Systemin Regulates Both Systemic and Volatile Signaling in Tomato Plants

J Chem Ecol (2007) 33:669–681 DOI 10.1007/s10886-007-9254-9

G. Corrado & R. Sasso & M. Pasquariello & L. Iodice & A. Carretta & P. Cascone & L. Ariati & M. C. Digilio & E. Guerrieri & R. Rao

Received: 29 October 2006 /Revised: 16 December 2006 /Accepted: 17 January 2007 / Published online: 28 February 2007 # Springer Science + Business Media, LLC 2007

Abstract The prevailing reaction of plants to pest attack is the activation of various defense mechanisms. In tomato, several studies indicate that an 18 amino acid (aa) peptide, called systemin, is a primary signal for the systemic induction of direct resistance against plant-chewing pests, and that the transgenic expression of the prosystemin gene (encoding the 200 aa systemin precursor) activates genes involved in the plant response to herbivores. By using a combination of behavioral, chemical, and gene expression analyses, we report that systemin enhances the production of bioactive volatile compounds, increases plant attractivity towards parasitiod wasps, and activates genes involved in volatile production. Our data imply that systemin is involved in the systemic activation of indirect defense in tomato, and we conclude that a single gene controls the systemic activation of coordinated and associated responses against pests.

G. Corrado and R. Sasso contributed equally to the work G. Corrado : M. Pasquariello : P. Cascone : R. Rao (*) Dipartimento di Scienze del Suolo della Pianta e dell’Ambiente, Università degli Studi di Napoli “Federico II”, 80055, Portici, Naples, Italy e-mail: [email protected]

R. Sasso : E. Guerrieri (*) Istituto per la Protezione delle Piante Consiglio Nazionale delle Ricerche, Via Università n. 133, 80055, Portici, Naples, Italy e-mail: [email protected]

L. Iodice : M. C. Digilio Dipartimento di Entomologia e Zoologia Agraria, Università degli Studi di Napoli “Federico II”, Via Università n. 100, 80055, Portici, Naples, Italy

A. Carretta IDROCONS Srl, Strada Savonesa n. 9, PST, Rivalta Scrivia, Tortona, Alessandria, 15050, Italy

L. Ariati Dipartimento di Medicina Interna, Sezione Farmacologia e Tossicologia Cellulare e Molecolare, Università degli Studi di Pavia, Piazza Botta n. 10, 27100, Pavia, Italy 670 J Chem Ecol (2007) 33:669–681

Keywords Prosystemin . Volatile . Plant–insect interaction . Gene expression . Indirect defense

Introduction

A large number of the plant defenses against pests are inducible and avoid an unnecessary use of metabolic resources in the absence of recurring and frequent attack (Walling, 2000; Heil and Baldwin, 2002). The activation of defense mechanisms following insect attack leads to the production of several toxins and antifeedant proteins, which reduce the fitness of the invader (direct defense), and volatile organic compounds (VOCs), used by natural enemies of phytophagous insects as semiochemicals to locate their victims (indirect defense) (Stout et al., 2006). Interestingly, some direct defense strategies, particularly those that slow herbivore growth by reducing their digestive efficiency, may not increase the fitness of the plants under attack without a third trophic level because slow- growing insects will eat more plant material while completing their development (Kessler and Baldwin, 2002). Tomato plants and other Solanaceae respond to chewing insects and mechanical wounding by releasing a highly mobile peptide called systemin (Bergey et al., 1996; Schilmiller and Howe, 2005). In tomato, this 18-amino acid (aa) molecule is synthesized as a 200-aa precursor protein named prosystemin (McGurl and Ryan, 1992). After its proteolytic cleavage, the peptide binds a plasma membrane-bound receptor kinase (Scheer and Ryan, 2002). Subsequently, it is assumed that the signaling pathway proceeds via the activation of a phospholipase activity, with the release of linolenic acid and the formation of jasmonic acid (JA) and its derivative, methyl jasmonate (Bergey et al., 1996). Eventually, the transcriptional activation of a number of genes, yet to be fully identified, leads to an increase of compounds (i.e., proteinase inhibitors and polyphenoloxidase) that are directly toxic to phytophagous insects (Bergey et al., 1996). Currently, mutational evidence implies that long-distance defense signaling is transmitted mainly by JA as a wave travelling via a positive amplification loop that involves systemin release (Schilmiller and Howe, 2005). While it is widely accepted that systemin activates the wound response in undamaged parts of the plant (Ryan and Pearce, 2003), unexpectedly, its possible role in modulating ecological interactions has not been elucidated. In infested plants, it is necessary that a signal be transmitted from the site of damage to distal unwounded leaves to trigger synthesis and the release of VOCs because volatile compounds are synthesized de novo at the site of release (Paré and Tumlinson, 1998). However, it is not clear whether there is a signal specific for volatile production (Degenhardt et al., 2003). It has been proposed that at least some plant elicitors of defense genes are likely to boost effects broader than expected, possibly having the role to activate shared resistance responses (Walling, 2000), because for a plant, challenged by different invaders, it is less expensive to have signal transduction pathways that are involved in the coordinated response to pests (Walling, 2000; Kessler and Baldwin, 2002). Most of the knowledge about plant indirect defenses and the emission of volatiles attractive to parasitoids has been based on plant treatment with chemical elicitors such as JA (Thaler, 1999; Birkett et al., 2000; Howe, 2004; Cooper and Goggin, 2005). Although considerable progress has been made by using exogenously applied compounds, it has been pointed out that artificial chemical treatments rarely mimic natural responses in quantitative terms (Heil and Baldwin, 2002), and they elicit many physiological and morphological changes that are not related to resistance (Heil, 2002). Recently, the roles of some genes in J Chem Ecol (2007) 33:669–681 671 plant indirect defense mechanisms have been elucidated by direct genetic manipulation. Several studies have focused on the downregulation of gene expression, which results in the lowering of both volatile production and attractiveness towards predators and parasitoids (Vancanneyt et al., 2001; Kessler et al., 2004; Sanchez-Hernadez et al., 2006). Nonetheless, studies that aim at the identification of mechanisms that enhance direct and indirect plant defense are of greatest interest for plant biotechnology and integrated pest management (Degenhardt et al., 2003). Our aim was to investigate if the plant hormone systemin can increase indirect defense mechanisms via the transcriptional activation of genes involved in the production of volatile compounds. We report that the overexpression of the systemin precursor influences volatile signaling in tomato, indicating that a single plant hormone leads to the systemic activation of coordinated responses. These results support the model that the elicitation of multiple yet associated defensive pathways is likely to be advantageous and may be necessary if plants need to defend themselves adaptively from diverse insect species.

