Evidence of Helicobacter Sp. in Dental Plaque of Captive Dolphins (Tursiops Gephyreus)

Journal of Wildlife Diseases, 38(3), 2002, pp. 644–648 ᭧ Wildlife Disease Association 2002

Evidence of Helicobacter sp. in Dental Plaque of Captive Dolphins (Tursiops gephyreus)

Cinthia G. Goldman,1,6 Julio D. Loureiro,2,3 Viviana Quse,2,3 Daniel Corach,4 Enrique Calderon,2 Ricardo A. Caro,1 JoseÂ Boccio,1 Sergio RodrõÂguez Heredia,2 Maria B. Di Carlo,5 and Marcela B. Zubillaga11 Radio- isotope Laboratory, School of Pharmacy and Biochemistry, University of Buenos Aires, Buenos Aires, Argentina; 2 Mundo Marino Foundation, San Clemente del TuyuÂ, Argentina; 3 Mundo Marino Oceanarium, San Clemente del TuyuÂ, Argentina; 4 DNA Fingerprint Gene Service and Genetics and Molecular Biology Department, School of Pharmacy and Biochemistry, University of Buenos Aires, Buenos Aires, Argentina; 5 Clinical Biochemistry Department, School of Pharmacy and Biochemistry, University of Buenos Aires, Buenos Aires, Argentina; 6 Cor- responding author (email: [email protected]) Downloaded from http://meridian.allenpress.com/jwd/article-pdf/38/3/644/2230356/0090-3558-38_3_644.pdf by guest on 14 April 2021

ABSTRACT: Gastrointestinal lesions have been ed that transmission of the infection to hu- extensively reported in wild and captive marine mans might occur (Fox et al., 1996). mammals. However, their etiology remains unclear. In humans and other animals, chronic Gastritis and peptic ulcers have been re- gastritis and peptic ulcers have been associated ported in wild dolphins and in marine with Helicobacter sp. Therefore, the aim of our mammals living in controlled environ- study was to investigate the presence of Heli- ments. In the southwest Atlantic Ocean, cobacter sp. in the gastric juice, dental plaque, digestive tract disease was reported in 20% and saliva of marine mammals living in a controlled environment. Five dolphins (Tursiops of the species of wild marine mammals ex- gephyreus), one killer whale (Orcinus orca), amined (Loureiro et al., 1996a), however, one false killer whale (Pseudorca crassidens), the etiology of those lesions was unclear. three sea lions (Otaria ﬂavescens), two ele- Stress, parasitic infections, consumption of phant seals (Mirounga leonina), and two fur seals (Arctocephalus australis) were studied. foreign objects, and/or high concentrations Saliva, dental plaque, and gastric juice samples of dietary histamine intake have been sug- were examined for Helicobacter sp. using poly- gested as causes (Sweeney and Ridgway, merase chain reaction. None of the gastric juice 1975). Recent isolation of Helicobacter sp. or saliva samples were positive for Helicobacter from gastric mucosa of dead dolphins sug- sp. However, Helicobacter sp. DNA was de- tected in dental plaque from two dolphins, suggests an infectious etiology for gastric ul- gesting the oral cavity might be a reservoir of cers in marine mammals (Harper et al., this bacterium. 2000). The aim of our study was to inves- Key words: Dental plaque, dolphins, gas- tigate the presence of Helicobacter sp. in tritis, Helicobacter, marine mammals, oral cavity. the gastric juice, saliva, and dental plaque of captive marine mammals with and with- Discovery of Helicobacter pylori in hu- out clinical signs compatible with gastritis. man gastric biopsies represented a revo- Thirteen marine mammals living in the lution in understanding gastroduodenal Mundo Marino Oceanarium (San Clemen- Њ Ј Њ Ј disease (Marshall and Warren, 1984) and te del Tuyu´ , Argentina; 36 18 S, 56 46 W) demonstrated that most of these condi- and one living in the Rehabilitation Centre tions are infectious diseases. Helicobacter of Mundo Marino Foundation (San Cle- pylori, a Gram negative, microaerophilic mente del Tuyu´ , Argentina) were studied bacterium, is involved in the development for the presence of Helicobacter sp. (Table of gastroduodenal lesions and is strongly 1). All animals except an elephant seal associated with gastric adenocarcinoma in (Mirounga leonina) from the Rehabilita- humans (Blaser, 1996; Dunn et al., 1997). tion Centre, had been trained for collec- Helicobacter pylori and other Helicobacter tion of medical samples. Animals at the spp. also occur in gastrointestinal lesions Oceanarium were clinically examined for 1 in animals (Fox and Lee, 1997; Neiger et yr prior to the start of this study. Clinical al., 1998). Isolation of H. pylori from fe- evaluation consisted of detailed observa- line gastric ﬂuid, saliva, and feces suggest- tions of behavior and periodic examination

