5000×g. Vector : pCMV3-C-GFPSpark 5. Store the plasmid at -20 ℃. Shipping carrier : Each tube contains approximately 10 μg of lyophilized plasmid. The plasmid is ready for: Storage : • Restriction enzyme digestion The lyophilized plasmid can be stored at ambient temperature for three months. • PCR amplification Quality control : • E. coli transformation The plasmid is confirmed by full-length sequencing with primers • DNA sequencing in the sequencing primer list. Sequencing primer list : E.coli strains for transformation (recommended but not limited) pCMV3-F： 5’ CAGGTGTCCACTCCCAGGTCCAAG 3’ Most commercially available competent cells are appropriate for pcDNA3-R ： 5’ GGCAACTAGAAGGCACAGTCGAGG 3’ the plasmid, e.g. TOP10, DH5α and TOP10F´. Or Forward T7 ： 5’ TAATACGACTCACTATAGGG 3’ ReverseBGH ： 5’ TAGAAGGCACAGTCGAGG 3’ pCMV3-F and pcDNA3-R are designed by Sino Biological Inc. Customers can order the primer pair from any oligonucleotide supplier. Manufactured By Sino Biological Inc., FOR RESEARCH USE ONLY. NOT FOR USE IN HUMANS. Fax :+86-10-51029969 Tel:+86- 400-890-9989 http://www.sinobiological.com Human C7orf50 ORF mammalian expression plasmid, C-GFPSpark tag Catalog Number: HG14587-ACG Vector Information All of the pCMV vectors are designed for high-level stable and transient expression in mammalian hosts.
    [Show full text]
  • Molecular Pathogenesis and Regulation of the Mir-29-3P-Family: Involvement of ITGA6 and ITGB1 in Intra-Hepatic Cholangiocarcinoma
    cancers Article Molecular Pathogenesis and Regulation of the miR-29-3p-Family: Involvement of ITGA6 and ITGB1 in Intra-Hepatic Cholangiocarcinoma Yuto Hozaka 1 , Naohiko Seki 2,* , Takako Tanaka 1, Shunichi Asai 2, Shogo Moriya 3, Tetsuya Idichi 1, Masumi Wada 1, Kiyonori Tanoue 1, Yota Kawasaki 1, Yuko Mataki 1 , Hiroshi Kurahara 1 and Takao Ohtsuka 1 1 Department of Digestive Surgery, Breast and Thyroid Surgery, Graduate School of Medical and Dental Sciences, Kagoshima University, Kagoshima 890-8520, Japan; [email protected] (Y.H.); [email protected] (T.T.); [email protected] (T.I.); [email protected] (M.W.); [email protected] (K.T.); [email protected] (Y.K.); [email protected] (Y.M.); [email protected] (H.K.); [email protected] (T.O.) 2 Department of Functional Genomics, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan; [email protected] 3 Department of Biochemistry and Genetics, Graduate School of Medicine, Chiba University, Chiba 260-8670, Japan; [email protected] * Correspondence: [email protected]; Tel.: +81-43-226-2971 Simple Summary: Even today, there are no effective targeted therapies for intrahepatic cholan- giocarcinoma (ICC) patients. Clarifying the molecular pathogenesis of ICC will contribute to the Citation: Hozaka, Y.; Seki, N.; development of treatment strategies for this disease. In this study, we searched for the role of the Tanaka, T.; Asai, S.; Moriya, S.; Idichi, miR-29-3p-family and its association with oncogenic pathway. Interestingly, aberrant expression of T.; Wada, M.; Tanoue, K.; Kawasaki, ITGA6 and ITGB1 was directly regulated by the miR-29-3p-family which are involved in multiple Y.; Mataki, Y.; et al.
    [Show full text]