Methods and Material

Plants and Insects Transgenic tomato overexpressing the prosystemin cDNA under the control of the 35S RNA CaMV promoter (BBS) and control plants BB (Solanum lycopersicum cv. Better Boy) were as described (McGurl et al., 1994). Plants were grown in sterilized soil and maintained in controlled environmental chambers for 3 weeks from sowing at 26+1°C with a photoperiod of 16:8 hr light/dark. The aphid parasitoid Aphidius ervi Haliday was reared on one of its natural hosts, the pea aphid Acyrthosiphon pisum (Harris), maintained on potted broad bean (Vicia faba L.) cv. Aquadulce as described (Guerrieri et al., 2002). Aphid and parasitoid cultures were kept in separate environmental chambers at 20±1°C, 65±5% relative humidity, 18:6-hr light/dark photoperiod. Insect parasitoids for the flight behavior bioassays were reared as synchronized cohorts as reported (Guerrieri et al., 2002).

Flight Behavior Bioassay Towards Plants Flight behavior of A. ervi towards tomato plants was measured as relative attractiveness in a single-choice wind tunnel bioassay. Behavioral observations were carried out as described previously (Guerrieri et al., 2002), modified by using a larger experimental glass box (100×50×50 cm). One hundred and fifty parasitoid females were tested for each target by releasing them individually in the odor plume 35 cm downwind from the target. Each female was only used once. Parasitoids were observed for a maximum time of 10 min, and flight behavior data were recorded and analyzed with the aid of event-recording software (the Observer, Noldus Information Technology, Wageningen, the Netherlands). Behavioral experiments were conducted on several days, and targets were presented in a random order to reduce the effect of temporal variability on the results. In a wind tunnel bioassay, 10 uninfested plants of each BB and BBS were tested. The percentage of response (oriented flights, landings on the target) to each target was calculated. The number of parasitoids responding to each target in any experiment was compared by a G test for independence with William’s correction (Sokal and Rohlf, 1995). The resulting values of G were compared with the critical values of x2 (Rohlf and Sokal, 1995).

Volatile Collection and Identification All glassware, silicon, and Teflon connections were scrupulously clean and heated at 100°C overnight before use. Volatiles from BB and BBS plants were collected by an airtight entrainment system immediately after the wind-tunnel 672 J Chem Ecol (2007) 33:669–681 bioassay. Single plants were placed into bell jars (20 l) sealed with Parafilm and connected to a circulation pump whose flow was adjusted at 200 ml/min. Before reentering the pump, the air passed through an adsorbent trap made of Tenax (Cat. no. 226-336, SKC, Eighty Four, PA, USA) connected to the system by a Teflon-capped glass plug. In order to reduce any stress to the plant in the system, each collection lasted 3 hr. Air entrainment volatiles were separated by an integrated system including thermal desorber (Tekmar TD-800), gas chromatograph (column: RTX-200, 60 m, 0.25 mmID, 0.25 μm, carrier gas: He), and mass spectrometer. The resulting peaks were compared with 36 available standards (Appendix) and compound’s database (National Institute of Standards and Technology). The mean quantities of these compound collected from 10 plants of each BB and BBS were analyzed by ANOVA, and the resulting values of P were compared with the critical values of x2 (Rohlf and Sokal, 1995).