644 SHORT COMMUNICATIONS 645

TABLE 1. Marine mammals studied and results of PCR on samples from the stomach and oral cavity.

PCR Age Weight Length resultsd Species (yr) Sexa (kg) (m) Gastritisb Samplec (DP)

Dolphin 15 F 296 3.07 Ϫ GJ, S, DP Ϫ (Tursiops gephyreus) 19 F 312 3.10 Ϫ GJ, S, DP Ϫ 5 M 306 2.80 ϩ GJ, S, DP ϩ 18 F 314 3.11 ϩ GJ, S, DP ϩ 19 M 420 3.20 Ϫ GJ, S, DP Ϫ Killer whale 11 M 2,300 5.30 Ϫ GJ, S, DP Ϫ (Orcinus orca) Downloaded from http://meridian.allenpress.com/jwd/article-pdf/38/3/644/2230356/0090-3558-38_3_644.pdf by guest on 14 April 2021 False killer whale 1 M ND 2.73 Ϫ GJ, S NDe (Pseudorca crassidens) Sea lion 8 F 97 1.70 Ϫ S ND (Otaria flavescens) 23 F 120 1.78 Ϫ GJ, S, DP Ϫ 15 F 104 1.80 Ϫ GJ, S ND Fur seal 17 M 84 1.62 Ϫ GJ, S, DP Ϫ (Arctocephalus australis 11 F 43 121 Ϫ GJ, S, DP Ϫ Elephant seal 17 M ND 3.71 Ϫ GJ, S, DP Ϫ (Mirounga leonina) 0.25 M 50 1.30 Ϫ GJ, S ND a F ϭ female, M ϭ male. b Clinical evidence of gastritis present (ϩ) or not present (Ϫ). c GJ ϭ gastric juice, S ϭ saliva, DP ϭ dental plaque. d Negative for all gastric juice and saliva samples. e ND ϭ not determined. of gastric contents to determine if clinical macroscopic, and microscopic examina- signs could be related to gastric disease tion. Gastric juice samples were then fil- (Table 1). Gastritis in cetaceans is charac- tered and immediately buffered to neutral terized by inappetence, lack of interaction pH with an equal volume of Tris/HCl (0.67 with other mammals and trainers, anorex- M, pH 7.4). Each neutralized gastric juice ia, abdominal tenderness, depression, and sample was concentrated by centrifugation occasional unresponsiveness (Sweeney and at 11,000ϫG and supernatants removed. Ridgway, 1975). In pinnipeds, the signs of Gastric juice pellets, saliva, and dental gastroduodenal inflammation include plaques received 0.5 ml of extraction buff- chronic variability in food intake, depres- er (10 mM Tris HCl [pH 7.4], 10 mM sion, reduction in activity, tucked-up body EDTA, 100 mM NaCl, 2% sodium lauryl posture while in water and on land, and sulphate) containing proteinase K (final reluctance to enter water (Sweeney, 1990). concentration 100 ␮g/ml), and the mix- Cetaceans were fasted for 14–16 hr and tures were incubated at 55 C overnight. pinnipeds for 8–14 hr before samples were For DNA extraction, an equal volume of taken. Saliva was collected from the oral phenol saturated in Tris HCl and stabilized cavity using sterile plastic pipettes and by with ␣-hydroxyquinaline was added and swabbing buccal mucosal surfaces with the samples were centrifuged at 3,500ϫG sterile cotton applicators. Dental plaque for 10 min. The upper aqueous layer was samples were removed from the tooth sur- recovered, and an equal volume of chlo- faces with a sterile periodontal curette. roform:isoamyl alcohol (24:1; vol/vol) was Gastric juice was aspirated from the stom- added. The samples were centrifuged at ach by gastric intubation. 3,500ϫG for an additional 10 min. To con- Samples were processed within 1 hr af- centrate DNA, the upper aqueous layer ter being collected. An aliquot of gastric was transferred into the sample reservoir juice was separated for physicochemical, of a Microcon௡-100 (Amicon, Millipore 646 JOURNAL OF WILDLIFE DISEASES, VOL. 38, NO. 3, JULY 2002