Flight Behavior Bioassay Towards Compounds After identification, commercial standards of the individual compounds that were overproduced by BBS plants were diluted in redistilled hexane and tested in a single choice wind tunnel bioassay. Each compound was tested at a concentration of 1 mg/ml. For each compound, a 50-μl solution was placed singly onto a small piece (3×1 cm) of filter paper (Whatman, no.1). This was inserted into an open-ended glass test tube (6×1 cm) with the end facing the parasitoid and surrounded by a green circular target to reduce any negative effect due to the absence of physical stimuli normally provided by the plant. A fresh aliquot of solution and a new piece of filter paper were used for each female parasitoid. A similar target, which was dosed with 50 μl redistilled hexane, served as control. One hundred and fifty parasitoid females were tested in a single-choice bioassay for each compound, under the same general conditions as those described above for the BB and BBS tests. Compounds were tested on different days in different sequences to eliminate any time variation. The percentage of response (oriented flights, landings on the target) to each compound was calculated and compared by a G test for independence with William’s correction (Sokal and Rohlf, 1995). The resulting values of G were compared with the critical values of x2 (Rohlf and Sokal, 1995).

RNA Isolation and Real-Time RT-PCR Total RNA was prepared from leaves as described (van Blokland et al., 1998) and subsequently treated with RNase-free DNase I (Amersham, Buckinghamshire, UK) to remove residual genomic DNA. First-strand cDNA was synthesized according to previously reported procedures (Corrado et al., 2005). Amplifi- cation of the cDNA coding for the Elongation Factor 1-α gene, a ubiquitously expressed gene (Shewmaker et al., 1990), served as control for cDNA synthesis and PCR efficiency in the different samples. Moreover, the sequences annealed by the two primers StEF fw and LeEF rv are localized in two contiguous exons for the detection of possible contaminant DNA in the PCR amplifications. Real-time PCRs were performed by using the ABI PRISM 7000 Sequence Detection System (Applied Biosystems, Foster City, CA, USA). Reactions (total volume of 25 μl) were prepared with 12.5 μl of the 2× SYBR Green PCR Master Kit (Applied Biosystems), 0.3 pmol of a primer pair, and 0.2 μl of cDNA template. Three independent amplifications were performed from each cDNA sample, and reactions were done in triplicates. The thermal cycling program started with a step of 2 min at 50°C and 10 min at 95°C, followed by 40 cycles of a 15 sec step at 95°C followed by 1 min at Ta indicated in Table 1. To check the specificity of the amplification products, a dissociation kinetics analysis was performed after each assay. Reaction products were also resolved onto an agarose gel to verify amplicon size. The primer pairs used and the size of the expected amplicons are shown in Table 1. Primers, designed with the aid of the Primer Express 2.0 J Chem Ecol (2007) 33:669–681 673

Table 1 Gene-specific primers used in real-time RT-PCR and relevant parameters

Primers Gene Sequence (5′ to 3′)%Amplicon Ta Accession GC Length (bp) Number

StEF fw EF 1-α GCTCCAGTGCTTGACTGTCAC 56 420 54 X53043 LeEF rv CACAACCTAATACACAACTC 40 BB-BBS fw Prosystemin GGGAGGGTGCACTAGAAATAA 47 110 51 M84800 BB-BBS rv TTGCATTTTGGGAGGATCACG 47 M84801 PcSISfw RT Prosystemin TCTGAATTTGTCTCCCGTTAGAA 39 142 58 M84801 PcSISrv RT AGCCAAAAGAAAGGAAGCAATAC 39 TomLoxCfw TomloxC TTGCCTATGGTGCTGAATGGA 48 101 58 U37839 TomLoxCrv CAAGCCATGTGGTTCATTTGG 48 TomLoxBfw TomloxB CAATCAGTTTGTTGTGCTTGT 52 101 58 U63118 TomLoxBrv AGACAATACAAGACAATACTC 52 HPL fw HPL CCAATCGCGGATCGATTAGAC 52 101 58 AF230372 HPL rv GGCACGTTCGTTCTGAAAACC 52 EF fw EF 1-α CAACCCTGACAAAATCCCCTTT 45 95 58 X14449 EF rv TTGGTCCCTTGTACCAGTCGAG 50 TomLoxDfw TomloxD TTCATGGCCGTGGTTGACA 52 103 58 U37840 TomLoxDrv AACAATCTCTGCATCTCCGG 52 GCS fw GCS TTGGTGAAGCCTTAACTCAGCC 50 101 58 035631 GCS rv GCAAATGGTGGTGTGCATCAT 48

%GC=percentage of G and C bases in the primer, Ta =experimental annealing temperature. software (Applied Biosystem) were chosen to amplify a fragment between 50 and 150 bp. Relative quantitation of gene expression was carried out using the 2ΔCT method (Livak and Schmittgen, 2001), where ΔCt ¼ Cttarget gene Ctreference gene. We used the housekeep- ing Elongation Factor 1-α gene (Shewmaker et al., 1990) as an endogenous reference gene for the normalization of the expression levels of the target genes. The statistical significance of the results was evaluated as already reported (Alfano et al., 2005).

Results

Effect of Prosystemin Overexpression on the Behavior of an Insect Parasitoid and VOC Production In a wind tunnel test, plants overexpressing the systemin precursor (BBS) proved to be significantly more attractive to naïve females of the aphid parasitoid A. ervi than untransformed control plants (BB) (Fig. 1). Nearly three times as many parasitoids oriented towards transformed plants and landed on them compared to controls. Remarkably, as parasitoids were never in contact with tomato plants before the assay, this response is innate. The GC-MS analysis of the volatiles collected from BBS and BB plants immediately after the wind-tunnel test revealed that systemin is involved in the production and/or release of biologically active VOC (Fig. 2). We recorded a significant increase in the total production of these compounds in BBS plants (92,974.1, vs. 35,633.6 ng collected from BB; P=0.03, df=1), and among them, eight were identified (the complete list of purified compounds used for identification is reported in the Appendix). Significant differences were not recorded in the production/release of (Z)-3-hexen-ol, 6-methyl-5- hepten-2-one, phellandrene, and trans-caryophyllene. In contrast, we collected significantly larger quantities of four monoterpenes from BBS plants, β-ocimene, α-pinene, β-myrcene/ 3-carene, and limonene (Fig. 3). To prove that these identified compounds overproduced by 674 J Chem Ecol (2007) 33:669–681

Fig. 1 Flight response (% of female showing oriented flights) 100 of the aphid parasitoid A. ervi towards tomato plants in a wind 80 tunnel bioassay (N=150, P<0.001) ** % 60 40 20 0 BB BBS

a 1200000

1000000

800000

600000

400000 5 200000 4 7 1 2 3 6 0 5 10 15 20 25 30 min b 1200000 5 1000000

800000 3 600000

400000 4 200000 7 1 6 2 0 5 10 15 20 25 30 min

Fig. 2 Chromatograms of volatile emissions collected by air-entrainment of head space from BB (a) and BBS (b) plants for 3 hr. Numbers indicate the identified peaks. 1, α-pinene; 2,(Z)-3-hexen-ol; 3, β-myrcene/ 3-carene; 4, limonene; 5, β-ocimene; 6, 6-methyl-5-hepten-2-one; 7, trans-β-caryophyllene J Chem Ecol (2007) 33:669–681 675 ng 1: -pinene ng 3: ß-myrcene/3-carene 100 800 80 * 600 * 60 400 40 200 20

0 0 BB BBS BB BBS

ng 4: limonene ng 5: ß-ocimene 1200 8000

1000 * 6000 ** 800

600 4000

400 2000 200 0 0 BB BBS BB BBS

Fig. 3 Quantitative differences of the emission of identified compounds released by BB and BBS plants. Each panel shows the mean quantity collected from 10 plants of each BB and BBS expressed in nanograms (single asterisks, P<0.05; double asterisks, P<0.01)

BBS plants affect the foraging behavior of the parasitoid A. ervi, we assayed α-pinene, β-myrcene, 3-carene, and limonene in a wind tunnel test. Each of these compounds elicited a significant higher proportion of oriented flights by this parasitoid in respect to bidistilled hexane, with α-pinene being the most attractive (Fig. 4).

Fig. 4 Flight response of A. ervi 30 towards pure volatile compounds a in a wind tunnel bioassay 25 expressed as percentage of females showing oriented flights 20 towards the target (N=150, different letters indicate a statisti- % 15 cal difference: a–b, P<0.001; b–c, P<0.01) 10 b b b 5 c 0 -pinene 3-carene ß-myrcene limonene hexane 676 J Chem Ecol (2007) 33:669–681

Expression Analysis Of Genes Involved In Indirect Defense And Volatile Production It has been shown that systemin overexpression increases the transcription of Lox genes (Bergey et al., 1996); yet, as there are at least four lipoxygenase in tomato (TomloxA, B, C, and D), their role has not been completely clarified in respect to defense mechanisms. We analyzed the expression level of TomloxC and TomloxD, as their gene products are targeted to chloroplasts, the proposed major site for fatty acid hydroperoxide metabolism. Real-time PCR experiments with gene-specific primers indicated that prosystemin overexpression associates with an increased level of expression of both TomloxC and TomloxD genes, implying that they have direct roles in plant defense and volatile production in leaves (Fig. 5). On the other hand, the transcription level of the TomloxB, which is not involved in the production of the known tomato flavor volatiles (Griffiths et al., 1999), was not affected (Fig. 5). Our results indicate that, in tomato, individual LOX isoforms are differentially regulated and should have distinct functions in systemin-mediated onset of direct and indirect defense mechanisms. The metabolism of linoleic and linolenic acids (the principal LOX substrates) is determined not only by the substrate and product specificities of the lipoxygenases but also by fatty acid hydroperoxide lyases (HPLs) (Matsui et al., 2001), important for the production of a vast class of VOC (Paré and Tumlinson, 1997). The analysis of the level of expression of the HPL indicated a moderate relative increase in the amount of transcripts in the BBS plants. Finally, as the analysis of volatile blend in transgenic plants indicated the presence of terpenoids, we also analyzed the expression of germacrene C synthase (GCS). This gene encodes one of the main enzymes responsible for the sesquiterpene synthase activity in tomato leaf (Colby et al., 1998). Our results indicated that prosystemin overexpression associates with increased levels of transcription of GCS C, a key gene involved in the production of terpenoid volatile compounds in tomato. Only recently has the systemin peptide been proposed as a promoter for long-distance defense responses by supporting the jasmonate production in vascular tissues. Hence, if an important role of the prosystemin gene is to generate and amplify a cell-to-cell signal to increase the production of phloem-mobile JAs, prosystemin transcription should be subject