Corp., Bedford, Maryland, USA), follow- ing manufacturer’s instructions. Polymerase chain reaction (PCR) was carried out with two primers, EHC-U and EHC-L (Li et al., 1995), which ampliﬁed a 417 base pair fragment from 860-bp DNA of H. pylori. Its sequences (ex- pressed 5Ј to 3Ј) were as follows: EHC-U (CCCTCACGCCATCAGTCCCAAAAA) and EHC-L (AAGAAGTCAAAAACGC- FIGURE 1. Polymerase chain reaction products

from dental plaque samples from marine mammals Downloaded from http://meridian.allenpress.com/jwd/article-pdf/38/3/644/2230356/0090-3558-38_3_644.pdf by guest on 14 April 2021 CCCAAAAC). Amplification was carried ␮ using the primers EHC-U and EHC-L. Lane M: 100- out in a total volume of 30 l containing bp ladder, lane 1: Helicobacter pylori (ATCC PCR buffer (50 mM KCl, 10 mM Tris HCl 43504D) positive control, lane 2: negative control, [pH 9.0 at 25 C] and 0.1% Triton௡-X100), lanes 3–12: dental plaque samples from marine mam- 1.5 mM MgCl , 200 ␮M (each) deoxynu- mals examined in this study, lanes 5–6 from dolphins 2 (Tursiops gephyreus). cleotides, 0.75 U of Taq polymerase (Pro- mega Corp., Madison, Wisconsin, USA), 0.5 ␮M each oligonucleotide primer, and were positive for Helicobacter sp. DNA 10 ␮l of DNA template. Thirty cycles of (Fig. 1; Table 1). amplification were performed with an au- The primers EHC-U and EHC-L we tomatic thermal cycler (PCR 9600 System, used are considered highly specific for Applied Biosystems, Foster City, Califor- identification of H. pylori (Li et al., 1993, nia, USA). Each cycle consisted of a 45 sec 1995; Song et al., 1999). Nevertheless, denaturation step at 94 C, a 30 sec an- their specificity for H. pylori in animal nealing step at 59 C, and a 45 sec exten- species which may carry novel Helicobac- sion step at 72 C. The final cycle included ter spp. closely related to H. pylori has not extension for 10 min at 72 C to ensure full yet been determined. For this reason, fur- extension of the product. The completed ther research should be performed to con- reactions were analyzed by electrophoresis firm the species of Helicobacter found in of a 10 ␮l aliquot through 1.5% (wt/vol) the dental plaque of dolphins. agarose gel stained with ethidium bro- The positive PCR results from dental mide, and the bands were visualized by ex- plaque were obtained from dolphins with citation under UV light. Purified DNA clinical signs compatible with gastritis dur- from H. pylori (ATCC 43504D) was em- ing the year before this study was con- ployed as a positive control and it was am- ducted. These dolphins were receiving an plified as described above. As a negative antacid treatment. Negative results from control, a reaction mixture containing dis- the gastric juices are not surprising; ant- tilled water in place of the DNA sample acids may inhibit Helicobacter spp. growth was included with each batch. and PCR (Wadowsky et al., 1994; Nakao Color and pH of gastric juice samples and Malfertheiner, 1998). were in the normal range for each species The mode of transmission of H. pylori (Loureiro et al., 1996b). The gastric juice infection among humans remains unclear. samples were negative for parasites, and Due to the fact that H. pylori has been no evidence of inflammation or hemor- isolated from human saliva, dental plaque, rhage was observed by microscopic exam- and feces, oral-oral and fecal-oral trans- ination. mission have been suggested (Li et al., Gastric juice and saliva samples were 1996; Oshowo et al., 1998; Song et al., negative for Helicobacter sp. DNA by PCR 1999). The oral cavity may be a reservoir analysis. However, by PCR amplification of this bacterium (Thomas et al., 1997). two (20%) of 10 dental plaque samples However, other authors maintain that H. SHORT COMMUNICATIONS 647 pylori is present in the oral cavity due to supports oral transmission. Digestive Diseases regurgitation of contaminated gastric juice and Sciences 41: 2,142–2,149. LOUREIRO, J. D., R. BASTIDA,V.QUSE,F.COSTA,D. Hel- (Madinier et al., 1997). Our finding of RODRIGUEZ, AND V. R UOPPOLO. 1996a. Rehabi- icobacter sp. in dental plaque samples of litacioń y reintroduccioń de mamı´feros marinos dolphins suggests that an oral location of a trave´s de la Fundacioń Mundo Marino (San this bacterium might occur in species oth- Clemente del Tuyu´ , Argentina). Proceedings of er than humans. the VII Reunioń de Trabajo de Especialistas en Mamı´feros Acua´ticos de Ame´rica del Sur y I To our knowledge, this is the first report Congreso de la Sociedad Latinoamericana de Es- of Helicobacter sp. in the dental plaque of pecialistas en Mamı´feros Marinos (SOLAMAC), dolphins. More research is required to un- p. 108. derstand the role of Helicobacter sp. in ,V.QUSE, AND A. MOSCA. 1996b. Descripcioń Downloaded from http://meridian.allenpress.com/jwd/article-pdf/38/3/644/2230356/0090-3558-38_3_644.pdf by guest on 14 April 2021 gastrointestinal diseases in marine mam- de las principales enfermedades en mamı´feros marinos en el Centro de Rehabilitacioń de la mals and to clarify its role in the oral cav- Fundacioń Mundo Marino (San Clemente del ity. Tuyu´ , Argentina). Proceedings of the VII Re- We thank the team of Mundo Marino unioń de Trabajo de Especialistas en Mamı´feros Foundation, the trainers, and R. Lafuente Acua´ticos de Ame´rica del Sur y I Congreso de for their kind collaboration. la Sociedad Latinoamericana de Especialistas en Mamı´feros Marinos (SOLAMAC), p. 108. LITERATURE CITED MADINIER, I. M., T. M. FOSSE, AND R. A. MONTEIL. 1997. Oral carriage of Helicobacter pylori: A re- BLASER, M. 1996. The bacteria behind the ulcers. view. Journal of Periodontology 68: 2–6. Scientific American 274: 92–97. MARSHALL, B. J., AND J. R. WARREN. 1984. Uniden- DUNN, B. E., H. COHEN, AND M. J. BLASER. 1997. tified curved bacilli in the stomach of patients Helicobacter pylori. Clinical Microbiology Re- with gastritis and peptic ulceration. Lancet i: views 10: 720–741. 1311–1314. FOX, J. G., AND A. LEE. 1997. The role of Helico- NAKAO, M., AND P. M ALFERTHEINER. 