Fig. 5 Relative gene expression by real-time PCR of genes involved in indirect defense against insects. For each gene, the graph displays the relative quantity of the target in BB (white columns) and in BBS (black columns). Quantities (RQ) are shown relative to the calibrator BB genotype. On the x-axis is reported the lists of the target genes analyzed. On the y-axis is reported the results of the relative quantification calculations. Relative quantities are graphed on a linear scale. Asterisks indicate that the Δ 2 Ct values were significantly different (P<0.01; Student’s t-test) J Chem Ecol (2007) 33:669–681 677

Relative gene expression

3 300 BB ** BB ** 2.5 BBS 250 BBS

2 200

1.5

RQ 150 RQ

1 100

0.5 50

0 0 Prosystemin (endog) Prosystemin Gene Gene

Fig. 6 Relative gene expression of prosystemin transcripts by real-time PCR. The graph displays the relative quantity of the target transcripts in BB (white columns) and in BBS (black columns). Left panel: primers were designed to amplify only the transcripts of the endogenous prosystemin gene. Right panel: primers were designed to amplify both the endogenous and the transgenic prosystemin transcripts. Quantity (RQ) is shown relative to the calibrator BB genotype. On the y-axis is reported the result of the relative quantification calculations on a linear scale. Asterisks indicate that the 2Δ Ct values were significantly different (P<0.01; Student’s t-test) to a positive enhancement to generate a transmissible signal. We investigated whether the transgenic expression of prosystemin cDNA has some transcriptional influence on the endogenous gene. For this purpose, we used two pairs of primers. The pair BB–BBS fw and BB–BBS rv anneals in a region shared by the transgene and the endogenous genes, and hence, they are able to amplify both transcripts. A relative quantification study based on real-time PCR experiments indicated that the amount of prosystemin transcripts in transgenic plants is much higher than in unwounded control plants, as expected. The primer PcSISrv RT anneals in a 3′ untranslated region that is absent in the transgenic prosystemin cDNA. This primer, in combination with the PcSISfw RT, can amplify only transcripts of the endogenous gene. A relative quantification study indicated that the expression of the endogenous prosystemin gene more than doubled in the transgenic BBS (Fig. 6). These experiments indicated that, despite the high level of defensive proteins in transgenic plants constitutively accumulating the systemin precursor, the prosystemin overexpression associates with an increase in the expression of the endogenous gene.

Discussion

The identification of genes that can be used to increase plant indirect defenses is of interest to understand plant biology and ecological relations and holds great promise for modern agricultural practices (Degenhardt et al., 2003). While there are different chemicals that, when exogenously applied, can influence tritrophic interactions, only a relatively reduced number of mutants with an altered production of some type of VOC have been identified (Kessler and Baldwin, 2002; Schilmiller and Howe, 2005). Many have obtained down- regulating gene expression by antisense technology (Vancanneyt et al., 2001; Kessler et al., 678 J Chem Ecol (2007) 33:669–681

2004; Sanchez-Hernadez et al., 2006). A straightforward approach towards the functional characterization of plant genes that can enhance indirect defenses is probably the analysis of genes that are naturally involved in the generation of response against pests. Because both direct and indirect defense should co-operate in nature to increase the fitness of the plants under attack, we investigated the role of prosystemin in tritrophic interactions. Different lines of evidence indicated that prosystemin overexpression associates with increased indirect defenses in tomato. Although we cannot exclude that additional factors, such as oral secretions, can influence, in a more complex way, plant gene expression and VOC production in undamaged leaves (Alborn et al., 1997; Maffei et al., 2004), our work indicates that the primary signal molecule systemin controls overlapping transduction pathways for different resistance mechanisms. The presence of a plant signal that coordinates the mounting of both direct and indirect defense implies that the attraction of a third trophic level is a relevant function of nonspecifically induced plant volatiles. This is in agreement with the finding that long-lasting mechanical wounding on defined leaf areas (in absence of herbivores) is sufficient for the emission of an herbivore-like VOC blend (Mithofer et al., 2005). The broad-role of systemin here described means that even pests completely devoid of salivary secretion or producing chemicals that are not recognized by the plant response systems would eventually trigger coordinated defense mechanisms. While it has been demonstrated previously that jasmonate-inducible plant defenses cause increased parasitism of herbivores (Thaler, 1999), our results indicate that the effects of nonspecifically induced volatiles are more complex than expected. The response of A. ervi to the VOC induced by prosystemin overexpression must be considered innate, as the parasitoids used in a wind tunnel bioassay were obtained from a different host and, thus, have never been in contact with tomato plants. It has been recently reported that tomato plants respond to biotic stresses altering the profile of VOC only in a quantitative way (Ament et al., 2004; Kant et al., 2004; Sanchez-Hernadez et al., 2006), and the effect of the systemin is consistent with those observations (see Fig. 2). All of the compounds that are overproduced/released by tomato plants that overexpress prosystemin seem to play a role in the attractiveness towards A. ervi. Apart from β-ocimene, which has been tested previously at the same concentration and that elicited a very high response (Birkett et al., 2000), among the four remaining compounds overproduced/released by BBS plants, α-pinene was the most active, followed by limonene, 3-carene, and β-myrcene (Fig. 4). The release of these compounds appears to be associated to plant responses to unspecific stresses, including aphid infestation (Sasso et al., unpublished), and this could explain the positive response recorded in an aphid parasitoid. Moreover, the lower attractiveness (expressed as percentage of oriented flights) that single compounds elicited in respect to the bioassay with plants, was expected as a consequence of the partition of the volatile bouquet. Furthermore, it is also possible that other unidentified peaks can also be involved in multitrophic interactions. As a consequence, for engineering volatile emission to make crop plants more attractive towards pests enemies, genes that code primary defensive signals may be preferred to those that control a single or a limited set of volatile compounds (Degenhardt et al., 2003). While our data are consistent with an important role for the octadecanoid-related pathways in enhancing multiple and associated response to pests (Walling, 2000; Schilmiller and Howe, 2005), they contrast with a recent publication indicating that, despite that the spr2 tomato mutant (impaired in the JA biosynthesis) has a reduced level of indirect defense, prosystemin overexpression associates with a marginal difference in VOC production (Sanchez-Hernadez et al., 2006). The authors proposed that this discrepancy may be due to the rather low concentration of JA present in the prosystemin overexpressing plants, sufficient to elicit only direct defense genes. This is supported by the finding that J Chem Ecol (2007) 33:669–681 679 two genes that encode enzymes required for the synthesis of JA (AOC and OPR3) presented similar very low expression levels (almost undetectable for OPR3) in the unwounded 35S::prosys and control plants (Sanchez-Hernadez et al., 2006). However, it is puzzling that such level of expression is also present in the JA-deficient mutant spr2 (Sanchez-Hernadez et al., 2006), probably suggesting that the activity of these genes is not sensitive to the variation of JA concentration in planta. Additionally, in our system, volatiles were collected from the whole plant, including the pot, as bioactive VOC can be produced even from the belowground part of the plant (Rasmann et al., 2005)andfora6- fold-longer period of time (3 hr). Finally, in agreement with our data, almost all the compounds identified by Sanchez-Hernadez et al. (2006) are present in the list of volatiles collected in this work, with one, namely, β-myrcene, being significantly higher in the plant overexpressing systemin. Having verified the prosystemin overexpression in the transgenic plants and proved that also the endogenous prosystemin gene is more active than in control plants, we analyzed the level of expression of genes that have been experimentally linked to volatile production in tomato by using the more sensitive real-time PCR assay. Consistent with the chemical analysis of the volatile blend, some genes responsible for the production of different VOC (i.e., members of the Lox family, HPL, GCS) are overexpressed in the transgenic plants. Our data also indicate the presence of at least a dual regulation of the LOX isoforms in tomato, as not all Tomlox genes are involved in systemin-mediated response to biotic stress. For instance, we showed that TomloxC, a gene that has been considered important during fruit development for its contribution to aroma and flavor generation (Chen et al., 2004) and whose expression in leaves is undetectable by Northern assay (Heitz et al., 1997), may play a role in the production of volatile defense compounds in leaves. It is not surprising that the same genes perform both roles. The generation of a stronger fruit aroma and the production of VOC involved in indirect defense are two functions that, while aiding seed dispersal and attracting parasitoids, respectively, should increase plant fitness by these diverse biotic interactions. In summary, our data indicate that systemin is an important element of the whole defensive response in tomato. Considering that some of the identified VOC could participate in plant-to-plant communication (Holopainen, 2004), it would be interesting in the future to address the role of systemin in more complex interactions.

Acknowledgments We thank Clarence Ryan (Institute of Biological Chemistry, Washington State University) for providing the seeds and useful suggestions during manuscript preparation and Adele Cataldo for technical support. This work was supported by Ministero dell’Università e Ricerca Scientifica (PRIN 2004, MIUR Progetto n. 32 Regioni Obiettivo 1).