1998. Growth bacter species in newly recognized gastrointesti- inhibitory and bactericidal activities of Lansopra- nal tract diseases of animals. Laboratory Animal zole compared with those of Omeprazole and Science 47: 222–255. Pantoprazole against Helicobacter pylori. Heli- ,S.PERKINS,L.YAN,Z.SHEN,L.ATTARDO, cobacter 3: 21–27. AND J. PAPPO. 1996. Local immune response in NEIGER, R., C. DIETERICH,A.BURNENS,A.WALD- Helicobacter pylori-infected cats and identifica- VOGEL,I.CORTHESY-THEULAZ,F.HALTER,B. tion of H. pylori in saliva, gastric fluid and faeces. LAUTERBURG, AND A. SCHMASSMANN. 1998. De- Immunology 88: 400–406. tection and prevalence of Helicobacter infection HARPER, C. M. G., C. A. DANGLER,S.XU,Y.FENG, in pet cats. Journal of Clinical Microbiology 36: Z. SHEN,B.SHEPPARD,A.STAMPER,F.E.DE- 634–637. WHIRST,B.J.PASTER, AND J. G. FOX. 2000. Iso- OSHOWO, A., D. GILLIAM,A.BOTHA,M.TUNIO,J. lation and characterization of a Helicobacter sp. HOLTON,P.BOULOS, AND M. HOBSLEY. 1998. from the gastric mucosa of dolphins, Lagenor- Helicobacter pylori: The mouth, stomach, and hynchus acutus and Delphinus delphis. Applied gut axis. Annals of Periodontology 3: 276–280. Environmental Microbiology 66: 4751–4757. SONG, Q., B. HALLER,R.M.SCHMID,G.ADLER, LI, C., D. A. FERGUSON JR., T. HA,D.S.CHI, AND AND G. BODE. 1999. Helicobacter pylori in den- E. THOMAS. 1993. A highly specific and sensitive tal plaque. A comparison of different PCR prim- DNA probe derived from chromosomal DNA of er sets. Digestive Diseases and Sciences 44: 479– Helicobacter pylori is useful for typing H. pylori 484. isolates. Journal of Clinical Microbiology 31: SWEENEY, J. 1990. Marine mammal behavioral diag- 2157–2162. nostics. In Handbook of marine mammal medi- ,P.R.MUSICH,T.HA,D.A.FERGUSON JR., cine: Health, disease, and rehabilitation, L. A. N. R. PATEL,D.S.CHI, AND E. THOMAS. 1995. Dierauf (ed.). CRC Press, Boca Raton, Florida, High prevalence of Helicobacter pylori in saliva pp. 53–72. demonstrated by a novel PCR assay. Journal of , AND S. H. RIDGWAY. 1975. Common diseas- Clinical Pathology 48: 662–666. es of small cetaceans. Journal of the American ,T.HA,D.A.FERGUSON,D.S.CHI,R.ZHAO, Veterinary Medical Association 167: 533–540. N. R. PATEL,G.KRISHNASWAMY, AND E. THOM- THOMAS, E., C. JIANG,D.S.CHI,C.LI, AND D. A. AS. 1996. A newly developed PCR assay of H. FERGUSON. 1997. The role of the oral cavity in pylori in gastric biopsy, saliva, and feces. Evi- Helicobacter pylori infection. The American dence of high prevalence of H. pylori in saliva Journal of Gastroenterology 92: 2148–2154. 648 JOURNAL OF WILDLIFE DISEASES, VOL. 38, NO. 3, JULY 2002

WADOWSKY, R. M., S. LAUS,T.LIBERT,S.J.STATES, nents of a nasopharyngeal swab. Journal of Clin- AND G. D. EHRLICH. 1994. Inhibition of PCR- ical Microbiology 32: 1054–1057. based assay for Bordetella pertussis by using cal- cium alginate ﬁber and aluminum shaft compo- Received for publication 7 March 2001. Downloaded from http://meridian.allenpress.com/jwd/article-pdf/38/3/644/2230356/0090-3558-38_3_644.pdf by guest on 14 April 2021