Appendix

Standards Used for the Identification of Volatiles Collected by Air-entrainment of Head Space from BB and BBS Plants in Alphabetical Order

(+) longifolene, (Z)-3-hexen-1-ol, 3-carene, 6-methyl-5-hepten-2-one, anisole-p-allyl, camphor, chlorobenzene, cis-nerolidol, decane, dodecene, eucalyptol, eugenol, hexanal, humulene (=α-caryophyllene), linalool, methyl salicilate, menthol, ocimene, p-cymene, p-dichlorobenzene (IS), phellandrene, R(+) limonene, S(−) limonene, skatol, terpinolene, trans-caryophyllene, trans-nerolidol, trans-β-farnesene, α-copaene, α-cubebene, α-gurjunene, α-pinene, α-terpinene, α-terpineol, β-myrcene, γ-terpinene 680 J Chem Ecol (2007) 33:669–681

References

ALBORN, T., TURLINGS, T. C. J., JONES, T. H., STENHAGEN, G., LOUGHRIN, J. H., and TUMLINSON,J.H. 1997. An elicitor of plant volatiles from beet armyworm oral secretion. Science 276:945–949. ALFANO, G., VITIELLO, C., CACCIOPPOLI, C., CARAMICO, T., CAROLA, A., SZEGO, M. J., MCINNES, R. R., AURICCHIO, A., and BANFI, S. 2005. Natural antisense transcripts associated with genes involved in eye development. Hum. Mol. Genet. 14:913–923. AMENT, K., KANT, M. R., SABELIS, M. W., HARING, M. A., and SCHUURINK, R. C. 2004. Jasmonic acid is a key regulator of spider mite-induced volatile terpenoid and methyl salicylate emission in tomato. Plant Physiol. 135:2025–2037. BERGEY, D. R., HOI, G. A., and RYAN, C. A. 1996. Polypeptide signaling for plant defensive genes exhibits analogies to defense signaling in animals. Proc. Natl. Acad. Sci. USA 93:12053–12058. BIRKETT, M. A., CAMPBELL, C. A. M., CHAMBERLAIN, K., GUERRIERI, E., HICK, A. J., MARTIN, J. L., MATTHES, M., NAPIER, J. A., PETTERSSON, J., PICKETT, J. A., et al. 2000. New roles for cis-jasmone as an insect semiochemical and in plant defense. Proc. Natl. Acad. Sci. USA 97:9329–9334. CHEN, G. P., HACKETT, R., WALKER, D., TAYLOR, A., LIN, Z. F., and GRIERSON, D. 2004. Identification of a specific isoform of tomato lipoxygenase (TomloxC) involved in the generation of fatty acid-derived flavor compounds. Plant Physiol. 136:2641–2651. COLBY, S. M., CROCK, J., DOWDLE-RIZZO, B., LEMAUX, P. G., and CROTEAU, R. 1998. Germacrene C synthase from Lycopersicon esculentum cv. VFNT Cherry tomato: cDNA isolation, characterization, and bacterial expression of the multiple product sesquiterpene cyclase. Proc. Natl. Acad. Sci. USA 95:2216–2221. COOPER,W.R.andGOGGIN, F. L. 2005. Effects of jasmonate-induced defenses in tomato on the potato aphid, Macrosiphum euphorbiae. Entomol. Exp. Appl. 115:107–115. CORRADO, G., BOVI, P. D., CILIENTO, R., GAUDIO, L., DI MARO, A., ACETO, S., LORITO, M., and RAO,R. 2005. Inducible expression of a Phytolacca heterotepala ribosome-inactivating protein leads to enhanced resistance against major fungal pathogens in tobacco. Phytopathology 95:206–215. DEGENHARDT, J., GERSHENZON, J., BALDWIN, I. T., and KESSLER, A. 2003. Attracting friends to feast on foes: engineering terpene emission to make crop plants more attractive to herbivore enemies. Curr. Opin. Biotechnol. 14:169–176. GRIFFITHS, A., BARRY, C., ALPUCHE-SOLIS, A. G., and GRIERSON, D. 1999. Ethylene and developmental signals regulate expression of lipoxygenase genes during tomato fruit ripening. J. Exp. Bot. 50:793–798. GUERRIERI,E.,POPPY,G.M.,POWELL,W.,RAO,R.,andPENNACCHIO, F. 2002. Plant-to-plant communication mediating in-flight orientation of Aphidius ervi. J. Chem. Ecol. 28:1703–1715. HEIL, M. 2002. Ecological costs of induced resistance. Curr. Opin. Plant Biol. 5:345–350. HEIL, M. and BALDWIN, I. T. 2002. Fitness costs of induced resistance: emerging experimental support for a slippery concept. Trends Plant Sci. 7:61–67. HEITZ, T., BERGEY, D. R., and RYAN, C. A. 1997. A gene encoding a chloroplast-targeted lipoxygenase in tomato leaves is transiently induced by wounding, systemin, and methyl jasmonate. Plant Physiol. 114:1085–1093. HOLOPAINEN, J. K. 2004. Multiple functions of inducible plant volatiles. Trends Plant Sci. 9:529–533. HOWE, G. A. 2004. Jasmonates as signals in the wound response. J. Plant Growth Regen. 23:223–237. KANT, M. R., AMENT, K., SABELIS, M. W., HARING, M. A., and SCHUURINK, R. C. 2004. Differential timing of spider mite-induced direct and indirect defenses in tomato plants. Plant Physiol. 135:483–495. KESSLER, A. and BALDWIN, I. T. 2002. Plant responses to insect herbivory: the emerging molecular analysis. Annu. Rev. Plant Biol. 53:299–328. KESSLER, A., HALITSCHKE, R., and BALDWIN, I. T. 2004. Silencing the jasmonate cascade: induced plant defenses and insect populations. Science 305:665–668. LIVAK, K. J. and SCHMITTGEN, T. D. 2001. Analysis of relative gene expression data using real-time quantitative PCR and the 2(T)(-ΔΔCt) method. Methods 25:402–408. MAFFEI, M., BOSSI, S., SPITELLER, D., MITHOFER, A., and BOLAND, W. 2004. Effects of feeding Spodoptera littoralis on lima bean leaves. I. Membrane potentials, intracellular calcium variations, oral secretions, and regurgitate components. Plant Physiol. 134:1752–1762. MATSUI, K., FUKUTOMI, S., WILKINSON, J., HIATT, B., KNAUFF, V., and KAJWARA, T. 2001. Effect of overexpression of fatty acid 9-hydroperoxide lyase in tomatoes (Lycopersicon esculentum Mill.). J. Agric. Food Chem. 49:5418–5424. MCGURL, B. and RYAN, C. A. 1992. The organization of the prosystemin gene. Plant Mol. Biol. 20:405–409. MCGURL, B., OROZCOCARDENAS, M., PEARCE, G., and RYAN, C. A. 1994. Overexpression of the prosystemin gene in transgenic tomato plants generates a systemic signal that constitutively induces proteinase-inhibitor synthesis. Proc. Natl. Acad. Sci. USA 91:9799–9802. J Chem Ecol (2007) 33:669–681 681

MITHOFER, A., WANNER, G., and BOLAND, W. 2005. Effects of feeding Spodoptera littoralis on lima bean leaves. II. Continuous mechanical wounding resembling insect feeding is sufficient to elicit herbivory- related volatile emission. Plant Physiol. 137:1160–1168. PARÉ,P.W.andTUMLINSON, J. H. 1997. De novo biosynthesis of volatiles induced by insect herbivory in cotton plants. Plant Physiol. 114:1161–1167. PARÉ,P.W.andTUMLINSON, J. H. 1998. Cotton volatiles synthesized and released distal to the site of insect damage. Phytochemistry 47:521–526. RASMANN,S.,KOLLNER,T.G.,DEGENHARDT,J.,HILTPOLD, I., TOEPFER,S.,KUHLMANN,U.,GERSHENZON,J., and TURLINGS, T. C. J. 2005. Recruitment of entomopathogenic nematodes by insect-damaged maize roots. Nature 434:732–737. ROHLF, F. J. and SOKAL, R. R. 1995. Statistical Tables. Freeman, New York, NY. RYAN, C. A. and PEARCE, G. 2003. Systemins: a functionally defined family of peptide signal that regulate defensive genes in Solanaceae species. Proc. Natl. Acad. Sci. USA 100:14577–14580. SANCHEZ-HERNADEZ, C., LOPEZ, M. G., and DELANO, J. P. 2006. Reduced levels of volatile emission in jasmonate-deficient spr2 tomato mutants favour ovideposition by insect herbivores. Plant Cell Env. 29:546–557. SCHEER, J. M. and RYAN, C. A. 2002. The systemin receptor SR160 from Lycopersicon peruvianum is a member of the LRR receptor kinase family. Proc. Natl. Acad. Sci. USA 99:9585–9590. SCHILMILLER, A. L. and HOWE, G. A. 2005. Systemic signaling in the wound response. Curr. Opin. Plant Biol. 8:369–377. SHEWMAKER, C. K., RIDGE, N. P., POKALSKY, A. R., ROSE, R. E., and HIATT, W. R. 1990. Nucleotide- sequence of an Ef-1-Alpha genomic clone from tomato. Nucleic Acid Res. 18:4276. SOKAL, R. R. and ROHLF, F. J. K. 1995. Biometry. W.H. Freeman, New York, NY. STOUT, M. J., THALER, J. S., and THOMMA, B. 2006. Plant-mediated interactions between pathogenic microorganisms and herbivorous arthropods. Annu. Rev. Entomol. 51:663–689. THALER, J. S. 1999. Jasmonate-inducible plant defences cause increased parasitism of herbivores. Nature 399:686–688. VAN BLOKLAND, R., ROSS, S., CORRADO, G., SCOLLAN, C., and MEYER, P. 1998. Developmental abnormalities associated with deoxyadenosine methylation in transgenic tobacco. Plant J. 15:543–551. VANCANNEYT, G., SANZ, C., FARMAKI, T., PANEQUE, M., ORTEGO, F., CASTANERA, P., and SANCHEZ- SERRANO, J. J. 2001. Hydroperoxide lyase depletion in transgenic potato plants leads to an increase in aphid performance. Proc. Natl. Acad. Sci. USA 98:8139–8144. WALLING, L. L. 2000. The myriad plant responses to herbivores. J. Plant Growth Regen. 19:195–216.